Science.gov

Sample records for 2-related factor nrf2

  1. Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) Mediates Neuroprotection in Traumatic Brain Injury at Least in Part by Inactivating Microglia

    PubMed Central

    Wu, Gang; Liu, Zongying

    2016-01-01

    Background Microglial activation has been reported to be involved in traumatic brain injury (TBI). Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a significant role in protecting against TBI-induced secondary brain injury. However, the exact mechanism is not clearly understood. The present study aimed to explore whether Nrf2 protects against TBI partly by regulating microglia function. Material/Methods Microglia cells were isolated from C57BL/6 mouse brains (postnatal day 1–3). The expression of Nrf2 was suppressed by transfection with Nrf2-specific small interfering RNA (siRNA), and overexpressed by transfections with pcDNA3.1-Nrf2. The expression of Nrf2 was confirmed by real-time PCR and Western blotting. After transfection, cell viability, phagocytic ability, and the expression of pro-inflammatory cytokines (tumor necrosis factor (TNF)-α and interleukin (IL)-6) were determined by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) colorimetric assay, phagocytosis assay, and enzyme-linked immunosorbent assay (ELISA), respectively. Results mRNA and protein expression levels of Nrf2 were significantly reduced by transfection with Nrf2-specific siRNA (both P<0.05) but were elevated by transfection with pcDNA3.1-Nrf2 (both P<0.01). The cell viability, phagocytic ability, and the expression of TNF-α and IL-6 were all significantly reduced by overexpression of Nrf2 but were significantly increased by silencing of Nrf2 compared with the control group. Conclusions Our results suggest that Nrf2 protects against TBI, at least part by regulating microglia function. PMID:27336674

  2. Bromodomain and Extra-Terminal (BET) proteins suppress nuclear factor E2-related factor 2 (Nrf2) -mediated antioxidant gene expression

    PubMed Central

    Clarke, Colin; Bhavsar, Pankaj K; Adcock, Ian M; Barnes, Peter J; Chung, Kian Fan

    2014-01-01

    Oxidative stress, a pathogenetic factor in many conditions including chronic obstructive pulmonary disease (COPD) arises due to accumulation of reactive oxygen species (ROS) and defective antioxidant defences in the lungs. The latter is due, at least in part, to impaired activation of nuclear factor E2-related factor 2 (Nrf2), a transcription factor involved in the activation of antioxidant and cytoprotective genes. The bromodomain and extra-terminal (BET) proteins, Brd2, Brd3, Brd4 and BrdT, bind to acetylated lysine residues on histone or non-histone proteins recruiting transcriptional regulators and thus activating or repressing gene transcription. We investigated whether BET proteins modulate the regulation of Nrf2-dependent gene expression in primary human airway smooth muscle cells (ASMCs) and the human monocytic cell line, THP-1. Inhibition of BET protein bromodomains using the inhibitor JQ1+, or attenuation of Brd2 and Brd4 expression using siRNA led to activation of Nrf2-dependent transcription and expression of the antioxidant proteins heme oxygenase (HO)-1, NADPH quinone oxidoreductase 1 (NQO1) and glutamate-cysteine ligase catalytic subunit (GCLC). Also, JQ1+ prevented hydrogen peroxide (H2O2)-induced intracellular ROS production. By co-immunoprecipitation, BET proteins were found to be complexed with Nrf2, whilst chromatin-immunoprecipitation studies indicated recruitment of Brd2 and Brd4 to Nrf2-binding sites on the promoters of HO-1 and NQO1. BET proteins, particularly Brd2 and Brd4, may play a key role in the regulation of Nrf2-dependent antioxidant gene transcription and are hence an important target for augmenting antioxidant responses in oxidative stress-mediated diseases. PMID:24733848

  3. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2).

    PubMed

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y

    2016-04-01

    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders.

  4. Identifying panaxynol, a natural activator of nuclear factor erythroid-2 related factor 2 (Nrf2) from American ginseng as a suppressor of inflamed macrophage-induced cardiomyocyte hypertrophy

    PubMed Central

    Qu, Chen; Li, Bin; Lai, Yimu; Li, Hechu; Windust, Anthony; Hofseth, Lorne J.; Nagarkatti, Mitzi; Nagarkatti, Prakash; Wang, Xing Li; Tang, Dongqi; Janicki, Joseph S.; Tian, Xingsong; Cui, Taixing

    2015-01-01

    Ethnopharmacological relevance American ginseng is capable of ameliorating cardiac dysfunction and activating Nrf2, a master regulator of antioxidant defense, in the heart. This study was designed to isolate compounds from American ginseng and to determine those responsible for the Nrf2-mediated resolution of inflamed macrophage-induced cardiomyocyte hypertrophy. Materials and methods A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. A bioassay-based fractionization of American ginseng was performed to identify the putative substances which could activate Nrf2-mediated suppression of pro-inflammatory cytokine expression in macrophages and macrophage-mediated pro-hypertrophic growth in cardiomyocytes. Results A hexane fraction of an anti-inflammatory crude extract of American ginseng was found to be most effective in suppressing the inflammatory responses in macrophages. Preparative, reverse-phase HPLC and a comparative analysis by analytical scale LC–UV/MS revealed the hexane fraction contains predominantly C17 polyacetylenes and linolenic acid. Panaxynol, one of the major polyacetylenes, was found to be a potent Nrf2 activator. Panaxynol posttranscriptionally activated Nrf2 by inhibiting Kelch-like ECH-associated protein (Keap) 1-mediated degradation without affecting the binding of Keap1 and Nrf2. Moreover, panaxynol suppressed a selected set of cytokine expression via the activation of Nrf2 while minimally regulating nuclear factor-kappa B (NF-κB)-mediated cytokine expression in macrophages. It also dramatically inhibited the inflamed macrophage-mediated cardiomyocyte death and hypertrophy by activating Nrf2 in macrophages. Conclusions These results demonstrate that American ginseng-derived panaxynol is a specific Nrf2 activator and panaxynol-activated Nrf2 signaling is at least partly responsible for American ginseng-induced health benefit in the heart. PMID

  5. p62/Sequestosome-1, Autophagy-related Gene 8, and Autophagy in Drosophila Are Regulated by Nuclear Factor Erythroid 2-related Factor 2 (NRF2), Independent of Transcription Factor TFEB*

    PubMed Central

    Jain, Ashish; Rusten, Tor Erik; Katheder, Nadja; Elvenes, Julianne; Bruun, Jack-Ansgar; Sjøttem, Eva; Lamark, Trond; Johansen, Terje

    2015-01-01

    The selective autophagy receptor p62/sequestosome 1 (SQSTM1) interacts directly with LC3 and is involved in oxidative stress signaling in two ways in mammals. First, p62 is transcriptionally induced upon oxidative stress by the NF-E2-related factor 2 (NRF2) by direct binding to an antioxidant response element in the p62 promoter. Second, p62 accumulation, occurring when autophagy is impaired, leads to increased p62 binding to the NRF2 inhibitor KEAP1, resulting in reduced proteasomal turnover of NRF2. This gives chronic oxidative stress signaling through a feed forward loop. Here, we show that the Drosophila p62/SQSTM1 orthologue, Ref(2)P, interacts directly with DmAtg8a via an LC3-interacting region motif, supporting a role for Ref(2)P in selective autophagy. The ref(2)P promoter also contains a functional antioxidant response element that is directly bound by the NRF2 orthologue, CncC, which can induce ref(2)P expression along with the oxidative stress-associated gene gstD1. However, distinct from the situation in mammals, Ref(2)P does not interact directly with DmKeap1 via a KEAP1-interacting region motif; nor does ectopically expressed Ref(2)P or autophagy deficiency activate the oxidative stress response. Instead, DmAtg8a interacts directly with DmKeap1, and DmKeap1 is removed upon programmed autophagy in Drosophila gut cells. Strikingly, CncC induced increased Atg8a levels and autophagy independent of TFEB/MitF in fat body and larval gut tissues. Thus, these results extend the intimate relationship between oxidative stress-sensing NRF2/CncC transcription factors and autophagy and suggest that NRF2/CncC may regulate autophagic activity in other organisms too. PMID:25931115

  6. Acetylation-deacetylation of the transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) regulates its transcriptional activity and nucleocytoplasmic localization.

    PubMed

    Kawai, Yumiko; Garduño, Lakisha; Theodore, Melanie; Yang, Jianqi; Arinze, Ifeanyi J

    2011-03-01

    Activation of Nrf2 by covalent modifications that release it from its inhibitor protein Keap1 has been extensively documented. In contrast, covalent modifications that may regulate its action after its release from Keap1 have received little attention. Here we show that CREB-binding protein induced acetylation of Nrf2, increased binding of Nrf2 to its cognate response element in a target gene promoter, and increased Nrf2-dependent transcription from target gene promoters. Heterologous sirtuin 1 (SIRT1) decreased acetylation of Nrf2 as well as Nrf2-dependent gene transcription, and its effects were overridden by dominant negative SIRT1 (SIRT1-H355A). The SIRT1-selective inhibitors EX-527 and nicotinamide stimulated Nrf2-dependent gene transcription, whereas resveratrol, a putative activator of SIRT1, was inhibitory, mimicking the effect of SIRT1. Mutating lysine to alanine or to arginine at Lys(588) and Lys(591) of Nrf2 resulted in decreased Nrf2-dependent gene transcription and abrogated the transcription-activating effect of CREB-binding protein. Furthermore, SIRT1 had no effect on transcription induced by these mutants, indicating that these sites are acetylation sites. Microscope imaging of GFP-Nrf2 in HepG2 cells as well as immunoblotting for Nrf2 showed that acetylation conditions resulted in increased nuclear localization of Nrf2, whereas deacetylation conditions enhanced its cytoplasmic rather than its nuclear localization. We posit that Nrf2 in the nucleus undergoes acetylation, resulting in binding, with basic-region leucine zipper protein(s), to the antioxidant response element and consequently in gene transcription, whereas deacetylation disengages it from the antioxidant response element, thereby resulting in transcriptional termination and subsequently in its nuclear export. PMID:21196497

  7. Activation of the Kelch-like ECH-associated protein 1 (Keap1)/NF-E2-related factor 2 (Nrf2) pathway through covalent modification of the 2-alkenal group of aliphatic electrophiles in Coriandrum sativum L.

    PubMed

    Abiko, Yumi; Mizokawa, Mai; Kumagai, Yoshito

    2014-11-12

    Phytochemicals able to activate the transcription factor NF-E2-related factor 2 (Nrf2) were isolated from an extract of Coriandrum sativum L. (C. sativum) leaves by preparative octadecyl silica column chromatography. Ultraperformance liquid chromatography and liquid chromatography-tandem mass spectrometry analysis of the isolated components after derivatization with 2-diphenylacetyl-1,3-inandione-1-hydrazone and experiments with HepG2 cells revealed that (E)-2-alkenals with different carbon numbers play a role in Nrf2 activation in these cells. Such Nrf2 activation appears to be attributable to S-alkylation of Kelch-like ECH-associated protein 1 (Keap1), the negative regulator for Nrf2, as determined by a biotin-PEAC5-maleimide assay. Interestingly, (E)-2-butenal caused Keap1 modification and Nrf2 activation, whereas butanal did not. These results suggest that (E)-2-alkenals with an α,β-unsaturated aldehyde moiety, which is a common substituent in phytochemicals isolated from C. sativum leaves, activate the Keap1/Nrf2 pathway associated with cellular protection.

  8. Activation of the Kelch-like ECH-associated protein 1 (Keap1)/NF-E2-related factor 2 (Nrf2) pathway through covalent modification of the 2-alkenal group of aliphatic electrophiles in Coriandrum sativum L.

    PubMed

    Abiko, Yumi; Mizokawa, Mai; Kumagai, Yoshito

    2014-11-12

    Phytochemicals able to activate the transcription factor NF-E2-related factor 2 (Nrf2) were isolated from an extract of Coriandrum sativum L. (C. sativum) leaves by preparative octadecyl silica column chromatography. Ultraperformance liquid chromatography and liquid chromatography-tandem mass spectrometry analysis of the isolated components after derivatization with 2-diphenylacetyl-1,3-inandione-1-hydrazone and experiments with HepG2 cells revealed that (E)-2-alkenals with different carbon numbers play a role in Nrf2 activation in these cells. Such Nrf2 activation appears to be attributable to S-alkylation of Kelch-like ECH-associated protein 1 (Keap1), the negative regulator for Nrf2, as determined by a biotin-PEAC5-maleimide assay. Interestingly, (E)-2-butenal caused Keap1 modification and Nrf2 activation, whereas butanal did not. These results suggest that (E)-2-alkenals with an α,β-unsaturated aldehyde moiety, which is a common substituent in phytochemicals isolated from C. sativum leaves, activate the Keap1/Nrf2 pathway associated with cellular protection. PMID:25307732

  9. Nrf2 and Nrf2-Related Proteins in Development and Developmental Toxicity: Insights from studies in Zebrafish (Danio rerio)

    PubMed Central

    Hahn, Mark E.; Timme-Laragy, Alicia R.; Karchner, Sibel I.; Stegeman, John J.

    2015-01-01

    Oxidative stress is an important mechanism of chemical toxicity, contributing to developmental toxicity and teratogenesis as well as to cardiovascular and neurodegenerative diseases and diabetic embryopathy. Developing animals are especially sensitive to effects of chemicals that disrupt the balance of processes generating reactive species and oxidative stress, and those anti-oxidant defenses that protect against oxidative stress. The expression and inducibility of anti-oxidant defenses through activation of NFE2-related factor 2 (Nrf2) and related proteins is an essential process affecting the susceptibility to oxidants, but the complex interactions of Nrf2 in determining embryonic response to oxidants and oxidative stress are only beginning to be understood. The zebrafish (Danio rerio) is an established model in developmental biology and now also in developmental toxicology and redox signaling. Here we review the regulation of genes involved in protection against oxidative stress in developing vertebrates, with a focus on Nrf2 and related cap’n’collar (CNC)-basic-leucine zipper (bZIP) transcription factors. Vertebrate animals including zebrafish share Nfe2, Nrf1, Nrf2, and Nrf3 as well as a core set of genes that respond to oxidative stress, contributing to the value of zebrafish as a model system with which to investigate the mechanisms involved in regulation of redox signaling and the response to oxidative stress during embryolarval development. Moreover, studies in zebrafish have revealed nrf and keap1 gene duplications that provide an opportunity to dissect multiple functions of vertebrate NRF genes, including multiple sensing mechanisms involved in chemical-specific effects. PMID:26130508

  10. Monascin attenuates oxidative stress-mediated lung inflammation via peroxisome proliferator-activated receptor-gamma (PPAR-γ) and nuclear factor-erythroid 2 related factor 2 (Nrf-2) modulation.

    PubMed

    Hsu, Wei-Hsuan; Lee, Bao-Hong; Pan, Tzu-Ming

    2014-06-11

    We speculated that peroxisome proliferator-activated receptor (PPAR)-γ agonists may modulate the oxidative stress pathway to ameliorate the development of airway inflammation. The effect of Monascus-fermented metabolite monascin (MS) and rosiglitazone (Rosi) on oxidative stress-induced lung inflammation was evaluated. Luciferase assay and DNA binding activity assay were used to point out that MS may be a novel PPAR-γ agonist and nuclear factor-erythroid 2 related factor 2 (Nrf-2) activator. We used hydrogen peroxide (H2O2) to induce inflammation in lung epithelial cells. MS and Rosi prevented H2O2-induced ROS generation in A549 epithelial cells through PPAR-γ translocation, avoiding inflammatory mediator expression via inhibiting nuclear factor (NF)-κB translocation. The regulatory ability of MS was abolished by siRNA against PPAR-γ. MS also elevated antioxidant enzyme expression via Nrf-2 activation. Both PPAR-γ and Nrf-2 might have benefits against lung inflammation. MS regulated PPAR-γ and Nrf-2 to improve lung oxidative inflammation. PMID:24865672

  11. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2).

    PubMed

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3h of exposure, returning to normality at 24h. Additionally, BZL increased glutathione peroxidase activity at 12h and the oxidized glutathione/total glutathione (GSSG/GSSG+GSH) ratio that reached a peak at 24h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG+GSH returned to control values at 48h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48h, explaining normalization of GSSG/GSSG+GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. PMID:27180241

  12. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    SciTech Connect

    Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching

    2013-11-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS

  13. Hydrogen Sulfide Levels and Nuclear Factor-Erythroid 2-Related Factor 2 (NRF2) Activity Are Attenuated in the Setting of Critical Limb Ischemia (CLI)

    PubMed Central

    Islam, Kazi N; Polhemus, David J; Donnarumma, Erminia; Brewster, Luke P; Lefer, David J

    2015-01-01

    Background Cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase are endogenous enzymatic sources of hydrogen sulfide (H2S). Functions of H2S are mediated by several targets including ion channels and signaling proteins. Nuclear factor-erythroid 2-related factor 2 is responsible for the expression of antioxidant response element–regulated genes and is known to be upregulated by H2S. We examined the levels of H2S, H2S-producing enzymes, and nuclear factor-erythroid 2-related factor 2 activation status in skeletal muscle obtained from critical limb ischemia (CLI) patients. Methods and Results Gastrocnemius tissues were attained postamputation from human CLI and healthy control patients. We found mRNA and protein levels of cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase were significantly decreased in skeletal muscle of CLI patients as compared to control. H2S and sulfane sulfur levels were significantly decreased in skeletal muscle of CLI patients. We also observed significant reductions in nuclear factor-erythroid 2-related factor 2 activation as well as antioxidant proteins, such as Cu, Zn-superoxide dismutase, catalase, and glutathione peroxidase in skeletal muscle of CLI patients. Biomarkers of oxidative stress, such as malondialdehyde and protein carbonyl formation, were significantly increased in skeletal muscle of CLI patients as compared to healthy controls. Conclusions The data demonstrate that H2S bioavailability and nuclear factor-erythroid 2-related factor 2 activation are both attenuated in CLI tissues concomitant with significantly increased oxidative stress. Reductions in the activity of H2S-producing enzymes may contribute to the pathogenesis of CLI. PMID:25977470

  14. The novel triterpenoid RTA 408 protects human retinal pigment epithelial cells against H2O2-induced cell injury via NF-E2-related factor 2 (Nrf2) activation.

    PubMed

    Liu, Xiaobin; Ward, Keith; Xavier, Christy; Jann, Jamieson; Clark, Abbot F; Pang, Iok-Hou; Wu, Hongli

    2016-08-01

    Oxidative stress-induced retinal pigment epithelial (RPE) cell damage is an important factor in the pathogenesis of age-related macular degeneration (AMD). Previous studies have shown that RTA 408, a synthetic triterpenoid compound, potently activates Nrf2. This study aimed to investigate the protective effects of RTA 408 in cultured RPE cells during oxidative stress and to determine the effects of RTA 408 on Nrf2 and its downstream target genes. Primary human RPE cells were pretreated with RTA 408 and then incubated in 200μM H2O2 for 6h. Cell viability was measured with the WST-8 assay. Apoptosis was quantitatively measured by annexin V/propidium iodide (PI) double staining and Hoechst 33342 fluorescent staining. Reduced (GSH) and oxidized glutathione (GSSG) were measured using colorimetric assays. Nrf2 activation and its downstream effects on phase II enzymes were examined by Western blot. Treatment of RPE cells with nanomolar ranges (10 and 100nM) of RTA 408 markedly attenuated H2O2-induced viability loss and apoptosis. RTA 408 pretreatment significantly protected cells from oxidative stress-induced GSH loss, GSSG formation and decreased ROS production. RTA 408 activated Nrf2 and increased the expression of its downstream genes, such as HO-1, NQO1, SOD2, catalase, Grx1, and Trx1. Consequently, the enzyme activities of NQO1, Grx1, and Trx1 were fully protected by RTA 408 pretreatment under oxidative stress. Moreover, knockdown of Nrf2 by siRNA significantly reduced the cytoprotective effects of RTA 408. In conclusion, our data suggest that RTA 408 protect primary human RPE cells from oxidative stress-induced damage by activating Nrf2 and its downstream genes. PMID:26773873

  15. Oleanolic Acid Activates Nrf2 and Protects from Acetaminophen Hepatotoxicity via Nrf2-Dependent and Nrf2-independent Processes

    PubMed Central

    Reisman, Scott A.; Aleksunes, Lauren M.; Klaassen, Curtis D.

    2009-01-01

    Oleanolic acid is a plant-derived triterpenoid, which protects against various hepatotoxicants in rodents. In order to determine whether oleanolic acid activates nuclear factor erythroid-2 related factor 2 (Nrf2), a transcription factor known to induce various antioxidant and cytoprotective genes, wild-type and Nrf2-null mice were treated with oleanolic acid (90 mg/kg, i.p.) once daily for three days. Oleanolic acid increased nuclear accumulation of Nrf2 in wild-type but not Nrf2-null mice, as determined by Western blot and immunofluorescence. Oleanolic acid-treated wild-type mice had increased hepatic mRNA expression of the Nrf2 target genes NAD(P)H:quinone oxidoreductase 1 (Nqo1); glutamate-cysteine ligase, catalytic subunit (Gclc); heme oxygenase-1 (Ho-1); as well as Nrf2 itself. In addition, oleanolic acid increased protein expression and enzyme activity of the prototypical Nrf2 target gene, Nqo1, in wild-type, but not in Nrf2-null mice. Oleanolic acid protected against acetaminophen hepatotoxicity in wild-type mice but to a lesser extent in Nrf2-null mice. Oleanolic acid-mediated Nrf2-independent protection from acetaminophen is, in part, due to induction of Nrf2-independent cytoprotective genes, such as metallothionein. Collectively, the present study demonstrates that oleanolic acid facilitates Nrf2 nuclear accumulation, causing induction of Nrf2-dependent genes, which contributes to protection from acetaminophen hepatotoxicity. PMID:19283895

  16. What is Known Regarding the Participation of Factor Nrf-2 in Liver Regeneration?

    PubMed Central

    Morales-González, José A.; Madrigal-Santillán, Eduardo; Morales-González, Ángel; Bautista, Mirandeli; Gayosso-Islas, Evila; Sánchez-Moreno, Cecilia

    2015-01-01

    It has been known for years that, after chemical damage or surgical removal of its tissue, the liver initiates a series of changes that, taken together, are known as regeneration, which are focused on the recovery of lost or affected tissue in terms of the anatomical or functional aspect. The Nuclear factor-erythroid 2-related factor (Nrf-2) is a reduction-oxidation reaction (redox)-sensitive transcriptional factor, with the basic leucine Zipper domain (bZIP) motif, encoding the NFE2L2 gene. The Keap1-Nrf2-ARE pathway is transcendental in the regulation of various cellular processes, such as antioxidant defenses, redox equilibrium, the inflammatory process, the apoptotic processes, intermediate metabolism, detoxification, and cellular proliferation. Some reports have demonstrated the regulator role of Nrf-2 in the cellular cycle of the hepatocyte, as well as in the modulation of the antioxidant response and of apoptotic processes during liver regeneration. It has been reported that there is a delay in liver regeneration after Partial hepatectomy (PH) in the absence of Nrf-2, and similarly as a regulator of hepatic cytoprotection due to diverse chemical or biological agents, and in diseases such as hepatitis, fibrosis, cirrhosis, and liver cancer. This regulator/protector capacity is due to the modulation of the Antioxidant response elements (ARE). It is postulated that oxidative stress (OS) can participate in the initial stages of liver regeneration and that Nrf-2 can probably participate. Studies are lacking on the different initiation stages, maintenance, and the termination of liver regeneration alone or with ethanol. PMID:26010752

  17. Nrf2-dependent suppression of azoxymethane/dextran sulfate sodium-induced colon carcinogenesis by the cinnamon-derived dietary factor cinnamaldehyde.

    PubMed

    Long, Min; Tao, Shasha; Rojo de la Vega, Montserrat; Jiang, Tao; Wen, Qing; Park, Sophia L; Zhang, Donna D; Wondrak, Georg T

    2015-05-01

    The progressive nature of colorectal cancer and poor prognosis associated with the metastatic phase of the disease create an urgent need for the development of more efficacious strategies targeting colorectal carcinogenesis. Cumulative evidence suggests that the redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defence, represents a promising molecular target for colorectal cancer chemoprevention. Recently, we have identified cinnamon, the ground bark of Cinnamomum aromaticum (cassia cinnamon) and Cinnamomum verum (Ceylon cinnamon), as a rich dietary source of the Nrf2 inducer cinnamaldehyde (CA) eliciting the Nrf2-regulated antioxidant response in human epithelial colon cells, conferring cytoprotection against electrophilic and genotoxic insult. Here, we have explored the molecular mechanism underlying CA-induced Nrf2 activation in colorectal epithelial cells and have examined the chemopreventive potential of CA in a murine colorectal cancer model comparing Nrf2(+/+) with Nrf2(-/-) mice. In HCT116 cells, CA caused a Keap1-C151-dependent increase in Nrf2 protein half-life via blockage of ubiquitination with upregulation of cytoprotective Nrf2 target genes and elevation of cellular glutathione. After optimizing colorectal Nrf2 activation and target gene expression by dietary CA-supplementation regimens, we demonstrated that CA suppresses AOM/DSS-induced inflammatory colon carcinogenesis with modulation of molecular markers of colorectal carcinogenesis. Dietary suppression of colorectal cancer using CA supplementation was achieved in Nrf2(+/+) but not in Nrf2(-/-) mice confirming the Nrf2 dependence of CA-induced chemopreventive effects. Taken together, our data suggest feasibility of colorectal cancer suppression by dietary CA, an FDA-approved food additive derived from the third most consumed spice in the world.

  18. Targeting the transcription factor Nrf2 to ameliorate oxidative stress and inflammation in chronic kidney disease.

    PubMed

    Ruiz, Stacey; Pergola, Pablo E; Zager, Richard A; Vaziri, Nosratola D

    2013-06-01

    Oxidative stress and inflammation are mediators in the development and progression of chronic kidney disease (CKD) and its complications, and they are inseparably linked as each begets and amplifies the other. CKD-associated oxidative stress is due to increased production of reactive oxygen species (ROS) and diminished antioxidant capacity. The latter is largely caused by impaired activation of Nrf2, the transcription factor that regulates genes encoding antioxidant and detoxifying molecules. Protective effects of Nrf2 are evidenced by amelioration of oxidative stress, inflammation, and kidney disease in response to natural Nrf2 activators in animal models, while Nrf2 deletion amplifies these pathogenic pathways and leads to autoimmune nephritis. Given the role of impaired Nrf2 activity in CKD-induced oxidative stress and inflammation, interventions aimed at restoring Nrf2 may be effective in retarding CKD progression. Clinical trials of the potent Nrf2 activator bardoxolone methyl showed significant improvement in renal function in CKD patients with type 2 diabetes. However, due to unforeseen complications the BEACON trial, which was designed to investigate the effect of this drug on time to end-stage renal disease or cardiovascular death in patients with advanced CKD, was prematurely terminated. This article provides an overview of the role of impaired Nrf2 activity in the pathogenesis of CKD-associated oxidative stress and inflammation and the potential utility of targeting Nrf2 in the treatment of CKD.

  19. The pesticide deltamethrin increases free radical production and promotes nuclear translocation of the stress response transcription factor Nrf2 in rat brain

    PubMed Central

    Li, HY; Wu, SY; Ma, Q; Shi, N

    2015-01-01

    The transcription factor NF-E2-related factor 2 (Nrf2) plays a critical role in the mammalian response to chemical and oxidative stress through induction of phase II detoxification enzymes and oxidative stress response proteins. We reported that Nrf2 expression was activated by deltamethrin (DM), a prototype of the widely used pyrithroid pesticides, in PC12 cells. However, no study has examined Nrf2 nuclear translocation and free radical production, two hallmarks of oxidative stress, in the mammalian brain in vivo. To this end, we examined translocation of Nrf2 and production of free radicals in rat brain exposed to DM. Indeed, DM initiated nuclear translocation of Nrf2 in a dose-dependent manner. Furthermore, Nrf2 translocation was accompanied by the expression of heme oxygenase-1 gene, an Nrf2-regulated gene linked to free radical production. Deltamethrin exposure promoted free radical formation in rat brain and reactive oxygen species generation in PC12 cells. Translocation of Nrf2 may be a response to DM-dependent induction of free radicals and DM may act as a mammalian neurotoxin by initiating oxidative stress. PMID:21398409

  20. [When defense becomes dangerous--transcription factor Nrf2 and cancer].

    PubMed

    Krysztofiak, Adam; Krajka-Kuźniak, Violetta

    2015-01-23

    The transcription factor Nrf2 controls the expression of genes encoding cytoprotective enzymes and proteins. Its activation is related to conformational changes in the inhibitory protein Keap1 and/or Nrf2 phosphorylation by upstream kinases. Activation of Nrf2 can lead to the induction of phase II enzymes responsible for the inactivation of potential carcinogens. This may constitute an important strategy of chemoprevention. Moreover, these enzymatic systems participating in the biotransformation of drugs can reduce their therapeutic effects, contributing to drug resistance. For this reason, a clear understanding of the role of Nrf2 is essential to assess the beneficial and adverse effects of its up-regulation, particularly in relation to the prevention and treatment of cancer. This article summarizes the current state of knowledge on the significance of Nrf2 in tumorigenesis.

  1. Glycosylation enables aesculin to activate Nrf2.

    PubMed

    Kim, Kyun Ha; Park, Hyunsu; Park, Hee Jin; Choi, Kyoung-Hwa; Sadikot, Ruxana T; Cha, Jaeho; Joo, Myungsoo

    2016-01-01

    Since aesculin, 6,7-dihydroxycoumarin-6-O-β-glucopyranoside, suppresses inflammation, we asked whether its anti-inflammatory activity is associated with the activation of nuclear factor-E2-related factor 2 (Nrf2), a key anti-inflammatory factor. Our results, however, show that aesculin marginally activated Nrf2. Since glycosylation can enhance the function of a compound, we then asked whether adding a glucose makes aesculin activate Nrf2. Our results show that the glycosylated aesculin, 3-O-β-d-glycosyl aesculin, robustly activated Nrf2, inducing the expression of Nrf2-dependent genes, such as heme oxygenase-1, glutamate-cysteine ligase catalytic subunit, and NAD(P)H quinone oxidoreductase 1 in macrophages. Mechanistically, 3-O-β-d-glycosyl aesculin suppressed ubiquitination of Nrf2, retarding degradation of Nrf2. Unlike aesculin, 3-O-β-d-glycosyl aesculin significantly suppressed neutrophilic lung inflammation, a hallmark of acute lung injury (ALI), in mice, which was not recapitulated in Nrf2 knockout mice, suggesting that the anti-inflammatory function of the compound largely acts through Nrf2. In a mouse model of sepsis, a major cause of ALI, 3-O-β-d-glycosyl aesculin significantly enhanced the survival of mice, compared with aesculin. Together, these results show that glycosylation could confer the ability to activate Nrf2 on aesculin, enhancing the anti-inflammatory function of aesculin. These results suggest that glycosylation can be a way to improve or alter the function of aesculin. PMID:27417293

  2. Glycosylation enables aesculin to activate Nrf2

    PubMed Central

    Kim, Kyun Ha; Park, Hyunsu; Park, Hee Jin; Choi, Kyoung-Hwa; Sadikot, Ruxana T.; Cha, Jaeho; Joo, Myungsoo

    2016-01-01

    Since aesculin, 6,7-dihydroxycoumarin-6-O-β-glucopyranoside, suppresses inflammation, we asked whether its anti-inflammatory activity is associated with the activation of nuclear factor-E2-related factor 2 (Nrf2), a key anti-inflammatory factor. Our results, however, show that aesculin marginally activated Nrf2. Since glycosylation can enhance the function of a compound, we then asked whether adding a glucose makes aesculin activate Nrf2. Our results show that the glycosylated aesculin, 3-O-β-d-glycosyl aesculin, robustly activated Nrf2, inducing the expression of Nrf2-dependent genes, such as heme oxygenase-1, glutamate-cysteine ligase catalytic subunit, and NAD(P)H quinone oxidoreductase 1 in macrophages. Mechanistically, 3-O-β-d-glycosyl aesculin suppressed ubiquitination of Nrf2, retarding degradation of Nrf2. Unlike aesculin, 3-O-β-d-glycosyl aesculin significantly suppressed neutrophilic lung inflammation, a hallmark of acute lung injury (ALI), in mice, which was not recapitulated in Nrf2 knockout mice, suggesting that the anti-inflammatory function of the compound largely acts through Nrf2. In a mouse model of sepsis, a major cause of ALI, 3-O-β-d-glycosyl aesculin significantly enhanced the survival of mice, compared with aesculin. Together, these results show that glycosylation could confer the ability to activate Nrf2 on aesculin, enhancing the anti-inflammatory function of aesculin. These results suggest that glycosylation can be a way to improve or alter the function of aesculin. PMID:27417293

  3. Nrf2 and cardiovascular defense.

    PubMed

    Howden, Reuben

    2013-01-01

    The cardiovascular system is susceptible to a group of diseases that are responsible for a larger proportion of morbidity and mortality than any other disease. Many cardiovascular diseases are associated with a failure of defenses against oxidative stress-induced cellular damage and/or death, leading to organ dysfunction. The pleiotropic transcription factor, nuclear factor-erythroid (NF-E) 2-related factor 2 (Nrf2), regulates the expression of antioxidant enzymes and proteins through the antioxidant response element. Nrf2 is an important component in antioxidant defenses in cardiovascular diseases such as atherosclerosis, hypertension, and heart failure. Nrf2 is also involved in protection against oxidant stress during the processes of ischemia-reperfusion injury and aging. However, evidence suggests that Nrf2 activity does not always lead to a positive outcome and may accelerate the pathogenesis of some cardiovascular diseases (e.g., atherosclerosis). The precise conditions under which Nrf2 acts to attenuate or stimulate cardiovascular disease processes are unclear. Further studies on the cellular environments related to cardiovascular diseases that influence Nrf2 pathways are required before Nrf2 can be considered a therapeutic target for the treatment of cardiovascular diseases.

  4. Nrf2 regulates curcumin-induced aldose reductase expression indirectly via nuclear factor-kappaB.

    PubMed

    Kang, Eun Sil; Kim, Gil Hyeong; Kim, Hyo Jung; Woo, Im Sun; Ham, Sun Ah; Jin, Hana; Kim, Min Young; Kim, Hye Jung; Lee, Jae Heun; Chang, Ki Churl; Seo, Han Geuk; Hwang, Jin-Yong

    2008-07-01

    The osmotic response element (ORE) differs from the nuclear factor-kappaB (NF-kappaB) binding sequence by a single base pair; therefore, we investigated the involvement of NF-kappaB in the induction of aldose reductase (AR) by curcumin. Curcumin, an herb-derived polyphenolic compound, elicited an increase in the expression and promoter activity of the AR gene in a nuclear factor-erythroid 2-related factor 2 (Nrf2)-dependent manner. Small interfering RNA (siRNA) against p65 or BAY11-7082, an inhibitor of NF-kappaB, significantly suppressed the curcumin and/or Nrf2-induced increase in expression levels and promoter activity of the AR gene. BAY11-7082 or siRNA against p65 also attenuated the curcumin-induced increase in the promoter activity of the wild type AR-ORE(wt) gene, but not that of the mutated AR-ORE(mt), indicating that the ORE is essential for the response to NF-kappaB. The expression of p65, the promoter activity and DNA binding activity of NF-kappaB were enhanced in the presence of curcumin in cells that were transfected with Nrf2 compared to those treated with curcumin alone. Cells that had been preincubated with curcumin demonstrated resistance to reactive oxygen species-induced cell damage through the suppressive effects in the generation of reactive aldehydes. These effects were significantly attenuated in the presence of BAY11-7082, indicating the involvement of NF-kappaB in the cellular response of AR to oxidative stress and toxic aldehydes.

  5. Nuclear Respiratory Factor 2β (NRF-2β) recruits NRF-2α to the nucleus by binding to importin-α:β via an unusual monopartite-type nuclear localization signal.

    PubMed

    Hayashi, Rippei; Takeuchi, Nono; Ueda, Takuya

    2013-09-23

    Nuclear respiratory factor 2 (NRF-2) is a mammalian transcription factor composed of two distinct and unrelated proteins: NRF-2α, which binds to DNA through its Ets domain, and NRF-2β, which contains the transcription activation domain. The activity of NRF-2 in neurons is regulated by nuclear localization; however, the mechanism by which NRF-2 is imported into the nucleus remains unknown. By using in vitro nuclear import assays and immuno-cytofluorescence, we dissect the nuclear import pathways of NRF-2. We show that both NRF-2α and NRF-2β contain intrinsic nuclear localization signals (NLSs): the Ets domain within NRF-2α and the NLS within NRF-2β (amino acids 311/321: EEPPAKRQCIE) that is recognized by importin-α:β. When NRF-2α and NRF-2β form a complex, the nuclear import of NRF-2αβ becomes strictly dependent on the NLS within NRF-2β. Therefore, the nuclear import mechanism of NRF-2 is unique among Ets factors. The NRF-2β NLS contains only two lysine/arginine residues, unlike other known importin-α:β-dependent NLSs. Using ELISA-based binding assays, we show that it is bound by importin-α in almost the same manner and with similar affinity to that of the classical monopartite NLSs, such as c-myc and SV40 T-antigen NLSs. However, the part of the tryptophan array of importin-α that is essential for the recognition of classical monopartite NLSs by generating apolar pockets for the P3 and the P5 lysine/arginine side chains is not required for the recognition of the NRF-2β NLS. We conclude that the NRF-2β NLS is an unusual but is, nevertheless, a bona fide monopartite-type NLS.

  6. Nrf2 protects against airway disorders

    SciTech Connect

    Cho, Hye-Youn; Kleeberger, Steven R.

    2010-04-01

    Nuclear factor-erythroid 2 related factor 2 (Nrf2) is a ubiquitous master transcription factor that regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. In the unstressed condition, Kelch-like ECH-associated protein 1 (Keap1) suppresses cellular Nrf2 in cytoplasm and drives its proteasomal degradation. Nrf2 can be activated by diverse stimuli including oxidants, pro-oxidants, antioxidants, and chemopreventive agents. Nrf2 induces cellular rescue pathways against oxidative injury, abnormal inflammatory and immune responses, apoptosis, and carcinogenesis. Application of Nrf2 germ-line mutant mice has identified an extensive range of protective roles for Nrf2 in experimental models of human disorders in the liver, gastrointestinal tract, airway, kidney, brain, circulation, and immune or nerve system. In the lung, lack of Nrf2 exacerbated toxicity caused by multiple oxidative insults including supplemental respiratory therapy (e.g., hyperoxia, mechanical ventilation), cigarette smoke, allergen, virus, bacterial endotoxin and other inflammatory agents (e.g., carrageenin), environmental pollution (e.g., particles), and a fibrotic agent bleomycin. Microarray analyses and bioinformatic studies elucidated functional AREs and Nrf2-directed genes that are critical components of signaling mechanisms in pulmonary protection by Nrf2. Association of loss of function with promoter polymorphisms in NRF2 or somatic and epigenetic mutations in KEAP1 and NRF2 has been found in cohorts of patients with acute lung injury/acute respiratory distress syndrome or lung cancer, which further supports the role for NRF2 in these lung diseases. In the current review, we address the role of Nrf2 in airways based on emerging evidence from experimental oxidative disease models and human studies.

  7. Functional polymorphisms in the transcription factor NRF2 in humans increase the risk of acute lung injury.

    PubMed

    Marzec, Jacqui M; Christie, Jason D; Reddy, Sekhar P; Jedlicka, Anne E; Vuong, Hue; Lanken, Paul N; Aplenc, Richard; Yamamoto, Tae; Yamamoto, Masayuki; Cho, Hye-Youn; Kleeberger, Steven R

    2007-07-01

    We recently used positional cloning to identify the transcription factor Nrf2 (NF-E2 related factor 2) as a susceptibility gene in a murine model of oxidant-induced acute lung injury (ALI). NRF2 binds to antioxidant response elements (ARE) and up-regulates protective detoxifying enzymes in response to oxidative stress. This led us to investigate NRF2 as a candidate susceptibility gene for risk of development of ALI in humans. We identified multiple single nucleotide polymorphisms (SNPs) by resequencing NRF2 in ethnically diverse subjects, and one (-617 C/A) significantly (P<0.001) diminished luciferase activity of promoter constructs containing the SNP and significantly decreased the binding affinity (P<0.001) relative to the wild type at this locus (-617 CC). In a nested case-control study, patients with the -617 A SNP had a significantly higher risk for developing ALI after major trauma (OR 6.44; 95% CI 1.34, 30.8; P=0.021) relative to patients with the wild type (-617 CC). This translational investigation provides novel insight into the molecular mechanisms of susceptibility to ALI and may help to identify patients who are predisposed to develop ALI under at risk conditions, such as trauma and sepsis. Furthermore, these findings may have important implications in other oxidative stress related illnesses.

  8. Nrf2 deficiency impairs fracture healing in mice.

    PubMed

    Lippross, Sebastian; Beckmann, Rainer; Streubesand, Nadine; Ayub, Ferda; Tohidnezhad, Mersedeh; Campbell, Graeme; Kan, Yuet Wai; Horst, Fischer; Sönmez, Tolga Taha; Varoga, Deike; Lichte, Philipp; Jahr, Holger; Pufe, Thomas; Wruck, Christoph Jan

    2014-10-01

    Oxidative stress plays an important role in wound healing but data relating oxidative stress to fracture healing are scarce. Nuclear factor erythroid 2-related factor 2 (Nrf2) is the major transcription factor that controls the cellular defence essential to combat oxidative stress by regulating the expression of antioxidative enzymes. This study examined the impact of Nrf2 on fracture healing using a standard closed femoral shaft fracture model in wild-type (WT) and Nrf2-knockout (Nrf2-KO)-mice. Healing was evaluated by histology, real-time RT-PCR, µCT and biomechanical measurements. We showed that Nrf2 expression is activated during fracture healing. Bone healing and remodelling were retarded in the Nrf2-KO compared to the WT-mice. Nrf2-KO-mice developed significantly less callus tissue compared to WT-mice. In addition, biomechanical testing demonstrated lower strength against shear stress in the Nrf2-KO-group compared to WT. The expression of vascular endothelial growth factor (VEGF) and osteocalcin is reduced during fracture healing in Nrf2-KO-mice. Taken together, our results demonstrate that Nrf2 deficiency in mice results in impaired fracture healing suggesting that Nrf2 plays an essential role in bone regeneration. Pharmacological activation of Nrf2 may have therapeutic potential for the enhancement of fracture healing.

  9. Nrf2, a master regulator of detoxification and also antioxidant, anti-inflammatory and other cytoprotective mechanisms, is raised by health promoting factors.

    PubMed

    Pall, Martin L; Levine, Stephen

    2015-02-25

    The transcription factor Nrf2, nuclear factor erythroid-2-related factor 2, activates the transcription of over 500 genes in the human genome, most of which have cytoprotective functions. Nrf2 produces cytoprotection by detoxification mechanisms leading to increased detoxification and excretion of both organic xenobiotics and toxic metals; its action via over two dozen genes increases highly coordinated antioxidant activities; it produces major anti-inflammatory changes; it stimulates mitochondrial biogenesis and otherwise improves mitochondrial function; and it stimulates autophagy, removing toxic protein aggregates and dysfunctional organelles. Health-promoting nutrients and other factors act, at least in part by raising Nrf2 including: many phenolic antioxidants; gamma- and delta-tocopherols and tocotrienols; long chain omega-3 fatty acids DHA and EPA; many carotenoids of which lycopene may be the most active; isothiocyanates from cruciferous vegetables; sulfur compounds from allium vegetables; terpenoids. Other health promoting, Nrf2 raising factors include low level oxidative stress (hormesis), exercise and caloric restriction. Raising Nrf2 has been found to prevent and/or treat a large number of chronic inflammatory diseases in animal models and/or humans including various cardiovascular diseases, kidney diseases, lung diseases, diseases of toxic liver damage, cancer (prevention), diabetes/metabolic syndrome/obesity, sepsis, autoimmune diseases, inflammatory bowel disease, HIV/AIDS and epilepsy. Lesser evidence suggests that raising Nrf2 may lower 16 other diseases. Many of these diseases are probable NO/ONOO(-) cycle diseases and Nrf2 lowers effects of NO/ONOO(-) cycle elements. The most healthful diets known, traditional Mediterranean and Okinawan, are rich in Nrf2 raising nutrients as apparently was the Paleolithic diet that our ancestors ate. Modern diets are deficient in such nutrients. Nrf2 is argued to be both lifespan and healthspan extending

  10. Nrf1 and Nrf2 Transcription Factors Regulate Androgen Receptor Transactivation in Prostate Cancer Cells

    PubMed Central

    Schultz, Michelle A.; Hagan, Sharika S.; Datta, Amrita; Zhang, Yiguo; Freeman, Michael L.; Sikka, Suresh C.; Abdel-Mageed, Asim B.; Mondal, Debasis

    2014-01-01

    Despite androgen deprivation therapy (ADT), persistent androgen receptor (AR) signaling enables outgrowth of castration resistant prostate cancer (CRPC). In prostate cancer (PCa) cells, ADT may enhance AR activity through induction of oxidative stress. Herein, we investigated the roles of Nrf1 and Nrf2, transcription factors that regulate antioxidant gene expression, on hormone-mediated AR transactivation using a syngeneic in vitro model of androgen dependent (LNCaP) and castration resistant (C4-2B) PCa cells. Dihydrotestosterone (DHT) stimulated transactivation of the androgen response element (ARE) was significantly greater in C4-2B cells than in LNCaP cells. DHT-induced AR transactivation was coupled with higher nuclear translocation of p65-Nrf1 in C4-2B cells, as compared to LNCaP cells. Conversely, DHT stimulation suppressed total Nrf2 levels in C4-2B cells but elevated total Nrf2 levels in LNCaP cells. Interestingly, siRNA mediated silencing of Nrf1 attenuated AR transactivation while p65-Nrf1 overexpression enhanced AR transactivation. Subsequent studies showed that Nrf1 physically interacts with AR and enhances AR’s DNA-binding activity, suggesting that the p65-Nrf1 isoform is a potential AR coactivator. In contrast, Nrf2 suppressed AR-mediated transactivation by stimulating the nuclear accumulation of the p120-Nrf1 which suppressed AR transactivation. Quantitative RT-PCR studies further validated the inductive effects of p65-Nrf1 isoform on the androgen regulated genes, PSA and TMPRSS2. Therefore, our findings implicate differential roles of Nrf1 and Nrf2 in regulating AR transactivation in PCa cells. Our findings also indicate that the DHT-stimulated increase in p65-Nrf1 and the simultaneous suppression of both Nrf2 and p120-Nrf1 ultimately facilitates AR transactivation in CRPC cells. PMID:24466341

  11. Nrf2 enhances myocardial clearance of toxic ubiquitinated proteins.

    PubMed

    Wang, Wenjuan; Li, Siying; Wang, Hui; Li, Bin; Shao, Lei; Lai, Yimu; Horvath, Gary; Wang, Qian; Yamamoto, Masayuki; Janicki, Joseph S; Wang, Xing Li; Tang, Dongqi; Cui, Taixing

    2014-07-01

    Nuclear factor erythroid-2 related factor 2 (Nrf2) is a master transcription factor that controls the basal and inducible expression of a battery of antioxidant genes and other cytoprotective phase II detoxifying enzymes. While knockout of Nrf2 exaggerates cardiac pathological remodeling and dysfunction in diverse pathological settings, pharmacological activation of Nrf2 protects against cardiomyocyte injury and cardiac dysfunction. In contrast, there is also a concern that the chronic activation of Nrf2 secondary to oxidative stress is a contributing mechanism for the reductive stress-mediated heart failure. However, a direct link between cardiac specific activation of Nrf2 and cardiac protection or dysfunction in vivo remains to be established. Therefore, we investigated the effect of cardiomyocyte-specific transgenic activation of Nrf2 (Nrf2(ctg)) on cardiac pathological remodeling and dysfunction. We found that the cardiomyocyte-specific activation of Nrf2 suppressed myocardial oxidative stress as well as cardiac apoptosis, fibrosis, hypertrophy, and dysfunction in a setting of sustained pressure overload induced by transverse aortic arch constriction (TAC) in mice. Notably, the constitutive activation of Nrf2 increased the steady level of autophagosomes while decreasing the ubiquitinated protein aggregates in the heart after TAC. Nrf2 gene gain- and loss-of-function approaches revealed that Nrf2 enhances autophagosome formation and autophagic flux in cardiomyocytes. Unexpectedly, while Nrf2 minimally regulated apoptosis, it suppressed significantly the proteotoxic necrosis in cardiomyocytes. In addition, Nrf2 attenuated the proteocytotoxicity presumably via enhancing autophagy-mediated clearance of ubiquitinated protein aggregates in cardiomyocytes. Taken together, we demonstrated for the first time that cardiac specific activation of Nrf2 suppresses cardiac maladaptive remodeling and dysfunction most likely by enhancing autophagic clearance of toxic protein

  12. Nrf2 enhances myocardial clearance of toxic ubiquitinated proteins

    PubMed Central

    Wang, Wenjuan; Li, Siying; Wang, Hui; Li, Bin; Shao, Lei; Lai, Yimu; Horvath, Gary; Wang, Qian; Yamamoto, Masayuki; Janicki, Joseph S.; Wang, Xing Li; Tang, Dongqi; Cui, Taixing

    2015-01-01

    Nuclear factor erythroid-2 related factor 2 (Nrf2) is a master transcription factor that controls the basal and inducible expression of a battery of antioxidant genes and other cytoprotective phase II detoxifying enzymes. While knockout of Nrf2 exaggerates cardiac pathological remodeling and dysfunction in diverse pathological settings, pharmacological activation of Nrf2 protects against cardiomyocyte injury and cardiac dysfunction. In contrast, there is also a concern that the chronic activation of Nrf2 secondary to oxidative stress is a contributing mechanism for the reductive stress-mediated heart failure. However, a direct link between cardiac specific activation of Nrf2 and cardiac protection or dysfunction in vivo remains to be established. Therefore, we investigated the effect of cardiomyocyte-specific transgenic activation of Nrf2 (Nrf2ctg) on cardiac pathological remodeling and dysfunction. We found that the cardiomyocyte-specific activation of Nrf2 suppressed myocardial oxidative stress as well as cardiac apoptosis, fibrosis, hypertrophy, and dysfunction in a setting of sustained pressure overload induced by transverse aortic arch constriction (TAC) in mice. Notably, the constitutive activation of Nrf2 increased the steady level of autophagosomes while decreasing the ubiquitinated protein aggregates in the heart after TAC. Nrf2 gene gain- and loss-of-function approaches revealed that Nrf2 enhances autophagosome formation and autophagic flux in cardiomyocytes. Unexpectedly, while Nrf2 minimally regulated apoptosis, it suppressed significantly the proteotoxic necrosis in cardiomyocytes. In addition, Nrf2 attenuated the proteocytotoxicity presumably via enhancing autophagy-mediated clearance of ubiquitinated protein aggregates in cardiomyocytes. Taken together, we demonstrated for the first time that cardiac specific activation of Nrf2 suppresses cardiac maladaptive remodeling and dysfunction most likely by enhancing autophagic clearance of toxic protein

  13. Targeting NRF2 signaling for cancer chemoprevention

    SciTech Connect

    Kwak, Mi-Kyoung; Kensler, Thomas W.

    2010-04-01

    Modulation of the metabolism and disposition of carcinogens through induction of cytoprotective enzymes is one of several promising strategies to prevent cancer. Chemopreventive efficacies of inducers such as dithiolethiones and sulforaphane have been extensively studied in animals as well as in humans. The KEAP1-NRF2 system is a key, but not unilateral, molecular target for these chemopreventive agents. The transcription factor NRF2 (NF-E2-related factor 2) is a master regulator of the expression of a subset of genes, which produce proteins responsible for the detoxication of electrophiles and reactive oxygen species as well as the removal or repair of some of their damage products. It is believed that chemopreventive enzyme inducers affect the interaction between KEAP1 and NRF2 through either mediating conformational changes of the KEAP1 protein or activating phosphorylation cascades targeting the KEAP1-NRF2 complex. These events in turn affect NRF2 stability and trafficking. Recent advances elucidating the underlying structural biology of KEAP1-NRF2 signaling and identification of the gene clusters under the transcriptional control of NRF2 are facilitating understanding of the potential pleiotropic effects of NRF2 activators and discovery of novel classes of potent chemopreventive agents such as the triterpenoids. Although there is appropriately a concern regarding a deleterious role of the KEAP1-NRF2 system in cancer cell biology, especially as the pathway affects cell survival and drug resistance, the development and the use of NRF2 activators as chemopreventive agents still holds a great promise for protection of normal cells from a diversity of environmental stresses that contribute to the burden of cancer and other chronic, degenerative diseases.

  14. Mining a human transcriptome database for Nrf2 modulators

    EPA Science Inventory

    Nuclear factor erythroid-2 related factor 2 (Nrf2) is a key transcription factor important in the protection against oxidative stress. We developed computational procedures to enable the identification of chemical, genetic and environmental modulators of Nrf2 in a large database ...

  15. The emerging role of the Nrf2–Keap1 signaling pathway in cancer

    PubMed Central

    Jaramillo, Melba C.; Zhang, Donna D.

    2013-01-01

    The Nrf2 (nuclear factor erythroid 2 [NF-E2]-related factor 2 [Nrf2])–Keap1 (Kelch-like erythroid cell-derived protein with CNC homology [ECH]-associated protein 1) signaling pathway is one of the most important cell defense and survival pathways. Nrf2 can protect cells and tissues from a variety of toxicants and carcinogens by increasing the expression of a number of cytoprotective genes. As a result, several Nrf2 activators are currently being tested as chemopreventive compounds in clinical trials. Just as Nrf2 protects normal cells, studies have shown that Nrf2 may also protect cancer cells from chemotherapeutic agents and facilitate cancer progression. Nrf2 is aberrantly accumulated in many types of cancer, and its expression is associated with a poor prognosis in patients. In addition, Nrf2 expression is induced during the course of drug resistance. Collectively, these studies suggest that Nrf2 contributes to both intrinsic and acquired chemoresistance. This discovery has opened up a broad spectrum of research geared toward a better understanding of the role of Nrf2 in cancer. This review provides an overview of (1) the Nrf2–Keap1 signaling pathway, (2) the dual role of Nrf2 in cancer, (3) the molecular basis of Nrf2 activation in cancer cells, and (4) the challenges in the development of Nrf2-based drugs for chemoprevention and chemotherapy. PMID:24142871

  16. Nrf2 activation prevents cadmium-induced acute liver injury

    SciTech Connect

    Wu, Kai C.; Liu, Jie J.; Klaassen, Curtis D.

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  17. The emerging role of Nrf2 in dermatotoxicology

    PubMed Central

    Tan, Nguan S; Wahli, Walter

    2014-01-01

    The nuclear factor erythroid 2-related factor 2 (Nrf2) is best known for its role in resistance to oxidant stress. In this issue of EMBO Molecular Medicine, Nrf2-prolonged genetic activation is shown with devastating effects on skin homeostasis. The study provides novel molecular insights into poison-induced chloracne and metabolizing acquired dioxin-induced skin hamartomas or MADISH. PMID:24521743

  18. The Nrf2-ARE pathway: a valuable therapeutic target for the treatment of neurodegenerative diseases

    PubMed Central

    Joshi, Gururaj; Johnson, Jeffrey A.

    2013-01-01

    Modulation of NF-E2 related factor 2 (Nrf2) has been shown in several neurodegenerative disorders. The overexpression of Nrf2 has become a potential therapeutic avenue for various neurodegenerative disorders such as Parkinson, Amyotrophic lateral sclerosis, and Alzheimer’s disease. The expression of phase II detoxification enzymes is governed by the cis-acting regulatory element known as antioxidant response element (ARE). The transcription factor Nrf2 binds to ARE thereby transcribing multitude of antioxidant genes. Keap1, a culin 3-based E3 ligase that targets Nrf2 for degradation, sequesters Nrf2 in cytoplasm. Disruption of Keap1-Nrf2 interaction or genetic overexpression of Nrf2 can increase the endogenous antioxidant capacity of the brain thereby rendering protection against oxidative stress in neurodegenerative disorders. This review primarily focuses on targeted Nrf2 overexpression as a promising therapeutic strategy for the treatment of neurodegenerative disorders. PMID:22742419

  19. Translational control of Nrf2 within the open reading frame

    SciTech Connect

    Perez-Leal, Oscar Barrero, Carlos A.; Merali, Salim

    2013-07-19

    Highlights: •Identification of a novel Nrf2 translational repression mechanism. •The repressor is within the 3′ portion of the Nrf2 ORF. •The translation of Nrf2 or eGFP is reduced by the regulatory element. •The translational repression can be reversed with synonymous codon substitutions. •The molecular mechanism requires the mRNA sequence, but not the encoded amino acids. -- Abstract: Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required – a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3′ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state.

  20. Nrf2 Is an Attractive Therapeutic Target for Retinal Diseases

    PubMed Central

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that binds to antioxidant response elements located in the promoter region of genes encoding many antioxidant enzymes and phase II detoxifying enzymes. Activation of Nrf2 functions is one of the critical defensive mechanisms against oxidative stress in many species. The retina is constantly exposed to reactive oxygen species, and oxidative stress is a major contributor to age-related macular diseases. Moreover, the resulting inflammation and neuronal degeneration are also related to other retinal diseases. The well-known Nrf2 activators, bardoxolone methyl and its derivatives, have been the subject of a number of clinical trials, including those aimed at treating chronic kidney disease, pulmonary arterial hypertension, and mitochondrial myopathies. Recent studies suggest that Nrf2 activation protects the retina from retinal diseases. In particular, this is supported by the finding that Nrf2 knockout mice display age-related retinal degeneration. Moreover, the concept has been validated by the efficacy of Nrf2 activators in a number of retinal pathological models. We have also recently succeeded in generating a novel Nrf2 activator, RS9, using a biotransformation technique. This review discusses current links between retinal diseases and Nrf2 and the possibility of treating retinal diseases by activating the Nrf2 signaling pathway.

  1. The cinnamon-derived dietary factor cinnamic aldehyde activates the Nrf2-dependent antioxidant response in human epithelial colon cells.

    PubMed

    Wondrak, Georg Thomas; Villeneuve, Nicole F; Lamore, Sarah D; Bause, Alexandra S; Jiang, Tao; Zhang, Donna D

    2010-05-07

    Colorectal cancer (CRC) is a major cause of tumor-related morbidity and mortality worldwide. Recent research suggests that pharmacological intervention using dietary factors that activate the redox sensitive Nrf2/Keap1-ARE signaling pathway may represent a promising strategy for chemoprevention of human cancer including CRC. In our search for dietary Nrf2 activators with potential chemopreventive activity targeting CRC, we have focused our studies on trans-cinnamic aldehyde (cinnamaldeyde, CA), the key flavor compound in cinnamon essential oil. Here we demonstrate that CA and an ethanolic extract (CE) prepared from Cinnamomum cassia bark, standardized for CA content by GC-MS analysis, display equipotent activity as inducers of Nrf2 transcriptional activity. In human colon cancer cells (HCT116, HT29) and non-immortalized primary fetal colon cells (FHC), CA- and CE-treatment upregulated cellular protein levels of Nrf2 and established Nrf2 targets involved in the antioxidant response including heme oxygenase 1 (HO-1) and gamma-glutamyl-cysteine synthetase (gamma-GCS, catalytic subunit). CA- and CE-pretreatment strongly upregulated cellular glutathione levels and protected HCT116 cells against hydrogen peroxide-induced genotoxicity and arsenic-induced oxidative insult. Taken together our data demonstrate that the cinnamon-derived food factor CA is a potent activator of the Nrf2-orchestrated antioxidant response in cultured human epithelial colon cells. CA may therefore represent an underappreciated chemopreventive dietary factor targeting colorectal carcinogenesis.

  2. The Cinnamon-derived Dietary Factor Cinnamic Aldehyde Activates the Nrf2-dependent Antioxidant Response in Human Epithelial Colon Cells

    PubMed Central

    Wondrak, Georg T.; Villeneuve, Nicole F.; Lamore, Sarah D.; Bause, Alexandra S.; Jiang, Tao; Zhang, Donna D.

    2011-01-01

    Colorectal cancer (CRC) is a major cause of tumor-related morbidity and mortality worldwide. Recent research suggests that pharmacological intervention using dietary factors that activate the redox sensitive Nrf2/Keap1-ARE signaling pathway may represent a promising strategy for chemoprevention of human cancer including CRC. In our search for dietary Nrf2 activators with potential chemopreventive activity targeting CRC, we have focused our studies on trans-cinnamic aldehyde (cinnamaldeyde, CA), the key flavor compound in cinnamon essential oil. Here we demonstrate that CA and an ethanolic extract (CE) prepared from Cinnamomum cassia bark, standardized for CA content by GC-MS analysis, display equipotent activity as inducers of Nrf2 transcriptional activity. In human colon cancer cells (HCT116, HT29) and non-immortalized primary fetal colon cells (FHC), CA- and CE-treatment upregulated cellular protein levels of Nrf2 and established Nrf2 targets involved in the antioxidant response including heme oxygenase 1 (HO-1) and γ-glutamylcysteine synthetase (γ-GCS, catalytic subunit). CA- and CE-pretreatment strongly upregulated cellular glutathione levels and protected HCT116 cells against hydrogen peroxide-induced genotoxicity and arsenic-induced oxidative insult. Taken together our data demonstrate that the cinnamon-derived food factor CA is a potent activator of the Nrf2-orchestrated antioxidant response in cultured human epithelial colon cells. CA may therefore represent an underappreciated chemopreventive dietary factor targeting colorectal carcinogenesis. PMID:20657484

  3. Regulation of NF-E2-Related Factor 2 Signaling for Cancer Chemoprevention: Antioxidant Coupled with Antiinflammatory

    PubMed Central

    Saw, Constance Lay-Lay

    2010-01-01

    Abstract Cancer chemoprevention is a process of using either natural or synthetic compounds to reduce the risk of developing cancer. Observations that NF-E2-related factor 2 (Nrf2)-deficient mice lack response to some chemopreventive agents point to the important role of Nrf2 in chemoprevention. Nrf2 is a member of basic-leucine zipper transcription factor family and has been shown to regulate gene expression by binding to a response element, antioxidant responsive element. It is generally believed that activation of Nrf2 signaling is an adaptive response to the environmental and endogenous stresses. Under homeostatic conditions, Nrf2 is suppressed by association with Kelch-like ECH-associated protein 1 (Keap1), but is stimulated upon exposure to oxidative or electrophilic stress. Once activated, Nrf2 translocates into nuclei and upregulates a group of genes that act in concert to combat oxidative stress. Nrf2 is also shown to have protective function against inflammation, a pathological process that could contribute to carcinogenesis. In this review, we will discuss the current progress in the study of Nrf2 signaling, in particular, the mechanisms of Nrf2 activation by chemopreventive agents. We will also discuss some of the potential caveats of Nrf2 in cancer treatment and future opportunity and challenges on regulation of Nrf2-mediated antioxidant and antiinflammatory signaling in the context of cancer prevention. Antioxid. Redox Signal. 13, 1679–1698. PMID:20486765

  4. Inhibition of liver fibrosis by solubilized coenzyme Q10: Role of Nrf2 activation in inhibiting transforming growth factor-beta1 expression

    SciTech Connect

    Choi, Hoo-Kyun; Pokharel, Yuba Raj; Lim, Sung Chul; Han, Hyo-Kyung; Ryu, Chang Seon; Kim, Sang Kyum; Kwak, Mi Kyong; Kang, Keon Wook

    2009-11-01

    Coenzyme Q10 (CoQ10), an endogenous antioxidant, is important in oxidative phosphorylation in mitochondria. It has anti-diabetic and anti-cardiovascular disease effects, but its ability to protect against liver fibrosis has not been studied. Here, we assessed the ability of solubilized CoQ10 to improve dimethylnitrosamine (DMN)-induced liver fibrogenesis in mice. DMN treatments for 3 weeks produced a marked liver fibrosis as assessed by histopathological examination and tissue 4-hydroxyproline content. Solubilized CoQ10 (10 and 30 mg/kg) significantly inhibited both the increases in fibrosis score and 4-hydroxyproline content induced by DMN. Reverse transcription-polymerase chain reaction and Western blot analyses revealed that solubilized CoQ10 inhibited increases in the transforming growth factor-beta1 (TGF-beta1) mRNA and alpha-smooth muscle actin (alpha-SMA) protein by DMN. Interestingly, hepatic glutamate-cysteine ligase (GCL) and glutathione S-transferase A2 (GSTA2) were up-regulated in mice treated with CoQ10. Solubilized CoQ10 also up-regulated antioxidant enzymes such as catalytic subunits of GCL and GSTA2 via activating NF-E2 related factor2 (Nrf2)/antioxidant response element (ARE) in H4IIE hepatoma cells. Moreover, CoQ10's inhibition of alpha-SMA and TGF-beta1 expressions disappeared in Nrf2-null MEF cells. In contrast, Nrf2 overexpression significantly decreased the basal expression levels of alpha-SMA and TGF-beta1 in Nrf2-null MEF cells. These results demonstrated that solubilized CoQ10 inhibited DMN-induced liver fibrosis through suppression of TGF-beta1 expression via Nrf2/ARE activation.

  5. Role of Nrf2 in preventing ethanol-induced oxidative stress and lipid accumulation

    SciTech Connect

    Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-08-01

    Oxidative stress and lipid accumulation play important roles in alcohol-induced liver injury. Previous reports showed that, in livers of nuclear factor erythroid 2-related factor 2 (Nrf2)-activated mice, genes involved in antioxidant defense are induced, whereas genes involved in lipid biosynthesis are suppressed. To investigate the role of Nrf2 in ethanol-induced hepatic alterations, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation, were treated with ethanol (5 g/kg, po). Blood and liver samples were collected 6 h thereafter. Ethanol increased alanine aminotransferase and lactate dehydrogenase activities as well as thiobarbituric acid reactive substances in serum of Nrf2-null and wild-type mice, but not in Nrf2-enhanced mice. After ethanol administration, mitochondrial glutathione concentrations decreased markedly in Nrf2-null mice but not in Nrf2-enhanced mice. H{sub 2}DCFDA staining of primary hepatocytes isolated from the four genotypes of mice indicates that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. Ethanol increased serum triglycerides and hepatic free fatty acids in Nrf2-null mice, and these increases were blunted in Nrf2-enhanced mice. In addition, the basal mRNA and nuclear protein levels of sterol regulatory element-binding protein 1(Srebp-1) were decreased with graded Nrf2 activation. Ethanol further induced Srebp-1 mRNA in Nrf2-null mice but not in Nrf2-enhanced mice. In conclusion, Nrf2 activation prevented alcohol-induced oxidative stress and accumulation of free fatty acids in liver by increasing genes involved in antioxidant defense and decreasing genes involved in lipogenesis. -- Highlights: ► Ethanol depleted mitochondrial GSH in Nrf2-null mice but not in Keap1-KD mice. ► Ethanol increased ROS in hepatocytes isolated from Nrf2-null and wild

  6. An Essential Role of NRF2 in Diabetic Wound Healing.

    PubMed

    Long, Min; Rojo de la Vega, Montserrat; Wen, Qing; Bharara, Manish; Jiang, Tao; Zhang, Rui; Zhou, Shiwen; Wong, Pak K; Wondrak, Georg T; Zheng, Hongting; Zhang, Donna D

    2016-03-01

    The high mortality and disability of diabetic nonhealing skin ulcers create an urgent need for the development of more efficacious strategies targeting diabetic wound healing. In the current study, using human clinical specimens, we show that perilesional skin tissues from patients with diabetes are under more severe oxidative stress and display higher activation of the nuclear factor-E2-related factor 2 (NRF2)-mediated antioxidant response than perilesional skin tissues from normoglycemic patients. In a streptozotocin-induced diabetes mouse model, Nrf2(-/-) mice have delayed wound closure rates compared with Nrf2(+/+) mice, which is, at least partially, due to greater oxidative DNA damage, low transforming growth factor-β1 (TGF-β1) and high matrix metalloproteinase 9 (MMP9) expression, and increased apoptosis. More importantly, pharmacological activation of the NRF2 pathway significantly improves diabetic wound healing. In vitro experiments in human immortalized keratinocyte cells confirm that NRF2 contributes to wound healing by alleviating oxidative stress, increasing proliferation and migration, decreasing apoptosis, and increasing the expression of TGF-β1 and lowering MMP9 under high-glucose conditions. This study indicates an essential role for NRF2 in diabetic wound healing and the therapeutic benefits of activating NRF2 in this disease, laying the foundation for future clinical trials using NRF2 activators in treating diabetic skin ulcers. PMID:26718502

  7. Nuclear Factor Erythroid 2-Related Factor 2 Deletion Impairs Glucose Tolerance and Exacerbates Hyperglycemia in Type 1 Diabetic MiceS⃞

    PubMed Central

    Aleksunes, Lauren M.; Reisman, Scott A.; Yeager, Ronnie L.; Goedken, Michael J.

    2010-01-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic β-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum β-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels. PMID:20086057

  8. Homocysteine Induces Heme Oxygenase-1 Expression via Transcription Factor Nrf2 Activation in HepG2 Cells

    PubMed Central

    Mani, Monireh; Golmohammadi, Taghi; Khaghani, Shahnaz; Zamani, Zahra; Azadmanesh, Kayhan; Meshkani, Reza; Pasalar, Parvin

    2013-01-01

    Background: Elevated level of plasma homocysteine has been related to various diseases. Patients with hyperhomocysteinemia can develop hepatic steatosis and fibrosis. We hypothesized that oxidative stress induced by homocysteine might play an important role in pathogenesis of liver injury. Also, the cellular response designed to combat oxidative stress is primarily controlled by the transcription factor Nrf2, a principal inducer of anti-oxidant and phase II-related genes. Methods: HepG2 cells were treated with homocysteine in different time periods. Glutathione content was measured by flowcytometry. Using electrophoretic mobility shift assay (EMSA) and Western-blotting, anti-oxidant response element (ARE)-binding activity of Nrf2 for heme ocygenase-1 (HO-1) was demonstrated. Real time RT-PCR and Western-blotting were performed to evaluate whether homocysteine was able to induce mRNA and protein expression of HO-1. Results: The role of Nrf2 in cellular response to homocysteine is substantiated by the following observations in HepG2 cells exposed to homocysteine (i) Western-blotting revealed that Nrf2 is strongly stabilized and became detectable in nuclear extracts. (ii) EMSA demonstrated increased binding of Nrf2 to oligomers containing HO-1 promoter-specific ARE-binding site. (iii) Real time RT-PCR and Western-blotting revealed increased mRNA and protein expression of inducible gene HO-1 after treatment with homocysteine. Conclusion: Data presented in the current study provide direct evidence that the immediate cellular response to oxidative stress provoked by homocysteine is orchestrated mainly by the Nrf2-ARE pathway. Therefore, induction of Nrf2-ARE-dependent expression of HO-1 could be a therapeutic option for hepatic cells damage induced by homocysteine. PMID:23567851

  9. Nuclear factor erythroid 2-related factor gene variants and susceptibility of arsenic-related skin lesions.

    PubMed

    Cordova, E J; Valenzuela, O L; Sánchez-Peña, L C; Escamilla-Guerrero, G; Hernández-Zavala, A; Orozco, L; Del Razo, L M

    2014-06-01

    Inorganic arsenic (iAs) is an important pollutant associated with various chronic-degenerative diseases. The cytoprotective protein nuclear factor erythroid 2-related factor (NRF2) has been proposed as an important responsive mechanism against iAs exposure. The aim of this study was to determine whether the risk of skin lesions in people exposed to iAs-contaminated water could be modified by the presence of single nucleotide polymorphisms in the NRF2 coding gene. We studied 117 individuals with long-term iAs exposure and 120 nonexposed individuals. Total As was determined in water, meanwhile iAs and its metabolites were measured in urine. The iAs-induced skin lesion status was evaluated by expert dermatologists. We sequenced the promoter region of NRF2 in a sample of 120 healthy donors. We found four polymorphisms previously reported and one novel polymorphism in the 5' regulatory region of the NRF2. In this study, we did not find allelic and genotype association of NRF2 polymorphisms with iAs-related skin lesion. However, the analysis of haplotypes composed by -653GA, and -617CA NRF2 single nucleotide polymorphisms showed a significant association with protection against skin lesions in the low-As exposure group. This is the first report studying the association between NRF2 polymorphisms and susceptibility of As-related skin lesions. Increasing the sample size will allow us to confirm this data. PMID:24107458

  10. Nuclear factor erythroid 2-related factor gene variants and susceptibility of arsenic-related skin lesions.

    PubMed

    Cordova, E J; Valenzuela, O L; Sánchez-Peña, L C; Escamilla-Guerrero, G; Hernández-Zavala, A; Orozco, L; Del Razo, L M

    2014-06-01

    Inorganic arsenic (iAs) is an important pollutant associated with various chronic-degenerative diseases. The cytoprotective protein nuclear factor erythroid 2-related factor (NRF2) has been proposed as an important responsive mechanism against iAs exposure. The aim of this study was to determine whether the risk of skin lesions in people exposed to iAs-contaminated water could be modified by the presence of single nucleotide polymorphisms in the NRF2 coding gene. We studied 117 individuals with long-term iAs exposure and 120 nonexposed individuals. Total As was determined in water, meanwhile iAs and its metabolites were measured in urine. The iAs-induced skin lesion status was evaluated by expert dermatologists. We sequenced the promoter region of NRF2 in a sample of 120 healthy donors. We found four polymorphisms previously reported and one novel polymorphism in the 5' regulatory region of the NRF2. In this study, we did not find allelic and genotype association of NRF2 polymorphisms with iAs-related skin lesion. However, the analysis of haplotypes composed by -653GA, and -617CA NRF2 single nucleotide polymorphisms showed a significant association with protection against skin lesions in the low-As exposure group. This is the first report studying the association between NRF2 polymorphisms and susceptibility of As-related skin lesions. Increasing the sample size will allow us to confirm this data.

