Science.gov

Sample records for 2-related factor nrf2

  1. Nrf2b, Novel Zebrafish Paralog of Oxidant-responsive Transcription Factor NF-E2-related Factor 2 (NRF2)*

    PubMed Central

    Timme-Laragy, Alicia R.; Karchner, Sibel I.; Franks, Diana G.; Jenny, Matthew J.; Harbeitner, Rachel C.; Goldstone, Jared V.; McArthur, Andrew G.; Hahn, Mark E.

    2012-01-01

    NF-E2-related factor 2 (NRF2; also called NFE2L2) and related NRF family members regulate antioxidant defenses by activating gene expression via antioxidant response elements (AREs), but their roles in embryonic development are not well understood. We report here that zebrafish (Danio rerio), an important developmental model species, possesses six nrf genes, including duplicated nrf1 and nrf2 genes. We cloned a novel zebrafish nrf2 paralog, nrf2b. The predicted Nrf2b protein sequence shares several domains with the original Nrf2 (now Nrf2a) but lacks the Neh4 transactivation domain. Zebrafish-human comparisons demonstrate conserved synteny involving nrf2 and hox genes, indicating that nrf2a and nrf2b are co-orthologs of human NRF2. nrf2a and nrf2b displayed distinct patterns of expression during embryonic development; nrf2b was more highly expressed at all stages. Embryos in which Nrf2a expression had been knocked down with morpholino oligonucleotides were more sensitive to tert-butylhydroperoxide but not tert-butylhydroquinone, whereas knockdown of Nrf2b did not affect sensitivity of embryos to either chemical. Gene expression profiling by microarray identified a specific role for Nrf2b as a negative regulator of several genes, including p53, cyclin G1, and heme oxygenase 1, in embryos. Nrf2a and Nrf2b exhibited different mechanisms of cross-talk with the Ahr2 signaling pathway. Together, these results demonstrate distinct roles for nrf2a and nrf2b, consistent with subfunction partitioning, and identify a novel negative regulatory role for Nrf2b during development. The identification of zebrafish nrf2 co-orthologs will facilitate new understanding of the multiple roles of NRF2 in protecting vertebrate embryos from oxidative damage. PMID:22174413

  2. The transcription factor NF-E2-related Factor 2 (Nrf2): a protooncogene?

    PubMed Central

    Shelton, Phillip; Jaiswal, Anil K.

    2013-01-01

    The transcription factor Nrf2 is responsible for regulating a battery of antioxidant and cellular protective genes, primarily in response to oxidative stress. A member of the cap 'n' collar family of transcription factors, Nrf2 activation is tightly controlled by a series of signaling events. These events can be separated into the basal state, a preinduction response, gene induction, and finally a postinduction response, culminating in the restoration of redox homeostasis. However, despite the immensely intricate level of control the cellular environment imposes on Nrf2 activity, there are many opportunities for perturbations to arise in the signaling events that favor carcinogenesis and, therefore, implicate Nrf2 as both a tumor suppressor and a protooncogene. Herein, we highlight the ways in which Nrf2 is regulated, and discuss some of the Nrf2-inducible antioxidant (NQO1, NQO2, HO-1, GCLC), antiapoptotic (Bcl-2), metabolic (G6PD, TKT, PPARγ), and drug efflux transporter (ABCG2, MRP3, MRP4) genes. In addition, we focus on how Nrf2 functions as a tumor suppressor under normal conditions and how its ability to detoxify the cellular environment makes it an attractive target for other oncogenes either via stabilization or degradation of the transcription factor. Finally, we discuss some of the ways in which Nrf2 is being considered as a therapeutic target for cancer treatment.—Shelton, P., Jaiswal, A. K. The transcription factor NF-E2-related factor 2 (Nrf2): a protooncogene? PMID:23109674

  3. Nuclear factor E2-related factor-2 (Nrf2) is required for NLRP3 and AIM2 inflammasome activation.

    PubMed

    Zhao, Changcheng; Gillette, Devyn D; Li, Xinghui; Zhang, Zhibin; Wen, Haitao

    2014-06-13

    Despite the number of extensive studies on the immune function and signaling of inflammasomes in various diseases, the activating mechanism of inflammasome, especially the NLRP3 inflammasome, is not fully understood. Nuclear factor E2-related Factor-2 (Nrf2), a key transcription factor that regulates cellular redox homeostasis, has been reported to play both protective and pathogenic roles depending on the disease conditions through undefined mechanism. This study reveals an essential role of Nrf2 in inflammasome activation. LPS stimulation increased Nrf2 protein levels in a Myd88-dependent manner. When compared with wild-type controls, Nrf2-deficient (Nrf2(-/-)) macrophages showed decreased maturation and secretion of caspase-1 and IL-1β and reduced apoptosis-associated speck-like protein containing CARD (ASC) speck formation in response to various NLRP3 and AIM2 inflammasome stimuli. In contrast, NLRC4 inflammasome activation was not controlled by Nrf2. Biochemical analysis revealed that Nrf2 appeared in the ASC-enriched cytosolic compartment after NLRP3 inflammasome activation. Furthermore, mitochondrial reactive oxygen species-induced NLRP3 activation also required Nrf2. Nrf2(-/-) mice showed a dramatic decrease in immune cell recruitment and IL-1β generation in alum-induced peritonitis, which is a typical IL-1 signaling-dependent inflammation animal model. This work discovered a critical proinflammatory effect of Nrf2 by mediating inflammasome activation.

  4. Nuclear Factor E2-related Factor-2 (Nrf2) Is Required for NLRP3 and AIM2 Inflammasome Activation*

    PubMed Central

    Zhao, Changcheng; Gillette, Devyn D.; Li, Xinghui; Zhang, Zhibin; Wen, Haitao

    2014-01-01

    Despite the number of extensive studies on the immune function and signaling of inflammasomes in various diseases, the activating mechanism of inflammasome, especially the NLRP3 inflammasome, is not fully understood. Nuclear factor E2-related Factor-2 (Nrf2), a key transcription factor that regulates cellular redox homeostasis, has been reported to play both protective and pathogenic roles depending on the disease conditions through undefined mechanism. This study reveals an essential role of Nrf2 in inflammasome activation. LPS stimulation increased Nrf2 protein levels in a Myd88-dependent manner. When compared with wild-type controls, Nrf2-deficient (Nrf2−/−) macrophages showed decreased maturation and secretion of caspase-1 and IL-1β and reduced apoptosis-associated speck-like protein containing CARD (ASC) speck formation in response to various NLRP3 and AIM2 inflammasome stimuli. In contrast, NLRC4 inflammasome activation was not controlled by Nrf2. Biochemical analysis revealed that Nrf2 appeared in the ASC-enriched cytosolic compartment after NLRP3 inflammasome activation. Furthermore, mitochondrial reactive oxygen species-induced NLRP3 activation also required Nrf2. Nrf2−/− mice showed a dramatic decrease in immune cell recruitment and IL-1β generation in alum-induced peritonitis, which is a typical IL-1 signaling-dependent inflammation animal model. This work discovered a critical proinflammatory effect of Nrf2 by mediating inflammasome activation. PMID:24798340

  5. Up-regulation of nuclear factor E2-related factor 2 (Nrf2) represses the replication of SVCV.

    PubMed

    Shao, Junhui; Huang, Jiang; Guo, Yana; Li, Lijuan; Liu, Xueqin; Chen, Xiaoxuan; Yuan, Junfa

    2016-11-01

    Generation of reactive oxygen species (ROS) and failure to maintain an appropriate redox balance contribute to viral pathogenesis. Nuclear factor E2-related factor 2 (Nrf2) is an important transcription factor that plays a pivotal role in maintaining intracellular homoeostasis and coping with invasive pathogens by coordinately activating a series of cytoprotective genes. Previous studies indicated that the transcription and expression levels of Nrf2 were up-regulated in SVCV-infected EPC cells with the unknown mechanism(s). In this study, the interactions between the Nrf2-ARE signalling pathway and SVCV replication were investigated, which demonstrated that SVCV infection induced accumulation of ROS as well as protein carbonyl groups and 8-OHdG, accompanied by the up-regulation of Nrf2 and its downstream genes. At the same time, the activation of Nrf2 with D, l-sulforaphane (SFN) and CDDO-Me could repress the replication of SVCV, and knockdown of Nrf2 by siRNA could promote the replication of SVCV. Taken together, these observations indicate that the Nrf2-ARE signal pathway activates a passive defensive response upon SVCV infection. The conclusions presented here suggest that targeting the Nrf2 pathway has potential for combating SVCV infection.

  6. Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) Mediates Neuroprotection in Traumatic Brain Injury at Least in Part by Inactivating Microglia

    PubMed Central

    Wu, Gang; Liu, Zongying

    2016-01-01

    Background Microglial activation has been reported to be involved in traumatic brain injury (TBI). Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a significant role in protecting against TBI-induced secondary brain injury. However, the exact mechanism is not clearly understood. The present study aimed to explore whether Nrf2 protects against TBI partly by regulating microglia function. Material/Methods Microglia cells were isolated from C57BL/6 mouse brains (postnatal day 1–3). The expression of Nrf2 was suppressed by transfection with Nrf2-specific small interfering RNA (siRNA), and overexpressed by transfections with pcDNA3.1-Nrf2. The expression of Nrf2 was confirmed by real-time PCR and Western blotting. After transfection, cell viability, phagocytic ability, and the expression of pro-inflammatory cytokines (tumor necrosis factor (TNF)-α and interleukin (IL)-6) were determined by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) colorimetric assay, phagocytosis assay, and enzyme-linked immunosorbent assay (ELISA), respectively. Results mRNA and protein expression levels of Nrf2 were significantly reduced by transfection with Nrf2-specific siRNA (both P<0.05) but were elevated by transfection with pcDNA3.1-Nrf2 (both P<0.01). The cell viability, phagocytic ability, and the expression of TNF-α and IL-6 were all significantly reduced by overexpression of Nrf2 but were significantly increased by silencing of Nrf2 compared with the control group. Conclusions Our results suggest that Nrf2 protects against TBI, at least part by regulating microglia function. PMID:27336674

  7. Expression of NF-E2-related factor 2 (Nrf2) in the basilar artery after experimental subarachnoid hemorrhage in rabbits: a preliminary study.

    PubMed

    Zhao, Xu-Dong; Zhou, Yi-Ting; Zhang, Xing; Wang, Xiao-Liang; Qi, Wu; Zhuang, Zong; Su, Xing-Fen; Shi, Ji-Xin

    2010-10-28

    It has been suggested that the pathogenesis of vasospasm is complex including endothelial damage, oxidative stress, inflammatory damage, and the accumulation of toxic metabolites. Recently, a growing body of evidence indicates that nuclear factor erythroid 2-related factor 2 (Nrf2) plays a unique role in many physiological stress processes. In this study, a total of 48 rabbits were assigned randomly to four groups: control group, SAH day 3, day 5, and day 7 groups. The animals in SAH day 3, day 5, and day 7 groups were subjected to injection of autologous blood into cisterna magna twice on day 0 and day 2 and were killed on days 3, 5, and 7, respectively. Cross-sectional area of basilar artery was measured and the Nrf2 expression was assessed by immunohistochemistry and Western blot analysis. The mRNA levels of Nrf2 were also determined by RT-PCR. The basilar arteries exhibited vasospasm after SAH and became more severe on days 3 and 5. The elevated expression of Nrf2 was detected after SAH and peaked on days 3 and 5. Nrf2 is increasingly expressed in a parallel time course to the development of cerebral vasospasm in a rabbit experimental model of SAH.

  8. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2).

    PubMed

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y

    2016-04-01

    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders.

  9. Identifying panaxynol, a natural activator of nuclear factor erythroid-2 related factor 2 (Nrf2) from American ginseng as a suppressor of inflamed macrophage-induced cardiomyocyte hypertrophy

    PubMed Central

    Qu, Chen; Li, Bin; Lai, Yimu; Li, Hechu; Windust, Anthony; Hofseth, Lorne J.; Nagarkatti, Mitzi; Nagarkatti, Prakash; Wang, Xing Li; Tang, Dongqi; Janicki, Joseph S.; Tian, Xingsong; Cui, Taixing

    2015-01-01

    Ethnopharmacological relevance American ginseng is capable of ameliorating cardiac dysfunction and activating Nrf2, a master regulator of antioxidant defense, in the heart. This study was designed to isolate compounds from American ginseng and to determine those responsible for the Nrf2-mediated resolution of inflamed macrophage-induced cardiomyocyte hypertrophy. Materials and methods A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. A bioassay-based fractionization of American ginseng was performed to identify the putative substances which could activate Nrf2-mediated suppression of pro-inflammatory cytokine expression in macrophages and macrophage-mediated pro-hypertrophic growth in cardiomyocytes. Results A hexane fraction of an anti-inflammatory crude extract of American ginseng was found to be most effective in suppressing the inflammatory responses in macrophages. Preparative, reverse-phase HPLC and a comparative analysis by analytical scale LC–UV/MS revealed the hexane fraction contains predominantly C17 polyacetylenes and linolenic acid. Panaxynol, one of the major polyacetylenes, was found to be a potent Nrf2 activator. Panaxynol posttranscriptionally activated Nrf2 by inhibiting Kelch-like ECH-associated protein (Keap) 1-mediated degradation without affecting the binding of Keap1 and Nrf2. Moreover, panaxynol suppressed a selected set of cytokine expression via the activation of Nrf2 while minimally regulating nuclear factor-kappa B (NF-κB)-mediated cytokine expression in macrophages. It also dramatically inhibited the inflamed macrophage-mediated cardiomyocyte death and hypertrophy by activating Nrf2 in macrophages. Conclusions These results demonstrate that American ginseng-derived panaxynol is a specific Nrf2 activator and panaxynol-activated Nrf2 signaling is at least partly responsible for American ginseng-induced health benefit in the heart. PMID

  10. Activation of the Kelch-like ECH-associated protein 1 (Keap1)/NF-E2-related factor 2 (Nrf2) pathway through covalent modification of the 2-alkenal group of aliphatic electrophiles in Coriandrum sativum L.