  11. Correlation Between Nuclear Factor E2-Related Factor 2 Expression and Gastric Cancer Progression

    PubMed Central

    Zheng, Hongyu; Nong, Zhiwei; Lu, Guohao

    2015-01-01

    Background Nuclear factor E2-related factor 2 (Nrf2) plays an anti-oxidative and phase II detoxification function via its up-regulation on various antioxidant response elements (ARE) genes. Nrf2 can protect both normal and cancer cells from damages of cell stress, thereby exerting a critical role in the development of cancer. The expression and significance of Nrf2 in gastric cancer, however, has not been reported. This study thus aimed to investigate the expression of Nrf2 in gastric cancer tissues via immunohistochemical (IHC) staining. Material/Methods Gastric carcinoma tissues from a total of 175 patients during surgical resection were examined for Nfr2 expression profiles using IHC staining on paraffin-embedded slides. Between-group-comparisons were performed by chi-square, Fisher’s exact, or Mann-Whitney U test. The correlation between Nfr2 expression and clinical indexes was further analyzed by Kaplan-Meier test, univariate/multivariate analysis, and log-rank test. Results Nrf2 is mainly expressed in nuclei of gastric carcinoma tissues, with significant correlation with clinical indexes, including tumor size, invasive depth, lymph node metastasis, and invasion. Patients with Nrf2-positive expression had significantly lower survival rates compared to those in the negative group (p<0.01), with chemo-resistance against 5-fluorouracil (5-FU) (p<0.05). Conclusions Nrf2 expression is positively correlated with invasive gastric cancer, suggesting its utility as a predictive index for unfavorable prognosis. PMID:26410168

  12. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    SciTech Connect

    Mercado, Nicolas; Thimmulappa, Rajesh; Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E.; Biswal, Shyam; Ito, Kazuhiro; Barnes, Peter J.

    2011-03-11

    Research highlights: {yields} Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. {yields} HDAC inhibition decreases Nrf2 protein stability. {yields} HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. {yields} HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H{sub 2}O{sub 2}) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H{sub 2}O{sub 2}-induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  13. Nrf2 suppresses macrophage inflammatory response by blocking proinflammatory cytokine transcription

    PubMed Central

    Kobayashi, Eri H.; Suzuki, Takafumi; Funayama, Ryo; Nagashima, Takeshi; Hayashi, Makiko; Sekine, Hiroki; Tanaka, Nobuyuki; Moriguchi, Takashi; Motohashi, Hozumi; Nakayama, Keiko; Yamamoto, Masayuki

    2016-01-01

    Nrf2 (NF-E2-related factor-2) transcription factor regulates oxidative/xenobiotic stress response and also represses inflammation. However, the mechanisms how Nrf2 alleviates inflammation are still unclear. Here, we demonstrate that Nrf2 interferes with lipopolysaccharide-induced transcriptional upregulation of proinflammatory cytokines, including IL-6 and IL-1β. Chromatin immunoprecipitation (ChIP)-seq and ChIP-qPCR analyses revealed that Nrf2 binds to the proximity of these genes in macrophages and inhibits RNA Pol II recruitment. Further, we found that Nrf2-mediated inhibition is independent of the Nrf2-binding motif and reactive oxygen species level. Murine inflammatory models further demonstrated that Nrf2 interferes with IL6 induction and inflammatory phenotypes in vivo. Thus, contrary to the widely accepted view that Nrf2 suppresses inflammation through redox control, we demonstrate here that Nrf2 opposes transcriptional upregulation of proinflammatory cytokine genes. This study identifies Nrf2 as the upstream regulator of cytokine production and establishes a molecular basis for an Nrf2-mediated anti-inflammation approach. PMID:27211851

  14. Correlation between expression of NF-E2-related factor 2 and progression of gastric cancer

    PubMed Central

    Bao, Jie; Li, Jiansheng; Li, Dongying; Li, Zhenjie

    2015-01-01

    Objective: Nuclear factor E2-related factor 2 (Nrf2) plays a part in antioxidant and phase II detoxification enzymes in cells by the up regulation of many antioxidant response elements (ARE) related gene transcription. Nrf2 not only protect the normal cells, but also can protect cancer cells from the effect of cell stress, which is helpful to the survival of cancer cell. Some studies show that the expression of Nrf2 has important clinical significance in cancer patients, but the analysis of gastrointestinal tumor Nrf2 comprehensive expression has not been reported. The aim of this study is to evaluate the expression of Nrf2 in gastric cancer by immunohistochemistry and analyze its related clinical significance. Methods: 180 cases of gastric cancer patients receive the gastrectomy and lymphadenectomy, and the resection of tissue is expressesd in paraffin embedded sections by immunohistochemical analysis of Nrf2. And the difference between groups use χ2 (chi-square criterion) test, and will be analyzed by Fisher’s exact test and Mann-Whitney U test. Use univariate and multivariate analysis, Kaplan-Meier curve and log-rank to test and evaluate the correlation between the expression of Nrf2 and the clinical pathological features. Results: The immune reaction of Nrf2 is mainly found in gastric cancer cell nucleus, which positive expression is closely related to the tumor size, depth of invasion, lymph node metastasis, lymphatic invasion and histological analysis (all P<0.05). The log-rank test shows that the survival rate of Nrf2 positive expression group is significantly lower than that of the negative expression group (P<0.01). The Nrf2 positive expression is closely related to the drug resistance of adjuvant chemotherapy on the basis of 5FU (P=0.022). Conclusion: There is a positive correlation between the expression of Nrf2 and the invasion of gastric cancer, which can be used as a potential indicator of patients’ poor prognosis. PMID:26550248

  15. Early modulation of the transcription factor Nrf2 in rodent striatal slices by quinolinic acid, a toxic metabolite of the kynurenine pathway.

    PubMed

    Colín-González, A L; Luna-López, A; Königsberg, M; Ali, S F; Pedraza-Chaverrí, J; Santamaría, A

    2014-02-28

    Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) is a transcription factor involved in the orchestration of antioxidant responses. Although its pharmacological activation has been largely hypothesized as a promising tool to ameliorate the progression of neurodegenerative events, the actual knowledge about its modulation in neurotoxic paradigms remains scarce. In this study, we investigated the early profile of Nrf2 modulation in striatal slices of rodents incubated in the presence of the toxic kynurenine pathway metabolite, quinolinic acid (QUIN). Tissue slices from rats and mice were obtained and used throughout the experiments in order to compare inter-species responses. Nuclear Nrf2 protein levels and oxidative damage to lipids were compared. Time- and concentration-response curves of all markers were explored. Nrf2 nuclear activation was corroborated through phase 2 antioxidant protein expression. The effects of QUIN on Nrf2 modulation and oxidative stress were also compared between slices of wild-type (Nrf2(+/+)) and Nrf2 knock-out (Nrf2(-/-)) mice. The possible involvement of the N-methyl-d-aspartate receptor (NMDAr) in the Nrf2 modulation and lipid peroxidation was further explored in mice striatal slices. In rat striatal slices, QUIN stimulated the Nrf2 nuclear translocation. This effect was accompanied by augmented lipid peroxidation. In the mouse striatum, QUIN per se exerted an induction of Nrf2 factor only at 1h of incubation, and a concentration-response effect on lipid peroxidation after 3h of incubation. QUIN stimulated the striatal content of phase 2 enzymes. Nrf2(-/-) mice were slightly more responsive than Nrf2(+/+) mice to the QUIN-induced oxidative damage, and completely unresponsive to the NMDAr antagonist MK-801 when tested against QUIN. Findings of this study indicate that: (1) Nrf2 is modulated in rodent striatal tissue in response to QUIN; (2) Nrf2(-/-) striatal tissue was moderately more vulnerable to oxidative damage than the Wt

  16. Transcription factor NRF2 regulates miR-1 and miR-206 to drive tumorigenesis

    PubMed Central

    Singh, Anju; Happel, Christine; Manna, Soumen K.; Acquaah-Mensah, George; Carrerero, Julian; Kumar, Sarvesh; Nasipuri, Poonam; Krausz, Kristopher W.; Wakabayashi, Nobunao; Dewi, Ruby; Boros, Laszlo G.; Gonzalez, Frank J.; Gabrielson, Edward; Wong, Kwok K.; Girnun, Geoffrey; Biswal, Shyam

    2013-01-01

    The mechanisms by which deregulated nuclear factor erythroid-2–related factor 2 (NRF2) and kelch-like ECH-associated protein 1 (KEAP1) signaling promote cellular proliferation and tumorigenesis are poorly understood. Using an integrated genomics and 13C-based targeted tracer fate association (TTFA) study, we found that NRF2 regulates miR-1 and miR-206 to direct carbon flux toward the pentose phosphate pathway (PPP) and the tricarboxylic acid (TCA) cycle, reprogramming glucose metabolism. Sustained activation of NRF2 signaling in cancer cells attenuated miR-1 and miR-206 expression, leading to enhanced expression of PPP genes. Conversely, overexpression of miR-1 and miR-206 decreased the expression of metabolic genes and dramatically impaired NADPH production, ribose synthesis, and in vivo tumor growth in mice. Loss of NRF2 decreased the expression of the redox-sensitive histone deacetylase, HDAC4, resulting in increased expression of miR-1 and miR-206, and not only inhibiting PPP expression and activity but functioning as a regulatory feedback loop that repressed HDAC4 expression. In primary tumor samples, the expression of miR-1 and miR-206 was inversely correlated with PPP gene expression, and increased expression of NRF2-dependent genes was associated with poor prognosis. Our results demonstrate that microRNA-dependent (miRNA-dependent) regulation of the PPP via NRF2 and HDAC4 represents a novel link between miRNA regulation, glucose metabolism, and ROS homeostasis in cancer cells. PMID:23921124

  17. The transcription factor Nrf2 promotes survival by enhancing the expression of uncoupling protein 3 under conditions of oxidative stress.

    PubMed

    Anedda, Andrea; López-Bernardo, Elia; Acosta-Iborra, Bárbara; Saadeh Suleiman, M; Landázuri, Manuel O; Cadenas, Susana

    2013-08-01

    Uncoupling protein 3 (UCP3) is a member of the mitochondrial inner membrane carrier superfamily that modulates energy efficiency by catalyzing proton conductance and thus decreasing the production of superoxide anion. However, its role during oxidative stress and the underlying regulatory and molecular mechanisms remain poorly understood. We sought to investigate how UCP3 expression is regulated by oxidative stress and to evaluate the putative antioxidant role of this protein. H2O2 treatment increased UCP3 expression and the nuclear accumulation of the transcription factor Nrf2 in C2C12 and HL-1 cells. Nrf2 siRNA prevented H2O2-induced UCP3 expression, increasing oxidative stress and cell death. ChIP assays identified an antioxidant-response element (ARE) within the UCP3 promoter that bound Nrf2 after exposure to H2O2. Luciferase reporter experiments confirmed increased ARE activity in H2O2-treated HL-1 cells. Importantly, H2O2 increased the UCP3-mediated proton leak, suggesting a role for this protein in attenuating ROS-induced damage. Nrf2 nuclear accumulation and increased UCP3 protein were also detected in intact mouse heart subjected to a condition known to increase ROS generation. This is the first study to demonstrate that H2O2 augments UCP3 expression and it provides the first evidence of Nrf2 binding to the UCP3 promoter in response to oxidative challenge. These findings suggest that UCP3 functions as a member of the cellular antioxidant defense system that protects against oxidative stress in vivo. In conclusion, we have identified a novel regulatory process induced by an oxidative insult whereby the expression of the mitochondrial protein UCP3 is driven by the Nrf2 transcription factor, which decreases ROS production and prevents cell death.

  18. Disruption of the Transcription Factor Nrf2 Promotes Pro-Oxidative Dendritic Cells That Stimulate Th2-Like Immunoresponsiveness upon Activation by Ambient Particulate Matter

    PubMed Central

    Williams, Marc A.; Rangasamy, Tirumalai; Bauer, Stephen M.; Killedar, Smruti; Karp, Matthew; Kensler, Thomas W.; Yamamoto, Masayuki; Breysse, Patrick; Biswal, Shyam; Georas, Steve N.

    2011-01-01

    Oxidative stress is important in dendritic cell (DC) activation. Environmental particulate matter (PM) directs pro-oxidant activities that may alter DC function. Nuclear erythroid 2 p45-related factor 2 (Nrf2) is a redox-sensitive transcription factor that regulates expression of antioxidant and detoxification genes. Oxidative stress and defective antioxidant responses may contribute to the exacerbations of asthma. We hypothesized that PM would impart differential responses by Nrf2 wild-type DCs as compared with Nrf2−/− DCs. We found that the deletion of Nrf2 affected important constitutive functions of both bone marrow-derived and highly purified myeloid lung DCs such as the secretion of inflammatory cytokines and their ability to take up exogenous Ag. Stimulation of Nrf2−/− DCs with PM augmented oxidative stress and cytokine production as compared with resting or Nrf2+/+ DCs. This was associated with the enhanced induction of Nrf2-regulated antioxidant genes. In contrast to Nrf2+/+ DCs, coincubation of Nrf2−/− DCs with PM and the antioxidant N-acetyl cysteine attenuated PM-induced up-regulation of CD80 and CD86. Our studies indicate a previously underappreciated role of Nrf2 in innate immunity and suggest that deficiency in Nrf2-dependent pathways may be involved in susceptibility to the adverse health effects of air pollution in part by promoting Th2 cytokine responses in the absence of functional Nrf2. Moreover, our studies have uncovered a hierarchal response to oxidative stress in terms of costimulatory molecule expression and cytokine secretion in DCs and suggest an important role of heightened oxidative stress in proallergic Th2-mediated immune responses orchestrated by DCs. PMID:18802057

  19. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    PubMed

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  20. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    PubMed

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet. PMID:26735303

  1. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae)

    PubMed Central

    Liu, Di; Irwin, David M.; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet. PMID:26735303

  2. Nrf2-Mediated Cardiac Maladaptive Remodeling and Dysfunction in a Setting of Autophagy Insufficiency.

    PubMed

    Qin, Qingyun; Qu, Chen; Niu, Ting; Zang, Huimei; Qi, Lei; Lyu, Linmao; Wang, Xuejun; Nagarkatti, Mitzi; Nagarkatti, Prakash; Janicki, Joseph S; Wang, Xing Li; Cui, Taixing

    2016-01-01

    Nuclear factor erythroid-2-related factor 2 (Nrf2) appears to exert either a protective or detrimental effect on the heart; however, the underlying mechanism remains poorly understood. Herein, we uncovered a novel mechanism for turning off the Nrf2-mediated cardioprotection and switching on Nrf2-mediated cardiac dysfunction. In a murine model of pressure overload-induced cardiac remodeling and dysfunction via transverse aortic arch constriction, knockout of Nrf2 enhanced myocardial necrosis and death rate during an initial stage of cardiac adaptation when myocardial autophagy function is intact. However, knockout of Nrf2 turned out to be cardioprotective throughout the later stage of cardiac maladaptive remodeling when myocardial autophagy function became insufficient. Transverse aortic arch constriction -induced activation of Nrf2 was dramatically enhanced in the heart with impaired autophagy, which is induced by cardiomyocyte-specific knockout of autophagy-related gene (Atg)5. Notably, Nrf2 activation coincided with the upregulation of angiotensinogen (Agt) only in the autophagy-impaired heart after transverse aortic arch constriction. Agt5 and Nrf2 gene loss-of-function approaches in combination with Jak2 and Fyn kinase inhibitors revealed that suppression of autophagy inactivated Jak2 and Fyn and nuclear translocation of Fyn, while enhancing nuclear translocation of Nrf2 and Nrf2-driven Agt expression in cardiomyocytes. Taken together, these results indicate that the pathophysiological consequences of Nrf2 activation are closely linked with the functional integrity of myocardial autophagy during cardiac remodeling. When autophagy is intact, Nrf2 is required for cardiac adaptive responses; however, autophagy impairment most likely turns off Fyn-operated Nrf2 nuclear export thus activating Nrf2-driven Agt transcription, which exacerbates cardiac maladaptation leading to dysfunction. PMID:26573705

  3. Association of Nrf2 Polymorphism Haplotypes with Acute Lung Injury Phenotypes in Inbred Strains of Mice

    PubMed Central

    Jedlicka, Anne E.; Gladwell, Wesley; Marzec, Jacqui; McCaw, Zackary R.; Bienstock, Rachelle J.; Kleeberger, Steven R.

    2015-01-01

    Abstract Aims: Nrf2 is a master transcription factor for antioxidant response element (ARE)-mediated cytoprotective gene induction. A protective role for pulmonary Nrf2 was determined in model oxidative disorders, including hyperoxia-induced acute lung injury (ALI). To obtain additional insights into the function and genetic regulation of Nrf2, we assessed functional single nucleotide polymorphisms (SNPs) of Nrf2 in inbred mouse strains and tested whether sequence variation is associated with hyperoxia susceptibility. Results: Nrf2 SNPs were compiled from publicly available databases and by re-sequencing DNA from inbred strains. Hierarchical clustering of Nrf2 SNPs categorized the strains into three major haplotypes. Hyperoxia susceptibility was greater in haplotypes 2 and 3 strains than in haplotype 1 strains. A promoter SNP −103 T/C adding an Sp1 binding site in haplotype 2 diminished promoter activation basally and under hyperoxia. Haplotype 3 mice bearing nonsynonymous coding SNPs located in (1862 A/T, His543Gln) and adjacent to (1417 T/C, Thr395Ile) the Neh1 domain showed suppressed nuclear transactivation of pulmonary Nrf2 relative to other strains, and overexpression of haplotype 3 Nrf2 showed lower ARE responsiveness than overexpression of haplotype 1 Nrf2 in airway cells. Importantly, we found a significant correlation of Nrf2 haplotypes and hyperoxic lung injury phenotypes. Innovation and Conclusion: The results indicate significant influence of Nrf2 polymorphisms and haplotypes on gene function and hyperoxia susceptibility. Our findings further support Nrf2 as a genetic determinant in ALI pathogenesis and provide useful tools for investigators who use mouse strains classified by Nrf2 haplotypes to elucidate the role for Nrf2 in oxidative disorders. Antioxid. Redox Signal. 22, 325–338. PMID:25268541

  4. Activation of nuclear factor E2-related factor 2 in hereditary tyrosinemia type 1 and its role in survival and tumor development.

    PubMed

    Marhenke, Silke; Lamlé, Jutta; Buitrago-Molina, Laura Elisa; Cañón, José Manuel Fernández; Geffers, Robert; Finegold, Milton; Sporn, Michael; Yamamoto, Masayuki; Manns, Michael P; Grompe, Markus; Vogel, Arndt

    2008-08-01

    In tyrosinemia type 1 (HT1), accumulation of toxic metabolites results in oxidative stress and DNA damage, leading to a high incidence of hepatocellular carcinomas. Nuclear factor erythroid-2 related factor 2 (Nrf2) is a key transcription factor important for cellular protection against oxidative stress and chemical induced liver damage. To specifically address the role of Nrf2 in HT1, fumarylacetoacetate hydrolase (Fah)/Nrf2(-/-) mice were generated. In acute HT1, loss of Nrf2 elicited a strong inflammatory response and dramatically increased the mortality of mice. Following low grade injury, Fah/Nrf2(-/-) mice develop a more severe hepatitis and liver fibrosis. The glutathione and cellular detoxification system was significantly impaired in Fah/Nrf2(-/-) mice, resulting in increased oxidative stress and DNA damage. Consequently, tumor development was significantly accelerated by loss of Nrf2. Potent pharmacological inducers of Nrf2 such as the triterpenoid analogs 1[2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oyl]imidazole have been developed as cancer chemoprevention agents. Pretreatment with 1[2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oyl]imidazole dramatically protected Fah(-/-) mice against fumarylacetoacetate (Faa)-induced toxicity. Our data establish a central role for Nrf2 in the protection against Faa-induced liver injury; the Nrf2 regulated cellular defense not only prevents acute Faa-induced liver failure but also delays hepatocarcinogenesis in HT1.

  5. NRF2 and cancer: the good, the bad and the importance of context

    PubMed Central

    Sporn, Michael B.; Liby, Karen T.

    2013-01-01

    Many studies of chemopreventive drugs have suggested that their beneficial effects on suppression of carcinogenesis and many other chronic diseases are mediated through activation of the transcription factor NFE2- related factor 2 (NRF2). More recently, genetic analyses of human tumours have indicated that NRF2 may conversely be oncogenic and cause resistance to chemotherapy. It is therefore controversial whether the activation, or alternatively the inhibition, of NRF2 is a useful strategy for the prevention or treatment of cancer. This Opinion article aims to rationalize these conflicting perspectives by critiquing the context dependence of NRF2 functions and the experimental methods behind these conflicting data. PMID:22810811

  6. NRF2 activation by antioxidant antidiabetic agents accelerates tumor metastasis.

    PubMed

    Wang, Hui; Liu, Xiufei; Long, Min; Huang, Yi; Zhang, Linlin; Zhang, Rui; Zheng, Yi; Liao, Xiaoyu; Wang, Yuren; Liao, Qian; Li, Wenjie; Tang, Zili; Tong, Qiang; Wang, Xiaocui; Fang, Fang; Rojo de la Vega, Montserrat; Ouyang, Qin; Zhang, Donna D; Yu, Shicang; Zheng, Hongting

    2016-04-13

    Cancer is a common comorbidity of diabetic patients; however, little is known about the effects that antidiabetic drugs have on tumors. We discovered that common classes of drugs used in type 2 diabetes mellitus, the hypoglycemic dipeptidyl peptidase-4 inhibitors (DPP-4i) saxagliptin and sitagliptin, as well as the antineuropathic α-lipoic acid (ALA), do not increase tumor incidence but increase the risk of metastasis of existing tumors. Specifically, these drugs induce prolonged activation of the nuclear factor E2-related factor 2 (NRF2)-mediated antioxidant response through inhibition of KEAP1-C151-dependent ubiquitination and subsequent degradation of NRF2, resulting in up-regulated expression of metastasis-associated proteins, increased cancer cell migration, and promotion of metastasis in xenograft mouse models. Accordingly, knockdown of NRF2 attenuated naturally occurring and DPP-4i-induced tumor metastasis, whereas NRF2 activation accelerated metastasis. Furthermore, in human liver cancer tissue samples, increased NRF2 expression correlated with metastasis. Our findings suggest that antioxidants that activate NRF2 signaling may need to be administered with caution in cancer patients, such as diabetic patients with cancer. Moreover, NRF2 may be a potential biomarker and therapeutic target for tumor metastasis. PMID:27075625

  7. NRF2-regulation in brain health and disease: implication of cerebral inflammation

    PubMed Central

    Sandberg, Mats; Patil, Jaspal; D’Angelo, Barbara; Weber, Stephen G; Mallard, Carina

    2014-01-01

    The nuclear factor erythroid 2 related factor 2 (NRF2) is a key regulator of endogenous inducible defense systems in the body. Under physiological conditions NRF2 is mainly located in the cytoplasm. However, in response to oxidative stress, NRF2 translocates to the nucleus and binds to specific DNA sites termed “anti-oxidant response elements” or “electrophile response elements” to initiate transcription of cytoprotective genes. Acute oxidative stress to the brain, such as stroke and traumatic brain injury is increased in animals that are deficient in NRF2. Insufficient NRF2 activation in humans has been linked to chronic diseases such as Parkinson’s disease, Alzheimer’s disease and amyotrophic lateral sclerosis. New findings have also linked activation of the NRF2 system to anti-inflammatory effects via interactions with NF-κB. Here we review literature on cellular mechanisms of NRF2 regulation, how to maintain and restore NRF2 function and the relationship between NRF2 regulation and brain damage. We bring forward the hypothesis that inflammation via prolonged activation of key kinases (p38 and GSK-3β) and activation of histone deacetylases gives rise to dysregulation of the NRF2 system in the brain, which contributes to oxidative stress and injury. PMID:24262633

  8. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    PubMed Central

    Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2012-01-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of Type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs3+) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs3+ exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs3+ and monomethylarsonous acid (MMA3+)-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs3+-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N-acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs3+. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. PMID:23000044

  9. [Nrf2 as a chemoprevention target in gastrointestinal carcinoma].

    PubMed

    Gao, Peng; Tang, Xiu-wen; Wang, Xiu-jun

    2012-07-01

    Gastrointestinal tract carcinoma is one of the leading causes of cancer-related death in China. Chemoprevention has been considered as a potential approach to control this type of disease. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that protects cells from oxidative/electrophilic stresses by activating the expression of a battery of cytoprotective genes through the antioxidant response element (ARE). Recently, Nrf2 has emerged as a novel target for chemoprevention. Several natural or synthetic chemicals, which activate Nrf2/ARE signaling pathway, have showed effect in animal models, and promises in many ongoing clinical trials. This review summarizes the recent findings on the regulation of Nrf2/ARE signaling pathway, and the developments in both preclinical and clinical studies.

  10. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    SciTech Connect

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H.; Mattson, Mark P.; Camandola, Simonetta

    2013-04-19

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity.

  11. Activation of Nrf2 by dimethyl fumarate improves vascular calcification.

    PubMed

    Ha, Chae-Myeong; Park, Sungmi; Choi, Young-Keun; Jeong, Ji-Yun; Oh, Chang Joo; Bae, Kwi-Hyun; Lee, Sun Joo; Kim, Ji-Hyun; Park, Keun-Gyu; Jun, Do Youn; Lee, In-Kyu

    2014-10-01

    Dimethyl fumarate (DMF) has several pharmacological benefits including immunomodulation and prevention of fibrosis, which are dependent on the NF-E2-related factor 2 (Nrf2) antioxidant pathways. Therefore, we hypothesized that DMF could attenuate vascular calcification via Nrf2 activation. Vascular calcification induced by hyperphosphataemia was significantly inhibited by DMF in vascular smooth muscle cells (VSMCs) in a dose-dependent manner. DMF-mediated Nrf2 upregulation was accompanied by the reduced expressions of genes related with osteoblast-like phenotype based on promoter activity, mRNA and protein expression, and von Kossa staining. Likewise, Nrf2 overexpression significantly decreased the formation of calcium deposit similar to the level of osteogenic staining in VSMCs, and DMF with Nrf2 knockdown failed to attenuate hyperphosphatemia induced vascular calcification. Furthermore, DMF significantly attenuated the calcification of ex vivo ring culture from both rat common carotid artery and mouse thoracic aorta as well as in vivo mouse model of Vitamin D3-induced calcification consistent with the increased Nrf2 protein levels in early stage of calcification by DMF. In conclusion, our data support that DMF stimulates Nrf2 activity to attenuate hyperphosphatamia in vitro or Vitamin D3-induced in vivo vascular calcification, which would be a beneficial effect on vascular diseases induced by oxidative stress such as vascular calcification. PMID:25135648

  12. Nrf2 and Redox Status in Prediabetic and Diabetic Patients

    PubMed Central

    Jiménez-Osorio, Angélica S.; Picazo, Alejandra; González-Reyes, Susana; Barrera-Oviedo, Diana; Rodríguez-Arellano, Martha E.; Pedraza-Chaverri, José

    2014-01-01

    The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2) was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS) in plasma and erythrocytes, glutathione (GSH) and malondialdehyde (MDA) content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC). Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients. PMID:25383674

  13. Oxidative stress and dysfunctional NRF2 underlie pachyonychia congenita phenotypes

    PubMed Central

    Kerns, Michelle L.; Hakim, Jill M.C.; Lu, Rosemary G.; Guo, Yajuan; Berroth, Andreas; Kaspar, Roger L.

    2016-01-01

    Palmoplantar keratoderma (PPK) are debilitating lesions that arise in individuals with pachyonychia congenita (PC) and feature upregulation of danger-associated molecular patterns and skin barrier regulators. The defining features of PC-associated PPK are reproduced in mice null for keratin 16 (Krt16), which is commonly mutated in PC patients. Here, we have shown that PPK onset is preceded by oxidative stress in footpad skin of Krt16–/– mice and correlates with an inability of keratinocytes to sustain nuclear factor erythroid–derived 2 related factor 2–dependent (NRF2-dependent) synthesis of the cellular antioxidant glutathione (GSH). Additionally, examination of plantar skin biopsies from individuals with PC confirmed the presence of high levels of hypophosphorylated NRF2 in lesional tissue. In Krt16–/– mice, genetic ablation of Nrf2 worsened spontaneous skin lesions and accelerated PPK development in footpad skin. Hypoactivity of NRF2 in Krt16–/– footpad skin correlated with decreased levels or activity of upstream NRF2 activators, including PKCδ, receptor for activated C kinase 1 (RACK1), and p21. Topical application of the NRF2 activator sulforaphane to the footpad of Krt16–/– mice prevented the development of PPK and normalized redox balance via regeneration of GSH from existing cellular pools. Together, these findings point to oxidative stress and dysfunctional NRF2 as contributors to PPK pathogenesis, identify K16 as a regulator of NRF2 activation, and suggest that pharmacological activation of NRF2 should be further explored for PC treatment. PMID:27183391

  14. Frequency Modulated Translocational Oscillations of Nrf2 Mediate the Antioxidant Response Element Cytoprotective Transcriptional Response

    PubMed Central

    Xue, Mingzhan; Momiji, Hiroshi; Rabbani, Naila; Barker, Guy; Bretschneider, Till; Shmygol, Anatoly; Rand, David A.

    2015-01-01

    Abstract Aims: Stress responsive signaling coordinated by nuclear factor erythroid 2-related factor 2 (Nrf2) provides an adaptive response for protection of cells against toxic insults, oxidative stress and metabolic dysfunction. Nrf2 regulates a battery of protective genes by binding to regulatory antioxidant response elements (AREs). The aim of this study was to examine how Nrf2 signals cell stress status and regulates transcription to maintain homeostasis. Results: In live cell microscopy we observed that Nrf2 undergoes autonomous translocational frequency-modulated oscillations between cytoplasm and nucleus. Oscillations occurred in quiescence and when cells were stimulated at physiological levels of activators, they decrease in period and amplitude and then evoke a cytoprotective transcriptional response. We propose a mechanism whereby oscillations are produced by negative feedback involving successive de-phosphorylation and phosphorylation steps. Nrf2 was inactivated in the nucleus and reactivated on return to the cytoplasm. Increased frequency of Nrf2 on return to the cytoplasm with increased reactivation or refresh-rate under stress conditions activated the transcriptional response mediating cytoprotective effects. The serine/threonine-protein phosphatase PGAM5, member of the Nrf2 interactome, was a key regulatory component. Innovation: We found that Nrf2 is activated in cells without change in total cellular Nrf2 protein concentration. Regulation of ARE-linked protective gene transcription occurs rather through translocational oscillations of Nrf2. We discovered cytoplasmic refresh rate of Nrf2 is important in maintaining and regulating the transcriptional response and links stress challenge to increased cytoplasmic surveillance. We found silencing and inhibition of PGAM5 provides potent activation of Nrf2. Conclusion: Frequency modulated translocational oscillations of Nrf2 mediate the ARE-linked cytoprotective transcriptional response. Antioxid. Redox

  15. The Effects of Sequence Variation on Genome-wide NRF2 Binding—New Target Genes and Regulatory SNPs

    PubMed Central

    Kuosmanen, Suvi M.; Viitala, Sari; Laitinen, Tuomo; Peräkylä, Mikael; Pölönen, Petri; Kansanen, Emilia; Leinonen, Hanna; Raju, Suresh; Wienecke-Baldacchino, Anke; Närvänen, Ale; Poso, Antti; Heinäniemi, Merja; Heikkinen, Sami; Levonen, Anna-Liisa

    2016-01-01

    Transcription factor binding specificity is crucial for proper target gene regulation. Motif discovery algorithms identify the main features of the binding patterns, but the accuracy on the lower affinity sites is often poor. Nuclear factor E2-related factor 2 (NRF2) is a ubiquitous redox-activated transcription factor having a key protective role against endogenous and exogenous oxidant and electrophile stress. Herein, we decipher the effects of sequence variation on the DNA binding sequence of NRF2, in order to identify both genome-wide binding sites for NRF2 and disease-associated regulatory SNPs (rSNPs) with drastic effects on NRF2 binding. Interactions between NRF2 and DNA were studied using molecular modelling, and NRF2 chromatin immunoprecipitation-sequence datasets together with protein binding microarray measurements were utilized to study binding sequence variation in detail. The binding model thus generated was used to identify genome-wide binding sites for NRF2, and genomic binding sites with rSNPs that have strong effects on NRF2 binding and reside on active regulatory elements in human cells. As a proof of concept, miR-126–3p and -5p were identified as NRF2 target microRNAs, and a rSNP (rs113067944) residing on NRF2 target gene (Ferritin, light polypeptide, FTL) promoter was experimentally verified to decrease NRF2 binding and result in decreased transcriptional activity. PMID:26826707

  16. Nrf2-Mediated Regulation of Skeletal Muscle Glycogen Metabolism.

    PubMed

    Uruno, Akira; Yagishita, Yoko; Katsuoka, Fumiki; Kitajima, Yasuo; Nunomiya, Aki; Nagatomi, Ryoichi; Pi, Jingbo; Biswal, Shyam S; Yamamoto, Masayuki

    2016-06-01

    Nrf2 (NF-E2-related factor 2) contributes to the maintenance of glucose homeostasis in vivo Nrf2 suppresses blood glucose levels by protecting pancreatic β cells from oxidative stress and improving peripheral tissue glucose utilization. To elucidate the molecular mechanisms by which Nrf2 contributes to the maintenance of glucose homeostasis, we generated skeletal muscle (SkM)-specific Keap1 knockout (Keap1MuKO) mice that express abundant Nrf2 in their SkM and then examined Nrf2 target gene expression in that tissue. In Keap1MuKO mice, blood glucose levels were significantly downregulated and the levels of the glycogen branching enzyme (Gbe1) and muscle-type PhKα subunit (Phka1) mRNAs, along with those of the glycogen branching enzyme (GBE) and the phosphorylase b kinase α subunit (PhKα) protein, were significantly upregulated in mouse SkM. Consistent with this result, chemical Nrf2 inducers promoted Gbe1 and Phka1 mRNA expression in both mouse SkM and C2C12 myotubes. Chromatin immunoprecipitation analysis demonstrated that Nrf2 binds the Gbe1 and Phka1 upstream promoter regions. In Keap1MuKO mice, muscle glycogen content was strongly reduced and forced GBE expression in C2C12 myotubes promoted glucose uptake. Therefore, our results demonstrate that Nrf2 induction in SkM increases GBE and PhKα expression and reduces muscle glycogen content, resulting in improved glucose tolerance. Our results also indicate that Nrf2 differentially regulates glycogen metabolism in SkM and the liver. PMID:27044864

  17. Transcription factor Nrf2 mediates an adaptive response to sulforaphane that protects fibroblasts in vitro against the cytotoxic effects of electrophiles, peroxides and redox-cycling agents

    SciTech Connect

    Higgins, Larry G.; Kelleher, Michael O.; Eggleston, Ian M.; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.

    2009-06-15

    Sulforaphane can stimulate cellular adaptation to redox stressors through transcription factor Nrf2. Using mouse embryonic fibroblasts (MEFs) as a model, we show herein that the normal homeostatic level of glutathione in Nrf2{sup -/-} MEFs was only 20% of that in their wild-type counterparts. Furthermore, the rate of glutathione synthesis following its acute depletion upon treatment with 3 {mu}mol/l sulforaphane was very substantially lower in Nrf2{sup -/-} MEFs than in wild-type cells, and the rebound leading to a {approx} 1.9-fold increase in glutathione that occurred 12-24 h after Nrf2{sup +/+} MEFs were treated with sulforaphane was not observed in Nrf2{sup -/-} fibroblasts. Wild-type MEFs that had been pre-treated for 24 h with 3 {mu}mol/l sulforaphane exhibited between 1.4- and 3.2-fold resistance against thiol-reactive electrophiles, including isothiocyanates, {alpha},{beta}-unsaturated carbonyl compounds (e.g. acrolein), aryl halides and alkene epoxides. Pre-treatment of Nrf2{sup +/+} MEFs with sulforaphane also protected against hydroperoxides (e.g. cumene hydroperoxide, CuOOH), free radical-generating compounds (e.g. menadione), and genotoxic electrophiles (e.g. chlorambucil). By contrast, Nrf2{sup -/-} MEFs were typically {approx} 50% less tolerant of these agents than wild-type fibroblasts, and sulforaphane pre-treatment did not protect the mutant cells against xenobiotics. To test whether Nrf2-mediated up-regulation of glutathione represents the major cytoprotective mechanism stimulated by sulforaphane, 5 {mu}mol/l buthionine sulfoximine (BSO) was used to inhibit glutathione synthesis. In Nrf2{sup +/+} MEFs pre-treated with sulforaphane, BSO diminished intrinsic resistance and abolished inducible resistance to acrolein, CuOOH and chlorambucil, but not menadione. Thus Nrf2-dependent up-regulation of GSH is the principal mechanism by which sulforaphane pre-treatment induced resistance to acrolein, CuOOH and chlorambucil, but not menadione.

  18. Transcription factor NFE2L2/NRF2 is a regulator of macroautophagy genes

    PubMed Central

    Pajares, Marta; Jiménez-Moreno, Natalia; García-Yagüe, Ángel J.; Escoll, Maribel; de Ceballos, María L.; Van Leuven, Fred; Rábano, Alberto; Yamamoto, Masayuki; Rojo, Ana I.; Cuadrado, Antonio

    2016-01-01

    ABSTRACT Autophagy is a highly coordinated process that is controlled at several levels including transcriptional regulation. Here, we identify the transcription factor NFE2L2/NRF2 (nuclear factor, erythroid 2 like 2) as a regulator of autophagy gene expression and its relevance in a mouse model of Alzheimer disease (AD) that reproduces impaired APP (amyloid β precursor protein) and human (Hs)MAPT/TAU processing, clearance and aggregation. We screened the chromatin immunoprecipitation database ENCODE for 2 proteins, MAFK and BACH1, that bind the NFE2L2-regulated enhancer antioxidant response element (ARE). Using a script generated from the JASPAR's consensus ARE sequence, we identified 27 putative AREs in 16 autophagy-related genes. Twelve of these sequences were validated as NFE2L2 regulated AREs in 9 autophagy genes by additional ChIP assays and quantitative RT-PCR on human and mouse cells after NFE2L2 activation with sulforaphane. Mouse embryo fibroblasts of nfe2l2-knockout mice exhibited reduced expression of autophagy genes, which was rescued by an NFE2L2 expressing lentivirus, and impaired autophagy flux when exposed to hydrogen peroxide. NFE2L2-deficient mice co-expressing HsAPPV717I and HsMAPTP301L, exhibited more intracellular aggregates of these proteins and reduced neuronal levels of SQSTM1/p62, CALCOCO2/NDP52, ULK1, ATG5 and GABARAPL1. Also, colocalization of HsAPPV717I and HsMAPTP301L with the NFE2L2-regulated autophagy marker SQSTM1/p62 was reduced in the absence of NFE2L2. In AD patients, neurons expressing high levels of APP or MAPT also expressed SQSTM1/p62 and nuclear NFE2L2, suggesting their attempt to degrade intraneuronal aggregates through autophagy. This study shows that NFE2L2 modulates autophagy gene expression and suggests a new strategy to combat proteinopathies. PMID:27427974

  19. Nrf2 is essential for timely M phase entry of replicating hepatocytes during liver regeneration.

    PubMed

    Zou, Yuhong; Hu, Min; Lee, Joonyong; Nambiar, Shashank Manohar; Garcia, Veronica; Bao, Qi; Chan, Jefferson Y; Dai, Guoli

    2015-02-15

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) regulates various cellular activities, including redox balance, detoxification, metabolism, autophagy, proliferation, and apoptosis. Several studies have demonstrated that Nrf2 regulates hepatocyte proliferation during liver regeneration. The aim of this study was to investigate how Nrf2 modulates the cell cycle of replicating hepatocytes in regenerating livers. Wild-type and Nrf2 null mice were subjected to 2/3 partial hepatectomy (PH) and killed at multiple time points for various analyses. Nrf2 null mice exhibited delayed liver regrowth, although the lost liver mass was eventually restored 7 days after PH. Nrf2 deficiency did not affect the number of hepatocytes entering the cell cycle but did delay hepatocyte mitosis. Mechanistically, the lack of Nrf2 resulted in increased mRNA and protein levels of hepatic cyclin A2 when the remaining hepatocytes were replicating in response to PH. Moreover, Nrf2 deficiency in regenerating livers caused dysregulation of Wee1, Cdc2, and cyclin B1 mRNA and protein expression, leading to decreased Cdc2 activity. Thus, Nrf2 is required for timely M phase entry of replicating hepatocytes by ensuring proper regulation of cyclin A2 and the Wee1/Cdc2/cyclin B1 pathway during liver regeneration.

  20. Astrocyte-Specific Overexpression of Nrf2 Protects Striatal Neurons from Mitochondrial Complex II Inhibition

    PubMed Central

    Calkins, Marcus J.; Vargas, Marcelo R.; Johnson, Delinda A.; Johnson, Jeffrey A.

    2010-01-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that is known to regulate a variety of cytoprotective genes through the antioxidant response element (ARE). This endogenous response is one of the major pathways by which cells are protected from xenobiotic or innate oxidative insults. Furthermore, in neural systems, astrocyte-specific activation of Nrf2 is known to protect neurons. In previous work, our laboratory found that Nrf2 protects from intrastriatal injections of the mitochondrial complex II inhibitor malonate. Here, we extend these results to show that multiple methods of astrocyte-specific Nrf2 overexpression provide protection from neurotoxicity in vivo. GFAP-Nrf2 transgenic mice are significantly more resistant to malonate lesioning. This outcome is associated with an increased basal resistance, but more so, an enhanced Nrf2 response to lesioning that attenuated the ensuing neurotoxicity. Furthermore, striatal transplantation of neuroprogenitor cells overexpressing Nrf2 that differentiate into astrocytes after grafting also significantly reduced malonate toxicity. Overall, these data establish that enhanced astrocytic Nrf2 response and Nrf2 preconditioning are both sufficient to protect from acute lesions from mitochondrial complex II inhibition. PMID:20211941

  1. Nrf2 as a Chemopreventive Target in Colorectal Cancer

    PubMed Central

    Saw, Constance Lay Lay; Kong, Tony Ah-Ng

    2012-01-01

    Introduction Numerous epidemiological studies have linked consumption of cruciferous vegetables to a reduced risk of colorectal cancer (CRC) in individuals. It is currently well accepted that chronic inflammation is a contributing factor in 15-20% malignancies including CRC. Many chemopreventive compounds are effective in preclinical systems and many on-going clinical trials are showing promising findings. Many of these compounds could activate the antioxidant responsive element (ARE), a critical regulatory element for phase II protective/detoxification and anti-oxidative stress enzymes mediated by nuclear factor-erythroid 2-related factor 2 (Nrf2). Recently, Nrf2 has emerged as a novel target for the prevention of CRC. Areas covered A full literature search was performed using PubMed with the key words ‘ARE, Nrf2, colon, colorectal cancer, chemoprevention, cancer prevention’, and all relevant publications are included. Expert opinion The use of Nrf2 knockout mice has provided key insights into the toxicological and chemopreventive importance of this pathway. Mounting evidence has revealed that Nrf2 is a critical regulator of inflammation as well, a major driving force for CRC progression and formation. Targeting the Nrf2/ARE pathway may present a novel therapeutic approach for the treatment of not only colorectal inflammatory diseases but the frequent subsequent development of CRC as well. PMID:21261563

  2. 6-OHDA-induced apoptosis and mitochondrial dysfunction are mediated by early modulation of intracellular signals and interaction of Nrf2 and NF-κB factors.

    PubMed

    Tobón-Velasco, Julio C; Limón-Pacheco, Jorge H; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F; Cuadrado, Antonio; Pedraza-Chaverrí, José; Santamaría, Abel

    2013-02-01

    6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage.

  3. Induction of Mrp3 and Mrp4 transporters during acetaminophen hepatotoxicity is dependent on Nrf2

    SciTech Connect

    Aleksunes, Lauren M. Slitt, Angela L. Maher, Jonathan M. Augustine, Lisa M. Goedken, Michael J. Chan, Jefferson Y. Cherrington, Nathan J. Klaassen, Curtis D. Manautou, Jose E.

    2008-01-01

    The transcription factor NFE2-related factor 2 (Nrf2) mediates detoxification and antioxidant gene transcription following electrophile exposure and oxidative stress. Mice deficient in Nrf2 (Nrf2-null) are highly susceptible to acetaminophen (APAP) hepatotoxicity and exhibit lower basal and inducible expression of cytoprotective genes, including NADPH quinone oxidoreductase 1 (Nqo1) and glutamate cysteine ligase (catalytic subunit, or Gclc). Administration of toxic APAP doses to C57BL/6J mice generates electrophilic stress and subsequently increases levels of hepatic Nqo1, Gclc and the efflux multidrug resistance-associated protein transporters 1-4 (Mrp1-4). It was hypothesized that induction of hepatic Mrp1-4 expression following APAP is Nrf2 dependent. Plasma and livers from wild-type (WT) and Nrf2-null mice were collected 4, 24 and 48 h after APAP. As expected, hepatotoxicity was greater in Nrf2-null compared to WT mice. Gene and protein expression of Mrp1-4 and the Nrf2 targets, Nqo1 and Gclc, was measured. Induction of Nqo1 and Gclc mRNA and protein after APAP was dependent on Nrf2 expression. Similarly, APAP treatment increased hepatic Mrp3 and Mrp4 mRNA and protein in WT, but not Nrf2-null mice. Mrp1 was induced in both genotypes after APAP, suggesting that elevated expression of this transporter was independent of Nrf2. Mrp2 was not induced in either genotype at the mRNA or protein levels. These results show that Nrf2 mediates induction of Mrp3 and Mrp4 after APAP but does not affect Mrp1 or Mrp2. Thus coordinated regulation of detoxification enzymes and transporters by Nrf2 during APAP hepatotoxicity is a mechanism by which hepatocytes may limit intracellular accumulation of potentially toxic chemicals.

  4. Nrf2 Expressions Correlate with WHO Grades in Gliomas and Meningiomas

    PubMed Central

    Tsai, Wen-Chiuan; Hueng, Dueng-Yuan; Lin, Chii-Ruey; Yang, Thomas C. K.; Gao, Hong-Wei

    2016-01-01

    Background: Nuclear factor erythroid 2-related factor 2 (NFE2L2, also known as Nrf2) is associated with cellular progression and chemotherapeutic resistance in some human cancers. We tested the relationship between Nrf2 expression and survival of patients with primary brain tumors (PBTs). Methods: In order to realize Nrf2 protein expression in gliomas, Western blot analysis was performed in normal brain tissue and U87MG, LN229, GBM8401 and U118MG glioma cell lines protein lysates. Then, U87MG, LN229, and GBM8401 mRNA were applied to performed quantitative RT-PCR for detect Nrf2 gene expression in glioma cell lines. At last, immunohistochemical analysis was used to determine the expression of Nrf2 in samples from 178 PBTs and 10 non-neoplastic brain tissues. Results: In these included in vitro studies, both Nrf2 protein and mRNA expression in all human glioma cell lines were higher than normal brain tissue. Similarly, on the viewpoint of immunohistochemistry, Nrf2 expression in gliomas were positively correlated with World Health Organization (WHO) grades. Additionally, compared with the expression of Nrf2 in non-neoplastic brain tissue, expression in meningiomas was of a stronger intensity and was present in a higher percentage of cells. Furthermore, scores were significantly higher in WHO grade II than in WHO grade I meningiomas. Finally, overall survival tended to be shorter in patients whose PBTs had higher expression of Nrf2, although the correlation was not statistically significant. Conclusions: Nrf2 overexpression positively correlated with WHO grade in gliomas and meningiomas. On the other hand, Nrf2 immunohistochemical stain could help pathologists to differentiate atypical meningiomas from benign tumors. Therefore, Nrf2 expression may be a useful biomarker to predict WHO grade and cellular behavior of PBTs. PMID:27187376

  5. Nrf2 promotes neuronal cell differentiation

    PubMed Central

    Zhao, Fei; Wu, Tongde; Lau, Alexandria; Jiang, Tao; Huang, Zheping; Wang, Xiao-Jun; Chen, Weimin; Wong, Pak Kin; Zhang, Donna D.

    2009-01-01

    The transcription factor Nrf2 has emerged as a master regulator for the endogenous antioxidant response, which is critical in defending cells against environmental insults and in maintaining intracellular redox balance. However, whether Nrf2 has any role in neuronal cell differentiation is largely unknown. In this report, we have examined the effects of Nrf2 on cell differentiation using a neuroblastoma cell line, SH-SY5Y. Retinoic acid (RA) and 12-O-tetradecanoylphorbol-13-acetate (TPA), two well-studied inducers for neuronal differentiation, are able to induce Nrf2 and its target gene NAD(P)H quinone oxidoreductase 1 (NQO1) in a dose- and time- dependent manner. RA-induced Nrf2 up-regulation is accompanied by neurite outgrowth and an induction of two neuronal differentiation markers, neurofilament-M (NF-M) and microtubule-associated protein 2 (MAP-2). Overexpression of Nrf2 in SH-SY5Y cells promotes neuronal differentiation whereas inhibition of endogenous Nrf2 expression inhibited neuronal differentiation. More remarkably, the positive role of Nrf2 in neuronal differentiation was verified ex vivo in primary neuron culture. Primary neurons isolated from Nrf2-null mice showed a retarded progress in differentiation, compared to that from wild-type mice. Collectively, our data demonstrate a novel role for Nrf2 in promoting neuronal cell differentiation, which will open new perspectives for therapeutic uses of Nrf2 activators in patients with neurodegenerative diseases. PMID:19573594

  6. Systemic administration of the apocarotenoid bixin protects skin against solar UV-induced damage through activation of NRF2.

    PubMed

    Tao, Shasha; Park, Sophia L; Rojo de la Vega, Montserrat; Zhang, Donna D; Wondrak, Georg T

    2015-12-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photodamage and carcinogenesis, and an urgent need exists for improved molecular photoprotective strategies different from (or synergistic with) photon absorption. Recent studies suggest a photoprotective role of cutaneous gene expression orchestrated by the transcription factor NRF2 (nuclear factor-E2-related factor 2). Here we have explored the molecular mechanism underlying carotenoid-based systemic skin photoprotection in SKH-1 mice and provide genetic evidence that photoprotection achieved by the FDA-approved apocarotenoid and food additive bixin depends on NRF2 activation. Bixin activates NRF2 through the critical Cys-151 sensor residue in KEAP1, orchestrating a broad cytoprotective response in cultured human keratinocytes as revealed by antioxidant gene expression array analysis. Following dose optimization studies for cutaneous NRF2 activation by systemic administration of bixin, feasibility of bixin-based suppression of acute cutaneous photodamage from solar UV exposure was investigated in Nrf2(+/+) versus Nrf2(-/-) SKH-1 mice. Systemic administration of bixin suppressed skin photodamage, attenuating epidermal oxidative DNA damage and inflammatory responses in Nrf2(+/+) but not in Nrf2(-/-) mice, confirming the NRF2-dependence of bixin-based cytoprotection. Taken together, these data demonstrate feasibility of achieving NRF2-dependent cutaneous photoprotection by systemic administration of the apocarotenoid bixin, a natural food additive consumed worldwide.

  7. S-allyl cysteine protects against 6-hydroxydopamine-induced neurotoxicity in the rat striatum: involvement of Nrf2 transcription factor activation and modulation of signaling kinase cascades.

    PubMed

    Tobón-Velasco, Julio César; Vázquez-Victorio, Genaro; Macías-Silva, Marina; Cuevas, Elvis; Ali, Syed F; Maldonado, Perla D; González-Trujano, María Eva; Cuadrado, Antonio; Pedraza-Chaverrí, José; Santamaría, Abel

    2012-09-01

    Pharmacological activation at the basal ganglia of the transcription factor Nrf2, guardian of redox homeostasis, holds a strong promise for the slow progression of Parkinson's disease (PD). However, a potent Nrf2 activator in the brain still must be found. In this study, we have investigated the potential use of the antioxidant compound S-allyl cysteine (SAC) in the activation of Nrf2 in 6-hydoxydopamine (6-OHDA)-intoxicated rats. In the rat striatum, SAC by itself promoted the Nrf2 dissociation of Keap-1, its nuclear translocation, the subsequent association with small MafK protein, and further binding of the Nrf2/MafK complex to ARE sequence, as well as the up-regulation of Nrf2-dependent genes encoding the antioxidant enzymes HO-1, NQO-1, GR, and SOD-1. In vivo and in vitro experiments to identify signaling pathways activated by SAC pointed to Akt as the most likely kinase participating in Nrf2 activation by SAC. In PC12 cells, SAC stimulated the activation of Akt and ERK1/2 and inhibited JNK1/2/3 activation. In the rat striatum, the SAC-induced activation of Nrf2 is likely to contribute to inhibit the toxic effects of 6-OHDA evidenced by phase 2 antioxidant enzymes up-regulation, glutathione recovery, and attenuation of reactive oxygen species (ROS), nitric oxide (NO), and lipid peroxides formation. These early protective effects correlated with the long-term preservation of the cellular redox status, the striatal dopamine (DA) and tyrosine hydroxylase (TH) levels, and the improvement of motor skills. Therefore, this study indicates that, in addition to direct scavenging actions, the activation of Nrf2 by SAC might confer neuroprotective responses through the modulation of kinase signaling pathways in rodent models of PD, and suggests that this antioxidant molecule may have a therapeutic value in this human pathology.

  8. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    SciTech Connect

    Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2012-11-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs{sup 3+}) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs{sup 3+} exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs{sup 3+} and monomethylarsonous acid (MMA{sup 3+})-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs{sup 3+}-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs{sup 3+}. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs{sup 3+} in β-cells. ► Deficiency of Nrf2 in

  9. Sulforaphane Inhibits HIV Infection of Macrophages through Nrf2

    PubMed Central

    Furuya, Andrea Kinga Marias; Sharifi, Hamayun J.; Jellinger, Robert M.; Cristofano, Paul; Shi, Binshan; de Noronha, Carlos M. C.

    2016-01-01

    Marburg virus, the Kaposi's sarcoma-associated herpesvirus (KSHV) and Dengue virus all activate, and benefit from, expression of the transcription regulator nuclear erythroid 2-related factor 2 (Nrf2). The impact of Nrf2 activation on human immunodeficiency virus (HIV) infection has not been tested. Sulforaphane (SFN), produced in cruciferous vegetables after mechanical damage, mobilizes Nrf2 to potently reprogram cellular gene expression. Here we show for the first time that SFN blocks HIV infection in primary macrophages but not in primary T cells. Similarly SFN blocks infection in PMA-differentiated promonocytic cell lines, but not in other cell lines tested. siRNA-mediated depletion of Nrf2 boosted HIV infectivity in primary macrophages and reduced the anti-viral effects of SFN treatment. This supports a model in which anti-viral activity is mediated through Nrf2 after it is mobilized by SFN. We further found that, like the type I interferon-induced cellular anti-viral proteins SAMHD1 and MX2, SFN treatment blocks infection after entry, but before formation of 2-LTR circles. Interestingly however, neither SAMHD1 nor MX2 were upregulated. This shows for the first time that Nrf2 action can potently block HIV infection and highlights a novel way to trigger this inhibition. PMID:27093399

  10. Sulforaphane Inhibits HIV Infection of Macrophages through Nrf2.

    PubMed

    Furuya, Andrea Kinga Marias; Sharifi, Hamayun J; Jellinger, Robert M; Cristofano, Paul; Shi, Binshan; de Noronha, Carlos M C

    2016-04-01

    Marburg virus, the Kaposi's sarcoma-associated herpesvirus (KSHV) and Dengue virus all activate, and benefit from, expression of the transcription regulator nuclear erythroid 2-related factor 2 (Nrf2). The impact of Nrf2 activation on human immunodeficiency virus (HIV) infection has not been tested. Sulforaphane (SFN), produced in cruciferous vegetables after mechanical damage, mobilizes Nrf2 to potently reprogram cellular gene expression. Here we show for the first time that SFN blocks HIV infection in primary macrophages but not in primary T cells. Similarly SFN blocks infection in PMA-differentiated promonocytic cell lines, but not in other cell lines tested. siRNA-mediated depletion of Nrf2 boosted HIV infectivity in primary macrophages and reduced the anti-viral effects of SFN treatment. This supports a model in which anti-viral activity is mediated through Nrf2 after it is mobilized by SFN. We further found that, like the type I interferon-induced cellular anti-viral proteins SAMHD1 and MX2, SFN treatment blocks infection after entry, but before formation of 2-LTR circles. Interestingly however, neither SAMHD1 nor MX2 were upregulated. This shows for the first time that Nrf2 action can potently block HIV infection and highlights a novel way to trigger this inhibition. PMID:27093399

  11. Apurinic/apyrimidinic endonuclease/redox factor-1 (APE1/Ref-1) redox function negatively regulates NRF2.

    PubMed

    Fishel, Melissa L; Wu, Xue; Devlin, Cecilia M; Logsdon, Derek P; Jiang, Yanlin; Luo, Meihua; He, Ying; Yu, Zhangsheng; Tong, Yan; Lipking, Kelsey P; Maitra, Anirban; Rajeshkumar, N V; Scandura, Glenda; Kelley, Mark R; Ivan, Mircea

    2015-01-30

    Apurinic/apyrimidinic endonuclease/redox factor-1 (APE1/Ref-1) (henceforth referred to as Ref-1) is a multifunctional protein that in addition to its base excision DNA repair activity exerts redox control of multiple transcription factors, including nuclear factor κ-light chain enhancer of activated B cells (NF-κB), STAT3, activator protein-1 (AP-1), hypoxia-inducible factor-1 (HIF-1), and tumor protein 53 (p53). In recent years, Ref-1 has emerged as a promising therapeutic target in cancer, particularly in pancreatic ductal carcinoma. Although a significant amount of research has centered on Ref-1, no wide-ranging approach had been performed on the effects of Ref-1 inhibition and transcription factor activity perturbation. Starting with a broader approach, we identified a previously unsuspected effect on the nuclear factor erythroid-related factor 2 (NRF2), a critical regulator of cellular defenses against oxidative stress. Based on genetic and small molecule inhibitor-based methodologies, we demonstrated that repression of Ref-1 potently activates NRF2 and its downstream targets in a dose-dependent fashion, and that the redox, rather than the DNA repair function of Ref-1 is critical for this effect. Intriguingly, our results also indicate that this pathway does not involve reactive oxygen species. The link between Ref-1 and NRF2 appears to be present in all cells tested in vitro, noncancerous and cancerous, including patient-derived tumor samples. In particular, we focused on understanding the implications of the novel interaction between these two pathways in primary pancreatic ductal adenocarcinoma tumor cells and provide the first evidence that this mechanism has implications for overcoming the resistance against experimental drugs targeting Ref-1 activity, with clear translational implications.

  12. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  13. Induction of cancer chemopreventive enzymes by coffee is mediated by transcription factor Nrf2. Evidence that the coffee-specific diterpenes cafestol and kahweol confer protection against acrolein

    SciTech Connect

    Higgins, Larry G. Cavin, Christophe; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.

    2008-02-01

    Mice fed diets containing 3% or 6% coffee for 5 days had increased levels of mRNA for NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutathione S-transferase class Alpha 1 (GSTA1) of between 4- and 20-fold in the liver and small intestine. Mice fed 6% coffee also had increased amounts of mRNA for UDP-glucuronosyl transferase 1A6 (UGT1A6) and the glutamate cysteine ligase catalytic (GCLC) subunit of between 3- and 10-fold in the small intestine. Up-regulation of these mRNAs was significantly greater in mice possessing Nrf2 (NF-E2 p45 subunit-related factor 2) than those lacking the transcription factor. Basal levels of mRNAs for NQO1, GSTA1, UGT1A6 and GCLC were lower in tissues from nrf2{sup -/-} mice than from nrf2{sup +/+} mice, but modest induction occurred in the mutant animals. Treatment of mouse embryonic fibroblasts (MEFs) from nrf2{sup +/+} mice with either coffee or the coffee-specific diterpenes cafestol and kahweol (C + K) increased NQO1 mRNA up to 9-fold. MEFs from nrf2{sup -/-} mice expressed less NQO1 mRNA than did wild-type MEFs, but NQO1 was induced modestly by coffee or C + K in the mutant fibroblasts. Transfection of MEFs with nqo1-luciferase reporter constructs showed that induction by C + K was mediated primarily by Nrf2 and required the presence of an antioxidant response element in the 5'-upstream region of the gene. Luciferase reporter activity did not increase following treatment of MEFs with 100 {mu}mol/l furan, suggesting that this ring structure within C + K is insufficient for gene induction. Priming of nrf2{sup +/+} MEFs, but not nrf2{sup -/-} MEFs, with C + K conferred 2-fold resistance towards acrolein.

  14. NRF2 Regulates HER2 and HER3 Signaling Pathway to Modulate Sensitivity to Targeted Immunotherapies

    PubMed Central

    Khalil, Hilal S.; Langdon, Simon P.; Kankia, Ibrahim H.; Bown, James; Deeni, Yusuf Y.

    2016-01-01

    NF-E2 related factor-2 (NRF2) is an essential transcription factor for multiple genes encoding antioxidants and detoxification enzymes. NRF2 is implicated in promoting cancer therapeutic resistance by its detoxification function and crosstalk with proproliferative pathways. However, the exact mechanism of this intricate connectivity between NRF2 and growth factor induced proliferative pathway remains elusive. Here, we have demonstrated that pharmacological activation of NRF2 by tert-butylhydroquinone (tBHQ) upregulates the HER family receptors, HER2 and HER3 expression, elevates pAKT levels, and enhances the proliferation of ovarian cancer cells. Preactivation of NRF2 also attenuates the combined growth inhibitory effects of HER2 targeting monoclonal antibodies, Pertuzumab and Trastuzumab. Further, tBHQ caused transcriptional induction of HER2 and HER3, while SiRNA-mediated knockdown of NRF2 prevented this and further caused transcriptional repression and enhanced cytotoxicity of the HER2 inhibitors. Hence, NRF2 regulates both HER2 and HER3 receptors to influence cellular responses to HER2 targeting monoclonal antibodies. This deciphered crosstalk mechanism reinforces the role of NRF2 in drug resistance and as a relevant anticancer target. PMID:26770651

  15. Amelioration of inflammation and tissue damage in sickle cell model mice by Nrf2 activation

    PubMed Central

    Keleku-Lukwete, Nadine; Suzuki, Mikiko; Otsuki, Akihito; Tsuchida, Kouhei; Katayama, Saori; Hayashi, Makiko; Naganuma, Eriko; Moriguchi, Takashi; Tanabe, Osamu; Engel, James Douglas; Imaizumi, Masue; Yamamoto, Masayuki

    2015-01-01

    Sickle cell disease (SCD) is an inherited disorder caused by a point mutation in the β-globin gene, leading to the production of abnormally shaped red blood cells. Sickle cells are prone to hemolysis and thereby release free heme into plasma, causing oxidative stress and inflammation that in turn result in damage to multiple organs. The transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) is a master regulator of the antioxidant cell-defense system. Here we show that constitutive Nrf2 activation by ablation of its negative regulator Keap1 (kelch-like ECH-associated protein 1) significantly improves symptoms in SCD model mice. SCD mice exhibit severe liver damage and lung inflammation associated with high expression levels of proinflammatory cytokines and adhesion molecules compared with normal mice. Importantly, these symptoms subsided after Nrf2 activation. Although hemolysis and stress erythropoiesis did not change substantially in the Nrf2-activated SCD mice, Nrf2 promoted the elimination of plasma heme released by sickle cells’ hemolysis and thereby reduced oxidative stress and inflammation, demonstrating that Nrf2 activation reduces organ damage and segregates inflammation from prevention of hemolysis in SCD mice. Furthermore, administration of the Nrf2 inducer CDDO-Im (2-cyano-3, 12 dioxooleana-1, 9 diene-28-imidazolide) also relieved inflammation and organ failure in SCD mice. These results support the contention that Nrf2 induction may be an important means to protect organs from the pathophysiology of sickle cell-induced damage. PMID:26371321

  16. Amelioration of inflammation and tissue damage in sickle cell model mice by Nrf2 activation.

    PubMed

    Keleku-Lukwete, Nadine; Suzuki, Mikiko; Otsuki, Akihito; Tsuchida, Kouhei; Katayama, Saori; Hayashi, Makiko; Naganuma, Eriko; Moriguchi, Takashi; Tanabe, Osamu; Engel, James Douglas; Imaizumi, Masue; Yamamoto, Masayuki

    2015-09-29

    Sickle cell disease (SCD) is an inherited disorder caused by a point mutation in the β-globin gene, leading to the production of abnormally shaped red blood cells. Sickle cells are prone to hemolysis and thereby release free heme into plasma, causing oxidative stress and inflammation that in turn result in damage to multiple organs. The transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) is a master regulator of the antioxidant cell-defense system. Here we show that constitutive Nrf2 activation by ablation of its negative regulator Keap1 (kelch-like ECH-associated protein 1) significantly improves symptoms in SCD model mice. SCD mice exhibit severe liver damage and lung inflammation associated with high expression levels of proinflammatory cytokines and adhesion molecules compared with normal mice. Importantly, these symptoms subsided after Nrf2 activation. Although hemolysis and stress erythropoiesis did not change substantially in the Nrf2-activated SCD mice, Nrf2 promoted the elimination of plasma heme released by sickle cells' hemolysis and thereby reduced oxidative stress and inflammation, demonstrating that Nrf2 activation reduces organ damage and segregates inflammation from prevention of hemolysis in SCD mice. Furthermore, administration of the Nrf2 inducer CDDO-Im (2-cyano-3, 12 dioxooleana-1, 9 diene-28-imidazolide) also relieved inflammation and organ failure in SCD mice. These results support the contention that Nrf2 induction may be an important means to protect organs from the pathophysiology of sickle cell-induced damage.

  17. Nrf2 activity as a potential biomarker for the pan-epigenetic anticancer agent, RRx-001.

    PubMed

    Ning, Shoucheng; Sekar, Thillai Veerapazham; Scicinski, Jan; Oronsky, Bryan; Peehl, Donna M; Knox, Susan J; Paulmurugan, Ramasamy

    2015-08-28

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a master regulatory transcription factor that plays an important role in the antioxidant response pathway against anticancer drug-induced cytotoxic effects. RRx-001 is a new anticancer agent that generates reactive oxygen and nitrogen species, and leads to epigenetic alterations in cancer cells. Here we report the RRx-001 mediated nuclear translocation of Nrf2 and the activation of expression of its downstream enzymes HO-1 and NQO1 in tumor cells. Inhibition of intrinsic Nrf2 expression by Nrf2-specific siRNA increased cell sensitivity to RRx-001. Molecular imaging of tumor cells co-expressing pARE-Firefly luciferase and pCMV-Renilla luciferase-mRFP in vitro and in vivo in mice revealed that RRx-001 significantly increased ARE-FLUC signal in cells in a dose- and time-dependent manner, suggesting that RRx-001 is an effective activator of the Nrf2-ARE signaling pathway. The pre-treatment level of ARE-FLUC signal in cells, reflecting basal activity of Nrf2, negatively correlated with the tumor response to RRx-001. The results support the concept that RRx-001 activates Nrf2-ARE antioxidant signaling pathways in tumor cells. Hence measurement of Nrf2-mediated activation of downstream target genes through ARE signaling may constitute a useful molecular biomarker for the early prediction of response to RRx-001 treatment, and thereby guide therapeutic decision-making.

  18. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    SciTech Connect

    Jing, Xu; Ren, Dongmei; Wei, Xinbing; Shi, Huanying; Zhang, Xiumei; Perez, Ruth G.; Lou, Haiyan; Lou, Hongxiang

    2013-12-15

    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury.

  19. Coordinated induction of Nrf2 target genes protects against iron nitrilotriacetate (FeNTA)-induced nephrotoxicity

    SciTech Connect

    Tanaka, Yuji; Aleksunes, Lauren M. |; Goedken, Michael J.; Chen, Chuan; Reisman, Scott A.; Manautou, Jose E.; Klaassen, Curtis D.

    2008-09-15

    The iron chelate, ferric nitrilotriacetate (FeNTA), induces acute proximal tubular necrosis as a consequence of lipid peroxidation and oxidative tissue damage. Chronic exposure of FeNTA leads to a high incidence of renal adenocarcinomas in rodents. NF-E2-related factor 2 (Nrf2) is a transcription factor that is activated by oxidative stress and electrophiles, and regulates the basal and inducible expression of numerous detoxifying and antioxidant genes. To determine the roles of Nrf2 in regulating renal gene expression and protecting against oxidative stress-induced kidney damage, wild-type and Nrf2-null mice were administered FeNTA. Renal Nrf2 protein translocated to the nucleus at 6h after FeNTA treatment. FeNTA increased mRNA levels of Nrf2 target genes, including NQO1, GCLC, GSTpi1/2, Mrp1, 2, and 4 in kidneys from wild-type mice, but not Nrf2-null mice. Protein expression of NQO1, a prototypical Nrf2 target gene, was increased in wild-type mice, with no change in Nrf2-null mice. FeNTA produced more nephrotoxicity in Nrf2-null mice than wild-type mice as indicated by higher serum urea nitrogen and creatinine levels, as more urinary NAG, stronger 4-hydroxynonenal protein adduct staining, and more extensive proximal tubule damage. Furthermore, pretreatment with CDDO-Im, a potent small molecule Nrf2 activator, protected mice against FeNTA-induced renal toxicity. Collectively, these results suggest that activation of Nrf2 protects mouse kidneys from FeNTA-induced oxidative stress damage by coordinately up-regulating the expression of cytoprotective genes.

  20. Molecular Basis of Electrophilic and Oxidative Defense: Promises and Perils of Nrf2

    PubMed Central

    Ma, Qiang; He, Xiaoqing

    2015-01-01

    Induction of drug-metabolizing enzymes through the antioxidant response element (ARE)-dependent transcription was initially implicated in chemoprevention against cancer by antioxidants. Recent progress in understanding the biology and mechanism of induction revealed a critical role of induction in cellular defense against electrophilic and oxidative stress. Induction is mediated through a novel signaling pathway via two regulatory proteins, the nuclear factor erythroid 2-related factor 2 (Nrf2) and the Kelch-like erythroid cell-derived protein with CNC homology-associated protein 1 (Keap1). Nrf2 binds to Keap1 at a two site-binding interface and is ubiquitinated by the Keap1/cullin 3/ring box protein-1-ubiquitin ligase, resulting in a rapid turnover of Nrf2 protein. Electrophiles and oxidants modify critical cysteine thiols of Keap1 and Nrf2 to inhibit Nrf2 ubiquitination, leading to Nrf2 activation and induction. Induction increases stress resistance critical for cell survival, because knockout of Nrf2 in mice increased susceptibility to a variety of toxicity and disease processes. Collateral to diverse functions of Nrf2, genome-wide search has led to the identification of a plethora of ARE-dependent genes regulated by Nrf2 in an inducer-, tissue-, and disease-dependent manner to control drug metabolism, antioxidant defense, stress response, proteasomal degradation, and cell proliferation. The protective nature of Nrf2 could also be hijacked in a number of pathological conditions by means of somatic mutation, epigenetic alteration, and accumulation of disruptor proteins, promoting drug resistance in cancer and pathologic liver features in autophagy deficiency. The repertoire of ARE inducers has expanded enormously; the therapeutic potential of the inducers has been examined beyond cancer prevention. Developing potent and specific ARE inducers and Nrf2 inhibitors holds certain new promise for the prevention and therapy against cancer, chronic disease, and toxicity

  1. Methamphetamine oxidative stress, neurotoxicity, and functional deficits are modulated by nuclear factor-E2-related factor 2.

    PubMed

    Ramkissoon, Annmarie; Wells, Peter G

    2015-12-01

    Activation of redox-sensitive transcription factors like nuclear factor-E2-related factor 2 (Nrf2) can enhance the transcription of cytoprotective genes during oxidative stress. We investigated whether Nrf2 is activated by methamphetamine (METH) thereby altering neurotoxicity in Nrf2 +/+ and -/- adult mouse brain. A single dose of METH can induce the mRNA levels of Nrf2-regulated antioxidant and cytoprotective proteins in mouse brain. Multiple-day dosing with METH enhanced DNA oxidation and decreased tyrosine hydroxylase and dopamine transporter staining in the striatum, indicating dopaminergic nerve terminal toxicity, which was more severe in -/- mice, as were deficits in motor coordination and olfactory discrimination. These Nrf2-dependent effects were independent of changes in METH metabolism or the induction of hyperthermia. Similarly, METH increased striatal glial fibrillary acidic protein, indicating neurotoxicity. METH neurotoxicity was also observed in the glial cells and in the GABAergic system of the olfactory bulbs and was enhanced in -/- mice, whereas dopaminergic parameters were unaffected. With one-day dosing of METH, there were no differences between +/+ and -/- mice in either basal or METH-enhanced DNA oxidation and neurotoxicity markers. Nrf2-mediated pathways accordingly may protect against the neurodegenerative effects and functional deficits initiated by METH and perhaps other reactive oxygen species-enhancing neurotoxicants, when there is time for transcriptional activation and protein induction. In human users of METH, this mechanism may be essential when differences in drug abuse patterns may alter the induction and duration of Nrf2 activation thereby modulating susceptibility to the neurotoxic effects of METH.

  2. Generation of a New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B1 Toxicity.

    PubMed

    Taguchi, Keiko; Takaku, Misaki; Egner, Patricia A; Morita, Masanobu; Kaneko, Takehito; Mashimo, Tomoji; Kensler, Thomas W; Yamamoto, Masayuki

    2016-07-01

    THE TRANSCRIPTION FACTOR NRF2: (NF-E2-related-factor 2) REGULATES A BATTERY OF ANTIOXIDATIVE STRESS-RESPONSE GENES AND DETOXICATION GENES, AND NRF2 KNOCKOUT LINES OF MICE HAVE BEEN CONTRIBUTING CRITICALLY TO THE CLARIFICATION OF ROLES THAT NRF2 PLAYS FOR CELL PROTECTION HOWEVER, THERE ARE APPARENT LIMITATIONS IN USE OF THE MOUSE MODELS FOR INSTANCE, RATS EXHIBIT MORE SUITABLE FEATURES FOR TOXICOLOGICAL OR PHYSIOLOGICAL EXAMINATIONS THAN MICE IN THIS STUDY, WE GENERATED 2 LINES OF NRF2 KNOCKOUT RATS BY USING A GENOME EDITING TECHNOLOGY; 1 LINE HARBORS A 7-BP DELETION Δ7 AND THE OTHER LINE HARBORS A 1-BP INSERTION +1 IN THE NRF2 GENE IN THE LIVERS OF RATS HOMOZYGOUSLY DELETING THE NRF2 GENE, AN ACTIVATOR OF NRF2 SIGNALING, CDDO-IM, COULD NOT INDUCE EXPRESSION OF REPRESENTATIVE NRF2 TARGET GENES TO EXAMINE ALTERED TOXICOLOGICAL RESPONSE, WE TREATED THE NRF2 KNOCKOUT RATS WITH AFLATOXIN B1 AFB1, A CARCINOGENIC MYCOTOXIN THAT ELICITS GENE MUTATIONS THROUGH BINDING OF ITS METABOLITES TO DNA AND FOR WHICH THE RAT HAS BEEN PROPOSED AS A REASONABLE SURROGATE FOR HUMAN TOXICITY INDEED, IN THE NRF2 KNOCKOUT RAT LIVERS THE ENZYMES OF THE AFB1 DETOXICATION PATHWAY WERE SIGNIFICANTLY DOWNREGULATED SINGLE DOSE ADMINISTRATION OF AFB1 INCREASED HEPATOTOXICITY AND BINDING OF AFB1-N7-GUANINE TO HEPATIC DNA IN NRF2 KNOCKOUT RATS COMPARED WITH WILD-TYPE NRF2 KNOCKOUT RATS REPEATEDLY TREATED WITH AFB1 WERE PRONE TO LETHALITY AND CDDO-IM WAS NO LONGER PROTECTIVE THESE RESULTS DEMONSTRATE THAT NRF2 KNOCKOUT RATS ARE QUITE SENSITIVE TO AFB1 TOXICITIES AND THIS RAT GENOTYPE EMERGES AS A NEW MODEL ANIMAL IN TOXICOLOGY.

  3. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    SciTech Connect

    Li, Bin; Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S.; Ward, Keith W.; Meyer, Colin J.; Wang, Xing Li; Tang, Dongqi; Cui, Taixing

    2014-02-21

    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  4. Nuclear factor erythroid 2-related factor 2 antibody attenuates thermal hyperalgesia in the dorsal root ganglion: Neurochemical changes and behavioral studies after sciatic nerve-pinch injury.

    PubMed

    Xiang, Qiong; Yu, Chao; Zhu, Yao-Feng; Li, Chun-Yan; Tian, Rong-Bo; Li, Xian-Hui

    2016-08-01

    Oxidative stress is generated in several peripheral nerve injury models.Nuclear factor erythroid 2-related factor 2 (Nrf2) is activated to have a role in antioxidant effect. After nerve injury, the severely painful behavior is also performed. However, little has been explored regarding the function of Nrf2 in this painful process. Therefore, in this study, we compared the effects of Nrf2 antibody administration following sciatic nerve-pinch injury on painful behavior induced in young mice and neurochemical changes in dorsal root ganglion neurons. After pinch nerve injury, we found that the magnitude of the thermal allodynia was significantly decreased after application of Nrf2 antibody (5ul, 1mg/ml) in such injured animals and phosphorylated ERK(p-ERK) as well as the apoptotic protein (i.e., Bcl-6) in DRG neurons were also down-regulated in the anti-Nrf2-treated injured groups compared to the saline-treated groups. Taken collectively, these data suggested that the Nrf2 antibody reduced thermal hyperalgesia via ERK pathway and the down regulation of Bcl-6 protein from the apoptosis pathway might be protecting against the protein deletions caused by anti-Nrf2 effect and suggested the new therapeutic strategy with Nrf2 inhibitor following nerve injury. PMID:27316447

  5. Nrf2 is the key to chemotherapy resistance in MCF7 breast cancer cells under hypoxia

    PubMed Central

    Syu, Jhih-Pu; Chi, Jen-Tsan; Kung, Hsiu-Ni

    2016-01-01

    Hypoxia leads to reactive oxygen species (ROS) imbalance, which is proposed to associate with drug resistance and oncogenesis. Inhibition of enzymes of antioxidant balancing system in tumor cells was shown to reduce chemoresistance under hypoxia. However, the underlying mechanism remains unknown. The key regulator of antioxidant balancing system is nuclear factor erythroid 2-related factor 2 (NFE2L2, Nrf2). In this study, we showed that hypoxia induced ROS production and increased the Nrf2 activity. Nrf2 activation increased levels of its downstream target antioxidant enzymes, including GCLC and GCLM. The Nrf2-overexpressing also confers chemo-resistant MCF7 cells under normoxia. The in vivo mouse model also demonstrated that the chemical inhibition of Nrf2 can increase cisplatin (CDDP) cytotoxicity. Together, these results showed that Nrf2 serves as a key regulator in chemotherapeutic resistance under hypoxia through ROS-Nrf2-GCLC-GSH pathway. Therefore, targeting Nrf2 can be a potential treatment for hypoxia-induced drug resistance in breast cancer cells. PMID:26894974

  6. Salidroside Suppresses HUVECs Cell Injury Induced by Oxidative Stress through Activating the Nrf2 Signaling Pathway.

    PubMed

    Zhu, Yao; Zhang, Ya-Jie; Liu, Wei-Wei; Shi, Ai-Wu; Gu, Ning

    2016-01-01

    Oxidative stress plays an important role in the pathogenesis of cardiovascular diseases. Salidroside (SAL), one of the main effective constituents of Rhodiola rosea, has been reported to suppress oxidative stress-induced cardiomyocyte injury and necrosis by promoting transcription of nuclear factor E2-related factor 2 (Nrf2)-regulated genes such as heme oxygenase-1 (HO-1) and NAD(P)H dehydrogenase (quinone1) (NQO1). However, it has not been indicated whether SAL might ameliorate endothelial injury induced by oxidative stress. Here, our study demonstrated that SAL might suppress HUVEC cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. The results of our study indicated that SAL decreased the levels of intercellular reactive oxygen species (ROS) and malondialdehyde (MDA), and improved the activities of superoxide dismutase (SOD) and catalase (CAT), resulting in protective effects against oxidative stress-induced cell damage in HUVECs. It suppressed oxidative stress damage by inducing Nrf2 nuclear translocation and activating the expression of Nrf2-regulated antioxidant enzyme genes such as HO-1 and NQO1 in HUVECs. Knockdown of Nrf2 with siRNA abolished the cytoprotective effects against oxidative stress, decreased the expression of Nrf2, HO-1, and NQO1, and inhibited the nucleus translocation of Nrf2 in HUVECs. This study is the first to demonstrate that SAL suppresses HUVECs cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. PMID:27517893

  7. Salidroside Suppresses HUVECs Cell Injury Induced by Oxidative Stress through Activating the Nrf2 Signaling Pathway.

    PubMed

    Zhu, Yao; Zhang, Ya-Jie; Liu, Wei-Wei; Shi, Ai-Wu; Gu, Ning

    2016-01-01

    Oxidative stress plays an important role in the pathogenesis of cardiovascular diseases. Salidroside (SAL), one of the main effective constituents of Rhodiola rosea, has been reported to suppress oxidative stress-induced cardiomyocyte injury and necrosis by promoting transcription of nuclear factor E2-related factor 2 (Nrf2)-regulated genes such as heme oxygenase-1 (HO-1) and NAD(P)H dehydrogenase (quinone1) (NQO1). However, it has not been indicated whether SAL might ameliorate endothelial injury induced by oxidative stress. Here, our study demonstrated that SAL might suppress HUVEC cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. The results of our study indicated that SAL decreased the levels of intercellular reactive oxygen species (ROS) and malondialdehyde (MDA), and improved the activities of superoxide dismutase (SOD) and catalase (CAT), resulting in protective effects against oxidative stress-induced cell damage in HUVECs. It suppressed oxidative stress damage by inducing Nrf2 nuclear translocation and activating the expression of Nrf2-regulated antioxidant enzyme genes such as HO-1 and NQO1 in HUVECs. Knockdown of Nrf2 with siRNA abolished the cytoprotective effects against oxidative stress, decreased the expression of Nrf2, HO-1, and NQO1, and inhibited the nucleus translocation of Nrf2 in HUVECs. This study is the first to demonstrate that SAL suppresses HUVECs cell injury induced by oxidative stress through activating the Nrf2 signaling pathway.

  8. Neuronal development is promoted by weakened intrinsic antioxidant defences due to epigenetic repression of Nrf2

    PubMed Central

    Bell, Karen F.S.; Al-Mubarak, Bashayer; Martel, Marc-André; McKay, Sean; Wheelan, Nicola; Hasel, Philip; Márkus, Nóra M.; Baxter, Paul; Deighton, Ruth F.; Serio, Andrea; Bilican, Bilada; Chowdhry, Sudhir; Meakin, Paul J.; Ashford, Michael L.J.; Wyllie, David J.A.; Scannevin, Robert H.; Chandran, Siddharthan; Hayes, John D.; Hardingham, Giles E.

    2015-01-01

    Forebrain neurons have weak intrinsic antioxidant defences compared with astrocytes, but the molecular basis and purpose of this is poorly understood. We show that early in mouse cortical neuronal development in vitro and in vivo, expression of the master-regulator of antioxidant genes, transcription factor NF-E2-related-factor-2 (Nrf2), is repressed by epigenetic inactivation of its promoter. Consequently, in contrast to astrocytes or young neurons, maturing neurons possess negligible Nrf2-dependent antioxidant defences, and exhibit no transcriptional responses to Nrf2 activators, or to ablation of Nrf2's inhibitor Keap1. Neuronal Nrf2 inactivation seems to be required for proper development: in maturing neurons, ectopic Nrf2 expression inhibits neurite outgrowth and aborization, and electrophysiological maturation, including synaptogenesis. These defects arise because Nrf2 activity buffers neuronal redox status, inhibiting maturation processes dependent on redox-sensitive JNK and Wnt pathways. Thus, developmental epigenetic Nrf2 repression weakens neuronal antioxidant defences but is necessary to create an environment that supports neuronal development. PMID:25967870

  9. Lithium Promotes Longevity through GSK3/NRF2-Dependent Hormesis

    PubMed Central

    Castillo-Quan, Jorge Iván; Li, Li; Kinghorn, Kerri J.; Ivanov, Dobril K.; Tain, Luke S.; Slack, Cathy; Kerr, Fiona; Nespital, Tobias; Thornton, Janet; Hardy, John; Bjedov, Ivana; Partridge, Linda

    2016-01-01

    Summary The quest to extend healthspan via pharmacological means is becoming increasingly urgent, both from a health and economic perspective. Here we show that lithium, a drug approved for human use, promotes longevity and healthspan. We demonstrate that lithium extends lifespan in female and male Drosophila, when administered throughout adulthood or only later in life. The life-extending mechanism involves the inhibition of glycogen synthase kinase-3 (GSK-3) and activation of the transcription factor nuclear factor erythroid 2-related factor (NRF-2). Combining genetic loss of the NRF-2 repressor Kelch-like ECH-associated protein 1 (Keap1) with lithium treatment revealed that high levels of NRF-2 activation conferred stress resistance, while low levels additionally promoted longevity. The discovery of GSK-3 as a therapeutic target for aging will likely lead to more effective treatments that can modulate mammalian aging and further improve health in later life. PMID:27068460

  10. Overview of Nrf2 as Therapeutic Target in Epilepsy

    PubMed Central

    Carmona-Aparicio, Liliana; Pérez-Cruz, Claudia; Zavala-Tecuapetla, Cecilia; Granados-Rojas, Leticia; Rivera-Espinosa, Liliana; Montesinos-Correa, Hortencia; Hernández-Damián, Jacqueline; Pedraza-Chaverri, José; Sampieri, Aristides III; Coballase-Urrutia, Elvia; Cárdenas-Rodríguez, Noemí

    2015-01-01

    Oxidative stress is a biochemical state of imbalance in the production of reactive oxygen and nitrogen species and antioxidant defenses. It is involved in the physiopathology of degenerative and chronic neuronal disorders, such as epilepsy. Experimental evidence in humans and animals support the involvement of oxidative stress before and after seizures. In the past few years, research has increasingly focused on the molecular pathways of this process, such as that involving transcription factor nuclear factor E2-related factor 2 (Nrf2), which plays a central role in the regulation of antioxidant response elements (ARE) and modulates cellular redox status. The aim of this review is to present experimental evidence on the role of Nrf2 in this neurological disorder and to further determine the therapeutic impact of Nrf2 in epilepsy. PMID:26262608

  11. Overview of Nrf2 as Therapeutic Target in Epilepsy.

    PubMed

    Carmona-Aparicio, Liliana; Pérez-Cruz, Claudia; Zavala-Tecuapetla, Cecilia; Granados-Rojas, Leticia; Rivera-Espinosa, Liliana; Montesinos-Correa, Hortencia; Hernández-Damián, Jacqueline; Pedraza-Chaverri, José; Sampieri, Aristides; Coballase-Urrutia, Elvia; Cárdenas-Rodríguez, Noemí

    2015-08-07

    Oxidative stress is a biochemical state of imbalance in the production of reactive oxygen and nitrogen species and antioxidant defenses. It is involved in the physiopathology of degenerative and chronic neuronal disorders, such as epilepsy. Experimental evidence in humans and animals support the involvement of oxidative stress before and after seizures. In the past few years, research has increasingly focused on the molecular pathways of this process, such as that involving transcription factor nuclear factor E2-related factor 2 (Nrf2), which plays a central role in the regulation of antioxidant response elements (ARE) and modulates cellular redox status. The aim of this review is to present experimental evidence on the role of Nrf2 in this neurological disorder and to further determine the therapeutic impact of Nrf2 in epilepsy.

  12. Fisetin stimulates autophagic degradation of phosphorylated tau via the activation of TFEB and Nrf2 transcription factors.

    PubMed

    Kim, Sunhyo; Choi, Ki Ju; Cho, Sun-Jung; Yun, Sang-Moon; Jeon, Jae-Pil; Koh, Young Ho; Song, Jihyun; Johnson, Gail V W; Jo, Chulman

    2016-04-26

    The neuronal accumulation of phosphorylated tau plays a critical role in the pathogenesis of Alzheimer's disease (AD). Here, we examined the effect of fisetin, a flavonol, on tau levels. Treatment of cortical cells or primary neurons with fisetin resulted in significant decreases in the levels of phosphorylated tau. In addition, fisetin decreased the levels of sarkosyl-insoluble tau in an active GSK-3β-induced tau aggregation model. However, there was no difference in activities of tau kinases and phosphatases such as protein phosphatase 2A, irrespective of fisetin treatment. Fisetin activated autophagy together with the activation of transcription factor EB (TFEB) and Nrf2 transcriptional factors. The activation of autophagy including TFEB is likely due to fisetin-mediated mammalian target of rapamycin complex 1 (mTORC1) inhibition, since the phosphorylation levels of p70S6 kinase and 4E-BP1 were decreased in the presence of fisetin. Indeed, fisetin-induced phosphorylated tau degradation was attenuated by chemical inhibitors of the autophagy-lysosome pathway. Together the results indicate that fisetin reduces levels of phosphorylated tau through the autophagy pathway activated by TFEB and Nrf2. Our result suggests fisetin should be evaluated further as a potential preventive and therapeutic drug candidate for AD.

  13. Fisetin stimulates autophagic degradation of phosphorylated tau via the activation of TFEB and Nrf2 transcription factors

    PubMed Central

    Kim, Sunhyo; Choi, Ki Ju; Cho, Sun-Jung; Yun, Sang-Moon; Jeon, Jae-Pil; Koh, Young Ho; Song, Jihyun; Johnson, Gail V. W.; Jo, Chulman

    2016-01-01

    The neuronal accumulation of phosphorylated tau plays a critical role in the pathogenesis of Alzheimer’s disease (AD). Here, we examined the effect of fisetin, a flavonol, on tau levels. Treatment of cortical cells or primary neurons with fisetin resulted in significant decreases in the levels of phosphorylated tau. In addition, fisetin decreased the levels of sarkosyl-insoluble tau in an active GSK-3β-induced tau aggregation model. However, there was no difference in activities of tau kinases and phosphatases such as protein phosphatase 2A, irrespective of fisetin treatment. Fisetin activated autophagy together with the activation of transcription factor EB (TFEB) and Nrf2 transcriptional factors. The activation of autophagy including TFEB is likely due to fisetin-mediated mammalian target of rapamycin complex 1 (mTORC1) inhibition, since the phosphorylation levels of p70S6 kinase and 4E-BP1 were decreased in the presence of fisetin. Indeed, fisetin-induced phosphorylated tau degradation was attenuated by chemical inhibitors of the autophagy-lysosome pathway. Together the results indicate that fisetin reduces levels of phosphorylated tau through the autophagy pathway activated by TFEB and Nrf2. Our result suggests fisetin should be evaluated further as a potential preventive and therapeutic drug candidate for AD. PMID:27112200

  14. Protective Role of Nuclear Factor E2-Related Factor 2 against Acute Oxidative Stress-Induced Pancreatic β -Cell Damage.

    PubMed

    Fu, Jingqi; Zheng, Hongzhi; Wang, Huihui; Yang, Bei; Zhao, Rui; Lu, Chunwei; Liu, Zhiyuan; Hou, Yongyong; Xu, Yuanyuan; Zhang, Qiang; Qu, Weidong; Pi, Jingbo

    2015-01-01

    Oxidative stress is implicated in the pathogenesis of pancreatic β-cell dysfunction that occurs in both type 1 and type 2 diabetes. Nuclear factor E2-related factor 2 (NRF2) is a master regulator in the cellular adaptive response to oxidative stress. The present study found that MIN6 β-cells with stable knockdown of Nrf2 (Nrf2-KD) and islets isolated from Nrf2-knockout mice expressed substantially reduced levels of antioxidant enzymes in response to a variety of stressors. In scramble MIN6 cells or wild-type islets, acute exposure to oxidative stressors, including hydrogen peroxide (H2O2) and S-nitroso-N-acetylpenicillamine, resulted in cell damage as determined by decrease in cell viability, reduced ATP content, morphology changes of islets, and/or alterations of apoptotic biomarkers in a concentration- and/or time-dependent manner. In contrast, silencing of Nrf2 sensitized MIN6 cells or islets to the damage. In addition, pretreatment of MIN6 β-cells with NRF2 activators, including CDDO-Im, dimethyl fumarate (DMF), and tert-butylhydroquinone (tBHQ), protected the cells from high levels of H2O2-induced cell damage. Given that reactive oxygen species (ROS) are involved in regulating glucose-stimulated insulin secretion (GSIS) and persistent activation of NRF2 blunts glucose-triggered ROS signaling and GSIS, the present study highlights the distinct roles that NRF2 may play in pancreatic β-cell dysfunction that occurs in different stages of diabetes. PMID:25949772

  15. A polymethoxy flavonoids-rich Citrus aurantium extract ameliorates ethanol-induced liver injury through modulation of AMPK and Nrf2-related signals in a binge drinking mouse model.

    PubMed

    Choi, Bong-Keun; Kim, Tae-Won; Lee, Dong-Ryung; Jung, Woon-Ha; Lim, Jong-Hwan; Jung, Ju-Young; Yang, Seung Hwan; Suh, Joo-Won

    2015-10-01

    Nobiletin and tangeretin are polymethoxy flavonoids (PMFs), found in rich quantities in the peel of citrus fruits. In the present study, we assessed the biological effect of the PMFs on liver damage using a mouse model of binge drinking. First, we extracted PMFs from the peels of Citrus aurantium to make Citrus aurantium extract (CAE). Male C57BL/6 mice were orally treated with silymarin and CAE (50, 100, and 200 mg/kg) for 3 days prior to ethanol (5 g/kg, total of 3 doses) oral gavage. Liver injury was observed in the ethanol alone group, as evidenced by increases in serum hepatic enzymes and histopathologic alteration, as well as by hepatic oxidative status disruption. CAE improved serum marker and hepatic structure and restored oxidative status by enhancing antioxidant enzyme levels and by reducing lipid peroxidation levels. In addition, CAE evidently suppressed inflammation and apoptosis in the livers of mice administered with ethanol, by 85% (tumor necrosis factor-α) and 44% compared to the control group, respectively. Furthermore, CAE activated lipid metabolism related signals and enhanced phosphorylation of AMP-activated protein kinase (AMPK) and nuclear factor E2-related factor 2 (Nrf2) with several cytoprotective proteins including heme oxygenase-1, NAD(P)H quinone oxidoreductase 1, and γ-glutamylcysteine synthetase. Taken together, the present study demonstrated that, CAE possesses antioxidant, anti-inflammatory, and antiapoptotic activity against ethanol-induced liver injury.

  16. The rise of antioxidant signaling-The evolution and hormetic actions of Nrf2

    SciTech Connect

    Maher, Jonathan; Yamamoto, Masayuki

    2010-04-01

    Organisms have evolved sophisticated and redundant mechanisms to manage oxidative and electrophilic challenges that arise from internal metabolism or xenobiotic challenge for survival. NF-E2-related factor 2 (Nrf2) is a transcription factor that has evolved over millennia from primitive origins, with homologues traceable back to invertebrate Caenorhabditis and Drosophila species. The ancestry of Nrf2 clearly has deep-seated roots in hematopoiesis, yet has diversified into a transcription factor that can mediate a multitude of antioxidant signaling and detoxification genes. In higher organisms, a more sophisticated means of tightly regulating Nrf2 activity was introduced via the cysteine-rich kelch-like ECH-associated protein 1 (Keap1), thus suggesting a need to modulate Nrf2 activity. This is evidenced in Keap1{sup -/-} mice, which succumb to juvenile mortality due to hyperkeratosis of the gastrointestinal tract. Although Nrf2 activation protects against acute toxicity and prevents or attenuates several disease states, constitutive activation in some tumors leads to poor clinical outcomes, suggesting Nrf2 has evolved in response to a multitude of selective pressures. The purpose of this review is to examine the origins of Nrf2, while highlighting the versatility and protective abilities elicited upon activation. Various model systems in which Nrf2 is normally beneficial but in which exaggerated pharmacology exacerbates a physiological or pathological condition will be addressed. Although Darwinian principles have selected Nrf2 activity for maximal beneficial effect based on environmental and oxidative challenge, both sub- or super-physiological effects have been noted to be detrimental. The functions of Nrf2 thus suggest a hormetic factor that has evolved empirically over time.

  17. Sensitivity to carcinogenesis is increased and chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-deficient mice

    PubMed Central

    Ramos-Gomez, Minerva; Kwak, Mi-Kyoung; Dolan, Patrick M.; Itoh, Ken; Yamamoto, Masayuki; Talalay, Paul; Kensler, Thomas W.

    2001-01-01

    Induction of phase 2 enzymes, which neutralize reactive electrophiles and act as indirect antioxidants, appears to be an effective means for achieving protection against a variety of carcinogens in animals and humans. Transcriptional control of the expression of these enzymes is mediated, at least in part, through the antioxidant response element (ARE) found in the regulatory regions of their genes. The transcription factor Nrf2, which binds to the ARE, appears to be essential for the induction of prototypical phase 2 enzymes such as glutathione S-transferases (GSTs) and NAD(P)H:quinone oxidoreductase (NQO1). Constitutive hepatic and gastric activities of GST and NQO1 were reduced by 50–80% in nrf2-deficient mice compared with wild-type mice. Moreover, the 2- to 5-fold induction of these enzymes in wild-type mice by the chemoprotective agent oltipraz, which is currently in clinical trials, was almost completely abrogated in the nrf2-deficient mice. In parallel with the enzymatic changes, nrf2-deficient mice had a significantly higher burden of gastric neoplasia after treatment with benzo[a]pyrene than did wild-type mice. Oltipraz significantly reduced multiplicity of gastric neoplasia in wild-type mice by 55%, but had no effect on tumor burden in nrf2-deficient mice. Thus, Nrf2 plays a central role in the regulation of constitutive and inducible expression of phase 2 enzymes in vivo and dramatically influences susceptibility to carcinogenesis. Moreover, the total loss of anticarcinogenic efficacy of oltipraz in the nrf2-disrupted mice highlights the prime importance of elevated phase 2 gene expression in chemoprotection by this and similar enzyme inducers. PMID:11248092

  18. Ascorbic acid partly antagonizes resveratrol mediated heme oxygenase-1 but not paraoxonase-1 induction in cultured hepatocytes - role of the redox-regulated transcription factor Nrf2

    PubMed Central

    2011-01-01

    Background Both resveratrol and vitamin C (ascorbic acid) are frequently used in complementary and alternative medicine. However, little is known about the underlying mechanisms for potential health benefits of resveratrol and its interactions with ascorbic acid. Methods The antioxidant enzymes heme oxygenase-1 and paraoxonase-1 were analysed for their mRNA and protein levels in HUH7 liver cells treated with 10 and 25 μmol/l resveratrol in the absence and presence of 100 and 1000 μmol/l ascorbic acid. Additionally the transactivation of the transcription factor Nrf2 and paraoxonase-1 were determined by reporter gene assays. Results Here, we demonstrate that resveratrol induces the antioxidant enzymes heme oxygenase-1 and paraoxonase-1 in cultured hepatocytes. Heme oxygenase-1 induction by resveratrol was accompanied by an increase in Nrf2 transactivation. Resveratrol mediated Nrf2 transactivation as well as heme oxygenase-1 induction were partly antagonized by 1000 μmol/l ascorbic acid. Conclusions Unlike heme oxygenase-1 (which is highly regulated by Nrf2) paraoxonase-1 (which exhibits fewer ARE/Nrf2 binding sites in its promoter) induction by resveratrol was not counteracted by ascorbic acid. Addition of resveratrol to the cell culture medium produced relatively low levels of hydrogen peroxide which may be a positive hormetic redox-signal for Nrf2 dependent gene expression thereby driving heme oxygenase-1 induction. However, high concentrations of ascorbic acid manifold increased hydrogen peroxide production in the cell culture medium which may be a stress signal thereby disrupting the Nrf2 signalling pathway. PMID:21199573

  19. Fibroblast growth factor 21 (FGF21) inhibits macrophage-mediated inflammation by activating Nrf2 and suppressing the NF-κB signaling pathway.

    PubMed

    Yu, Yinhang; He, Jinjiao; Li, Siming; Song, Liying; Guo, Xiaochen; Yao, Wenbing; Zou, Dehua; Gao, Xinyu; Liu, Yunye; Bai, Fuliang; Ren, Guiping; Li, Deshan

    2016-09-01

    Our previous report has shown that FGF21 has anti-inflammatory properties in a collagen-induced arthritis (CIA) model. In this study, the underlying molecular mechanisms of action were also investigated using RAW 264.7 cells, a murine monocyte-macrophage. RAW 264.7 cells were pre-incubated with various concentrations (2000, 500, 100ng/ml) of FGF21 and stimulated with LPS to induce oxidative stress and inflammation. The result of flow cytometry showed that β-Klotho, FGF21 specific receptor, was expressed in murine splenic macrophages and RAW 264.7. In vitro, FGF21 reduced the expression of TNF-α, IL-1β, IL-6 and IFN-γ and increased the level of IL-10 in a dose-dependent manner in LPS-stimulated RAW 264.7 macrophages. FGF21 also suppressed profound elevation of ROS production and oxidative stress, as evidenced by an increase of the MDA level and depletion of the intracellular GSH level, and restored the activities of antioxidant enzymes SOD and GSH-Px in LPS-stimulated RAW 264.7 macrophages. Moreover, FGF21 inhibited LPS-induced nuclear factor-κB (NF-κB) activation, including degradation of I-κB and nuclear translocation of p65. In addition, the result of Western blot and real-time PCR showed that FGF21 induced heme oxygenase-1 (HO-1) expression and increased the nuclear transcription factor-E2-related factor 2 (Nrf2) levels in a dose-dependent manner in LPS-stimulated RAW 264.7 macrophages. In conclusion, the results suggest that macrophages are the targets for the anti-inflammatory effects of FGF21, and FGF21 exerted an anti-inflammatory effect mainly via enhancing Nrf2-mediated anti-oxidant capacity and suppressing NF-κB signaling pathway.

  20. Fibroblast growth factor 21 (FGF21) inhibits macrophage-mediated inflammation by activating Nrf2 and suppressing the NF-κB signaling pathway.

    PubMed

    Yu, Yinhang; He, Jinjiao; Li, Siming; Song, Liying; Guo, Xiaochen; Yao, Wenbing; Zou, Dehua; Gao, Xinyu; Liu, Yunye; Bai, Fuliang; Ren, Guiping; Li, Deshan

    2016-09-01

    Our previous report has shown that FGF21 has anti-inflammatory properties in a collagen-induced arthritis (CIA) model. In this study, the underlying molecular mechanisms of action were also investigated using RAW 264.7 cells, a murine monocyte-macrophage. RAW 264.7 cells were pre-incubated with various concentrations (2000, 500, 100ng/ml) of FGF21 and stimulated with LPS to induce oxidative stress and inflammation. The result of flow cytometry showed that β-Klotho, FGF21 specific receptor, was expressed in murine splenic macrophages and RAW 264.7. In vitro, FGF21 reduced the expression of TNF-α, IL-1β, IL-6 and IFN-γ and increased the level of IL-10 in a dose-dependent manner in LPS-stimulated RAW 264.7 macrophages. FGF21 also suppressed profound elevation of ROS production and oxidative stress, as evidenced by an increase of the MDA level and depletion of the intracellular GSH level, and restored the activities of antioxidant enzymes SOD and GSH-Px in LPS-stimulated RAW 264.7 macrophages. Moreover, FGF21 inhibited LPS-induced nuclear factor-κB (NF-κB) activation, including degradation of I-κB and nuclear translocation of p65. In addition, the result of Western blot and real-time PCR showed that FGF21 induced heme oxygenase-1 (HO-1) expression and increased the nuclear transcription factor-E2-related factor 2 (Nrf2) levels in a dose-dependent manner in LPS-stimulated RAW 264.7 macrophages. In conclusion, the results suggest that macrophages are the targets for the anti-inflammatory effects of FGF21, and FGF21 exerted an anti-inflammatory effect mainly via enhancing Nrf2-mediated anti-oxidant capacity and suppressing NF-κB signaling pathway. PMID:27276443

  1. Nrf2: friend or foe for chemoprevention?

    PubMed Central

    Kensler, Thomas W.; Wakabayashi, Nobunao

    2010-01-01

    Health reflects the ability of an organism to adapt to stress. Stresses—metabolic, proteotoxic, mitotic, oxidative and DNA-damage stresses—not only contribute to the etiology of cancer and other chronic degenerative diseases but are also hallmarks of the cancer phenotype. Activation of the Kelch-like ECH-associated protein 1 (KEAP1)–NF-E2-related factor 2 (NRF2)-signaling pathway is an adaptive response to environmental and endogenous stresses and serves to render animals resistant to chemical carcinogenesis and other forms of toxicity, whilst disruption of the pathway exacerbates these outcomes. This pathway can be induced by thiol-reactive small molecules that demonstrate protective efficacy in preclinical chemoprevention models and in clinical trials. However, mutations and epigenetic modifications affecting the regulation and fate of NRF2 can lead to constitutive dominant hyperactivation of signaling that preserves rather than attenuates cancer phenotypes by providing selective resistance to stresses. This review provides a synopsis of KEAP1–NRF2 signaling, compares the impact of genetic versus pharmacologic activation and considers both the attributes and concerns of targeting the pathway in chemoprevention. PMID:19793802

  2. Astrocytes Prevent Ethanol Induced Apoptosis of Nrf2 Depleted Neurons by Maintaining GSH Homeostasis.

    PubMed

    Narasimhan, Madhusudhanan; Rathinam, Marylatha; Patel, Dhyanesh; Henderson, George; Mahimainathan, Lenin

    2012-07-01

    Glutathione (GSH), a major cellular antioxidant protects cells against oxidative stress injury. Nuclear factor erythroid 2-related factor 2 (NFE2L2/Nrf2) is a redox sensitive master regulator of battery of antioxidant enzymes including those involved in GSH antioxidant machinery. Earlier we reported that ethanol (ETOH) elicits apoptotic death of primary cortical neurons (PCNs) which in partly due to depletion of intracellular GSH levels. Further a recent report from our laboratory illustrated that ETOH exacerbated the dysregulation of GSH and caspase mediated cell death of cortical neurons that are compromised in Nrf2 machinery (Narasimhan et al., 2011). In various experimental models of neurodegeneration, neuronal antioxidant defenses mainly GSH has been shown to be supported by astrocytes. We therefore sought to determine whether astrocytes can render protection to neurons against ETOH toxicity, particularly when the function of Nrf2 is compromised in neurons. The experimental model consisted of co-culturing primary cortical astrocytes (PCA) with Nrf2 downregulated PCNs that were exposed with 4 mg/mL ETOH for 24 h. Monochlorobimane (MCB) staining followed by FACS analysis showed that astrocytes blocked ETOH induced GSH decrement in Nrf2-silenced neurons as opposed to exaggerated GSH depletion in Nrf2 downregulated PCNs alone. Similarly, the heightened activation of caspase 3/7 observed in Nrf2-compromised neurons was attenuated when co-cultured with astrocytes as measured by luminescence based caspase Glo assay. Furthermore, annexin-V-FITC staining followed by FACS analysis revealed that Nrf2 depleted neurons showed resistance to ETOH induced neuronal apoptosis when co-cultured with astrocytes. Thus, the current study identifies ETOH induced dysregulation of GSH and associated apoptotic events observed in Nrf2-depleted neurons can be blocked by astrocytes. Further our results suggest that this neuroprotective effect of astrocyte despite dysfunctional Nrf2 system

  3. Nrf2-ARE pathway: An emerging target against oxidative stress and neuroinflammation in neurodegenerative diseases.

    PubMed

    Buendia, Izaskun; Michalska, Patrycja; Navarro, Elisa; Gameiro, Isabel; Egea, Javier; León, Rafael

    2016-01-01

    Neurodegenerative diseases (NDDs) are predicted to be the biggest health concern in this century and the second leading cause of death by 2050. The main risk factor of these diseases is aging, and as the aging population in Western societies is increasing, the prevalence of these diseases is augmenting exponentially. Despite the great efforts to find a cure, current treatments remain ineffective or have low efficacy. Increasing lines of evidence point to exacerbated oxidative stress, mitochondrial dysfunction and chronic neuroinflammation as common pathological mechanisms underlying neurodegeneration. We will address the role of the nuclear factor E2-related factor 2 (Nrf2) as a potential target for the treatment of NDDs. The Nrf2-ARE pathway is an intrinsic mechanism of defence against oxidative stress. Nrf2 is a transcription factor that induces the expression of a great number of cytoprotective and detoxificant genes. There are many evidences that highlight the protective role of the Nrf2-ARE pathway in neurodegenerative conditions, as it reduces oxidative stress and neuroinflammation. Therefore, the Nrf2 pathway is being increasingly considered a therapeutic target for NDDs. Herein we will review the deregulation of the Nrf2 pathway in different NDDs and the recent studies with Nrf2 inducers as "proof-of-concept" for the treatment of those devastating pathologies.

  4. Could physical exercises modulate Nrf2-Keap1 pathway in chronic kidney disease?

    PubMed

    Abreu, C C; Cardozo, L F M F; Mafra, D

    2015-01-01

    Patients with chronic kidney disease (CKD) have various metabolic disorders caused by a chronic state of oxidative stress and inflammation, and recently, nuclear factor-erythroid 2-related factor 2 (Nrf2) has emerged as a factor that plays a significant role in cellular protection against oxidative stress and inflammation. This transcription factor when activated can regulate antioxidant and anti-inflammatory cellular responses leading to the expression of detoxifying enzymes. Studies have shown that Nrf2 expression can be modulated by several factors, such as bioactive compounds and physical exercise. In fact, exercise in CKD patients can bring many benefits; however, there are no studies correlating physical activity and Nrf2 expression in CKD patients. This review aims to discuss whether there is any evidence to justify a recommendation of physical exercise in CKD patients as a non-pharmacological option to activate the Nrf2 pathway. PMID:25466297

  5. Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver

    SciTech Connect

    Klaassen, Curtis D.; Reisman, Scott A.

    2010-04-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that positively regulates the basal and inducible expression of a large battery of cytoprotective genes. These gene products include proteins that catalyze reduction reactions (NAD(P)H:quinone oxidoreductase 1, Nqo1), conjugation reactions (glutathione-S-transferases, Gsts and UDP-glucuronosyltransferases, Ugts), as well as the efflux of potentially toxic xenobiotics and xenobiotic conjugates (multidrug resistance-associated proteins, Mrps). The significance of Nrf2 in the liver has been established, as livers of Nrf2-null mice are more susceptible to various oxidative/electrophilic stress-induced pathologies than wild-type mice. In contrast, both pharmacological and genetic models of hepatic Nrf2 activation are protective against oxidative/electrophilic stress. Furthermore, because certain Nrf2-target genes in the liver could affect the distribution, metabolism, and excretion of xenobiotics, the effects of Nrf2 on the kinetics of drugs and other xenobiotics should also be considered, with a special emphasis on metabolism and excretion. Therefore, this review highlights the research that has contributed to the understanding of the importance of Nrf2 in toxicodynamics and toxicokinetics, especially that which pertains to the liver.

  6. Nrf2-mediated transcriptional induction of antioxidant response in mouse embryos exposed to ethanol in vivo: implications for the prevention of fetal alcohol spectrum disorders.

    PubMed

    Dong, Jian; Sulik, Kathleen K; Chen, Shao-Yu

    2008-12-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that is important in protection against oxidative stress. This study was designed to determine the role of Nrf2 signaling in transcriptional activation of detoxifying and antioxidant genes in an in vivo mouse fetal alcohol syndrome model. Maternal ethanol treatment was found to increase both Nrf2 protein levels and Nrf2-ARE binding in mouse embryos. It also resulted in a moderate increase in the mRNA expression of Nrf2 downstream target detoxifying and antioxidant genes as well as an increase in the expression of antioxidant proteins. Pretreatment with the Nrf2 inducer, 3H-1,2 dithiole-3-thione (D3T), significantly increased Nrf2 protein levels and Nrf2-ARE binding, and strongly induced the mRNA expression of Nrf2 downstream target genes. It also increased the expression of antioxidant proteins and the activities of the antioxidant enzymes. Additionally, D3T pretreatment resulted in a significant decrease in ethanol-induced reactive oxygen species generation and apoptosis in mouse embryos. These results demonstrate that Nrf2 signaling is involved in the induction of antioxidant response in ethanol-exposed embryos. In addition, the potency of D3T in inducing antioxidants as well as in diminishing ethanol-induced apoptosis suggests that further exploration of the antiteratogenic effect of this compound will be fruitful.

  7. Nrf2 gene deletion fails to alter psychostimulant-induced behavior or neurotoxicity.

    PubMed

    Pacchioni, Alejandra M; Vallone, Joseph; Melendez, Roberto I; Shih, Andy; Murphy, Timothy H; Kalivas, Peter W

    2007-01-01

    The transcription factor NF-E2-related factor (Nrf2) regulates the induction of phase 2 detoxifying enzymes by oxidative stress, including synthesis of the catalytic subunit (xCT) of the heterodimeric cystine-glutamate exchanger (system xc-). Repeated cocaine treatment in rats causes persistent neuroadaptations in glutamate neurotransmission in the nucleus accumbens that result, in part, from reduced activity of system xc-. Since in vitro under- or over-expression of Nrf2 regulates system xc- activity and xCT content, it was hypothesized that in vivo deletion of the Nrf2 gene would: 1) decrease system xc- activity, 2) produce a behavioral phenotype resembling that elicited by chronic cocaine administration, and 3) enhance dopamine depletion after methamphetamine-induced oxidative stress. In all three experiments no genotypic difference was measured between mice sustaining homozygous Nrf2 gene deletion and wild-type littermates. Thus, while Nrf2 is a transcriptional regulator of xCT and capable of protecting cells from oxidative stress, following Nrf2 gene deletion this role can be partially compensated by other mechanisms and methamphetamine-induced oxidative stress and dopamine toxicity does not significantly involve Nrf2.

  8. Sodium arsenite induced reactive oxygen species generation, nuclear factor (erythroid-2 related) factor 2 activation, heme oxygenase-1 expression, and glutathione elevation in Chang human hepatocytes.

    PubMed

    Li, Bing; Li, Xin; Zhu, Bo; Zhang, Xinyu; Wang, Yi; Xu, Yuanyuan; Wang, Huihui; Hou, Yongyong; Zheng, Quanmei; Sun, Guifan

    2013-07-01

    Liver is one of the major target organs of arsenic toxicity and carcinogenesis. Nuclear factor (erythroid-2 related) factor 2 (Nrf2) is a redox-sensitive transcription factor, regulating critically cellular defense responses against the toxic metallic arsenic in many cell types and tissues. This study was conducted to evaluate the hepato-cellular Nrf2 and Nrf2-regulated antioxidant reactions of sodium arsenite exposure in Chang human hepatocytes. Nrf2 and heme oxygenase-1 (HO-1) protein levels were detected by Western blot, and Nrf2-regulated HO-1 mRNA expressions were determined using semiquantitative RT-PCR by 0∼50 μmol/L of sodium arsenite exposure for 2, 6, 12, and 24 h. We also observed the changes of intracellular reactive oxygen species (ROS) and total cellular glutathione (GSH) by flow cytometry and spectrophotometry, respectively. Our results showed that intracellular ROS were both dose- and time-dependent induced by inorganic arsenic; Cellular Nrf2 protein levels increased rapidly after 2 h of exposure, elevated significantly at 6 h, and reached the maximum at 12 h. The endogenous Nrf2-regulated downstream HO-1 mRNA and protein were also induced dramatically and lasted for as long as 24 h. In addition, intracellular GSH levels elevated in consistent with Nrf2 activation. Our findings here suggest that inorganic arsenic alters cellular redox balance in hepatocytes to trigger Nrf2-regulated antioxidant responses promptly, which may represent an adaptive cell defense mechanism against inorganic arsenic induced liver injuries and hepatoxicity.

  9. Ferrous Iron Induces Nrf2 Expression in Mouse Brain Astrocytes to Prevent Neurotoxicity.

    PubMed

    Cui, Zhenwen; Zhong, Zhihong; Yang, Yong; Wang, Baofeng; Sun, Yuhao; Sun, Qingfang; Yang, Guo-Yuan; Bian, Liuguan

    2016-08-01

    Free radical damage caused by ferrous iron is involved in the pathogenesis of secondary brain injury after intracerebral hemorrhage (ICH). NF-E2-related factor 2 (Nrf2), a major phase II gene regulator that binds to antioxidant response element, represents an important cellular cytoprotective mechanism against oxidative damage. We hypothesized that Nrf2 might protect astrocytes from damage by Fe(2+) . Therefore, we examined cytotoxicity in primary astrocytes induced by iron overload and evaluated the effects of Fe(2+) on Nrf2 expression. The results demonstrated that 24-h Fe(2+) exposure exerted time- and concentration-dependent cytotoxicity in astrocytes. Furthermore, Fe(2+) exposure in astrocytes resulted in time- and concentration-dependent increases in Nrf2 expression, which preceded Fe(2+) toxicity. Nrf2-specific siRNA further knocked down Nrf2 levels, resulting in greater Fe(2+) -induced astrocyte cytotoxicity. These data indicate that induction of Nrf2 expression could serve as an adaptive self-defense mechanism, although it is insufficient to completely protect primary astrocytes from Fe(2+) -induced neurotoxicity. PMID:27037625

  10. Activation of the Nrf2 pathway by inorganic arsenic in human hepatocytes and the role of transcriptional repressor Bach1.

    PubMed

    Liu, Dan; Duan, Xiaoxu; Dong, Dandan; Bai, Caijun; Li, Xin; Sun, Guifan; Li, Bing

    2013-01-01

    Previous studies have proved that the environmental toxicant, inorganic arsenic, activates nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in many different cell types. This study tried to explore the hepatic Nrf2 pathway upon arsenic treatment comprehensively, since liver is one of the major target organs of arsenical toxicity. Our results showed that inorganic arsenic significantly induced Nrf2 protein and mRNA expression in Chang human hepatocytes. We also observed a dose-dependent increase of antioxidant response element- (ARE-) luciferase activity. Both the mRNA and protein levels of NAD(P)H:quinone oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1) were all upregulated dramatically. On the other hand, entry and accumulation of Nrf2 protein in the nucleus, while exportting the transcriptional repressor BTB and CNC homology 1 (Bach1) from nucleus to cytoplasm, were also confirmed by western blot and immunofluorescence assay. Our results therefore confirmed the arsenic-induced Nrf2 pathway activation in hepatocytes and also suggested that the translocation of Bach1 was associated with the regulation of Nrf2 pathway by arsenic. Hepatic Nrf2 pathway plays indispensable roles for cellular defenses against arsenic hepatotoxicity, and the interplay of Bach1 and Nrf2 may be helpful to understand the self-defensive responses and the diverse biological effects of arsenicals.

  11. Activation of the Nrf2 pathway by inorganic arsenic in human hepatocytes and the role of transcriptional repressor Bach1.

    PubMed

    Liu, Dan; Duan, Xiaoxu; Dong, Dandan; Bai, Caijun; Li, Xin; Sun, Guifan; Li, Bing

    2013-01-01

    Previous studies have proved that the environmental toxicant, inorganic arsenic, activates nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in many different cell types. This study tried to explore the hepatic Nrf2 pathway upon arsenic treatment comprehensively, since liver is one of the major target organs of arsenical toxicity. Our results showed that inorganic arsenic significantly induced Nrf2 protein and mRNA expression in Chang human hepatocytes. We also observed a dose-dependent increase of antioxidant response element- (ARE-) luciferase activity. Both the mRNA and protein levels of NAD(P)H:quinone oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1) were all upregulated dramatically. On the other hand, entry and accumulation of Nrf2 protein in the nucleus, while exportting the transcriptional repressor BTB and CNC homology 1 (Bach1) from nucleus to cytoplasm, were also confirmed by western blot and immunofluorescence assay. Our results therefore confirmed the arsenic-induced Nrf2 pathway activation in hepatocytes and also suggested that the translocation of Bach1 was associated with the regulation of Nrf2 pathway by arsenic. Hepatic Nrf2 pathway plays indispensable roles for cellular defenses against arsenic hepatotoxicity, and the interplay of Bach1 and Nrf2 may be helpful to understand the self-defensive responses and the diverse biological effects of arsenicals. PMID:23738048

  12. Activated AMPK boosts the Nrf2/HO-1 signaling axis—A role for the unfolded protein response

    PubMed Central

    Zimmermann, Kristin; Baldinger, Johannes; Mayerhofer, Barbara; Atanasov, Atanas G.; Dirsch, Verena M.; Heiss, Elke H.

    2015-01-01

    In light of the emerging interplay between redox and metabolic signaling pathways we investigated the potential cross talk between nuclear factor E2-related factor 2 (Nrf2) and AMP-activated kinase (AMPK), central regulators of the cellular redox and energy balance, respectively. Making use of xanthohumol (XN) as an activator of both the AMPK and the Nrf2 signaling pathway we show that AMPK exerts a positive influence on Nrf2/heme oxygenase (HO)-1 signaling in mouse embryonic fibroblasts. Genetic ablation and pharmacological inhibition of AMPK blunts Nrf2-dependent HO-1 expression by XN already at the mRNA level. XN leads to AMPK activation via interference with mitochondrial function and activation of liver kinase B1 as upstream AMPK kinase. The subsequent AMPK-mediated enhancement of the Nrf2/HO-1 response does not depend on inhibition of the mammalian target of rapamycin, inhibition of glycogen synthase kinase 3β, or altered abundance of Nrf2 (total and nuclear). However, reduced endoplasmic reticulum stress was identified and elaborated as a step in the AMPK-augmented Nrf2/HO-1 response. Overall, we shed more light on the hitherto incompletely understood cross talk between the LKB1/AMPK and the Nrf2/HO-1 axis revealing for the first time involvement of the unfolded protein response as an additional player and suggesting tight cooperation between signaling pathways controlling cellular redox, energy, or protein homeostasis. PMID:25843659

  13. The nuclear cofactor RAC3/AIB1/SRC-3 enhances Nrf2 signaling by interacting with transactivation domains

    PubMed Central

    Kim, Jung-Hwan; Yu, Siwang; Chen, J. Don; Kong, A.-N. Tony

    2012-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2, NM 006164, 605 AA) is essential for the antioxidant responsive element (ARE)-mediated expression of a group of detoxifying antioxidant genes that detoxify carcinogens and protect against oxidative stress. Several proteins have been identified as Nrf2-interacting molecules. In this study, we found that the overexpression of RAC3/AIB-1/SRC-3, a nuclear co-regulator and oncogene frequently amplified in human breast cancers, induced heme oxygenase-1 (HO-1) through Nrf2 transactivation in HeLa cells. Next, we determined the interaction between RAC3 and Nrf2 proteins using a co-immunoprecipitation assay (co-IP) and fluorescence resonance energy transfer (FRET) analysis. The results showed that RAC3 bound directly to the Nrf2 protein in the nucleus. Subsequently, we identified the interacting domains of Nrf2 and RAC3 using a GST pull-down assay. The results showed that both the N-terminal RAC3-pasB and C-terminal RAC3-R3B3 domains were tightly bound to the Neh4 and Neh5 transactivation domains. Furthermore, chromatin immunoprecipitation (ChIP) showed that RAC3 bound tightly to the ARE enhancer region of the HO-1 promoter via Nrf2 binding. These data suggest that Nrf2 activation is modulated and directly controlled through interactions with the RAC3 protein in HeLa cells. PMID:22370642

  14. Activation of the Nrf2 Pathway by Inorganic Arsenic in Human Hepatocytes and the Role of Transcriptional Repressor Bach1

    PubMed Central

    Liu, Dan; Duan, Xiaoxu; Dong, Dandan; Bai, Caijun; Li, Xin; Sun, Guifan; Li, Bing

    2013-01-01

    Previous studies have proved that the environmental toxicant, inorganic arsenic, activates nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in many different cell types. This study tried to explore the hepatic Nrf2 pathway upon arsenic treatment comprehensively, since liver is one of the major target organs of arsenical toxicity. Our results showed that inorganic arsenic significantly induced Nrf2 protein and mRNA expression in Chang human hepatocytes. We also observed a dose-dependent increase of antioxidant response element- (ARE-) luciferase activity. Both the mRNA and protein levels of NAD(P)H:quinone oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1) were all upregulated dramatically. On the other hand, entry and accumulation of Nrf2 protein in the nucleus, while exportting the transcriptional repressor BTB and CNC homology 1 (Bach1) from nucleus to cytoplasm, were also confirmed by western blot and immunofluorescence assay. Our results therefore confirmed the arsenic-induced Nrf2 pathway activation in hepatocytes and also suggested that the translocation of Bach1 was associated with the regulation of Nrf2 pathway by arsenic. Hepatic Nrf2 pathway plays indispensable roles for cellular defenses against arsenic hepatotoxicity, and the interplay of Bach1 and Nrf2 may be helpful to understand the self-defensive responses and the diverse biological effects of arsenicals. PMID:23738048

  15. Structural and Functional Characterization of Nrf2 Degradation by the Glycogen Synthase Kinase 3/β-TrCP Axis

    PubMed Central

    Rada, Patricia; Rojo, Ana I.; Evrard-Todeschi, Nathalie; Innamorato, Nadia G.; Cotte, Axelle; Jaworski, Tomasz; Tobón-Velasco, Julio C.; Devijver, Herman; García-Mayoral, María Flor; Van Leuven, Fred; Hayes, John D.

    2012-01-01

    The transcription factor NF-E2-related factor 2 (Nrf2) is a master regulator of a genetic program, termed the phase 2 response, that controls redox homeostasis and participates in multiple aspects of physiology and pathology. Nrf2 protein stability is regulated by two E3 ubiquitin ligase adaptors, Keap1 and β-TrCP, the latter of which was only recently reported. Here, two-dimensional (2D) gel electrophoresis and site-directed mutagenesis allowed us to identify two serines of Nrf2 that are phosphorylated by glycogen synthase kinase 3β (GSK-3β) in the sequence DSGISL. Nuclear magnetic resonance studies defined key residues of this phosphosequence involved in docking to the WD40 propeller of β-TrCP, through electrostatic and hydrophobic interactions. We also identified three arginine residues of β-TrCP that participate in Nrf2 docking. Intraperitoneal injection of the GSK-3 inhibitor SB216763 led to increased Nrf2 and heme oxygenase-1 levels in liver and hippocampus. Moreover, mice with hippocampal absence of GSK-3β exhibited increased levels of Nrf2 and phase 2 gene products, reduced glutathione, and decreased levels of carbonylated proteins and malondialdehyde. This study establishes the structural parameters of the interaction of Nrf2 with the GSK-3/β-TrCP axis and its functional relevance in the regulation of Nrf2 by the signaling pathways that impinge on GSK-3. PMID:22751928

  16. Roles nrf2 plays in myeloid cells and related disorders.

    PubMed

    Kobayashi, Eri; Suzuki, Takafumi; Yamamoto, Masayuki

    2013-01-01

    The Keap1-Nrf2 system protects animals from oxidative and electrophilic stresses. Nrf2 is a transcription factor that induces the expression of genes essential for detoxifying reactive oxygen species (ROS) and cytotoxic electrophiles. Keap1 is a stress sensor protein that binds to and ubiquitinates Nrf2 under unstressed conditions, leading to the rapid proteasomal degradation of Nrf2. Upon exposure to stress, Keap1 is modified and inactivated, which allows Nrf2 to accumulate and activate the transcription of a battery of cytoprotective genes. Antioxidative and detoxification activities are important for many types of cells to avoid DNA damage and cell death. Accumulating lines of recent evidence suggest that Nrf2 is also required for the primary functions of myeloid cells, which include phagocytosis, inflammation regulation, and ROS generation for bactericidal activities. In fact, results from several mouse models have shown that Nrf2 expression in myeloid cells is required for the proper regulation of inflammation, antitumor immunity, and atherosclerosis. Moreover, several molecules generated upon inflammation activate Nrf2. Although ROS detoxification mediated by Nrf2 is assumed to be required for anti-inflammation, the entire picture of the Nrf2-mediated regulation of myeloid cell primary functions has yet to be elucidated. In this review, we describe the Nrf2 inducers characteristic of myeloid cells and the contributions of Nrf2 to diseases.

  17. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    SciTech Connect

    Han, Jae Yun; Cho, Seung Sik; Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho; Park, Da Eon; Bang, Joon Seok; Jung, Young Suk; Ki, Sung Hwan

    2015-08-15

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  18. Nrf2-related gene expression and exposure to traffic-related air pollution in elderly subjects with cardiovascular disease: An exploratory panel study.

    PubMed

    Wittkopp, Sharine; Staimer, Norbert; Tjoa, Thomas; Stinchcombe, Timothy; Daher, Nancy; Schauer, James J; Shafer, Martin M; Sioutas, Constantinos; Gillen, Daniel L; Delfino, Ralph J

    2016-01-01

    Gene expression changes are linked to air pollutant exposures in in vitro and animal experiments. However, limited data are available on how these outcomes relate to ambient air pollutant exposures in humans. We performed an exploratory analysis testing whether gene expression levels were associated with air pollution exposures in a Los Angeles area cohort of elderly subjects with coronary artery disease. Candidate genes (35) were selected from published studies of gene expression-pollutant associations. Expression levels were measured weekly in 43 subjects (≤ 12 weeks) using quantitative PCR. Exposures included gaseous pollutants O3, nitrogen oxides (NOx), and CO; particulate matter (PM) pollutants elemental and black carbon (EC, BC); and size-fractionated PM mass. We measured organic compounds from PM filter extracts, including polycyclic aromatic hydrocarbons (PAHs), and determined the in vitro oxidative potential of particle extracts. Associations between exposures and gene expression levels were analyzed using mixed-effects regression models. We found positive associations of traffic-related pollutants (EC, BC, primary organic carbon, PM 0.25-2.5 PAH and/or PM 0.25 PAH, and NOx) with NFE2L2, Nrf2-mediated genes (HMOX1, NQO1, and SOD2), CYP1B1, IL1B, and SELP. Findings suggest that NFE2L2 gene expression links associations of traffic-related air pollution with phase I and II enzyme genes at the promoter transcription level. PMID:25564368

  19. Nrf2-related gene expression and exposure to traffic-related air pollution in elderly subjects with cardiovascular disease: An exploratory panel study

    PubMed Central

    Wittkopp, Sharine; Staimer, Norbert; Tjoa, Thomas; Stinchcombe, Timothy; Daher, Nancy; Schauer, James J.; Shafer, Martin M.; Sioutas, Constantinos; Gillen, Daniel L.; Delfino, Ralph J.

    2015-01-01

    Gene expression changes are linked to air pollutant exposures in in vitro and animal experiments. However, limited data are available on how these outcomes relate to ambient air pollutant exposures in humans. We performed an exploratory analysis testing whether gene expression levels were associated with air pollution exposures in a Los Angeles area cohort of elderly subjects with coronary artery disease. Candidate genes (35) were selected from published studies of gene expression-pollutant associations. Expression levels were measured weekly in 43 subjects (≤12 weeks) using quantitative PCR. Exposures included gaseous pollutants O3, nitrogen oxides (NOx), and CO; particulate matter (PM) pollutants elemental and black carbon (EC, BC); and size-fractionated PM mass. We measured organic compounds from PM filter extracts, including polycyclic aromatic hydrocarbons (PAHs), and determined the in vitro oxidative potential of particle extracts. Associations between exposures and gene expression levels were analyzed using mixed-effects regression models. We found positive associations of traffic-related pollutants (EC, BC, primary organic carbon, PM0.25-2.5 PAH and/or PM0.25 PAH, and NOx) with NFE2L2, Nrf2-mediated genes (HMOX1, NQO1, and SOD2), CYP1B1, IL1B, and SELP. Findings suggest that NFE2L2 gene expression links associations of traffic-related air pollution with phase I and II enzyme genes at the promoter transcription level. PMID:25564368

  20. Nrf2-related gene expression and exposure to traffic-related air pollution in elderly subjects with cardiovascular disease: An exploratory panel study.

    PubMed

    Wittkopp, Sharine; Staimer, Norbert; Tjoa, Thomas; Stinchcombe, Timothy; Daher, Nancy; Schauer, James J; Shafer, Martin M; Sioutas, Constantinos; Gillen, Daniel L; Delfino, Ralph J

    2016-01-01

    Gene expression changes are linked to air pollutant exposures in in vitro and animal experiments. However, limited data are available on how these outcomes relate to ambient air pollutant exposures in humans. We performed an exploratory analysis testing whether gene expression levels were associated with air pollution exposures in a Los Angeles area cohort of elderly subjects with coronary artery disease. Candidate genes (35) were selected from published studies of gene expression-pollutant associations. Expression levels were measured weekly in 43 subjects (≤ 12 weeks) using quantitative PCR. Exposures included gaseous pollutants O3, nitrogen oxides (NOx), and CO; particulate matter (PM) pollutants elemental and black carbon (EC, BC); and size-fractionated PM mass. We measured organic compounds from PM filter extracts, including polycyclic aromatic hydrocarbons (PAHs), and determined the in vitro oxidative potential of particle extracts. Associations between exposures and gene expression levels were analyzed using mixed-effects regression models. We found positive associations of traffic-related pollutants (EC, BC, primary organic carbon, PM 0.25-2.5 PAH and/or PM 0.25 PAH, and NOx) with NFE2L2, Nrf2-mediated genes (HMOX1, NQO1, and SOD2), CYP1B1, IL1B, and SELP. Findings suggest that NFE2L2 gene expression links associations of traffic-related air pollution with phase I and II enzyme genes at the promoter transcription level.

  1. Sulforaphane homologues: Enantiodivergent synthesis of both enantiomers, activation of the Nrf2 transcription factor and selective cytotoxic activity.

    PubMed

    Elhalem, Eleonora; Recio, Rocío; Werner, Sabine; Lieder, Franziska; Calderón-Montaño, José Manuel; López-Lázaro, Miguel; Fernández, Inmaculada; Khiar, Noureddine

    2014-11-24

    Reported is an enantiodivergent approach for the synthesis of both enantiomers of sulforaphane (SFN) homologues with different chain lengths between the sulfinyl sulfur and the isothiocyanate groups and different substituents on the sulfinyl sulfur. The homologues were designed in order to unravel the effect of all the diversity elements included in sulforaphane's structure. The key step of the approach is the diastereoselective synthesis of both sulfinate ester epimers at sulfur, using as single chiral auxiliary the sugar derived diacetone-d-glucose. The approach allows the first synthesis of both enantiomers of 5-methylsulfinylpentyl isothiocyanate, and the biologically important 6-methylsulfinylhexyl isothiocyanate (6-HITC) found in Japanese horseradish, wasabi (Wasabia japonica). The ability of the synthesized compounds as inductors of phase II detoxifying enzymes has been studied by determining their ability to activate the cytoprotective transcription factor Nrf2. The cytotoxic activity of all the synthesized compounds against human lung adenocarcinoma (A549) and foetal lung fibroblasts (MRC-5) is also reported. PMID:25299679

  2. Nrf2 protects against furosemide-induced hepatotoxicity.

    PubMed

    Qu, Qiang; Liu, Jie; Zhou, Hong-Hao; Klaassen, Curtis D

    2014-10-01

    Furosemide is a diuretic drug, but its reactive intermediates lead to acute liver injury in mice. Given the essential role of Nrf2 as a cellular defense regulator, we investigated whether Nrf2 would protect against furosemide-induced liver injury using the Nrf2 "gene-dose response" mouse model (Nrf2-null with Nrf2 knock-out, wild-type with normal expression of Nrf2, Keap1-KD with enhanced Nrf2 activation and Keap1-HKO mice with maximum Nrf2 activation). Twenty-four hours after furosemide administration (250mg/kg, i.p.), serum ALT activities and histopathological analysis indicated severe hepatotoxicity in Nrf2-null and WT mice, but significantly less in the Nrf2-overexpressing Keap1-KD and Keap1-HKO mice. Furosemide increased the mRNA of genes involved in the acute phase response (hemeoxygenase-1 and metallothionein-1), ER stress (C/Ebp-homologous protein and Growth arrest and DNA-damage-inducible protein), inflammatory cytokine (interleukin 1 beta), chemokines (macrophage inflammatory protein 2 and mouse keratinocyte-derived chemokine), as well as apoptosis (early growth response factor and BCL2-associated X protein) in livers of Nrf2-null and wild-type mice, but these genes increased less in mice with more Nrf2. The two genotypes of over-expressed Nrf2 mice had increased expression of the Nrf2 target genes Gclm, Gclc and Nqo1 prior to furosemide administration, and the expressions of these genes were increased further after furosemide administration. Thus, our findings provide strong evidence that over-expression of Nrf2 in Keap1-KD and Keap1-HKO mice and the increases in mRNA of a number of genes involved in anti-oxidative stress, anti-inflammation, anti-ER stress and anti-apoptosis protect against furosemide-induced hepatotoxicity.

  3. Regulatory potential for concerted modulation of Nrf2- and Nfkb1-mediated gene expression in inflammation and carcinogenesis

    PubMed Central

    Nair, S; Doh, S T; Chan, J Y; Kong, A-N; Cai, L

    2008-01-01

    Many studies have implicated nuclear factor E2-related factor 2 (Nrf2) and nuclear factor-κB1 (Nfkb1) in inflammation and cancer. However, the regulatory potential for crosstalk between these two important transcription factors in inflammation and carcinogenesis has not been explored. To delineate conserved transcription factor-binding site signatures, we performed bioinformatic analyses on the promoter regions of human and murine Nrf2 and Nfkb1. We performed multiple sequence alignment of Nrf2 and Nfkb1 genes in five mammalian species – human, chimpanzee, dog, mouse and rat – to explore conserved biological features. We constructed a canonical regulatory network for concerted modulation of Nrf2 and Nfkb1 involving several members of the mitogen-activated protein kinase (MAPK) family and present a putative model for concerted modulation of Nrf2 and Nfkb1 in inflammation/carcinogenesis. Our results reflect potential for putative crosstalk between Nrf2 and Nfkb1 modulated through the MAPK cascade that may influence inflammation-associated etiopathogenesis of cancer. Taken together, the elucidation of potential relationships between Nrf2 and Nfkb1 may help to better understand transcriptional regulation, as well as transcription factor networks, associated with the etiopathogenesis of inflammation and cancer. PMID:19050705

  4. NRF2, a Key Regulator of Antioxidants with Two Faces towards Cancer

    PubMed Central

    2016-01-01

    While reactive oxygen species (ROS) is generally considered harmful, a relevant amount of ROS is necessary for a number of cellular functions, including the intracellular signal transduction. In order to deal with an excessive amount of ROS, organisms are equipped with a sufficient amount of antioxidants together with NF-E2-related factor-2 (NRF2), a transcription factor that plays a key role in the protection of organisms against environmental or intracellular stresses. While the NRF2 activity has been generally viewed as beneficial to preserve the integrity of organisms, recent studies have demonstrated that cancer cells hijack the NRF2 activity to survive under the oxidative stress and, therefore, a close check must be kept on the NRF2 activity in cancer. In the present review, we briefly highlight important progresses in understanding the molecular mechanism, structure, and function of KEAP1 and NRF2 interaction. In addition, we provide general perspectives that justify conflicting views on the NRF2 activity in cancer. PMID:27340506

  5. Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity.

    PubMed

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han

    2015-10-01

    Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. PMID:26325428

  6. Combating oxidative stress in diabetic complications with Nrf2 activators: how much is too much?

    PubMed

    Tan, Sih Min; de Haan, Judy B

    2014-05-01

    Diabetes is increasing at an alarming rate and, despite anti-hypertensive and insulin therapies, diabetic patients are still at risk of developing complications such as chronic kidney disease, cardiovascular disease, and retinopathy. There is therefore an urgent need for more effective therapies to prevent the development and progression of diabetic complications. Oxidative stress is a major player in the aetiology of diabetic complications. However, results from clinical trials thus far using general antioxidants have been disappointing. Mechanism-based antioxidants have gained considerable attention due to their more targeted approach at reducing oxidative stress and associated complications in diabetes. The transcription factor, NFE2-related factor 2 (Nrf2), is a master regulator of redox homeostasis and the cellular detoxification response. Instead of relying on a single antioxidant, activation of Nrf2 results in the concerted upregulation of several antioxidant enzymes and cytoprotective genes, making it an attractive therapeutic target for diabetic complications. Several Nrf2 activators have been discovered and have proven effective at activating Nrf2 signalling through different mechanisms in both in vitro and in vivo models of diabetes. This review will address some of the most promising and well-known Nrf2 activators and their roles in preventing the development and progression of diabetic complications. Challenges facing the advancement of this drug class into the clinic will be discussed, as will be the future of Nrf2 activation as a therapeutic strategy in preventing the development of diabetic complications.

  7. Induction of human fetal hemoglobin via the NRF2 antioxidant response signaling pathway.

    PubMed

    Macari, Elizabeth R; Lowrey, Christopher H

    2011-06-01

    Although hematopoietic stem cell transplantation and gene therapy have the potential to cure β-thalassemia and sickle cell disease, they are not currently available to most people with these diseases. In the near term, pharmacologic induction of fetal hemoglobin (HbF) may offer the best possibility for safe, effective, and widely available therapy. In an effort to define new pathways for targeted drug development for HbF induction, we evaluated the nuclear factor erythroid 2-related factor 2 (NRF2) antioxidant response element signaling pathway. We found that 3 well-known activators of this pathway increased γ-globin mRNA at nontoxic doses in K562 cells. Tert-butylhydroquinone (tBHQ), the most active of these compounds, increased cellular levels and nuclear translocation of NRF2 and binding of NRF2 to the γ-globin promoter. siRNA knockdown of NRF2 inhibited γ-globin induction by tBHQ. When tested in human primary erythroid cells, tBHQ induced NRF2 binding to the γ-globin promoter, increased γ-globin mRNA and HbF, and suppressed β-globin mRNA and HbA, resulting in a > 3-fold increase in the percentage of HbF. These results suggest that drugs that activate the NRF2/antioxidant response element signaling pathway have the potential to induce therapeutic levels of HbF in people with β-hemoglobinopathies.

  8. Downregulation of Nuclear Factor Erythroid 2-Related Factor and Associated Antioxidant Genes Contributes to Redox-Sensitive Vascular Dysfunction in Hypertension.

    PubMed

    Lopes, Rhéure A; Neves, Karla B; Tostes, Rita C; Montezano, Augusto C; Touyz, Rhian M

    2015-12-01

    Oxidative stress is implicated in vascular dysfunction in hypertension. Although mechanisms regulating vascular pro-oxidants are emerging, there is a paucity of information on antioxidant systems, particularly nuclear factor erythroid 2-related factor (Nrf2), a master regulator of antioxidants enzymes. We evaluated the vascular regulatory role of Nrf2 in hypertension and examined molecular mechanisms, whereby Nrf2 influences redox signaling in small arteries and vascular smooth muscle cells from Wistar Kyoto (WKY) and stroke-prone spontaneously hypertensive rats (SHRSP). Cells were stimulated with angiotensin II in the absence/presence of Nrf2 activators (bardoxolone/L-sulforaphane). Increased vascular reactive oxygen species production (chemiluminescence and amplex red) was associated with reduced Nrf2 activity in arteries (18%) and vascular smooth muscle cells (48%) in SHRSP (P<0.05 versus WKY). Expression of antioxidant enzymes, including superoxide dismutase-1 (64%), catalase (60%), peroxiredoxin 1 (75%), and glutathione peroxidase (54%), was reduced in SHRSP. L-sulforaphane reversed these effects. Angiotensin II increased nuclear accumulation of Nrf2 in vascular smooth muscle cells from WKY (197% versus vehicle), with blunted effects in SHRSP (44% versus vehicle). These responses were associated with increased antioxidant expression (superoxide dismutase-1, 32%; catalase, 42%; thioredoxin, 71%; peroxiredoxin, 1%-90%; quinone oxidoreductase, 84%; P<0.05 versus vehicle) and increased activity of superoxide dismutase-1, catalase, and thioredoxin in WKY but not in SHRSP, which exhibited increased Bach1 expression. Nrf2 activators blocked angiotensin II-induced reactive oxygen species generation. Vascular function demonstrated increased contractility (Emax WKY 113.4±5.6 versus SHRSP 159.0±8.3) and decreased endothelial-dependent relaxation (Emax WKY 88.6±3.1 versus SHRSP 74.6±3.2, P<0.05) in SHRSP, effects corrected by L-sulforaphane. Our findings suggest that

  9. Nrf2 reduces allergic asthma in mice through enhanced airway epithelial cytoprotective function.

    PubMed

    Sussan, Thomas E; Gajghate, Sachin; Chatterjee, Samit; Mandke, Pooja; McCormick, Sarah; Sudini, Kuladeep; Kumar, Sarvesh; Breysse, Patrick N; Diette, Gregory B; Sidhaye, Venkataramana K; Biswal, Shyam

    2015-07-01

    Asthma development and pathogenesis are influenced by the interactions of airway epithelial cells and innate and adaptive immune cells in response to allergens. Oxidative stress is an important mediator of asthmatic phenotypes in these cell types. Nuclear erythroid 2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that is the key regulator of the response to oxidative and environmental stress. We previously demonstrated that Nrf2-deficient mice have heightened susceptibility to asthma, including elevated oxidative stress, inflammation, mucus, and airway hyperresponsiveness (AHR) (Rangasamy T, Guo J, Mitzner WA, Roman J, Singh A, Fryer AD, Yamamoto M, Kensler TW, Tuder RM, Georas SN, Biswal S. J Exp Med 202: 47-59, 2005). Here we dissected the role of Nrf2 in lung epithelial cells and tested whether genetic or pharmacological activation of Nrf2 reduces allergic asthma in mice. Cell-specific activation of Nrf2 in club cells of the airway epithelium significantly reduced allergen-induced AHR, inflammation, mucus, Th2 cytokine secretion, oxidative stress, and airway leakiness and increased airway levels of tight junction proteins zonula occludens-1 and E-cadherin. In isolated airway epithelial cells, Nrf2 enhanced epithelial barrier function and increased localization of zonula occludens-1 to the cell surface. Pharmacological activation of Nrf2 by 2-trifluoromethyl-2'-methoxychalone during the allergen challenge was sufficient to reduce allergic inflammation and AHR. New therapeutic options are needed for asthma, and this study demonstrates that activation of Nrf2 in lung epithelial cells is a novel potential therapeutic target to reduce asthma susceptibility.