    PubMed

    Abiko, Yumi; Mizokawa, Mai; Kumagai, Yoshito

    2014-11-12

    Phytochemicals able to activate the transcription factor NF-E2-related factor 2 (Nrf2) were isolated from an extract of Coriandrum sativum L. (C. sativum) leaves by preparative octadecyl silica column chromatography. Ultraperformance liquid chromatography and liquid chromatography-tandem mass spectrometry analysis of the isolated components after derivatization with 2-diphenylacetyl-1,3-inandione-1-hydrazone and experiments with HepG2 cells revealed that (E)-2-alkenals with different carbon numbers play a role in Nrf2 activation in these cells. Such Nrf2 activation appears to be attributable to S-alkylation of Kelch-like ECH-associated protein 1 (Keap1), the negative regulator for Nrf2, as determined by a biotin-PEAC5-maleimide assay. Interestingly, (E)-2-butenal caused Keap1 modification and Nrf2 activation, whereas butanal did not. These results suggest that (E)-2-alkenals with an α,β-unsaturated aldehyde moiety, which is a common substituent in phytochemicals isolated from C. sativum leaves, activate the Keap1/Nrf2 pathway associated with cellular protection.

  11. Identification of UV-protective activators of nuclear factor erythroid-derived 2-related factor 2 (Nrf2) by combining a chemical library screen with computer-based virtual screening.

    PubMed

    Lieder, Franziska; Reisen, Felix; Geppert, Tim; Sollberger, Gabriel; Beer, Hans-Dietmar; auf dem Keller, Ulrich; Schäfer, Matthias; Detmar, Michael; Schneider, Gisbert; Werner, Sabine

    2012-09-21

    Nuclear factor erythroid-derived 2-related factor 2 (Nrf2) is a master regulator of cellular antioxidant defense systems, and activation of this transcription factor is a promising strategy for protection of skin and other organs from environmental insults. To identify efficient Nrf2 activators in keratinocytes, we combined a chemical library screen with computer-based virtual screening. Among 14 novel Nrf2 activators, the most potent compound, a nitrophenyl derivative of 2-chloro-5-nitro-N-phenyl-benzamide, was characterized with regard to its molecular mechanism of action. This compound induced the expression of cytoprotective genes in keratinocytes isolated from wild-type but not from Nrf2-deficient mice. Most importantly, it showed low toxicity and protected primary human keratinocytes from UVB-induced cell death. Therefore, it represents a potential lead compound for the development of drugs for skin protection under stress conditions. Our study demonstrates that chemical library screening combined with advanced computational similarity searching is a powerful strategy for identification of bioactive compounds, and it points toward an innovative therapeutic approach against UVB-induced skin damage.

  12. Nrf2 and Nrf2-Related Proteins in Development and Developmental Toxicity: Insights from studies in Zebrafish (Danio rerio)

    PubMed Central

    Hahn, Mark E.; Timme-Laragy, Alicia R.; Karchner, Sibel I.; Stegeman, John J.

    2015-01-01

    Oxidative stress is an important mechanism of chemical toxicity, contributing to developmental toxicity and teratogenesis as well as to cardiovascular and neurodegenerative diseases and diabetic embryopathy. Developing animals are especially sensitive to effects of chemicals that disrupt the balance of processes generating reactive species and oxidative stress, and those anti-oxidant defenses that protect against oxidative stress. The expression and inducibility of anti-oxidant defenses through activation of NFE2-related factor 2 (Nrf2) and related proteins is an essential process affecting the susceptibility to oxidants, but the complex interactions of Nrf2 in determining embryonic response to oxidants and oxidative stress are only beginning to be understood. The zebrafish (Danio rerio) is an established model in developmental biology and now also in developmental toxicology and redox signaling. Here we review the regulation of genes involved in protection against oxidative stress in developing vertebrates, with a focus on Nrf2 and related cap’n’collar (CNC)-basic-leucine zipper (bZIP) transcription factors. Vertebrate animals including zebrafish share Nfe2, Nrf1, Nrf2, and Nrf3 as well as a core set of genes that respond to oxidative stress, contributing to the value of zebrafish as a model system with which to investigate the mechanisms involved in regulation of redox signaling and the response to oxidative stress during embryolarval development. Moreover, studies in zebrafish have revealed nrf and keap1 gene duplications that provide an opportunity to dissect multiple functions of vertebrate NRF genes, including multiple sensing mechanisms involved in chemical-specific effects. PMID:26130508

  13. Src subfamily kinases regulate nuclear export and degradation of transcription factor Nrf2 to switch off Nrf2-mediated antioxidant activation of cytoprotective gene expression.

    PubMed

    Niture, Suryakant K; Jain, Abhinav K; Shelton, Phillip M; Jaiswal, Anil K

    2011-08-19

    Nrf2 (NF-E2-related factor 2) is a nuclear transcription factor that in response to chemical and radiation stress regulates coordinated induction of a battery of cytoprotective gene expressions leading to cellular protection. In this study, we investigated the role of Src kinases in the regulation of Nrf2 and downstream signaling. siRNA-mediated inhibition of Fyn, Src, Yes, and Fgr, but not Lyn, in mouse hepatoma Hepa-1 cells, led to nuclear accumulation of Nrf2 and up-regulation of Nrf2 downstream gene expression. Mouse embryonic fibroblasts with combined deficiency of Fyn/Src/Yes/Fgr supported results from siRNA. In addition, steady-state overexpression of Fyn, Src, and Yes phosphorylated Nrf2Tyr568 that triggered nuclear export and degradation of Nrf2 and down-regulation of Nrf2 downstream gene expression. Exposure of cells to antioxidant, oxidant, or UV radiation increased nuclear import of Fyn, Src, and Yes kinases, which phosphorylated Nrf2Tyr568 resulting in nuclear export and degradation of Nrf2. Further analysis revealed that stress-activated GSK3β acted upstream to the Src kinases and phosphorylated the Src kinases, leading to their nuclear localization and Nrf2 phosphorylation. The overexpression of Src kinases in Hepa-1 cells led to decreased Nrf2, increased apoptosis, and decreased cell survival. Mouse embryonic fibroblasts deficient in Src kinases showed nuclear accumulation of Nrf2, induction of Nrf2 and downstream gene expression, reduced apoptosis, and increased cell survival. The studies together demonstrate that Src kinases play a critical role in nuclear export and degradation of Nrf2, thereby providing a negative feedback mechanism to switch off Nrf2 activation and restore normal cellular homeostasis.

  14. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    SciTech Connect

    Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching

    2013-11-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS

  15. Hydrogen Sulfide Levels and Nuclear Factor-Erythroid 2-Related Factor 2 (NRF2) Activity Are Attenuated in the Setting of Critical Limb Ischemia (CLI)

    PubMed Central

    Islam, Kazi N; Polhemus, David J; Donnarumma, Erminia; Brewster, Luke P; Lefer, David J

    2015-01-01

    Background Cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase are endogenous enzymatic sources of hydrogen sulfide (H2S). Functions of H2S are mediated by several targets including ion channels and signaling proteins. Nuclear factor-erythroid 2-related factor 2 is responsible for the expression of antioxidant response element–regulated genes and is known to be upregulated by H2S. We examined the levels of H2S, H2S-producing enzymes, and nuclear factor-erythroid 2-related factor 2 activation status in skeletal muscle obtained from critical limb ischemia (CLI) patients. Methods and Results Gastrocnemius tissues were attained postamputation from human CLI and healthy control patients. We found mRNA and protein levels of cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase were significantly decreased in skeletal muscle of CLI patients as compared to control. H2S and sulfane sulfur levels were significantly decreased in skeletal muscle of CLI patients. We also observed significant reductions in nuclear factor-erythroid 2-related factor 2 activation as well as antioxidant proteins, such as Cu, Zn-superoxide dismutase, catalase, and glutathione peroxidase in skeletal muscle of CLI patients. Biomarkers of oxidative stress, such as malondialdehyde and protein carbonyl formation, were significantly increased in skeletal muscle of CLI patients as compared to healthy controls. Conclusions The data demonstrate that H2S bioavailability and nuclear factor-erythroid 2-related factor 2 activation are both attenuated in CLI tissues concomitant with significantly increased oxidative stress. Reductions in the activity of H2S-producing enzymes may contribute to the pathogenesis of CLI. PMID:25977470

  16. Multiple nuclear localization signals function in the nuclear import of the transcription factor Nrf2.

    PubMed

    Theodore, Melanie; Kawai, Yumiko; Yang, Jianqi; Kleshchenko, Yuliya; Reddy, Sekhar P; Villalta, Fernando; Arinze, Ifeanyi J

    2008-04-04

    Nuclear factor erythroid 2-related factor 2 (Nrf2) mediates the transcriptional response of cells to oxidative stress and is translocated into the nucleus following, or concomitant with, its activation by electrophiles or reactive oxygen species. The mechanism of its translocation into the nucleus is not entirely elucidated. Here we have identified two novel nuclear localization signal (NLS) motifs in murine Nrf2, one located near the N-terminal region (amino acid residues 42-53) and the other (residues 587-593) located near the C-terminal region. Imaging of green fluorescent protein (GFP)-tagged Nrf2 revealed that mutation(s) in any of these sequences resulted in decreased nuclear fluorescence intensity compared with the wild-type Nrf2 when Nrf2 activation was induced with the electrophile tert-butylhydroquinone. The mutations also impaired Nrf2-induced transactivation of antioxidant response element-driven reporter gene expression to the same extent as the Nrf2 construct bearing mutation in a previously identified bipartite NLS that maps at residues 494-511. When linked to GFP or to GFP-PEPCK-C each of the novel NLS motifs was sufficient to drive nuclear translocation of the fusion proteins. Co-immunoprecipitation assays demonstrated that importins alpha5 and beta1 associate with Nrf2, an interaction that was blocked by the nuclear import inhibitor SN50. SN50 also blocked tert-butylhydroquinone-induced nuclear fluorescence of GFP-Nrf2 in cells transfected with wild-type GFP-Nrf2. Overall these results reveal that multiple NLS motifs in Nrf2 function in its nuclear translocation in response to pro-oxidant stimuli and that the importin alpha-beta heterodimer nuclear import receptor system plays a critical role in the import process.

  17. Knockout of the transcription factor Nrf2 disrupts spermatogenesis in an age-dependent manner

    PubMed Central

    Nakamura, Brooke N.; Lawson, Gregory; Chan, Jefferson Y.; Banuelos, Jésus; Cortés, Mabel M.; Hoang, Yvonne D.; Ortiz, Laura; Rau, Bogdan A.; Luderer, Ulrike

    2010-01-01

    Oxidative stress occurs when generation of reactive oxygen species (ROS) overwhelms antioxidant defenses. Oxidative stress has been associated with male infertility. The transcription factor Nuclear Factor-Erythroid 2-Related Factor 2 (NRF2) regulates basal and inducible transcription of genes encoding enzymes important for protection against ROS. We hypothesized that deletion of the Nrf2 gene causes testicular and epididymal oxidative stress, which disrupts spermatogenesis. Our results show that male Nrf2−/− mice have decreased fertility compared to wild type and heterozygous littermates, due to accumulating seminiferous tubule damage with increasing age. Testicular sperm head counts, epididymal sperm counts, and epididymal sperm motility in 2 month old Nrf2−/− males did not differ from wild type littermates; however, by age 6 months, Nrf2−/− males had 44% lower testicular sperm head counts, 65% lower epididymal sperm counts, and 66% lower epididymal sperm motility than wild type males. Two to 4 month old Nrf2−/− males had elevated levels of testicular and epididymal lipid peroxidation and testicular germ cell apoptosis, and decreased levels of antioxidants compared to wild type males. These results provide evidence that oxidative stress has deleterious effects on the testis and epididymis and demonstrate a critical role for the transcription factor NRF2 in preventing oxidative disruption of spermatogenesis. PMID:20692336

  18. Myeloid-Derived Suppressor Cell Survival and Function Are Regulated by the Transcription Factor Nrf2.

    PubMed

    Beury, Daniel W; Carter, Kayla A; Nelson, Cassandra; Sinha, Pratima; Hanson, Erica; Nyandjo, Maeva; Fitzgerald, Phillip J; Majeed, Amry; Wali, Neha; Ostrand-Rosenberg, Suzanne

    2016-04-15

    Tumor-induced myeloid-derived suppressor cells (MDSC) contribute to immune suppression in tumor-bearing individuals and are a major obstacle to effective immunotherapy. Reactive oxygen species (ROS) are one of the mechanisms used by MDSC to suppress T cell activation. Although ROS are toxic to most cells, MDSC survive despite their elevated content and release of ROS. NF erythroid 2-related factor 2 (Nrf2) is a transcription factor that regulates a battery of genes that attenuate oxidative stress. Therefore, we hypothesized that MDSC resistance to ROS may be regulated by Nrf2. To test this hypothesis, we used Nrf2(+/+)and Nrf2(-/-)BALB/c and C57BL/6 mice bearing 4T1 mammary carcinoma and MC38 colon carcinoma, respectively. Nrf2 enhanced MDSC suppressive activity by increasing MDSC production of H2O2, and it increased the quantity of tumor-infiltrating MDSC by reducing their oxidative stress and rate of apoptosis. Nrf2 did not affect circulating levels of MDSC in tumor-bearing mice because the decreased apoptotic rate of tumor-infiltrating MDSC was balanced by a decreased rate of differentiation from bone marrow progenitor cells. These results demonstrate that Nrf2 regulates the generation, survival, and suppressive potency of MDSC, and that a feedback homeostatic mechanism maintains a steady-state level of circulating MDSC in tumor-bearing individuals.

  19. Aldosterone Activates Transcription Factor Nrf2 in Kidney Cells Both In Vitro and In Vivo

    PubMed Central

    Oteiza, Patricia I.; Link, Samuel; Hey, Valentin; Stopper, Helga; Schupp, Nicole

    2014-01-01

    Abstract Aims: An increased kidney cancer risk was found in hypertensive patients, who frequently exhibit hyperaldosteronism, known to contribute to kidney injury, with oxidative stress playing an important role. The capacity of kidney cells to up-regulate transcription factor nuclear factor-erythroid-2-related factor 2 (Nrf2), a key regulator of the cellular antioxidative defense, as a prevention of aldosterone-induced oxidative damage was investigated both in vitro and in vivo. Results: Aldosterone activated Nrf2 and increased the expression of enzymes involved in glutathione (GSH) synthesis and detoxification. This activation depended on the mineralocorticoid receptor (MR) and oxidative stress. In vitro, Nrf2 activation, GSH amounts, and target gene levels decreased after 24 h, while oxidant levels remained high. Nrf2 activation could not protect cells against oxidative DNA damage, as aldosterone-induced double-strand breaks and 7,8-dihydro-8-oxo-guanine (8-oxodG) lesions steadily rose. The Nrf2 activator sulforaphane enhanced the Nrf2 response both in vitro and in vivo, thereby preventing aldosterone-induced DNA damage. In vivo, Nrf2 activation further had beneficial effects on the aldosterone-caused blood pressure increase and loss of kidney function. Innovation: This is the first study showing the activation of Nrf2 by aldosterone. Moreover, the results identify sulforaphane as a substance that is capable of preventing aldosterone-induced damage both in vivo and in vitro. Conclusion: Aldosterone-induced Nrf2 adaptive response cannot neutralize oxidative actions of chronically increased aldosterone, which, therefore could be causally involved in the increased cancer incidence of hypertensive individuals. Enhancing the cellular antioxidative defense with sulforaphane might exhibit beneficial effects. Antioxid. Redox Signal. 21, 2126–2142. PMID:24512358

  20. Sirtuin 2 regulates cellular iron homeostasis via deacetylation of transcription factor NRF2.

    PubMed

    Yang, Xiaoyan; Park, Seong-Hoon; Chang, Hsiang-Chun; Shapiro, Jason S; Vassilopoulos, Athanassios; Sawicki, Konrad T; Chen, Chunlei; Shang, Meng; Burridge, Paul W; Epting, Conrad L; Wilsbacher, Lisa D; Jenkitkasemwong, Supak; Knutson, Mitchell; Gius, David; Ardehali, Hossein

    2017-03-13

    SIRT2 is a cytoplasmic sirtuin that plays a role in various cellular processes, including tumorigenesis, metabolism, and inflammation. Since these processes require iron, we hypothesized that SIRT2 directly regulates cellular iron homeostasis. Here, we have demonstrated that SIRT2 depletion results in a decrease in cellular iron levels both in vitro and in vivo. Mechanistically, we determined that SIRT2 maintains cellular iron levels by binding to and deacetylating nuclear factor erythroid-derived 2-related factor 2 (NRF2) on lysines 506 and 508, leading to a reduction in total and nuclear NRF2 levels. The reduction in nuclear NRF2 leads to reduced ferroportin 1 (FPN1) expression, which in turn results in decreased cellular iron export. Finally, we observed that Sirt2 deletion reduced cell viability in response to iron deficiency. Moreover, livers from Sirt2-/- mice had decreased iron levels, while this effect was reversed in Sirt2-/- Nrf2-/- double-KO mice. Taken together, our results uncover a link between sirtuin proteins and direct control over cellular iron homeostasis via regulation of NRF2 deacetylation and stability.

  1. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response

    PubMed Central

    Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun

    2017-01-01

    Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (Aβ)42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1β, prostaglandin (PG)E2, and nitric oxide (NO) because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD. PMID:28373747

  2. Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region.

    PubMed Central

    Moi, P; Chan, K; Asunis, I; Cao, A; Kan, Y W

    1994-01-01

    Hypersensitive site 2 located in the beta-globin locus control region confers high levels of expression to the genes of the beta-globin cluster. A tandem repeat of the consensus sequence for the transcription factors AP1 and NF-E2 (activating protein 1 and nuclear factor erythroid 2, respectively) is present within hypersensitive site 2 and is absolutely required for strong enhancer activity. This sequence binds, in vitro and in vivo, to ubiquitous proteins of the AP1 family and to the recently cloned erythroid-specific transcription factor NF-E2. Using the tandem repeat as a recognition site probe to screen a lambda gt11 cDNA expression library from K562 cells, we isolated several DNA binding proteins. Here, we report the characterization of one of the clones isolated. The gene, which we named Nrf2 (NF-E2-related factor 2), is encoded within a 2.2-kb transcript and predicts a 66-kDa protein with a basic leucine zipper DNA binding domain highly homologous to that of NF-E2. Although Nrf2 is expressed ubiquitously, a role of this protein in mediating enhancer activity of hypersensitive site 2 in erythroid cells cannot be excluded. In this respect, Nrf2 contains a powerful acidic activation domain that may participate in the transcriptional stimulation of beta-globin genes. Images PMID:7937919

  3. Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases.

    PubMed

    Pajares, Marta; Cuadrado, Antonio; Rojo, Ana I

    2017-04-01

    Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2)-like 2). NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.

  4. What is Known Regarding the Participation of Factor Nrf-2 in Liver Regeneration?

    PubMed Central

    Morales-González, José A.; Madrigal-Santillán, Eduardo; Morales-González, Ángel; Bautista, Mirandeli; Gayosso-Islas, Evila; Sánchez-Moreno, Cecilia

    2015-01-01

    It has been known for years that, after chemical damage or surgical removal of its tissue, the liver initiates a series of changes that, taken together, are known as regeneration, which are focused on the recovery of lost or affected tissue in terms of the anatomical or functional aspect. The Nuclear factor-erythroid 2-related factor (Nrf-2) is a reduction-oxidation reaction (redox)-sensitive transcriptional factor, with the basic leucine Zipper domain (bZIP) motif, encoding the NFE2L2 gene. The Keap1-Nrf2-ARE pathway is transcendental in the regulation of various cellular processes, such as antioxidant defenses, redox equilibrium, the inflammatory process, the apoptotic processes, intermediate metabolism, detoxification, and cellular proliferation. Some reports have demonstrated the regulator role of Nrf-2 in the cellular cycle of the hepatocyte, as well as in the modulation of the antioxidant response and of apoptotic processes during liver regeneration. It has been reported that there is a delay in liver regeneration after Partial hepatectomy (PH) in the absence of Nrf-2, and similarly as a regulator of hepatic cytoprotection due to diverse chemical or biological agents, and in diseases such as hepatitis, fibrosis, cirrhosis, and liver cancer. This regulator/protector capacity is due to the modulation of the Antioxidant response elements (ARE). It is postulated that oxidative stress (OS) can participate in the initial stages of liver regeneration and that Nrf-2 can probably participate. Studies are lacking on the different initiation stages, maintenance, and the termination of liver regeneration alone or with ethanol. PMID:26010752

  5. Nrf2-dependent suppression of azoxymethane/dextran sulfate sodium-induced colon carcinogenesis by the cinnamon-derived dietary factor cinnamaldehyde

    PubMed Central

    Long, Min; Tao, Shasha; de la Vega, Montserrat Rojo; Jiang, Tao; Wen, Qing; Park, Sophia L.; Zhang, Donna D.; Wondrak, Georg T.

    2015-01-01

    The progressive nature of colorectal cancer (CRC) and poor prognosis associated with the metastatic phase of the disease create an urgent need for the development of more efficacious strategies targeting colorectal carcinogenesis. Cumulative evidence suggests that the redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defence, represents a promising molecular target for CRC chemoprevention. Recently, we have identified cinnamon, the ground bark of Cinnamomum aromaticum (cassia cinnamon) and Cinnamomum verum (Ceylon cinnamon), as a rich dietary source of the Nrf2 inducer cinnamaldehyde (CA) eliciting the Nrf2-regulated antioxidant response in human epithelial colon cells, conferring cytoprotection against electrophilic and genotoxic insult. Here, we have explored the molecular mechanism underlying CA-induced Nrf2 activation in colorectal epithelial cells and have examined the chemopreventive potential of CA in a murine CRC model comparing Nrf2+/+ and Nrf2−/− mice. In HCT116 cells, CA caused a Keap1-C151-dependent increase in Nrf2 protein half-life via blockage of ubiquitination with upregulation of cytoprotective Nrf2 target genes and elevation of cellular glutathione. After optimizing colorectal Nrf2 activation and target gene expression by dietary CA-supplementation regimens, we demonstrated that CA suppresses AOM/DSS-induced inflammatory colon carcinogenesis with modulation of molecular markers of colorectal carcinogenesis. Dietary suppression of CRC using CA supplementation was achieved in Nrf2+/+ but not in Nrf2−/− mice confirming the Nrf2-dependence of CA-induced chemopreventive effects. Taken together, our data suggest feasibility of CRC suppression by dietary CA, an FDA-approved food additive derived from the third most consumed spice in the world. PMID:25712056

  6. Nrf2-dependent suppression of azoxymethane/dextran sulfate sodium-induced colon carcinogenesis by the cinnamon-derived dietary factor cinnamaldehyde.

    PubMed

    Long, Min; Tao, Shasha; Rojo de la Vega, Montserrat; Jiang, Tao; Wen, Qing; Park, Sophia L; Zhang, Donna D; Wondrak, Georg T

    2015-05-01

    The progressive nature of colorectal cancer and poor prognosis associated with the metastatic phase of the disease create an urgent need for the development of more efficacious strategies targeting colorectal carcinogenesis. Cumulative evidence suggests that the redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defence, represents a promising molecular target for colorectal cancer chemoprevention. Recently, we have identified cinnamon, the ground bark of Cinnamomum aromaticum (cassia cinnamon) and Cinnamomum verum (Ceylon cinnamon), as a rich dietary source of the Nrf2 inducer cinnamaldehyde (CA) eliciting the Nrf2-regulated antioxidant response in human epithelial colon cells, conferring cytoprotection against electrophilic and genotoxic insult. Here, we have explored the molecular mechanism underlying CA-induced Nrf2 activation in colorectal epithelial cells and have examined the chemopreventive potential of CA in a murine colorectal cancer model comparing Nrf2(+/+) with Nrf2(-/-) mice. In HCT116 cells, CA caused a Keap1-C151-dependent increase in Nrf2 protein half-life via blockage of ubiquitination with upregulation of cytoprotective Nrf2 target genes and elevation of cellular glutathione. After optimizing colorectal Nrf2 activation and target gene expression by dietary CA-supplementation regimens, we demonstrated that CA suppresses AOM/DSS-induced inflammatory colon carcinogenesis with modulation of molecular markers of colorectal carcinogenesis. Dietary suppression of colorectal cancer using CA supplementation was achieved in Nrf2(+/+) but not in Nrf2(-/-) mice confirming the Nrf2 dependence of CA-induced chemopreventive effects. Taken together, our data suggest feasibility of colorectal cancer suppression by dietary CA, an FDA-approved food additive derived from the third most consumed spice in the world.

  7. Targeting Nrf2 Signaling to Combat Chemoresistance

    PubMed Central

    No, Jae Hong; Kim, Yong-Beom; Song, Yong Sang

    2014-01-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that upregulates expression of a battery of genes to combat oxidative and electrophilic stress. Modification of Kelch-like ECH-associated protein 1 (Keap1) by reactive oxygen species stabilizes Nrf2 by escaping from degradation. Nrf2 then binds to antioxidant response elements (AREs) on the promoter region of various genes. Activation of the Keap1-Nrf2-ARE pathway plays critical roles in the chemopreventive effect of various phytochemicals. However, Nrf2 can protect cancer cells from oxidative stress and promote cell proliferation. Moreover, recent studies reveal that activation of the Nrf2 pathway is critical for resistance to chemotherapeutic agents. The aim of this review is to provide a molecular basis for the use of Nrf2 inhibitors in overcoming chemoresistance. PMID:25337579

  8. NRF2, cancer and calorie restriction

    PubMed Central

    Martín-Montalvo, A; Villalba, JM; Navas, P; de Cabo, R

    2015-01-01

    The transcription factor NF-E2-related factor (NRF2) is a key regulator of several enzymatic pathways, including cytoprotective enzymes in highly metabolic organs. In this review, we summarize the ongoing research related to NRF2 activity in cancer development, focusing on in vivo studies using NRF2 knockout (KO) mice, which have helped in defining the crucial role of NRF2 in chemoprevention. The lower cancer protection observed in NRF2 KO mice under calorie restriction (CR) suggests that most of the beneficial effects of CR on the carcinogenesis process are likely mediated by NRF2. We propose that future interventions in cancer treatment would be carried out through the activation of NRF2 in somatic cells, which will lead to a delay or prevention of the onset of some forms of human cancers, and subsequently an extension of health- and lifespan. PMID:21057541

  9. Targeting the transcription factor Nrf2 to ameliorate oxidative stress and inflammation in chronic kidney disease.

    PubMed

    Ruiz, Stacey; Pergola, Pablo E; Zager, Richard A; Vaziri, Nosratola D

    2013-06-01

    Oxidative stress and inflammation are mediators in the development and progression of chronic kidney disease (CKD) and its complications, and they are inseparably linked as each begets and amplifies the other. CKD-associated oxidative stress is due to increased production of reactive oxygen species (ROS) and diminished antioxidant capacity. The latter is largely caused by impaired activation of Nrf2, the transcription factor that regulates genes encoding antioxidant and detoxifying molecules. Protective effects of Nrf2 are evidenced by amelioration of oxidative stress, inflammation, and kidney disease in response to natural Nrf2 activators in animal models, while Nrf2 deletion amplifies these pathogenic pathways and leads to autoimmune nephritis. Given the role of impaired Nrf2 activity in CKD-induced oxidative stress and inflammation, interventions aimed at restoring Nrf2 may be effective in retarding CKD progression. Clinical trials of the potent Nrf2 activator bardoxolone methyl showed significant improvement in renal function in CKD patients with type 2 diabetes. However, due to unforeseen complications the BEACON trial, which was designed to investigate the effect of this drug on time to end-stage renal disease or cardiovascular death in patients with advanced CKD, was prematurely terminated. This article provides an overview of the role of impaired Nrf2 activity in the pathogenesis of CKD-associated oxidative stress and inflammation and the potential utility of targeting Nrf2 in the treatment of CKD.