  10. Nrf2 induces cisplatin resistance through activation of autophagy in ovarian carcinoma

    PubMed Central

    Bao, Ling-Jie; Jaramillo, Melba C; Zhang, Zhen-Bo; Zheng, Yun-Xi; Yao, Ming; Zhang, Donna D; Yi, Xiao-Fang

    2014-01-01

    Cisplatin resistance is a major problem affecting ovarian carcinoma treatment. NF-E2-related factor 2 (Nrf2), a nuclear transcription factor, plays an important role in chemotherapy resistance. However, the underlying mechanism by which Nrf2 mediates cisplatin chemoresistance is unclear. Methods: The human ovarian carcinoma cell line, A2780, and its cisplatin-resistant variant, A2780cp were cultivated. Cell viability was determined with WST-8 assay. Western blot was applied to detect the expression of Nrf2, Nrf2 target genes, and autophagy-related proteins. RNA interference was used to knock down target genes. Annexin V and propidium iodide (PI) staining was utilized to quantify apoptosis. The ultrastructural analysis of autophagosomes was performed by transmission electron microscopy (TEM). Results: Nrf2 and its targeting genes, NQO1 and HO-1, are overexpressed in A2780cp cells compared with A2780 cells. Knocking down Nrf2 sensitized A2780cp cells to cisplatin treatment and decreased autophagy-related genes, Atg3, Atg6, Atg12 and p62 in both mRNA and protein levels. Furthermore, we demonstrated that in both cell lines cisplatin could induce the formation of autophagosomes and upregulate the expression of autophagy-related genes Atg3, Atg6 and Atg12. Treatment with an autophagy inhibitor, 3-Methyladenine (3-MA), or beclin 1 siRNA enhanced cisplatin-induced cell death in A2780cp cells, suggesting that inhibition of autophagy renders resistant cells to be more sensitive to cisplatin. Taken together, Nrf2 signaling may regulate cisplatin resistance by activating autophagy. Conclusions: Nrf2-activated autophagy may function as a novel mechanism causing cisplatin-resistance. PMID:24817946

  11. Nrf2:INrf2 (Keap1) signaling in oxidative stress.

    PubMed

    Kaspar, James W; Niture, Suryakant K; Jaiswal, Anil K

    2009-11-01

    Nrf2:INrf2 (Keap1) are cellular sensors of chemical- and radiation-induced oxidative and electrophilic stress. Nrf2 is a nuclear transcription factor that controls the expression and coordinated induction of a battery of defensive genes encoding detoxifying enzymes and antioxidant proteins. This is a mechanism of critical importance for cellular protection and cell survival. Nrf2 is retained in the cytoplasm by an inhibitor, INrf2 which functions as an adapter for Cul3/Rbx1-mediated degradation of Nrf2. In response to oxidative/electrophilic stress, Nrf2 is switched on and then off by distinct early and delayed mechanisms. Oxidative/electrophilic modification of INrf2 cysteine 151 and/or protein kinase C phosphorylation of Nrf2 serine 40 results in the escape or release of Nrf2 from INrf2. Nrf2 is stabilized and translocates to the nucleus, forms heterodimers with unknown proteins, and binds the antioxidant response element, which leads to coordinated activation of gene expression. It takes less than 15 min from the time of exposure to switch on nuclear import of Nrf2. This is followed by activation of a delayed mechanism that controls the switching off of Nrf2 activation of gene expression. GSK3beta phosphorylates Fyn at an unknown threonine residue(s), leading to the nuclear localization of Fyn. Fyn phosphorylates Nrf2 tyrosine 568, resulting in the nuclear export of Nrf2, binding with INrf2, and degradation of Nrf2. The switching on and off of Nrf2 protects cells against free radical damage, prevents apoptosis, and promotes cell survival.

  12. Partial contribution of the Keap1-Nrf2 system to cadmium-mediated metallothionein expression in vascular endothelial cells.

    PubMed

    Shinkai, Yasuhiro; Kimura, Tomoki; Itagaki, Ayaka; Yamamoto, Chika; Taguchi, Keiko; Yamamoto, Masayuki; Kumagai, Yoshito; Kaji, Toshiyuki

    2016-03-15

    Cadmium is an environmental electrophile that modifies protein reactive thiols such as Kelch-like ECH-associated protein 1 (Keap1), a negative regulator of nuclear factor-erythroid 2-related factor 2 (Nrf2). In the present study, we investigated a role of the Keap1-Nrf2 system in cellular response to cadmium in vascular endothelial cells. Exposure of bovine aortic endothelial cells to cadmium resulted in modification of Keap1 and Nrf2 activation, thereby up-regulating not only its typical downstream proteins but also metallothionein-1/2. Experiments with siRNA-mediated knockdown of Nrf2 or Keap1 supported participation of the Keap1-Nrf2 system in the modulation of metallothionein-1/2 expression. Furthermore, chromatin immunoprecipitation assay showed that Nrf2 was recruited to the antioxidant response element of the promoter region of the bovine metallothionein-2 gene in the presence of cadmium. These results suggest that the transcription factor Nrf2 plays, at least in part, a role in the changes in metallothionein expression mediated by exposure to cadmium.

  13. Escin activates AKT-Nrf2 signaling to protect retinal pigment epithelium cells from oxidative stress.

    PubMed

    Wang, Kaijun; Jiang, Yiqian; Wang, Wei; Ma, Jian; Chen, Min

    2015-12-25

    Here we explored the anti-oxidative and cytoprotective potentials of escin, a natural triterpene-saponin, against hydrogen peroxide (H2O2) in retinal pigment epithelium (RPE) cells. We showed that escin remarkably attenuated H2O2-induced death and apoptosis of established (ARPE-19) and primary murine RPE cells. Meanwhile, ROS production and lipid peroxidation by H2O2 were remarkably inhibited by escin. Escin treatment in RPE cells resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by transcription of anti-oxidant-responsive element (ARE)-regulated genes, including HO-1, NQO-1 and SRXN-1. Knockdown of Nrf2 through targeted shRNAs/siRNAs alleviated escin-mediated ARE gene transcription, and almost abolished escin-mediated anti-oxidant activity and RPE cytoprotection against H2O2. Reversely, escin was more potent against H2O2 damages in Nrf2-over-expressed ARPE-19 cells. Further studies showed that escin-induced Nrf2 activation in RPE cells required AKT signaling. AKT inhibitors (LY294002 and perifosine) blocked escin-induced AKT activation, and dramatically inhibited Nrf2 phosphorylation, its cytosol accumulation and nuclear translocation in RPE cells. Escin-induced RPE cytoprotection against H2O2 was also alleviated by the AKT inhibitors. Together, these results demonstrate that escin protects RPE cells from oxidative stress possibly through activating AKT-Nrf2 signaling. PMID:26505797

  14. Protective effects of nuclear factor erythroid 2-related factor 2 on whole body heat stress-induced oxidative damage in the mouse testis

    PubMed Central

    2013-01-01

    Background Whole body heat stress had detrimental effect on male reproductive function. It's known that the nuclear factor erythroid 2-related factor 2 (Nrf2) activates expression of cytoprotective genes to enable cell adaptation to protect against oxidative stress. However, it’s still unclear about the exactly effects of Nrf2 on the testis. Here, we investigate the protective effect of Nrf2 on whole body heat stress-induced oxidative damage in mouse testis. Methods Male mice were exposed to the elevated ambient temperature (42°C) daily for 2 h. During the period of twelve consecutive days, mice were sacrificed on days 1, 2, 4, 8 and 12 immediately following heat exposure. Testes weight, enzymatic antioxidant activities and concentrations of malondialdehyde (MDA) and glutathione (GSH) in the testes were determined and immunohistochemical detection of Nrf2 protein and mRNA expression of Nrf2-regulated genes were analyzed to assess the status of Nrf2-antioxidant system. Results Heat-exposed mice presented significant increases in rectal, scrotal surface and body surface temperature. The concentrations of cortisol and testosterone in serum fluctuated with the number of exposed days. There were significant decrease in testes weight and relative testes weight on day 12 compared with those on other days, but significant increases in catalase (CAT) activity on day 1 and GSH level on day 4 compared with control group. The activities of total superoxide dismutase (T-SOD) and copper-zinc SOD (CuZn-SOD) increased significantly on days 8 and 12. Moreover, prominent nuclear accumulation of Nrf2 protein was observed in Leydig cells on day 2, accompanying with up-regulated mRNA levels of Nrf2-regulated genes such as Nrf2, heme oxygenase 1 (HO-1), γ-Glutamylcysteine synthetase (GCLC) and NAD (P) H: quinone oxidoreductase 1 (NQO1)) in heat-treated groups. Conclusions These results suggest that Nrf2 displayed nuclear accumulation and protective activity in the process of heat

  15. Suppression of NRF2-ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells.

    PubMed

    Peng, Hui; Wang, Huihui; Xue, Peng; Hou, Yongyong; Dong, Jian; Zhou, Tong; Qu, Weidong; Peng, Shuangqing; Li, Jin; Carmichael, Paul L; Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E; Pi, Jingbo

    2016-02-01

    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2-ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As2O3), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2-ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As2O3-challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2-ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As2O3-induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As2O3-induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2-ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents.

  16. Estrogen increases Nrf2 activity through activation of the PI3K pathway in MCF-7 breast cancer cells

    SciTech Connect

    Wu, Juanjuan; Williams, Devin; Walter, Grant A.; Thompson, Winston E.; Sidell, Neil

    2014-11-01

    The actions of the transcription factor Nuclear factor erythroid 2-related factor (Nrf2) in breast cancer have been shown to include both pro-oncogenic and anti-oncogenic activities which is influenced, at least in part, by the hormonal environment. However, direct regulation of Nrf2 by steroid hormones (estrogen and progesterone) has received only scant attention. Nrf2 is known to be regulated by its cytosolic binding protein, Kelch-like ECH-associated protein 1 (Keap1), and by a Keap1-independent mechanism involving a series of phosphorylation steps mediated by phosphatidylinositol 3-kinase (PI3K) and glycogen synthase kinase 3 beta (GSK3β). Here, we report that estrogen (E2) increases Nrf2 activity in MCF7 breast cancer cells through activation of the PI3K/GSK3β pathway. Utilizing antioxidant response element (ARE)-containing luciferase reporter constructs as read-outs for Nrf2 activity, our data indicated that E2 increased ARE activity >14-fold and enhanced the action of the Nrf2 activators, tertiary butylhydroquinone (tBHQ) and sulforaphane (Sul) 4 to 9 fold compared with cells treated with tBHQ or Sul as single agents. This activity was shown to be an estrogen receptor-mediated phenomenon and was antagonized by progesterone. In addition to its action on the reporter constructs, mRNA and protein levels of heme oxygenase 1, an endogenous target gene of Nrf2, was markedly upregulated by E2 both alone and in combination with tBHQ. Importantly, E2-induced Nrf2 activation was completely suppressed by the PI3K inhibitors LY294002 and Wortmannin while the GSK3β inhibitor CT99021 upregulated Nrf2 activity. Confirmation that E2 was, at least partly, acting through the PI3K/GSK3β pathway was indicated by our finding that E2 increased the phosphorylation status of both GSK3β and Akt, a well-characterized downstream target of PI3K. Together, these results demonstrate a novel mechanism by which E2 can regulate Nrf2 activity in estrogen receptor-positive breast cancer

  17. Reactive Oxygen Species and Nuclear Factor Erythroid 2-Related Factor 2 Activation in Diabetic Nephropathy: A Hidden Target

    PubMed Central

    Abdo, Shaaban; Zhang, Shao-Ling; Chan, John S.D.

    2015-01-01

    Hyperglycemia, oxidative stress and renin-angiotensin system (RAS) dysfunction have been implicated in diabetic nephropathy (DN) progression, but the underlying molecular mechanisms are far from being fully understood. In addition to the systemic RAS, the existence of a local intrarenal RAS in renal proximal tubular cells has been recognized. Angiotensinogen is the sole precursor of all angiotensins (Ang). Intrarenal reactive oxygen species (ROS) generation, Ang II level and RAS gene expression are up-regulated in diabetes, indicating that intrarenal ROS and RAS activation play an important role in DN. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is one of the major protective processes that occurs in response to intracellular oxidative stress. Nrf2 stimulates an array of antioxidant enzymes that convert excessive ROS to less reactive or less damaging forms. Recent studies have, however, revealed that Nrf2 activation might have other undesirable effects in diabetic animals and in diabetic patients with chronic kidney disease. This mini-review summarizes current knowledge of the relationship between ROS, Nrf2 and intra renal RAS activation in DN progression as well as possible novel target(s) for DN treatment. PMID:26213634

  18. Nrf2 Represses FGF21 During Long-Term High-Fat Diet–Induced Obesity in Mice

    PubMed Central

    Chartoumpekis, Dionysios V.; Ziros, Panos G.; Psyrogiannis, Agathoklis I.; Papavassiliou, Athanasios G.; Kyriazopoulou, Venetsana E.; Sykiotis, Gerasimos P.; Habeos, Ioannis G.

    2011-01-01

    OBJECTIVE Obesity is characterized by chronic oxidative stress. Fibroblast growth factor 21 (FGF21) has recently been identified as a novel hormone that regulates metabolism. NFE2-related factor 2 (Nrf2) is a transcription factor that orchestrates the expression of a battery of antioxidant and detoxification genes under both basal and stress conditions. The current study investigated the role of Nrf2 in a mouse model of long-term high-fat diet (HFD)-induced obesity and characterized its crosstalk to FGF21 in this process. RESEARCH DESIGN AND METHODS Wild-type (WT) and Nrf2 knockout (Nrf2-KO) mice were fed an HFD for 180 days. During this period, food consumption and body weights were measured. Glucose metabolism was assessed by an intraperitoneal glucose tolerance test and intraperitoneal insulin tolerance test. Total RNA was prepared from liver and adipose tissue and was used for quantitative real-time RT-PCR. Fasting plasma was collected and analyzed for blood chemistries. The ST-2 cell line was used for transfection studies. RESULTS Nrf2-KO mice were partially protected from HFD-induced obesity and developed a less insulin-resistant phenotype. Importantly, Nrf2-KO mice had higher plasma FGF21 levels and higher FGF21 mRNA levels in liver and white adipose tissue than WT mice. Thus, the altered metabolic phenotype of Nrf2-KO mice under HFD was associated with higher expression and abundance of FGF21. Consistently, the overexpression of Nrf2 in ST-2 cells resulted in decreased FGF21 mRNA levels as well as in suppressed activity of a FGF21 promoter luciferase reporter. CONCLUSIONS The identification of Nrf2 as a novel regulator of FGF21 expands our understanding of the crosstalk between metabolism and stress defense. PMID:21852674

  19. S-allyl cysteine activates the Nrf2-dependent antioxidant response and protects neurons against ischemic injury in vitro and in vivo.

    PubMed

    Shi, Huanying; Jing, Xu; Wei, Xinbing; Perez, Ruth G; Ren, Manru; Zhang, Xiumei; Lou, Haiyan

    2015-04-01

    Stroke is a devastating clinical condition for which an effective neuroprotective treatment is currently unavailable. S-allyl cysteine (SAC), the most abundant organosulfur compound in aged garlic extract, has been reported to possess neuroprotective effects against stroke. However, the mechanisms underlying its beneficial effects remain poorly defined. The present study tests the hypothesis that SAC attenuates ischemic neuronal injury by activating the nuclear factor erythroid-2-related factor 2 (Nrf2)-dependent antioxidant response in both in vitro and in vivo models. Our findings demonstrate that SAC treatment resulted in an increase in Nrf2 protein levels and subsequent activation of antioxidant response element pathway genes in primary cultured neurons and mice. Exposure of primary neurons to SAC provided protection against oxygen and glucose deprivation-induced oxidative insults. In wild-type (Nrf2(+/+) ) mice, systemic administration of SAC attenuated middle cerebral artery occlusion-induced ischemic damage, a protective effect not observed in Nrf2 knockout (Nrf2(-/-) ) mice. Taken together, these findings provide the first evidence that activation of the Nrf2 antioxidant response by SAC is strongly associated with its neuroprotective effects against experimental stroke and suggest that targeting the Nrf2 pathway may provide therapeutic benefit for the treatment of stroke. The transcription factor Nrf2 is involved in cerebral ischemic disease and may be a promising target for the treatment of stroke. We provide novel evidence that SAC confers neuroprotection against ischemic stroke by activating the antioxidant Nrf2 signaling pathway. ARE, antioxidant response element; GCLC, glutathione cysteine ligase regulatory subunit; GCLM, glutathione cysteine ligase modulatory subunit; HO-1, heme oxygenase-1; JNK, c-Jun N-terminal kinase; Keap1, Kelch-like ECH-associated protein 1; Maf, musculoaponeurotic fibrosarcoma; Nrf2, nuclear factor erythroid-2-related factor 2

  20. S-allyl cysteine activates the Nrf2-dependent antioxidant response and protects neurons against ischemic injury in vitro and in vivo.

    PubMed

    Shi, Huanying; Jing, Xu; Wei, Xinbing; Perez, Ruth G; Ren, Manru; Zhang, Xiumei; Lou, Haiyan

    2015-04-01

    Stroke is a devastating clinical condition for which an effective neuroprotective treatment is currently unavailable. S-allyl cysteine (SAC), the most abundant organosulfur compound in aged garlic extract, has been reported to possess neuroprotective effects against stroke. However, the mechanisms underlying its beneficial effects remain poorly defined. The present study tests the hypothesis that SAC attenuates ischemic neuronal injury by activating the nuclear factor erythroid-2-related factor 2 (Nrf2)-dependent antioxidant response in both in vitro and in vivo models. Our findings demonstrate that SAC treatment resulted in an increase in Nrf2 protein levels and subsequent activation of antioxidant response element pathway genes in primary cultured neurons and mice. Exposure of primary neurons to SAC provided protection against oxygen and glucose deprivation-induced oxidative insults. In wild-type (Nrf2(+/+) ) mice, systemic administration of SAC attenuated middle cerebral artery occlusion-induced ischemic damage, a protective effect not observed in Nrf2 knockout (Nrf2(-/-) ) mice. Taken together, these findings provide the first evidence that activation of the Nrf2 antioxidant response by SAC is strongly associated with its neuroprotective effects against experimental stroke and suggest that targeting the Nrf2 pathway may provide therapeutic benefit for the treatment of stroke. The transcription factor Nrf2 is involved in cerebral ischemic disease and may be a promising target for the treatment of stroke. We provide novel evidence that SAC confers neuroprotection against ischemic stroke by activating the antioxidant Nrf2 signaling pathway. ARE, antioxidant response element; GCLC, glutathione cysteine ligase regulatory subunit; GCLM, glutathione cysteine ligase modulatory subunit; HO-1, heme oxygenase-1; JNK, c-Jun N-terminal kinase; Keap1, Kelch-like ECH-associated protein 1; Maf, musculoaponeurotic fibrosarcoma; Nrf2, nuclear factor erythroid-2-related factor 2

  1. Expression of NRF2 and NRF2-modulated genes in peripheral blood leukocytes of bladder cancer males.

    PubMed

    Reszka, E; Jablonowski, Z; Wieczorek, E; Gromadzinska, J; Jablonska, E; Sosnowski, M; Wasowicz, W

    2013-01-01

    Nuclear factor (erythroid-derived 2)-like 2 (NRF2) is an oxidant-responsive transcription factor involved in induction of antioxidant genes. We assessed NRF2 and selected NRF2-modulated gene expression: glutathione S-transferase A1 and P1 (GSTA1 and GSTP1), mitochondrial superoxide dismutase (SOD2) in blood leukocytes of 51 bladder cancer patients and 90 control males. A significant up-regulation of SOD2 expression (P=0.002) was observed in leukocytes of patients. NRF2 expression was positively correlated with GSTP1 and with SOD2 mRNA level, both in patients and controls. These data suggest disturbances in SOD2 transcription in circulating blood leukocytes of males with bladder cancer. Moreover, concomitant constitutive expression of NRF2 and its target genes may suggest important role of NRF2 transcription factor in positive regulation of antioxidant genes, resulted in enhanced cytoprotection in human peripheral blood leukocytes. PMID:23259779

  2. Electrophilic nitro-fatty acids prevent astrocyte-mediated toxicity to motor neurons in a cell model of familial amyotrophic lateral sclerosis via nuclear factor erythroid 2-related factor activation.

    PubMed

    Diaz-Amarilla, Pablo; Miquel, Ernesto; Trostchansky, Andrés; Trias, Emiliano; Ferreira, Ana M; Freeman, Bruce A; Cassina, Patricia; Barbeito, Luis; Vargas, Marcelo R; Rubbo, Homero

    2016-06-01

    Nitro-fatty acids (NO2-FA) are electrophilic signaling mediators formed in tissues during inflammation, which are able to induce pleiotropic cytoprotective and antioxidant pathways including up regulation of Nuclear factor erythroid 2-related factor 2 (Nrf2) responsive genes. Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease characterized by the loss of motor neurons associated to an inflammatory process that usually aggravates the disease progression. In ALS animal models, the activation of the transcription factor Nrf2 in astrocytes confers protection to neighboring neurons. It is currently unknown whether NO2-FA can exert protective activity in ALS through Nrf2 activation. Herein we demonstrate that nitro-arachidonic acid (NO2-AA) or nitro-oleic acid (NO2-OA) administrated to astrocytes expressing the ALS-linked hSOD1(G93A) induce antioxidant phase II enzyme expression through Nrf2 activation concomitant with increasing intracellular glutathione levels. Furthermore, treatment of hSOD1(G93A)-expressing astrocytes with NO2-FA prevented their toxicity to motor neurons. Transfection of siRNA targeted to Nrf2 mRNA supported the involvement of Nrf2 activation in NO2-FA-mediated protective effects. Our results show for the first time that NO2-FA induce a potent Nrf2-dependent antioxidant response in astrocytes capable of preventing motor neurons death in a culture model of ALS. PMID:27012417

  3. Electrophilic nitro-fatty acids prevent astrocyte-mediated toxicity to motor neurons in a cell model of familial amyotrophic lateral sclerosis via nuclear factor erythroid 2-related factor activation.

    PubMed

    Diaz-Amarilla, Pablo; Miquel, Ernesto; Trostchansky, Andrés; Trias, Emiliano; Ferreira, Ana M; Freeman, Bruce A; Cassina, Patricia; Barbeito, Luis; Vargas, Marcelo R; Rubbo, Homero

    2016-06-01

    Nitro-fatty acids (NO2-FA) are electrophilic signaling mediators formed in tissues during inflammation, which are able to induce pleiotropic cytoprotective and antioxidant pathways including up regulation of Nuclear factor erythroid 2-related factor 2 (Nrf2) responsive genes. Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease characterized by the loss of motor neurons associated to an inflammatory process that usually aggravates the disease progression. In ALS animal models, the activation of the transcription factor Nrf2 in astrocytes confers protection to neighboring neurons. It is currently unknown whether NO2-FA can exert protective activity in ALS through Nrf2 activation. Herein we demonstrate that nitro-arachidonic acid (NO2-AA) or nitro-oleic acid (NO2-OA) administrated to astrocytes expressing the ALS-linked hSOD1(G93A) induce antioxidant phase II enzyme expression through Nrf2 activation concomitant with increasing intracellular glutathione levels. Furthermore, treatment of hSOD1(G93A)-expressing astrocytes with NO2-FA prevented their toxicity to motor neurons. Transfection of siRNA targeted to Nrf2 mRNA supported the involvement of Nrf2 activation in NO2-FA-mediated protective effects. Our results show for the first time that NO2-FA induce a potent Nrf2-dependent antioxidant response in astrocytes capable of preventing motor neurons death in a culture model of ALS.

  4. Sulforaphane Ameliorates Okadaic Acid-Induced Memory Impairment in Rats by Activating the Nrf2/HO-1 Antioxidant Pathway.

    PubMed

    Dwivedi, Subhash; Rajasekar, N; Hanif, Kashif; Nath, Chandishwar; Shukla, Rakesh

    2016-10-01

    Okadaic acid (OKA) causes memory impairment and attenuates nuclear factor erythroid 2-related factor 2 (Nrf2) along with oxidative stress and neuroinflammation in rats. Sulforaphane (dietary isothiocyanate compound), an activator of Nrf2 signaling, exhibits neuroprotective effects. However, the protective effect of sulforaphane in OKA-induced neurotoxicity remains uninvestigated. Therefore, in the present study, the role of sulforaphane in OKA-induced memory impairment in rats was explored. A significant increased Nrf2 expression in the hippocampus and cerebral cortex was observed in trained (Morris water maze) rats, and a significant decreased Nrf2 expression in memory-impaired (OKA, 200 ng icv) rats indicated its involvement in memory function. Sulforaphane administration (5 and 10 mg/kg, ip, days 1 and 2) ameliorates OKA-induced memory impairment in rats. The treatment also restored Nrf2 and its downstream antioxidant protein expression (GCLC, HO-1) and attenuated oxidative stress (ROS, nitrite, GSH), neuroinflammation (NF-κB, TNF-α, IL-10), and neuronal apoptosis in the cerebral cortex and hippocampus of OKA-treated rats. Further, to determine whether modulation of Nrf2 signaling is responsible for the protective effect of sulforaphane, in vitro, Nrf2 siRNA and its downstream HO-1 inhibition studies were carried out in a rat astrocytoma cell line (C6). The protective effects of sulforaphane were abolished with Nrf2 siRNA and HO-1 inhibition in astrocytes. The results suggest that Nrf2-dependent activation of cellular antioxidant machinery results in sulforaphane-mediated protection against OKA-induced memory impairment in rats. Graphical Abstract ᅟ.

  5. Development of Neh2-Luciferase Reporter and Its Application for High Throughput Screening and Real-Time Monitoring of Nrf2 Activators

    PubMed Central

    Smirnova, Natalya A.; Haskew-Layton, Renee E.; Basso, Manuela; Hushpulian, Dmitry M.; Payappilly, Jimmy B.; Speer, Rachel E.; Ahn, Young-Hoon; Rakhman, Ilay; Cole, Philip A.; Pinto, John T.; Ratan, Rajiv R.; Gazaryan, Irina G.

    2011-01-01

    SUMMARY The NF-E2-related factor 2 (Nrf2) is a key transcriptional regulator of antioxidant defense and detoxification. To directly monitor stabilization of Nrf2, we fused its Neh2 domain, responsible for the interaction with its nucleocytoplasmic regulator, Keap1, to firefly luciferase (Neh2-luciferase). We show that Neh2 domain is sufficient for recognition, ubiquitination, and proteasomal degradation of Neh2-luciferase fusion protein. The Neh2-luc reporter system allows direct monitoring of the adaptive response to redox stress and classification of drugs based on the time course of reporter activation. The reporter was used to screen the Spectrum library of 2000 biologically active compounds to identify activators of Nrf2. The most robust and yet nontoxic Nrf2 activators found—nordihydroguaiaretic acid, fisetin, and gedunin—induced astrocyte-dependent neuroprotection from oxidative stress via an Nrf2-dependent mechanism. PMID:21700211

  6. Development of Neh2-luciferase reporter and its application for high throughput screening and real-time monitoring of Nrf2 activators.

    PubMed

    Smirnova, Natalya A; Haskew-Layton, Renee E; Basso, Manuela; Hushpulian, Dmitry M; Payappilly, Jimmy B; Speer, Rachel E; Ahn, Young-Hoon; Rakhman, Ilay; Cole, Philip A; Pinto, John T; Ratan, Rajiv R; Gazaryan, Irina G

    2011-06-24

    The NF-E2-related factor 2 (Nrf2) is a key transcriptional regulator of antioxidant defense and detoxification. To directly monitor stabilization of Nrf2, we fused its Neh2 domain, responsible for the interaction with its nucleocytoplasmic regulator, Keap1, to firefly luciferase (Neh2-luciferase). We show that Neh2 domain is sufficient for recognition, ubiquitination, and proteasomal degradation of Neh2-luciferase fusion protein. The Neh2-luc reporter system allows direct monitoring of the adaptive response to redox stress and classification of drugs based on the time course of reporter activation. The reporter was used to screen the Spectrum library of 2000 biologically active compounds to identify activators of Nrf2. The most robust and yet nontoxic Nrf2 activators found--nordihydroguaiaretic acid, fisetin, and gedunin--induced astrocyte-dependent neuroprotection from oxidative stress via an Nrf2-dependent mechanism. PMID:21700211

  7. Structure activity relationship of phenolic diterpenes from Salvia officinalis as activators of the nuclear factor E2-related factor 2 pathway.

    PubMed

    Fischedick, Justin T; Standiford, Miranda; Johnson, Delinda A; Johnson, Jeffrey A

    2013-05-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor known to activate cytoprotective genes which may be useful in the treatment of neurodegenerative disease. In order to better understand the structure activity relationship of phenolic diterpenes from Salvia officinalis L., we isolated carnosic acid, carnosol, epirosmanol, rosmanol, 12-methoxy-carnosic acid, sageone, and carnosaldehyde using polyamide column, centrifugal partition chromatography, and semi-preparative high performance liquid chromatography. Isolated compounds were screened in vitro for their ability to active the Nrf2 and general cellular toxicity using mouse primary cortical cultures. All compounds except 12-methoxy-carnosic acid were able to activate the antioxidant response element. Furthermore both carnosol and carnoasldehyde were able to induce Nrf2-dependent gene expression as well as protect mouse primary cortical neuronal cultures from H(2)O(2) induced cell death.

  8. Nrf2-mediated redox signaling in arsenic carcinogenesis: a review.

    PubMed

    Sinha, Dona; Biswas, Jaydip; Bishayee, Anupam

    2013-02-01

    Arsenic is a ubiquitous toxic metalloid whose natural leaching from geogenic resources of earths crust into groundwater has become a dreadful health hazard to millions of people across the globe. Arsenic has been documented as a top most potent human carcinogen by Agency of Toxic Substances and Disease Registry. There have been a number of schools of opinions regarding the underlying mechanism of arsenic-induced carcinogenicity, but the theory of oxidative stress generated by arsenic has gained much importance. Imbalance in the cellular redox state and its associated complications have been closely associated with nuclear factor-erythroid 2-related factor 2 (Nrf2), a basic-leucine zipper transcription factor that activates the antioxidant responsive element and electrophilic responsive element, thereby upregulating the expression of a variety of downstream genes. This review has been framed on the lines of differential molecular responses of Nrf2 on arsenic exposure as well as the chemopreventive strategy which may be improvised to regulate Nrf2 in order to combat arsenic-induced oxidative stress and its long-term carcinogenic effect.

  9. Nrf2-mediated redox signaling in arsenic carcinogenesis: a review.

    PubMed

    Sinha, Dona; Biswas, Jaydip; Bishayee, Anupam

    2013-02-01

    Arsenic is a ubiquitous toxic metalloid whose natural leaching from geogenic resources of earths crust into groundwater has become a dreadful health hazard to millions of people across the globe. Arsenic has been documented as a top most potent human carcinogen by Agency of Toxic Substances and Disease Registry. There have been a number of schools of opinions regarding the underlying mechanism of arsenic-induced carcinogenicity, but the theory of oxidative stress generated by arsenic has gained much importance. Imbalance in the cellular redox state and its associated complications have been closely associated with nuclear factor-erythroid 2-related factor 2 (Nrf2), a basic-leucine zipper transcription factor that activates the antioxidant responsive element and electrophilic responsive element, thereby upregulating the expression of a variety of downstream genes. This review has been framed on the lines of differential molecular responses of Nrf2 on arsenic exposure as well as the chemopreventive strategy which may be improvised to regulate Nrf2 in order to combat arsenic-induced oxidative stress and its long-term carcinogenic effect. PMID:22914984

  10. Role of the Keap1/Nrf2 pathway in neurodegenerative diseases.

    PubMed

    Yamazaki, Hiromi; Tanji, Kunikazu; Wakabayashi, Koichi; Matsuura, Shin; Itoh, Ken

    2015-05-01

    As the elderly population increases, a growing number of individuals suffer from age-associated neurodegenerative diseases, such as Alzheimer's disease (AD) and Parkinson's disease (PD). Oxidative stress is considered to play a crucial role in the pathogenesis of age-related diseases. The transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) is activated by oxidative stress and regulates the expression of a variety of antioxidant enzymes and proteins that exert cytoprotective effects against oxidative stress. Numerous studies have addressed the role of Nrf2 in age-related diseases, including neurodegenerative diseases, using animal or in vitro cell culture models. Here, we introduce the role of oxidative stress in the pathogenesis of neurodegenerative diseases and critically examine the recent findings concerning the role for Nrf2 in the amelioration of AD and PD. Nrf2 not only regulates antioxidant proteins but also regulates the genes associated with autophagy and nerve growth factor signaling. Current research unequivocally demonstrates that the activation of the Nrf2 pathway is a promising novel strategy for the prevention and modification of neurodegenerative diseases. PMID:25707882

  11. Linalool attenuates lung inflammation induced by Pasteurella multocida via activating Nrf-2 signaling pathway.

    PubMed

    Wu, Qianchao; Yu, Lijun; Qiu, Jiaming; Shen, Bingyu; Wang, Di; Soromou, Lanan Wassy; Feng, Haihua

    2014-08-01

    Pasteurellosis caused by Pasteurella multocida manifest often as respiratory infection in farmed small ruminants. Although the incidence of pasteurellosis due to P. multocida mainly takes the form of pneumonia, there is limited information on host factors that play a role in disease pathogenesis in the milieu of host-pathogen interactions. Nuclear factor-erythroid 2 related factor 2 (Nrf-2), a critical regulator for various inflammatory and immune responses by controlling oxidative stress, may play an important role in the processes of inflammation induced by P. multocida. In this study, linalool, a natural compound of the essential oils in several aromatic plant species, elevated nuclear Nrf-2 protein translocation in the A549 lung cell line and in vivo. The P. multocida-induced pro-inflammatory cytokines expression was abrogated by Nrf-2 siRNA. Postponed treatment with linalool decreased lung neutrophil accumulation and enhanced clearance of P. multocida. Furthermore, linalool significantly increased the expression of antioxidant enzymes regulated by Nrf-2 and diminished lung tissue levels of several pro-inflammatory cytokines, including tumor necrosis factor α (TNF-α) and interleukin (IL)-6. In addition, animals treated with linalool had a marked improvement in survival. These findings have uncovered that linalool acts as a novel Nrf-2 activator for a novel therapeutic strategy in pathogen-mediated lung inflammation.

  12. Enhanced muscle nutrient content and flesh quality, resulting from tryptophan, is associated with anti-oxidative damage referred to the Nrf2 and TOR signalling factors in young grass carp (Ctenopharyngodon idella): Avoid tryptophan deficiency or excess.

    PubMed

    Jiang, Wei-Dan; Wen, Hai-Lang; Liu, Yang; Jiang, Jun; Wu, Pei; Zhao, Juan; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu; Feng, Lin

    2016-05-15

    Flesh quality, muscle antioxidant status and related signalling molecule expressions were investigated in young grass carp fed six levels of tryptophan (Trp) for 8 weeks. The results indicated that fish fed 0.7 (deficiency) and 6.1g Trp g/kg (excess) diets exhibited lower muscle water-holding capacity, tenderness, cathepsin activity, protein levels, lipids and collagen contents. Optimal Trp reversed these negative effects, which were related to enhanced glutathione (GSH) content and glutathione peroxidase (GPx) activities regulated at gene transcription levels, rather than to superoxide dismutase (SOD) or catalase (CAT). The expression of signalling molecules [Kelch-like ECH-associated protein 1, target of rapamycin (TOR) and ribosomal S6 protein kinase 1] involved in the NF-E2-related factor 2 (Nrf2) pathway revealed a potential method of Trp-enhanced antioxidant defence. Collectively, the present study indicated that appropriate Trp levels improved flesh quality partly related to the enhancement of antioxidant ability through Nrf2 and TOR signalling.

  13. Altered Nrf2 Signaling Mediates Hypoglycemia-Induced Blood–Brain Barrier Endothelial Dysfunction In Vitro

    PubMed Central

    Sajja, Ravi K.; Green, Kayla N.; Cucullo, Luca

    2015-01-01

    Hypoglycemia impairs blood-brain barrier (BBB) endothelial function; a major hallmark in the pathogenesis of various CNS disorders. Previously, we have demonstrated that prolonged hypoglycemic exposure down-regulated BBB endothelial NF-E2 related factor-2 (Nrf2) expression; a redox-sensitive transcriptional factor that regulates endothelial function. Here, we sought to determine the functional role of Nrf2 in preserving BBB integrity and molecular mechanisms underlying hypoglycemia-induced Nrf2 down-regulation in vitro using human cerebral microvascular endothelial cell line (hCMEC/D3). Cell monolayers were exposed to normal or hypoglycemic (5.5 or 2.2mM D-glucose) media for 3-24h. Pharmacological or gene manipulation (by silencing RNA) approaches were used to investigate specific molecular pathways implicated in hypoglycemia-induced Nrf2 degradation. BBB integrity was assessed by paracellular permeability to labeled dextrans of increasing molecular sizes (4-70kDa). Silencing Nrf2 expression in hCMEC/D3 cells abrogated the expression of claudin-5 and VE-cadherin, while ZO-1 was up-regulated. These effects were paralleled by a decrease in electrical resistance of hCMEC/D3 monolayers and potential increase in permeability to all labeled dextrans. Hypoglycemic exposure (3-24h) led to progressive and sustained down-regulation of Nrf2 (without affecting mRNA) and its target, NQO-1, with a concomitant increase in the cytosolic pool of E3 ubiquitin ligase, Siah2 (but not Keap1). Pretreatment with protease inhibitor MG132, or selective knock-down of Siah2 (but not Keap1) significantly attenuated hypoglycemia-induced Nrf2 destabilization. While hypoglycemic exposure triggered a significant increase in BBB permeability to dextrans, silencing Siah2 gene abrogated the effects of hypoglycemia and restored BBB integrity. In summary, our data indicate a potential role for Nrf2 signaling in regulating tight junction integrity and maintaining BBB function. Nrf2 suppression by

  14. Role of the Nrf2-heme oxygenase-1 pathway in silver nanoparticle-mediated cytotoxicity

    SciTech Connect

    Kang, Su Jin; Ryoo, In-geun; Lee, Young Joon; Kwak, Mi-Kyoung

    2012-01-01

    Silver nanoparticles (nano-Ag) have been widely used in various commercial products including textiles, electronic appliances and biomedical products. However, there remains insufficient information on the potential risk of nano-Ag to human health and environment. In the current study, we have investigated the role of NF-E2-related factor 2 (Nrf2) transcription factor in nano-Ag-induced cytotoxicity. When Nrf2 expression was blocked using interring RNA expression in ovarian carcinoma cell line, nano-Ag treatment showed a substantial decrease in cell viability with concomitant increases in apoptosis and DNA damage compared to the control cells. Target gene analysis revealed that the expression of heme oxygenase-1 (HO-1) was highly elevated by nano-Ag in nonspecific shRNA expressing cells, while Nrf2 knockdown cells (NRF2i) did not increase HO-1 expression. The role of HO-1 in cytoprotection against nano-Ag was reinforced by results using pharmacological inducer of HO-1: cobalt protoporphyrin-mediated HO-1 activation in the NRF2i cells prevented nano-Ag-mediated cell death. Similarly, pharmacological or genetic inhibition of HO-1 in nonspecific control cells exacerbated nano-Ag toxicity. As the upstream signaling mechanism, nano-Ag required the phosphoinositide 3-kinase (PI3K) and p38MAPK signaling cascades for HO-1 induction. The treatment with either PI3K inhibitor or p38MAPK inhibitor suppressed HO-1 induction and intensified nano-Ag-induced cell death. Taken together, these results suggest that Nrf2-dependent HO-1 up-regulation plays a protective role in nano-Ag-induced DNA damage and consequent cell death. In addition, nano-Ag-mediated HO-1 induction is associated with the PI3K and p38MAPK signaling pathways. -- Highlights: ► Role of Nrf2 signaling in silver nanoparticle toxicity. ► Silver nanoparticle toxicity is increased by Nrf2 blockade. ► Nrf2-dependent HO-1 induction protects cells from silver nanoparticle toxicity. ► PI3K and p38MAPK cascades are

  15. Nrf2 activation attenuates both orthodontic tooth movement and relapse.

    PubMed

    Kanzaki, H; Shinohara, F; Itohiya-Kasuya, K; Ishikawa, M; Nakamura, Y

    2015-06-01

    During orthodontic tooth movement, osteoclasts resorb the alveolar bone at the compress side of periodontium. Reactive oxygen species (ROS) works as intracellular signaling molecules of RANKL during osteoclastogenesis, although ROS has cytotoxicity against cells such as lipid oxidation. To deal with oxidative stress, cells have a defense system that is scavenging ROS by augmented antioxidative stress enzymes via transcriptional regulation with nuclear factor E2-related factor 2 (Nrf2). Previously, we reported that augmented antioxidative stress enzymes by Nrf2-gene transfer inhibited bone destruction. In the present study, we examined the effects of Nrf2 activation on osteoclastogenesis and, thereby, orthodontic tooth movement and orthodontic relapse. Mouse macrophage cell line RAW264.7 cells were used as osteoclast progenitor cells and stimulated with recombinant RANKL (100 ng/mL) with or without Nrf2 activator sulforaphane (SFN) and epigallocatechin gallate (EGCG) or ROS scavenger catechin. Osteoclastogenesis, resorption activity, and osteoclast marker gene expression were examined. Intracellular ROS was analyzed by flow cytometry. Maxillary first molars of C57BL6 male mice were moved palatally with 0.012-inch NiTi wire (100-mN force); SFN or EGCG was injected into the palatal gingiva once a week; and phosphate buffered saline was injected on the contralateral side. Tooth movement was monitored using a stone model with precise impression, and the amount of the tooth movement was compared among groups. SFN and EGCG significantly, but catechin weakly, inhibited RANKL-mediated osteoclastogenesis in vitro. Western blot analysis revealed that SFN and EGCG augmented the nuclear translocation of Nrf2 and the expression of anti-oxidative stress enzymes such as HO-1, although catechin did not. SFN and EGCG significantly, but catechin weakly, attenuated the intracellular ROS. Finally, animal experiment revealed that both SFN and EGCG successfully inhibited the orthodontic

  16. Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo

    SciTech Connect

    Chian, Song; Thapa, Ruby; Chi, Zhexu; Wang, Xiu Jun; Tang, Xiuwen

    2014-05-16

    Highlights: • Luteolin inhibits the Nrf2 pathway in mouse liver and in xenografted tumors. • Luteolin markedly inhibits the growth of xenograft tumors. • Luteolin enhances the anti-cancer effect of cisplatin in mice in vivo. • Luteolin could serve as an adjuvant in the chemotherapy of NSCLC. - Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) is over-expressed in many types of tumor, promotes tumor growth, and confers resistance to anticancer therapy. Hence, Nrf2 is regarded as a novel therapeutic target in cancer. Previously, we reported that luteolin is a strong inhibitor of Nrf2 in vitro. Here, we showed that luteolin reduced the constitutive expression of NAD(P)H quinone oxidoreductase 1 in mouse liver in a time- and dose-dependent manner. Further, luteolin inhibited the expression of antioxidant enzymes and glutathione transferases, decreasing the reduced glutathione in the liver of wild-type mice under both constitutive and butylated hydroxyanisole-induced conditions. In contrast, such distinct responses were not detected in Nrf2{sup −/−} mice. In addition, oral administration of luteolin, either alone or combined with intraperitoneal injection of the cytotoxic drug cisplatin, greatly inhibited the growth of xenograft tumors from non-small-cell lung cancer (NSCLC) cell line A549 cells grown subcutaneously in athymic nude mice. Cell proliferation, the expression of Nrf2, and antioxidant enzymes were all reduced in tumor xenograft tissues. Furthermore, luteolin enhanced the anti-cancer effect of cisplatin. Together, our findings demonstrated that luteolin inhibits the Nrf2 pathway in vivo and can serve as an adjuvant in the chemotherapy of NSCLC.

  17. Inorganic Arsenic Induces NRF2-Regulated Antioxidant Defenses in Both Cerebral Cortex and Hippocampus in Vivo.

    PubMed

    Zhang, Yang; Duan, Xiaoxu; Li, Jinlong; Zhao, Shuo; Li, Wei; Zhao, Lu; Li, Wei; Nie, Huifang; Sun, Guifang; Li, Bing

    2016-08-01

    Inorganic arsenic is reported to induce the reactive oxygen species-mediated oxidative stress, which is supposed to be one of the main mechanisms of arsenic-related neurological diseases. Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of antioxidant defense systems, up-regulates the expression of target genes to fight against oxidative damages caused by harmful substances, including metals. In the present study, mice were used as a model to investigate the oxidative stress levels and the expressions of NRF2-regulated antioxidant substances in both cerebral cortex and hippocampus with 5, 10 and 20 mg/kg NaAsO2 exposure intra-gastrically. Our results showed that acute NaAsO2 treatment resulted in decreased total anti-oxidative capacity (T-AOC) and increased maleic dialdehyde production in the nervous system. We also detected rapidly elevation of NRF2 protein levels by enhancement of Nrf2 transcription, especially at 20 mg/kg NaAsO2 exposure group. In the meantime, mRNA and protein levels of Nrf2 encoding antioxidant enzymes heme oxygenase-1 (HO-1), NAD(P)H: quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) were consistently elevated time- and dose-dependently both in the cerebral cortex and hippocampus. Taken together, the presence study demonstrated the activation of NRF2 pathway, an early antioxidant defensive response, in both cerebral cortex and hippocampus upon inorganic arsenic (iAs) exposure in vivo. A better knowledge on the roles of NRF2 pathway in maintaining cellular redox homeostasis would be helpful for the strategies on improvement of neurotoxicity related to this metalloid. PMID:27165637

  18. Potential drugs which activate nuclear factor E2-related factor 2 signaling to prevent diabetic cardiovascular complications: A focus on fumaric acid esters.

    PubMed

    Zhou, Shanshan; Jin, Jingpeng; Bai, Tao; Sachleben, Leroy R; Cai, Lu; Zheng, Yang

    2015-08-01

    Diabetes and its cardiovascular complications have been a major public health issue. These complications are mainly attributable to a severe imbalance between free radical and reactive oxygen species production and the antioxidant defense systems. Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that controls the basal and inducible expression of a battery of antioxidant enzyme genes and other cyto-protective phase II detoxifying enzymes. As a result, Nrf2 has gained great attention as a promising drug target for preventing diabetic cardiovascular complications. And while animal studies have shown that several Nrf2 activators manifest a potential to efficiently prevent the diabetic complications, their use in humans has not been approved due to the lack of substantial evidence regarding safety and efficacy of the Nrf2 activation. We provide here a brief review of a few clinically-used drugs that can up-regulate Nrf2 with the potential of extending their usage to diabetic patients for the prevention of cardiovascular complications and conclude with a closer inspection of dimethyl fumarate and its mimic members. PMID:26044512

  19. Modulation of mitochondrial dysfunction in neurodegenerative diseases via activation of nuclear factor erythroid-2-related factor 2 by food-derived compounds.

    PubMed

    Denzer, Isabel; Münch, Gerald; Friedland, Kristina

    2016-01-01

    Oxidative stress and mitochondrial dysfunction are early events in the pathogenesis of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and amyotrophic lateral sclerosis (ALS). Mitochondria are important key players in cellular function based on mitochondrial energy production and their major role in cell physiology. Since neurons are highly depending on mitochondrial energy production due to their high energy demand and their reduced glycolytic capacity mitochondrial dysfunction has fatal consequences for neuronal function and survival. The transcription factor nuclear factor erythroid-2-related factor 2 (Nrf2) is the major regulator of cellular response to oxidative stress. Activation of Nrf2 induces the transcriptional regulation of antioxidant response element (ARE)-dependent expression of a battery of cytoprotective and antioxidant enzymes and proteins. Moreover, activation of Nrf2 protects mitochondria from dysfunction and promotes mitochondrial biogenesis. Therefore, the Nrf2/ARE pathway has become an attractive target for the prevention and treatment of oxidative stress-related neurodegenerative diseases. Small food-derived inducers of the Nrf2/ARE pathway including l-sulforaphane from broccoli and isoliquiritigenin from licorice displayed promising protection of mitochondrial function in models of oxidative stress and neurodegenerative diseases and represent a novel approach to prevent and treat aging-associated neurodegenerative diseases.

  20. Nrf2 as molecular target for polyphenols: A novel therapeutic strategy in diabetic retinopathy.

    PubMed

    Nabavi, Seyed Fazel; Barber, Alistair J; Spagnuolo, Carmela; Russo, Gian Luigi; Daglia, Maria; Nabavi, Seyed Mohammad; Sobarzo-Sánchez, Eduardo

    2016-10-01

    Diabetic retinopathy is a microvascular complication of diabetes that is considered one of the leading causes of blindness among adults. More than 4.4 million people suffer from this disorder throughout the world. Growing evidence suggests that oxidative stress plays a crucial role in the pathophysiology of diabetic retinopathy. Nuclear factor erythroid 2-related factor 2 (Nrf2), a redox sensitive transcription factor, plays an essential protective role in regulating the physiological response to oxidative and electrophilic stress via regulation of multiple genes encoding antioxidant proteins and phase II detoxifying enzymes. Many studies suggest that dozens of natural compounds, including polyphenols, can supress oxidative stress and inflammation through targeting Nrf2 and consequently activating the antioxidant response element-related cytoprotective genes. Therefore, Nrf2 may provide a new therapeutic target for treatment of diabetic retinopathy. In the present article, we will focus on the role of Nrf2 in diabetic retinopathy and the ability of polyphenols to target Nrf2 as a therapeutic strategy.

  1. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician's Expectation Be Matched by the Reality?

    PubMed Central

    Houghton, Christine A.; Fassett, Robert G.; Coombes, Jeff S.

    2016-01-01

    The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements. PMID:26881038

  2. Sofalcone, a gastric mucosa protective agent, increases vascular endothelial growth factor via the Nrf2-heme-oxygenase-1 dependent pathway in gastric epithelial cells

    SciTech Connect

    Shibuya, Akiko; Onda, Kenji; Kawahara, Hirofumi; Uchiyama, Yuka; Nakayama, Hiroko; Omi, Takamasa; Nagaoka, Masayoshi; Matsui, Hirofumi; Hirano, Toshihiko

    2010-07-30

    Research highlights: {yields} Sofalcone increases HO-1 in gastric epithelial cells. {yields} The induction of HO-1 by sofalcone treatment follows the activation of Nrf2. {yields} The production of VEGF by sofalcone treatment is mediated by HO-1 induction. -- Abstract: Sofalcone, 2'-carboxymethoxy-4,4-bis(3-methyl-2-butenyloxy)chalcone, is an anti-ulcer agent that is classified as a gastric mucosa protective agent. Recent studies indicate heat shock proteins such as HSP32, also known as heme-oxygenase-1(HO-1), play important roles in protecting gastrointestinal tissues from several stresses. We have previously reported that sofalcone increases the expression of HO-1 in adipocytes and pre-adipocytes, although the effect of sofalcone on HO-1 induction in gastrointestinal tissues is not clear. In the current study, we investigated the effects of sofalcone on the expression of HO-1 and its functional role in rat gastric epithelial (RGM-1) cells. We found that sofalcone increased HO-1 expression in RGM-1 cells in both time- and concentration-dependent manners. The HO-1 induction was associated with the nuclear translocation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) in RGM-1 cells. We also observed that sofalcone increased vascular endothelial growth factor (VEGF) production in the culture medium. Treatment of RGM-1 cells with an HO-1 inhibitor (tin-protoporphyrin), or HO-1 siRNA inhibited sofalcone-induced VEGF production, suggesting that the effect of sofalcone on VEGF expression is mediated by the HO-1 pathway. These results suggest that the gastroprotective effects of sofalcone are partly exerted via Nrf2-HO-1 activation followed by VEGF production.

  3. Activation of nuclear factor erythroid 2-related factor 2 coordinates dimethylarginine dimethylaminohydrolase/PPAR-γ/endothelial nitric oxide synthase pathways that enhance nitric oxide generation in human glomerular endothelial cells.

    PubMed

    Luo, Zaiming; Aslam, Shakil; Welch, William J; Wilcox, Christopher S

    2015-04-01

    Dimethylarginine dimethylaminohydrolase (DDAH) degrades asymmetric dimethylarginine, which inhibits nitric oxide (NO) synthase (NOS). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that binds to antioxidant response elements and transcribes many antioxidant genes. Because the promoters of the human DDAH-1 and DDAH-2, endothelial NOS (eNOS) and PPAR-γ genes contain 2 to 3 putative antioxidant response elements, we hypothesized that they were regulated by Nrf2/antioxidant response element. Incubation of human renal glomerular endothelial cells with the Nrf2 activator tert-butylhydroquinone (20 μmol·L(-1)) significantly (P<0.05) increased NO and activities of NOS and DDAH and decreased asymmetric dimethylarginine. It upregulated genes for hemoxygenase-1, eNOS, DDAH-1, DDAH-2, and PPAR-γ and partitioned Nrf2 into the nucleus. Knockdown of Nrf2 abolished these effects. Nrf2 bound to one antioxidant response element on DDAH-1 and DDAH-2 and PPAR-γ promoters but not to the eNOS promoter. An increased eNOS and phosphorylated eNOS (P-eNOSser-1177) expression with tert-butylhydroquinone was prevented by knockdown of PPAR-γ. Expression of Nrf2 was reduced by knockdown of PPAR-γ, whereas PPAR-γ was reduced by knockdown of Nrf2, thereby demonstrating 2-way positive interactions. Thus, Nrf2 transcribes HO-1 and other genes to reduce reactive oxygen species, and DDAH-1 and DDAH-2 to reduce asymmetric dimethylarginine and PPAR-γ to increase eNOS and its phosphorylation and activity thereby coordinating 3 pathways that enhance endothelial NO generation. PMID:25691623

  4. Recent Updates on Acetaminophen Hepatotoxicity: The Role of Nrf2 in Hepatoprotection

    PubMed Central

    Gum, Sang Il

    2013-01-01

    Acetaminophen (APAP) known as paracetamol is the main ingredient in Tylenol, which has analgesic and anti-pyretic properties. Inappropriate use of APAP causes major morbidity and mortality secondary to hepatic failure. Overdose of APAP depletes the hepatic glutathione (GSH) rapidly, and the metabolic intermediate leads to hepatocellular death. This article reviews the mechanisms of hepatotoxicity and provides an overview of current research studies. Pharmacokinetics including metabolism (activation and detoxification), subsequent transport (efflux)-facilitating excretion, and some other aspects related to toxicity are discussed. Nuclear factor erythroid 2-related factor 2 (Nrf2)-regulated gene battery plays a critical role in the multiple steps associated with the mitigation of APAP toxicity. The role of Nrf2 as a protective target is described, and potential natural products inhibiting APAP toxicity are outlined. This review provides an update on the mechanism of APAP toxicity and highlights the beneficial role of Nrf2 and specific natural products in hepatoprotection. PMID:24386516

  5. Identification of Chromomoric Acid C-I as an Nrf2 Activator in Chromolaena odorata

    PubMed Central

    2014-01-01

    Activation of nuclear factor-erythroid 2-related factor 2 (Nrf2) contributes to several beneficial bioactivities of natural products, including induction of an increased cellular stress resistance and prevention or resolution of inflammation. In this study, the potential of a crude leaf extract of Chromolaena odorata, traditionally used against inflammation and skin lesions, was examined for Nrf2 activation. Guided by an Nrf2-dependent luciferase reporter gene assay, the phytoprostane chromomoric acid C-I (1) was identified as a potent Nrf2 activator from C. odorata with a CD (concentration doubling the response of vehicle-treated cells) of 5.2 μM. When tested at 1–10 μM, 1 was able to induce the endogenous Nrf2 target gene heme oxygenase 1 (HO-1) in fibroblasts. Between 2 and 5 μM, compound 1 induced HO-1 in vascular smooth muscle cells (VSMC) and inhibited their proliferation in a HO-1-dependent manner, without eliciting signs of cytotoxicity. PMID:24476568

  6. Identification of chromomoric acid C-I as an Nrf2 activator in Chromolaena odorata.

    PubMed

    Heiss, Elke H; Tran, Thi Van Anh; Zimmermann, Kristin; Schwaiger, Stefan; Vouk, Corina; Mayerhofer, Barbara; Malainer, Clemens; Atanasov, Atanas G; Stuppner, Hermann; Dirsch, Verena M

    2014-03-28

    Activation of nuclear factor-erythroid 2-related factor 2 (Nrf2) contributes to several beneficial bioactivities of natural products, including induction of an increased cellular stress resistance and prevention or resolution of inflammation. In this study, the potential of a crude leaf extract of Chromolaena odorata, traditionally used against inflammation and skin lesions, was examined for Nrf2 activation. Guided by an Nrf2-dependent luciferase reporter gene assay, the phytoprostane chromomoric acid C-I (1) was identified as a potent Nrf2 activator from C. odorata with a CD (concentration doubling the response of vehicle-treated cells) of 5.2 μM. When tested at 1-10 μM, 1 was able to induce the endogenous Nrf2 target gene heme oxygenase 1 (HO-1) in fibroblasts. Between 2 and 5 μM, compound 1 induced HO-1 in vascular smooth muscle cells (VSMC) and inhibited their proliferation in a HO-1-dependent manner, without eliciting signs of cytotoxicity.

  7. Phytoestrogens modulate hepcidin expression by Nrf2: Implications for dietary control of iron absorption

    PubMed Central

    Bayele, Henry K.; Balesaria, Sara; Srai, Surjit K.S.

    2015-01-01

    Hepcidin is a liver-derived antimicrobial peptide that regulates iron absorption and is also an integral part of the acute phase response. In a previous report, we found evidence that this peptide could also be induced by toxic heavy metals and xenobiotics, thus broadening its teleological role as a defensin. However it remained unclear how its sensing of disparate biotic and abiotic stressors might be integrated at the transcriptional level. We hypothesized that its function in cytoprotection may be regulated by NFE2-related factor 2 (Nrf2), the master transcriptional controller of cellular stress defenses. In this report, we show that hepcidin regulation is inextricably linked to the acute stress response through Nrf2 signaling. Nrf2 regulates hepcidin expression from a prototypical antioxidant response element in its promoter, and by synergizing with other basic leucine-zipper transcription factors. We also show that polyphenolic small molecules or phytoestrogens commonly found in fruits and vegetables including the red wine constituent resveratrol can induce hepcidin expression in vitro and post-prandially, with concomitant reductions in circulating iron levels and transferrin saturation by one such polyphenol quercetin. Furthermore, these molecules derepress hepcidin promoter activity when its transcription by Nrf2 is repressed by Keap1. Taken together, the data show that hepcidin is a prototypical antioxidant response or cytoprotective gene within the Nrf2 transcriptional circuitry. The ability of phytoestrogens to modulate hepcidin expression in vivo suggests a novel mechanism by which diet may impact iron homeostasis. PMID:26546695

  8. Phytoestrogens modulate hepcidin expression by Nrf2: Implications for dietary control of iron absorption.

    PubMed

    Bayele, Henry K; Balesaria, Sara; Srai, Surjit K S

    2015-12-01

    Hepcidin is a liver-derived antimicrobial peptide that regulates iron absorption and is also an integral part of the acute phase response. In a previous report, we found evidence that this peptide could also be induced by toxic heavy metals and xenobiotics, thus broadening its teleological role as a defensin. However it remained unclear how its sensing of disparate biotic and abiotic stressors might be integrated at the transcriptional level. We hypothesized that its function in cytoprotection may be regulated by NFE2-related factor 2 (Nrf2), the master transcriptional controller of cellular stress defenses. In this report, we show that hepcidin regulation is inextricably linked to the acute stress response through Nrf2 signaling. Nrf2 regulates hepcidin expression from a prototypical antioxidant response element in its promoter, and by synergizing with other basic leucine-zipper transcription factors. We also show that polyphenolic small molecules or phytoestrogens commonly found in fruits and vegetables including the red wine constituent resveratrol can induce hepcidin expression in vitro and post-prandially, with concomitant reductions in circulating iron levels and transferrin saturation by one such polyphenol quercetin. Furthermore, these molecules derepress hepcidin promoter activity when its transcription by Nrf2 is repressed by Keap1. Taken together, the data show that hepcidin is a prototypical antioxidant response or cytoprotective gene within the Nrf2 transcriptional circuitry. The ability of phytoestrogens to modulate hepcidin expression in vivo suggests a novel mechanism by which diet may impact iron homeostasis.

  9. Astrocyte NMDA receptors' activity sustains neuronal survival through a Cdk5–Nrf2 pathway

    PubMed Central

    Jimenez-Blasco, D; Santofimia-Castaño, P; Gonzalez, A; Almeida, A; Bolaños, J P

    2015-01-01

    Neurotransmission unavoidably increases mitochondrial reactive oxygen species. However, the intrinsic antioxidant defense of neurons is weak and hence the mechanism whereby these cells are physiologically protected against oxidative damage is unknown. Here we found that the antioxidant defense of neurons is repressed owing to the continuous protein destabilization of the master antioxidant transcriptional activator, nuclear factor-erythroid 2-related factor-2 (Nrf2). By contrast, Nrf2 is highly stable in neighbor astrocytes explaining their robust antioxidant defense and resistance against oxidative stress. We also show that subtle and persistent stimulation of N-methyl-d-aspartate receptors (NMDAR) in astrocytes, through a mechanism not requiring extracellular Ca2+ influx, upregulates a signal transduction pathway involving phospholipase C-mediated endoplasmic reticulum release of Ca2+ and protein kinase Cδ activation. Active protein kinase Cδ promotes, by phosphorylation, the stabilization of p35, a cyclin-dependent kinase-5 (Cdk5) cofactor. Active p35/Cdk5 complex in the cytosol phosphorylates Nrf2 at Thr395, Ser433 and Thr439 that is sufficient to promote Nrf2 translocation to the nucleus and induce the expression of antioxidant genes. Furthermore, this Cdk5–Nrf2 transduction pathway boosts glutathione metabolism in astrocytes efficiently protecting closely spaced neurons against oxidative damage. Thus, intercellular communication through NMDAR couples neurotransmission with neuronal survival. PMID:25909891

  10. Activation of Nrf2-ARE signal pathway in hippocampus of amygdala kindling rats.

    PubMed

    Wang, Wei; Wang, Wei-Ping; Zhang, Guo-Liang; Wu, Yan-Fen; Xie, Tao; Kan, Min-Chen; Fang, Hai-Bo; Wang, Hong-Chao

    2013-05-24

    Oxidative stress resulting from excessive free-radical release is likely implicated in the initiation and progression of epilepsy. Therefore, antioxidant therapies have received considerable attention in epilepsy treatment. It is well known that the transcription factor NF-E2-related factor (Nrf2) binds to antioxidant response element (ARE) to induce antioxidant and phase II detoxification enzymes under conditions of oxidative stress, which reduces oxidative stress and accumulation of toxic metabolites. However, whether Nrf2-ARE pathway is activated after seizure has not been studied. In the present study, Wistar rats were rapidly kindled in the amygdala. Twenty-four hours after the last seizure, the hippocampus of control, sham and kindled rats were examined for oxidative stress parameters (malondialdehyde and glutathione) by spectrophotometry, the expression of Nrf2, heme oxygenase-1 (HO-1) and NAD(P)H: quinone oxidoreductase-1 (NQO1) were determined using immunohistochemistry, Western blot and real-time fluorescence quantitative polymerase chain reaction (PCR). The results showed that the kindled seizures induced oxidative stress, the expression of Nrf2, HO-1 and NQO1 at protein or gene levels significantly increased in hippocampus after seizure. According to these results, it could be postulated that Nrf2-ARE signal pathway was activated in the hippocampus after seizure.

  11. Tert-butylhydroquinone ameliorates doxorubicin-induced cardiotoxicity by activating Nrf2 and inducing the expression of its target genes

    PubMed Central

    Wang, Lin-Feng; Su, Su-Wen; Wang, Lei; Zhang, Guo-Qiang; Zhang, Rong; Niu, Yu-Jie; Guo, Yan-Su; Li, Chun-Yan; Jiang, Wen-Bo; Liu, Yi; Guo, Hui-Cai

    2015-01-01

    Oxidative stress plays an important role in doxorubicin (DOX)-induced cardiotoxicity. Nuclear factor E2-related factor-2 (Nrf2) is a transcription factor that orchestrates the antioxidant and cytoprotective responses to oxidative stress. In the present study, we tested whether tert-butylhydroquinone (tBHQ) could protect against DOX-induced cardiotoxicity in vivo and, if so, whether the protection was associated with the up-regulation of the Nrf2 pathway. The results showed that treatment with tBHQ significantly decreased the DOX-induced cardiac injury in wild-type mice. Moreover, tBHQ ameliorated the DOX-induced oxidative stress and apoptosis. Further studies suggested that tBHQ increased the nuclear accumulation of Nrf2 and the Nrf2-regulated gene expression, including heme oxygenase-1 (HO-1) and NAD(P)H:quinone oxido-reductase-1 (NQO-1) expression. Knocking out Nrf2 in mice abolished the protective effect of tBHQ on the DOX-induced cardiotoxicity. These results indicate that tBHQ has a beneficial effect on DOX-induced cardiotoxicity, and this effect was associated with the enhanced expression of Nrf2 and its downstream antioxidant genes, HO-1 and NQO-1. PMID:26692920

  12. A conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative stress adaptation in mammals, Caenorhabditis elegans and Drosophila melanogaster

    PubMed Central

    Pickering, Andrew M.; Staab, Trisha A.; Tower, John; Sieburth, Derek; Davies, Kelvin J. A.

    2013-01-01

    SUMMARY In mammalian cells, hydrogen peroxide (H2O2)-induced adaptation to oxidative stress is strongly dependent on an Nrf2 transcription factor-mediated increase in the 20S proteasome. Here, we report that both Caenorhabditis elegans nematode worms and Drosophila melanogaster fruit flies are also capable of adapting to oxidative stress with H2O2 pre-treatment. As in mammalian cells, this adaptive response in worms and flies involves an increase in proteolytic activity and increased expression of the 20S proteasome, but not of the 26S proteasome. We also found that the increase in 20S proteasome expression in both worms and flies, as in mammalian cells, is important for the adaptive response, and that it is mediated by the SKN-1 and CNC-C orthologs of the mammalian Nrf2 transcription factor, respectively. These studies demonstrate that stress mechanisms operative in cell culture also apply in disparate intact organisms across a wide biological diversity. PMID:23038734

  13. Neuroprotective Effects of the Triterpenoid, CDDO Methyl Amide, a Potent Inducer of Nrf2-Mediated Transcription

    PubMed Central

    Yang, Lichuan; Calingasan, Noel Y.; Thomas, Bobby; Chaturvedi, Rajnish K.; Kiaei, Mahmoud; Wille, Elizabeth J.; Liby, Karen T.; Williams, Charlotte; Royce, Darlene; Risingsong, Renee; Musiek, Eric S.; Morrow, Jason D.; Sporn, Michael; Beal, M. Flint

    2009-01-01

    The NF-E2-related factor-2 (Nrf2)/antioxidant response element (ARE) signaling pathway regulates phase 2 detoxification genes, including a variety of antioxidative enzymes. We tested neuroprotective effects of the synthetic triterpenoid CDDO-MA, a potent activator of the Nrf2/ARE signaling. CDDO-MA treatment of neuroblastoma SH-SY5Y cells resulted in Nrf2 upregulation and translocation from cytosol to nucleus and subsequent activation of ARE pathway genes. CDDO-MA blocked t-butylhydroperoxide-induced production of reactive oxygen species (ROS) by activation of ARE genes only in wild type, but not Nrf2 knockout mouse embryonic fibroblasts. Oral administration of CDDO-MA resulted in significant protection against MPTP-induced nigrostriatal dopaminergic neurodegeneration, pathological alpha-synuclein accumulation and oxidative damage in mice. Additionally, CDDO-MA treatment in rats produced significant rescue against striatal lesions caused by the neurotoxin 3-NP, and associated increases in the oxidative damage markers malondialdehyde, F2-Isoprostanes, 8-hydroxy-2-deoxyguanosine, 3-nitrotyrosine, and impaired glutathione homeostasis. Our results indicate that the CDDO-MA renders its neuroprotective effects through its potent activation of the Nrf2/ARE pathway, and suggest that triterpenoids may be beneficial for the treatment of neurodegenerative diseases like Parkinson's disease and Huntington's disease. PMID:19484125

  14. Nrf2-mediated liver protection by sauchinone, an antioxidant lignan, from acetaminophen toxicity through the PKCδ-GSK3β pathway.

    PubMed

    Kay, Hee Yeon; Kim, Young Woo; Ryu, Da Hye; Sung, Sang Hyun; Hwang, Se Jin; Kim, Sang Geon

    2011-08-01

    BACKGROUND AND PURPOSE Sauchinone, an antioxidant lignan, protects hepatocytes from iron-induced toxicity. This study investigated the protective effects of sauchinone against acetaminophen (APAP)-induced toxicity in the liver and the role of nuclear factor erythroid-2-related factor-2 (Nrf2) in this effect. EXPERIMENTAL APPROACH Blood biochemistry and histopathology were assessed in mice treated with APAP or APAP + sauchinone. The levels of mRNA and protein were measured using real-time PCR assays and immunoblottings. KEY RESULTS Sauchinone ameliorated liver injury caused by a high dose of APAP. This effect was prevented by a deficiency of Nrf2. Sauchinone treatment induced modifier subunit of glutamate-cysteine ligase, NAD(P)H:quinone oxidoreductase-1 (NQO1) and heat shock protein 32 in the liver, which was abolished by Nrf2 deficiency. In a hepatocyte model, sauchinone activated Nrf2, as evidenced by the increased nuclear accumulation of Nrf2, the induction of NQO1-antioxidant response element reporter gene, and glutamate-cysteine ligase and NQO1 protein induction, which contributed to the restoration of hepatic glutathione content. Consistently, treatment of sauchinone enhanced Nrf2 phosphorylation with a reciprocal decrease in its interaction with Kelch-like ECH-associated protein-1. Intriguingly, sauchinone activated protein kinase C-δ (PKCδ), which led to Nrf2 phosphorylation. In addition, it increased the inhibitory phosphorylation of glycogen synthase kinase-3β (GSK3β), derepressing Nrf2 activity, which was supported by the reversal of sauchinone's activation of Nrf2 by an activated mutant of GSK3β. Moreover, phosphorylation of GSK3β by sauchinone depended on PKCδ activation. CONCLUSION AND IMPLICATIONS Our results demonstrate that sauchinone protects the liver from APAP-induced toxicity by activating Nrf2, and this effect is mediated by PKCδ activation, which induces inhibitory phosphorylation of GSK3β.

  15. Nrf2 signalling and autophagy are involved in diabetes mellitus-induced defects in the development of mouse placenta.

    PubMed

    He, Mei-Yao; Wang, Guang; Han, Sha-Sha; Jin, Ya; Li, He; Wu, Xia; Ma, Zheng-Lai; Cheng, Xin; Tang, Xiuwen; Yang, Xuesong; Liu, Guo-Sheng

    2016-07-01

    It is widely accepted that diabetes mellitus impairs placental development, but the mechanism by which the disease operates to impair development remains controversial. In this study, we demonstrated that pregestational diabetes mellitus (PGDM)-induced defects in placental development in mice are mainly characterized by the changes of morphological structure of placenta. The alteration of differentiation-related gene expressions in trophoblast cells rather than cell proliferation/apoptosis is responsible for the phenotypes found in mouse placenta. Meanwhile, excess reactive oxygen species (ROS) production and activated nuclear factor erythroid2-related factor 2 (Nrf2) signalling were observed in the placenta of mice suffering from PGDM. Using BeWo cells, we also demonstrated that excess ROS was produced and Nrf2 signalling molecules were activated in settings characterized by a high concentration of glucose. More interestingly, differentiation-related gene expressions in trophoblast cells were altered when endogenous Nrf2 expression is manipulated by transfecting Nrf2-wt or Nrf2-shRNA. In addition, PGDM interferes with autophagy in both mouse placenta and BeWo cells, implying that autophagy is also involved, directly or indirectly, in PGDM-induced placental phenotypes. Therefore, we revealed that dysfunctional oxidative stress-activated Nrf2 signalling and autophagy are probably responsible for PGDM-induced defects in the placental development of mice. The mechanism was through the interference with differentiation-related gene expression in trophoblast cells. PMID:27383629

  16. Novel oxime-bearing coumarin derivatives act as potent Nrf2/ARE activators in vitro and in mouse model.

    PubMed

    Chang, Ken-Ming; Chen, Huang-Hui; Wang, Tai-Chi; Chen, I-Li; Chen, Yu-Tsen; Yang, Shyh-Chyun; Chen, Yeh-Long; Chang, Hsin-Huei; Huang, Chih-Hsiang; Chang, Jang-Yang; Shih, Chuan; Kuo, Ching-Chuan; Tzeng, Cherng-Chyi

    2015-12-01

    We have designed and synthesized certain novel oxime- and amide-bearing coumarin derivatives as nuclear factor erythroid 2 p45-related factor 2 (Nrf2) activators. The potency of these compounds was measured by antioxidant responsive element (ARE)-driven luciferase activity, level of Nrf2-related cytoprotective genes and proteins, and antioxidant activity. Among them, (Z)-3-(2-(hydroxyimino)-2-phenylethoxy)-2H-chromen-2-one (17a) was the most active, and more potent than the positive t-BHQ in the induction of ARE-driven luciferase activity. Exposure of HSC-3 cells to various concentrations of 17a strongly increased Nrf2 nuclear translocation and the expression level of Nrf2-mediated cytoprotective proteins in a concentration-dependent manner. HSC-3 cells pretreated with 17a significantly reduced t-BOOH-induced oxidative stress. In the animal experiment, Nrf2-mediated cytoprotective proteins, such as aldo-keto reductase 1 subunit C-1 (AKR1C1), glutathione reductase (GR), and heme oxygenase (HO-1), were obviously elevated in the liver of 17a-treated mice than that of control. These results suggested that novel oxime-bearing coumarin 17a is able to activate Nrf2/ARE pathway in vivo and are therefore seen as a promising candidate for further investigation.

  17. Nrf2 signalling and autophagy are involved in diabetes mellitus-induced defects in the development of mouse placenta

    PubMed Central

    Han, Sha-sha; Jin, Ya; Li, He; Wu, Xia; Ma, Zheng-lai; cheng, Xin; Tang, Xiuwen

    2016-01-01

    It is widely accepted that diabetes mellitus impairs placental development, but the mechanism by which the disease operates to impair development remains controversial. In this study, we demonstrated that pregestational diabetes mellitus (PGDM)-induced defects in placental development in mice are mainly characterized by the changes of morphological structure of placenta. The alteration of differentiation-related gene expressions in trophoblast cells rather than cell proliferation/apoptosis is responsible for the phenotypes found in mouse placenta. Meanwhile, excess reactive oxygen species (ROS) production and activated nuclear factor erythroid2-related factor 2 (Nrf2) signalling were observed in the placenta of mice suffering from PGDM. Using BeWo cells, we also demonstrated that excess ROS was produced and Nrf2 signalling molecules were activated in settings characterized by a high concentration of glucose. More interestingly, differentiation-related gene expressions in trophoblast cells were altered when endogenous Nrf2 expression is manipulated by transfecting Nrf2-wt or Nrf2-shRNA. In addition, PGDM interferes with autophagy in both mouse placenta and BeWo cells, implying that autophagy is also involved, directly or indirectly, in PGDM-induced placental phenotypes. Therefore, we revealed that dysfunctional oxidative stress-activated Nrf2 signalling and autophagy are probably responsible for PGDM-induced defects in the placental development of mice. The mechanism was through the interference with differentiation-related gene expression in trophoblast cells. PMID:27383629

  18. Antisense oligonucleotide against GSK-3β in brain of SAMP8 mice improves learning and memory and decreases oxidative stress: Involvement of transcription factor Nrf2 and implications for Alzheimer disease.

    PubMed

    Farr, Susan A; Ripley, Jessica L; Sultana, Rukhsana; Zhang, Zhaoshu; Niehoff, Michael L; Platt, Thomas L; Murphy, M Paul; Morley, John E; Kumar, Vijaya; Butterfield, D Allan

    2014-02-01

    Glycogen synthase kinase (GSK)-3β is a multifunctional protein that has been implicated in the pathological characteristics of Alzheimer's disease (AD), including the heightened levels of neurofibrillary tangles, amyloid-beta (Aβ), and neurodegeneration. In this study we used 12-month-old SAMP8 mice, an AD model, to examine the effects GSK-3β may cause regarding the cognitive impairment and oxidative stress associated with AD. To suppress the level of GSK-3β, SAMP8 mice were treated with an antisense oligonucleotide (GAO) directed at this kinase. We measured a decreased level of GSK-3β in the cortex of the mice, indicating the success of the antisense treatment. Learning and memory assessments of the SAMP8 mice were tested post-antisense treatment using an aversive T-maze and object recognition test, both of which observably improved. In cortex samples of the SAMP8 mice, decreased levels of protein carbonyl and protein-bound HNE were measured, indicating decreased oxidative stress. Nuclear factor erythroid-2-related factor 2 (Nrf2) is a transcription factor known to increase the level of many antioxidants, including glutathione-S transferase (GST), and is negatively regulated by the activity of GSK-3β. Our results indicated the increased nuclear localization of Nrf2 and level of GST, suggesting the increased activity of the transcription factor as a result of GSK-3β suppression, consistent with the decreased oxidative stress observed. Consistent with the improved learning and memory, and consistent with GSK-3b being a tau kinase, we observed decreased tau phosphorylation in brain of GAO-treated SAMP8 mice compared to that of RAO-treated SAMP8 mice. Lastly, we examined the ability of GAO to cross the blood-brain barrier and determined it to be possible. The results presented in this study demonstrate that reducing GSK-3 with a phosphorothionated antisense against GSK-3 improves learning and memory, reduces oxidative stress, possibly coincident with increased

  19. Schisandrol B protects against acetaminophen-induced acute hepatotoxicity in mice via activation of the NRF2/ARE signaling pathway

    PubMed Central

    Jiang, Yi-ming; Wang, Ying; Tan, Hua-sen; Yu, Tao; Fan, Xiao-mei; Chen, Pan; Zeng, Hang; Huang, Min; Bi, Hui-chang

    2016-01-01

    Aim: The nuclear factor erythroid 2-related factor 2 (NRF2) acts through the antioxidant response element (ARE) to regulate the expression of many detoxifying and antioxidant genes responsible for cytoprotective processes. We previously reported that Schisandrol B (SolB) isolated from Schisandra sphenanthera produced a protective effect against acetaminophen (APAP)-induced liver injury. In this study we investigated whether the NRF2/ARE signaling pathway was involved in this hepato-protective effect. Methods: Male C57BL/6 mice were treated with SolB (200 mg·kg−1·d−1, ig) for 3 d before injection of APAP (400 mg/kg, ip). Serum and liver tissue samples were collected 6 h later. The mRNA and protein expression were measured using qRT-PCR and Western blot assay, respectively. The activation of NRF2 was examined in HepG2 cells using luciferase reporter gene assay. Results: SolB pretreatment significantly alleviated the hepatic injury (large patchy necrosis and hyperemia of the hepatic sinus), the increase of serum AST, ALT levels and hepatic MDA contents, and the decrease of liver and mitochondrial glutathione levels in APAP-treated mice. Furthermore, SolB pretreatment significantly increased nuclear accumulation of NRF2 and increased hepatic expression of NRF2 downstream proteins, including GCLC, GSR, NQO1, GSTs, MRP2, MRP3 and MRP4 in APAP-treated mice. Moreover, treatment with SolB (2.5–20 μmol/L) dose-dependently increased the activity of NRF2 reporter gene in HepG2 cells. Conclusion: SolB exhibits a remarkable protective effect against APAP-induced hepatotoxicity, partially via activation of the NRF2/ARE pathway and regulation of NRF2 target genes, which induce detoxification and increase antioxidant capacity. PMID:26806302

  20. Chemoprevention of dietary digitoflavone on colitis-associated colon tumorigenesis through inducing Nrf2 signaling pathway and inhibition of inflammation

    PubMed Central

    2014-01-01

    Background Nuclear factor-erythroid 2-related factor 2 (Nrf2) has emerged as a novel target for the prevention of colorectal cancer (CRC). Many chemopreventive compounds associated with Nrf2 activation are effective in preclinical systems and many on-going clinical trials are showing promising findings. In present study we evaluated the cytoprotective effect and chemopreventive properties of dietary digitoflavone. Method A cell based Antioxidant Response Element (ARE)-driven luciferase reporter system was applied to screen potential Nrf2 activators. Activation of Nrf2 by digitoflavone was confirmed through mRNA, protein and GSH level assay in Caco-2 cell line. The cytoprotective effect of digitoflavone was evaluated in H2O2-induced oxidative stress model and further signaling pathways analysis was used to determine the target of digitoflavone induced Nrf2 activation. An AOM-DSS induced colorectal cancer model was used to assess the chemopreventive effect of digitoflavone. Result Micromolarity (10 μM) level of digitoflavone increased Nrf2 expressing, nuclear translocation and expression of downstream phase II antioxidant enzymes. Furthermore, digitoflavone decreased H2O2-induced oxidative stress and cell death via p38 MAPK-Nrf2/ARE pathway. In vivo study, 50 mg/kg digitoflavone significantly reduced AOM-DSS induced tumor incidence, number and size. Conclusion These observations suggest that digitoflavone is a novel Nrf2 pathway activator, and protects against oxidative stress-induced cell injury. The results of the present study add further evidence of the molecular mechanisms that allow digitoflavone to exert protective effects and reaffirm its potential role as a chemopreventive agent in colorectal carcinogenesis. PMID:24602443

  1. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    SciTech Connect

    Lo, Raymond; Matthews, Jason

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  2. Zinc is essential for the transcription function of Nrf2 in human renal tubule cells in vitro and mouse kidney in vivo under the diabetic condition

    PubMed Central

    Li, Bing; Cui, Wenpeng; Tan, Yi; Luo, Ping; Chen, Qiang; Zhang, Chi; Qu, Wei; Miao, Lining; Cai, Lu

    2014-01-01

    Increasing evidence from human and laboratory studies showed the effect of zinc (Zn) on diabetic complications. Nuclear factor-erythroid 2-related factor 2 (Nrf2) plays important role in the prevention of oxidative damage. This study was to define whether Zn statues (deficiency or supplement) affect the Nrf2 expression and function, and also affect the damage severity of human renal tubular (HK11) cells exposed to high glucose (HG) with palmitate (Pal) and kidney of diabetic mice induced by multiple low-dose streptozotocins. For Zn deficiency diabetic mice were treated with Zn chelator PTEN at 5 mg/kg bw daily for 4 months. Results showed that HG/Pal significantly increased the expression of pro-fibrotic mediators, connective tissue growth factor and PAI-1, in HK11 cells, which was exacerbated by TPEN that depleted intracellular free Zn and decreased Nrf2 expression and transcription. Zn supplement prevented the effects of TPEN and also increased Akt and GSK-3β phosphorylation with a decrease in Nrf2 nuclear exporter, Fyn. All these effects of Zn were abolished by Akt inhibitor. Therefore, Zn up-regulates Nrf2 function via activating Akt-mediated inhibition of Fyn function. Treatment of diabetic mice with TPEN decreased renal Zn level and Nrf2 expression and transcription, with an exacerbation of renal oxidative damage, inflammation and fibrosis. These results suggest the essentiality of Zn for Nrf2 expression and transcription function. PMID:24597671

  3. Zinc is essential for the transcription function of Nrf2 in human renal tubule cells in vitro and mouse kidney in vivo under the diabetic condition.

    PubMed

    Li, Bing; Cui, Wenpeng; Tan, Yi; Luo, Ping; Chen, Qiang; Zhang, Chi; Qu, Wei; Miao, Lining; Cai, Lu

    2014-05-01

    Increasing evidence from human and laboratory studies showed the effect of zinc (Zn) on diabetic complications. Nuclear factor-erythroid 2-related factor 2 (Nrf2) plays important role in the prevention of oxidative damage. This study was to define whether Zn statues (deficiency or supplement) affect the Nrf2 expression and function, and also affect the damage severity of human renal tubular (HK11) cells exposed to high glucose (HG) with palmitate (Pal) and kidney of diabetic mice induced by multiple low-dose streptozotocins. For Zn deficiency diabetic mice were treated with Zn chelator PTEN at 5 mg/kg bw daily for 4 months. Results showed that HG/Pal significantly increased the expression of pro-fibrotic mediators, connective tissue growth factor and PAI-1, in HK11 cells, which was exacerbated by TPEN that depleted intracellular free Zn and decreased Nrf2 expression and transcription. Zn supplement prevented the effects of TPEN and also increased Akt and GSK-3β phosphorylation with a decrease in Nrf2 nuclear exporter, Fyn. All these effects of Zn were abolished by Akt inhibitor. Therefore, Zn up-regulates Nrf2 function via activating Akt-mediated inhibition of Fyn function. Treatment of diabetic mice with TPEN decreased renal Zn level and Nrf2 expression and transcription, with an exacerbation of renal oxidative damage, inflammation and fibrosis. These results suggest the essentiality of Zn for Nrf2 expression and transcription function.

  4. Neuroprotective effects of salidroside on focal cerebral ischemia/reperfusion injury involve the nuclear erythroid 2-related factor 2 pathway

    PubMed Central

    Han, Jing; Xiao, Qing; Lin, Yan-hua; Zheng, Zhen-zhu; He, Zhao-dong; Hu, Juan; Chen, Li-dian

    2015-01-01

    Salidroside, the main active ingredient extracted from Rhodiola crenulata, has been shown to be neuroprotective in ischemic cerebral injury, but the underlying mechanism for this neuroprotection is poorly understood. In the current study, the neuroprotective effect of salidroside on cerebral ischemia-induced oxidative stress and the role of the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway was investigated in a rat model of middle cerebral artery occlusion. Salidroside (30 mg/kg) reduced infarct size, improved neurological function and histological changes, increased activity of superoxide dismutase and glutathione-S-transferase, and reduced malon-dialdehyde levels after cerebral ischemia and reperfusion. Furthermore, salidroside apparently increased Nrf2 and heme oxygenase-1 expression. These results suggest that salidroside exerts its neuroprotective effect against cerebral ischemia through anti-oxidant mechanisms and that activation of the Nrf2 pathway is involved. The Nrf2/antioxidant response element pathway may become a new therapeutic target for the treatment of ischemic stroke. PMID:26889188

  5. Protective Effect of Nuclear Factor E2-Related Factor 2 on Inflammatory Cytokine Response to Brominated Diphenyl Ether-47 in the HTR-8/SVneo Human First Trimester Extravillous Trophoblast Cell Line

    PubMed Central

    Park, Hae-Ryung; Loch-Caruso, Rita

    2014-01-01

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. PMID:25305463

  6. Emerging role of Nrf2 in adipocytes and adipose biology.

    PubMed

    Schneider, Kevin S; Chan, Jefferson Y

    2013-01-01

    Maintenance of a balanced redox state within the cell is of critical importance to a wide variety of biological systems. Nuclear factor erythroid-derived 2-like 2 (Nrf2) is a critical regulator of key aspects of the antioxidant defense pathway and has long been a subject of interest regarding conditions of chronic stress such as inflammation and cancer. Recent data have emerged demonstrating that oxidative stress and Nrf2 also play critical roles in the biology of adipose tissue. This review examines data identifying the roles of Nrf2 and oxidative stress in the biological process of adipose cell differentiation as well as the implications of Nrf2 modulation on obesity. Working to understand the complex interplay among Nrf2, oxidative stress, and adipose biology could lead to a variety of possible treatments for obesity and other related disorders.

  7. Neuroprotection by acetyl-11-keto-β-Boswellic acid, in ischemic brain injury involves the Nrf2/HO-1 defense pathway.

    PubMed

    Ding, Yi; Chen, MinChun; Wang, Min; Wang, MingMing; Zhang, Tiejun; Park, Jongsun; Zhu, YanRong; Guo, Chao; Jia, YanYan; Li, YuWen; Wen, AiDong

    2014-01-01

    Stroke is a complex disease involved oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway has been considered a potential target for neuroprotection in stroke. Acetyl-11-Keto-β-Boswellic Acid (AKBA) is an active triterpenoid compound from the extract of Boswellia serrate. The present study was to determine whether AKBA, a novel Nrf2 activator, can protect against cerebral ischemic injury. The stroke model was produced in Sprague-Dawley rats via middle cerebral artery occlusion. To model ischemia-like conditions in vitro, primary cultured cortical neurons were exposed to transient oxygen and glucose deprivation (OGD). Treatment of AKBA significantly reduced infarct volumes and apoptotic cells, and also increased neurologic scores by elevating the Nrf2 and HO-1 expression in brain tissues in middle cerebral artery occlusion (MCAO) rats at 48 hours post reperfusion. In primary cultured neurons, AKBA increased the Nrf2 and HO-1 expression, which provided protection against OGD-induced oxidative insult. Additionally, AKBA treatment increased Nrf2 binding activity to antioxidant-response elements (ARE). The protective effect of AKBA was attenuated by knockdown of Nrf2 or HO-1. In conclusion, these findings provide evidence that AKBA protects neurons against ischemic injury, and this neuroprotective effect involves the Nrf2/HO-1 pathway. PMID:25384416

  8. S[+] Apomorphine is a CNS penetrating activator of the Nrf2-ARE pathway with activity in mouse and patient fibroblast models of amyotrophic lateral sclerosis☆

    PubMed Central

    Mead, Richard J.; Higginbottom, Adrian; Allen, Scott P.; Kirby, Janine; Bennett, Ellen; Barber, Siân C.; Heath, Paul R.; Coluccia, Antonio; Patel, Neelam; Gardner, Iain; Brancale, Andrea; Grierson, Andrew J.; Shaw, Pamela J.

    2013-01-01

    Compelling evidence indicates that oxidative stress contributes to motor neuron injury in amyotrophic lateral sclerosis (ALS), but antioxidant therapies have not yet achieved therapeutic benefit in the clinic. The nuclear erythroid 2-related-factor 2 (Nrf2) transcription factor is a key regulator of an important neuroprotective response by driving the expression of multiple cytoprotective genes via its interaction with the antioxidant response element (ARE). Dysregulation of the Nrf2-ARE system has been identified in ALS models and human disease. Taking the Nrf2-ARE pathway as an attractive therapeutic target for neuroprotection in ALS, we aimed to identify CNS penetrating, small molecule activators of Nrf2-mediated transcription in a library of 2000 drugs and natural products. Compounds were screened extensively for Nrf2 activation, and antioxidant and neuroprotective properties in vitro. S[+]-Apomorphine, a receptor-inactive enantiomer of the clinically approved dopamine-receptor agonist (R[–]-apomorphine), was identified as a nontoxic Nrf2 activating molecule. In vivo S[+]-apomorphine demonstrated CNS penetrance, Nrf2 induction, and significant attenuation of motor dysfunction in the SOD1G93A transgenic mouse model of ALS. S[+]-apomorphine also reduced pathological oxidative stress and improved survival following an oxidative insult in fibroblasts from ALS patients. This molecule emerges as a promising candidate for evaluation as a potential neuroprotective agent in ALS patients in the clinic. PMID:23608463

  9. S[+] Apomorphine is a CNS penetrating activator of the Nrf2-ARE pathway with activity in mouse and patient fibroblast models of amyotrophic lateral sclerosis.

    PubMed

    Mead, Richard J; Higginbottom, Adrian; Allen, Scott P; Kirby, Janine; Bennett, Ellen; Barber, Siân C; Heath, Paul R; Coluccia, Antonio; Patel, Neelam; Gardner, Iain; Brancale, Andrea; Grierson, Andrew J; Shaw, Pamela J

    2013-08-01

    Compelling evidence indicates that oxidative stress contributes to motor neuron injury in amyotrophic lateral sclerosis (ALS), but antioxidant therapies have not yet achieved therapeutic benefit in the clinic. The nuclear erythroid 2-related-factor 2 (Nrf2) transcription factor is a key regulator of an important neuroprotective response by driving the expression of multiple cytoprotective genes via its interaction with the antioxidant response element (ARE). Dysregulation of the Nrf2-ARE system has been identified in ALS models and human disease. Taking the Nrf2-ARE pathway as an attractive therapeutic target for neuroprotection in ALS, we aimed to identify CNS penetrating, small molecule activators of Nrf2-mediated transcription in a library of 2000 drugs and natural products. Compounds were screened extensively for Nrf2 activation, and antioxidant and neuroprotective properties in vitro. S[+]-Apomorphine, a receptor-inactive enantiomer of the clinically approved dopamine-receptor agonist (R[-]-apomorphine), was identified as a nontoxic Nrf2 activating molecule. In vivo S[+]-apomorphine demonstrated CNS penetrance, Nrf2 induction, and significant attenuation of motor dysfunction in the SOD1(G93A) transgenic mouse model of ALS. S[+]-apomorphine also reduced pathological oxidative stress and improved survival following an oxidative insult in fibroblasts from ALS patients. This molecule emerges as a promising candidate for evaluation as a potential neuroprotective agent in ALS patients in the clinic.

  10. Plant Extracts of the Family Lauraceae: A Potential Resource for Chemopreventive Agents that Activate the Nuclear Factor-Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway

    PubMed Central

    Shen, Tao; Chen, Xue-Mei; Harder, Bryan; Long, Min; Wang, Xiao-Ning; Lou, Hong-Xiang; Wondrak, Georg T.; Ren, Dong-Mei; Zhang, Donna D.

    2015-01-01

    Cells and tissues counteract insults from exogenous or endogenous carcinogens through the expression of genes encoding antioxidants and phase II detoxifying enzymes regulated by antioxidant response element promoter regions. Nuclear factor-erythroid 2-related factor 2 plays a key role in regulating the antioxidant response elements-target gene expression. Hence, the Nrf2/ARE pathway represents a vital cellular defense mechanism against damage caused by oxidative stress and xenobiotics, and is recognized as a potential molecular target for discovering chemo-preventive agents. Using a stable antioxidant response element luciferase reporter cell line derived from human breast cancer MDA-MB-231 cells combined with a 96-well high-throughput screening system, we have identified a series of plant extracts from the family Lauraceae that harbor Nrf2-inducing effects. These extracts, including Litsea garrettii (ZK-08), Cinnamomum chartophyllum (ZK-02), C. mollifolium (ZK-04), C. camphora var. linaloolifera (ZK-05), and C. burmannii (ZK-10), promoted nuclear translocation of Nrf2, enhanced protein expression of Nrf2 and its target genes, and augmented intracellular glutathione levels. Cytoprotective activity of these extracts against two electrophilic toxicants, sodium arsenite and H2O2, was investigated. Treatment of human bronchial epithelial cells with extracts of ZK-02, ZK-05, and ZK-10 significantly improved cell survival in response to sodium arsenite and H2O2, while ZK-08 showed a protective effect against only H2O2. Importantly, their protective effects against insults from both sodium arsenite and H2O2 were Nrf2-dependent. Therefore, our data provide evidence that the selected plants from the family Lauraceae are potential sources for chemopreventive agents targeting the Nrf2/ARE pathway. PMID:24585092

  11. Overexpression of Nrf2 protects against microcystin-induced hepatotoxicity in mice.

    PubMed

    Lu, Yuan-Fu; Liu, Jie; Wu, Kai Connie; Qu, Qiang; Fan, Fang; Klaassen, Curtis D

    2014-01-01

    Oxidative stress and glutathione (GSH) depletion are implicated in mycocystin hepatotoxicity. To investigate the role of nuclear factor erythroid 2-related factor 2 (Nrf2) in microcystin-induced liver injury, Nrf2-null, wild-type, and Keap1-hepatocyte knockout (Keap1-HKO) mice were treated with microcystin (50 μg/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Microcystin increased serum alanine aminotransferase and aspartate aminotransferase activities, and caused extensive inflammation and necrosis in Nrf2-null and wild-type mice, but not in Keap1-HKO mice. Oxidative stress and inflammation are implicated in microcystin-induced hepatotoxicity, as evidenced by increased lipid peroxidation and increased expression of pro-inflammatory genes, such as neutrophil-specific chemokines mKC and MIP-2, and pro-inflammatory cytokines IL-1β and IL-6. The increased expression of these pro-inflammatory genes was attenuated in Keap1-HKO mice. Nrf2 and Nqo1 mRNA and protein were higher in Keap1-HKO mice at constitutive levels and after microcystin. To further investigate the mechanism of the protection, hepatic GSH and the mRNA of GSH-related enzymes were determined. Microcystin markedly depleted liver GSH by 60-70% in Nrf2 and WT mice but only 35% in Keap1-HKO mice. The mRNAs of GSH conjugation and peroxide reduction enzymes, such as Gstα1, Gstα4, Gstμ, and Gpx2 were higher in livers of Keap1-HKO mice, together with higher expression of the rate-limiting enzyme for GSH synthesis (Gclc). Organic anion transport polypeptides were increased by microcystin with the most increase in Keap1-HKO mice. In conclusion, this study demonstrates that higher basal levels of Nrf2 and GSH-related genes in Keap1-HKO mice prevented microcystin-induced oxidative stress and liver injury.

  12. Bardoxolone methyl (BARD) ameliorates aristolochic acid (AA)-induced acute kidney injury through Nrf2 pathway.

    PubMed

    Wu, Juan; Liu, Xinhui; Fan, Jinjin; Chen, Wenfang; Wang, Juan; Zeng, Youjia; Feng, Xiaorang; Yu, Xueqing; Yang, Xiao

    2014-04-01

    Bardoxolone methyl (BARD) is an antioxidant modulator that acts through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. This study aimed to investigate the role of BARD in protecting kidneys from aristolochic acid (AA)-induced acute kidney injury (AKI). Male C57BL/6 mice received intraperitoneal (i.p.) injections of aristolochic acid I (AAI) (5mg/kg/day) for 5 days to produce acute AA nephropathy (AAN) model. BARD (10mg/kg/day, i.p.) was applied for 7 consecutive days, starting 2 days prior to AAI administration. The mice in the AA group showed AKI as evidenced by worsening kidney function evaluated by blood urea nitrogen (BUN) and serum creatinine (SCr) levels, and severe tubulointerstitial injury marked by massive tubule necrosis in kidney tissues. BARD significantly reduced BUN and SCr levels which were elevated by AAI. Additionally, AAI-induced histopathological renal damage was ameliorated by BARD. Furthermore, the expression of Nrf2 was reduced, and its repressor Kelch-like ECH-associated protein 1 (Keap1) was increased significantly, whereas heme oxygenase-1 (HO-1) was upregulated and NAD(P)H quinone oxidoreductase-1 (NQO1) was barely increased in the cytoplasm of tubules in kidneys after treatment with AAI. BARD significantly upregulated renal Nrf2, NQO1 and HO-1 expression and downregulated Keap1 expression compared with those in the AA group. Moreover, it was found that Nrf2 was expressed both in the cytoplasm and nuclear of glomeruli and tubules, whereas NQO1 and HO-1 were localized in the cytoplasm of tubules only. In conclusion, AA-induced acute renal injury was associated with impaired Nrf2 activation and expression of its downstream target genes in renal tissues. BARD prevented renal damage induced by AAI, and this renoprotective effect may be exerted by activating the Nrf2 signaling pathway and increasing expression of the downstream target genes.

  13. Cigarette smoking is associated with human semen quality in synergy with functional NRF2 polymorphisms.

    PubMed

    Yu, Bolan; Chen, Jingyi; Liu, Dan; Zhou, Hua; Xiao, Weiwei; Xia, Xuefeng; Huang, Zhaofeng

    2013-07-01

    Although cigarette smoking is considered a major risk factor for several human diseases, the effects of smoking on male fertility are controversial. Studies on the consequences of smoking, which also take into account genetic background, may facilitate understanding of the interactions between genes and smoking and their effects on male fertility. In this study, genetic variants of two functional polymorphisms of erythroid 2-related factor 2 (NRF2), mRNA expression levels of the antioxidant gene NRF2, catalase (CAT), superoxide dismutase isoenzyme-2 (SOD2), glutathione S-transferase-M1 (GSTM1), and seminal SOD activities were compared in 314 heavy smokers and 314 matched nonsmokers. The NRF2 rs6721961 TT genotype was found to be associated with low semen quality in heavy smokers (OR [95% CI] = 2.370 [1.106-5.081]). This variant genotype was found more frequently in heavy smokers with low semen quality than in those with high semen quality (P = 0.011). Heavy smokers with this genotype had significantly lower sperm concentrations and sperm counts (P < 0.05) when compared with those without this genotype. Smoking was also significantly associated with decreased seminal SOD activity (P < 0.05) and reduced NRF2 and SOD2 mRNA expression in heavy smokers with this variant genotype. These results were specific to heavy smokers with the NRF2 rs6721961 TT genotypes, but did not apply to nonsmokers or heavy smokers that did not carry this genotype. This study suggests an association between cigarette smoking in heavy smokers with NRF2 rs6721961 TT genotype and a decrease in semen quality.

  14. Aged garlic extract enhances heme oxygenase-1 and glutamate-cysteine ligase modifier subunit expression via the nuclear factor erythroid 2-related factor 2-antioxidant response element signaling pathway in human endothelial cells.

    PubMed

    Hiramatsu, Kei; Tsuneyoshi, Tadamitsu; Ogawa, Takahiro; Morihara, Naoaki

    2016-02-01

    The nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway defends cells against oxidative stress and regulates the cellular redox balance. Activation of this pathway induces a variety of antioxidant enzymes, resulting in the protection of our bodies against oxidative damage. It has been reported that aged garlic extract (AGE), a garlic preparation that is rich in water-soluble cysteinyl moieties, reduces oxidative stress and helps to ameliorate of cardiovascular, renal and hepatic diseases. We hypothesized that AGE enhances the expression of antioxidant enzymes via the Nrf2-ARE pathway in human umbilical vein endothelial cells in culture. Gene expression of antioxidant enzymes was measured using real-time polymerase chain reaction. Nuclear accumulation of Nrf2 and antioxidant enzymes expression were evaluated using western blotting analyses. We found that AGE promoted the accumulation of Nrf2 into the nucleus in a time- and dose-dependent manner and increased the gene expression and polypeptide level of heme oxygenase-1 (HO-1) and glutamate-cysteine ligase modifier subunit (GCLM). Moreover, the effect of AGE in elevating the gene expression of HO-1 and GCLM was found to be mediated via Nrf2 activation in human umbilical vein endothelial cells. Taken together, these observations suggest that AGE induces the expression of HO-1 and GCLM, which are antioxidant enzymes, via activation of the Nrf2-ARE signaling pathway. PMID:26507778

  15. Dipeptidyl peptidase-4 inhibition by gemigliptin prevents abnormal vascular remodeling via NF-E2-related factor 2 activation.

    PubMed

    Choi, Seung Hee; Park, Sungmi; Oh, Chang Joo; Leem, Jaechan; Park, Keun-Gyu; Lee, In-Kyu

    2015-10-01

    Dipeptidyl peptidase-4 (DPP-4) inhibitors exert a potent anti-hyperglycemic effect and reduce cardiovascular risk in type 2 diabetic patients. Several studies have shown that DPP-4 inhibitors including sitagliptin have beneficial effects in atherosclerosis and cardiac infarction involving reactive oxygen species. Here, we show that gemigliptin can directly attenuate the abnormal proliferation and migration of vascular smooth muscle cells (VSMCs) via enhanced NF-E2-related factor 2 (Nrf2) activity. Gemigliptin dramatically prevented ligation injury-induced neointimal hyperplasia in mouse carotid arteries. Likewise, the proliferation of primary VSMCs was significantly attenuated by gemigliptin in a dose-dependent manner consistent with a decrease in phospho-Rb, resulting in G1 cell cycle arrest. We found that gemigliptin enhanced Nrf2 activity not only by mRNA expression, but also by increasing Keap1 proteosomal degradation by p62, leading to the induction of Nrf2 target genes such as HO-1 and NQO1. The anti-proliferative role of gemigliptin disappeared with DPP-4 siRNA knockdown, indicating that the endogenous DPP-4 in VSMCs contributed to the effect of gemigliptin. In addition, gemigliptin diminished TNF-α-mediated cell adhesion molecules such as MCP-1 and VCAM-1 and reduced MMP2 activity in VSMCs. Taken together, our data indicate that gemigliptin exerts a preventative effect on the proliferation and migration of VSMCs via Nrf2. PMID:26187356

  16. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line

    SciTech Connect

    Park, Hae-Ryung Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential

  17. Toxicogenomics of endoplasmic reticulum stress inducer tunicamycin in the small intestine and liver of Nrf2 knockout and C57BL/6J mice.

    PubMed

    Nair, Sujit; Xu, Changjiang; Shen, Guoxiang; Hebbar, Vidya; Gopalakrishnan, Avantika; Hu, Rong; Jain, Mohit Raja; Liew, Celine; Chan, Jefferson Y; Kong, Ah-Ng Tony

    2007-01-10

    This objective of this study was to investigate the toxicogenomics and the spatial regulation of global gene expression profiles elicited by endoplasmic reticulum (ER) stress inducer tunicamycin (TM) in mouse small intestine and liver as well as to identify TM-modulated nuclear factor-E2-related factor 2 (Nrf2)-dependent genes. Gene expression profiles were analyzed using 45,000 Affymetrix mouse genome 430 2.0 array and GeneSpring 7.2 software. Microarray results were validated by quantitative real-time reverse transcription-PCR analyses. Clusters of genes that were either induced or suppressed more than two-fold by TM treatment compared with vehicle in C57BL/6J/Nrf2 (-/-; knockout) and C57BL/6J Nrf2 (+/+; wildtype) mice genotypes were identified. Amongst these, in small intestine and liver, 1291 and 750 genes, respectively, were identified as Nrf2-dependent and upregulated, and 1370 and 943 genes, respectively, as Nrf2-dependent and downregulated. Based on their biological functions, these genes can be categorized into molecular chaperones and heat shock proteins, ubiquitination/proteolysis, apoptosis/cell cycle, electron transport, detoxification, cell growth/differentiation, signaling molecules/interacting partners, kinases and phosphatases, transport, biosynthesis/metabolism, nuclear assembly and processing, and genes related to calcium and glucose homeostasis. Phase II detoxification/antioxidant genes as well as putative interacting partners of Nrf2 such as nuclear corepressors and coactivators, were also identified as Nrf2-dependent genes. The identification of TM-regulated and Nrf2-dependent genes in the unfolded protein response to ER stress not only provides potential novel insights into the gestalt biological effects of TM on the toxicogenomics and spatial regulation of global gene expression profiles in cancer pharmacology and toxicology, but also points to the pivotal role of Nrf2 in these biological processes.

  18. Nrf2/Keap1 system regulates vascular smooth muscle cell apoptosis for vascular homeostasis: role in neointimal formation after vascular injury

    PubMed Central

    Ashino, Takashi; Yamamoto, Masayuki; Numazawa, Satoshi

    2016-01-01

    Abnormal increases in vascular smooth muscle cells (VSMCs) in the intimal region after a vascular injury is a key event in developing neointimal hyperplasia. To maintain vascular function, proliferation and apoptosis of VSMCs is tightly controlled during vascular remodeling. NF-E2-related factor 2 (Nrf2)/Kelch-like ECH-associated protein 1 (Keap1) system, a key component of the oxidative stress response that acts in maintaining homeostasis, plays an important role in neointimal hyperplasia after a vascular injury; however, the role of Nrf2/Keap1 in VSMC apoptosis has not been clarified. Here we report that 14 days after arterial injury in mice, TUNEL-positive VSMCs are detected in both the neointimal and medial layers. These layers contain cells expressing high levels of Nrf2 but low Keap1 expression. In VSMCs, Keap1 depletion induces features of apoptosis, such as positive TUNEL staining and annexin V binding. These changes are associated with an increased expression of nuclear Nrf2. Simultaneous Nrf2 depletion inhibits Keap1 depletion-induced apoptosis. At 14 days after the vascular injury, Nrf2-deficient mice demonstrated fewer TUNEL-positive cells and increased neointimal formation in the neointimal and medial areas. The results suggest that the Nrf2/Keap1 system regulates VSMC apoptosis during neointimal formation, thereby inhibiting neointimal hyperplasia after a vascular injury. PMID:27198574

  19. Silica nanoparticles induce oxidative stress, inflammation, and endothelial dysfunction in vitro via activation of the MAPK/Nrf2 pathway and nuclear factor-κB signaling

    PubMed Central

    Guo, Caixia; Xia, Yinye; Niu, Piye; Jiang, Lizhen; Duan, Junchao; Yu, Yang; Zhou, Xianqing; Li, Yanbo; Sun, Zhiwei

    2015-01-01

    Despite the widespread application of silica nanoparticles (SiNPs) in industrial, commercial, and biomedical fields, their response to human cells has not been fully elucidated. Overall, little is known about the toxicological effects of SiNPs on the cardiovascular system. In this study, SiNPs with a 58 nm diameter were used to study their interaction with human umbilical vein endothelial cells (HUVECs). Dose- and time-dependent decrease in cell viability and damage on cell plasma-membrane integrity showed the cytotoxic potential of the SiNPs. SiNPs were found to induce oxidative stress, as evidenced by the significant elevation of reactive oxygen species generation and malondialdehyde production and downregulated activity in glutathione peroxidase. SiNPs also stimulated release of cytoprotective nitric oxide (NO) and upregulated inducible nitric oxide synthase (NOS) messenger ribonucleic acid, while downregulating endothelial NOS and ET-1 messenger ribonucleic acid, suggesting that SiNPs disturbed the NO/NOS system. SiNP-induced oxidative stress and NO/NOS imbalance resulted in endothelial dysfunction. SiNPs induced inflammation characterized by the upregulation of key inflammatory mediators, including IL-1β, IL-6, IL-8, TNFα, ICAM-1, VCAM-1, and MCP-1. In addition, SiNPs triggered the activation of the Nrf2-mediated antioxidant system, as evidenced by the induction of nuclear factor-κB and MAPK pathway activation. Our findings demonstrated that SiNPs could induce oxidative stress, inflammation, and NO/NOS system imbalance, and eventually lead to endothelial dysfunction via activation of the MAPK/Nrf2 pathway and nuclear factor-κB signaling. This study indicated a potential deleterious effect of SiNPs on the vascular endothelium, which warrants more careful assessment of SiNPs before their application. PMID:25759575

  20. Targeting Nrf2 in healthy and malignant ovarian epithelial cells: Protection versus promotion.

    PubMed

    van der Wijst, Monique G P; Huisman, Christian; Mposhi, Archibold; Roelfes, Gerard; Rots, Marianne G

    2015-08-01

    Risk factors indicate the importance of oxidative stress during ovarian carcinogenesis. To tolerate oxidative stress, cells activate the transcription factor Nrf2 (Nfe2l2), the master regulator of antioxidant and cytoprotective genes. Indeed, for most cancers, hyperactivity of Nrf2 is observed, and siRNA studies assigned Nrf2 as therapeutic target. However, the cancer-protective role of Nrf2 in healthy cells highlights the requirement for an adequate therapeutic window. We engineered artificial transcription factors to assess the role of Nrf2 in healthy (OSE-C2) and malignant ovarian cells (A2780). Successful NRF2 up- and downregulation correlated with decreased, respectively increased, sensitivity toward oxidative stress. Inhibition of NRF2 reduced the colony forming potential to the same extent in wild-type and BRCA1 knockdown A2780 cells. Only in BRCA1 knockdown A2780 cells, the effect of Nrf2 inhibition could be enhanced when combined with PARP inhibitors. Therefore, we propose that this combination therapy of PARP inhibitors and Nrf2 inhibition can further improve treatment efficacy specifically in BRCA1 mutant cancer cells without acquiring the side-effects associated with previously studied Nrf2 inhibition combinations with either chemotherapy or radiation. Our findings stress the dual role of Nrf2 in carcinogenesis, while offering approaches to exploit Nrf2 as a potent therapeutic target in ovarian cancer.

  1. Dimethylfumarate attenuates restenosis after acute vascular injury by cell-specific and Nrf2-dependent mechanisms

    PubMed Central

    Oh, Chang Joo; Park, Sungmi; Kim, Joon-Young; Kim, Han-Jong; Jeoung, Nam Ho; Choi, Young-Keun; Go, Younghoon; Park, Keun-Gyu; Lee, In-Kyu

    2014-01-01

    Excessive proliferation of vascular smooth muscle cells (VSMCs) and incomplete re-endothelialization is a major clinical problem limiting the long-term efficacy of percutaneous coronary angioplasty. We tested if dimethylfumarate (DMF), an anti-psoriasis drug, could inhibit abnormal vascular remodeling via NF−E2-related factor 2 (Nrf2)-NAD(P)H quinone oxidoreductase 1 (NQO1) activity. DMF significantly attenuated neointimal hyperplasia induced by balloon injury in rat carotid arteries via suppression of the G1 to S phase transition resulting from induction of p21 protein in VSMCs. Initially, DMF increased p21 protein stability through an enhancement in Nrf2 activity without an increase in p21 mRNA. Later on, DMF stimulated p21 mRNA expression through a process dependent on p53 activity. However, heme oxygenase-1 (HO-1) or NQO1 activity, well-known target genes induced by Nrf2, were dispensable for the DMF induction of p21 protein and the effect on the VSMC proliferation. Likewise, DMF protected endothelial cells from TNF-α-induced apoptosis and the dysfunction characterized by decreased eNOS expression. With knock-down of Nrf2 or NQO1, DMF failed to prevent TNF-α-induced cell apoptosis and decreased eNOS expression. Also, CD31 expression, an endothelial specific marker, was restored in vivo by DMF. In conclusion, DMF prevented abnormal proliferation in VSMCs by G1 cell cycle arrest via p21 upregulation driven by Nrf2 and p53 activity, and had a beneficial effect on TNF-α-induced apoptosis and dysfunction in endothelial cells through Nrf2–NQO1 activity suggesting that DMF might be a therapeutic drug for patients with vascular disease. PMID:25009787

  2. Ajoene, a stable garlic by-product, has an antioxidant effect through Nrf2-mediated glutamate-cysteine ligase induction in HepG2 cells and primary hepatocytes.

    PubMed

    Kay, Hee Yeon; Won Yang, Jin; Kim, Tae Hyun; Lee, Da Yeon; Kang, Bomi; Ryu, Jae-Ha; Jeon, Raok; Kim, Sang Geon

    2010-07-01

    Cytoprotective effects of chemopreventive agents may be attributed to the induction of antioxidant enzymes. Among these, the induction of glutamate-cysteine ligase (GCL) protects cells from oxidative injury by increasing glutathione (GSH) content. Nuclear factor erythroid-2-related factor 2 (Nrf2) transcriptionally regulates the expression of genes encoding for GCL and other cysteine-metabolizing enzymes. Despite extensive studies on the components in garlic, little information is available on organosulfur by-products made from garlic. In this study, we investigated whether ajoene, a chemically stable garlic by-product, has the ability to activate Nrf2 and induce GCL, and, if so, what is the role of activating Nrf2 in cytoprotection against oxidative stress. Immunoblottings and reporter gene assays were performed in HepG2 cells. Ajoene treatment activated Nrf2, as indicated by increased phosphorylation and nuclear accumulation of Nrf2, decreased interaction with Kelch-like ECH-associated protein-1, and decreased Nrf2 ubiquitination. Consistently, treatment of ajoene increased antioxidant response element reporter gene activity and the mRNA and protein levels of GCL subunits. Ajoene activated protein kinase C-delta (PKCdelta). Inhibition of PKCdelta activation by rottlerin abrogated its ability to activate Nrf2 and induce GCL, suggesting that ajoene promotes the Nrf2-dependent antioxidant defense system via PKCdelta activation. Consequently, ajoene prevented cell death, GSH depletion, and hydrogen peroxide production elicited by tert-butylhydroperoxide. The important role of Nrf2 in cytoprotection was verified by the reversal of ajoene's ability to protect hepatocytes in Nrf2-knockout mice. Our results demonstrate that ajoene increases PKCdelta-dependent Nrf2 activation, GCL induction, and the cellular GSH concentration, which may contribute to protecting cells from oxidative stress.

  3. HIV-Tat Induces the Nrf2/ARE Pathway through NMDA Receptor-Elicited Spermine Oxidase Activation in Human Neuroblastoma Cells

    PubMed Central

    Mastrantonio, Roberta; Cervelli, Manuela; Pietropaoli, Stefano; Mariottini, Paolo; Colasanti, Marco; Persichini, Tiziana

    2016-01-01

    Previously, we reported that HIV-Tat elicits spermine oxidase (SMO) activity upregulation through NMDA receptor (NMDAR) stimulation in human SH-SY5Y neuroblastoma cells, thus increasing ROS generation, which in turn leads to GSH depletion, oxidative stress, and reduced cell viability. In several cell types, ROS can trigger an antioxidant cell response through the transcriptional induction of oxidative stress-responsive genes regulated by the nuclear factor erythroid 2-related factor 2 (Nrf2). Here, we demonstrate that Tat induces both antioxidant gene expression and Nrf2 activation in SH-SY5Y cells, mediated by SMO activity. Furthermore, NMDAR is involved in Tat-induced Nrf2 activation. These findings suggest that the NMDAR/SMO/Nrf2 pathway is an important target for protection against HIV-associated neurocognitive disorders. PMID:26895301

  4. Nuclear Factor Erythroid 2-Related Factor 2 Drives Podocyte-Specific Expression of Peroxisome Proliferator-Activated Receptor γ Essential for Resistance to Crescentic GN.

    PubMed

    Henique, Carole; Bollee, Guillaume; Lenoir, Olivia; Dhaun, Neeraj; Camus, Marine; Chipont, Anna; Flosseau, Kathleen; Mandet, Chantal; Yamamoto, Masayuki; Karras, Alexandre; Thervet, Eric; Bruneval, Patrick; Nochy, Dominique; Mesnard, Laurent; Tharaux, Pierre-Louis

    2016-01-01

    Necrotizing and crescentic rapidly progressive GN (RPGN) is a life-threatening syndrome characterized by a rapid loss of renal function. Evidence suggests that podocyte expression of the transcription factor peroxisome proliferator-activated receptor γ (PPARγ) may prevent podocyte injury, but the function of glomerular PPARγ in acute, severe inflammatory GN is unknown. Here, we observed marked loss of PPARγ abundance and transcriptional activity in glomerular podocytes in experimental RPGN. Blunted expression of PPARγ in podocyte nuclei was also found in kidneys from patients diagnosed with crescentic GN. Podocyte-specific Pparγ gene targeting accentuated glomerular damage, with increased urinary loss of albumin and severe kidney failure. Furthermore, a PPARγ gain-of-function approach achieved by systemic administration of thiazolidinedione (TZD) failed to prevent severe RPGN in mice with podocyte-specific Pparγ gene deficiency. In nuclear factor erythroid 2-related factor 2 (NRF2)-deficient mice, loss of podocyte PPARγ was observed at baseline. NRF2 deficiency markedly aggravated the course of RPGN, an effect that was partially prevented by TZD administration. Furthermore, delayed administration of TZD, initiated after the onset of RPGN, still alleviated the severity of experimental RPGN. These findings establish a requirement for the NRF2-PPARγ cascade in podocytes, and we suggest that these transcription factors have a role in augmenting the tolerance of glomeruli to severe immune-complex mediated injury. The NRF2-PPARγ pathway may be a therapeutic target for RPGN. PMID:25999406

  5. Betanin, a beetroot component, induces nuclear factor erythroid-2-related factor 2-mediated expression of detoxifying/antioxidant enzymes in human liver cell lines.

    PubMed

    Krajka-Kuźniak, Violetta; Paluszczak, Jarosław; Szaefer, Hanna; Baer-Dubowska, Wanda

    2013-12-01

    Our recent study has shown that beetroot juice protects against N-nitrosodimethylamine (NDEA)-induced liver injury and increases the activity of phase II enzymes, suggesting the activation of the nuclear factor erythroid-2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway. The aim of the present study was to further explore the mechanism of the activity of beetroot by evaluating the cytoprotective effects of its major component. The influence of betanin (BET) on the activation of Nrf2 and the expression of GSTA, GSTP, GSTM, GSTT, NQO1 and HO-1 was assessed in two hepatic cell lines: non-tumour THLE-2 and hepatoma-derived HepG2 cell lines. The level of the tumour suppressor p53 in both cell lines and the methylation of GSTP in HepG2 cells were also evaluated. Treatment of both cell lines with 2, 10 and 20 μm of BET resulted in the translocation of Nrf2 from the cytosol to the nucleus. The mRNA and nuclear protein levels of Nrf2 and the binding of Nrf2 to ARE sequences were increased only in the THLE-2 cells and were accompanied by the phosphorylation of serine/threonine kinase (AKT), c-Jun N-terminal kinase (JNK) and extracellular signal-regulated kinase (ERK). BET also significantly increased the mRNA and protein levels of GSTP, GSTT, GSTM and NQO1 in these cells. Conversely, besides the translocation of Nrf2 from the cytosol to the nucleus, BET did not modulate any of the other parameters measured in the HepG2 cells. BET did not change the methylation of GSTP1 in these cells either. These results indicate that BET through the activation of Nrf2 and subsequent induction of the expression of genes controlled by this factor may exert its hepatoprotective and anticarcinogenic effects. Moreover, the activation of mitogen-activated protein kinases may be responsible for the activation of Nrf2 in the THLE-2 cells.

  6. Prolonged metformin treatment leads to reduced transcription of Nrf2 and neurotrophic factors without cognitive impairment in older C57BL/6J mice.

    PubMed

    Allard, Joanne S; Perez, Evelyn J; Fukui, Koji; Carpenter, Priscilla; Ingram, Donald K; de Cabo, Rafael

    2016-03-15

    Long-term use of anti-diabetic agents has become commonplace as rates of obesity, metabolic syndrome and diabetes continue to escalate. Metformin, a commonly used anti-diabetic drug, has been shown to have many beneficial effects outside of its therapeutic regulation of glucose metabolism and insulin sensitivity. Studies on metformin's effects on the central nervous system are limited and predominantly consist of in vitro studies and a few in vivo studies with short-term treatment in relatively young animals; some provide support for metformin as a neuroprotective agent while others show evidence that metformin may be deleterious to neuronal survival. In this study, we examined the effect of long-term metformin treatment on brain neurotrophins and cognition in aged male C57Bl/6 mice. Mice were fed control (C), high-fat (HF) or a high-fat diet supplemented with metformin (HFM) for 6 months. Metformin decreased body fat composition and attenuated declines in motor function induced by a HF diet. Performance in the Morris water maze test of hippocampal based memory function, showed that metformin prevented impairment of spatial reference memory associated with the HF diet. Quantitative RT-PCR on brain homogenates revealed decreased transcription of BDNF, NGF and NTF3; however protein levels were not altered. Metformin treatment also decreased expression of the antioxidant pathway regulator, Nrf2. The decrease in transcription of neurotrophic factors and Nrf2 with chronic metformin intake, cautions of the possibility that extended metformin use may alter brain biochemistry in a manner that creates a vulnerable brain environment and warrants further investigation. PMID:26698400

  7. Prolonged metformin treatment leads to reduced transcription of Nrf2 and neurotrophic factors without cognitive impairment in older C57BL/6J mice.

    PubMed

    Allard, Joanne S; Perez, Evelyn J; Fukui, Koji; Carpenter, Priscilla; Ingram, Donald K; de Cabo, Rafael

    2016-03-15

    Long-term use of anti-diabetic agents has become commonplace as rates of obesity, metabolic syndrome and diabetes continue to escalate. Metformin, a commonly used anti-diabetic drug, has been shown to have many beneficial effects outside of its therapeutic regulation of glucose metabolism and insulin sensitivity. Studies on metformin's effects on the central nervous system are limited and predominantly consist of in vitro studies and a few in vivo studies with short-term treatment in relatively young animals; some provide support for metformin as a neuroprotective agent while others show evidence that metformin may be deleterious to neuronal survival. In this study, we examined the effect of long-term metformin treatment on brain neurotrophins and cognition in aged male C57Bl/6 mice. Mice were fed control (C), high-fat (HF) or a high-fat diet supplemented with metformin (HFM) for 6 months. Metformin decreased body fat composition and attenuated declines in motor function induced by a HF diet. Performance in the Morris water maze test of hippocampal based memory function, showed that metformin prevented impairment of spatial reference memory associated with the HF diet. Quantitative RT-PCR on brain homogenates revealed decreased transcription of BDNF, NGF and NTF3; however protein levels were not altered. Metformin treatment also decreased expression of the antioxidant pathway regulator, Nrf2. The decrease in transcription of neurotrophic factors and Nrf2 with chronic metformin intake, cautions of the possibility that extended metformin use may alter brain biochemistry in a manner that creates a vulnerable brain environment and warrants further investigation.

  8. Targeted Deletion of Nrf2 Impairs Lung Development and Oxidant Injury in Neonatal Mice

    PubMed Central

    van Houten, Bennett; Wang, Xuting; Miller-DeGraff, Laura; Fostel, Jennifer; Gladwell, Wesley; Perrow, Ligon; Panduri, Vijayalakshmi; Kobzik, Lester; Yamamoto, Masayuki; Bell, Douglas A.; Kleeberger, Steven R.

    2012-01-01

    Abstract Aims: Nrf2 is an essential transcription factor for protection against oxidant disorders. However, its role in organ development and neonatal disease has received little attention. Therapeutically administered oxygen has been considered to contribute to bronchopulmonary dysplasia (BPD) in prematurity. The current study was performed to determine Nrf2-mediated molecular events during saccular-to-alveolar lung maturation, and the role of Nrf2 in the pathogenesis of hyperoxic lung injury using newborn Nrf2-deficient (Nrf2−/−) and wild-type (Nrf2+/+) mice. Results: Pulmonary basal expression of cell cycle, redox balance, and lipid/carbohydrate metabolism genes was lower while lymphocyte immunity genes were more highly expressed in Nrf2−/− neonates than in Nrf2+/+ neonates. Hyperoxia-induced phenotypes, including mortality, arrest of saccular-to-alveolar transition, and lung edema, and inflammation accompanying DNA damage and tissue oxidation were significantly more severe in Nrf2−/− neonates than in Nrf2+/+ neonates. During lung injury pathogenesis, Nrf2 orchestrated expression of lung genes involved in organ injury and morphology, cellular growth/proliferation, vasculature development, immune response, and cell–cell interaction. Bioinformatic identification of Nrf2 binding motifs and augmented hyperoxia-induced inflammation in genetically deficient neonates supported Gpx2 and Marco as Nrf2 effectors. Innovation: This investigation used lung transcriptomics and gene targeted mice to identify novel molecular events during saccular-to-alveolar stage transition and to elucidate Nrf2 downstream mechanisms in protection from hyperoxia-induced injury in neonate mouse lungs. Conclusion: Nrf2 deficiency augmented lung injury and arrest of alveolarization caused by hyperoxia during the newborn period. Results suggest a therapeutic potential of specific Nrf2 activators for oxidative stress-associated neonatal disorders including BPD. Antioxid. Redox Signal

  9. Network inference algorithms elucidate Nrf2 regulation of mouse lung oxidative stress.

    PubMed

    Taylor, Ronald C; Acquaah-Mensah, George; Singhal, Mudita; Malhotra, Deepti; Biswal, Shyam

    2008-01-01

    A variety of cardiovascular, neurological, and neoplastic conditions have been associated with oxidative stress, i.e., conditions under which levels of reactive oxygen species (ROS) are elevated over significant periods. Nuclear factor erythroid 2-related factor (Nrf2) regulates the transcription of several gene products involved in the protective response to oxidative stress. The transcriptional regulatory and signaling relationships linking gene products involved in the response to oxidative stress are, currently, only partially resolved. Microarray data constitute RNA abundance measures representing gene expression patterns. In some cases, these patterns can identify the molecular interactions of gene products. They can be, in effect, proxies for protein-protein and protein-DNA interactions. Traditional techniques used for clustering coregulated genes on high-throughput gene arrays are rarely capable of distinguishing between direct transcriptional regulatory interactions and indirect ones. In this study, newly developed information-theoretic algorithms that employ the concept of mutual information were used: the Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNE), and Context Likelihood of Relatedness (CLR). These algorithms captured dependencies in the gene expression profiles of the mouse lung, allowing the regulatory effect of Nrf2 in response to oxidative stress to be determined more precisely. In addition, a characterization of promoter sequences of Nrf2 regulatory targets was conducted using a Support Vector Machine classification algorithm to corroborate ARACNE and CLR predictions. Inferred networks were analyzed, compared, and integrated using the Collective Analysis of Biological Interaction Networks (CABIN) plug-in of Cytoscape. Using the two network inference algorithms and one machine learning algorithm, a number of both previously known and novel targets of Nrf2 transcriptional activation were identified. Genes predicted as

  10. Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients

    PubMed Central

    Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

    2016-01-01

    The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of NAD(P)H:quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients. PMID:27274779

  11. Nrf2 reduces levels of phosphorylated tau protein by inducing autophagy adaptor protein NDP52

    NASA Astrophysics Data System (ADS)

    Jo, Chulman; Gundemir, Soner; Pritchard, Susanne; Jin, Youngnam N.; Rahman, Irfan; Johnson, Gail V. W.

    2014-03-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a pivotal transcription factor in the defence against oxidative stress. Here we provide evidence that activation of the Nrf2 pathway reduces the levels of phosphorylated tau by induction of an autophagy adaptor protein NDP52 (also known as CALCOCO2) in neurons. The expression of NDP52, which we show has three antioxidant response elements (AREs) in its promoter region, is strongly induced by Nrf2, and its overexpression facilitates clearance of phosphorylated tau in the presence of an autophagy stimulator. In Nrf2-knockout mice, phosphorylated and sarkosyl-insoluble tau accumulates in the brains concurrent with decreased levels of NDP52. Moreover, NDP52 associates with phosphorylated tau from brain cortical samples of Alzheimer disease cases, and the amount of phosphorylated tau in sarkosyl-insoluble fractions is inversely proportional to that of NDP52. These results suggest that NDP52 plays a key role in autophagy-mediated degradation of phosphorylated tau in vivo.

  12. Molecular and genomic approach for understanding the gene-environment interaction between Nrf2 deficiency and carcinogenic nickel-induced DNA damage.

    PubMed

    Kim, Hye Lim; Seo, Young Rok

    2012-12-01

    Nickel (Ⅱ) is a toxic and carcinogenic metal which induces a redox imbalance following oxidative stress. Nuclear factor erythroid-2 related factor 2 (Nrf2) is a redox factor that regulates oxidation/reduction status and consequently mediates cytoprotective responses against exposure to environmental toxicants. In this study, we investigated the protective roles of the Nrf2 gene against oxidative stress and DNA damage induced by nickel at sub-lethal doses. Under nickel exposure conditions, we detected significantly increased intracellular ROS generation, in addition to higher amounts of DNA damage using comet assay and γ-H2AX immunofluorescence staining in Nrf2 lacking cells, as compared to Nrf2 wild-type cells. In addition, we attempted to identify potential nickel and Nrf2-responsive targets and the relevant pathway. The genomic expression data were analyzed using microarray for the selection of synergistic effect-related genes by Nrf2 knockdown under nickel treatment. In particular, altered expressions of 6 upregulated genes (CAV1, FOSL2, MICA, PIM2, RUNX1 and SLC7A6) and 4 downregulated genes (APLP1, CLSPN, PCAF and PRAME) were confirmed by qRT-PCR. Additionally, using bioinformatics tool, we found that these genes functioned principally in a variety of molecular processes, including oxidative stress response, necrosis, DNA repair and cell survival. Thus, we describe the potential biomarkers regarded as molecular candidates for Nrf2-related cellular protection against nickel exposure. In conclusion, these findings indicate that Nrf2 is an important factor with a protective role in the suppression of mutagenicity and carcinogenicity by environmental nickel exposure in terms of gene-environment interaction. PMID:23023193

  13. Mechanisms and functions of Nrf2 signaling in Drosophila.

    PubMed

    Pitoniak, Andrew; Bohmann, Dirk

    2015-11-01

    The Nrf2 transcription factor belongs to the Cap'n'collar family, named after the founding member of this group, the product of the Drosophila Cap'n'collar gene. The encoded protein, Cap'n'collar, abbreviated Cnc, offers a convenient and accessible model to study the structure, function, and biology of Nrf2 transcription factors at the organismic, tissular, cellular, and molecular levels, using the powerful genetic, genomic, and biochemical tools available in Drosophila. In this review we provide an account of the original identification of Cnc as a regulator of embryonic development. We then describe the discovery of Nrf2-like functions of Cnc and its role in acute stress signaling and aging. The establishment of Drosophila as a model organism in which the mechanisms and functions of Nrf2 signaling can be studied has led to several discoveries: the regulation of stem cell activity by an Nrf2-mediated redox mechanism, the interaction of Nrf2 with p62 and Myc in the control of tissue growth and the unfolded protein response, and more. Several of these more recent lines of investigation are highlighted. Model organisms such as the fly and the worm remain powerful experimental platforms that can help to unravel the many remaining puzzles regarding the role of Nrf2 and its relatives in controlling the physiology and maintaining the health of multicellular organisms.

  14. Mechanisms and functions of Nrf2 signaling in Drosophila.

    PubMed

    Pitoniak, Andrew; Bohmann, Dirk

    2015-11-01

    The Nrf2 transcription factor belongs to the Cap'n'collar family, named after the founding member of this group, the product of the Drosophila Cap'n'collar gene. The encoded protein, Cap'n'collar, abbreviated Cnc, offers a convenient and accessible model to study the structure, function, and biology of Nrf2 transcription factors at the organismic, tissular, cellular, and molecular levels, using the powerful genetic, genomic, and biochemical tools available in Drosophila. In this review we provide an account of the original identification of Cnc as a regulator of embryonic development. We then describe the discovery of Nrf2-like functions of Cnc and its role in acute stress signaling and aging. The establishment of Drosophila as a model organism in which the mechanisms and functions of Nrf2 signaling can be studied has led to several discoveries: the regulation of stem cell activity by an Nrf2-mediated redox mechanism, the interaction of Nrf2 with p62 and Myc in the control of tissue growth and the unfolded protein response, and more. Several of these more recent lines of investigation are highlighted. Model organisms such as the fly and the worm remain powerful experimental platforms that can help to unravel the many remaining puzzles regarding the role of Nrf2 and its relatives in controlling the physiology and maintaining the health of multicellular organisms. PMID:26117322

  15. Involvement of the Nrf2-proteasome pathway in the endoplasmic reticulum stress response in pancreatic β-cells.

    PubMed

    Lee, Sanghwan; Hur, Eu-gene; Ryoo, In-geun; Jung, Kyeong-Ah; Kwak, Jiyeon; Kwak, Mi-Kyoung

    2012-11-01

    The ubiquitin-proteasome system plays a central role in protein quality control through endoplasmic reticulum (ER)-associated degradation (ERAD) of unfolded and misfolded proteins. NF-E2-related factor 2 (Nrf2) is a transcription factor that controls the expression of an array of phase II detoxification and antioxidant genes. Nrf2 signaling has additionally been shown to upregulate the expression of the proteasome catalytic subunits in several cell types. Here, we investigated the role of Nrf2 in tunicamycin-induced ER stress using a murine insulinoma β-cell line, βTC-6. shRNA-mediated silencing of Nrf2 expression in βTC-6 cells significantly increased tunicamycin-induced cytotoxicity, elevated the expression of the pro-apoptotic ER stress marker Chop10, and inhibited tunicamycin-inducible expression of the proteasomal catalytic subunits Psmb5 and Psmb6. The effects of 3H-1,2-dithiole-3-thione (D3T), a small molecule Nrf2 activator, on ER stress were also examined in βTC-6 cells. D3T pretreatment reduced tunicamycin cytotoxicity and attenuated the tunicamycin-inducible Chop10 and protein kinase RNA-activated-like ER kinase (Perk). The protective effect of D3T was shown to be associated with increased ERAD. D3T increased the expression of Psmb5 and Psmb6 and elevated chymotrypsin-like peptidase activity; proteasome inhibitor treatment blocked D3T effects on tunicamycin cytotoxicity and ER stress marker changes. Similarly, silencing of Nrf2 abolished the protective effect of D3T against ER stress. These results indicate that the Nrf2 pathway contributes to the ER stress response in pancreatic β-cells by enhancing proteasome-mediated ERAD.

  16. miR-144 reverses chemoresistance of hepatocellular carcinoma cell lines by targeting Nrf2-dependent antioxidant pathway

    PubMed Central

    Zhou, Suna; Ye, Wenguang; Zhang, Yanjun; Yu, Dequan; Shao, Qiuju; Liang, Jun; Zhang, Mingxin

    2016-01-01

    Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide. Chemoresistance occurrence is a major cause of treatment failure in HCC. Currently, extensive research has revealed diverse mechanisms for chemoresistance, but the molecular mechanisms underlying the role of miRNAs in resistance to 5-FU are not confirmed in HCC cells. By quantitative real-time polymerase chain reaction (qRT-PCR) analysis, we found that miR-144 was significantly decreased in HCC cell lines. It has been further demonstrated that miR-144 were significantly down-regulated in Bel-7402/5-FU cells compared with parental Bel-7402 cells by qRT-PCR and western blot. The expression of Nrf2 was reversely correlated to that of miR-144 in HCC cells. Moreover, Enhancement of 5-FU-induced cytotoxicity and apoptosis are resulted from the transfection with miR-144 mimics in Bel-7402/5-FU cells. Mechanically, miR-144 promoted nuclear factor erythroid-2-related factor-2 (Nrf2) mRNA degradation by directly targeting the Nrf2 3’untranslated region (3’UTR). In addition, ectopic expression of miR-144 in Bel-7402/5-FU cells reduced the levels of Nrf2 and inhibited the transcription of Nrf2-dependent HO-1 gene, thus contributing to 5-FU sensibilization. Conversely, re-expression of Nrf2 partly attenuated the chemosensibilization of miR-144. Our study showed that miR-144 serves as a potential chemoresistance-reversal agent in hepatocellular carcinoma cells, which is at least partly due to the down-regulation of Nrf2-dependent antioxidant pathway. PMID:27508019

  17. Kaposi's Sarcoma-Associated Herpesvirus Induces Nrf2 during De Novo Infection of Endothelial Cells to Create a Microenvironment Conducive to Infection

    PubMed Central

    Gjyshi, Olsi; Bottero, Virginie; Veettil, Mohanan Valliya; Dutta, Sujoy; Singh, Vivek Vikram; Chikoti, Leela; Chandran, Bala

    2014-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiological agent of Kaposi's sarcoma (KS) and primary effusion B-cell lymphoma. KSHV induces reactive oxygen species (ROS) early during infection of human dermal microvascular endothelial (HMVEC-d) cells that are critical for virus entry. One of the downstream targets of ROS is nuclear factor E2-related factor 2 (Nrf2), a transcription factor with important anti-oxidative functions. Here, we show that KS skin lesions have high Nrf2 activity compared to healthy skin tissue. Within 30 minutes of de novo KSHV infection of HMVEC-d cells, we observed Nrf2 activation through ROS-mediated dissociation from its inhibitor Keap1, Ser-40 phosphorylation, and subsequent nuclear translocation. KSHV binding and consequent signaling through Src, PI3-K and PKC-ζ were also important for Nrf2 stability, phosphorylation and transcriptional activity. Although Nrf2 was dispensable for ROS homeostasis, it was essential for the induction of COX-2, VEGF-A, VEGF-D, Bcl-2, NQO1, GCS, HO1, TKT, TALDO and G6PD gene expression in KSHV-infected HMVEC-d cells. The COX-2 product PGE2 induced Nrf2 activity through paracrine and autocrine signaling, creating a feed-forward loop between COX-2 and Nrf2. vFLIP, a product of KSHV latent gene ORF71, induced Nrf2 and its target genes NQO1 and HO1. Activated Nrf2 colocalized with the KSHV genome as well as with the latency protein LANA-1. Nrf2 knockdown enhanced ORF73 expression while reducing ORF50 and other lytic gene expression without affecting KSHV entry or genome nuclear delivery. Collectively, these studies for the first time demonstrate that during de novo infection, KSHV induces Nrf2 through intricate mechanisms involving multiple signal molecules, which is important for its ability to manipulate host and viral genes, creating a microenvironment conducive to KSHV infection. Thus, Nrf2 is a potential attractive target to intervene in KSHV infection and the associated maladies. PMID:25340789

  18. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages.

    PubMed

    Gu, Da-Min; Lu, Pei-Hua; Zhang, Ke; Wang, Xiang; Sun, Min; Chen, Guo-Qian; Wang, Qiong

    2015-02-13

    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. PMID:25582778

  19. Lipoicmethylenedioxyphenol Reduces Experimental Atherosclerosis through Activation of Nrf2 Signaling

    PubMed Central

    Ying, Zhekang; Chen, Minjie; Xie, Xiaoyun; Wang, Xiaoke; Kherada, Nisharahmed; Desikan, Rajagopal; Mihai, Georgeta; Burns, Patrick; Sun, Qinghua; Rajagopalan, Sanjay

    2016-01-01

    Objective Oxidative stress is implicated in the pathogenesis of atherosclerosis, and Nrf2 is the transcriptional factor central in cellular antioxidant responses. In the present study, we investigate the effect of a dihydrolipoic acid derivative lipoicmethylenedioxyphenol (LMDP) on the progression of atherosclerosis and test whether its effect on atherosclerosis is mediated by Nrf2. Methods and Results Both magnetic resonance imaging (MRI) scanning and en face analysis reveal that 14 weeks of treatment with LMDP markedly reduced atherosclerotic burden in a rabbit balloon vascular injury model. Myograph analyses show decreased aortic contractile response to phenylephrine and increased aortic response to acetylcholine and insulin in LMDP-treated animals, suggesting that LMDP inhibits atherosclerosis through improving vascular function. A role of Nrf2 signaling in mediating the amelioration of vascular function by LMDP was supported by increased Nrf2 translocation into nuclear and increased expression of Nrf2 target genes. Furthermore, chemotaxis analysis with Boydem chamber shows that leukocytes isolated from LMDP-treated rabbits had reduced chemotaxis, and knock-down of Nrf2 significantly reduced the effect of LMDP on the chemotaxis of mouse macrophages. Conclusion Our results support that LMDP has an anti-atherosclerotic effect likely through activation of Nrf2 signaling and subsequent inhibition of macrophage chemotaxis. PMID:26859892

  20. Lutein Has a Protective Effect on Hepatotoxicity Induced by Arsenic via Nrf2 Signaling

    PubMed Central

    Li, Shugang; Ding, Yusong; Niu, Qiang; Xu, Shangzhi; Pang, Lijuan; Ma, Rulin; Jing, Mingxia; Feng, Gangling; Tang, Jing Xia; Zhang, Qian; Ma, Xiaomei; Yan, Yizhong; Wang, Hai Xia; Li, Feng; Guo, Shuxia

    2015-01-01

    Arsenic produces liver disease through the oxidative stress. While lutein can alleviate cytotoxic and oxidative injury, nuclear factor erythroid 2-related factor 2 (Nrf2) pathway plays a critical role in defending oxidative species. However, the mechanisms by which lutein protects the liver against the effect of arsenic are not known. Therefore, this study aims to investigate the mechanisms involved in the action of lutein using mice model in which hepatotoxicity was induced by arsenic. We found that mice treatment with lutein could reverse changes in morphological and liver indexes and result in a significant improvement in hepatic function comparing with arsenic trioxide group. Lutein treatment improved the activities of antioxidant enzymes and attenuated increasing of ROS and MDA induced by arsenic trioxide. Lutein could increase the mRNA and protein expression of Nrf2 signaling related genes (Nrf2, Nqo1, Ho-1, and Gst). These findings provide additional evidence that lutein may be useful for reducing reproductive injury associated with oxidative stress by the activation of Nrf2 signaling. Our findings suggest a possible mechanism of antioxidant lutein in preventing the hepatotoxicity, which implicate that a dietary lutein may be a potential treatment for liver diseases, especially for arsenicosis therapy. PMID:25815309

  1. Lutein has a protective effect on hepatotoxicity induced by arsenic via Nrf2 signaling.

    PubMed

    Li, Shugang; Ding, Yusong; Niu, Qiang; Xu, Shangzhi; Pang, Lijuan; Ma, Rulin; Jing, Mingxia; Feng, Gangling; Tang, Jing Xia; Zhang, Qian; Ma, Xiaomei; Yan, Yizhong; Zhang, Jingyu; Wei, Meng; Wang, Hai Xia; Li, Feng; Guo, Shuxia

    2015-01-01

    Arsenic produces liver disease through the oxidative stress. While lutein can alleviate cytotoxic and oxidative injury, nuclear factor erythroid 2-related factor 2 (Nrf2) pathway plays a critical role in defending oxidative species. However, the mechanisms by which lutein protects the liver against the effect of arsenic are not known. Therefore, this study aims to investigate the mechanisms involved in the action of lutein using mice model in which hepatotoxicity was induced by arsenic. We found that mice treatment with lutein could reverse changes in morphological and liver indexes and result in a significant improvement in hepatic function comparing with arsenic trioxide group. Lutein treatment improved the activities of antioxidant enzymes and attenuated increasing of ROS and MDA induced by arsenic trioxide. Lutein could increase the mRNA and protein expression of Nrf2 signaling related genes (Nrf2, Nqo1, Ho-1, and Gst). These findings provide additional evidence that lutein may be useful for reducing reproductive injury associated with oxidative stress by the activation of Nrf2 signaling. Our findings suggest a possible mechanism of antioxidant lutein in preventing the hepatotoxicity, which implicate that a dietary lutein may be a potential treatment for liver diseases, especially for arsenicosis therapy.