  10. Low and high dose UVB regulation of transcription factor NF-E2-related factor 2.

    PubMed

    Kannan, Sankaranarayanan; Jaiswal, Anil K

    2006-09-01

    Transcription factor NF-E2-related factor 2 (Nrf2) regulates antioxidant response element (ARE)-mediated expression and coordinated induction of chemoprotective proteins in response to chemical stress. In this report, we investigated Nrf2 response to low and high dose UVB irradiation. Low dose (7.5 J/m(2)) UVB exposure of mouse hepatoma, mouse keratinocyte, and human skin fibroblast cells led to the nuclear accumulation of Nrf2 and up-regulation of ARE-mediated gene expression. On the contrary, and intriguingly, high dose (20 J/m(2)) UVB exposure of cells led to the nuclear exclusion of Nrf2 and down-regulation of chemoprotective gene expression with possible implications in UVB carcinogenesis. We investigated the mechanism by which high dose UVB induced the nuclear exclusion of Nrf2. Prior treatment with nuclear export inhibitor, leptomycin B, abrogated the UVB-induced nuclear exclusion of Nrf2, indicating that the decrease of Nrf2 in the nucleus was due to the nuclear export of Nrf2. High dose UVB increased the phosphorylation of Nrf2Y568 which stimulated the nuclear export of Nrf2. Mutation of Nrf2Y568 to phenylalanine and src kinase inhibitor PP2 abrogated/reduced the UVB-induced phosphorylation of Nrf2Y568 and nuclear exclusion of Nrf2. Transfection with src family member Fyn small interfering RNA resulted in the nuclear accumulation of Nrf2 and an increase in the expression and UVB induction of ARE-mediated gene expression. UVB exposure also induced the nuclear localization of Fyn. These results suggest that high dose UVB induced the activation/nuclear localization of Fyn which led to increased phosphorylation of Nrf2Y568 and enhanced nuclear export of Nrf2. This resulted in nuclear exclusion of Nrf2 and down-regulation of ARE-mediated chemoprotective gene expression.

  11. Glycosylation enables aesculin to activate Nrf2

    PubMed Central

    Kim, Kyun Ha; Park, Hyunsu; Park, Hee Jin; Choi, Kyoung-Hwa; Sadikot, Ruxana T.; Cha, Jaeho; Joo, Myungsoo

    2016-01-01

    Since aesculin, 6,7-dihydroxycoumarin-6-O-β-glucopyranoside, suppresses inflammation, we asked whether its anti-inflammatory activity is associated with the activation of nuclear factor-E2-related factor 2 (Nrf2), a key anti-inflammatory factor. Our results, however, show that aesculin marginally activated Nrf2. Since glycosylation can enhance the function of a compound, we then asked whether adding a glucose makes aesculin activate Nrf2. Our results show that the glycosylated aesculin, 3-O-β-d-glycosyl aesculin, robustly activated Nrf2, inducing the expression of Nrf2-dependent genes, such as heme oxygenase-1, glutamate-cysteine ligase catalytic subunit, and NAD(P)H quinone oxidoreductase 1 in macrophages. Mechanistically, 3-O-β-d-glycosyl aesculin suppressed ubiquitination of Nrf2, retarding degradation of Nrf2. Unlike aesculin, 3-O-β-d-glycosyl aesculin significantly suppressed neutrophilic lung inflammation, a hallmark of acute lung injury (ALI), in mice, which was not recapitulated in Nrf2 knockout mice, suggesting that the anti-inflammatory function of the compound largely acts through Nrf2. In a mouse model of sepsis, a major cause of ALI, 3-O-β-d-glycosyl aesculin significantly enhanced the survival of mice, compared with aesculin. Together, these results show that glycosylation could confer the ability to activate Nrf2 on aesculin, enhancing the anti-inflammatory function of aesculin. These results suggest that glycosylation can be a way to improve or alter the function of aesculin. PMID:27417293

  12. Nuclear transcription factor Nrf2 suppresses prostate cancer cells growth and migration through upregulating ferroportin.

    PubMed

    Xue, Dong; Zhou, Cuixing; Shi, Yunbo; Lu, Hao; Xu, Renfang; He, Xiaozhou

    2016-11-29

    VTo investigate the effect of nuclear transcription factor Nrf2 on the transcription of Ferroportin (FPN) in prostate cancer cells, and the regulation mechanisms of FPN on cell viability, migration and apoptosis of prostate cancer cells.Empty vectors, pEGFPC1-Nrf2, pEGFPC1-FPN, Si-FPN and Si-Nrf2 were transfected into prostate cancer cell line PC3. The expression of mRNA and protein were measured by real time-PCR (RT-PCR) and western blot. Cell viability, migration, cycle and apoptosis were tested by CCK-8 assay, wound healing and flow cytometry, respectively. The interaction between FPN and Nrf2 was confirmed by chromatin immunoprecipitation (CHIP) assay.The viability, migration and mitosis of PC3 cells could be repressed by over-expressed FPN, with decreased intracellular ferritin. The CHIP assay demonstrated that Nrf2 is one transcription factor of FPN and promotes its transcription. With the increase of Nrf2 in PC3 cells, the viability, migration ability and concentration of ferritin were suppressed, while the apoptosis rate was increased. The above effects were counteracted by down-regulating FPN.FPN could inhibit the prostate cancer cell viability, migration and mitosis, which is also related to a decrease of intracellular ferritin content. In conclusion, Nrf2 suppresses prostate cancer cells viability, migration, and mitosis through upregulating FPN.

  13. Nuclear transcription factor Nrf2 suppresses prostate cancer cells growth and migration through upregulating ferroportin

    PubMed Central

    Xue, Dong; Zhou, Cuixing; Shi, Yunbo; Lu, Hao; Xu, Renfang; He, Xiaozhou

    2016-01-01

    VTo investigate the effect of nuclear transcription factor Nrf2 on the transcription of Ferroportin (FPN) in prostate cancer cells, and the regulation mechanisms of FPN on cell viability, migration and apoptosis of prostate cancer cells. Empty vectors, pEGFPC1-Nrf2, pEGFPC1-FPN, Si-FPN and Si-Nrf2 were transfected into prostate cancer cell line PC3. The expression of mRNA and protein were measured by real time-PCR (RT-PCR) and western blot. Cell viability, migration, cycle and apoptosis were tested by CCK-8 assay, wound healing and flow cytometry, respectively. The interaction between FPN and Nrf2 was confirmed by chromatin immunoprecipitation (CHIP) assay. The viability, migration and mitosis of PC3 cells could be repressed by over-expressed FPN, with decreased intracellular ferritin. The CHIP assay demonstrated that Nrf2 is one transcription factor of FPN and promotes its transcription. With the increase of Nrf2 in PC3 cells, the viability, migration ability and concentration of ferritin were suppressed, while the apoptosis rate was increased. The above effects were counteracted by down-regulating FPN. FPN could inhibit the prostate cancer cell viability, migration and mitosis, which is also related to a decrease of intracellular ferritin content. In conclusion, Nrf2 suppresses prostate cancer cells viability, migration, and mitosis through upregulating FPN. PMID:27788496

  14. Nuclear Respiratory Factor 2β (NRF-2β) recruits NRF-2α to the nucleus by binding to importin-α:β via an unusual monopartite-type nuclear localization signal.

    PubMed

    Hayashi, Rippei; Takeuchi, Nono; Ueda, Takuya

    2013-09-23

    Nuclear respiratory factor 2 (NRF-2) is a mammalian transcription factor composed of two distinct and unrelated proteins: NRF-2α, which binds to DNA through its Ets domain, and NRF-2β, which contains the transcription activation domain. The activity of NRF-2 in neurons is regulated by nuclear localization; however, the mechanism by which NRF-2 is imported into the nucleus remains unknown. By using in vitro nuclear import assays and immuno-cytofluorescence, we dissect the nuclear import pathways of NRF-2. We show that both NRF-2α and NRF-2β contain intrinsic nuclear localization signals (NLSs): the Ets domain within NRF-2α and the NLS within NRF-2β (amino acids 311/321: EEPPAKRQCIE) that is recognized by importin-α:β. When NRF-2α and NRF-2β form a complex, the nuclear import of NRF-2αβ becomes strictly dependent on the NLS within NRF-2β. Therefore, the nuclear import mechanism of NRF-2 is unique among Ets factors. The NRF-2β NLS contains only two lysine/arginine residues, unlike other known importin-α:β-dependent NLSs. Using ELISA-based binding assays, we show that it is bound by importin-α in almost the same manner and with similar affinity to that of the classical monopartite NLSs, such as c-myc and SV40 T-antigen NLSs. However, the part of the tryptophan array of importin-α that is essential for the recognition of classical monopartite NLSs by generating apolar pockets for the P3 and the P5 lysine/arginine side chains is not required for the recognition of the NRF-2β NLS. We conclude that the NRF-2β NLS is an unusual but is, nevertheless, a bona fide monopartite-type NLS.

  15. Nrf2 protects against airway disorders

    SciTech Connect

    Cho, Hye-Youn; Kleeberger, Steven R.

    2010-04-01

    Nuclear factor-erythroid 2 related factor 2 (Nrf2) is a ubiquitous master transcription factor that regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. In the unstressed condition, Kelch-like ECH-associated protein 1 (Keap1) suppresses cellular Nrf2 in cytoplasm and drives its proteasomal degradation. Nrf2 can be activated by diverse stimuli including oxidants, pro-oxidants, antioxidants, and chemopreventive agents. Nrf2 induces cellular rescue pathways against oxidative injury, abnormal inflammatory and immune responses, apoptosis, and carcinogenesis. Application of Nrf2 germ-line mutant mice has identified an extensive range of protective roles for Nrf2 in experimental models of human disorders in the liver, gastrointestinal tract, airway, kidney, brain, circulation, and immune or nerve system. In the lung, lack of Nrf2 exacerbated toxicity caused by multiple oxidative insults including supplemental respiratory therapy (e.g., hyperoxia, mechanical ventilation), cigarette smoke, allergen, virus, bacterial endotoxin and other inflammatory agents (e.g., carrageenin), environmental pollution (e.g., particles), and a fibrotic agent bleomycin. Microarray analyses and bioinformatic studies elucidated functional AREs and Nrf2-directed genes that are critical components of signaling mechanisms in pulmonary protection by Nrf2. Association of loss of function with promoter polymorphisms in NRF2 or somatic and epigenetic mutations in KEAP1 and NRF2 has been found in cohorts of patients with acute lung injury/acute respiratory distress syndrome or lung cancer, which further supports the role for NRF2 in these lung diseases. In the current review, we address the role of Nrf2 in airways based on emerging evidence from experimental oxidative disease models and human studies.

  16. Antioxidant effects of Lactobacillus plantarum via activation of transcription factor Nrf2.

    PubMed

    Gao, Dawei; Gao, Zhengrong; Zhu, Guanghua

    2013-06-01

    The present study was undertaken to investigate antioxidant and hypolipidemic effects, as well as its molecular mechanism of wild Lactobacillus plantarum FC225 isolated from fermented cabbages. The scavenging activities of superoxide anion radical, 1,1-diphenyl-2-picrylhydrazyl radical (DPPH) and hydroxyl radical were enhanced by FC225 treatment. The strain FC225 also attenuated hyperlipidemic status, decreased lipid peroxidation, plasma cholesterol, triglyceride and low-density lipoprotein cholesterol levels in high fat diet-fed mice. Meanwhile, FC225 therapy could significantly elevate the activities of superoxidase dismutase and glutathione peroxidase, and decrease the content of malondialdehyde (MDA) in liver homogenates, whereas there was no change in catalase activity in high fat diet-fed mice. In addition, compared with the control group, FC225 markedly elevated the gene expression of nuclear factor erythroid 2-related factor 2 (Nrf2), which was in parallel with the increased value of CD4+/CD8+ ratio in the FC225-treated hyperlipidemic mice. The results demonstrated that the strain FC225 confers hypolipidemic and antioxidant protective effects which may be attributable to Nrf2 signal pathway mediated antioxidant enzyme expression.

  17. Expression of Nrf2 in Neurodegenerative Diseases

    PubMed Central

    Ramsey, Chenere P.; Glass, Charles A.; Montgomery, Marshall B.; Lindl, Kathryn A.; Ritson, Gillian P.; Chia, Luis A.; Hamilton, Ronald L.; Chu, Charleen T.; Jordan-Sciutto, Kelly L.

    2008-01-01

    In response to oxidative stress, the nuclear factor E2-related factor 2 (Nrf2) transcription factor translocates from the cytoplasm into the nucleus and transactivates expression of genes with antioxidant activity. Despite this cellular mechanism, oxidative damage is abundant in Alzheimer and Parkinson disease (AD and PD). To investigate mechanisms by which Nrf2 activity may be aberrant or insufficient in neurodegenerative conditions, we assessed Nrf2 localization in affected brain regions of AD, Lewy body variant of AD (LBVAD), and PD. By immunohistochemistry, Nrf2 is expressed in both the nucleus and the cytoplasm of neurons in normal hippocampi with predominant expression in the nucleus. In AD and LBVAD, Nrf2 was predominantly cytoplasmic in hippocampal neurons and was not a major component of beta amyloid plaques or neurofibrillary tangles. By immunoblotting, we observed a significant decrease in nuclear Nrf2 levels in AD cases. In contrast, Nrf2 was strongly nuclear in PD nigral neurons but cytoplasmic in substantia nigra of normal, AD, and LBVAD cases. These findings suggest that Nrf2-mediated transcription is not induced in neurons in AD despite the presence of oxidative stress. In PD, nuclear localization of Nrf2 is strongly induced, but this response may be insufficient to protect neurons from degeneration. PMID:17204939

  18. Nrf2 deficiency impairs fracture healing in mice.

    PubMed

    Lippross, Sebastian; Beckmann, Rainer; Streubesand, Nadine; Ayub, Ferda; Tohidnezhad, Mersedeh; Campbell, Graeme; Kan, Yuet Wai; Horst, Fischer; Sönmez, Tolga Taha; Varoga, Deike; Lichte, Philipp; Jahr, Holger; Pufe, Thomas; Wruck, Christoph Jan

    2014-10-01

    Oxidative stress plays an important role in wound healing but data relating oxidative stress to fracture healing are scarce. Nuclear factor erythroid 2-related factor 2 (Nrf2) is the major transcription factor that controls the cellular defence essential to combat oxidative stress by regulating the expression of antioxidative enzymes. This study examined the impact of Nrf2 on fracture healing using a standard closed femoral shaft fracture model in wild-type (WT) and Nrf2-knockout (Nrf2-KO)-mice. Healing was evaluated by histology, real-time RT-PCR, µCT and biomechanical measurements. We showed that Nrf2 expression is activated during fracture healing. Bone healing and remodelling were retarded in the Nrf2-KO compared to the WT-mice. Nrf2-KO-mice developed significantly less callus tissue compared to WT-mice. In addition, biomechanical testing demonstrated lower strength against shear stress in the Nrf2-KO-group compared to WT. The expression of vascular endothelial growth factor (VEGF) and osteocalcin is reduced during fracture healing in Nrf2-KO-mice. Taken together, our results demonstrate that Nrf2 deficiency in mice results in impaired fracture healing suggesting that Nrf2 plays an essential role in bone regeneration. Pharmacological activation of Nrf2 may have therapeutic potential for the enhancement of fracture healing.

  19. Lannea coromandelica (Houtt.) Merr. Induces Heme Oxygenase 1 (HO-1) Expression and Reduces Oxidative Stress via the p38/c-Jun N-Terminal Kinase–Nuclear Factor Erythroid 2-Related Factor 2 (p38/JNK–NRF2)-Mediated Antioxidant Pathway

    PubMed Central

    Alam, Md Badrul; Kwon, Kyoo-Ri; Lee, Seok-Hyun; Lee, Sang-Han

    2017-01-01

    The leaves of Lannea coromandelica (Houtt.) Merr. are used in the Garo, Pahan, and Teli tribal communities of Bangladesh as a traditional medicinal plant to treat hepatitis, diabetes, ulcers, heart disease, and dysentery. However, there have been limited phytochemical and biological studies on the bark of L. coromandelica. This study aimed to investigate the antioxidant activities of L. coromandelica bark extract (LCBE) and the underlying mechanism using RAW 264.7 cells. The LCBE was analysed by high-pressure liquid chromatography (HPLC) to detect its key polyphenolic compounds. Various in vitro antioxidant assays were performed using RAW 264.7 cells to assess the antioxidant effects of the LCBE and to understand the underlying molecular mechanism. HPLC revealed the presence of gallic acid, (−)-epigallocatechin-3-gallate, catechin, chlorogenic acid, and caffeic acid in the LCBE. The extract showed a very potent capacity to scavenge numerous free radicals through hydrogen atom transfer and/or electron donation and also quenched cellular reactive oxygen species (ROS) generation without showing any toxicity. The LCBE was found to combat the oxidative stress by enhancing the expression, at both transcriptional and translational levels, of primary antioxidant enzymes as well as phase II detoxifying enzymes, especially heme oxygenase 1, through the upregulation of the nuclear factor erythroid 2-related factor 2 (NRF2)-mediated pathway in RAW 264.7 cells via the phosphorylation of p38 kinase and c-Jun N-terminal kinase (JNK). The LCBE exhibited strong antioxidant activities and mitigated the cellular ROS production. These results provide scientific evidence of its potential as an ideal applicant for a cost-effective, readily available, and natural phytochemical, as well as a strategy for preventing diseases associated with oxidative stress and attenuating disease progress. PMID:28146074

  20. Nrf2 Weaves an Elaborate Network of Neuroprotection Against Stroke.

    PubMed

    Jiang, Shuai; Deng, Chao; Lv, Jianjun; Fan, Chongxi; Hu, Wei; Di, Shouyin; Yan, Xiaolong; Ma, Zhiqiang; Liang, Zhenxing; Yang, Yang

    2017-03-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a neuroprotective transcription factor that has recently attracted increased attention. Stroke, a common and serious neurological disease, is currently a leading cause of death in the USA so far. It is therefore of vital importance to explore how Nrf2 behaves in stroke. In this review, we first introduce the structural features of Nrf2 and Kelch-like ECH-associated protein 1 (Keap1) and briefly depict the activation, inactivation, and regulation processes of the Nrf2 pathway. Next, we discuss the physiopathological mechanisms, upstream modulators, and downstream targets of the Nrf2 pathway. Following this background, we expand our discussion to the roles of Nrf2 in ischemic and hemorrhagic stroke and provide several potential future directions. The information presented here may be useful in the design of future experimental research and increase the likelihood of using Nrf2 as a therapeutic target for stroke in the future.

  1. Multiorgan autoimmune inflammation, enhanced lymphoproliferation, and impaired homeostasis of reactive oxygen species in mice lacking the antioxidant-activated transcription factor Nrf2.

    PubMed

    Ma, Qiang; Battelli, Lori; Hubbs, Ann F

    2006-06-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is an antioxidant-activated cap "n" collar basic leucine zipper transcription factor. To assess the function of Nrf2 in the antioxidant response, we examined mice with targeted disruption of the Nrf2 gene. Nrf2-null mice developed complex disease manifestations, with a majority exhibiting a lupus-like autoimmune syndrome characterized by multiorgan inflammatory lesions with a marked female predominance, appearance of anti-double-stranded DNA antibodies in young adulthood, intravascular deposition of immunoglobulin complexes in blood vessels, and premature death due to rapidly progressing membranoproliferative glomerular nephritis. Mechanistic analyses revealed that the null mice showed enhanced proliferative response of CD4+ T cells, altered ratios of CD4+ and CD8+ cells, and increased oxidative lesions in tissues. Analyses of antioxidant-induced gene expression showed that the knockout mice were devoid of the basal and inducible expression of certain phase 2 detoxification enzymes and antioxidant genes in hepatic and lymphoid cells in vivo. Our findings suggest that Nrf2 mediates important antioxidant functions involved in the control of peripheral lymphocyte homeostasis and autoimmune surveillance.

  2. Mining a human transcriptome database for Nrf2 modulators

    EPA Science Inventory

    Nuclear factor erythroid-2 related factor 2 (Nrf2) is a key transcription factor important in the protection against oxidative stress. We developed computational procedures to enable the identification of chemical, genetic and environmental modulators of Nrf2 in a large database ...

  3. Targeting NRF2 signaling for cancer chemoprevention

    SciTech Connect

    Kwak, Mi-Kyoung; Kensler, Thomas W.

    2010-04-01

    Modulation of the metabolism and disposition of carcinogens through induction of cytoprotective enzymes is one of several promising strategies to prevent cancer. Chemopreventive efficacies of inducers such as dithiolethiones and sulforaphane have been extensively studied in animals as well as in humans. The KEAP1-NRF2 system is a key, but not unilateral, molecular target for these chemopreventive agents. The transcription factor NRF2 (NF-E2-related factor 2) is a master regulator of the expression of a subset of genes, which produce proteins responsible for the detoxication of electrophiles and reactive oxygen species as well as the removal or repair of some of their damage products. It is believed that chemopreventive enzyme inducers affect the interaction between KEAP1 and NRF2 through either mediating conformational changes of the KEAP1 protein or activating phosphorylation cascades targeting the KEAP1-NRF2 complex. These events in turn affect NRF2 stability and trafficking. Recent advances elucidating the underlying structural biology of KEAP1-NRF2 signaling and identification of the gene clusters under the transcriptional control of NRF2 are facilitating understanding of the potential pleiotropic effects of NRF2 activators and discovery of novel classes of potent chemopreventive agents such as the triterpenoids. Although there is appropriately a concern regarding a deleterious role of the KEAP1-NRF2 system in cancer cell biology, especially as the pathway affects cell survival and drug resistance, the development and the use of NRF2 activators as chemopreventive agents still holds a great promise for protection of normal cells from a diversity of environmental stresses that contribute to the burden of cancer and other chronic, degenerative diseases.

  4. Nrf2 activation prevents cadmium-induced acute liver injury

    SciTech Connect

    Wu, Kai C.; Liu, Jie J.; Klaassen, Curtis D.

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  5. Hyperactivation of Nrf2 in early tubular development induces nephrogenic diabetes insipidus

    PubMed Central

    Suzuki, Takafumi; Seki, Shiori; Hiramoto, Keiichiro; Naganuma, Eriko; Kobayashi, Eri H.; Yamaoka, Ayaka; Baird, Liam; Takahashi, Nobuyuki; Sato, Hiroshi; Yamamoto, Masayuki

    2017-01-01

    NF-E2-related factor-2 (Nrf2) regulates cellular responses to oxidative and electrophilic stress. Loss of Keap1 increases Nrf2 protein levels, and Keap1-null mice die of oesophageal hyperkeratosis because of Nrf2 hyperactivation. Here we show that deletion of oesophageal Nrf2 in Keap1-null mice allows survival until adulthood, but the animals develop polyuria with low osmolality and bilateral hydronephrosis. This phenotype is caused by defects in water reabsorption that are the result of reduced aquaporin 2 levels in the kidney. Renal tubular deletion of Keap1 promotes nephrogenic diabetes insipidus features, confirming that Nrf2 activation in developing tubular cells causes a water reabsorption defect. These findings suggest that Nrf2 activity should be tightly controlled during development in order to maintain renal homeostasis. In addition, tissue-specific ablation of Nrf2 in Keap1-null mice might create useful animal models to uncover novel physiological functions of Nrf2. PMID:28233855

  6. Hyperactivation of Nrf2 in early tubular development induces nephrogenic diabetes insipidus.

    PubMed

    Suzuki, Takafumi; Seki, Shiori; Hiramoto, Keiichiro; Naganuma, Eriko; Kobayashi, Eri H; Yamaoka, Ayaka; Baird, Liam; Takahashi, Nobuyuki; Sato, Hiroshi; Yamamoto, Masayuki

    2017-02-24

    NF-E2-related factor-2 (Nrf2) regulates cellular responses to oxidative and electrophilic stress. Loss of Keap1 increases Nrf2 protein levels, and Keap1-null mice die of oesophageal hyperkeratosis because of Nrf2 hyperactivation. Here we show that deletion of oesophageal Nrf2 in Keap1-null mice allows survival until adulthood, but the animals develop polyuria with low osmolality and bilateral hydronephrosis. This phenotype is caused by defects in water reabsorption that are the result of reduced aquaporin 2 levels in the kidney. Renal tubular deletion of Keap1 promotes nephrogenic diabetes insipidus features, confirming that Nrf2 activation in developing tubular cells causes a water reabsorption defect. These findings suggest that Nrf2 activity should be tightly controlled during development in order to maintain renal homeostasis. In addition, tissue-specific ablation of Nrf2 in Keap1-null mice might create useful animal models to uncover novel physiological functions of Nrf2.

  7. Nrf2 Is an Attractive Therapeutic Target for Retinal Diseases.

    PubMed

    Nakagami, Yasuhiro

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that binds to antioxidant response elements located in the promoter region of genes encoding many antioxidant enzymes and phase II detoxifying enzymes. Activation of Nrf2 functions is one of the critical defensive mechanisms against oxidative stress in many species. The retina is constantly exposed to reactive oxygen species, and oxidative stress is a major contributor to age-related macular diseases. Moreover, the resulting inflammation and neuronal degeneration are also related to other retinal diseases. The well-known Nrf2 activators, bardoxolone methyl and its derivatives, have been the subject of a number of clinical trials, including those aimed at treating chronic kidney disease, pulmonary arterial hypertension, and mitochondrial myopathies. Recent studies suggest that Nrf2 activation protects the retina from retinal diseases. In particular, this is supported by the finding that Nrf2 knockout mice display age-related retinal degeneration. Moreover, the concept has been validated by the efficacy of Nrf2 activators in a number of retinal pathological models. We have also recently succeeded in generating a novel Nrf2 activator, RS9, using a biotransformation technique. This review discusses current links between retinal diseases and Nrf2 and the possibility of treating retinal diseases by activating the Nrf2 signaling pathway.

  8. Nrf2 Is an Attractive Therapeutic Target for Retinal Diseases

    PubMed Central

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that binds to antioxidant response elements located in the promoter region of genes encoding many antioxidant enzymes and phase II detoxifying enzymes. Activation of Nrf2 functions is one of the critical defensive mechanisms against oxidative stress in many species. The retina is constantly exposed to reactive oxygen species, and oxidative stress is a major contributor to age-related macular diseases. Moreover, the resulting inflammation and neuronal degeneration are also related to other retinal diseases. The well-known Nrf2 activators, bardoxolone methyl and its derivatives, have been the subject of a number of clinical trials, including those aimed at treating chronic kidney disease, pulmonary arterial hypertension, and mitochondrial myopathies. Recent studies suggest that Nrf2 activation protects the retina from retinal diseases. In particular, this is supported by the finding that Nrf2 knockout mice display age-related retinal degeneration. Moreover, the concept has been validated by the efficacy of Nrf2 activators in a number of retinal pathological models. We have also recently succeeded in generating a novel Nrf2 activator, RS9, using a biotransformation technique. This review discusses current links between retinal diseases and Nrf2 and the possibility of treating retinal diseases by activating the Nrf2 signaling pathway. PMID:27818722

  9. Translational control of Nrf2 within the open reading frame

    SciTech Connect

    Perez-Leal, Oscar Barrero, Carlos A.; Merali, Salim

    2013-07-19

    Highlights: •Identification of a novel Nrf2 translational repression mechanism. •The repressor is within the 3′ portion of the Nrf2 ORF. •The translation of Nrf2 or eGFP is reduced by the regulatory element. •The translational repression can be reversed with synonymous codon substitutions. •The molecular mechanism requires the mRNA sequence, but not the encoded amino acids. -- Abstract: Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required – a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3′ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state.