  2. Involvement of NRF2 Signaling in Doxorubicin Resistance of Cancer Stem Cell-Enriched Colonospheres.

    PubMed

    Ryoo, In-Geun; Kim, Geon; Choi, Bo-Hyun; Lee, Sang-Hwan; Kwak, Mi-Kyoung

    2016-09-01

    Cancer stem cells (CSCs) are a subset of tumor cells, which are characterized by resistance against chemotherapy and environmental stress, and are known to cause tumor relapse after therapy. A number of molecular mechanisms underlie the chemoresistance of CSCs, including high expression levels of drug efflux transporters. We investigated the role of the antioxidant transcription factor NF-E2-related factor 2 (NRF2) in chemoresistance development, using a CSC-enriched colonosphere system. HCT116 colonospheres were more resistant to doxorubicin-induced cell death and expressed higher levels of drug efflux transporters such as P-glycoprotein (Pgp) and breast cancer resistance protein (BCRP) compared to HCT116 monolayers. Notably, levels of NRF2 and expression of its target genes were substantially elevated in colonospheres, and these increases were linked to doxorubicin resistance. When NRF2 expression was silenced in colonospheres, Pgp and BCRP expression was downregulated, and doxorubicin resistance was diminished. Collectively, these results indicate that NRF2 activation contributes to chemoresistance acquisition in CSC-enriched colonospheres through the upregulation of drug efflux transporters. PMID:27582554

  3. Involvement of NRF2 Signaling in Doxorubicin Resistance of Cancer Stem Cell-Enriched Colonospheres

    PubMed Central

    Ryoo, In-geun; Kim, Geon; Choi, Bo-hyun; Lee, Sang-hwan; Kwak, Mi-Kyoung

    2016-01-01

    Cancer stem cells (CSCs) are a subset of tumor cells, which are characterized by resistance against chemotherapy and environmental stress, and are known to cause tumor relapse after therapy. A number of molecular mechanisms underlie the chemoresistance of CSCs, including high expression levels of drug efflux transporters. We investigated the role of the antioxidant transcription factor NF-E2-related factor 2 (NRF2) in chemoresistance development, using a CSC-enriched colonosphere system. HCT116 colonospheres were more resistant to doxorubicin-induced cell death and expressed higher levels of drug efflux transporters such as P-glycoprotein (Pgp) and breast cancer resistance protein (BCRP) compared to HCT116 monolayers. Notably, levels of NRF2 and expression of its target genes were substantially elevated in colonospheres, and these increases were linked to doxorubicin resistance. When NRF2 expression was silenced in colonospheres, Pgp and BCRP expression was downregulated, and doxorubicin resistance was diminished. Collectively, these results indicate that NRF2 activation contributes to chemoresistance acquisition in CSC-enriched colonospheres through the upregulation of drug efflux transporters. PMID:27582554

  4. A novel natural Nrf2 activator with PPARγ-agonist (monascin) attenuates the toxicity of methylglyoxal and hyperglycemia.

    PubMed

    Hsu, Wei-Hsuan; Lee, Bao-Hong; Chang, Yu-Ying; Hsu, Ya-Wen; Pan, Tzu-Ming

    2013-11-01

    Methylglyoxal (MG) is a toxic-glucose metabolite and a major precursor of advanced glycation endproducts (AGEs). MG has been reported to result in inflammation by activating receptor for AGEs (RAGE). We recently found that Monascus-fermented metabolite monascin acts as a novel natural peroxisome proliferator-activated receptor-γ (PPARγ) agonist that improves insulin sensitivity. We investigated the metabolic, biochemical, and molecular abnormalities characteristic of type 2 diabetes in MG-treated Wistar rats treated with oral administration of monascin or rosiglitazone. Monascin (a novel PPARγ agonist) activated nuclear factor-erythroid 2-related factor 2 (Nrf2) and down-regulated hyperinsulinmia in oral glucose tolerance test (OGTT). Monascin was able to elevate glyoxalase-1 expression via activation of hepatic Nrf2, hence, resulting in MG metabolism to d-lactic acid and protected from AGEs production in MG-treated rats. Rosiglitazone did not activate Nrf2 nor glyoxalase expression to lower serum and hepatic AGEs levels. Monascin acts as a novel natural Nrf2 activator with PPARγ-agonist activity were confirmed by Nrf2 and PPARγ reporter assays in Hep G2 cells. These findings suggest that monascin acts as an anti-diabetic and anti-oxidative stress agent to a greater degree than rosiglitazone and thus may have therapeutic potential for the prevention of diabetes. PMID:23954466

  5. Curcumin Protects Human Keratinocytes against Inorganic Arsenite-Induced Acute Cytotoxicity through an NRF2-Dependent Mechanism

    PubMed Central

    Zhao, Rui; Yang, Bei; Wang, Linlin; Xue, Peng; Deng, Baocheng; Zhang, Guohua; Jiang, Shukun; Zhang, Miao; Liu, Min; Pi, Jingbo; Guan, Dawei

    2013-01-01

    Human exposure to inorganic arsenic leads to various dermal disorders, including hyperkeratosis and skin cancer. Curcumin is demonstrated to induce remarkable antioxidant activity in a variety of cells and tissues. The present study aimed at identifying curcumin as a potent activator of nuclear factor erythroid 2-related factor 2 (NRF2) and demonstrating its protective effect against inorganic arsenite- (iAs3+-) induced cytotoxicity in human keratinocytes. We found that curcumin led to nuclear accumulation of NRF2 protein and increased the expression of antioxidant response element- (ARE-) regulated genes in HaCaT keratinocytes in concentration- and time-dependent manners. High concentration of curcumin (20 μM) also increased protein expression of long isoforms of NRF1. Treatment with low concentrations of curcumin (2.5 or 5 μM) effectively increased the viability and survival of HaCaT cells against iAs3+-induced cytotoxicity as assessed by the MTT assay and flow cytometry and also attenuated iAs3+-induced expression of cleaved caspase-3 and cleaved PARP protein. Selective knockdown of NRF2 or KEAP1 by lentiviral shRNAs significantly diminished the cytoprotection conferred by curcumin, suggesting that the protection against iAs3+-induced cytotoxicity is dependent on the activation of NRF2. Our results provided a proof of the concept of using curcumin to activate the NRF2 pathway to alleviate arsenic-induced dermal damage. PMID:23710286

  6. Standardized Extract of Bacopa monniera Attenuates Okadaic Acid Induced Memory Dysfunction in Rats: Effect on Nrf2 Pathway

    PubMed Central

    Nagarajan, Rajasekar; Hanif, Kashif; Siddiqui, Hefazat Husain; Nath, Chandishwar

    2013-01-01

    The aim of the present study is to investigate the effect of standardized extract of Bacopa monnieri (memory enhancer) and Melatonin (an antioxidant) on nuclear factor erythroid 2 related factor 2 (Nrf2) pathway in Okadaic acid induced memory impaired rats. OKA (200 ng) was administered intracerebroventricularly (ICV) to induce memory impairment in rats. Bacopa monnieri (BM-40 and 80 mg/kg) and Melatonin (20 mg/kg) were administered 1 hr before OKA injection and continued daily up to day 13. Memory functions were assessed by Morris water maze test on days 13–15. Rats were sacrificed for biochemical estimations of oxidative stress, neuroinflammation, apoptosis, and molecular studies of Nrf2, HO1, and GCLC expressions in cerebral cortex and hippocampus brain regions. OKA caused a significant memory deficit with oxidative stress, neuroinflammation, and neuronal loss which was concomitant with attenuated expression of Nrf2, HO1, and GCLC. Treatment with BM and Melatonin significantly improved memory dysfunction in OKA rats as shown by decreased latency time and path length. The treatments also restored Nrf2, HO1, and GCLC expressions and decreased oxidative stress, neuroinflammation, and neuronal loss. Thus strengthening the endogenous defense through Nrf2 modulation plays a key role in the protective effect of BM and Melatonin in OKA induced memory impairment in rats. PMID:24078822

  7. Taurine protects against As2O3-induced autophagy in pancreas of rat offsprings through Nrf2/Trx pathway.

    PubMed

    Bai, Jie; Yao, Xiaofeng; Jiang, Liping; Qiu, Tianming; Liu, Shuang; Qi, Baoxu; Zheng, Yue; Kong, Yuan; Yang, Guang; Chen, Min; Liu, Xiaofang; Sun, Xiance

    2016-04-01

    Arsenic was increasingly to blame as a risk factor for type 2 diabetes mellitus. In our previous study, we had found iAs stimulated autophagic flux and caused autophagic cell death through ROS pathway in INS-1 cells. Since NF-E2-related factor 2 (Nrf2) and the thioredoxin (Trx) system was a crucial line of defense against ROS, we investigated whether Nrf2/Trx pathway contributed to As2O3-stimulated autophagy and the role of taurine in this study. After treatment with 2 mg/kg BW-8 mg/kg BW As2O3 for 57 d, the expression of Nrf2 protein was decreased significantly in offsprings' pancreas. The expression of Trx gene was decreased significantly in pancreas subsequently. Finally, the generation of reactive oxygen species stimulated autophagy in arsenic-treated pancreas. Taurine could reverse arsenic-inhibited Nrf2 and Trx and inhibit autophagy. In short, inhibition of Nrf2/Trx pathway might play an important role in the pathogenesis of arsenic-related diabetes. Taurine could serve as nutrition supplementation against arsenic-related diabetes in high arsenic exposure area.

  8. Nrf2 and selenoproteins are essential for maintaining oxidative homeostasis in erythrocytes and protecting against hemolytic anemia.

    PubMed

    Kawatani, Yukie; Suzuki, Takafumi; Shimizu, Ritsuko; Kelly, Vincent P; Yamamoto, Masayuki

    2011-01-20

    Reactive oxygen species (ROS) are highly destructive toward cellular macromolecules. However, moderate levels of ROS can contribute to normal cellular processes including signaling. Herein we evaluate the consequence of a pro-oxidant environment on hematopoietic homeostasis. The NF-E2 related factor 2 (Nrf2) transcription factor regulates genes related to ROS scavenging and detoxification. Nrf2 responds to altered cellular redox status, such as occurs with loss of antioxidant selenoproteins after deletion of the selenocysteine-tRNA gene (Trsp). Conditional knockout of the Trsp gene using Mx1-inducible Cre-recombinase leads to selenoprotein deficiency and anemia on a wild-type background, whereas Trsp:Nrf2 double deficiency dramatically exacerbates the anemia and increases intracellular hydrogen peroxide levels in erythroblasts. Results indicate that Nrf2 compensates for defective ROS scavenging when selenoproteins are lost from erythroid cells. We also observed thymus atrophy in single Trsp-conditional knockout mice, suggesting a requirement for selenoprotein function in T-cell differentiation within the thymus. Surprisingly, no changes were observed in the myelomonocytic or megakaryocytic populations. Therefore, our results show that selenoprotein activity and the Nrf2 gene battery are particularly important for oxidative homeostasis in erythrocytes and for the prevention of hemolytic anemia. PMID:20978266

  9. Taurine protects against As2O3-induced autophagy in pancreas of rat offsprings through Nrf2/Trx pathway.

    PubMed

    Bai, Jie; Yao, Xiaofeng; Jiang, Liping; Qiu, Tianming; Liu, Shuang; Qi, Baoxu; Zheng, Yue; Kong, Yuan; Yang, Guang; Chen, Min; Liu, Xiaofang; Sun, Xiance

    2016-04-01

    Arsenic was increasingly to blame as a risk factor for type 2 diabetes mellitus. In our previous study, we had found iAs stimulated autophagic flux and caused autophagic cell death through ROS pathway in INS-1 cells. Since NF-E2-related factor 2 (Nrf2) and the thioredoxin (Trx) system was a crucial line of defense against ROS, we investigated whether Nrf2/Trx pathway contributed to As2O3-stimulated autophagy and the role of taurine in this study. After treatment with 2 mg/kg BW-8 mg/kg BW As2O3 for 57 d, the expression of Nrf2 protein was decreased significantly in offsprings' pancreas. The expression of Trx gene was decreased significantly in pancreas subsequently. Finally, the generation of reactive oxygen species stimulated autophagy in arsenic-treated pancreas. Taurine could reverse arsenic-inhibited Nrf2 and Trx and inhibit autophagy. In short, inhibition of Nrf2/Trx pathway might play an important role in the pathogenesis of arsenic-related diabetes. Taurine could serve as nutrition supplementation against arsenic-related diabetes in high arsenic exposure area. PMID:26775255

  10. Nrf2 and selenoproteins are essential for maintaining oxidative homeostasis in erythrocytes and protecting against hemolytic anemia.

    PubMed

    Kawatani, Yukie; Suzuki, Takafumi; Shimizu, Ritsuko; Kelly, Vincent P; Yamamoto, Masayuki

    2011-01-20

    Reactive oxygen species (ROS) are highly destructive toward cellular macromolecules. However, moderate levels of ROS can contribute to normal cellular processes including signaling. Herein we evaluate the consequence of a pro-oxidant environment on hematopoietic homeostasis. The NF-E2 related factor 2 (Nrf2) transcription factor regulates genes related to ROS scavenging and detoxification. Nrf2 responds to altered cellular redox status, such as occurs with loss of antioxidant selenoproteins after deletion of the selenocysteine-tRNA gene (Trsp). Conditional knockout of the Trsp gene using Mx1-inducible Cre-recombinase leads to selenoprotein deficiency and anemia on a wild-type background, whereas Trsp:Nrf2 double deficiency dramatically exacerbates the anemia and increases intracellular hydrogen peroxide levels in erythroblasts. Results indicate that Nrf2 compensates for defective ROS scavenging when selenoproteins are lost from erythroid cells. We also observed thymus atrophy in single Trsp-conditional knockout mice, suggesting a requirement for selenoprotein function in T-cell differentiation within the thymus. Surprisingly, no changes were observed in the myelomonocytic or megakaryocytic populations. Therefore, our results show that selenoprotein activity and the Nrf2 gene battery are particularly important for oxidative homeostasis in erythrocytes and for the prevention of hemolytic anemia.

  11. Cerebroprotection of Flavanol (−)-Epicatechin after Traumatic Brain Injury via Nrf2-dependent and –independent Pathways

    PubMed Central

    Cheng, Tian; Wang, Wenzhu; Li, Qian; Han, Xiaoning; Xing, Jing; Qi, Cunfang; Lan, Xi; Wan, Jieru; Potts, Alexa; Guan, Fangxia; Wang, Jian

    2016-01-01

    Traumatic brain injury (TBI), which leads to disability, dysfunction, and even death, is a prominent health problem worldwide with no effective treatment. A brain-permeable flavonoid named (−)-epicatechin (EC) modulates redox/oxidative stress and has been shown to be beneficial for vascular and cognitive function in humans and for ischemic and hemorrhagic stroke in rodents. Here we examined whether EC is able to protect the brain against TBI-induced brain injury in mice and if so, whether it exerts neuroprotection by modulating the NF-E2-related factor (Nrf2) pathway. We used the controlled cortical impact model to mimic TBI. EC was administered orally at 3 h after TBI and then every 24 h for either 3 or 7 days. We evaluated lesion volume, brain edema, white matter injury, neurologic deficits, cognitive performance and emotion-like behaviors, neutrophil infiltration, reactive oxygen species (ROS), and a variety of injury-related protein markers. Nrf2 knockout mice were used to determine the role of the Nrf2 signaling pathway after EC treatment. In wild-type mice, EC significantly reduced lesion volume, edema, and cell death and improved neurologic function on days 3 and 28; cognitive performance and depression-like behaviors were also improved with EC administration. In addition, EC reduced white matter injury, heme oxygenase-1 expression, and ferric iron deposition after TBI. These changes were accompanied by attenuation of neutrophil infiltration and oxidative insults, reduced activity of matrix metalloproteinase 9, decreased Keap 1 expression, increased Nrf2 nuclear accumulation, and increased expression of superoxide dismutase 1 and quinone 1. However, EC did not significantly reduce lesion volume or improve neurologic deficits in Nrf2 knockout mice after TBI. Our results show that EC protects the TBI brain by activating the Nrf2 pathway, inhibiting heme oxygenase-1 protein expression, and reducing iron deposition. The latter two effects could represent an

  12. Resveratrol restored Nrf2 function, reduced renal inflammation, and mitigated hypertension in spontaneously hypertensive rats.

    PubMed

    Javkhedkar, Apurva A; Quiroz, Yasmir; Rodriguez-Iturbe, Bernardo; Vaziri, Nosratola D; Lokhandwala, Mustafa F; Banday, Anees A

    2015-05-15

    Compelling evidence supports the role of oxidative stress and renal interstitial inflammation in the pathogenesis of hypertension. Resveratrol is a polyphenolic stilbene, which can lower oxidative stress by activating the transcription factor nuclear factor-E2-related factor-2 (Nrf2), the master regulator of numerous genes encoding antioxidant and phase II-detoxifying enzymes and molecules. Given the role of oxidative stress and inflammation in the pathogenesis of hypertension, we conducted this study to test the hypothesis that long-term administration of resveratrol will attenuate renal inflammation and oxidative stress and, hence, progression of hypertension in the young spontaneously hypertensive rats (SHR). SHR and control [Wistar-Kyoto (WKY)] rats were treated for 9 wk with resveratrol or vehicle in their drinking water. Vehicle-treated SHR exhibited renal inflammatory injury and oxidative stress, as evidenced by glomerulosclerosis, tubulointerstitial injury, infiltration of inflammatory cells, and increased levels of renal 8-isoprostane and protein carbonylation. This was associated with reduced antioxidant capacity and downregulations of Nrf2 and phase II antioxidant enzyme glutathione-S-transferase (GST). Resveratrol treatment mitigated renal inflammation and injury, reduced oxidative stress, normalized antioxidant capacity, restored Nrf2 and GST activity, and attenuated the progression of hypertension in SHR. However, resveratrol had no effect on these parameters in WKY rats. In conclusion, development and progression of hypertension in the SHR are associated with inflammation, oxidative stress, and impaired Nrf2-GST activity in the kidney. Long-term administration of resveratrol restores Nrf2 expression, ameliorates inflammation, and attenuates development of hypertension in SHR. Clinical studies are needed to explore efficacy of resveratrol in human hypertension.

  13. Nrf2, a Guardian of Healthspan and Gatekeeper of Species Longevity

    PubMed Central

    Lewis, Kaitlyn N.; Mele, James; Hayes, John D.; Buffenstein, Rochelle

    2010-01-01

    Although aging is a ubiquitous process that prevails in all organisms, the mechanisms governing both the rate of decline in functionality and the age of onset remain elusive. A profound constitutively upregulated cytoprotective response is commonly observed in naturally long-lived species and experimental models of extensions to lifespan (e.g., genetically-altered and/or experimentally manipulated organisms), as indicated by enhanced resistance to stress and upregulated downstream components of the cytoprotective nuclear factor erythroid 2-related factor 2 (Nrf2)-signaling pathway. The transcription factor Nrf2 is constitutively expressed in all tissues, although levels may vary among organs, with the key detoxification organs (kidney and liver) exhibiting highest levels. Nrf2 may be further induced by cellular stressors including endogenous reactive-oxygen species or exogenous electrophiles. The Nrf2-signaling pathway mediates multiple avenues of cytoprotection by activating the transcription of more than 200 genes that are crucial in the metabolism of drugs and toxins, protection against oxidative stress and inflammation, as well as playing an integral role in stability of proteins and in the removal of damaged proteins via proteasomal degradation or autophagy. Nrf2 interacts with other important cell regulators such as tumor suppressor protein 53 (p53) and nuclear factor-kappa beta (NF-κB) and through their combined interactions is the guardian of healthspan, protecting against many age-related diseases including cancer and neurodegeneration. We hypothesize that this signaling pathway plays a critical role in the determination of species longevity and that this pathway may indeed be the master regulator of the aging process. PMID:21031035

  14. Expression of target genes of nuclear factor E2-related factor 2 in the liver of dairy cows in the transition period and at different stages of lactation.

    PubMed

    Gessner, D K; Schlegel, G; Keller, J; Schwarz, F J; Ringseis, R; Eder, K

    2013-02-01

    In the liver of dairy cows, the production of cytokines is enhanced during the periparturient phase, which in turn leads to inflammation and an impairment of hepatic function. Nuclear factor E2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that controls the transcription of genes encoding various antioxidative and cytoprotective proteins. In the present study, we investigated the hypothesis that Nrf2 is activated in the liver of dairy cows during the periparturient phase to protect the liver against the deleterious effects of cytokines and reactive oxygen species. Therefore, we determined relative mRNA abundances of TNF (encoding tumor necrosis factor-α), various acute phase proteins and several Nrf2 target genes in liver biopsy samples of 20 dairy cows at each time point from 3 wk antepartum to 1, 5, and 14 wk postpartum. We observed an increase in mRNA abundances of TNF and acute-phase proteins [serum amyloid A 3 (SAA3), haptoglobin (HP), and C-reactive protein (CRP)] from 3 wk antepartum to 1 wk postpartum, indicative of a proinflammatory condition. Messenger RNA abundances of various Nrf2 target genes with antioxidative or cytoprotective functions [glutathione peroxidase 3 (GPX3); microsomal glutathione S-transferase 3 (MGST3); superoxide dismutase (SOD1); catalase (CAT); metallothioneins 1A, 1E, and 2A (MT1A, MT1E, and MT2A, respectively); NAD(P)H dehydrogenase, quinone 1 (NQO1); heme oxygenase 2 (HMOX2); and UDP glucuronosyltransferase 1 family, polypeptide A1 (UGT1A1)] were also greatly increased from 3 wk antepartum to 1 wk postpartum. From 1 wk postpartum to later lactation, mRNA abundances of all the Nrf2-target genes considered declined but remained at levels that were higher than those in 3 wk antepartum. No correlations were found, however, between plasma concentrations of nonesterified fatty acids or β-hydroxybutyrate and mRNA abundances of Nrf2 target genes, indicating that a negative energy balance might not have been the main

  15. Carvedilol, a third-generation β-blocker prevents oxidative stress-induced neuronal death and activates Nrf2/ARE pathway in HT22 cells

    SciTech Connect

    Ouyang, Ying; Chen, Ziwei; Tan, Min; Liu, Anmin; Chen, Meihui; Liu, Jun; Pi, Rongbiao; Fang, Jianpei

    2013-11-29

    Highlights: •Carvedilol significantly prevented oxidative stress-induced cell death. •Carvedilol significantly decreased the production of ROS. •Carvedilol activated Nrf2/ARE pathway. •Carvedilol increased the protein levels of HO-1 and NQO-1. -- Abstract: Carvedilol, a nonselective β-adrenoreceptor blocker with pleiotropic activities has been shown to exert neuroprotective effect due to its antioxidant property. However, the neuroprotective mechanism of carvedilol is still not fully uncovered. Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. Here we investigated the effect of carvedilol on oxidative stress-induced cell death (glutamate 2 mM and H{sub 2}O{sub 2} 600 μM) and the activity of Nrf2/ARE pathway in HT22 hippocampal cells. Carvedilol significantly increased cell viability and decreased ROS in HT22 cells exposed to glutamate or H{sub 2}O{sub 2}. Furthermore, carvedilol activated the Nrf2/ARE pathway in a concentration-dependent manner, and increased the protein levels of heme oxygenase-1(HO-1) and NAD(P)H quinone oxidoreductase-1(NQO-1), two downstream factors of the Nrf2/ARE pathway. Collectively, our results indicate that carvedilol protects neuronal cell against glutamate- and H{sub 2}O{sub 2}-induced neurotoxicity possibly through activating the Nrf2/ARE signaling pathway.

  16. Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway

    PubMed Central

    Campbell, Michelle R.; Karaca, Mehmet; Adamski, Kelly N.; Chorley, Brian N.; Wang, Xuting; Bell, Douglas A.

    2013-01-01

    Nuclear factor- (erythroid-derived 2) like 2 (NFE2L2, NRF2) is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN) to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq) identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE) in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1), and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis. PMID:23766848

  17. Proteomic analysis of Nrf2 deficient transgenic mice reveals cellular defence and lipid metabolism as primary Nrf2-dependent pathways in the liver.

    PubMed

    Kitteringham, Neil R; Abdullah, Azman; Walsh, Joanne; Randle, Laura; Jenkins, Rosalind E; Sison, Rowena; Goldring, Christopher E P; Powell, Helen; Sanderson, Christopher; Williams, Samantha; Higgins, Larry; Yamamoto, Masayuki; Hayes, John; Park, B Kevin

    2010-06-16

    The transcription factor Nrf2 regulates expression of multiple cellular defence proteins through the antioxidant response element (ARE). Nrf2-deficient mice (Nrf2(-/-)) are highly susceptible to xenobiotic-mediated toxicity, but the precise molecular basis of enhanced toxicity is unknown. Oligonucleotide array studies suggest that a wide range of gene products is altered constitutively, however no equivalent proteomics analyses have been conducted. To define the range of Nrf2-regulated proteins at the constitutive level, protein expression profiling of livers from Nrf2(-/-) and wild type mice was conducted using both stable isotope labelling (iTRAQ) and gel electrophoresis methods. To establish a robust reproducible list of Nrf2-dependent proteins, three independent groups of mice were analysed. Correlative network analysis (MetaCore) identified two predominant groups of Nrf2-regulated proteins. As expected, one group comprised proteins involved in phase II drug metabolism, which were down-regulated in the absence of Nrf2. Surprisingly, the most profound changes were observed amongst proteins involved in the synthesis and metabolism of fatty acids and other lipids. Importantly, we show here for the first time, that the enzyme ATP-citrate lyase, responsible for acetyl-CoA production, is negatively regulated by Nrf2. This latter finding suggests that Nrf2 is a major regulator of cellular lipid disposition in the liver.

  18. Sulforaphane Protects against Cardiovascular Disease via Nrf2 Activation

    PubMed Central

    Bai, Yang; Wang, Xiaolu; Zhao, Song; Ma, Chunye; Cui, Jiuwei; Zheng, Yang

    2015-01-01

    Cardiovascular disease (CVD) causes an unparalleled proportion of the global burden of disease and will remain the main cause of mortality for the near future. Oxidative stress plays a major role in the pathophysiology of cardiac disorders. Several studies have highlighted the cardinal role played by the overproduction of reactive oxygen or nitrogen species in the pathogenesis of ischemic myocardial damage and consequent cardiac dysfunction. Isothiocyanates (ITC) are sulfur-containing compounds that are broadly distributed among cruciferous vegetables. Sulforaphane (SFN) is an ITC shown to possess anticancer activities by both in vivo and epidemiological studies. Recent data have indicated that the beneficial effects of SFN in CVD are due to its antioxidant and anti-inflammatory properties. SFN activates NF-E2-related factor 2 (Nrf2), a basic leucine zipper transcription factor that serves as a defense mechanism against oxidative stress and electrophilic toxicants by inducing more than a hundred cytoprotective proteins, including antioxidants and phase II detoxifying enzymes. This review will summarize the evidence from clinical studies and animal experiments relating to the potential mechanisms by which SFN modulates Nrf2 activation and protects against CVD. PMID:26583056

  19. Epalrestat increases glutathione, thioredoxin, and heme oxygenase-1 by stimulating Nrf2 pathway in endothelial cells

    PubMed Central

    Yama, Kaori; Sato, Keisuke; Abe, Natsuki; Murao, Yu; Tatsunami, Ryosuke; Tampo, Yoshiko

    2014-01-01

    Epalrestat (EPS) is the only aldose reductase inhibitor that is currently available for the treatment of diabetic neuropathy. Recently, we found that EPS at near-plasma concentration increases the intracellular levels of glutathione (GSH) in rat Schwann cells. GSH plays a crucial role in protecting endothelial cells from oxidative stress, thereby preventing vascular diseases. Here we show that EPS increases GSH levels in not only Schwann cells but also endothelial cells. Treatment of bovine aortic endothelial cells (BAECs), an in vitro model of the vascular endothelium, with EPS caused a dramatic increase in intracellular GSH levels. This was concomitant with the up-regulation of glutamate cysteine ligase, an enzyme catalyzing the first and rate-limiting step in de novo GSH synthesis. Moreover, EPS stimulated the expression of thioredoxin and heme oxygenase-1, which have important redox regulatory functions in endothelial cells. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key transcription factor that regulates the expression of antioxidant genes. EPS increased nuclear Nrf2 levels in BAECs. Nrf2 knockdown by siRNA suppressed the EPS-induced glutamate cysteine ligase, thioredoxin-1, and heme oxygenase-1 expression. Interestingly, LY294002, an inhibitor of phosphatidylinositol 3-kinase, abolished the EPS-stimulated GSH synthesis, suggesting that the kinase is associated with Nrf2 activation induced by EPS. Furthermore, EPS reduced the cytotoxicity induced by H2O2 and tert-butylhydroperoxide, indicating that EPS plays a role in protecting cells from oxidative stress. Taken together, the results provide evidence that EPS exerts new beneficial effects on endothelial cells by increasing GSH, thioredoxin, and heme oxygenase-1 levels through the activation of Nrf2. We suggest that EPS has the potential to prevent several vascular diseases caused by oxidative stress. PMID:25529839

  20. Broccoli sprout extract prevents diabetic cardiomyopathy via Nrf2 activation in db/db T2DM mice.

    PubMed

    Xu, Zheng; Wang, Shudong; Ji, Honglei; Zhang, Zhiguo; Chen, Jing; Tan, Yi; Wintergerst, Kupper; Zheng, Yang; Sun, Jian; Cai, Lu

    2016-01-01

    To develop a clinic-relevant protocol for systemic up-regulation of NFE2-related factor 2 (Nrf2) to prevent diabetic cardiomyopathy (DCM), male db/db and age-matched wild-type (WT) mice were given sulforaphane (SFN, an Nrf2 activator) and its natural source, broccoli sprout extract (BSE) by gavage every other day for 3 months, with four groups: vehicle (0.1 ml/10 g), BSE-low dose (estimated SFN availability at 0.5 mg/kg), BSE-high dose (estimated SFN availability at 1.0 mg/kg), and SFN (0.5 mg/kg). Cardiac function and pathological changes (hypertrophy, fibrosis, inflammation and oxidative damage) were assessed by echocardiography and histopathological examination along with Western blot and real-time PCR, respectively. Both BSE and SFN significantly prevented diabetes-induced cardiac dysfunction, hypertrophy and fibrosis. Mechanistically, BSE, like SFN, significantly up-regulated Nrf2 transcriptional activity, evidenced by the increased Nrf2 nuclear accumulation and its downstream gene expression. This resulted in a significant prevention of cardiac oxidative damage and inflammation. For all these preventive effects, BSE at high dose provided a similar effect as did SFN. These results indicated that BSE at high dose prevents DCM in a manner congruent with SFN treatment. Therefore, it suggests that BSE could potentially be used as a natural and safe treatment against DCM via Nrf2 activation. PMID:27457280

  1. Broccoli sprout extract prevents diabetic cardiomyopathy via Nrf2 activation in db/db T2DM mice

    PubMed Central

    Xu, Zheng; Wang, Shudong; Ji, Honglei; Zhang, Zhiguo; Chen, Jing; Tan, Yi; Wintergerst, Kupper; Zheng, Yang; Sun, Jian; Cai, Lu

    2016-01-01

    To develop a clinic-relevant protocol for systemic up-regulation of NFE2-related factor 2 (Nrf2) to prevent diabetic cardiomyopathy (DCM), male db/db and age-matched wild-type (WT) mice were given sulforaphane (SFN, an Nrf2 activator) and its natural source, broccoli sprout extract (BSE) by gavage every other day for 3 months, with four groups: vehicle (0.1 ml/10 g), BSE-low dose (estimated SFN availability at 0.5 mg/kg), BSE-high dose (estimated SFN availability at 1.0 mg/kg), and SFN (0.5 mg/kg). Cardiac function and pathological changes (hypertrophy, fibrosis, inflammation and oxidative damage) were assessed by echocardiography and histopathological examination along with Western blot and real-time PCR, respectively. Both BSE and SFN significantly prevented diabetes-induced cardiac dysfunction, hypertrophy and fibrosis. Mechanistically, BSE, like SFN, significantly up-regulated Nrf2 transcriptional activity, evidenced by the increased Nrf2 nuclear accumulation and its downstream gene expression. This resulted in a significant prevention of cardiac oxidative damage and inflammation. For all these preventive effects, BSE at high dose provided a similar effect as did SFN. These results indicated that BSE at high dose prevents DCM in a manner congruent with SFN treatment. Therefore, it suggests that BSE could potentially be used as a natural and safe treatment against DCM via Nrf2 activation. PMID:27457280

  2. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages

    SciTech Connect

    Gu, Da-min; Lu, Pei-Hua; Zhang, Ke; Wang, Xiang; Sun, Min; Chen, Guo-Qian; Wang, Qiong

    2015-02-13

    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. - Highlights: • Pre-treatment of astragaloside IV (AS-IV) protects murine cortical neurons from OGD/R. • AS-IV activates Nrf2-ARE signaling in murine cortical neurons. • Nrf2 is required for AS-IV-mediated anti-oxidant and neuroprotective activities. • AS-IV stimulates HB-EGF release to trans-activate EGFR in murine cortical neurons. • EGFR mediates AS-IV-induced Nrf2 activation and neuroprotection against OGD/R.

  3. CD36 Upregulation Mediated by Intranasal LV-NRF2 Treatment Mitigates Hypoxia-Induced Progression of Alzheimer's-Like Pathogenesis

    PubMed Central

    Wang, Chun-Yan; Xie, Jing-Wei; Cai, Jian-Hui; Wang, Tao; Xu, Ye; Wang, Xu

    2014-01-01

    Abstract Aims: There is extensive evidence that oxidative stress induces cellular dysfunction in the brain and plays a critical role in Alzheimer's disease (AD) pathogenesis. Hypoxia increases factors involved in oxidative stress injury and contributes to the onset and progression of AD. Nuclear factor erythroid 2-related factor 2 (NRF2), a major component regulating antioxidant response, is attenuated in the AD brain. Importantly, NRF2 directly regulates the alternative first exons of CD36, an important participant in oxidative and inflammatory processes. To explore the effects of hypoxia-induced deterioration of AD-like pathogenesis and investigate the correlation between hypoxia-induced NRF2 signal alterations and CD36 expression, we examined the NRF2 signaling, CD36, and oxidative stress events in hypoxia-treated APPswe/PSEN1dE9 (APP/PS1) mice brain. Results: We observed that hypoxia treatment increased oxidative stress, exacerbated inflammation, and aggravated learning defects in aged APP/PS1 mice. Microglia from hypoxia-treated mice brain exhibited marked reduction in CD36 expression and inhibition of β-amyloid (Aβ) degradation. Accordingly, hypoxia treatment caused a decrease in transactivation of NRF2 target genes in the aging mouse brain. Intranasal administration with a lentiviral vector encoding human NRF2 increased CD36 expression, ameliorated the weak antioxidant response triggered by hypoxia, diminished Aβ deposition, and improved spatial memory defects. Innovation: In this study, we demonstrated for the first time that NRF2 intranasal treatment-induced increases of CD36 could enhance Aβ clearance in AD transgenic mouse. Conclusion: These results suggest that targeting NRF2-mediated CD36 expression might provide a beneficial intervention for cognitive impairment and oxidative stress in AD progression. Antioxid. Redox Signal. 21, 2208–2230. PMID:24702189

  4. Posttreatment with 11-Keto-β-Boswellic Acid Ameliorates Cerebral Ischemia-Reperfusion Injury: Nrf2/HO-1 Pathway as a Potential Mechanism.

    PubMed

    Ding, Yi; Chen, MinChun; Wang, MingMing; Li, YuWen; Wen, AiDong

    2015-12-01

    Oxidative stress is well known to play a pivotal role in cerebral ischemia-reperfusion injury. The nuclear factor erythroid-2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway has been considered a potential target for neuroprotection in stroke. 11-Keto-β-boswellic acid (KBA) is a triterpenoid compound from extracts of Boswellia serrata. The aim of the present study was to determine whether KBA, a novel Nrf2 activator, can protect against cerebral ischemic injury. Middle cerebral artery occlusion (MCAO) was operated on male Sprague-Dawley rats. KBA (25 mg/kg) applied 1 h after reperfusion significantly reduced infarct volumes and apoptotic cells as well as increased neurologic scores at 48 h after reperfusion. Meanwhile, posttreatment with KBA significantly decreased malondialdehyde (MDA) levels, restored the superoxide dismutase (SOD) activity, and increased the protein Nrf2 and HO-1 expression in brain tissues. In primary cultured astrocytes, KBA increased the Nrf2 and HO-1 expression, which provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. But knockdown of Nrf2 or HO-1 attenuated the protective effect of KBA. In conclusion, these findings provide evidence that the neuroprotection of KBA against oxidative stress-induced ischemic injury involves the Nrf2/HO-1 pathway.

  5. Posttreatment with 11-Keto-β-Boswellic Acid Ameliorates Cerebral Ischemia-Reperfusion Injury: Nrf2/HO-1 Pathway as a Potential Mechanism.

    PubMed

    Ding, Yi; Chen, MinChun; Wang, MingMing; Li, YuWen; Wen, AiDong

    2015-12-01

    Oxidative stress is well known to play a pivotal role in cerebral ischemia-reperfusion injury. The nuclear factor erythroid-2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway has been considered a potential target for neuroprotection in stroke. 11-Keto-β-boswellic acid (KBA) is a triterpenoid compound from extracts of Boswellia serrata. The aim of the present study was to determine whether KBA, a novel Nrf2 activator, can protect against cerebral ischemic injury. Middle cerebral artery occlusion (MCAO) was operated on male Sprague-Dawley rats. KBA (25 mg/kg) applied 1 h after reperfusion significantly reduced infarct volumes and apoptotic cells as well as increased neurologic scores at 48 h after reperfusion. Meanwhile, posttreatment with KBA significantly decreased malondialdehyde (MDA) levels, restored the superoxide dismutase (SOD) activity, and increased the protein Nrf2 and HO-1 expression in brain tissues. In primary cultured astrocytes, KBA increased the Nrf2 and HO-1 expression, which provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. But knockdown of Nrf2 or HO-1 attenuated the protective effect of KBA. In conclusion, these findings provide evidence that the neuroprotection of KBA against oxidative stress-induced ischemic injury involves the Nrf2/HO-1 pathway. PMID:25452227

  6. Induction of the pi class of glutathione S-transferase by carnosic acid in rat Clone 9 cells via the p38/Nrf2 pathway.

    PubMed

    Lin, Chia-Yuan; Wu, Chi-Rei; Chang, Shu-Wei; Wang, Yu-Jung; Wu, Jia-Jiuan; Tsai, Chia-Wen

    2015-06-01

    Induction of phase II enzymes is important in cancer chemoprevention. We compared the effect of rosemary diterpenes on the expression of the pi class of glutathione S-transferase (GSTP) in rat liver Clone 9 cells and the signaling pathways involved. Culturing cells with 1, 5, 10, or 20 μM carnosic acid (CA) or carnosol (CS) for 24 h in a dose-dependent manner increased the GSTP expression. CA was more potent than CS. The RNA level and the enzyme activity of GSTP were also enhanced by CA treatment. Treatment with 10 μM CA highly induced the reporter activity of the enhancer element GPEI. Furthermore, CA markedly increased the translocation of nuclear factor erythroid-2 related factor 2 (Nrf2) from the cytosol to the nucleus after 30 to 60 min. CA the stimulated the protein induction of p38, nuclear Nrf2, and GSTP was diminished in the presence of SB203580 (a p38 inhibitor). In addition, SB203580 pretreatment or silencing of Nrf2 by siRNA suppressed the CA-induced GPEI-DNA binding activity and GSTP protein expression. Knockdown of p38 or Nrf2 by siRNA abolished the activation of p38 and Nrf2 as well as the protein induction and enzyme activity of GSTP by CA. These results suggest that CA up-regulates the expression and enzyme activity of GSTP via the p38/Nrf2/GPEI pathway.

  7. Activation of NRF2 pathway in spleen, thymus as well as peripheral blood mononuclear cells by acute arsenic exposure in mice.

    PubMed

    Duan, Xiaoxu; Li, Jinlong; Zhang, Yang; Li, Wei; Zhao, Lu; Nie, Huifang; Sun, Guifan; Li, Bing

    2015-10-01

    Arsenic has already been demonstrated to activate the nuclear factor erythroid 2-related factor 2 (NRF2) in many different organs and cell lines. The present study tried to explore the expression of NRF2 pathway by acute arsenic exposure in immune system in vivo. Our results showed that treatment with arsenic (sodium arsenite, 5, 10 and 20mg/kg, intra-gastrically) increased the expression of NRF2 and its downstream targets heme oxygenase-1 (HO-1), glutathione-S-transferase (GST), glutamate-cysteine ligase (GCL) and glutathione reductase (GR) consistently in spleen, thymus, as well as peripheral blood mononuclear cells (PBMCs), as early as treatment from 6h. Arsenic was also detected to up-regulate the mRNA levels of Hmox1, NAD(P)H: quinine oxidoreductase 1 (Nqo1), Gclc and Gclm in spleen and thymus. Besides, we detected the enhancement of Kelch-like ECH-associated protein (KEAP1) expression in these immune organs and immunocytes. What's more, our results also found the imbalanced oxidative redox status under the circumstances that arsenic activated NRF2 pathway, reflected by the generation of lipid peroxidation, as well as the reduction of antioxidative capacities in both spleen and thymus. Taken together, our results here strongly suggested the expression and activation of NRF2 pathway by acute arsenic exposure in immune system in vivo. Further studies are being investigated to explore the possible roles and functions of NRF2 pathway stimulation in the regulation of immune responses of this metalloid.

  8. Suppression of antioxidant Nrf-2 and downstream pathway in H9c2 cells by advanced glycation end products (AGEs) via ERK phosphorylation.

    PubMed

    Ko, Shun-Yao; Chang, Shu-Shing; Lin, I-Hsuan; Chen, Hong-I

    2015-11-01

    Diabetic cardiomyopathy is related to oxidative stress and correlated with the presence of advanced glycation end products (AGEs). In a clinical setting, AGEs can be detected in patients presenting diabetic cardiomyopathy; however, the underlying mechanism has yet to be elucidated. In our previous study, AGEs increase cell hypertrophy via ERK phosphorylation in a process closely related to ROS production. Thus, we propose that AGEs regulate the antioxidant gene nuclear factor-erythroid 2-related factor (Nrf-2). In H9c2 cells treated with AGEs, the expression of Nrf-2 was reduced; however, ERK phosphorylation was shown to increase. Treatment with H2O2 was also shown to increase Nrf-2 and ERK phosphorylation. In cells pretreatment with ROS scavenger NAC, the effects of H2O2 were reduced; however, the effects of the AGEs remained largely unchanged. Conversely, when cells were pretreated with PD98059 (ERK inhibitor), the expression of Nrf-2 was recovered following treatment with AGEs. Our results suggest that AGEs inhibit Nrf-2 via the ERK pathway; however, this influence is partly associated with ROS. Our finding further indicated that AGEs possess both ROS-dependent and ROS-independent pathways, resulting in a reduction in Nrf-2. This report reveals an important mechanism underlying the regulation of diabetic cardiomyopathy progression by AGEs. PMID:26212730

  9. Contribution of Nrf2 to Atherogenic Phenotype Switching of Coronary Arterial Smooth Muscle Cells Lacking CD38 Gene

    PubMed Central

    Xu, Ming; Li, Xiao-Xue; Wang, Lei; Wang, Mi; Zhang, Yang; Li, Pin-Lan

    2015-01-01

    Background/Aims Recent studies have indicated that CD38 gene deficiency results in dedifferentiation or transdifferentiation of arterial smooth muscle cells upon atherogenic stimulations. However, the molecular mechanisms mediating this vascular smooth muscle (SMC) phenotypic switching remain unknown. Methods & Results In the present study, we first characterized the phenotypic change in the primary cultures of coronary arterial myocytes (CAMs) from CD38−/− mice. It was shown that CD38 deficiency decreased the expression of contractile marker calponin, SM22α and α-SMA but increased the expression of SMC dedifferentiation marker, vimentin, which was accompanied by enhanced cell proliferation. This phenotypic change in CD38−/− CAMs was enhanced by 7-ketocholesterol (7-Ket), an atherogenic stimulus. We further found that the CD38 deficiency decreased the expression and activity of nuclear factor E2-related factor 2 (Nrf2), a basic leucine zipper (bZIP) transcription factor sensitive to redox regulation. Similar to CD38 deletion, Nrf2 gene silencing increased CAM dedifferentiation upon 7-Ket stimulation. In contrast, the overexpression of Nrf2 gene abolished 7-Ket-induced dedifferentiation in CD38−/− CAMs. Given the sensitivity of Nrf2 to oxidative stress, we determined the role of redox signaling in the regulation of Nrf2 expression and activity associated with CD38 effect in CAM phenotype changes. It was demonstrated that in CD38−/− CAMs, 7-Ket failed to stimulate the production of O2−., while in CD38+/+ CAMs 7-Ket induced marked O2−. production and enhancement of Nrf2 activity, which was substantially attenuated by NOX4 gene silencing. Finally, we demonstrated that 7-Ket-induced and NOX4-dependent O2−. production was inhibited by 8-Br-cADPR, an antagonist of cADPR or NED-19, an antagonist of NAADP as product of CD38 ADP-ribosylcyclase, which significantly inhibited the level of cytosolic Ca2+ and the activation of Nrf2 under 7-Ket. Conclusion

  10. The Keap1-Nrf2 system in cancers: stress response and anabolic metabolism.

    PubMed

    Mitsuishi, Yoichiro; Motohashi, Hozumi; Yamamoto, Masayuki

    2012-01-01

    The Keap1-Nrf2 [Kelch-like ECH-associated protein 1-nuclear factor (erythroid-derived 2)-like 2] pathway plays a central role in the protection of cells against oxidative and xenobiotic stresses. Nrf2 is a potent transcription activator that recognizes a unique DNA sequence known as the antioxidant response element (ARE). Under normal conditions, Nrf2 binds to Keap1 in the cytoplasm, resulting in proteasomal degradation. Following exposure to electrophiles or reactive oxygen species, Nrf2 becomes stabilized, translocates into the nucleus, and activates the transcription of various cytoprotective genes. Increasing attention has been paid to the role of Nrf2 in cancer cells because the constitutive stabilization of Nrf2 has been observed in many human cancers with poor prognosis. Recent studies have shown that the antioxidant and detoxification activities of Nrf2 confer chemo- and radio-resistance to cancer cells. In this review, we provide an overview of the Keap1-Nrf2 system and discuss its role under physiological and pathological conditions, including cancers. We also introduce the results of our recent study describing Nrf2 function in the metabolism of cancer cells. Nrf2 likely confers a growth advantage to cancer cells through enhancing cytoprotection and anabolism. Finally, we discuss the possible impact of Nrf2 inhibitors on cancer therapy. PMID:23272301

  11. The Keap1–Nrf2 system in cancers: stress response and anabolic metabolism

    PubMed Central

    Mitsuishi, Yoichiro; Motohashi, Hozumi; Yamamoto, Masayuki

    2012-01-01

    The Keap1–Nrf2 [Kelch-like ECH-associated protein 1–nuclear factor (erythroid-derived 2)-like 2] pathway plays a central role in the protection of cells against oxidative and xenobiotic stresses. Nrf2 is a potent transcription activator that recognizes a unique DNA sequence known as the antioxidant response element (ARE). Under normal conditions, Nrf2 binds to Keap1 in the cytoplasm, resulting in proteasomal degradation. Following exposure to electrophiles or reactive oxygen species, Nrf2 becomes stabilized, translocates into the nucleus, and activates the transcription of various cytoprotective genes. Increasing attention has been paid to the role of Nrf2 in cancer cells because the constitutive stabilization of Nrf2 has been observed in many human cancers with poor prognosis. Recent studies have shown that the antioxidant and detoxification activities of Nrf2 confer chemo- and radio-resistance to cancer cells. In this review, we provide an overview of the Keap1–Nrf2 system and discuss its role under physiological and pathological conditions, including cancers. We also introduce the results of our recent study describing Nrf2 function in the metabolism of cancer cells. Nrf2 likely confers a growth advantage to cancer cells through enhancing cytoprotection and anabolism. Finally, we discuss the possible impact of Nrf2 inhibitors on cancer therapy. PMID:23272301

  12. Nrf2-dependent protection against acute sodium arsenite toxicity in zebrafish.

    PubMed

    Fuse, Yuji; Nguyen, Vu Thanh; Kobayashi, Makoto

    2016-08-15

    Transcription factor Nrf2 induces a number of detoxifying enzymes and antioxidant proteins to confer protection against the toxic effects of a diverse range of chemicals including inorganic arsenicals. Although a number of studies using cultured cells have demonstrated that Nrf2 has a cell-protective function against acute and high-dose arsenic toxicity, there is no clear in vivo evidence of this effect. In the present study, we genetically investigated the protective role of Nrf2 against acute sodium arsenite toxicity using the zebrafish Nrf2 mutant, nrf2a(fh318). After treatment with 1mM sodium arsenite, the survival of nrf2a(fh318) larvae was significantly shorter than that of wild-type siblings, suggesting that Nrf2 protected the zebrafish larvae against high-dose arsenite exposure. To understand the molecular basis of the Nrf2-dependent protection, we analyzed the gene expression profiles after arsenite exposure, and found that the genes involved in the antioxidative function (prdx1 and gclc), arsenic metabolism (gstp1) and xenobiotic elimination (abcc2) were induced in an Nrf2-dependent manner. Furthermore, pre-treatment with sulforaphane, a well-known Nrf2 activator improved the survival of zebrafish larvae after arsenic exposure. Based on these results, we concluded that Nrf2 plays a fundamental and conserved role in protection against acute sodium arsenite toxicity.

  13. Nrf2-dependent protection from LPS induced inflammatory response and mortality by CDDO-Imidazolide.

    PubMed

    Thimmulappa, Rajesh K; Scollick, Catherine; Traore, Kassim; Yates, Melinda; Trush, Michael A; Liby, Karen T; Sporn, Michael B; Yamamoto, Masayuki; Kensler, Thomas W; Biswal, Shyam

    2006-12-29

    Sepsis induced lethality is characterized by amplified host innate immune response. Nrf2, a bZIP transcription factor, regulates a battery of cellular antioxidative genes and maintains cellular redox homeostasis. This study demonstrates that increasing Nrf2 activity by a potent small molecule activator, CDDO-Im (1-[2-cyano-3-,12-dioxooleana-1,9(11)-dien-28-oyl]imidazole), protects from deregulation of lipopolysaccharide (LPS) induced innate immune response. In response to LPS stimuli, nrf2-deficient (nrf2 -/-) peritoneal neutrophils showed increased NADPH oxidase-dependent ROS generation, proinflammatory cytokines (Tnf-alpha and Il-6) and chemokines (Mip2 and Mcp-1) relative to wild-type (nrf2 +/+) cells. Pretreatment of peritoneal neutrophils with CDDO-Im induced antioxidative genes (Ho-1, Gclc, Gclm, and Nqo1) and attenuated LPS induced ROS generation as well as expression of proinflammatory cytokines exclusively in nrf2 +/+ neutrophils but not in nrf2 -/- cells. In corroboration with in vitro studies, pretreatment with CDDO-Im induced Nrf2-dependent antioxidative genes, attenuated LPS induced proinflammatory cytokine expression, and decreased mortality specifically in the nrf2 +/+ mice. In conclusion, the results suggest that Nrf2 is associated with oxidative regulation of LPS induced innate immune response in neutrophils. Activation of Nrf2-dependent compensatory antioxidative pathways by CDDO-Im protects from LPS induced inflammatory response and mortality.

  14. Oxidative stress responses and NRF2 in human leukaemia.

    PubMed

    Abdul-Aziz, Amina; MacEwan, David J; Bowles, Kristian M; Rushworth, Stuart A

    2015-01-01

    Oxidative stress as a result of elevated levels of reactive oxygen species (ROS) has been observed in almost all cancers, including leukaemia, where they contribute to disease development and progression. However, cancer cells also express increased levels of antioxidant proteins which detoxify ROS. This includes glutathione, the major antioxidant in human cells, which has recently been identified to have dysregulated metabolism in human leukaemia. This suggests that critical balance of intracellular ROS levels is required for cancer cell function, growth, and survival. Nuclear factor (erythroid-derived 2)-like 2 (NRF2) transcription factor plays a dual role in cancer. Primarily, NRF2 is a transcription factor functioning to protect nonmalignant cells from malignant transformation and oxidative stress through transcriptional activation of detoxifying and antioxidant enzymes. However, once malignant transformation has occurred within a cell, NRF2 functions to protect the tumour from oxidative stress and chemotherapy-induced cytotoxicity. Moreover, inhibition of the NRF2 oxidative stress pathway in leukaemia cells renders them more sensitive to cytotoxic chemotherapy. Our improved understanding of NRF2 biology in human leukaemia may permit mechanisms by which we could potentially improve future cancer therapies. This review highlights the mechanisms by which leukaemic cells exploit the NRF2/ROS response to promote their growth and survival.

  15. Oxidative Stress Responses and NRF2 in Human Leukaemia

    PubMed Central

    Abdul-Aziz, Amina; MacEwan, David J.; Bowles, Kristian M.; Rushworth, Stuart A.

    2015-01-01

    Oxidative stress as a result of elevated levels of reactive oxygen species (ROS) has been observed in almost all cancers, including leukaemia, where they contribute to disease development and progression. However, cancer cells also express increased levels of antioxidant proteins which detoxify ROS. This includes glutathione, the major antioxidant in human cells, which has recently been identified to have dysregulated metabolism in human leukaemia. This suggests that critical balance of intracellular ROS levels is required for cancer cell function, growth, and survival. Nuclear factor (erythroid-derived 2)-like 2 (NRF2) transcription factor plays a dual role in cancer. Primarily, NRF2 is a transcription factor functioning to protect nonmalignant cells from malignant transformation and oxidative stress through transcriptional activation of detoxifying and antioxidant enzymes. However, once malignant transformation has occurred within a cell, NRF2 functions to protect the tumour from oxidative stress and chemotherapy-induced cytotoxicity. Moreover, inhibition of the NRF2 oxidative stress pathway in leukaemia cells renders them more sensitive to cytotoxic chemotherapy. Our improved understanding of NRF2 biology in human leukaemia may permit mechanisms by which we could potentially improve future cancer therapies. This review highlights the mechanisms by which leukaemic cells exploit the NRF2/ROS response to promote their growth and survival. PMID:25918581

  16. NRF2 Regulates PINK1 Expression under Oxidative Stress Conditions

    PubMed Central

    Murata, Hitoshi; Takamatsu, Hitoshi; Liu, Sulai; Kataoka, Ken; Huh, Nam-ho; Sakaguchi, Masakiyo

    2015-01-01

    Mutations of the PTEN-induced putative kinase 1 (PINK1) gene are a cause of autosomal recessive forms of Parkinson’s disease. Recent studies have revealed that PINK1 is an essential factor for controlling mitochondrial quality, and that it protects cells from oxidative stresses. Although there has been considerable progress in the elucidation of various aspects of PINK1 protein regulation such as activation, stability and degradation, the transcriptional regulation of PINK1 mRNA under stress conditions remains unclear. In this study, we found that nuclear factor (erythroid-derived 2)-like 2 (NRF2), an antioxidant transcription factor, regulates PINK1 expression under oxidative stress conditions. Damaged mitochondria arising from stress conditions induced NRF2-dependent transcription of the PINK1 gene through production of reactive oxygen species (ROS). Either an ROS scavenger or forced expression of KEAP1, a potent inhibitory partner to NRF2, restricted PINK1 expression induced by activated NRF2. Transcriptionally up-regulated PINK1 diminished oxidative stress-associated cell death. The results indicate that PINK1 expression is positively regulated by NRF2 and that the NRF2-PINK1 signaling axis is deeply involved in cell survival. PMID:26555609

  17. Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation

    SciTech Connect

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han

    2015-09-25

    Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death.

  18. Nrf2 Deficiency Improves Glucose Tolerance in Mice Fed a High-Fat Diet

    PubMed Central

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-01-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. PMID:23017736

  19. ROS/Autophagy/Nrf2 Pathway Mediated Low-Dose Radiation Induced Radio-Resistance in Human Lung Adenocarcinoma A549 Cell.

    PubMed

    Chen, Ni; Wu, Lijun; Yuan, Hang; Wang, Jun

    2015-01-01

    Low-dose ionizing radiation (LDIR) can induce radio-resistance to following high dose radiation in various mammalian cells. The protective role of LDIR has been thought to be associated with the overall outcomes of cancer radiotherapy. NF-E2 related factor 2 (Nrf2) is a transcription factor that plays pivotal roles in maintaining cellular oxidative equilibrium. Since oxidative stress has been indicated to be a mediator of LDIR induced radio-resistance, the role of Nrf2 in this process was investigated in this research. Our results showed that in human lung adenocarcinoma A549 cell, 5cGy alpha particle induced radio-resistance to following 75cGy alpha particle radiation. The expression level of Nrf2 and its target Heme Oxygenase-1(HO-1) increased after 5cGy radiation. Both the shRNA of Nrf2 and the chemical inhibitor of HO-1 suppressed the induced radio-resistance, indicating the involvement of Nrf2 antioxidant pathway in this process. Further, we found 5cGy radiation stimulated autophagy process in A549. Inhibition of the autophagy process resulted in suppression of the radio-resistance and the induced expression of Nrf2 and HO-1. ROS scavenger N-acetyl-L-cysteine (NAC) blocked the autophagy process induced by 5cGy alpha particle, the upregulation of Nrf2 and HO-1, as well as the induced radio-resistance. In conclusion, ROS elevation caused by LDIR promoted Autophagy/Nrf2-HO-1 and conferred radio-resistance in A549.

  20. The protective role of Nrf2-Gadd45b against antimony-induced oxidative stress and apoptosis in HEK293 cells.

    PubMed

    Jiang, Xingkang; An, Zesheng; Lu, Chao; Chen, Yue; Du, E; Qi, Shiyong; Yang, Kuo; Zhang, Zhihong; Xu, Yong

    2016-08-10

    Antimony (Sb) is one of the most prevalent heavy metals and frequently causes biological toxicity. However, the specific mechanisms by which Sb elicits its toxic effects remains to be fully elucidated. In this study, we found antimony trioxide (Sb2O3) caused a dose-dependent cytotoxicity against HEK293 cells, and Sb2O3-induced excessive reactive oxygen species (ROS) was closely correlated with increased cell apoptosis. Mechanistic investigation manifested that nuclear factor NF-E2-related factor 2 (Nrf2) expression and nuclear translocation were significantly induced under Sb2O3 treatment in HEK293 cells, and Nrf2 knockdown aggregated Sb2O3-induced cell apoptosis. Moreover, elevated Gadd45b expression actives the phosphorylation of MAPKs upon Sb2O3 exposure, whereas Gadd45b knockdown diminished Sb2O3-induced activation of MAPKs and promoted cell apoptosis. In the meantime, however, the antioxidant N-acetylcysteine (NAC) was found to ameliorate Nrf2 expression and nuclear translocation as well as Gadd45b expression and MAPKs activation by repressing Sb2O3-induced ROS production. More importantly, we found Gadd45b was transcriptionally enhanced by Nrf2 through binding to three canonical antioxidant response elements (AREs) within its promoter region. Either Sb2O3 or TBHQ (a selective Nrf2 activator) treatment, Gadd45b expression was significantly increased by luciferase assay. Nrf2 inhibition greatly diminished Gadd45b expression due to reduced binding of Nrf2 in Gadd45b promoter under Sb2O3 treatment. To summarize, this study demonstrated the Nrf2-Gadd45b signaling axis exhibited a protective role in Sb-induced cell apoptosis. PMID:27208483

  1. Interplay between the chalcone cardamonin and selenium in the biosynthesis of Nrf2-regulated antioxidant enzymes in intestinal Caco-2 cells.

    PubMed

    De Spirt, Silke; Eckers, Anna; Wehrend, Carina; Micoogullari, Mustafa; Sies, Helmut; Stahl, Wilhelm; Steinbrenner, Holger

    2016-02-01

    Selenoenzymes and nuclear factor erythroid 2-related factor 2 (Nrf2)-regulated phase II enzymes comprise key components of the cellular redox and antioxidant systems, which show multiple interrelations. Deficiency of the micronutrient selenium (Se) and impaired biosynthesis of selenoproteins have been reported to result in induction of Nrf2 target genes. Conversely, transcription of the selenoenzymes glutathione peroxidase 2 (GPx2) and thioredoxin reductase 1 (TrxR1) is up-regulated upon Nrf2 activation. Here, we have studied the interplay between Se and the secondary plant metabolite cardamonin, an Nrf2-activating chalcone, in the regulation of Nrf2-controlled antioxidant enzymes. Se-deficient and Se-repleted (sodium selenite-supplemented) human intestinal Caco-2 cells were exposed to cardamonin. Uptake of cardamonin by the Caco-2 cells was independent of their Se status. Cardamonin strongly induced gene expression of GPx2 and TrxR1. However, cardamonin treatment did not result in elevated GPx or TrxR activity and protein levels, possibly relating to a concomitant down-regulation of O-phosphoseryl-tRNA(Sec) kinase (PSTK), an enzyme involved in translation of selenoprotein mRNAs. On the other hand, induction of the Nrf2-regulated enzyme heme oxygenase 1 (HO-1) by cardamonin was diminished in Se-replete compared to Se-deficient cells. Our findings suggest that cardamonin interferes with the biosynthesis of Nrf2-regulated selenoenzymes, in contrast to the Nrf2-activating isothiocyanate compound sulforaphane, which has been shown earlier to synergize with Se-mediated cytoprotection. Conversely, the cellular Se status apparently affects the cardamonin-mediated induction of non-selenoprotein antioxidant enzymes such as HO-1. PMID:26698667

  2. Hydrogen gas reduces hyperoxic lung injury via the Nrf2 pathway in vivo

    PubMed Central

    Kawamura, Tomohiro; Wakabayashi, Nobunao; Shigemura, Norihisa; Huang, Chien-Sheng; Masutani, Kosuke; Tanaka, Yugo; Noda, Kentaro; Peng, Ximei; Takahashi, Toru; Billiar, Timothy R.; Okumura, Meinoshin; Toyoda, Yoshiya; Kensler, Thomas W.

    2013-01-01

    Hyperoxic lung injury is a major concern in critically ill patients who receive high concentrations of oxygen to treat lung diseases. Successful abrogation of hyperoxic lung injury would have a huge impact on respiratory and critical care medicine. Hydrogen can be administered as a therapeutic medical gas. We recently demonstrated that inhaled hydrogen reduced transplant-induced lung injury and induced heme oxygenase (HO)-1. To determine whether hydrogen could reduce hyperoxic lung injury and investigate the underlying mechanisms, we randomly assigned rats to four experimental groups and administered the following gas mixtures for 60 h: 98% oxygen (hyperoxia), 2% nitrogen; 98% oxygen (hyperoxia), 2% hydrogen; 98% balanced air (normoxia), 2% nitrogen; and 98% balanced air (normoxia), 2% hydrogen. We examined lung function by blood gas analysis, extent of lung injury, and expression of HO-1. We also investigated the role of NF-E2-related factor (Nrf) 2, which regulates HO-1 expression, by examining the expression of Nrf2-dependent genes and the ability of hydrogen to reduce hyperoxic lung injury in Nrf2-deficient mice. Hydrogen treatment during exposure to hyperoxia significantly improved blood oxygenation, reduced inflammatory events, and induced HO-1 expression. Hydrogen did not mitigate hyperoxic lung injury or induce HO-1 in Nrf2-deficient mice. These findings indicate that hydrogen gas can ameliorate hyperoxic lung injury through induction of Nrf2-dependent genes, such as HO-1. The findings suggest a potentially novel and applicable solution to hyperoxic lung injury and provide new insight into the molecular mechanisms and actions of hydrogen. PMID:23475767

  3. Design, Synthesis, and Evaluation of Triazole Derivatives That Induce Nrf2 Dependent Gene Products and Inhibit the Keap1-Nrf2 Protein-Protein Interaction.

    PubMed

    Bertrand, Hélène C; Schaap, Marjolein; Baird, Liam; Georgakopoulos, Nikolaos D; Fowkes, Adrian; Thiollier, Clarisse; Kachi, Hiroko; Dinkova-Kostova, Albena T; Wells, Geoff

    2015-09-24

    The transcription factor Nrf2 regulates the expression of a large network of cytoprotective and metabolic enzymes and proteins. Compounds that directly and reversibly inhibit the interaction between Nrf2 and its main negative regulator Keap1 are potential pharmacological agents for a range of disease types including neurodegenerative conditions and cancer. We describe the development of a series of 1,4-diphenyl-1,2,3-triazole compounds that inhibit the Nrf2-Keap1 protein-protein interaction (PPI) in vitro and in live cells and up-regulate the expression of Nrf2-dependent gene products.

  4. Heme oxygenase 1 plays role of neuron-protection by regulating Nrf2-ARE signaling post intracerebral hemorrhage

    PubMed Central

    Yin, Xiao-Ping; Wu, Dan; Zhou, Jun; Chen, Zhi-Ying; Bao, Bing; Xie, Liang

    2015-01-01

    The NF-E2 related factor 2 (Nrf2) could be activated in intracerebral hemorrhage (ICH), and trigger the expression of ARE regulated heme oxygenase 1 (HO-1) subsequently. This study aims to explore neuroprotection of HO-1 protein in regulating the Nrf2-ARE signaling pathway in ICH. In this study, the femoral artery injection method was used to establish the ICH model. The zinc porphyrin-9 (ZPP-IX) was used to inhibit the HO-1 expression in ICH rats. The ICH rats were randomly divided into 3 groups, ICH group, ZPP-IX (10 mg/kg) + ICH group and DMSO (10 mg/kg) + ICH group. Neurological scores were evaluated for the 3 groups. Double immunofluorescence staining method was employed to observe the co-expression of HO-1, Nrf2, NF-κB and TNF-α and CD11b in glia cells. Western blot and RT-PCR assay were used to detect the total Nrf2, binding Nrf2, HO-1, NF-κB and TNF-α expression. The results indicated that ZPP-IX could aggravate the neurological dyafunstions of ICH rats. The HO-1 level in ZPP-IX group was significantly decreased compared to the ICH group (P < 0.05). The binding-Nrf2 protein was significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The NF-κB and TNF-α level were significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The ZPP-IX significantly inhibited the HO-1 and Nrf2, and enhanced NF-κB and TNF-α co-expressing with the CD11b compared to the ICH group (P < 0.05). In conclusion, HO-1 protein regulates the Nrf2-ARE pathway in ICH model by inhibiting the Nrf2 entering nucleus and activating the NF-κB and TNF-α expression. PMID:26617723

  5. Epigenetic modifications of triterpenoid ursolic acid in activating Nrf2 and blocking cellular transformation of mouse epidermal cells.

    PubMed

    Kim, Hyuck; Ramirez, Christina N; Su, Zheng-Yuan; Kong, Ah-Ng Tony

    2016-07-01

    Ursolic acid (UA), a well-known natural triterpenoid found in abundance in blueberries, cranberries and apple peels, has been reported to possess many beneficial health effects. These effects include anticancer activity in various cancers, such as skin cancer. Skin cancer is the most common cancer in the world. Nuclear factor E2-related factor 2 (Nrf2) is a master regulator of antioxidative stress response with anticarcinogenic activity against UV- and chemical-induced tumor formation in the skin. Recent studies show that epigenetic modifications of Nrf2 play an important role in cancer prevention. However, the epigenetic impact of UA on Nrf2 signaling remains poorly understood in skin cancer. In this study, we investigated the epigenetic effects of UA on mouse epidermal JB6 P+ cells. UA inhibited cellular transformation by 12-O-tetradecanoylphorbol-13-acetate at a concentration at which the cytotoxicity was no more than 25%. Under this condition, UA induced the expression of the Nrf2-mediated detoxifying/antioxidant enzymes heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 and UDP-glucuronosyltransferase 1A1. DNA methylation analysis revealed that UA demethylated the first 15 CpG sites of the Nrf2 promoter region, which correlated with the reexpression of Nrf2. Furthermore, UA reduced the expression of epigenetic modifying enzymes, including the DNA methyltransferases DNMT1 and DNMT3a and the histone deacetylases (HDACs) HDAC1, HDAC2, HDAC3 and HDAC8 (Class I) and HDAC6 and HDAC7 (Class II), and HDAC activity. Taken together, these results suggest that the epigenetic effects of the triterpenoid UA could potentially contribute to its beneficial effects, including the prevention of skin cancer. PMID:27260468

  6. Epigenetic modifications of triterpenoid ursolic acid in activating Nrf2 and blocking cellular transformation of mouse epidermal cells.

    PubMed

    Kim, Hyuck; Ramirez, Christina N; Su, Zheng-Yuan; Kong, Ah-Ng Tony

    2016-07-01

    Ursolic acid (UA), a well-known natural triterpenoid found in abundance in blueberries, cranberries and apple peels, has been reported to possess many beneficial health effects. These effects include anticancer activity in various cancers, such as skin cancer. Skin cancer is the most common cancer in the world. Nuclear factor E2-related factor 2 (Nrf2) is a master regulator of antioxidative stress response with anticarcinogenic activity against UV- and chemical-induced tumor formation in the skin. Recent studies show that epigenetic modifications of Nrf2 play an important role in cancer prevention. However, the epigenetic impact of UA on Nrf2 signaling remains poorly understood in skin cancer. In this study, we investigated the epigenetic effects of UA on mouse epidermal JB6 P+ cells. UA inhibited cellular transformation by 12-O-tetradecanoylphorbol-13-acetate at a concentration at which the cytotoxicity was no more than 25%. Under this condition, UA induced the expression of the Nrf2-mediated detoxifying/antioxidant enzymes heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 and UDP-glucuronosyltransferase 1A1. DNA methylation analysis revealed that UA demethylated the first 15 CpG sites of the Nrf2 promoter region, which correlated with the reexpression of Nrf2. Furthermore, UA reduced the expression of epigenetic modifying enzymes, including the DNA methyltransferases DNMT1 and DNMT3a and the histone deacetylases (HDACs) HDAC1, HDAC2, HDAC3 and HDAC8 (Class I) and HDAC6 and HDAC7 (Class II), and HDAC activity. Taken together, these results suggest that the epigenetic effects of the triterpenoid UA could potentially contribute to its beneficial effects, including the prevention of skin cancer.

  7. A novel natural Nrf2 activator with PPARγ-agonist (monascin) attenuates the toxicity of methylglyoxal and hyperglycemia

    SciTech Connect

    Hsu, Wei-Hsuan; Lee, Bao-Hong; Chang, Yu-Ying; Hsu, Ya-Wen; Pan, Tzu-Ming

    2013-11-01

    Methylglyoxal (MG) is a toxic-glucose metabolite and a major precursor of advanced glycation endproducts (AGEs). MG has been reported to result in inflammation by activating receptor for AGEs (RAGE). We recently found that Monascus-fermented metabolite monascin acts as a novel natural peroxisome proliferator-activated receptor-γ (PPARγ) agonist that improves insulin sensitivity. We investigated the metabolic, biochemical, and molecular abnormalities characteristic of type 2 diabetes in MG-treated Wistar rats treated with oral administration of monascin or rosiglitazone. Monascin (a novel PPARγ agonist) activated nuclear factor-erythroid 2-related factor 2 (Nrf2) and down-regulated hyperinsulinmia in oral glucose tolerance test (OGTT). Monascin was able to elevate glyoxalase-1 expression via activation of hepatic Nrf2, hence, resulting in MG metabolism to D-lactic acid and protected from AGEs production in MG-treated rats. Rosiglitazone did not activate Nrf2 nor glyoxalase expression to lower serum and hepatic AGEs levels. Monascin acts as a novel natural Nrf2 activator with PPARγ-agonist activity were confirmed by Nrf2 and PPARγ reporter assays in Hep G2 cells. These findings suggest that monascin acts as an anti-diabetic and anti-oxidative stress agent to a greater degree than rosiglitazone and thus may have therapeutic potential for the prevention of diabetes. - Highlights: • Monascin acts as a PPARgamma agonist. • Monascin activates Nrf2 and AMPK. • Monascin promotes MG metabolism into D-lactic acid. • Monascin attenuates inflammation and diabetes in vivo.

  8. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    SciTech Connect

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-11-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  9. The emerging role of Nrf2 in mitochondrial function

    PubMed Central

    Dinkova-Kostova, Albena T.; Abramov, Andrey Y.