  10. Effects of deletion of the transcription factor Nrf2 and benzo[a]pyrene treatment on ovarian follicles and ovarian surface epithelial cells in mice

    PubMed Central

    Lim, Jinhwan; Ortiz, Laura; Nakamura, Brooke N.; Hoang, Yvonne D.; Banuelos, Jesus; Flores, Victoria N.; Chan, Jefferson Y.; Luderer, Ulrike

    2015-01-01

    Polycyclic aromatic hydrocarbons, like benzo[a]pyrene (BaP), are ubiquitous environmental pollutants and potent ovarian toxicants. The transcription factor NRF2 is an important regulator of the cellular response to electrophilic toxicants like BaP and to oxidative stress. NRF2 regulates transcription of genes involved in the detoxification of reactive metabolites of BaP and reactive oxygen species. We therefore hypothesized that Nrf2−/− mice have accelerated ovarian aging and increased sensitivity to the ovarian toxicity of BaP. A single injection of BaP dose-dependently depleted ovarian follicles in Nrf2+/+ and Nrf2−/− mice, but the effects of BaP were not enhanced in the absence of Nrf2. Similarly, Nrf2−/− mice did not have increased ovarian BaP DNA adduct formation compared to Nrf2+/+ mice. Ovarian follicle numbers did not differ between peripubertal Nrf2−/− and Nrf2+/+ mice, but by middle age, Nrf2−/− mice had significantly fewer primordial follicles than Nrf2+/+ mice, consistent with accelerated ovarian aging. PMID:26247513

  11. The Cinnamon-derived Dietary Factor Cinnamic Aldehyde Activates the Nrf2-dependent Antioxidant Response in Human Epithelial Colon Cells

    PubMed Central

    Wondrak, Georg T.; Villeneuve, Nicole F.; Lamore, Sarah D.; Bause, Alexandra S.; Jiang, Tao; Zhang, Donna D.

    2011-01-01

    Colorectal cancer (CRC) is a major cause of tumor-related morbidity and mortality worldwide. Recent research suggests that pharmacological intervention using dietary factors that activate the redox sensitive Nrf2/Keap1-ARE signaling pathway may represent a promising strategy for chemoprevention of human cancer including CRC. In our search for dietary Nrf2 activators with potential chemopreventive activity targeting CRC, we have focused our studies on trans-cinnamic aldehyde (cinnamaldeyde, CA), the key flavor compound in cinnamon essential oil. Here we demonstrate that CA and an ethanolic extract (CE) prepared from Cinnamomum cassia bark, standardized for CA content by GC-MS analysis, display equipotent activity as inducers of Nrf2 transcriptional activity. In human colon cancer cells (HCT116, HT29) and non-immortalized primary fetal colon cells (FHC), CA- and CE-treatment upregulated cellular protein levels of Nrf2 and established Nrf2 targets involved in the antioxidant response including heme oxygenase 1 (HO-1) and γ-glutamylcysteine synthetase (γ-GCS, catalytic subunit). CA- and CE-pretreatment strongly upregulated cellular glutathione levels and protected HCT116 cells against hydrogen peroxide-induced genotoxicity and arsenic-induced oxidative insult. Taken together our data demonstrate that the cinnamon-derived food factor CA is a potent activator of the Nrf2-orchestrated antioxidant response in cultured human epithelial colon cells. CA may therefore represent an underappreciated chemopreventive dietary factor targeting colorectal carcinogenesis. PMID:20657484

  12. The cinnamon-derived dietary factor cinnamic aldehyde activates the Nrf2-dependent antioxidant response in human epithelial colon cells.

    PubMed

    Wondrak, Georg Thomas; Villeneuve, Nicole F; Lamore, Sarah D; Bause, Alexandra S; Jiang, Tao; Zhang, Donna D

    2010-05-07

    Colorectal cancer (CRC) is a major cause of tumor-related morbidity and mortality worldwide. Recent research suggests that pharmacological intervention using dietary factors that activate the redox sensitive Nrf2/Keap1-ARE signaling pathway may represent a promising strategy for chemoprevention of human cancer including CRC. In our search for dietary Nrf2 activators with potential chemopreventive activity targeting CRC, we have focused our studies on trans-cinnamic aldehyde (cinnamaldeyde, CA), the key flavor compound in cinnamon essential oil. Here we demonstrate that CA and an ethanolic extract (CE) prepared from Cinnamomum cassia bark, standardized for CA content by GC-MS analysis, display equipotent activity as inducers of Nrf2 transcriptional activity. In human colon cancer cells (HCT116, HT29) and non-immortalized primary fetal colon cells (FHC), CA- and CE-treatment upregulated cellular protein levels of Nrf2 and established Nrf2 targets involved in the antioxidant response including heme oxygenase 1 (HO-1) and gamma-glutamyl-cysteine synthetase (gamma-GCS, catalytic subunit). CA- and CE-pretreatment strongly upregulated cellular glutathione levels and protected HCT116 cells against hydrogen peroxide-induced genotoxicity and arsenic-induced oxidative insult. Taken together our data demonstrate that the cinnamon-derived food factor CA is a potent activator of the Nrf2-orchestrated antioxidant response in cultured human epithelial colon cells. CA may therefore represent an underappreciated chemopreventive dietary factor targeting colorectal carcinogenesis.

  13. Resveratrol preconditioning protects against cerebral ischemic injury via Nrf2

    PubMed Central

    Narayanan, Srinivasan V.; Dave, Kunjan R.; Saul, Isa; Perez-Pinzon, Miguel A.

    2015-01-01

    Background and Purpose Nuclear erythroid 2 related factor 2 (Nrf2) is an astrocyte-enriched transcription factor that has previously been shown to upregulate cellular antioxidant systems in response to ischemia. While resveratrol preconditioning (RPC) has emerged as a potential neuroprotective therapy, the involvement of Nrf2 in RPC-induced neuroprotection and mitochondrial reactive oxygen species (ROS) production following cerebral ischemia remains unclear. The goal of our study was to study the contribution of Nrf2 to RPC and its effects on mitochondrial function. Methods We used rodent astrocyte cultures and an in vivo stroke model with RPC. An Nrf2 DNA-binding ELISA and protein analysis via Western blotting of downstream Nrf2 targets were performed to determine RPC-induced activation of Nrf2 in rat and mouse astrocytes. Following RPC, mitochondrial function was determined by measuring ROS production and mitochondrial respiration in both wild-type (WT) and Nrf2−/− mice. Infarct volume was measured to determine neuroprotection, while protein levels were measured by immunoblotting. Results We report that Nrf2 is activated by RPC in rodent astrocyte cultures, and that loss of Nrf2 reduced RPC-mediated neuroprotection in a mouse model of focal cerebral ischemia. In addition, we observed that wild-type and Nrf2−/− cortical mitochondria exhibited increased uncoupling and ROS production following RPC treatments, Finally, Nrf2−/− astrocytes exhibited decreased mitochondrial antioxidant expression and were unable to upregulate cellular antioxidants following RPC treatment. Conclusion Nrf2 contributes to RPC-induced neuroprotection through maintaining mitochondrial coupling and antioxidant protein expression. PMID:25908459

  14. Sestrin 2 protein regulates platelet-derived growth factor receptor β (Pdgfrβ) expression by modulating proteasomal and Nrf2 transcription factor functions.

    PubMed

    Tomasovic, Ana; Kurrle, Nina; Sürün, Duran; Heidler, Juliana; Husnjak, Koraljka; Poser, Ina; Schnütgen, Frank; Scheibe, Susan; Seimetz, Michael; Jaksch, Peter; Hyman, Anthony; Weissmann, Norbert; von Melchner, Harald

    2015-04-10

    We recently identified the antioxidant protein Sestrin 2 (Sesn2) as a suppressor of platelet-derived growth factor receptor β (Pdgfrβ) signaling and Pdgfrβ signaling as an inducer of lung regeneration and injury repair. Here, we identified Sesn2 and the antioxidant gene inducer nuclear factor erythroid 2-related factor 2 (Nrf2) as positive regulators of proteasomal function. Inactivation of Sesn2 or Nrf2 induced reactive oxygen species-mediated proteasomal inhibition and Pdgfrβ accumulation. Using bacterial artificial chromosome (BAC) transgenic HeLa and mouse embryonic stem cells stably expressing enhanced green fluorescent protein-tagged Sesn2 at nearly endogenous levels, we also showed that Sesn2 physically interacts with 2-Cys peroxiredoxins and Nrf2 albeit under different reductive conditions. Overall, we characterized a novel, redox-sensitive Sesn2/Pdgfrβ suppressor pathway that negatively interferes with lung regeneration and is up-regulated in the emphysematous lungs of patients with chronic obstructive pulmonary disease (COPD).

  15. Inhibition of liver fibrosis by solubilized coenzyme Q10: Role of Nrf2 activation in inhibiting transforming growth factor-beta1 expression

    SciTech Connect

    Choi, Hoo-Kyun; Pokharel, Yuba Raj; Lim, Sung Chul; Han, Hyo-Kyung; Ryu, Chang Seon; Kim, Sang Kyum; Kwak, Mi Kyong; Kang, Keon Wook

    2009-11-01

    Coenzyme Q10 (CoQ10), an endogenous antioxidant, is important in oxidative phosphorylation in mitochondria. It has anti-diabetic and anti-cardiovascular disease effects, but its ability to protect against liver fibrosis has not been studied. Here, we assessed the ability of solubilized CoQ10 to improve dimethylnitrosamine (DMN)-induced liver fibrogenesis in mice. DMN treatments for 3 weeks produced a marked liver fibrosis as assessed by histopathological examination and tissue 4-hydroxyproline content. Solubilized CoQ10 (10 and 30 mg/kg) significantly inhibited both the increases in fibrosis score and 4-hydroxyproline content induced by DMN. Reverse transcription-polymerase chain reaction and Western blot analyses revealed that solubilized CoQ10 inhibited increases in the transforming growth factor-beta1 (TGF-beta1) mRNA and alpha-smooth muscle actin (alpha-SMA) protein by DMN. Interestingly, hepatic glutamate-cysteine ligase (GCL) and glutathione S-transferase A2 (GSTA2) were up-regulated in mice treated with CoQ10. Solubilized CoQ10 also up-regulated antioxidant enzymes such as catalytic subunits of GCL and GSTA2 via activating NF-E2 related factor2 (Nrf2)/antioxidant response element (ARE) in H4IIE hepatoma cells. Moreover, CoQ10's inhibition of alpha-SMA and TGF-beta1 expressions disappeared in Nrf2-null MEF cells. In contrast, Nrf2 overexpression significantly decreased the basal expression levels of alpha-SMA and TGF-beta1 in Nrf2-null MEF cells. These results demonstrated that solubilized CoQ10 inhibited DMN-induced liver fibrosis through suppression of TGF-beta1 expression via Nrf2/ARE activation.

  16. Trafficking of the Transcription Factor Nrf2 to Promyelocytic Leukemia-Nuclear Bodies

    PubMed Central

    Malloy, Melanie Theodore; McIntosh, Deneshia J.; Walters, Treniqka S.; Flores, Andrea; Goodwin, J. Shawn; Arinze, Ifeanyi J.

    2013-01-01

    Ubiquitylation of Nrf2 by the Keap1-Cullin3/RING box1 (Cul3-Rbx1) E3 ubiquitin ligase complex targets Nrf2 for proteasomal degradation in the cytoplasm and is an extensively studied mechanism for regulating the cellular level of Nrf2. Although mechanistic details are lacking, reports abound that Nrf2 can also be degraded in the nucleus. Here, we demonstrate that Nrf2 is a target for sumoylation by both SUMO-1 and SUMO-2. HepG2 cells treated with As2O3, which enhances attachment of SUMO-2/3 to target proteins, increased SUMO-2/3-modification (polysumoylation) of Nrf2. We show that Nrf2 traffics, in part, to promyelocytic leukemia-nuclear bodies (PML-NBs). Cell fractions harboring key components of PML-NBs did not contain biologically active Keap1 but contained modified Nrf2 as well as RING finger protein 4 (RNF4), a poly-SUMO-specific E3 ubiquitin ligase. Overexpression of wild-type RNF4, but not the catalytically inactive mutant, decreased the steady-state levels of Nrf2, measured in the PML-NB-enriched cell fraction. The proteasome inhibitor MG-132 interfered with this decrease, resulting in elevated levels of polysumoylated Nrf2 that was also ubiquitylated. Wild-type RNF4 accelerated the half-life (t½) of Nrf2, measured in PML-NB-enriched cell fractions. These results suggest that RNF4 mediates polyubiquitylation of polysumoylated Nrf2, leading to its subsequent degradation in PML-NBs. Overall, this work identifies Nrf2 as a target for sumoylation and provides a novel mechanism for its degradation in the nucleus, independent of Keap1. PMID:23543742

  17. Role of Nrf2 in preventing ethanol-induced oxidative stress and lipid accumulation

    SciTech Connect

    Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-08-01

    Oxidative stress and lipid accumulation play important roles in alcohol-induced liver injury. Previous reports showed that, in livers of nuclear factor erythroid 2-related factor 2 (Nrf2)-activated mice, genes involved in antioxidant defense are induced, whereas genes involved in lipid biosynthesis are suppressed. To investigate the role of Nrf2 in ethanol-induced hepatic alterations, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation, were treated with ethanol (5 g/kg, po). Blood and liver samples were collected 6 h thereafter. Ethanol increased alanine aminotransferase and lactate dehydrogenase activities as well as thiobarbituric acid reactive substances in serum of Nrf2-null and wild-type mice, but not in Nrf2-enhanced mice. After ethanol administration, mitochondrial glutathione concentrations decreased markedly in Nrf2-null mice but not in Nrf2-enhanced mice. H{sub 2}DCFDA staining of primary hepatocytes isolated from the four genotypes of mice indicates that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. Ethanol increased serum triglycerides and hepatic free fatty acids in Nrf2-null mice, and these increases were blunted in Nrf2-enhanced mice. In addition, the basal mRNA and nuclear protein levels of sterol regulatory element-binding protein 1(Srebp-1) were decreased with graded Nrf2 activation. Ethanol further induced Srebp-1 mRNA in Nrf2-null mice but not in Nrf2-enhanced mice. In conclusion, Nrf2 activation prevented alcohol-induced oxidative stress and accumulation of free fatty acids in liver by increasing genes involved in antioxidant defense and decreasing genes involved in lipogenesis. -- Highlights: ► Ethanol depleted mitochondrial GSH in Nrf2-null mice but not in Keap1-KD mice. ► Ethanol increased ROS in hepatocytes isolated from Nrf2-null and wild

  18. Enhancement of the Effect of Methyl Pyropheophorbide-a-Mediated Photodynamic Therapy was Achieved by Increasing ROS via Inhibition of Nrf2-HO-1 or Nrf2-ABCG2 Signaling.

    PubMed

    Tian, Si; Yong, Min; Zhu, Jiang; Zhang, Li; Pan, Li; Chen, Qing; Li, Kai-Ting; Kong, Yu-Han; Jiang, Yuan; Yu, Ting-He; Yu, Le-Hua; Bai, Ding-Qun

    2017-03-27

    Emerging evidence indicates that the transcription factor nuclear factor-E2-related factor 2 (-NRF2) plays an essential role in cellular defense against oxidative stress; its activation has been related to cytoprotection. Here, we investigated the role of Nrf2 in improving the efficacy of methyl pyropheophorbide-a-mediated photodynamic therapy (Mppa-PDT) via the downregulation of Nrf2 in human ovarian cancer A2780 cells and SKOV3 cells. We found that Nrf2 translocated from the cytoplasm to the nucleus in vitro and in vivo, and the expression of Nrf2 and P-Nrf2 increased through a possible mechanism regulated by mitogen-activated protein kinase (MAPK) after Mppa-PDT treatment. Furthermore, cytotoxicity and apoptosis induced by Mppa-PDT increased after Nrf2down-regulation. Nrf2 down -regulation increased reactive oxygen species (ROS) levels by attenuating antioxidants or pumping Mppa out of cells, which resulted from the inhibition of Nrf2-HO-1 or Nrf2-ABCG2 signaling. In addition, SKOV3 cells exhibited increased resistance to Mppa-PDT, and the expression levels of P-Nrf2 and ABCG2 were higher in SKOV3 cells than in A2780 cells, suggesting that Nrf2-ABCG2 signaling might be involved in the intrinsic resistanceto Mppa-PDT. Taken together, these results provided evidence that Nrf2 down-regulation can enhance the effect of Mppa-PDT.

  19. Nuclear Factor Erythroid 2-Related Factor 2 Deletion Impairs Glucose Tolerance and Exacerbates Hyperglycemia in Type 1 Diabetic MiceS⃞

    PubMed Central

    Aleksunes, Lauren M.; Reisman, Scott A.; Yeager, Ronnie L.; Goedken, Michael J.

    2010-01-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic β-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum β-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels. PMID:20086057

  20. Mitochondrial permeabilization without caspase activation mediates the increase of basal apoptosis in cells lacking Nrf2.

    PubMed

    Ariza, Julia; González-Reyes, José A; Jódar, Laura; Díaz-Ruiz, Alberto; de Cabo, Rafael; Villalba, José Manuel

    2016-06-01

    Nuclear factor E2-related factor-2 (Nrf2) is a cap'n'collar/basic leucine zipper (b-ZIP) transcription factor which acts as sensor of oxidative and electrophilic stress. Low levels of Nrf2 predispose cells to chemical carcinogenesis but a dark side of Nrf2 function also exists because its unrestrained activation may allow the survival of potentially dangerous damaged cells. Since Nrf2 inhibition may be of therapeutic interest in cancer, and a decrease of Nrf2 activity may be related with degenerative changes associated with aging, it is important to investigate how the lack of Nrf2 function activates molecular mechanisms mediating cell death. Murine Embryonic Fibroblasts (MEFs) bearing a Nrf2 deletion (Nrf2KO) displayed diminished cellular growth rate and shortened lifespan compared with wild-type MEFs. Basal rates of DNA fragmentation and histone H2A.X phosphorylation were higher in Nrf2KO MEFs, although steady-state levels of reactive oxygen species were not significantly increased. Enhanced rates of apoptotic DNA fragmentation were confirmed in liver and lung tissues from Nrf2KO mice. Apoptosis in Nrf2KO MEFs was associated with a decrease of Bcl-2 but not Bax levels, and with the release of the mitochondrial pro-apoptotic factors cytochrome c and AIF. Procaspase-9 and Apaf-1 were also increased in Nrf2KO MEFs but caspase-3 was not activated. Inhibition of XIAP increased death in Nrf2KO but not in wild-type MEFs. Mitochondrial ultrastructure was also altered in Nrf2KO MEFs. Our results support that Nrf2 deletion produces mitochondrial dysfunction associated with mitochondrial permeabilization, increasing basal apoptosis through a caspase-independent and AIF-dependent pathway.

  1. Nuclear factor erythroid 2-related factor 2 facilitates neuronal glutathione synthesis by upregulating neuronal excitatory amino acid transporter 3 expression.

    PubMed

    Escartin, Carole; Won, Seok Joon; Malgorn, Carole; Auregan, Gwennaelle; Berman, Ari E; Chen, Pei-Chun; Déglon, Nicole; Johnson, Jeffrey A; Suh, Sang Won; Swanson, Raymond A

    2011-05-18

    Astrocytes support neuronal antioxidant capacity by releasing glutathione, which is cleaved to cysteine in brain extracellular space. Free cysteine is then taken up by neurons through excitatory amino acid transporter 3 [EAAT3; also termed Slc1a1 (solute carrier family 1 member 1)] to support de novo glutathione synthesis. Activation of the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant responsive element (ARE) pathway by oxidative stress promotes astrocyte release of glutathione, but it remains unknown how this release is coupled to neuronal glutathione synthesis. Here we evaluated transcriptional regulation of the neuronal cysteine transporter EAAT3 by the Nrf2-ARE pathway. Nrf2 activators and Nrf2 overexpression both produced EAAT3 transcriptional activation in C6 cells. A conserved ARE-related sequence was found in the EAAT3 promoter of several mammalian species. This ARE-related sequence was bound by Nrf2 in mouse neurons in vivo as observed by chromatin immunoprecipitation. Chemical activation of the Nrf2-ARE pathway in mouse brain increased both neuronal EAAT3 levels and neuronal glutathione content, and these effects were abrogated in mice genetically deficient in either Nrf2 or EAAT3. Selective overexpression of Nrf2 in brain neurons by lentiviral gene transfer was sufficient to upregulate both neuronal EAAT3 protein and glutathione content. These findings identify a mechanism whereby Nrf2 activation can coordinate astrocyte glutathione release with neuronal glutathione synthesis through transcriptional upregulation of neuronal EAAT3 expression.

  2. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    SciTech Connect

    Mercado, Nicolas; Thimmulappa, Rajesh; Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E.; Biswal, Shyam; Ito, Kazuhiro; Barnes, Peter J.

    2011-03-11

    Research highlights: {yields} Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. {yields} HDAC inhibition decreases Nrf2 protein stability. {yields} HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. {yields} HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H{sub 2}O{sub 2}) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H{sub 2}O{sub 2}-induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  3. Rifampicin Attenuated Global Cerebral Ischemia Injury via Activating the Nuclear Factor Erythroid 2-Related Factor Pathway

    PubMed Central

    Chen, Beibei; Cao, Huimin; Chen, Lili; Yang, Xuemei; Tian, Xiaoyan; Li, Rong; Cheng, Oumei

    2016-01-01

    Background: Recent studies have found that rifampicin has neuroprotective properties in neurodegenerative diseases. However, the exact mechanisms of action remain unclear. The nuclear factor erythroid 2-related factor 2 (Nrf2) has been considered a potential target for neuroprotection. In this study, we examined whether rifampicin exhibits beneficial effects mediated by the Nrf2 pathway after global cerebral ischemia (GCI). Methods: Rats were randomly assigned to four groups that included a sham group and three treatment groups with global ischemia-reperfusion [control, rifampicin, and rifampicin plus brusatol (an inhibitor of Nrf2)]. Rats were subjected to transient GCI induced by bilateral common carotid artery occlusion for 20 min with systemic hypotension by blood withdrawal. The Morris water maze test was performed for neurobehavioral testing, whereas the pathological changes were investigated using HE and TUNEL staining. The protein expression of Nrf2, hemeoxygenase-1 (HO-1) and cyclooxygenase-2 (COX-2) in the hippocampus were analyzed by Western blotting. The immunofluorescence staining was used to determine the distribution of Nrf2. Results: Rifampicin treatment significantly improved spatial learning ability compared with the control group, which was consistent with the pathological changes. In addition, rifampicin significantly elevated the nuclear expression of Nrf2, Nrf2 downstream anti-oxidant protein, HO-1 compared with the control group, and it simultaneously downregulated the expression of COX-2 in the hippocampus on day 3 after ischemia-reperfusion. Interestingly, the forenamed effects of rifampicin were abolished by pretreatment with brusatol, a specific inhibitor of Nrf2 activation. Conclusions: Rifampicin exerts neuroprotective effects against global cerebral ischemia, which may be attributed to activation of the Nrf2 pathway. PMID:27965540

  4. The Keap1-Nrf2 system and diabetes mellitus.

    PubMed

    Uruno, Akira; Yagishita, Yoko; Yamamoto, Masayuki

    2015-01-15

    Nrf2 (NF-E2-related factor 2) plays a key role in the protection of vertebrates against environmental stress by contributing to the inducible expression of detoxification and antioxidant enzymes. Keap1 (Kelch-like ECH-associated protein 1) is a sensor for oxidative and electrophilic stresses. Keap1 also acts as an E3 ubiquitin ligase substrate-recognition subunit that specifically targets Nrf2. Keap1 causes Nrf2 to be degraded through the ubiquitin-proteasome pathway and thus ensures that Nrf2 is constitutively suppressed under unstressed conditions. Upon exposure to oxidative or electrophilic stress, Keap1 loses its ability to ubiquitinate Nrf2. Many lines of evidence have recently clarified that the Keap1-Nrf2 system also plays critical roles in the maintenance of cellular homeostasis. One of the most salient examples is the contribution of Keap1-Nrf2 to metabolic and energy-balance regulation. In particular, how the Keap1-Nrf2 system protects the body against diabetes mellitus and how perturbations in this system provoke the disease condition are now under intense investigation. This review will summarize the recent progress made in this area.

  5. Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension

    PubMed Central

    Li, Liwen; Pan, Hao; Wang, Handong; Li, Xiang; Bu, Xiaomin; Wang, Qiang; Gao, Yongyue; Wen, Guodao; Zhou, Yali; Cong, Zixiang; Yang, Youqing; Tang, Chao; Liu, Zhengwei

    2016-01-01

    Venous hypertension(VH) plays an important role in the pathogenesis of cerebral arteriovenous malformations (AVMs) and is closely associated with the HIF-1α/VEGF signaling pathway. Nuclear factor erythroid 2-related factor 2(Nrf2) significantly influences angiogenesis; however, the interplay between Nrf2 and VEGF under VH in brain AVMs remains unclear. Therefore, our study aimed to investigate the interplay between Nrf2 and VEGF due to VH in brain AVMs. Immunohistochemistry indicated that Nrf2 and VEGF were highly expressed in human brain AVM tissues. In vivo, we established a VH model in both wild-type (WT) and siRNA-mediated Nrf2 knockdown rats. VH significantly increased the expression of Nrf2 and VEGF. Loss of Nrf2 markedly inhibited the upregulation of VEGF, as determined by Western blot analysis and qRT-PCR. In vitro, primary brain microvascular endothelial cells (BMECs) were isolated from WT and Nrf2−/− mice, and a VEGF-Nrf2 positive feed-back loop was observed in BMECs. By trans well assay and angiogenesis assay, Nrf2 knockout significantly inhibited the migration and vascular tube formation of BMECs. These findings suggest that the interplay between Nrf2 and VEGF can contribute to VH-induced angiogenesis in brain AVMs pathogenesis. PMID:27869147

  6. Early modulation of the transcription factor Nrf2 in rodent striatal slices by quinolinic acid, a toxic metabolite of the kynurenine pathway.