    2015-01-01

    The transcription factor NF-E2 p45-related factor 2 (Nrf2; gene name NFE2L2) allows adaptation and survival under conditions of stress by regulating the gene expression of diverse networks of cytoprotective proteins, including antioxidant, anti-inflammatory, and detoxification enzymes as well as proteins that assist in the repair or removal of damaged macromolecules. Nrf2 has a crucial role in the maintenance of cellular redox homeostasis by regulating the biosynthesis, utilization, and regeneration of glutathione, thioredoxin, and NADPH and by controlling the production of reactive oxygen species by mitochondria and NADPH oxidase. Under homeostatic conditions, Nrf2 affects the mitochondrial membrane potential, fatty acid oxidation, availability of substrates (NADH and FADH2/succinate) for respiration, and ATP synthesis. Under conditions of stress or growth factor stimulation, activation of Nrf2 counteracts the increased reactive oxygen species production in mitochondria via transcriptional upregulation of uncoupling protein 3 and influences mitochondrial biogenesis by maintaining the levels of nuclear respiratory factor 1 and peroxisome proliferator-activated receptor γ coactivator 1α, as well as by promoting purine nucleotide biosynthesis. Pharmacological Nrf2 activators, such as the naturally occurring isothiocyanate sulforaphane, inhibit oxidant-mediated opening of the mitochondrial permeability transition pore and mitochondrial swelling. Curiously, a synthetic 1,4-diphenyl-1,2,3-triazole compound, originally designed as an Nrf2 activator, was found to promote mitophagy, thereby contributing to the overall mitochondrial homeostasis. Thus, Nrf2 is a prominent player in supporting the structural and functional integrity of the mitochondria, and this role is particularly crucial under conditions of stress. PMID:25975984

  10. WNT-3A Regulates an Axin1/NRF2 Complex That Regulates Antioxidant Metabolism in Hepatocytes

    PubMed Central

    Rada, Patricia; Rojo, Ana I.; Offergeld, Anika; Feng, Gui Jie; Velasco-Martín, Juan P.; González-Sancho, José Manuel; Valverde, Ángela M.; Dale, Trevor; Regadera, Javier

    2015-01-01

    Abstract Aims: Nuclear factor (erythroid-derived 2)-like 2 (NRF2) is a master regulator of oxidant and xenobiotic metabolism, but it is unknown how it is regulated to provide basal expression of this defense system. Here, we studied the putative connection between NRF2 and the canonical WNT pathway, which modulates hepatocyte metabolism. Results: WNT-3A increased the levels of NRF2 and its transcriptional signature in mouse hepatocytes and HEK293T cells. The use of short interfering RNAs in hepatocytes and mouse embryonic fibroblasts which are deficient in the redox sensor Kelch-like ECH-associated protein 1 (KEAP1) indicated that WNT-3A activates NRF2 in a β-Catenin- and KEAP1-independent manner. WNT-3A stabilized NRF2 by preventing its GSK-3-dependent phosphorylation and subsequent SCF/β-TrCP-dependent ubiquitination and proteasomal degradation. Axin1 and NRF2 were physically associated in a protein complex that was regulated by WNT-3A, involving the central region of Axin1 and the Neh4/Neh5 domains of NRF2. Axin1 knockdown increased NRF2 protein levels, while Axin1 stabilization with Tankyrase inhibitors blocked WNT/NRF2 signaling. The relevance of this novel pathway was assessed in mice with a conditional deletion of Axin1 in the liver, which showed upregulation of the NRF2 signature in hepatocytes and disruption of liver zonation of antioxidant metabolism. Innovation: NRF2 takes part in a protein complex with Axin1 that is regulated by the canonical WNT pathway. This new WNT-NRF2 axis controls the antioxidant metabolism of hepatocytes. Conclusion: These results uncover the participation of NRF2 in a WNT-regulated signalosome that participates in basal maintenance of hepatic antioxidant metabolism. Antioxid. Redox Signal. 22, 555–571. PMID:25336178

  11. Attenuation of UVB-induced sunburn reaction and oxidative DNA damage with no alterations in UVB-induced skin carcinogenesis in Nrf2 gene-deficient mice.

    PubMed

    Kawachi, Yasuhiro; Xu, Xuezhu; Taguchi, Shiroma; Sakurai, Hideko; Nakamura, Yasuhiro; Ishii, Yoshiyuki; Fujisawa, Yasuhiro; Furuta, Junichi; Takahashi, Takenori; Itoh, Ken; Yamamoto, Masayuki; Yamazaki, Fumikazu; Otsuka, Fujio

    2008-07-01

    UV radiation is an important environmental factor in the pathogenesis of skin aging and cancer. Many harmful effects of UV radiation are associated with generation of reactive oxygen species. Cellular antioxidants prevent the occurrence and reduce the severity of UV-induced photoaging and diseases of the skin. The transcription factor Nrf2 (NF-E2-related factor 2) and its negative regulator protein, Keap1 (Kelch-like-ECH-associated protein 1), are central regulators of cellular antioxidant responses. We used nrf2-null mice to investigate the roles of the Nrf2-Keap1 system in protection of skin from harmful effects of UVB irradiation. A single irradiation with UVB induced stronger and longer lasting sunburn reaction in nrf2-null mice. Histological changes, including epidermal necrosis, dermal edema, inflammatory cell infiltration, sunburn cell formation, TUNEL-positive apoptotic cell formation, and accumulation of oxidative DNA products such as 8-hydroxy-2'-deoxyguanosine after UVB irradiation, were more prominent in nrf2-null mice. These findings indicate that the Nrf2-Keap1 pathway plays an important role in protection of the skin against acute UVB reactions, including cutaneous cell apoptosis and oxidative damage. However, there were no significant differences in skin carcinogenesis between nrf2-null and wild-type mice exposed to chronic UVB irradiation, suggesting that there is a complex and subtle balance between factors promoting and preventing photocarcinogenesis. Journal of Investigative Dermatology (2008) 128, 1773-1779; doi:10.1038/sj.jid.5701245; published online 17 January 2008.

  12. Nrf2 expression is increased in peripheral blood mononuclear cells derived from mild-moderate ex-smoker COPD patients with persistent oxidative stress.

    PubMed

    Fratta Pasini, Anna Maria; Ferrari, Marcello; Stranieri, Chiara; Vallerio, Paola; Mozzini, Chiara; Garbin, Ulisse; Zambon, Giorgia; Cominacini, Luciano

    2016-01-01

    Inadequacy of antioxidant nuclear factor-E2-related factor 2 (Nrf2) and endoplasmic reticulum stress-mediated unfolded protein response has been implicated in severe chronic obstructive pulmonary disease (COPD) and cigarette smoking-induced emphysema. As evidence suggests that the ability to upregulate Nrf2 expression may influence the progression of COPD and no data exist up to now in ex-smokers with mild-moderate COPD, this study was first aimed to evaluate Nrf2 and unfolded protein response expression in peripheral blood mononuclear cells (PBMC) of mild-moderate ex-smokers with COPD compared to smoking habit-matched non-COPD subjects. Then, we tested whether oxidative stress persists after cigarette smoking cessation and whether the concentrations of oxidized phospholipids (oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine [oxPAPC]) in the PBMC of the same subjects may have a causative role in determining the upregulation of Nrf2. The expression (mRNA and protein) of Nrf2 and of its related gene heme oxygenase-1 was significantly increased in COPD group without differences in the unfolded protein response. Plasma malondialdehyde, the circulating marker of oxidative stress, and oxPAPC in PBMC were significantly higher in COPD than in non-COPD subjects. The fact that the expression of p47phox, a subunit of NADPH oxidase, was increased in PBMC of COPD patients and that it was directly correlated with oxPAPC may indicate that oxPAPC may be one of the determinants of oxidative stress-induced Nrf2 upregulation. Finally, we also demonstrated that lung function inversely correlated with plasma malondialdehyde and with Nrf2 and heme oxygenase-1 mRNA expression in all subjects. Our results indicate that mild-moderate ex-smokers with COPD may be able to counteract oxidative stress by increasing the expression of Nrf2/antioxidant-response elements. Because Nrf2 failure significantly contributes to the development of COPD, our

  13. Nrf2 expression is increased in peripheral blood mononuclear cells derived from mild–moderate ex-smoker COPD patients with persistent oxidative stress

    PubMed Central

    Fratta Pasini, Anna Maria; Ferrari, Marcello; Stranieri, Chiara; Vallerio, Paola; Mozzini, Chiara; Garbin, Ulisse; Zambon, Giorgia; Cominacini, Luciano

    2016-01-01

    Inadequacy of antioxidant nuclear factor-E2-related factor 2 (Nrf2) and endoplasmic reticulum stress-mediated unfolded protein response has been implicated in severe chronic obstructive pulmonary disease (COPD) and cigarette smoking-induced emphysema. As evidence suggests that the ability to upregulate Nrf2 expression may influence the progression of COPD and no data exist up to now in ex-smokers with mild–moderate COPD, this study was first aimed to evaluate Nrf2 and unfolded protein response expression in peripheral blood mononuclear cells (PBMC) of mild–moderate ex-smokers with COPD compared to smoking habit-matched non-COPD subjects. Then, we tested whether oxidative stress persists after cigarette smoking cessation and whether the concentrations of oxidized phospholipids (oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine [oxPAPC]) in the PBMC of the same subjects may have a causative role in determining the upregulation of Nrf2. The expression (mRNA and protein) of Nrf2 and of its related gene heme oxygenase-1 was significantly increased in COPD group without differences in the unfolded protein response. Plasma malondialdehyde, the circulating marker of oxidative stress, and oxPAPC in PBMC were significantly higher in COPD than in non-COPD subjects. The fact that the expression of p47phox, a subunit of NADPH oxidase, was increased in PBMC of COPD patients and that it was directly correlated with oxPAPC may indicate that oxPAPC may be one of the determinants of oxidative stress-induced Nrf2 upregulation. Finally, we also demonstrated that lung function inversely correlated with plasma malondialdehyde and with Nrf2 and heme oxygenase-1 mRNA expression in all subjects. Our results indicate that mild–moderate ex-smokers with COPD may be able to counteract oxidative stress by increasing the expression of Nrf2/antioxidant-response elements. Because Nrf2 failure significantly contributes to the development of COPD

  14. Expression of xCT and activity of system xc(-) are regulated by NRF2 in human breast cancer cells in response to oxidative stress.

    PubMed

    Habib, Eric; Linher-Melville, Katja; Lin, Han-Xin; Singh, Gurmit

    2015-08-01

    Cancer cells adapt to high levels of oxidative stress in order to survive and proliferate by activating key transcription factors. One such master regulator, the redox sensitive transcription factor NF E2 Related Factor 2 (NRF2), controls the expression of cellular defense genes including those encoding intracellular redox-balancing proteins involved in glutathione (GSH) synthesis. Under basal conditions, Kelch-like ECH-associated protein 1 (KEAP1) targets NRF2 for ubiquitination. In response to oxidative stress, NRF2 dissociates from KEAP1, entering the nucleus and binding to the antioxidant response element (ARE) in the promoter of its target genes. Elevated reactive oxygen species (ROS) production may deplete GSH levels within cancer cells. System xc(-), an antiporter that exports glutamate while importing cystine to be converted into cysteine for GSH synthesis, is upregulated in cancer cells in response to oxidative stress. Here, we provided evidence that the expression of xCT, the light chain subunit of system xc(-), is regulated by NRF2 in representative human breast cancer cells. Hydrogen peroxide (H2O2) treatment increased nuclear translocation of NRF2, also increasing levels of xCT mRNA and protein and extracellular glutamate release. Overexpression of NRF2 up-regulated the activity of the xCT promoter, which contains a proximal ARE. In contrast, overexpression of KEAP1 repressed promoter activity and decreased xCT protein levels, while siRNA knockdown of KEAP1 up-regulated xCT protein levels and transporter activity. These results demonstrate the importance of the KEAP1/NRF2 pathway in balancing oxidative stress in breast cancer cells through system xc(-). We have previously shown that xCT is upregulated in various cancer cell lines under oxidative stress. In the current investigation, we focused on MCF-7 cells as a model for mechanistic studies.

  15. Jun dimerization protein 2 is a critical component of the Nrf2/MafK complex regulating the response to ROS homeostasis

    PubMed Central

    Tanigawa, S; Lee, C H; Lin, C S; Ku, C C; Hasegawa, H; Qin, S; Kawahara, A; Korenori, Y; Miyamori, K; Noguchi, M; Lee, L H; Lin, Y C; Steve Lin, C L; Nakamura, Y; Jin, C; Yamaguchi, N; Eckner, R; Hou, D-X; Yokoyama, K K

    2013-01-01

    Oxidative stress and reactive oxygen species (ROS) are associated with diseases such as cancer, cardiovascular complications, inflammation and neurodegeneration. Cellular defense systems must work constantly to control ROS levels and to prevent their accumulation. We report here that the Jun dimerization protein 2 (JDP2) has a critical role as a cofactor for transcription factors nuclear factor-erythroid 2-related factor 2 (Nrf2) and small Maf protein family K (MafK) in the regulation of the antioxidant-responsive element (ARE) and production of ROS. Chromatin immunoprecipitation–quantitative PCR (qPCR), electrophoresis mobility shift and ARE-driven reporter assays were carried out to examine the role of JDP2 in ROS production. JDP2 bound directly to the ARE core sequence, associated with Nrf2 and MafK (Nrf2–MafK) via basic leucine zipper domains, and increased DNA-binding activity of the Nrf2–MafK complex to the ARE and the transcription of ARE-dependent genes. In mouse embryonic fibroblasts from Jdp2-knockout (Jdp2 KO) mice, the coordinate transcriptional activation of several ARE-containing genes and the ability of Nrf2 to activate expression of target genes were impaired. Moreover, intracellular accumulation of ROS and increased thickness of the epidermis were detected in Jdp2 KO mice in response to oxidative stress-inducing reagents. These data suggest that JDP2 is required to protect against intracellular oxidation, ROS activation and DNA oxidation. qPCR demonstrated that several Nrf2 target genes such as heme oxygenase-1, glutamate–cysteine ligase catalytic and modifier subunits, the notch receptor ligand jagged 1 and NAD(P)H dehydrogenase quinone 1 are also dependent on JDP2 for full expression. Taken together, these results suggest that JDP2 is an integral component of the Nrf2–MafK complex and that it modulates antioxidant and detoxification programs by acting via the ARE. PMID:24232097

  16. Adenovirus-Mediated Over-Expression of Nrf2 Within Mesenchymal Stem Cells (MSCs) Protected Rats Against Acute Kidney Injury

    PubMed Central

    Mohammadzadeh-Vardin, Mohammad; Habibi Roudkenar, Mehryar; Jahanian-Najafabadi, Ali

    2015-01-01

    Purpose: Recent developments in the field of cell therapy have led to a renewed interest in treatment of acute kidney injury (AKI). However, the early death of transplanted mesenchymal stem cells (MSCs) in stressful microenvironment of a recipient tissue is a major problem with this kind of treatment. The objective of this study was to determine whether overexpression of a cytoprotective factor, nuclear factor erythroid-2 related factor 2 (Nrf2), in MSCs could protect rats against AKI. Methods: The Nrf2 was overexpressed in MSCs by recombinant adenoviruses, and the MSCs were implanted to rats suffering from cisplatin-induced AKI. Results: The obtained results showed that transplantation with the engineered MSCs ameliorates cisplatin-induced AKI. Morphologic features of the investigated kidneys showed that transplantation with the MSCs in which Nrf2 had been overexpressed significantly improved the complications of AKI. Conclusion: These findings suggested that the engineered MSCs might be a good candidate to be further evaluated in clinical trials. However, detailed studies must be performed to investigate the possible carcinogenic effect of Nrf2 overexpression. PMID:26236658

  17. Regulation of the Nrf2 antioxidant pathway by microRNAs: New players in micromanaging redox homeostasis.

    PubMed

    Cheng, Xinghua; Ku, Ching-Hsin; Siow, Richard C M

    2013-09-01

    MicroRNAs are now thought to play a central role in the regulation of many diverse aspects of cell biology; however, it remains to be fully elucidated how microRNAs can orchestrate cellular redox homeostasis, which plays a central role in a multitude of physiological and pathophysiological processes. The redox-sensitive transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) serves as a "master regulator" of cell survival through the coordinated induction of phase II and antioxidant defense enzymes to counteract oxidative stress and modulate redox signaling events. MicroRNAs are able to "fine-tune" the regulation of processes including those directly interacting with the Nrf2 pathway and the generation of reactive oxygen species (ROS). This review highlights that cellular redox homeostasis can be regulated by microRNAs through their modulation of Nrf2-driven antioxidant gene expression as well as key enzymes that generate ROS, which in turn can alter the biogenesis and processing of microRNAs. Therefore redox sensitive microRNAs or "redoximiRs" add an important regulatory mechanism for redox signaling beyond the well-characterized actions of Nrf2. The potential exists for microRNA-based therapies where diminished antioxidant defenses and dysregulated redox signaling can lead to cardiovascular diseases, cancers, neurodegeneration, and accelerated aging.

  18. RNA-binding motif protein 47 inhibits Nrf2 activity to suppress tumor growth in lung adenocarcinoma

    PubMed Central

    Sakurai, T; Isogaya, K; Sakai, S; Morikawa, M; Morishita, Y; Ehata, S; Miyazono, K; Koinuma, D

    2016-01-01

    RNA-binding proteins provide a new layer of posttranscriptional regulation of RNA during cancer progression. We identified RNA-binding motif protein 47 (RBM47) as a target gene of transforming growth factor (TGF)-β in mammary gland epithelial cells (NMuMG cells) that have undergone the epithelial-to-mesenchymal transition. TGF-β repressed RBM47 expression in NMuMG cells and lung cancer cell lines. Expression of RBM47 correlated with good prognosis in patients with lung, breast and gastric cancer. RBM47 suppressed the expression of cell metabolism-related genes, which were the direct targets of nuclear factor erythroid 2-related factor 2 (Nrf2; also known as NFE2L2). RBM47 bound to KEAP1 and Cullin 3 mRNAs, and knockdown of RBM47 inhibited their protein expression, which led to enhanced binding of Nrf2 to target genomic regions. Knockdown of RBM47 also enhanced the expression of some Nrf2 activators, p21/CDKN1A and MafK induced by TGF-β. Both mitochondrial respiration rates and the side population cells in lung cancer cells increased in the absence of RBM47. Our findings, together with the enhanced tumor formation and metastasis of xenografted mice by knockdown of the RBM47 expression, suggested tumor-suppressive roles for RBM47 through the inhibition of Nrf2 activity. PMID:26923328

  19. A novel Nrf2 activator from microbial transformation inhibits radiation-induced dermatitis in mice

    PubMed Central

    Nakagami, Yasuhiro; Masuda, Kayoko

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that regulates many antioxidants, and we have recently succeeded in obtaining a novel Nrf2 activator, RS9, from microbial transformation. RS9 is categorized as a triterpenoid, and well-known triterpenoids such as RTA 402 (bardoxolone methyl) and RTA 408 have been tested in clinical trials. RTA 408 lotion is currently being tested in patients at risk for radiation dermatitis. This prompted us to study the profiles of RS9 in the skin. All the above triterpenoids increased the level of an Nrf2-targeted gene, NADPH:quinone oxidoreductase-1, in normal human epidermal keratinocytes. Among them, the activity of RS9 was prominent; furthermore, the cellular toxicity was less compared with RTA compounds. BALB/c mice were irradiated with 30 Gy/day on Day 0, and compounds were topically applied on the back once daily from Day 1 to Day 30. Dermatitis scores peaked on Day 18, with a score of 2.6 in vehicle-treated mice, and topical applications of 0.1% RTA 402, RTA 408 and RS9 reduced the scores to 1.8, 2.0 and 1.4, respectively. Moreover, the percentage of animals with scores ≥2 was analyzed, and 0.1% RS9 suppressed the percentage from 100% to 47%. These results imply that RS9 has potential efficacy for treating radiation dermatitis. PMID:27242339

  20. Exercise, Nrf2 and Antioxidant Signaling in Cardiac Aging

    PubMed Central

    Narasimhan, Madhusudhanan; Rajasekaran, Namakkal S.

    2016-01-01

    Aging is represented by a progressive decline in cellular functions. The age-related deformities in cardiac behaviors are the loss of cardiac myocytes through apoptosis or programmed cell death. Oxidative stress (OS) and its deleterious consequence contribute to age-related mechanical remodeling, reduced regenerative capacity, and apoptosis in cardiac tissue. The pathogenesis of OS in the elderly can predispose the heart to other cardiac complications such as atherosclerosis, hypertension, ischemic heart disease, cardiac myopathy, and so on. At the molecular level, oxidant-induced activation of Nrf2 (Nuclear erythroid-2-p45-related factor-2), a transcription factor, regulates several genes containing AREs (Antioxidant Response Element) and bring the respective translates to counteract the reactive radicals and establish homeostasis. Myriad of Nrf2 gene knockout studies in various organs such as lung, liver, kidney, brain, etc. have shown that dysregulation of Nrf2 severely affects the oxidant/ROS sensitivity and predispose the system to several pathological changes with aberrant cellular lesions. On the other hand, its gain of function chemical interventions exhibited oxidant stress resistance and cytoprotection. However, thus far, only a few investigations have shown the potential role of Nrf2 and its non-pharmacological induction in cardiac aging. Therefore, here we review the involvement of Nrf2 signaling along with its responses and ramifications on the cascade of OS under acute exercise stress (AES), moderate exercise training (MET), and endurance exercise stress (EES) conditions in the aging heart. PMID:27378947

  1. Exercise, Nrf2 and Antioxidant Signaling in Cardiac Aging.

    PubMed

    Narasimhan, Madhusudhanan; Rajasekaran, Namakkal S

    2016-01-01

    Aging is represented by a progressive decline in cellular functions. The age-related deformities in cardiac behaviors are the loss of cardiac myocytes through apoptosis or programmed cell death. Oxidative stress (OS) and its deleterious consequence contribute to age-related mechanical remodeling, reduced regenerative capacity, and apoptosis in cardiac tissue. The pathogenesis of OS in the elderly can predispose the heart to other cardiac complications such as atherosclerosis, hypertension, ischemic heart disease, cardiac myopathy, and so on. At the molecular level, oxidant-induced activation of Nrf2 (Nuclear erythroid-2-p45-related factor-2), a transcription factor, regulates several genes containing AREs (Antioxidant Response Element) and bring the respective translates to counteract the reactive radicals and establish homeostasis. Myriad of Nrf2 gene knockout studies in various organs such as lung, liver, kidney, brain, etc. have shown that dysregulation of Nrf2 severely affects the oxidant/ROS sensitivity and predispose the system to several pathological changes with aberrant cellular lesions. On the other hand, its gain of function chemical interventions exhibited oxidant stress resistance and cytoprotection. However, thus far, only a few investigations have shown the potential role of Nrf2 and its non-pharmacological induction in cardiac aging. Therefore, here we review the involvement of Nrf2 signaling along with its responses and ramifications on the cascade of OS under acute exercise stress (AES), moderate exercise training (MET), and endurance exercise stress (EES) conditions in the aging heart. PMID:27378947

  2. The neuroprotection of hypoxic preconditioning on rat brain against traumatic brain injury by up-regulated transcription factor Nrf2 and HO-1 expression.

    PubMed

    Shu, Longfei; Wang, Chunlin; Wang, Jinbiao; Zhang, Yongming; Zhang, Xing; Yang, Yanyan; Zhuo, Jianwei; Liu, Jiachuan

    2016-01-12

    Hypoxic preconditioning (HPC) increases the inherent tolerance of brain tissue suffering from severe hypoxia or ischemia insult by stimulating the protective ability of the brain. However, little is known concerning the effect of HPC on traumatic brain injury (TBI). We designed this study to investigate the effect of HPC on TBI and explore its underlying mechanisms. We found that HPC significantly alleviates neurological dysfunction, lessens brain edema, reduces cell apoptosis, increases neuronal survival, up-regulates the expressions of Nrf2 and HO-1, and decreases the inducer of protein carbonyls, 4-hydroxy-2-nonenal, and 8-hydroxy-2-deoxyguanosine in the brain tissue of rats 24h after brain injury. However, no influence was observed in normal rats after only 3d of hypoxic training. Results further indicated that HPC protects the brain against traumatic damage. This protective effect may be achieved by up-regulating Nrf2 and HO-1 expression and alleviating oxidative stress damage. PMID:26590328

  3. Fraxetin Induces Heme Oxygenase-1 Expression by Activation of Akt/Nrf2 or AMP-activated Protein Kinase α/Nrf2 Pathway in HaCaT Cells

    PubMed Central

    Kundu, Juthika; Chae, In Gyeong; Chun, Kyung-Soo

    2016-01-01

    Background Fraxetin (7,8-dihydroxy-6-methoxy coumarin), a coumarin derivative, has been reported to possess antioxidative, anti-inflammatory and neuroprotective effects. A number of recent observations suggest that the induction of heme oxygenase-1 (HO-1) inhibits inflammation and tumorigenesis. In the present study, we determined the effect of fraxetin on HO-1 expression in HaCaT human keratinocytes and investigated its underlying molecular mechanisms. Methods Reverse transcriptase-PCR and Western blot analysis were performed to detect HO-1 mRNA and protein expression, respectively. Cell viability was measured by the MTS test. The induction of intracellular reactive oxygen species (ROS) by fraxetin was evaluated by 2′,7′-dichlorofluorescin diacetate staining. Results Fraxetin upregulated mRNA and protein expression of HO-1. Incubation with fraxetin induced the localization of nuclear factor-erythroid-2-related factor-2 (Nrf2) in the nucleus and increased the antioxidant response element-reporter gene activity. Fraxetin also induced the phosphorylation of Akt and AMP-activated protein kinase (AMPK)α and diminished the expression of phosphatase and tensin homolog, a negative regulator of Akt. Pharmacological inhibition of Akt and AMPKα abrogated fraxetin-induced expression of HO-1 and nuclear localization of Nrf2. Furthermore, fraxetin generated ROS in a concentration-dependent manner. Conclusions Fraxetin induces HO-1 expression through activation of Akt/Nrf2 or AMPKα/Nrf2 pathway in HaCaT cells. PMID:27722139

  4. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    SciTech Connect

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun; Yang, Chung S.; Zhang, Jinsong

    2015-02-15

    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  5. The effect of ex vivo CDDO-Me activation on nuclear factor erythroid 2-related factor 2 pathway in white blood cells from patients with septic shock.

    PubMed

    Noel, Sanjeev; Zheng, Laura; Navas-Acien, Ana; Fuchs, Ralph J

    2014-11-01

    Nuclear factor erythroid 2-related factor 2 (NRF2) has been shown to protect against experimental sepsis in mice and lipopolysaccharide (LPS)-induced inflammation in ex vivo white blood cells from healthy subjects by upregulating cellular antioxidant genes. The objective of this study was to test the hypothesis that ex vivo methyl 2-cyano-3,12-dioxoolean-1,9-dien-28-oate (CDDO-Me) activates NRF2-regulated antioxidant genes in white blood cells from patients with septic shock and protects against LPS-induced inflammation and reactive oxidative species production. Peripheral blood was collected from 18 patients with septic shock who were being treated in medical and surgical intensive care units. Real-time polymerase chain reaction was used to quantify the expression of NRF2 target genes (NQO1, HO-1, GCLM, and FTL) and IL-6 in peripheral blood mononuclear cells (PBMCs), monocytes, and neutrophils after CDDO-Me treatment alone or after subsequent LPS exposure. Superoxide anion (O2) was measured to assess the effect of CDDO-Me pretreatment on subsequent LPS exposure. Treatment with CDDO-Me increased the gene expression of NQO1 (P = 0.04) and decreased the expression of HO-1 (P = 0.03) in PBMCs from patients with septic shock. Purified monocytes exhibited significant increases in the expression of NQO1 (P = 0.01) and GCLM (P = 0.003) after CDDO-Me treatment. Levels of other NRF2 target genes (HO-1 and FTL) remained similar to those of vehicle-treated cells. Peripheral blood mononuclear cells showed a trend toward increased IL-6 gene expression after CDDO-Me treatment, whereas purified monocytes showed a trend toward decreased IL-6. There was no discernible trend in the IL-6 expression subsequent to LPS treatment in either vehicle-treated or CDDO-Me-treated PBMCs and monocytes. Treatment with CDDO-Me significantly increased O2 production in PBMCs (P = 0.04). Although CDDO-Me pretreatment significantly attenuated O2 production to subsequent LPS exposure (P = 0.03), the

  6. Activation of NRF2 Signaling in HEK293 Cells by a First-in-Class Direct KEAP1-NRF2 Inhibitor.

    PubMed

    Wen, Xia; Thorne, Gabriell; Hu, Longqin; Joy, Melanie S; Aleksunes, Lauren M

    2015-06-01

    Under basal conditions, the antioxidant transcription factor nuclear factor (erythroid-derived 2)-like 2 (NRF2) is bound to the Kelch-like ECH-associated protein 1 (KEAP1) protein and targeted for proteasomal degradation in the cytoplasm. In response to cellular injury or chemical treatment, NRF2 dissociates from KEAP1 and activates the transcription of protective genes and defends against injury. LH601A is a first-in-class direct inhibitor of the KEAP1-NRF2 protein-protein interaction. The purpose of this study was to determine whether LH601A activates NRF2 signaling in human kidney cells. Human embryonic kidney 293 (HEK293) cells were treated with LH601A or the indirect NRF2 activator, sulforaphane (SFN) for 6 or 16 h. SFN and LH601A upregulated NRF2 target genes heme oxygenase-1 (HO-1) (two- to sevenfold), thioredoxin 1 (TRX1) (twofold) and NAD(P)H quinone oxidoreductase 1 (NQO1) mRNAs (twofold). Both compounds also elevated HO-1 and TRX1 protein expression. Since NRF2 activation can protect tissues from injury, LH601A, a direct inhibitor of the KEAP1-NRF2 interaction may be used to defend against kidney injury and/or diseases.

  7. Overexpression of miR-200a protects cardiomyocytes against hypoxia-induced apoptosis by modulating the kelch-like ECH-associated protein 1-nuclear factor erythroid 2-related factor 2 signaling axis.

    PubMed

    Sun, Xiaoxia; Zuo, Hong; Liu, Chunmei; Yang, Yafeng

    2016-10-01

    The kelch-like ECH-associated protein 1 (Keap1)-nuclear factor erythroid 2-related factor 2 (Nrf2) signaling axis plays an important role in regulating oxidative stress in ischemic cardiomyocytes. Targeting Keap1 in order to promote Nrf2 activation is considered a potential method for protecting cardiomyocytes against ischemic injury. In recent years, microRNAs (miRNAs or miRs) have emerged as powerful tools for controlling gene expression. The present study aimed to determine whether Keap1-Nrf2 was regulated by specific miRNAs in cardiomyocytes under hypoxic conditions. We demonstrated that miR-200a was significantly downregulated in ischemic myocardial tissues and hypoxic cardiomyocytes. The overexpression of miR-200a was found to protect cardiomyocytes from hypoxia-induced cell damage and the excessive production of reactive oxygen species. Through bioinformatics analysis and a dual-luciferase report assay, miR-200a was found to interact with the 3'-untranslated region of Keap1, the native regulator of Nrf2. Reverse transcription-quantitative polymerase chain reaction and western blot analysis revealed that miR-200a negatively regulated the expression of Keap1. The overexpression of miR-200a significantly increased the nuclear translocation of Nrf2 as well as downstream antioxidant enzyme gene expression. The inhibition of miR-200a displayed the opposite effects. Restoring the expression of Keap1 significantly abrogated the protective effect of miR‑200a. Taken together, these findings indicate that the suppression of Keap1 by miR-200a exerted a cardioprotective effect against hypoxia-induced oxidative stress and cell apoptosis, and suggest that the activation of Nrf2 signaling by miR‑200a represents a novel and promising therapeutic strategy for the treatment of ischemic heart disease. PMID:27573160

  8. Overexpression of miR-200a protects cardiomyocytes against hypoxia-induced apoptosis by modulating the kelch-like ECH-associated protein 1-nuclear factor erythroid 2-related factor 2 signaling axis.

    PubMed

    Sun, Xiaoxia; Zuo, Hong; Liu, Chunmei; Yang, Yafeng

    2016-10-01

    The kelch-like ECH-associated protein 1 (Keap1)-nuclear factor erythroid 2-related factor 2 (Nrf2) signaling axis plays an important role in regulating oxidative stress in ischemic cardiomyocytes. Targeting Keap1 in order to promote Nrf2 activation is considered a potential method for protecting cardiomyocytes against ischemic injury. In recent years, microRNAs (miRNAs or miRs) have emerged as powerful tools for controlling gene expression. The present study aimed to determine whether Keap1-Nrf2 was regulated by specific miRNAs in cardiomyocytes under hypoxic conditions. We demonstrated that miR-200a was significantly downregulated in ischemic myocardial tissues and hypoxic cardiomyocytes. The overexpression of miR-200a was found to protect cardiomyocytes from hypoxia-induced cell damage and the excessive production of reactive oxygen species. Through bioinformatics analysis and a dual-luciferase report assay, miR-200a was found to interact with the 3'-untranslated region of Keap1, the native regulator of Nrf2. Reverse transcription-quantitative polymerase chain reaction and western blot analysis revealed that miR-200a negatively regulated the expression of Keap1. The overexpression of miR-200a significantly increased the nuclear translocation of Nrf2 as well as downstream antioxidant enzyme gene expression. The inhibition of miR-200a displayed the opposite effects. Restoring the expression of Keap1 significantly abrogated the protective effect of miR‑200a. Taken together, these findings indicate that the suppression of Keap1 by miR-200a exerted a cardioprotective effect against hypoxia-induced oxidative stress and cell apoptosis, and suggest that the activation of Nrf2 signaling by miR‑200a represents a novel and promising therapeutic strategy for the treatment of ischemic heart disease.

  9. Chinese herbal medicine formula tao hong si wu decoction protects against cerebral ischemia-reperfusion injury via PI3K/Akt and the Nrf2 signaling pathway.

    PubMed

    Li, Li; Yang, Na; Nin, Ling; Zhao, Zhilong; Chen, Lu; Yu, Jie; Jiang, Zhuyun; Zhong, Zhendong; Zeng, Daiwen; Qi, Hongyi; Xu, Xiaoyu

    2015-01-01

    The Chinese herbal medicine formula Tao Hong Si Wu decoction (THSWD) is traditionally used for the prevention and treatment of ischemic stroke. Transcription factor NF-E2-related factor 2 (Nrf2) regulates a battery of phase II enzymes and is known as the major mechanism of cellular defense against oxidative stress. The present study aimed to explore the potential effect of THSWD on the Nrf2 signaling pathway and the consequent effect during cerebral ischemia-reperfusion (I/R) injury. We found that THSWD reduced infarct volume and improved neurological function in a rat stroke model induced by middle cerebral artery occlusion (MCAO). Additionally, heme oxygenase 1 (HO-1), a key endogenous antioxidant enzyme regulated by Nrf2, was significantly further induced by THSWD in this in vivo model. In neuronal-like PC12 cells, THSWD remarkably up-regulated HO-1 expression and promoted Nrf2 nuclear translocation. Furthermore, phosphatidylinositol 3-kinase (PI3K)/Akt kinase was found to be involved in the upstream of Nrf2 regulation. In an in vitro oxygen-glucose deprivation/reperfusion (OGD-Rep) model, THSWD treatment significantly reduced cell death induced by OGD-Rep insult. Importantly, the protective action was attenuated while PI3K activity was inhibited by a specific inhibitor, LY294002, and the Nrf2 signaling pathway was blocked by antioxidant response element (ARE) decoy oligonucleotides. Collectively, these results demonstrated that THSWD exhibited notable neuroprotective properties in vitro and in vivo and activation of PI3K/Akt and the Nrf2 signaling pathway may be, at least in part, responsible for the protection. This study provides a better understanding of the molecular mechanism underlying the traditional use of the Chinese herbal medicine formula THSWD.

  10. Green tea polyphenol (-)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: responses of major antioxidant enzymes and the Nrf2 rescue pathway.

    PubMed

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun; Yang, Chung S; Zhang, Jinsong

    2015-02-15

    (-)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. PMID:25585349

  11. Lung endothelial barrier protection by resveratrol involves inhibition of HMGB1 release and HMGB1-induced mitochondrial oxidative damage via an Nrf2-dependent mechanism.

    PubMed

    Dong, Wen-Wen; Liu, Yu-Jian; Lv, Zhou; Mao, Yan-Fei; Wang, Ying-Wei; Zhu, Xiao-Yan; Jiang, Lai

    2015-11-01

    High-mobility group box 1 (HMGB1) contributes to lung vascular hyperpermeability during ventilator-induced lung injury. We aimed to determine whether the natural antioxidant resveratrol protected against HMGB1-induced endothelial hyperpermeability both in vitro and in vivo. We found that HMGB1 decreased vascular endothelial (VE)-cadherin expression and increased endothelial permeability, leading to mitochondrial oxidative damage in primary cultured mouse lung vascular endothelial cells (MLVECs). Both the mitochondrial superoxide dismutase 2 mimetic MnTBAP and resveratrol blocked HMGB1-induced mitochondrial oxidative damage, VE-cadherin downregulation, and endothelial hyperpermeability. In in vivo studies, anesthetized male ICR mice were ventilated for 4h using low tidal volume (6 ml/kg) or high tidal volume (HVT; 30 ml/kg) ventilation. The mice were injected intraperitoneally with resveratrol immediately before the onset of ventilation. We found that resveratrol attenuated HVT-associated lung vascular hyperpermeability and HMGB1 production. HVT caused a significant increase in nuclear factor-erythroid 2-related factor 2 (Nrf2) nuclear translocation and Nrf2 target gene expression in lung tissues, which was further enhanced by resveratrol treatment. HMGB1 had no effect on Nrf2 activation, whereas resveratrol treatment activated the Nrf2 signaling pathway in HMGB1-treated MLVECs. Moreover, Nrf2 knockdown reversed the inhibitory effects of resveratrol on HMGB1-induced mitochondrial oxidative damage and endothelial hyperpermeability. The inhibitory effect of resveratrol on cyclic stretch-induced HMGB1 mRNA expression in primary cultured MLVECs was also abolished by Nrf2 knockdown. In summary, this study demonstrates that resveratrol protects against lung endothelial barrier dysfunction initiated by HVT. Lung endothelial barrier protection by resveratrol involves inhibition of mechanical stretch-induced HMGB1 release and HMGB1-induced mitochondrial oxidative damage

  12. Chemopreventive Properties of Genipin on AGS Cell Line via Induction of JNK/Nrf2/ARE Signaling Pathway.

    PubMed

    Kim, Jee Min; Ko, Hyeonseok; Kim, Sun-Joong; Shim, So Hee; Ha, Chang Hoon; Chang, Hyo Ihl

    2016-01-01

    Roles of dietary phytochemicals in cancer chemoprevention via induction of nuclear factor-erythroid-2-related factor 2 (Nrf2)-mediated antioxidant enzymes have been well established in a number of studies. In this study, FACS analysis was used to reveal that the intracellular reactive oxygen species level decreased at 0-25 μM of genipin treatment. Furthermore, immunofluorescence analysis and Western blotting were used to demonstrate that genipin treatment resulted in the upregulation and nuclear translocation of Nrf2, as well as upregulation of gastrointestinal glutathione peroxidase. Finally, we found that C-Jun-NH2-kinase (JNK) was also dose-dependently activated, where depleting JNK by using a biochemical inhibitor indicated that JNK was upstream of Nrf2. Interestingly, the antioxidant effects were limited to the treatment in the lower dosage of genipin, where higher dosage of genipin treatment resulted in the increased reactive oxygen species level and cytotoxicity. Thus, this study demonstrates for the first time that lower dosage of genipin results in the induction of JNK/Nrf2/ARE signaling pathway and protection from cell death.

  13. Protective Effect of Decursin Extracted from Angelica gigas in Male Infertility via Nrf2/HO-1 Signaling Pathway

    PubMed Central

    Bae, Woong Jin; Ha, U. Syn; Choi, Jin Bong; Kim, Kang Sup; Kim, Su Jin; Cho, Hyuk Jin; Hong, Sung Hoo; Lee, Ji Youl; Wang, Zhiping; Hwang, Sung Yeoun; Kim, Sae Woong

    2016-01-01

    Higher testicular temperature results in altered spermatogenesis due to heat-related oxidative stress. We examined the effects of decursin extracted from Angelica gigas Nakai on antioxidant activity in vitro and in a cryptorchidism-induced infertility rat model. TM3 Leydig cell viability was measured based on oxidative stress according to treatment. Either distilled water or AG 400 mg/kg of A. gigas extract was administered orally for 4 weeks after unilateral cryptorchidism was induced. After 1, 2, and 4 weeks, six rats from the control group and six rats from treatment group were sacrificed. Testicular weight, semen quality, antioxidant activities, nuclear factor erythroid 2-related factor 2 (Nrf2) protein, and mRNA expression of Nrf2-regulated genes were analyzed. Treatment with A. gigas extract (1) protected TM3 cells against oxidative stress in a dose-dependent manner, (2) improved the mean weight of the cryptorchid testis, (3) maintained sperm counts, motility, and spermatogenic cell density, (4) decreased levels of 8-hydroxy-2-deoxyguanosine (8-OHdG) and increased levels of superoxide dismutase (SOD), (5) significantly increased Nrf2 and heme oxygenase-1 (HO-1), and (6) significantly decreased apoptosis. This study suggests that decursin extracted from A. gigas is a supplemental agent that can reduce oxidative stress by Nrf2-mediated upregulation of HO-1 in rat experimentally induced unilateral cryptorchidism and may improve cryptorchidism-induced infertility. PMID:27034737

  14. Protective Effects of Quercetin on Mitochondrial Biogenesis in Experimental Traumatic Brain Injury via the Nrf2 Signaling Pathway

    PubMed Central

    Li, Xiang; Wang, Handong; Gao, Yongyue; Li, Liwen; Tang, Chao; Wen, Guodao; Zhou, Yuan; Zhou, Mengliang; Mao, Lei; Fan, Youwu

    2016-01-01

    The present investigation was carried out to elucidate a possible molecular mechanism related to the protective effect of quercetin administration against oxidative stress on various mitochondrial respiratory complex subunits with special emphasis on the role of nuclear factor erythroid 2-related factor 2 (Nrf2) in mitochondrial biogenesis. Recently, quercetin has been proved to have a protective effect against mitochondria damage after traumatic brain injury (TBI). However, its precise role and underlying mechanisms in traumatic brain injury are not yet fully understood. The aim of the present study was to investigate the effect of quercetin on the potential mechanism of these effects in a weight-drop model of TBI in male mice that were treated with quercetin or vehicle via intraperitoneal injection administrated 30 min after TBI. In this experiment, ICR mice were divided into four groups: A sham group, TBI group, TBI + vehicle group, and TBI + quercetin group. Brain samples were collected 24 h later for analysis. Quercetin treatment resulted in an upregulation of Nrf2 expression and cytochrome c, malondialdehyde (MDA) and superoxide dismutase (SOD) levels were restored by quercetin treatment. Quercetin markedly promoted the translocation of Nrf2 protein from the cytoplasm to the nucleus. These observations suggest that quercetin improves mitochondrial function in TBI models, possibly by activating the Nrf2 pathway. PMID:27780244

  15. Andrographolide protects against cigarette smoke-induced oxidative lung injury via augmentation of Nrf2 activity

    PubMed Central

    Guan, SP; Tee, W; Ng, DSW; Chan, TK; Peh, HY; Ho, WE; Cheng, C; Mak, JC; Wong, WSF

    2013-01-01

    Background and Purpose Cigarette smoke is a major cause for chronic obstructive pulmonary disease (COPD). Andrographolide is an active biomolecule isolated from the plant Andrographis paniculata. Andrographolide has been shown to activate nuclear factor erythroid-2-related factor 2 (Nrf2), a redox-sensitive antioxidant transcription factor. As Nrf2 activity is reduced in COPD, we hypothesize that andrographolide may have therapeutic value for COPD. Experimental Approach Andrographolide was given i.p. to BALB/c mice daily 2 h before 4% cigarette smoke exposure for 1 h over five consecutive days. Bronchoalveolar lavage fluid and lungs were collected for analyses of cytokines, oxidative damage markers and antioxidant activities. BEAS-2B bronchial epithelial cells were exposed to cigarette smoke extract (CSE) and used to study the antioxidant mechanism of action of andrographolide. Key Results Andrographolide suppressed cigarette smoke-induced increases in lavage fluid cell counts; levels of IL-1β, MCP-1, IP-10 and KC; and levels of oxidative biomarkers 8-isoprostane, 8-OHdG and 3-nitrotyrosine in a dose-dependent manner. Andrographolide promoted inductions of glutathione peroxidase (GPx) and glutathione reductase (GR) activities in lungs from cigarette smoke-exposed mice. In BEAS-2B cells, andrographolide markedly increased nuclear Nrf2 accumulation, promoted binding to antioxidant response element (ARE) and total cellular glutathione level in response to CSE. Andrographolide up-regulated ARE-regulated gene targets including glutamate-cysteine ligase catalytic (GCLC) subunit, GCL modifier (GCLM) subunit, GPx, GR and heme oxygenase-1 in BEAS-2B cells in response to CSE. Conclusions Andrographolide possesses antioxidative properties against cigarette smoke-induced lung injury probably via augmentation of Nrf2 activity and may have therapeutic potential for treating COPD. PMID:23146110

  16. SIRT6 safeguards human mesenchymal stem cells from oxidative stress by coactivating NRF2

    PubMed Central

    Pan, Huize; Guan, Di; Liu, Xiaomeng; Li, Jingyi; Wang, Lixia; Wu, Jun; Zhou, Junzhi; Zhang, Weizhou; Ren, Ruotong; Zhang, Weiqi; Li, Ying; Yang, Jiping; Hao, Ying; Yuan, Tingting; Yuan, Guohong; Wang, Hu; Ju, Zhenyu; Mao, Zhiyong; Li, Jian; Qu, Jing; Tang, Fuchou; Liu, Guang-Hui

    2016-01-01

    SIRT6 belongs to the mammalian homologs of Sir2 histone NAD+-dependent deacylase family. In rodents, SIRT6 deficiency leads to aging-associated degeneration of mesodermal tissues. It remains unknown whether human SIRT6 has a direct role in maintaining the homeostasis of mesodermal tissues. To this end, we generated SIRT6 knockout human mesenchymal stem cells (hMSCs) by targeted gene editing. SIRT6-deficient hMSCs exhibited accelerated functional decay, a feature distinct from typical premature cellular senescence. Rather than compromised chromosomal stability, SIRT6-null hMSCs were predominately characterized by dysregulated redox metabolism and increased sensitivity to the oxidative stress. In addition, we found SIRT6 in a protein complex with both nuclear factor erythroid 2-related factor 2 (NRF2) and RNA polymerase II, which was required for the transactivation of NRF2-regulated antioxidant genes, including heme oxygenase 1 (HO-1). Overexpression of HO-1 in SIRT6-null hMSCs rescued premature cellular attrition. Our study uncovers a novel function of SIRT6 in maintaining hMSC homeostasis by serving as a NRF2 coactivator, which represents a new layer of regulation of oxidative stress-associated stem cell decay. PMID:26768768

  17. Isoorientin induces Nrf2 pathway-driven antioxidant response through phosphatidylinositol 3-kinase signaling.

    PubMed

    Lim, Ju Hee; Park, Hae-Suk; Choi, Jung-Kap; Lee, Ik-Soo; Choi, Hyun Jin

    2007-12-01

    Because oxidative stress is involved in the pathogenesis of various chronic diseases and the aging process, antioxidants that can increase the intrinsic antioxidant potency are proposed as desirable therapeutic agents to counteract oxidative stress-related diseases. NF-E2-related factor-2 (Nrf2) is a transcription factor that regulates important antioxidant and phase II detoxification genes, and therefore, the molecule that regulates nuclear translocation of Nrf2 and the induction of antioxidative proteins is thought to be a promising candidate as a cytoprotective agent for oxidative stress. In the present study, we show that isoorientin (luteolin 6-C-beta-D-glucoside) obtained from the leaves of Sasa borealis upregulates and activates Nrf2, and has protective ability against oxidative damage caused by reactive oxygen intermediates in HepG2 cells. Isoorientin induces increase in the level of antioxidant enzyme proteins, especially NQO1, and the cytoprotective and antioxidative effects of isoorientin are PI3K/Akt pathway-dependent. Together with direct radical scavenging activity, the novel effect of isoorientin on the regulation of antioxidative gene expression provides attractive strategy to prevent diseases associated with oxidative stress and attenuate the progress of the diseases. PMID:18254247

  18. SIRT6 safeguards human mesenchymal stem cells from oxidative stress by coactivating NRF2.

    PubMed

    Pan, Huize; Guan, Di; Liu, Xiaomeng; Li, Jingyi; Wang, Lixia; Wu, Jun; Zhou, Junzhi; Zhang, Weizhou; Ren, Ruotong; Zhang, Weiqi; Li, Ying; Yang, Jiping; Hao, Ying; Yuan, Tingting; Yuan, Guohong; Wang, Hu; Ju, Zhenyu; Mao, Zhiyong; Li, Jian; Qu, Jing; Tang, Fuchou; Liu, Guang-Hui

    2016-02-01

    SIRT6 belongs to the mammalian homologs of Sir2 histone NAD(+)-dependent deacylase family. In rodents, SIRT6 deficiency leads to aging-associated degeneration of mesodermal tissues. It remains unknown whether human SIRT6 has a direct role in maintaining the homeostasis of mesodermal tissues. To this end, we generated SIRT6 knockout human mesenchymal stem cells (hMSCs) by targeted gene editing. SIRT6-deficient hMSCs exhibited accelerated functional decay, a feature distinct from typical premature cellular senescence. Rather than compromised chromosomal stability, SIRT6-null hMSCs were predominately characterized by dysregulated redox metabolism and increased sensitivity to the oxidative stress. In addition, we found SIRT6 in a protein complex with both nuclear factor erythroid 2-related factor 2 (NRF2) and RNA polymerase II, which was required for the transactivation of NRF2-regulated antioxidant genes, including heme oxygenase 1 (HO-1). Overexpression of HO-1 in SIRT6-null hMSCs rescued premature cellular attrition. Our study uncovers a novel function of SIRT6 in maintaining hMSC homeostasis by serving as a NRF2 coactivator, which represents a new layer of regulation of oxidative stress-associated stem cell decay.

  19. Redox Modulating NRF2: A Potential Mediator of Cancer Stem Cell Resistance

    PubMed Central

    Ryoo, In-geun; Lee, Sang-hwan; Kwak, Mi-Kyoung

    2016-01-01

    Tumors contain a distinct small subpopulation of cells that possess stem cell-like characteristics. These cells have been called cancer stem cells (CSCs) and are thought to be responsible for anticancer drug resistance and tumor relapse after therapy. Emerging evidence indicates that CSCs share many properties, such as self-renewal and quiescence, with normal stem cells. In particular, CSCs and normal stem cells retain low levels of reactive oxygen species (ROS), which can contribute to stem cell maintenance and resistance to stressful tumor environments. Current literatures demonstrate that the activation of ataxia telangiectasia mutated (ATM) and forkhead box O3 (FoxO3) is associated with the maintenance of low ROS levels in normal stem cells such as hematopoietic stem cells. However, the importance of ROS signaling in CSC biology remains poorly understood. Recent studies demonstrate that nuclear factor-erythroid 2-related factor 2 (NRF2), a master regulator of the cellular antioxidant defense system, is involved in the maintenance of quiescence, survival, and stress resistance of CSCs. Here, we review the recent findings on the roles of NRF2 in maintenance of the redox state and multidrug resistance in CSCs, focusing on how NRF2-mediated ROS modulation influences the growth and resistance of CSCs. PMID:26682001

  20. High levels of Nrf2 determine chemoresistance in type II endometrial cancer

    PubMed Central

    Jiang, Tao; Chen, Ning; Zhao, Fei; Wang, Xiao-Jun; Kong, Beihua; Zheng, Wenxin; Zhang, Donna D.

    2010-01-01

    Type II endometrial cancer, which mainly presents as serous and clear cell types, has proved to be the most malignant and recurrent carcinoma among various female genital malignancies. The transcription factor, Nrf2, was first described as having chemopreventive activity. Activation of the Nrf2-mediated cellular defense response protects cells against the toxic and carcinogenic effects of environmental insults by upregulating an array of genes that detoxify reactive oxygen species (ROS) and restore cellular redox homeostasis. However, the cancer-promoting role of Nrf2 has recently been revealed. Nrf2 is constitutively upregulated in several types of human cancer tissues and cancer cell lines. Furthermore, inhibition of Nrf2 expression sensitizes cancer cells to chemotherapeutic drugs. In this study, the constitutive level of Nrf2 was compared in different types of human endometrial tumors. It was found that Nrf2 was highly expressed in endometrial serous carcinoma (ESC), whereas complex hyperplasia (CH) and endometrial endometrioid carcinoma (EEC) had no or marginal expression of Nrf2. Likewise, the ESC derived SPEC-2 cell line had a higher level of Nrf2 expression and was more resistant to the toxic effects of cisplatin and paclitaxel than that of the Ishikawa cell line, which was generated from EEC. Silencing of Nrf2 rendered SPEC-2 cells more susceptible to chemotherapeutic drugs while it had a limited effect on Ishikawa cells. Inhibition of Nrf2 expression by overexpressing Keap1 sensitized SPEC-2 cells or SPEC-2-derived xenografts to chemotherapeutic treatments using both cell culture and SCID mouse models. Collectively, we provide a molecular basis for the use of Nrf2 inhibitors to increase the efficacy of chemotherapeutic drugs and to combat chemoresistance, the biggest obstacle in chemotherapy. PMID:20530669

  1. Arsenic-mediated activation of the Nrf2-Keap1 antioxidant pathway.

    PubMed

    Lau, Alexandria; Whitman, Samantha A; Jaramillo, Melba C; Zhang, Donna D

    2013-02-01

    Arsenic is present in the environment and has become a worldwide health concern due to its toxicity and carcinogenicity. However, the specific mechanism(s) by which arsenic elicits its toxic effects has yet to be fully elucidated. The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) has been recognized as the master regulator of a cellular defense mechanism against toxic insults. This review highlights studies demonstrating that arsenic activates the Nrf2-Keap1 antioxidant pathway by a distinct mechanism from that of natural compounds such as sulforaphane (SF) found in broccoli sprouts or tert-butylhyrdoquinone (tBHQ), a natural antioxidant commonly used as a food preservative. Evidence also suggests that arsenic prolongs Nrf2 activation and may mimic constitutive activation of Nrf2, which has been found in several human cancers due to disruption of the Nrf2-Keap1 axis. The current literature strongly suggests that activation of Nrf2 by arsenic potentially contributes to, rather than protects against, arsenic toxicity and carcinogenicity. The mechanism(s) by which known Nrf2 activators, such as the natural chemopreventive compounds SF and lipoic acid, protect against the deleterious effects caused by arsenic will also be discussed. These findings will provide insight to further understand how arsenic promotes a prolonged Nrf2 response, which will lead to the identification of novel molecular markers and development of rational therapies for the prevention or intervention of arsenic-induced diseases. The National Institute of Environmental Health Science (NIEHS) Outstanding New Environmental Scientist (ONES) award has provided the opportunity to review the progress both in the fields of arsenic toxicology and Nrf2 biology. Much of the funding has led to (1) the novel discovery that arsenic activates the Nrf2 pathway by a mechanism different to that of other Nrf2 activators, such as sulforaphane and tert-butylhydroquinone, (2) activation of Nrf

  2. Upregulation of phase II enzymes through phytochemical activation of Nrf2 protects cardiomyocytes against oxidant stress.

    PubMed

    Reuland, Danielle J; Khademi, Shadi; Castle, Christopher J; Irwin, David C; McCord, Joe M; Miller, Benjamin F; Hamilton, Karyn L

    2013-03-01

    Increased production of reactive oxygen species has been implicated in the pathogenesis of cardiovascular disease (CVD), and enhanced endogenous antioxidants have been proposed as a mechanism for regulating redox balance. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) is a transcriptional regulator of phase II antioxidant enzymes, and activation of Nrf2 has been suggested to be an important step in attenuating oxidative stress associated with CVD. A well-defined combination of five widely studied medicinal plants derived from botanical sources (Bacopa monniera, Silybum marianum (milk thistle), Withania somnifera (Ashwagandha), Camellia sinensis (green tea), and Curcuma longa (turmeric)) has been shown to activate Nrf2 and induce phase II enzymes through the antioxidant response element. The purpose of these experiments was to determine if treatment of cardiomyocytes with this phytochemical composition, marketed as Protandim, activates Nrf2, induces phase II detoxification enzymes, and protects cardiomyocytes from oxidant-induced apoptosis in a Nrf2-dependent manner. In cultured HL-1 cardiomyocytes, phytochemical treatment was associated with nuclear accumulation of Nrf2, significant induction of phase II enzymes, and concomitant protection against hydrogen peroxide-induced apoptosis. The protection against oxidant stress was abolished when Nrf2 was silenced by shRNA, suggesting that our phytochemical treatment worked through the Nrf2 pathway. Interestingly, phytochemical treatment was found to be a more robust activator of Nrf2 than oxidant treatment, supporting the use of the phytochemicals as a potential treatment to increase antioxidant defenses and protect heart cells against an oxidative challenge.

  3. Berberine Hydrochloride Protects C2C12 Myoblast Cells Against Oxidative Stress-Induced Damage via Induction of Nrf-2-Mediated HO-1 Expression.

    PubMed

    Choi, Yung Hyun

    2016-09-01

    Preclinical Research The aim of the present study was to evaluate the effects of berberine hydrochloride (BBH), an isoquinoline alkaloid that can be isolated from a variety of herbs, on hydrogen peroxide (H2 O2 )-induced oxidative stress in C2C12 myoblasts and to investigate the molecular mechanisms involved in this process, especially the expression of the Nrf2/HO-1 pathway. BBH preconditioning attenuated H2 O2 -induced growth inhibition and DNA damage as well as apoptosis in C2C12 cells via suppression of the accumulation of intracellular reactive oxygen species (ROS). Treatment with BBHride alone effectively upregulated the expression of nuclear factor-erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) and elevated HO-1 activity. However, the protective effects of BBH against H2 O2 -induced ROS generation and cell growth reduction were abolished by an HO-1 inhibitor. Moreover, BBH-mediated induction and activation of HO-1 were reduced by genetic silencing of Nrf2 using small interfering RNA (siRNA). In addition, the effects of BBH against H2 O2 -induced ROS accumulation and growth inhibition were abrogated in C2C12 cells transfected with Nrf2 siRNA. Therefore, the present study demonstrated that BBH could protect C2C12 cells against oxidative stress-induced injury and this effect involved activation of the Nrf2/HO-1 pathway. Drug Dev Res, 2016. © 2016 Wiley Periodicals, Inc. PMID:27535021

  4. Nrf2 regulates PU.1 expression and activity in the alveolar macrophage.

    PubMed

    Staitieh, Bashar S; Fan, Xian; Neveu, Wendy; Guidot, David M

    2015-05-15

    Alveolar macrophage (AM) immune function depends on the activation of the transcription factor PU.1 by granulocyte macrophage colony-stimulating factor. We have determined that chronic alcohol ingestion dampens PU.1 signaling via an unknown zinc-dependent mechanism; specifically, although PU.1 is not known to be a zinc-dependent transcription factor, zinc treatment reversed alcohol-mediated dampening of PU.1 signaling. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), a zinc-dependent basic leucine zipper protein essential for antioxidant defenses, is also impaired by chronic alcohol ingestion and enhanced by zinc treatment. We hypothesized that the response of PU.1 to zinc treatment may result from the action of Nrf2 on PU.1. We first performed Nrf2/PU.1 protein coimmunoprecipitation on a rat AM cell line (NR8383) and found no evidence of protein-protein interactions. We then found evidence of increased Nrf2 binding to the PU.1 promoter region by chromatin immunoprecipitation. We next activated Nrf2 using either sulforaphane or an overexpression vector and inhibited Nrf2 with silencing RNA to determine whether Nrf2 could actively regulate PU.1. Nrf2 activation increased protein expression of both factors as well as gene expression of their respective downstream effectors, NAD(P)H dehydrogenase[quinone] 1 (NQO1) and cluster of differentiation antigen-14 (CD14). In contrast, Nrf2 silencing decreased the expression of both proteins, as well as gene expression of their effectors. Activating and inhibiting Nrf2 in primary rat AMs resulted in similar effects. Taken together, these findings suggest that Nrf2 regulates the expression and activity of PU.1 and that antioxidant response and immune activation are coordinately regulated within the AM.

  5. Molecular hydrogen attenuates hypoxia/reoxygenation injury of intrahepatic cholangiocytes by activating Nrf2 expression.

    PubMed

    Yu, Jianhua; Zhang, Weiguang; Zhang, Rongguo; Jiang, Guixing; Tang, Haijun; Ruan, Xinxian; Ren, Peitu; Lu, Baochun

    2015-11-01

    Hypoxia/reoxygenation (H/R) injury of cholangiocytes causes serious biliary complications during hepatobiliary surgeries. Molecular hydrogen (H2) has been shown to be effective in protecting various cells and organs against oxidative stress injury. Human liver cholangiocytes were used to determine the potential protective effects of hydrogen against cholangiocyte H/R injury and explore the underlying mechanisms. We found that H2 ameliorated H/R-induced cholangiocytes apoptosis. Our study revealed that H2 activated NF-E2-related factor 2 (Nrf2) and downstream cytoprotective protein expression. However, the protective function of H2 was abolished when Nrf2 was silenced. Apoptosis in cholangiocytes isolated from a rat model of liver ischemia/reperfusion injury indicated that H2 significantly attenuates ischemia/reperfusion cholangiocyte injury in vivo. In conclusion, our study shows that H2 protects intrahepatic cholangiocytes from hypoxia/reoxygenation-induced apoptosis in vitro or in vivo, and this phenomenon may depend on activating Nrf2 expression.

  6. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism.

    PubMed

    Hayes, John D; Dinkova-Kostova, Albena T

    2014-04-01

    Nuclear factor-erythroid 2 p45-related factor 2 (Nrf2, also called Nfe2l2) is a transcription factor that regulates the cellular redox status. Nrf2 is controlled through a complex transcriptional/epigenetic and post-translational network that ensures its activity increases during redox perturbation, inflammation, growth factor stimulation and nutrient/energy fluxes, thereby enabling the factor to orchestrate adaptive responses to diverse forms of stress. Besides mediating stress-stimulated induction of antioxidant and detoxification genes, Nrf2 contributes to adaptation by upregulating the repair and degradation of damaged macromolecules, and by modulating intermediary metabolism. In the latter case, Nrf2 inhibits lipogenesis, supports β-oxidation of fatty acids, facilitates flux through the pentose phosphate pathway, and increases NADPH regeneration and purine biosynthesis; these observations suggest Nrf2 directs metabolic reprogramming during stress.

  7. NRF2/long noncoding RNA ROR signaling regulates mammary stem cell expansion and protects against estrogen genotoxicity.

    PubMed

    Zhang, Yongshu; Xia, Jixiang; Li, Qinglin; Yao, Yuan; Eades, Gabriel; Gernapudi, Ramkishore; Duru, Nadire; Kensler, Thomas W; Zhou, Qun

    2014-11-01

    Long noncoding RNAs (lncRNAs) have emerged as key regulators of gene expression in embryonic stem cell (ESC) self-renewal and differentiation. In ESCs, lncRNAs are regulated at the genetic level via transcription factor binding to lncRNA gene promoters. Here we demonstrate that the key cytoprotective transcription factor NRF2 controls lncRNA expression in mammary stem cells. By profiling lncRNAs in wild-type and NRF2 knockdown mammary stem cells, we demonstrate that the lncRNA ROR, a regulator of embryonic stem cell pluripotency, is overexpressed upon NRF2 knockdown. We performed promoter analyses and examined predicted NRF2 binding elements in the ROR promoter using luciferase reporter constructs of a ROR promoter deletion series. Our studies revealed that NRF2 binds to two specific NRF2 response elements flanking the ROR promoter and that these two NRF2 response elements are equally important to suppress ROR transcription. In addition, we identified associated H3K27me3 chromatin modification and EZH2 binding at the ROR promoter that was dependent on NRF2 binding. We observed that NRF2 knockdown or ROR overexpression leads to increased stem cell self-renewal in mammary stem cells. Furthermore, we demonstrate Nrf2 regulation of the mammary stem cell population in vivo. These observations provide further evidence for the critical role of NRF2 in maintaining normal stem cell subpopulations in mammary epithelium.

  8. Ethanol Extract of Cirsium japonicum var. ussuriense Kitamura Exhibits the Activation of Nuclear Factor Erythroid 2-Related Factor 2-dependent Antioxidant Response Element and Protects Human Keratinocyte HaCaT Cells Against Oxidative DNA Damage

    PubMed Central

    Yoo, Ok-Kyung; Choi, Bu Young; Park, Jin-Oh; Lee, Ji-Won; Park, Byoung-Kwon; Joo, Chul Gue; Heo, Hyo-Jung; Keum, Young-Sam

    2016-01-01

    Keratinocytes are constantly exposed to extracellular insults, such as ultraviolet B, toxic chemicals and mechanical stress, all of which can facilitate the aging of keratinocytes via the generation of intracellular reactive oxygen species (ROS). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that plays a critical role in protecting keratinocytes against oxidants and xenobiotics by binding to the antioxidant response element (ARE), a cis-acting element existing in the promoter of most phase II cytoprotective genes. In the present study, we have attempted to find novel ethanol extract(s) of indigenous plants of Jeju island, Korea that can activate the Nrf2/ARE-dependent gene expression in human keratinocyte HaCaT cells. As a result, we identified that ethanol extract of Cirsium japonicum var. ussuriense Kitamura (ECJUK) elicited strong stimulatory effect on the ARE-dependent gene expression. Supporting this observation, we found that ECJUK induced the expression of Nrf2, hemoxygenase-1, and NAD(P)H:quinone oxidoreductase-1 and this event was correlated with Akt1 phosphorylation. We also found that ECJUK increased the intracellular reduced glutathione level and suppressed 12-O-tetradecanoylphorbol acetate-induced 8-hydroxyguanosine formation without affecting the overall viability. Collectively, our results provide evidence that ECJUK can protect against oxidative stress-mediated damages through the activation of Nrf2/ARE-dependent phase II cytoprotective gene expression. PMID:27051652

  9. Nrf2 Knockout Attenuates the Anti-Inflammatory Effects of Phenethyl Isothiocyanate and Curcumin

    PubMed Central

    2015-01-01

    The role of phytochemicals in preventive and therapeutic medicine is a major area of scientific research. Several studies have illustrated the mechanistic roles of phytochemicals in Nrf2 transcriptional activation. The present study aims to examine the importance of the transcription factor Nrf2 by treating peritoneal macrophages from Nrf2+/+ and Nrf2–/– mice ex vivo with phenethyl isothiocyanate (PEITC) and curcumin (CUR). The peritoneal macrophages were pretreated with the drugs and challenged with lipopolysaccharides (LPSs) alone and in combination with PEITC or CUR to assess their anti-inflammatory and antioxidative effects based on gene and protein expression in the treated cells. LPS treatment resulted in an increase in the expression of inflammatory markers such as cycloxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) in both Nrf2+/+ and Nrf2–/– macrophages, detected by quantitative polymerase chain reaction (qPCR). Nrf2+/+ macrophages treated with PEITC and CUR exhibited a significant decrease in the expression of these anti-inflammatory genes along with an increase in the expression of hemeoxygenase-1 (HO-1), which is an antioxidative stress gene downstream of the Nrf2 transcription factor battery. Although there was no significant decrease in the expression of the anti-inflammatory genes or an increase in HO-1 expression in Nrf2–/– macrophages treated with either PEITC or CUR, there was a significant decrease in the protein expression of COX-2 and an increase in the expression of HO-1 in Nrf2+/+ macrophages treated with PEITC compared to that with CUR treatment. No significant changes were observed in the macrophages from knockout animals. Additionally, there was a significant decrease in LPS-induced IL-6 and TNF-α production following PEITC treatment compared with that following CUR in Nrf2+/+ macrophages, whereas no change was observed in the macrophages from knockout

  10. Identification of novel NRF2-regulated genes by ChIP-Seq: influence on retinoid X receptor alpha

    PubMed Central

    Chorley, Brian N.; Campbell, Michelle R.; Wang, Xuting; Karaca, Mehmet; Sambandan, Deepa; Bangura, Fatu; Xue, Peng; Pi, Jingbo; Kleeberger, Steven R.; Bell, Douglas A.

    2012-01-01

    Cellular oxidative and electrophilic stress triggers a protective response in mammals regulated by NRF2 (nuclear factor (erythroid-derived) 2-like; NFE2L2) binding to deoxyribonucleic acid-regulatory sequences near stress-responsive genes. Studies using Nrf2-deficient mice suggest that hundreds of genes may be regulated by NRF2. To identify human NRF2-regulated genes, we conducted chromatin immunoprecipitation (ChIP)-sequencing experiments in lymphoid cells treated with the dietary isothiocyanate, sulforaphane (SFN) and carried out follow-up biological experiments on candidates. We found 242 high confidence, NRF2-bound genomic regions and 96% of these regions contained NRF2-regulatory sequence motifs. The majority of binding sites were near potential novel members of the NRF2 pathway. Validation of selected candidate genes using parallel ChIP techniques and in NRF2-silenced cell lines indicated that the expression of about two-thirds of the candidates are likely to be directly NRF2-dependent including retinoid X receptor alpha (RXRA). NRF2 regulation of RXRA has implications for response to retinoid treatments and adipogenesis. In mouse, 3T3-L1 cells’ SFN treatment affected Rxra expression early in adipogenesis, and knockdown of Nrf2-delayed Rxra expression, both leading to impaired adipogenesis. PMID:22581777

  11. Epigallocatechin-3-gallate prevents oxidative stress-induced cellular senescence in human mesenchymal stem cells via Nrf2

    PubMed Central

    Shin, Joo-Hyun; Jeon, Hyo-Jin; Park, Jihye; Chang, Mi-Sook

    2016-01-01

    Human mesenchymal stem cells (hMSCs) have great therapeutic potential due to their high plasticity, immune privileged status and ease of preparation, as well as a lack of ethical barriers to their use. However, their ultimate usefulness is limited by cellular senescence occurring secondary to increased cellular levels of reactive oxygen species (ROS) during their propagation in culture. The underlying molecular mechanisms responsible for this process in hMSCs remain unclear. An antioxidant polyphenol epigallocatechin-3-gallate (EGCG) found in green tea, is known to activate nuclear factor-erythroid 2-related factor 2 (Nrf2), a master transcriptional regulator of antioxidant genes. Herein, we examined the EGCG-mediated antioxidant mechanism in hMSCs exposed to ROS which involves Nrf2 activation. The H2O2-exposed hMSCs showed cellular senescence with significantly increased protein levels of acetyl-p53 and p21 in comparison with the untreated hMSCs, and these effects were prevented by pre-treatment with EGCG. By contrast, in Nrf2-knockdown hMSCs, EGCG lost its antioxidant effect, exhibiting high levels of acetyl-p53 and p21 following EGCG pre-treatment and H2O2 exposure. This indicates that Nrf2 and p53/p21 may be involved in the anti-senescent effect of EGCG in hMSCs. Taken together, these findings indicate the important role of EGCG in preventing oxidative stress-induced cellular senescence in hMSCs through Nrf2 activation, which has applications for the massive production of more suitable hMSCs for cell-based therapy. PMID:27498709

  12. Protective Effect of Thymoquinone against Cyclophosphamide-Induced Hemorrhagic Cystitis through Inhibiting DNA Damage and Upregulation of Nrf2 Expression.

    PubMed

    Gore, Prashant R; Prajapati, Chaitali P; Mahajan, Umesh B; Goyal, Sameer N; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R

    2016-01-01

    Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues. PMID:27489498

  13. Reduction of DNA damage induced by titanium dioxide nanoparticles through Nrf2 in vitro and in vivo.

    PubMed

    Shi, Zhiqin; Niu, Yujie; Wang, Qian; Shi, Lei; Guo, Huicai; Liu, Yi; Zhu, Yue; Liu, Shufeng; Liu, Chao; Chen, Xin; Zhang, Rong

    2015-11-15

    Titanium dioxide nanoparticles (Nano-TiO2) are widely used to additives in cosmetics, pharmaceutical, paints and foods. Recent studies have demonstrated that Nano-TiO2 induces DNA damage and increased the risk of cancer and the mechanism might relate with oxidative stress. The aim of this study was to evaluate the effects of Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), an anti-oxidative mediator, on DNA damage induced by Nano-TiO2. Wildtype, Nrf2 knockout (Nrf2(-/-)) and tert-butylhydroquinone (tBHQ) pre-treated HepG2 cells and mice were treated with Nano-TiO2. And then the oxidative stress and DNA damage were evaluated. Our data showed that DNA damage, reactive oxygen species (ROS) generation and MDA content in Nano-TiO2 exposed cells were significantly increased than those of control in dose dependent manners. Nrf2/ARE droved the downstream genes including NAD(P)H dehydrogenase [quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC) expression were significantly higher in wildtype HepG2 cells after Nano-TiO2 treatment. After treatment with Nano-TiO2, the DNA damages were significantly increased in Nrf(-/-) cells and mice whereas significantly decreased in tBHQ pre-treatment cells and mice, compared with the wildtype HepG2 cells and mice, respectively. Our results indicated that the acquired of Nrf2 leads to a decreased susceptibility to DNA damages induction by Nano-TiO2 and decreasing of risk of cancer which would provide a strategy for a more efficacious sensitization of against of Nano-TiO2 toxication.

  14. Protective Effect of Thymoquinone against Cyclophosphamide-Induced Hemorrhagic Cystitis through Inhibiting DNA Damage and Upregulation of Nrf2 Expression

    PubMed Central

    Gore, Prashant R.; Prajapati, Chaitali P.; Mahajan, Umesh B.; Goyal, Sameer N.; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R.

    2016-01-01

    Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues. PMID:27489498

  15. Epigallocatechin-3-gallate prevents oxidative stress-induced cellular senescence in human mesenchymal stem cells via Nrf2.

    PubMed

    Shin, Joo-Hyun; Jeon, Hyo-Jin; Park, Jihye; Chang, Mi-Sook

    2016-10-01

    Human mesenchymal stem cells (hMSCs) have great therapeutic potential due to their high plasticity, immune privileged status and ease of preparation, as well as a lack of ethical barriers to their use. However, their ultimate usefulness is limited by cellular senescence occurring secondary to increased cellular levels of reactive oxygen species (ROS) during their propagation in culture. The underlying molecular mechanisms responsible for this process in hMSCs remain unclear. An antioxidant polyphenol epigallocatechin-3-gallate (EGCG) found in green tea, is known to activate nuclear factor-erythroid 2-related factor 2 (Nrf2), a master transcriptional regulator of antioxidant genes. Herein, we examined the EGCG-mediated antioxidant mechanism in hMSCs exposed to ROS which involves Nrf2 activation. The H2O2-exposed hMSCs showed cellular senescence with significantly increased protein levels of acetyl-p53 and p21 in comparison with the untreated hMSCs, and these effects were prevented by pre-treatment with EGCG. By contrast, in Nrf2-knockdown hMSCs, EGCG lost its antioxidant effect, exhibiting high levels of acetyl-p53 and p21 following EGCG pre-treatment and H2O2 exposure. This indicates that Nrf2 and p53/p21 may be involved in the anti‑senescent effect of EGCG in hMSCs. Taken together, these findings indicate the important role of EGCG in preventing oxidative stress-induced cellular senescence in hMSCs through Nrf2 activation, which has applications for the massive production of more suitable hMSCs for cell-based therapy. PMID:27498709

  16. Genetic or Pharmacologic Activation of Nrf2 Signaling Fails to Protect Against Aflatoxin Genotoxicity in Hypersensitive GSTA3 Knockout Mice

    PubMed Central

    Kensler, Kevin H.; Slocum, Stephen L.; Chartoumpekis, Dionysios V.; Dolan, Patrick M.; Johnson, Natalie M.; Ilic, Zoran; Crawford, Dana R.; Sell, Stewart; Groopman, John D.; Kensler, Thomas W.; Egner, Patricia A.

    2014-01-01

    Mice are resistant to aflatoxin hepatotoxicity, primarily due to high expression of glutathione S-transferases (GSTs), and in particular the GSTA3 subunit. Nuclear factor erythroid 2 related factor 2 (Nrf2) signaling, which controls a broad-based cytoprotective response, was activated either genetically or pharmacologically in an attempt to rescue GSTA3 knockout mice from aflatoxin genotoxicity. Genetic activation of Nrf2 signaling was attained in a GSTA3: hepatocyte-specific Keap1 double knockout (DKO) mouse whereas pharmacologic activation of Nrf2 was achieved through pretreatment of mice with the triterpenoid 1-[2-cyano-3-,12-dioxoleana-1,9(11)-dien-28-oyl] imidazole (CDDO-Im) prior to aflatoxin B1 exposure. Following oral treatment with aflatoxin, urine was collected from mice for 24 h and hepatic and urinary aflatoxin metabolites then quantified using isotope dilution-mass spectrometry. Although Nrf2 was successfully activated genetically and pharmacologically, neither means affected the response of GSTA3 knockout mice to chemical insult with aflatoxin. Hepatic aflatoxin B1-N7-guanine levels were elevated 120-fold in GSTA3 knockout mice compared with wild-type and levels were not attenuated by the interventions. This lack of effect was mirrored in the urinary excretion of aflatoxin B1-N7-guanine. By contrast, urinary excretion of aflatoxin B1-N-acetylcysteine was >200-fold higher in wild-type mice compared with the single GSTA3 knockout or DKO mouse. The inability to rescue GSTA3 knockout mice from aflatoxin genotoxicity through the Nrf2 transcriptional program indicates that Gsta3 is unilaterally responsible for the detoxication of aflatoxin in mice. PMID:24675090

  17. Adiponectin ameliorates hyperglycemia-induced cardiac hypertrophy and dysfunction by concomitantly activating Nrf2 and Brg1.

    PubMed

    Li, Haobo; Yao, Weifeng; Irwin, Michael G; Wang, Tingting; Wang, Shuang; Zhang, Liangqing; Xia, Zhengyuan

    2015-07-01

    Hyperglycemia-induced oxidative stress is implicated in the development of cardiomyopathy in diabetes that is associated with reduced adiponectin (APN) and heme oxygenase-1 (HO-1). Brahma-related gene 1 (Brg1) assists nuclear factor-erythroid-2-related factor-2 (Nrf2) to activate HO-1 to increase myocardial antioxidant capacity in response to oxidative stress. We hypothesized that reduced adiponectin (APN) impairs HO-1 induction which contributes to the development of diabetic cardiomyopathy, and that supplementation of APN may ameliorate diabetic cardiomyopathy by activating HO-1 through Nrf2 and Brg1 in diabetes. Control (C) and streptozotocin-induced diabetic (D) rats were untreated or treated with APN adenovirus (1×10(9) pfu) 3 weeks after diabetes induction and examined and terminated 1 week afterward. Rat left ventricular functions were assessed by a pressure-volume conductance system, before the rat hearts were removed to perform histological and biochemical assays. Four weeks after diabetes induction, D rats developed cardiac hypertrophy evidenced as increased ratio of heart weight to body weight, elevated myocardial collagen I content, and larger cardiomyocyte cross-sectional area (all P<0.05 vs C). Diabetes elevated cardiac oxidative stress (increased 15-F2t-isoprostane, 4-hydroxynonenal generation, 8-hydroxy-2'-deoxyguanosine, and superoxide anion generation), increased myocardial apoptosis, and impaired cardiac function (all P<0.05 vs C). In D rats, myocardial HO-1 mRNA and protein expression were reduced which was associated with reduced Brg1 and nuclear Nrf2 protein expression. All these changes were either attenuated or prevented by APN. In primarily cultured cardiomyocytes (CMs) isolated from D rats or in the embryonic rat cardiomyocytes cell line H9C2 cells incubated with high glucose (HG, 25 mM), supplementation of recombined globular APN (gAd, 2μg/mL) reversed HG-induced reductions of HO-1, Brg1, and nuclear Nrf2 protein expression and

  18. Ethanol Extract of Ganoderma lucidum Augments Cellular Anti-oxidant Defense through Activation of Nrf2/HO-1

    PubMed Central

    Lee, Yoo-hwan; Kim, Jung-hee; Song, Choon-ho; Jang, Kyung-jeon; kim, Cheol-hong; Kang, Ji- Sook; Choi, Yung-hyun

    2016-01-01

    Objectives: The mushroom Ganoderma lucidum has been widely used as a traditional herbal medicine for many years. Although several studies have focused on the anti-oxidative activity of this mushroom, the molecular mechanisms underlying its activity have not yet been clearly established. The present study investigated the cytoprotective effect of ethanol extract of Ganoderma lucidum (EGL) against oxidative stress (hydrogen peroxide, H2O2) and elucidated the underlying mechanisms in a C2C12 myoblast cell line. Methods: Oxidative stress markers were determined by using the comet assay to measure reactive oxygen species (ROS) generation and deoxyribonucleic acid (DNA) damage. Cell viability and Western blotting analyses were employed to evaluate the cellular response to EGL and H2O2 in C2C12 cells. Transfection with nuclear factor erythroid 2-related factor 2 (Nrf2)-specific small interfering ribonucleic acid (siRNA) was conducted to understand the relationship between Nrf2 expression and H2O2-induced growth inhibition. Results: The results showed that EGL effectively inhibited H2O2-induced growth and the generation of ROS. EGL markedly suppressed H2O2-induced comet-like DNA formation and phosphorylation of histone H2AX at serine 139 (p-γH2AX), a widely used marker of DNA damage, suggesting that EGL prevented H2O2-induced DNA damage. Furthermore, the EGL treatment effectively induced the expression of Nrf2, as well as heme oxygenase-1 (HO-1), with parallel phosphorylation and nuclear translocation of Nrf2 in the C2C12 myoblasts. However, zinc protoporphyrin IX, a HO-1 inhibitor, significantly abolished the protective effects of EGL against H2O2-induced accumulation of ROS and reduced cell growth. Notably, transient transfection with Nrf2-specific siRNA attenuated the cytoprotective effects and HO-1 induction by EGL, indicating that EGL induced the expression of HO-1 in an Nrf2-dependent manner. Conclusion: Collectively, these results demonstrate that EGL augments the

  19. Supplementation of a grape seed and grape marc meal extract decreases activities of the oxidative stress-responsive transcription factors NF-κB and Nrf2 in the duodenal mucosa of pigs

    PubMed Central

    2013-01-01

    Background In pigs, enteric infections and the development of gut disorders such as diarrhoea are commonly observed, particularly after weaning. The present study investigated the hypothesis that feeding a grape seed and grape marc extract (GSGME) as a dietary supplement has the potential to suppress the inflammatory process in the small intestine of pigs by modulating the activities of NF-κB and Nrf2 due to its high content of flavonoids. Methods Twenty-four crossbred, 6 weeks old pigs were randomly assigned to 2 groups of 12 animals each and fed nutritionally adequate diets without or with 1% GSGME for 4 weeks. Results Pigs administered GSGME had a lower transactivation of NF-κB and Nrf2 and a lower expression of various target genes of these transcription factors in the duodenal mucosa than control pigs (P < 0.05). Concentrations of α-tocopherol and thiobarbituric acid reactive substances (TBARS) in liver and plasma and total antioxidant capacity of plasma and relative mRNA abundances of NF-κB and Nrf2 target genes in the liver did not differ between the two groups. However, the ratio of villus height:crypt depth and the gain:feed ratio was higher in the pigs fed GSGME than in control pigs (P < 0.05). Conclusions This study shows that dietary supplementation of a polyphenol rich GSGME suppresses the activity of NF-κB in the duodenal mucosa of pigs and thus might provide a useful dietary strategy to inhibit inflammation in the gut frequently occurring in pigs. Feeding GSGME did not influence vitamin E status and the antioxidant system of the pigs but improved the gain:feed ratio. In overall, the study suggests that polyphenol-rich plant extracts such GSGME could be useful feed supplements in pig nutrition, in order to maintain animal health and improve performance. PMID:23453040

  20. Exogenous phospholipids supplementation improves growth and modulates immune response and physical barrier referring to NF-κB, TOR, MLCK and Nrf2 signaling factors in the intestine of juvenile grass carp (Ctenopharyngodon idella).

    PubMed

    Chen, Yong-Po; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Wu, Pei; Zhao, Juan; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu; Feng, Lin

    2015-11-01

    This study was conducted to investigate the effects of dietary phospholipids (PL) on the growth performance, intestinal enzyme activity and immune response and intestinal physical barrier of juvenile grass carp (Ctenopharyngodon idella). A total of 1080 juvenile grass carp with an average initial weight of 9.34 ± 0.03 g were fed six semi-purified diets containing 0.40% (unsupplemented control group), 1.43%, 2.38%, 3.29%, 4.37% and 5.42% PL for 2 months. Results indicated that 3.29% PL increased lysozyme (LZ) and acid phosphatase (ACP) activities and complement component 3 (C3) content (P < 0.05), up-regulated the mRNA relative expression levels of interleukin 10, transforming growth factor β1 (TGF-β1), inhibitor protein κBα (IκBα), target of rapamycin (TOR) and casein kinase 2 (CK2) (P < 0.05), and down-regulated tumor necrosis factor α (TNF-α), interleukin 1β, nuclear factor κB p65 (NF-κB p65), IκB kinase β (IKKβ) and IκB kinase γ (IKKγ) mRNA relative expression levels (P < 0.05) in the intestine, suggesting that optimum PL could improve fish intestinal immunity. In addition, 3.29% PL increased the activities of anti-superoxide anion (ASA), anti-hydroxyl radical, copper/zinc superoxide dismutase (SOD1), glutathione peroxidase (GPx) and glutathione reductase (GR), the content of glutathione (P < 0.05), and the mRNA relative expression levels of occludin, zonula occludens 1 (ZO-1), claudin 3, claudin 12, claudin b, claudin c, SOD1, GPx, GR and NF-E2-related factor 2 (Nrf2) and decreased malondialdehyde (MDA), protein carbonyl (PC) and ROS content (P < 0.05), the mRNA relative expression levels of Kelch-like-ECH-associated protein 1a (Keap1a), myosin light chain kinase (MLCK) and p38 mitogen-activated protein kinase (p38 MAPK) in the intestine, indicating that the optimum PL could improve fish intestinal physical barrier. Finally, based on the PWG, C3 content in the DI, ACP activity in the DI, intestinal PC content and intestinal ASA activity, the

  1. Role of Nrf2 in Oxidative Stress and Toxicity

    PubMed Central

    Ma, Qiang

    2015-01-01

    Organismal life encounters reactive oxidants from internal metabolism and environmental toxicant exposure. Reactive oxygen and nitrogen species cause oxidative stress and are traditionally viewed as being harmful. On the other hand, controlled production of oxidants in normal cells serves useful purposes to regulate signaling pathways. Reactive oxidants are counterbalanced by complex antioxidant defense systems regulated by a web of pathways to ensure that the response to oxidants is adequate for the body’s needs. A recurrent theme in oxidant signaling and antioxidant defense is reactive cysteine thiol–based redox signaling. The nuclear factor erythroid 2–related factor 2 (Nrf2) is an emerging regulator of cellular resistance to oxidants. Nrf2 controls the basal and induced expression of an array of antioxidant response element–dependent genes to regulate the physiological and pathophysiological outcomes of oxidant exposure. This review discusses the impact of Nrf2 on oxidative stress and toxicity and how Nrf2 senses oxidants and regulates antioxidant defense. PMID:23294312

  2. Nrf2 protects against As(III)-induced damage in mouse liver and bladder.

    PubMed

    Jiang, Tao; Huang, Zheping; Chan, Jefferson Y; Zhang, Donna D

    2009-10-01

    Arsenic compounds are classified as toxicants and human carcinogens. Environmental exposure to arsenic imposes a big health issue worldwide. Arsenic elicits its toxic efforts through many mechanisms, including generation of reactive oxygen species (ROS). Nrf2 is the primary transcription factor that controls expression of a main cellular antioxidant response, which is required for neutralizing ROS and thus defending cells from exogenous insults. Previously, we demonstrated a protective role of Nrf2 against arsenic-induced toxicity using a cell culture model. In this report, we present evidence that Nrf2 protects against liver and bladder injury in response to six weeks of arsenic exposure in a mouse model. Nrf2(-/-) mice displayed more severe pathological changes in the liver and bladder, compared to Nrf2(+/+) mice. Furthermore, Nrf2(-/-) mice were more sensitive to arsenic-induced DNA hypomethylation, oxidative DNA damage, and apoptotic cell death. These results indicate a protective role of Nrf2 against arsenic toxicity in vivo. Hence, this work demonstrates the feasibility of using dietary compounds that target activation of the Nrf2 signaling pathway to alleviate arsenic-induced damage. PMID:19538980

  3. Nrf2 protects against As(III)-induced damage in mouse liver and bladder

    SciTech Connect

    Jiang Tao; Huang Zheping; Chan, Jefferson Y.; Zhang, Donna D.

    2009-10-01

    Arsenic compounds are classified as toxicants and human carcinogens. Environmental exposure to arsenic imposes a big health issue worldwide. Arsenic elicits its toxic efforts through many mechanisms, including generation of reactive oxygen species (ROS). Nrf2 is the primary transcription factor that controls expression of a main cellular antioxidant response, which is required for neutralizing ROS and thus defending cells from exogenous insults. Previously, we demonstrated a protective role of Nrf2 against arsenic-induced toxicity using a cell culture model. In this report, we present evidence that Nrf2 protects against liver and bladder injury in response to six weeks of arsenic exposure in a mouse model. Nrf2{sup -/-} mice displayed more severe pathological changes in the liver and bladder, compared to Nrf2{sup +/+} mice. Furthermore, Nrf2{sup -/-} mice were more sensitive to arsenic-induced DNA hypomethylation, oxidative DNA damage, and apoptotic cell death. These results indicate a protective role of Nrf2 against arsenic toxicity in vivo. Hence, this work demonstrates the feasibility of using dietary compounds that target activation of the Nrf2 signaling pathway to alleviate arsenic-induced damage.

  4. Nrf2 protects against As(III)-induced damage in mouse liver and bladder.

    PubMed

    Jiang, Tao; Huang, Zheping; Chan, Jefferson Y; Zhang, Donna D

    2009-10-01

    Arsenic compounds are classified as toxicants and human carcinogens. Environmental exposure to arsenic imposes a big health issue worldwide. Arsenic elicits its toxic efforts through many mechanisms, including generation of reactive oxygen species (ROS). Nrf2 is the primary transcription factor that controls expression of a main cellular antioxidant response, which is required for neutralizing ROS and thus defending cells from exogenous insults. Previously, we demonstrated a protective role of Nrf2 against arsenic-induced toxicity using a cell culture model. In this report, we present evidence that Nrf2 protects against liver and bladder injury in response to six weeks of arsenic exposure in a mouse model. Nrf2(-/-) mice displayed more severe pathological changes in the liver and bladder, compared to Nrf2(+/+) mice. Furthermore, Nrf2(-/-) mice were more sensitive to arsenic-induced DNA hypomethylation, oxidative DNA damage, and apoptotic cell death. These results indicate a protective role of Nrf2 against arsenic toxicity in vivo. Hence, this work demonstrates the feasibility of using dietary compounds that target activation of the Nrf2 signaling pathway to alleviate arsenic-induced damage.

  5. A novel Nrf2-miR-29-desmocollin-2 axis regulates desmosome function in keratinocytes.

    PubMed

    Kurinna, Svitlana; Schäfer, Matthias; Ostano, Paola; Karouzakis, Emmanuel; Chiorino, Giovanna; Bloch, Wilhelm; Bachmann, Andreas; Gay, Steffen; Garrod, David; Lefort, Karine; Dotto, Gian-Paolo; Beer, Hans-Dietmar; Werner, Sabine

    2014-01-01

    The Nrf2 transcription factor controls the expression of genes involved in the antioxidant defense system. Here, we identified Nrf2 as a novel regulator of desmosomes in the epidermis through the regulation of microRNAs. On Nrf2 activation, expression of miR-29a and miR-29b increases in cultured human keratinocytes and in mouse epidermis. Chromatin immunoprecipitation identified the Mir29ab1 and Mir29b2c genes as direct Nrf2 targets in keratinocytes. While binding of Nrf2 to the Mir29ab1 gene activates expression of miR-29a and -b, the Mir29b2c gene is silenced by DNA methylation. We identified desmocollin-2 (Dsc2) as a major target of Nrf2-induced miR-29s. This is functionally important, since Nrf2 activation in keratinocytes of transgenic mice causes structural alterations of epidermal desmosomes. Furthermore, the overexpression of miR-29a/b or knockdown of Dsc2 impairs the formation of hyper-adhesive desmosomes in keratinocytes, whereas Dsc2 overexpression has the opposite effect. These results demonstrate that a novel Nrf2-miR-29-Dsc2 axis controls desmosome function and cutaneous homeostasis. PMID:25283360

  6. Different Susceptibility to the Parkinson's Toxin MPTP in Mice Lacking the Redox Master Regulator Nrf2 or Its Target Gene Heme Oxygenase-1

    PubMed Central

    Innamorato, Nadia G.; Jazwa, Agnieszka; Rojo, Ana I.; García, Concepción; Fernández-Ruiz, Javier; Grochot–Przeczek, Anna; Stachurska, Anna; Jozkowicz, Alicja; Dulak, Jozef; Cuadrado, Antonio

    2010-01-01

    Background The transcription factor Nrf2 (NF-E2-related factor 2) and its target gene products, including heme oxygenase-1 (HO-1), elicit an antioxidant response that may have therapeutic value for Parkinson's disease (PD). However, HO-1 protein levels are increased in dopaminergic neurons of Parkinson's disease (PD) patients, suggesting its participation in free-iron deposition, oxidative stress and neurotoxicity. Before targeting Nrf2 for PD therapy it is imperative to determine if HO-1 is neurotoxic or neuroprotective in the basal ganglia. Methodology We addressed this question by comparing neuronal damage and gliosis in Nrf2- or HO-1-knockout mice submitted to intraperitoneal injection of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) for five consecutive days. Nrf2-knockout mice showed exacerbated gliosis and dopaminergic nigrostriatal degeneration, as determined by immunohistochemical staining of tyrosine hydroxylase in striatum (STR) and substantia nigra (SN) and by HPLC determination of striatal dopamine and 3,4- dihydroxyphenylacetic acid (DOPAC). On the other hand, the severity of gliosis and dopaminergic degeneration in HO-1-null mice was neither increased nor reduced. Regarding free-iron deposition, both Nrf2- and HO-1-deficient mice exhibited similar number of deposits as determined by Perl's staining, therefore indicating that these proteins do not contribute significantly to iron accumulation or clearance in MPTP-induced Parkinsonism. Conclusions These results suggest that HO-1 does not protect or enhance the sensitivity to neuronal death in Parkinson's disease and that pharmacological or genetic intervention on Nrf2 may provide a neuroprotective benefit as add on therapy with current symptomatic protocols. PMID:20676377

  7. Nrf2-mediated haeme oxygenase-1 up-regulation induced by cobalt protoporphyrin has antinociceptive effects against inflammatory pain in the formalin test in mice.

    PubMed

    Rosa, Angelo O; Egea, Javier; Lorrio, Silvia; Rojo, Ana I; Cuadrado, Antonio; López, Manuela G

    2008-07-15

    This study investigated the effect of haeme oxygenase-1 (HO-1) in nociception induced by formalin injection in the mice hind paw. Intraperitoneal (i.p.) administration of cobalt protoporphyrin (CoPP, an HO-1 inducer, 5mg/kg) 24h before the test, inhibited the nociceptive response during the second phase, but not during the first phase of the formalin test. The effect of CoPP was prevented by treatment with tin protoporphyrin (SnPP, an inhibitor of HO-1 activity) administered either by i.p. (25mg/kg, 30 min before the test) or intraplantar (400 nmol/paw, 5 min before the test) routes. Human embryonic kidney (HEK) 293T cells treated with 10 microM CoPP expressed 20-fold higher HO-1 levels when compared to controls; this effect was suppressed by transfection with the dominant negative for the nuclear factor-erythroid 2-related factor 2 (Nrf2). Western blot analysis also revealed that CoPP treatment induced a similar 20-fold increase in HO-1 expression in the paw; this effect was attenuated in knockout mice for Nrf2. CoPP treatment of wild-type, but not in Nrf2 knockout mice, resulted in a striking increase of HO-1 stained cells surrounding the muscular tissues of the hind limbs. HO-1 positive cells were scarce in wild-type and in Nrf2 knockout untreated mice. CoPP-induced HO-1 expression in Nrf2 knockout mice was lost and correlated with the loss of antinociceptive effects. In conclusion, Nrf2-mediated HO-1 expression induced an antinociceptive effect at peripheral sites. These results suggest that HO-1 modulates the inflammatory pain pathways. Hence, the development of drugs that could raise peripheral HO-1 could be relevant in inflammatory pain treatment.

  8. Sustained NRF2 activation in hereditary leiomyomatosis and renal cell cancer (HLRCC) and in hereditary tyrosinemia type 1 (HT1).

    PubMed

    Sandhu, Ivraj Singh; Maksim, Nicholas James; Amouzougan, Eva Alice; Gallion, Bryce Wilson; Raviele, Anthony L J; Ooi, Aikseng

    2015-08-01

    The nuclear erythroid 2-like 2 transcription factor (NRF2), is a major regulator of cellular redox balance. Although NRF2 activation is generally regarded as beneficial to human health, recent studies have identified that sustained NRF2 activation is over-represented in many cancers. This raises the question regarding the role of NRF2 activation in the development and progression of those cancers. This review focuses on the mechanisms and the effects of NRF2 activation in two hereditary cancer predisposition syndromes: hereditary leiomyomatosis and renal cell cancer (HLRCC) and hereditary tyrosinemia type 1 (HT1). Because the cancer initiating mutations in these hereditary syndromes are well defined, they offer a unique opportunity to explore the roles of NRF2 activation in the early stages of carcinogenesis. Over the years, a variety of approaches have been utilized to study the biology of HLRCC and HT1. In HLRCC, in vitro studies have demonstrated the importance of NRF2 activation in sustaining cancer cell proliferation. In the mouse model of HT1 however, NRF2 activation seems to protect cells from malignant transformation. In both HT1 and HLRCC, NRF2 activation promotes the clearance of electrophilic metabolites, enabling cells to survive cancer-initiating mutations. Biological insights gained from the hereditary syndromes' studies may shed light on to the roles of NRF2 activation in sporadic tumours.

  9. Dietary myo-inositol modulates immunity through antioxidant activity and the Nrf2 and E2F4/cyclin signalling factors in the head kidney and spleen following infection of juvenile fish with Aeromonas hydrophila.

    PubMed

    Jiang, Wei-Dan; Hu, Kai; Liu, Yang; Jiang, Jun; Wu, Pei; Zhao, Juan; Zhang, Yong-An; Zhou, Xiao-Qiu; Feng, Lin

    2016-02-01

    This study was conducted to investigate the effects of the dietary vitamin myo-inositol (MI), on the immunity and structural integrity of the head kidney and spleen following infection of fish with the major freshwater pathogen bacterial Aeromonas hydrophila. The results demonstrated for the first time that MI deficiency depressed the lysozyme and acid phosphatase (ACP) activities and the complement 3 (C3) and C4 contents in the head kidney and spleen compared with the optimal MI levels, indicating that MI deficiency decreased the immunity of these important fish immune organs. The depression in immunity due to MI deficiency was partially related to oxidative damage [indicated by increases in the malondialdehyde (MDA) and protein carbonyl (PC) contents] that was in turn partially due to the decreased glutathione (GSH) content and the disturbances in antioxidant enzyme activities [total superoxide dismutase (T-SOD), CuZnSOD, MnSOD, catalase (CAT), glutathione peroxidase (GPx) and glutathione reductase (GR)]. MI deficiency inhibited the antioxidant-related gene transcription [CuZnSOD, MnSOD, CAT, GPx1a, GR and NF-E2-related factor 2 (Nrf2)] in the head kidney and spleen following infection of the fish with A. hydrophila. The oxidative damage due to MI deficiency also resulted in the inhibition of proliferation-associated signalling (cyclin D1, cyclin A, cyclin E and E2F4). Thus, MI deficiency partially inhibited damage repair. Excessive MI exhibited negative effects that were similar to MI deficiency, whereas the optimal MI content reversed those indicators. These observations indicated that an MI deficiency or excess could cause depression of the immune system that might be partially related to oxidative damage, antioxidant disturbances, and the inhibition of the proliferation-associated signalling in the head kidney and spleen following infection of fish with A. hydrophila. Finally, the optimal MI levels were 660.7 (based on ACP) and 736.8 mg kg(-1) diet (based

  10. CDDO-Im protects from acetaminophen hepatotoxicity through induction of Nrf2-dependent genes

    SciTech Connect

    Reisman, Scott A.; Buckley, David B.; Tanaka, Yuji; Klaassen, Curtis D.

    2009-04-01

    CDDO-Im is a synthetic triterpenoid recently shown to induce cytoprotective genes through the Nrf2-Keap1 pathway, an important mechanism for the induction of cytoprotective genes in response to oxidative stress. Upon oxidative or electrophilic insult, the transcription factor Nrf2 translocates to the nucleus, heterodimerizes with small Maf proteins, and binds to antioxidant response elements (AREs) in the upstream promoter regions of various cytoprotective genes. To further elucidate the hepatoprotective effects of CDDO-Im, wild-type and Nrf2-null mice were pretreated with CDDO-Im (1 mg/kg, i.p.) or vehicle (DMSO), and then administered acetaminophen (500 mg/kg, i.p.). Pretreatment of wild-type mice with CDDO-Im reduced liver injury caused by acetaminophen. In contrast, hepatoprotection by CDDO-Im was not observed in Nrf2-null mice. CDDO-Im increased Nrf2 protein expression and Nrf2-ARE binding in wild-type, but not Nrf2-null mice. Furthermore, CDDO-Im increased the mRNA expression of the Nrf2 target genes NAD(P)H: quinone oxidoreductase-1 (Nqo1); glutamate-cysteine ligase, catalytic subunit (Gclc); and heme-oxygenase-1 (Ho-1), in both a dose- and time-dependent manner. Conversely, CDDO-Im did not induce Nqo1, Gclc, and Ho-1 mRNA expression in Nrf2-null mice. Collectively, the present study shows that CDDO-Im pretreatment induces Nrf2-dependent cytoprotective genes and protects the liver from acetaminophen-induced hepatic injury.

  11. Effects of that ATRA inhibits Nrf2-ARE pathway on glial cells activation after intracerebral hemorrhage

    PubMed Central

    Yin, Xiao-Ping; Zhou, Jun; Wu, Dan; Chen, Zhi-Ying; Bao, Bing

    2015-01-01

    Previous studies indicate that the Nrf2-ARE signaling pathway plays a neruo-protective role in glia cell, however, the mechanism was also elusive. This study aims to explore the inhibitive function of all-trans-retinoic (ATRA) on Nrf2-ARE pathway in intracerebral hemorrhage (ICH), and investigate the mechanism. In this study, the femoral artery injection method was employed to establish ICH model. The model rats were randomly divided into four groups, including Sham group, ICH group, ATRA group and DMSO group. The neurological scores were evaluated for the four groups at different time points. Hematoxylin-Eosin staining was used to stain the CD11b positive glia cells. Double immunofluorescence staining method was utilized to observe the co-expression of HO-1, NF-κB, Nrf2 and TNF-α and CD11b marker in glia cells. Western blot assay was used to detect the Nrf2 protein (total and binding Nrf2), HO-1, NF-κB and TNF-α proteins in every group. The results indicated that neurologiclal scores were significantly decreased in ATRA group compared to ICH gorup (P < 0.05). The glia cells were significantly activated and accumulated in ICH rats. ATRA significantly decreased co-expression of Nrf2, HO-1 and CD11b, and increased co-expression of NF-κB, TNF-α and CD11b of glia cells. ATRA significantly decreased total Nrf2 expression and increased binding Nrf2 expression in ATRA group compared to ICH group (P < 0.05). ATRA decreased anti-oxygen protein Nrf2 and HO-1, and increases inflammatory factors NF-κB and TNF-α. In conclusion, the application of ATRA could inhibit the neuro-protective function effectively by blocking the Nrf2-ARE pathway in glia cells. PMID:26617752

  12. CDDO-Im Protects from Acetaminophen Hepatotoxicity Through Induction of Nrf2-Dependent Genes

    PubMed Central

    Reisman, Scott A.; Buckley, David B.; Tanaka, Yuji; Klaassen, Curtis D.

    2009-01-01

    CDDO-Im is a synthetic triterpenoid recently shown to induce cytoprotective genes through the Nrf2-Keap1 pathway, an important mechanism for the induction of cytoprotective genes in response to oxidative stress. Upon oxidative or electrophilic insult, the transcription factor Nrf2 translocates to the nucleus, heterodimerizes with small Maf proteins, and binds to antioxidant response elements (AREs) in the upstream promoter regions of various cytoprotective genes. To further elucidate the hepatoprotective effects of CDDO-Im, wild-type and Nrf2-null mice were pretreated with CDDO-Im (1 mg/kg, i.p.) or vehicle (DMSO), and then administered acetaminophen (500 mg/kg, i.p.). Pretreatment of wild-type mice with CDDO-Im reduced liver injury caused by acetaminophen. In contrast, hepatoprotection by CDDO-Im was not observed in Nrf2-null mice. CDDO-Im increased Nrf2 protein expression and Nrf2-ARE binding in wild-type, but not Nrf2–null mice. Furthermore, CDDO-Im increased the mRNA expression of the Nrf2 target genes NAD(P)H: quinone oxidoreductase-1 (Nqo1); glutamate-cysteine ligase, catalytic subunit (Gclc); and heme-oxygenase-1 (Ho-1), in both a dose- and time-dependent manner. Conversely, CDDO-Im did not induce Nqo1, Gclc, and Ho-1 mRNA expression in Nrf2-null mice. Collectively, the present study shows that CDDO-Im pretreatment induces Nrf2-dependent cytoprotective genes and protects the liver from acetaminophen-induced hepatic injury. PMID:19371629

  13. Impact of Nrf2 on UVB-induced skin inflammation/photoprotection and photoprotective effect of sulforaphane.

    PubMed

    Saw, Constance L; Huang, Mou-Tuan; Liu, Yue; Khor, Tin Oo; Conney, Allan H; Kong, Ah-Ng

    2011-06-01

    Ultraviolet (UV) of sunlight is a complete carcinogen that can burn skin, enhance inflammation, and drive skin carcinogenesis. Previously, we have shown that sulforaphane (SFN) inhibited chemically induced skin carcinogenesis via nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and others have shown that broccoli sprout extracts containing high SFN protected against UV-induced skin carcinogenesis in SKH-1 hairless mice. A recent study showed that there was no difference between Nrf2 knockout (Nrf2 KO) and Nrf2 wild-type (WT) BALB/C mice after exposing to high dose of UVB. Since Nrf2 plays critical roles in the anti-oxidative stress/anti-inflammatory responses, it is relevant to assess the role of Nrf2 for photoprotection against UV. In this context, the role of Nrf2 in UVB-induced skin inflammation in Nrf2 WT and Nrf2 KO C57BL/6 mice was studied. A single dose of UVB (300 mJ/cm(2)) resulted in skin inflammation in both WT and Nrf2 KO (-/-) mice (KO mice) at 8 h and 8 d following UVB irradiation. In the WT mice inflammation returned to the basal level to a greater extent when compared to the KO mice. SFN treatment of Nrf2 WT but not Nrf2 KO mice restored the number of sunburn cells back to their basal level by 8 d after UVB irradiation. Additionally, UVB-induced short-term inflammatory biomarkers (interleukin-1β and interleukin-6) were increased in the KO mice and UVB-induced apoptotic cells in the KO mice were significantly higher as compared to that in the WT. Taken together, our results show that functional Nrf2 confers a protective effect against UVB-induced inflammation, sunburn reaction, and SFN-mediated photoprotective effects in the skin. PMID:21557329

  14. Impact of Nrf2 on UVB-induced skin inflammation/photoprotection and photoprotective effect of sulforaphane.

    PubMed

    Saw, Constance L; Huang, Mou-Tuan; Liu, Yue; Khor, Tin Oo; Conney, Allan H; Kong, Ah-Ng

    2011-06-01

    Ultraviolet (UV) of sunlight is a complete carcinogen that can burn skin, enhance inflammation, and drive skin carcinogenesis. Previously, we have shown that sulforaphane (SFN) inhibited chemically induced skin carcinogenesis via nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and others have shown that broccoli sprout extracts containing high SFN protected against UV-induced skin carcinogenesis in SKH-1 hairless mice. A recent study showed that there was no difference between Nrf2 knockout (Nrf2 KO) and Nrf2 wild-type (WT) BALB/C mice after exposing to high dose of UVB. Since Nrf2 plays critical roles in the anti-oxidative stress/anti-inflammatory responses, it is relevant to assess the role of Nrf2 for photoprotection against UV. In this context, the role of Nrf2 in UVB-induced skin inflammation in Nrf2 WT and Nrf2 KO C57BL/6 mice was studied. A single dose of UVB (300 mJ/cm(2)) resulted in skin inflammation in both WT and Nrf2 KO (-/-) mice (KO mice) at 8 h and 8 d following UVB irradiation. In the WT mice inflammation returned to the basal level to a greater extent when compared to the KO mice. SFN treatment of Nrf2 WT but not Nrf2 KO mice restored the number of sunburn cells back to their basal level by 8 d after UVB irradiation. Additionally, UVB-induced short-term inflammatory biomarkers (interleukin-1β and interleukin-6) were increased in the KO mice and UVB-induced apoptotic cells in the KO mice were significantly higher as compared to that in the WT. Taken together, our results show that functional Nrf2 confers a protective effect against UVB-induced inflammation, sunburn reaction, and SFN-mediated photoprotective effects in the skin.

  15. Role of Nrf2/ARE Pathway in Protective Effect of Electroacupuncture against Endotoxic Shock-Induced Acute Lung Injury in Rabbits

    PubMed Central

    Yu, Jian-bo; Shi, Jia; Gong, Li-rong; Dong, Shu-an; Xu, Yan; Zhang, Yuan; Cao, Xin-shun; Wu, Li-li

    2014-01-01

    NF-E2 related factor 2 (Nrf2) is a major transcription factor and acts as a key regulator of antioxidant genes to exogenous stimulations. The aim of current study was to determine whether Nrf2/ARE pathway is involved in the protective effect of electroacupuncture on the injured lung in a rabbit model of endotoxic shock. A dose of lipopolysaccharide (LPS) 5 mg/kg was administered intravenously to replicate the model of acute lung injury induced by endotoxic shock. Electroacupuncture pretreatment was handled bilaterally at Zusanli and Feishu acupoints for five consecutive days while sham electroacupuncture punctured at non-acupoints. Fourty anesthetized New England male rabbits were randomized into normal control group (group C), LPS group (group L), electroacupuncture + LPS group (group EL) and sham electroacupuncture + LPS (group SEL). At 6 h after LPS administration, the animals were sacrificed and the blood samples were collected for biochemical measurements. The lungs were removed for calculation of wet-to-dry weight ratios (W/D), histopathologic examination, determination of heme oxygenase (HO)-1 protein and mRNA, Nrf2 total and nucleoprotein, as well as Nrf2 mRNA expression, and evaluation of the intracellular distribution of Nrf2 nucleoprotein. LPS caused extensive morphologic lung damage, which was lessened by electroacupuncture treatment. Besides, lung W/D ratios were significantly decreased, the level of malondialdehyde was inhibited, plasma levels of TNF-α and interleukin-6 were decreased, while the activities of superoxide dismutase, glutathione peroxidase and catalase were enhanced in the electroacupucnture treated animals. In addition, electroacupuncture stimulation distinctly increased the expressions of HO-1 and Nrf2 protein including Nrf2 total protein and nucleoprotein as well as mRNA in lung tissue, while these effects were blunted in the sham electroacupuncture group. We concluded that electroacupuncture treatment at ST36 and BL13 effectively

  16. Regulation of Ahr signaling by Nrf2 during development: Effects of Nrf2a deficiency on PCB126 embryotoxicity in zebrafish (Danio rerio)

    PubMed Central

    Rousseau, Michelle E.; Sant, Karilyn E.; Borden, Linnea R.; Franks, Diana G.; Hahn, Mark E.; Timme-Laragy, Alicia R.

    2015-01-01

    The embryotoxicity of co-planar PCBs is regulated by the aryl hydrocarbon receptor (Ahr), and has been reported to involve oxidative stress. Ahr participates in crosstalk with another transcription factor, Nfe2l2, or Nrf2. Nrf2 binds to antioxidant response elements to regulate the adaptive response to oxidative stress. To explore aspects of the crosstalk between Nrf2 and Ahr and its impact on development, we used zebrafish (Danio rerio) with a mutated DNA binding domain in Nrf2a (nrf2afh318/fh318), rendering these embryos more sensitive to oxidative stress. Embryos were exposed to 2 nM or 5 nM PCB126 at 24 hours post fertilization (prim-5 stage of pharyngula) and examined for gene expression and morphology at 4 days post fertilization (dpf; protruding –mouth stage). Nrf2a mutant eleutheroembryos were more sensitive to PCB126 toxicity at 4 dpf, and in the absence of treatment also displayed some subtle developmental differences from wildtype embryos, including delayed inflation of the swim bladder and smaller yolk sacs. We used qPCR to measure changes in expression of the nrf gene family, keap1a, keap1b, the ahr gene family, and known target genes. cyp1a induction by PCB126 was enhanced in the Nrf2a mutants (156-fold in wildtypes vs. 228-fold in mutants exposed to 5 nM). Decreased expression of heme oxygenase (decycling) 1 (hmox1) in the Nrf2a mutants was accompanied by increased nrf2b expression. Target genes of Nrf2a and AhR2, NAD(P)H:quinone oxidoreductase 1 (nqo1) and glutathione S-transferase, alpha-like (gsta1), showed a 2-5-fold increase in expression in the Nrf2a mutants as compared to wildtype. This study elucidates the interaction between two important transcription factor pathways in the developmental toxicity of co-planar PCBs. PMID:26325326

  17. Chemical and biological mechanisms of phytochemical activation of Nrf2 and importance in disease prevention

    PubMed Central

    Eggler, Aimee L.; Savinov, Sergey N.

    2016-01-01

    Plants are an incredibly rich source of compounds that activate the Nrf2 transcription factor, leading to upregulation of a battery of cytoprotective genes. This perspective surveys established and proposed molecular mechanisms of Nrf2 activation by phytochemicals with a special emphasis on a common chemical property of Nrf2 activators: the ability as “soft” electrophiles to modify cellular thiols, either directly or as oxidized biotransformants. In addition, the role of reactive oxygen/nitrogen species as secondary messengers in Nrf2 activation is discussed. While the uniquely reactive C151 of Keap1, an Nrf2 repressor protein, is highlighted as a key target of cytoprotective phytochemicals, also reviewed are other stress-responsive proteins, including kinases, which play non-redundant roles in the activation of Nrf2 by plant-derived agents. Finally, the perspective presents two key factors accounting for the enhanced therapeutic windows of effective phytochemical activators of the Keap1–Nrf2 axis: enhanced selectivity toward sensor cysteines and reversibility of addition to thiolate molecules. PMID:26855455

  18. Stabilization of endogenous Nrf2 by minocycline protects against Nlrp3-inflammasome induced diabetic nephropathy

    PubMed Central

    Shahzad, Khurrum; Bock, Fabian; Al-Dabet, Moh’d Mohanad; Gadi, Ihsan; Nazir, Sumra; Wang, Hongjie; Kohli, Shrey; Ranjan, Satish; Mertens, Peter R.; Nawroth, Peter P.; Isermann, Berend

    2016-01-01

    While a plethora of studies support a therapeutic benefit of Nrf2 activation and ROS inhibition in diabetic nephropathy (dNP), the Nrf2 activator bardoxolone failed in clinical studies in type 2 diabetic patients due to cardiovascular side effects. Hence, alternative approaches to target Nrf2 are required. Intriguingly, the tetracycline antibiotic minocycline, which has been in clinical use for decades, has been shown to convey anti-inflammatory effects in diabetic patients and nephroprotection in rodent models of dNP. However, the mechanism underlying the nephroprotection remains unknown. Here we show that minocycline protects against dNP in mouse models of type 1 and type 2 diabetes, while caspase -3,-6,-7,-8 and -10 inhibition is insufficient, indicating a function of minocycline independent of apoptosis inhibition. Minocycline stabilizes endogenous Nrf2 in kidneys of db/db mice, thus dampening ROS-induced inflammasome activation in the kidney. Indeed, minocycline exerts antioxidant effects in vitro and in vivo, reducing glomerular markers of oxidative stress. Minocycline reduces ubiquitination of the redox-sensitive transcription factor Nrf2 and increases its protein levels. Accordingly, minocycline mediated Nlrp3 inflammasome inhibition and amelioration of dNP are abolished in diabetic Nrf2−/− mice. Taken together, we uncover a new function of minocycline, which stabilizes the redox-sensitive transcription factor Nrf2, thus protecting from dNP. PMID:27721446

  19. Activation of Nrf2 in keratinocytes causes chloracne (MADISH)-like skin disease in mice

    PubMed Central

    Schäfer, Matthias; Willrodt, Ann-Helen; Kurinna, Svitlana; Link, Andrea S; Farwanah, Hany; Geusau, Alexandra; Gruber, Florian; Sorg, Olivier; Huebner, Aaron J; Roop, Dennis R; Sandhoff, Konrad; Saurat, Jean-Hilaire; Tschachler, Erwin; Schneider, Marlon R; Langbein, Lutz; Bloch, Wilhelm; Beer, Hans-Dietmar; Werner, Sabine

    2014-01-01

    The transcription factor Nrf2 is a key regulator of the cellular stress response, and pharmacological Nrf2 activation is a promising strategy for skin protection and cancer prevention. We show here that prolonged Nrf2 activation in keratinocytes causes sebaceous gland enlargement and seborrhea in mice due to upregulation of the growth factor epigen, which we identified as a novel Nrf2 target. This was accompanied by thickening and hyperkeratosis of hair follicle infundibula. These abnormalities caused dilatation of infundibula, hair loss, and cyst development upon aging. Upregulation of epigen, secretory leukocyte peptidase inhibitor (Slpi), and small proline-rich protein 2d (Sprr2d) in hair follicles was identified as the likely cause of infundibular acanthosis, hyperkeratosis, and cyst formation. These alterations were highly reminiscent to the phenotype of chloracne/“metabolizing acquired dioxin-induced skin hamartomas” (MADISH) patients. Indeed, SLPI, SPRR2, and epigen were strongly expressed in cysts of MADISH patients and upregulated by dioxin in human keratinocytes in an NRF2-dependent manner. These results identify novel Nrf2 activities in the pilosebaceous unit and point to a role of NRF2 in MADISH pathogenesis. PMID:24503019

  20. The NRF2 knockout rat: a new animal model to study endothelial dysfunction, oxidant stress, and microvascular rarefaction.

    PubMed

    Priestley, Jessica R C; Kautenburg, Katie E; Casati, Marc C; Endres, Bradley T; Geurts, Aron M; Lombard, Julian H

    2016-02-15

    Nuclear factor (erythroid-derived 2)-like-2 (NRF2) is a master antioxidant and cell protective transcription factor that upregulates antioxidant defenses. In this study we developed a strain of Nrf2 null mutant rats to evaluate the role of reduced NRF2-regulated antioxidant defenses in contributing to endothelial dysfunction and impaired angiogenic responses during salt-induced ANG II suppression. Nrf2(-/-) mutant rats were developed using transcription activator-like effector nuclease technology in the Sprague-Dawley genetic background, and exhibited a 41-bp deletion that included the start codon for Nrf2 and an absence of immunohistochemically detectable NRF2 protein. Expression of mRNA for the NRF2-regulated indicator enzymes heme oxygenase-1, catalase, superoxide dismutase 1, superoxide dismutase 2, and glutathione reductase was significantly lower in livers of Nrf2(-/-) mutant rats fed high salt (HS; 4% NaCl) for 2 wk compared with wild-type controls. Endothelium-dependent dilation to acetylcholine was similar in isolated middle cerebral arteries (MCA) of Nrf2(-/-) mutant rats and wild-type littermates fed low-salt (0.4% NaCl) diet, and was eliminated by short-term (3 days) HS diet in both strains. Low-dose ANG II infusion (100 ng/kg sc) reversed salt-induced endothelial dysfunction in MCA and prevented microvessel rarefaction in wild-type rats fed HS diet, but not in Nrf2(-/-) mutant rats. The results of this study indicate that suppression of NRF2 antioxidant defenses plays an essential role in the development of salt-induced oxidant stress, endothelial dysfunction, and microvessel rarefaction in normotensive rats and emphasize the potential therapeutic benefits of directly upregulating NRF2-mediated antioxidant defenses to ameliorate vascular oxidant stress in humans. PMID:26637559

  1. Nrf2 Activation Protects against Solar-Simulated Ultraviolet Radiation in Mice and Humans.

    PubMed

    Knatko, Elena V; Ibbotson, Sally H; Zhang, Ying; Higgins, Maureen; Fahey, Jed W; Talalay, Paul; Dawe, Robert S; Ferguson, James; Huang, Jeffrey T-J; Clarke, Rosemary; Zheng, Suqing; Saito, Akira; Kalra, Sukirti; Benedict, Andrea L; Honda, Tadashi; Proby, Charlotte M; Dinkova-Kostova, Albena T

    2015-06-01

    The transcription factor Nrf2 determines the ability to adapt and survive under conditions of electrophilic, oxidative, and inflammatory stress by regulating the expression of elaborate networks comprising nearly 500 genes encoding proteins with versatile cytoprotective functions. In mice, disruption of Nrf2 increases susceptibility to carcinogens and accelerates disease pathogenesis. Paradoxically, Nrf2 is upregulated in established human tumors, but whether this upregulation drives carcinogenesis is not known. Here we show that the incidence, multiplicity, and burden of solar-simulated UV radiation-mediated cutaneous tumors that form in SKH-1 hairless mice in which Nrf2 is genetically constitutively activated are lower than those that arise in their wild-type counterparts. Pharmacologic Nrf2 activation by topical biweekly applications of small (40 nmol) quantities of the potent bis(cyano enone) inducer TBE-31 has a similar protective effect against solar-simulated UV radiation in animals receiving long-term treatment with the immunosuppressive agent azathioprine. Genetic or pharmacologic Nrf2 activation lowers the expression of the pro-inflammatory factors IL6 and IL1β, and COX2 after acute exposure of mice to UV radiation. In healthy human subjects, topical applications of extracts delivering the Nrf2 activator sulforaphane reduced the degree of solar-simulated UV radiation-induced skin erythema, a quantifiable surrogate endpoint for cutaneous damage and skin cancer risk. Collectively, these data show that Nrf2 is not a driver for tumorigenesis even upon exposure to a very potent and complete carcinogen and strongly suggest that the frequent activation of Nrf2 in established human tumors is a marker of metabolic adaptation.

  2. Nrf2 activation protects against solar-simulated ultraviolet radiation in mice and humans

    PubMed Central

    Knatko, Elena V.; Ibbotson, Sally H.; Zhang, Ying; Higgins, Maureen; Fahey, Jed W.; Talalay, Paul; Dawe, Robert S.; Ferguson, James; Huang, Jeffrey T.-J.; Clarke, Rosemary; Zheng, Suqing; Saito, Akira; Kalra, Sukirti; Benedict, Andrea L.; Honda, Tadashi; Proby, Charlotte M.; Dinkova-Kostova, Albena T.

    2015-01-01

    The transcription factor Nrf2 determines the ability to adapt and survive under conditions of electrophilic, oxidative and inflammatory stress by regulating the expression of elaborate networks comprising nearly 500 genes encoding proteins with versatile cytoprotective functions. In mice, disruption of Nrf2 increases susceptibility to carcinogens and accelerates disease pathogenesis. Paradoxically, Nrf2 is upregulated in established human tumors, but whether this upregulation drives carcinogenesis is not known. Here we show that the incidence, multiplicity and burden of solar-simulated UV radiation-mediated cutaneous tumors that form in SKH-1 hairless mice in which Nrf2 is genetically constitutively activated, are lower than those that arise in their wild-type counterparts. Pharmacological Nrf2 activation by topical bi-weekly applications of small (40 nmol) quantities of the potent bis(cyano enone) inducer TBE-31 has a similar protective effect against solar-simulated UV radiation in animals receiving long-term treatment with the immunosuppressive agent azathioprine. Genetic or pharmacological Nrf2 activation lowers the expression of the pro-inflammatory factors interleukin (IL)-6 and IL-1β, and cyclooxygenase (COX)-2 after acute exposure of mice to UV radiation. In healthy human subjects, topical applications of extracts delivering the Nrf2 activator sulforaphane, reduced the degree of solar-simulated UV radiation-induced skin erythema, a quantifiable surrogate end-point for cutaneous damage and skin cancer risk. Collectively, these data show that Nrf2 is not a driver for tumorigenesis even upon exposure to a very potent and complete carcinogen, and strongly suggest that the frequent activation of Nrf2 in established human tumors is a marker of metabolic adaptation. PMID:25804610

  3. The clinical potential of influencing Nrf2 signaling in degenerative and immunological disorders

    PubMed Central

    Gao, Bifeng; Doan, An; Hybertson, Brooks M

    2014-01-01

    Nuclear factor (erythroid-derived 2)-like 2 (Nrf2; encoded in humans by the NFE2L2 gene) is a transcription factor that regulates the gene expression of a wide variety of cytoprotective phase II detoxification and antioxidant enzymes through a promoter sequence known as the antioxidant-responsive element (ARE). The ARE is a promoter element found in many cytoprotective genes; therefore, Nrf2 plays a pivotal role in the ARE-driven cellular defense system against environmental stresses. Agents that target the ARE/Nrf2 pathway have been tested in a wide variety of disorders, with at least one new Nrf2-activating drug now approved by the US Food and Drug Administration. Examination of in vitro and in vivo experimental results, and taking into account recent human clinical trial results, has led to an opinion that Nrf2-activating strategies – which can include drugs, foods, dietary supplements, and exercise – are likely best targeted at disease prevention, disease recurrence prevention, or slowing of disease progression in early stage illnesses; they may also be useful as an interventional strategy. However, this rubric may be viewed even more conservatively in the pathophysiology of cancer. The activation of the Nrf2 pathway has been widely accepted as offering chemoprevention benefit, but it may be unhelpful or even harmful in the setting of established cancers. For example, Nrf2 activation might interfere with chemotherapies or radiotherapies or otherwise give tumor cells additional growth and survival advantages, unless they already possess mutations that fully activate their Nrf2 pathway constitutively. With all this in mind, the ARE/Nrf2 pathway remains of great interest as a possible target for the pharmacological control of degenerative and immunological diseases, both by activation and by inhibition, and its regulation remains a promising biological target for the development of new therapies. PMID:24520207

  4. The Cytoprotective Effect of Hyperoside against Oxidative Stress Is Mediated by the Nrf2-ARE Signaling Pathway through GSK-3β Inactivation

    PubMed Central

    Xing, Hai-Yan; Cai, Yong-Qing; Wang, Xian-Feng; Wang, Lin-Li; Li, Pan; Wang, Guan-Ying; Chen, Jian-Hong

    2015-01-01

    Glycogen synthase kinase-3β (GSK-3β) acts as a negative regulator of NF-E2 related factor 2 (Nrf2) by inducing Nrf2 degradation and nuclear export. Our previous study demonstrated that the flavonoid hyperoside elicits cytoprotection against oxidative stress by activating the Keap1-Nrf2-ARE signaling pathway, thus increasing the expression of antioxidant enzymes, such as heme oxygenase-1 (HO-1), superoxide dismutase (SOD) and catalase. However, the role of GSK-3β in hyperoside-mediated Nrf2 activation is unclear. Here, we demonstrate that in a normal human hepatocyte cell line, (L02), hyperoside is capable of inducing the phosphorylation of GSK-3β at Ser9 without affecting the protein levels of GSK-3β and its phosphorylation at Thr390. Lithium chloride (LiCl) and short interfering RNA (siRNA)-mediated inhibition of GSK-3β significantly enhanced the ability of hyperoside to protect L02 liver cells from H2O2-induced oxidative damage, leading to increased cell survival shown by the maintenance of cell membrane integrity and elevated levels of glutathione (GSH), one of the endogenous antioxidant biomarkers. Further study showed that LiCl and siRNA-mediated inhibition of GSK-3β increased hyperoside-induced HO-1 expression, and the effect was dependent upon enhanced Nrf2 nuclear translocation and gene expression. These activities were followed by ARE-mediated transcriptional activation in the presence of hyperoside, which was abolished by the transfection of the cells with Nrf2 siRNA. Furthermore, the siRNA-mediated inhibition of Keap1 also enhanced hyperoside-induced Nrf2 nuclear accumulation and HO-1 expression, which was relatively smaller than the effects obtained from GSK-3β siRNA administration. Moreover, Keap1 siRNA administration alone had no significant effect on the phosphorylation and protein expression of GSK-3β. Collectively, our data provide evidence that hyperoside attenuates H2O2 -induced L02 cell damage by activating the Nrf2-ARE signaling

  5. Keap1/Nrf2 pathway in the frontiers of cancer and non-cancer cell metabolism

    PubMed Central

    Chartoumpekis, Dionysios V.; Wakabayashi, Nobunao; Kensler, Thomas W.

    2015-01-01

    Cancer cells adapt their metabolism to their increased needs for energy and substrates for protein, lipid and nucleic acid synthesis. Nuclear erythroid factor 2-like 2 (Nrf2) pathway is usually activated in cancers and has been suggested to promote cancer cell survival mainly by inducing a large battery of cytoprotective genes. This mini review focuses on metabolic pathways, beyond cytoprotection, which can be directly or indirectly regulated by Nrf2 in cancer cells to affect their survival. The pentose phosphate pathway (PPP) is enhanced by Nrf2 in cancers and aids their growth. PPP has also been found to be up-regulated in non-cancer tissues and other pathways, such as de novo lipogenesis, have been found to be repressed after activation of the Nrf2 pathway. The importance of these Nrf2-regulated metabolic pathways in cancer compared with non-cancer state remains to be determined. Last but not least, the importance of context about Nrf2 and cancer is highlighted as the Nrf2 pathway may be activated in cancers but its pharmacological activators are useful in chemoprevention. PMID:26551705

  6. The Nrf2/HO-1 Axis in Cancer Cell Growth and Chemoresistance

    PubMed Central

    Furfaro, A. L.; Traverso, N.; Domenicotti, C.; Piras, S.; Moretta, L.; Marinari, U. M.; Pronzato, M. A.; Nitti, M.

    2016-01-01

    The transcription factor, nuclear factor erythroid 2 p45-related factor 2 (Nrf2), acts as a sensor of oxidative or electrophilic stresses and plays a pivotal role in redox homeostasis. Oxidative or electrophilic agents cause a conformational change in the Nrf2 inhibitory protein Keap1 inducing the nuclear translocation of the transcription factor which, through its binding to the antioxidant/electrophilic response element (ARE/EpRE), regulates the expression of antioxidant and detoxifying genes such as heme oxygenase 1 (HO-1). Nrf2 and HO-1 are frequently upregulated in different types of tumours and correlate with tumour progression, aggressiveness, resistance to therapy, and poor prognosis. This review focuses on the Nrf2/HO-1 stress response mechanism as a promising target for anticancer treatment which is able to overcome resistance to therapies. PMID:26697129

  7. The Nrf2/HO-1 Axis in Cancer Cell Growth and Chemoresistance.

    PubMed

    Furfaro, A L; Traverso, N; Domenicotti, C; Piras, S; Moretta, L; Marinari, U M; Pronzato, M A; Nitti, M

    2016-01-01

    The transcription factor, nuclear factor erythroid 2 p45-related factor 2 (Nrf2), acts as a sensor of oxidative or electrophilic stresses and plays a pivotal role in redox homeostasis. Oxidative or electrophilic agents cause a conformational change in the Nrf2 inhibitory protein Keap1 inducing the nuclear translocation of the transcription factor which, through its binding to the antioxidant/electrophilic response element (ARE/EpRE), regulates the expression of antioxidant and detoxifying genes such as heme oxygenase 1 (HO-1). Nrf2 and HO-1 are frequently upregulated in different types of tumours and correlate with tumour progression, aggressiveness, resistance to therapy, and poor prognosis. This review focuses on the Nrf2/HO-1 stress response mechanism as a promising target for anticancer treatment which is able to overcome resistance to therapies.

  8. Role of Hydroxytyrosol-dependent Regulation of HO-1 Expression in Promoting Wound Healing of Vascular Endothelial Cells via Nrf2 De Novo Synthesis and Stabilization.

    PubMed

    Zrelli, Houda; Kusunoki, Miki; Miyazaki, Hitoshi

    2015-07-01

    Hydroxytyrosol (HT), an olive plant (Olea europaea L.) polyphenol, has proven atheroprotective effects. We previously demonstrated that heme oxygenase-1 (HO-1) is involved in the HT dependent prevention of dysfunction induced by oxidative stress in vascular endothelial cells (VECs). Here, we further investigated the signaling pathway of HT-dependent HO-1 expression in VECs. HT dose- and time-dependently increased HO-1 mRNA and protein levels through the PI3K/Akt and ERK1/2 pathways. Cycloheximide and actinomycin D inhibited both increases, suggesting that HT-triggered HO-1 induction is transcriptionally regulated and that de novo protein synthesis is necessary for this HT effect. HT stimulated nuclear accumulation of nuclear factor E2-related factor 2 (Nrf2). This Nrf2 accumulation was blocked by actinomycin D and cycloheximide whereas HT in combination with the 26S proteasome inhibitor MG132 enhanced the accumulation. HT also extended the half-life of Nrf2 proteins by decelerating its turnover. Moreover, HO-1 inhibitor, ZnppIX and CO scavenger, hemoglobin impaired HT-dependent wound healing while CORM-2, a CO generator, accelerated wound closure. Together, these data demonstrate that HT upregulates HO-1 expression by stimulating the nuclear accumulation and stabilization of Nrf2, leading to the wound repair of VECs crucial in the prevention of atherosclerosis.

  9. Chebulic acid prevents hepatic fibrosis induced by advanced glycation end-products in LX-2 cell by modulating Nrf2 translocation via ERK pathway.

    PubMed

    Koo, Yun-Chang; Pyo, Min Cheol; Nam, Mi-Hyun; Hong, Chung-Oui; Yang, Sung-Yong; Lee, Kwang-Won

    2016-08-01

    Advanced glycation end-products (AGEs) are formed during normal aging, and at an accelerated rate in metabolic syndrome patients. Nonalcoholic steatohepatitis (NASH) can be caused by the AGEs in plasma, while glyceraldehyde-derived AGEs (glycer-AGEs) are significantly higher in the serum of NASH patients. In this study, we investigated the molecular mechanisms of chebulic acid, isolated from Terminalia chebula Retz., in the inhibition of glycer-AGEs induced production of reactive oxygen species (ROS) and collagen accumulation using the LX-2 cell line. Chebulic acid significantly inhibited the induction of ROS and accumulation of collagen proteins by glycer-AGEs. ERK phosphorylation and total nuclear factor E2-related factor 2 (Nrf2) protein expression were induced by chebulic acid in a dose-dependent manner. Chebulic acid was also found to induce translocation of Nrf2 into the nucleus, which was attenuated by inhibition of ERK phosphorylation through treatment with PD98059. Following translocation of Nrf2, chebulic acid induced the protein expressions of catalytic subunit of γ-glutamylcysteine synthetase and glutathione synthesis. Collagen accumulation was also significantly reduced by chebulic acid treatment. The observed effects of chebulic acid were all inhibited by PD98059 treatment. Taken together, these results suggest that chebulic acid prevents the glycer-AGEs-induced ROS formation of LX-2 cells and collagen accumulation by ERK-phosphorylation-mediated Nrf2 nuclear translocation, which causes upregulation of antioxidant protein production. PMID:27021876

  10. CYP2C8-derived epoxyeicosatrienoic acids decrease oxidative stress-induced endothelial apoptosis in development of atherosclerosis: Role of Nrf2 activation.

    PubMed

    Liu, Wan-jun; Wang, Tao; Wang, Bei; Liu, Xin-tian; He, Xing-wei; Liu, Yu-jian; Li, Zhu-xi; Tan, Rong; Zeng, He-song

    2015-10-01

    The aim of the present study is to investigate how cytochrome P450 enzymes (CYP) 2C8-derived epoxyeicosatrienoic acids (EETs) regulate the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway and protect against oxidative stress-induced endothelial injuries in the development and progression of atherosclerosis. In this study, cultured human umbilical vein endothelial cells (HUVECs) were transfected with CYP2C8 or pretreated with exogenous EETs (1 μmol/L) before TNF-α (20 ng/mL) stimulation. Apoptosis and intracellular ROS production were determined by flow cytometry. The expression levels of ROS-associated NAD(P)H subunits gp91 and p47, the anti-oxidative enzyme catalase (CAT), Nrf2, heme oxygenase-1 (HO-1) and endothelial nitric oxide synthase (eNOS) were detected by Western blotting. The results showed that CYP2C8-derived EETs decreased apoptosis of HUVECs treated with TNF-α. Pretreatment with 11, 12-EET also significantly blocked TNF-α-induced ROS production. In addition, 11, 12-EET decreased oxidative stress-induced apoptosis. Furthermore, the ability of 11, 12-EET to protect cells against TNF-α-induced apoptosis via oxidative stress was abrogated by transient transfection with Nrf2-specific small interfering RNA (siRNA). In conclusion, CYP2C8-derived EETs prevented TNF-α-induced HUVECs apoptosis via inhibition of oxidative stress associated with the Nrf2 signaling. PMID:26489615

  11. Curcumin attenuates arsenic-induced hepatic injuries and oxidative stress in experimental mice through activation of Nrf2 pathway, promotion of arsenic methylation and urinary excretion.

    PubMed

    Gao, Shuang; Duan, Xiaoxu; Wang, Xin; Dong, Dandan; Liu, Dan; Li, Xin; Sun, Guifan; Li, Bing

    2013-09-01

    Oxidative stress is one of the major mechanisms implicated in inorganic arsenic poisoning. Curcumin is a natural phenolic compound with impressive antioxidant properties. What's more, curcumin is recently proved to exert its chemopreventive effects partly through the activation of nuclear factor (erythroid-2 related) factor 2 (Nrf2) and its antioxidant and phase II detoxifying enzymes. In vivo, we investigated the protective effects of curcumin against arsenic-induced hepatotoxicity and oxidative injuries. Our results showed that arsenic-induced elevation of serum alanine amino transferase (ALT) and aspartate aminotransferase (AST) activities, augmentation of hepatic malonaldehyde (MDA), as well as the reduction of blood and hepatic glutathione (GSH) levels, were all consistently relieved by curcumin. We also observed the involvement of curcumin in promoting arsenic methylation and urinary elimination in vivo. Furthermore, both the hepatic Nrf2 protein and two typically recognized Nrf2 downstream genes, NADP(H) quinine oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1), were consistently up-regulated in curcumin-treated mice. Our study confirmed the antagonistic roles of curcumin to counteract inorganic arsenic-induced hepatic toxicity in vivo, and suggested that the potent Nrf2 activation capability might be valuable for the protective effects of curcumin against arsenic intoxication. This provides a potential useful chemopreventive dietary component for human populations. PMID:23871787

  12. Curcumin attenuates arsenic-induced hepatic injuries and oxidative stress in experimental mice through activation of Nrf2 pathway, promotion of arsenic methylation and urinary excretion.

    PubMed

    Gao, Shuang; Duan, Xiaoxu; Wang, Xin; Dong, Dandan; Liu, Dan; Li, Xin; Sun, Guifan; Li, Bing

    2013-09-01

    Oxidative stress is one of the major mechanisms implicated in inorganic arsenic poisoning. Curcumin is a natural phenolic compound with impressive antioxidant properties. What's more, curcumin is recently proved to exert its chemopreventive effects partly through the activation of nuclear factor (erythroid-2 related) factor 2 (Nrf2) and its antioxidant and phase II detoxifying enzymes. In vivo, we investigated the protective effects of curcumin against arsenic-induced hepatotoxicity and oxidative injuries. Our results showed that arsenic-induced elevation of serum alanine amino transferase (ALT) and aspartate aminotransferase (AST) activities, augmentation of hepatic malonaldehyde (MDA), as well as the reduction of blood and hepatic glutathione (GSH) levels, were all consistently relieved by curcumin. We also observed the involvement of curcumin in promoting arsenic methylation and urinary elimination in vivo. Furthermore, both the hepatic Nrf2 protein and two typically recognized Nrf2 downstream genes, NADP(H) quinine oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1), were consistently up-regulated in curcumin-treated mice. Our study confirmed the antagonistic roles of curcumin to counteract inorganic arsenic-induced hepatic toxicity in vivo, and suggested that the potent Nrf2 activation capability might be valuable for the protective effects of curcumin against arsenic intoxication. This provides a potential useful chemopreventive dietary component for human populations.

  13. MicroRNA-153/Nrf-2/GPx1 pathway regulates radiosensitivity and stemness of glioma stem cells via reactive oxygen species

    PubMed Central

    Yang, Wei; Shen, Yueming; Wei, Jing; Liu, Fenju

    2015-01-01

    Glioma stem cells (GSCs) exhibit stem cell properties and high resistance to radiotherapy. The main aim of our study was to determine the roles of ROS in radioresistance and stemness of GSCs. We found that microRNA (miR)-153 was down-regulated and its target gene nuclear factor-erythroid 2-related factor-2 (Nrf-2) was up-regulated in GSCs compared with that of non-GSCs glioma cells. The enhanced Nrf-2 expression increased glutathione peroxidase 1 (GPx1) transcription and decreased ROS level leading to radioresistance of GSCs. MiR-153 overexpression resulted in increased ROS production and radiosensitization of GSCs. Moreover, miR-153 overexpression led to decreased neurosphere formation capacity and stem cell marker expression, and induced differentiation through ROS-mediated activation of p38 MAPK in GSCs. Nrf-2 overexpression rescued the decreased stemness and radioresistance resulting from miR-153 overexpression in GSCs. In addition, miR-153 overexpression reduced tumorigenic capacity of GSCs and increased survival in mice bearing human GSCs. These findings demonstrated that miR-153 overexpression decreased radioresistance and stemness of GSCs through targeting Nrf-2/GPx1/ROS pathway. PMID:26124081

  14. S-Propargyl-cysteine Exerts a Novel Protective Effect on Methionine and Choline Deficient Diet-Induced Fatty Liver via Akt/Nrf2/HO-1 Pathway

    PubMed Central

    Li, Wenwen; Ma, Fenfen; Zhang, Laiyin; Huang, Yong; Li, Xinghui; Zhang, Aijie; Hou, Cuilan; Zhu, Yichun; Zhu, YiZhun

    2016-01-01

    This study investigated the antioxidative effect of S-propargyl-cysteine (SPRC) on nonalcoholic fatty liver (NAFLD) by treating mice fed a methionine and choline deficient (MCD) diet with SPRC for four weeks. We found that SPRC significantly reduced hepatic reactive oxygen species (ROS) and methane dicarboxylic aldehyde (MDA) levels. Moreover, SPRC also increased the superoxide dismutase (SOD) activity. By Western blot, we found that this protective effect of SPRC was importantly attributed to the regulated hepatic antioxidant-related proteins, including protein kinase B (Akt), heme oxygenase-1 (HO-1), nuclear factor erythroid 2-related factor 2 (Nrf2), and cystathionine γ-lyase (CSE, an enzyme that synthesizes hydrogen sulfide). Next, we examined the detailed molecular mechanism of the SPRC protective effect using oleic acid- (OA-) induced HepG2 cells. The results showed that SPRC significantly decreased intracellular ROS and MDA levels in OA-induced HepG2 cells by upregulating the phosphorylation of Akt, the expression of HO-1 and CSE, and the translocation of Nrf2. SPRC-induced HO-1 expression and Nrf2 translocation were abolished by the phosphoinositide 3-kinase (PI3K) inhibitor LY294002. Moreover, the antioxidative effect of SPRC was abolished by CSE inhibitor DL-propargylglycine (PAG) and HO-1 siRNA. Therefore, these results proved that SPRC produced an antioxidative effect on NAFLD through the PI3K/Akt/Nrf2/HO-1 signaling pathway. PMID:27313828

  15. Effect of Nrf2 activators on release of glutathione, cysteinylglycine and homocysteine by human U373 astroglial cells.

    PubMed

    Steele, Megan L; Fuller, Stacey; Patel, Mili; Kersaitis, Cindy; Ooi, Lezanne; Münch, Gerald

    2013-01-01

    Neurons rely on the release and subsequent cleavage of GSH to cysteinylglycine (CysGly) by astrocytes in order to maintain optimal intracellular GSH levels. In neurodegenerative diseases characterised by oxidative stress, neurons need an optimal GSH supply to defend themselves against free radicals released from activated microglia and astroglia. The rate of GSH synthesis is controlled largely by the activity of γ-glutamyl cysteine ligase. Expression of γ-glutamyl cysteine ligase and of the Xc- system, which facilitates cystine uptake, is regulated by the redox-sensitive transcription factor, nuclear factor erythroid-2-related factor 2 (Nrf2). Compounds that can activate the Nrf2-ARE pathway, referred to as 'Nrf2 activators' are receiving growing attention due to their potential as GSH-boosting drugs. This study compares four known Nrf2 activators, R-α-Lipoic acid (LA), tert-butylhydroquinone (TBHQ), sulforaphane (SFN) and Polygonum cuspidatum extract containing 50% resveratrol (PC-Res) for their effects on astroglial release of GSH and CysGly. GSH levels increased dose-dependently in response to all four drugs. Sulforaphane produced the most potent effect, increasing GSH by up to 2.4-fold. PC-Res increased GSH up to 1.6-fold, followed by TBHQ (1.5-fold) and LA (1.4-fold). GSH is processed by the ectoenzyme, γ-glutamyl transpeptidase, to form CysGly. Once again, SFN produced the most potent effect, increasing CysGly by up to 1.7-fold, compared to control cells. TBHQ and PC-Res both induced fold increases of 1.3, followed by LA with a fold increase of 1.2. The results from the present study showed that sulforaphane, followed by lipoic acid, resveratrol and Polygonum multiflorum were all identified as potent "GSH and Cys-Gly boosters". PMID:24191238

  16. The role of hypercholesterolemic diet and vitamin E on Nrf2 pathway, endoplasmic reticulum stress and proteasome activity.

    PubMed

    Bozaykut, Perinur; Sozen, Erdi;