    PubMed

    Colín-González, A L; Luna-López, A; Königsberg, M; Ali, S F; Pedraza-Chaverrí, J; Santamaría, A

    2014-02-28

    Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) is a transcription factor involved in the orchestration of antioxidant responses. Although its pharmacological activation has been largely hypothesized as a promising tool to ameliorate the progression of neurodegenerative events, the actual knowledge about its modulation in neurotoxic paradigms remains scarce. In this study, we investigated the early profile of Nrf2 modulation in striatal slices of rodents incubated in the presence of the toxic kynurenine pathway metabolite, quinolinic acid (QUIN). Tissue slices from rats and mice were obtained and used throughout the experiments in order to compare inter-species responses. Nuclear Nrf2 protein levels and oxidative damage to lipids were compared. Time- and concentration-response curves of all markers were explored. Nrf2 nuclear activation was corroborated through phase 2 antioxidant protein expression. The effects of QUIN on Nrf2 modulation and oxidative stress were also compared between slices of wild-type (Nrf2(+/+)) and Nrf2 knock-out (Nrf2(-/-)) mice. The possible involvement of the N-methyl-d-aspartate receptor (NMDAr) in the Nrf2 modulation and lipid peroxidation was further explored in mice striatal slices. In rat striatal slices, QUIN stimulated the Nrf2 nuclear translocation. This effect was accompanied by augmented lipid peroxidation. In the mouse striatum, QUIN per se exerted an induction of Nrf2 factor only at 1h of incubation, and a concentration-response effect on lipid peroxidation after 3h of incubation. QUIN stimulated the striatal content of phase 2 enzymes. Nrf2(-/-) mice were slightly more responsive than Nrf2(+/+) mice to the QUIN-induced oxidative damage, and completely unresponsive to the NMDAr antagonist MK-801 when tested against QUIN. Findings of this study indicate that: (1) Nrf2 is modulated in rodent striatal tissue in response to QUIN; (2) Nrf2(-/-) striatal tissue was moderately more vulnerable to oxidative damage than the Wt

  7. Transcription factor NRF2 regulates miR-1 and miR-206 to drive tumorigenesis

    PubMed Central

    Singh, Anju; Happel, Christine; Manna, Soumen K.; Acquaah-Mensah, George; Carrerero, Julian; Kumar, Sarvesh; Nasipuri, Poonam; Krausz, Kristopher W.; Wakabayashi, Nobunao; Dewi, Ruby; Boros, Laszlo G.; Gonzalez, Frank J.; Gabrielson, Edward; Wong, Kwok K.; Girnun, Geoffrey; Biswal, Shyam

    2013-01-01

    The mechanisms by which deregulated nuclear factor erythroid-2–related factor 2 (NRF2) and kelch-like ECH-associated protein 1 (KEAP1) signaling promote cellular proliferation and tumorigenesis are poorly understood. Using an integrated genomics and 13C-based targeted tracer fate association (TTFA) study, we found that NRF2 regulates miR-1 and miR-206 to direct carbon flux toward the pentose phosphate pathway (PPP) and the tricarboxylic acid (TCA) cycle, reprogramming glucose metabolism. Sustained activation of NRF2 signaling in cancer cells attenuated miR-1 and miR-206 expression, leading to enhanced expression of PPP genes. Conversely, overexpression of miR-1 and miR-206 decreased the expression of metabolic genes and dramatically impaired NADPH production, ribose synthesis, and in vivo tumor growth in mice. Loss of NRF2 decreased the expression of the redox-sensitive histone deacetylase, HDAC4, resulting in increased expression of miR-1 and miR-206, and not only inhibiting PPP expression and activity but functioning as a regulatory feedback loop that repressed HDAC4 expression. In primary tumor samples, the expression of miR-1 and miR-206 was inversely correlated with PPP gene expression, and increased expression of NRF2-dependent genes was associated with poor prognosis. Our results demonstrate that microRNA-dependent (miRNA-dependent) regulation of the PPP via NRF2 and HDAC4 represents a novel link between miRNA regulation, glucose metabolism, and ROS homeostasis in cancer cells. PMID:23921124

  8. Activation of Nrf2-ARE signaling mitigates cyclophosphamide-induced myelosuppression.

    PubMed

    Que, Linling; He, Liu; Yu, Chenshu; Yin, Wencheng; Ma, Liwen; Cao, Baoshan; Yu, Siwang

    2016-11-16

    Myelosuppression is the most common dose-limiting adverse effect of chemotherapies. In the present study, we investigated the involvement of nuclear erythroid 2-related factor 2 (Nrf2) in cyclophosphamide-induced myelosuppression in mice, and evaluated the potential of activating Nrf2 signaling as a preventive strategy. The whole blood from Nrf2(-/-) mice exhibited decreased antioxidant capacities, while the bone marrow cells, peripheral blood mononuclear cells and granulocytes from Nrf2(-/-) mice were more susceptible to acrolein-induced cytotoxicity than those from wild type mice. Single dosage of cyclophosphamide induced significantly severer acute myelosuppression in Nrf2(-/-) mice than in wild type mice. Furthermore, Nrf2(-/-) mice exhibited greater loss of peripheral blood nucleated cells and recovered slower from myelosuppression nadir upon multiple consecutive dosages of cyclophosphamide than wild type mice did. This was accompanied with decreased antioxidant and detoxifying gene expressions and impaired colony formation ability of Nrf2(-/-) bone marrow cells. More importantly, activation of Nrf2 signaling by CDDO-Me significantly alleviated cyclophosphamide-induced myelosuppression, while this alleviation was diminished in Nrf2(-/-) mice. In conclusion, the present study shows that Nrf2 plays a protective role in cyclophosphamide-induced myelosuppression and activation of Nrf2 is a promising strategy to prevent or treat chemotherapy-induced myelosuppression.

  9. The Antioxidant Transcription Factor Nrf2 Negatively Regulates Autophagy and Growth Arrest Induced by the Anticancer Redox Agent Mitoquinone*

    PubMed Central

    Rao, V. Ashutosh; Klein, Sarah R.; Bonar, Spencer J.; Zielonka, Jacek; Mizuno, Naoko; Dickey, Jennifer S.; Keller, Paul W.; Joseph, Joy; Kalyanaraman, Balaraman; Shacter, Emily

    2010-01-01

    Mitoquinone (MitoQ) is a synthetically modified, redox-active ubiquinone compound that accumulates predominantly in mitochondria. We found that MitoQ is 30-fold more cytotoxic to breast cancer cells than to healthy mammary cells. MitoQ treatment led to irreversible inhibition of clonogenic growth of breast cancer cells through a combination of autophagy and apoptotic cell death mechanisms. Relatively limited cytotoxicity was seen with the parent ubiquinone coenzyme Q10. Inhibition of cancer cell growth by MitoQ was associated with G1/S cell cycle arrest and phosphorylation of the checkpoint kinases Chk1 and Chk2. The possible role of oxidative stress in MitoQ activity was investigated by measuring the products of hydroethidine oxidation. Increases in ethidium and dihydroethidium levels, markers of one-electron oxidation of hydroethidine, were observed at cytotoxic concentrations of MitoQ. Keap1, an oxidative stress sensor protein that regulates the antioxidant transcription factor Nrf2, underwent oxidation, degradation, and dissociation from Nrf2 in MitoQ-treated cells. Nrf2 protein levels, nuclear localization, and transcriptional activity also increased following MitoQ treatment. Knockdown of Nrf2 caused a 2-fold increase in autophagy and an increase in G1 cell cycle arrest in response to MitoQ but had no apparent effect on apoptosis. The Nrf2-regulated enzyme NQO1 is partly responsible for controlling the level of autophagy. Keap1 and Nrf2 act as redox sensors for oxidative perturbations that lead to autophagy. MitoQ and similar compounds should be further evaluated for novel anticancer activity. PMID:20805228

  10. Developmental role of nuclear factor E2-related factor 2 in mitigating methamphetamine fetal toxicity and postnatal neurodevelopmental deficits.

    PubMed

    Ramkissoon, Annmarie; Wells, Peter G

    2013-12-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that mediates protective responses to oxidative stress, but its developmental role is unknown. Herein, we treated pregnant Nrf2-deficient knockout mice with methamphetamine (METH) (5-40 mg/kg ip), which increases fetal reactive oxygen species (ROS) and oxidatively damaged DNA in fetal brain tissue. METH-exposed Nrf2(-/-) fetuses were unable to increase mRNA levels of ROS-protective heme oxygenase-1, NAD(P)H:quinone oxidoreductase, or oxoguanine glycosylase 1, unlike wild-type controls, and exhibited enhanced DNA oxidation, fetal resorption, edema, and reduced fetal weight, with greater toxicity in female Nrf2(-/-) fetuses. Postnatal neurodevelopmental deficits in activity and olfactory function were exacerbated, with gender-dependent differences, and the olfactory bulb GABAergic marker GAD-65 was decreased in Nrf2(-/-) offspring exposed in utero to METH. In utero METH-initiated olfactory deficits may be a sensitive postnatal functional test for long-term neurotoxicity, and indicated a broad fetal role for Nrf2. The results show that fetal Nrf2 deficiency enhances METH-initiated oxidative DNA damage and toxicity, suggesting that Nrf2 activation of cytoprotective proteins mitigates the effects of ROS and their oxidative damage to cellular macromolecules, thereby protecting the developing fetus from adverse structural and postnatal neurodevelopmental consequences.

  11. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    PubMed

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  12. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae)

    PubMed Central

    Liu, Di; Irwin, David M.; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet. PMID:26735303

  13. Artemisitene activates the Nrf2-dependent antioxidant response and protects against bleomycin-induced lung injury.

    PubMed

    Chen, Weimin; Li, Shanshan; Li, Jinwei; Zhou, Wen; Wu, Shouhai; Xu, Shengmei; Cui, Ke; Zhang, Donna D; Liu, Bo

    2016-07-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) is a crucial regulator of the cellular antioxidant response and xenobiotic metabolism. Activation of the Nrf2 signaling pathway has been demonstrated to confer protection against environmental insults and prevent disease or inhibit the progression of diseases related to oxidative stress. In an attempt to identify novel improved Nrf2 inducers for systemic protection against tissue damage by environmental insults, we identified artemisitene as a novel Nrf2 activator using antioxidant responsive element luciferase assay in MDA-MB-231 cells. Further studies suggest that artemisitene activates Nrf2 by decreasing Nrf2 ubiquitination and increasing its stability. In Nrf2 wild-type mice, systemic administration of artemisitene strongly inhibits bleomycin-induced lung damage. Artemisitene represents a novel class of Nrf2 inducer, and artemisitene-based therapeutic approach targeting Nrf2 may also provide antioxidant protection for humans against tissue damage by toxic chemicals.-Chen, W., Li, S., Li, J., Zhou, W., Wu, S., Xu, S., Cui, K., Zhang, D. D., Liu, B. Artemisitene activates the Nrf2-dependent antioxidant response and protects against bleomycin-induced lung injury.

  14. NRF2 and cancer: the good, the bad and the importance of context

    PubMed Central

    Sporn, Michael B.; Liby, Karen T.

    2013-01-01

    Many studies of chemopreventive drugs have suggested that their beneficial effects on suppression of carcinogenesis and many other chronic diseases are mediated through activation of the transcription factor NFE2- related factor 2 (NRF2). More recently, genetic analyses of human tumours have indicated that NRF2 may conversely be oncogenic and cause resistance to chemotherapy. It is therefore controversial whether the activation, or alternatively the inhibition, of NRF2 is a useful strategy for the prevention or treatment of cancer. This Opinion article aims to rationalize these conflicting perspectives by critiquing the context dependence of NRF2 functions and the experimental methods behind these conflicting data. PMID:22810811

  15. NRF2 activation by antioxidant antidiabetic agents accelerates tumor metastasis.

    PubMed

    Wang, Hui; Liu, Xiufei; Long, Min; Huang, Yi; Zhang, Linlin; Zhang, Rui; Zheng, Yi; Liao, Xiaoyu; Wang, Yuren; Liao, Qian; Li, Wenjie; Tang, Zili; Tong, Qiang; Wang, Xiaocui; Fang, Fang; Rojo de la Vega, Montserrat; Ouyang, Qin; Zhang, Donna D; Yu, Shicang; Zheng, Hongting

    2016-04-13

    Cancer is a common comorbidity of diabetic patients; however, little is known about the effects that antidiabetic drugs have on tumors. We discovered that common classes of drugs used in type 2 diabetes mellitus, the hypoglycemic dipeptidyl peptidase-4 inhibitors (DPP-4i) saxagliptin and sitagliptin, as well as the antineuropathic α-lipoic acid (ALA), do not increase tumor incidence but increase the risk of metastasis of existing tumors. Specifically, these drugs induce prolonged activation of the nuclear factor E2-related factor 2 (NRF2)-mediated antioxidant response through inhibition of KEAP1-C151-dependent ubiquitination and subsequent degradation of NRF2, resulting in up-regulated expression of metastasis-associated proteins, increased cancer cell migration, and promotion of metastasis in xenograft mouse models. Accordingly, knockdown of NRF2 attenuated naturally occurring and DPP-4i-induced tumor metastasis, whereas NRF2 activation accelerated metastasis. Furthermore, in human liver cancer tissue samples, increased NRF2 expression correlated with metastasis. Our findings suggest that antioxidants that activate NRF2 signaling may need to be administered with caution in cancer patients, such as diabetic patients with cancer. Moreover, NRF2 may be a potential biomarker and therapeutic target for tumor metastasis.

  16. The Keap1-Nrf2-ARE Pathway As a Potential Preventive and Therapeutic Target: An Update.

    PubMed

    Lu, Meng-Chen; Ji, Jian-Ai; Jiang, Zheng-Yu; You, Qi-Dong

    2016-09-01

    The Keap1-Nrf2-ARE ((Kelch-like ECH-Associating protein 1) nuclear factor erythroid 2 related factor 2-antioxidant response element) pathway is one of the most important defense mechanisms against oxidative and/or electrophilic stresses, and it is closely associated with inflammatory diseases, including cancer, neurodegenerative diseases, cardiovascular diseases, and aging. In recent years, progress has been made in strategies aimed at modulating the Keap1-Nrf2-ARE pathway. The Nrf2 activator DMF (Dimethylfumarates) has been approved by the FDA as a new first-line oral drug to treat patients with relapsing forms of multiple sclerosis, while a phase 3 study of another promising candidate, CDDO-Me, was terminated for safety reasons. Directly inhibiting Keap1-Nrf2 protein-protein interactions as a novel Nrf2-modulating strategy has many advantages over using electrophilic Nrf2 activators. The development of Keap1-Nrf2 protein-protein interaction inhibitors has become a topic of intense research, and potent inhibitors of this target have been identified. In addition, inhibiting Nrf2 activity has attracted an increasing amount of attention because it may provide an alternative cancer therapy. This review summarizes the molecular mechanisms and biological functions of the Keap1-Nrf2-ARE system. The main focus of this review is on recent progress in studies of agents that target the Keap1-Nrf2-ARE pathway and the therapeutic applications of such agents.

  17. NRF2-regulation in brain health and disease: implication of cerebral inflammation

    PubMed Central

    Sandberg, Mats; Patil, Jaspal; D’Angelo, Barbara; Weber, Stephen G; Mallard, Carina

    2014-01-01

    The nuclear factor erythroid 2 related factor 2 (NRF2) is a key regulator of endogenous inducible defense systems in the body. Under physiological conditions NRF2 is mainly located in the cytoplasm. However, in response to oxidative stress, NRF2 translocates to the nucleus and binds to specific DNA sites termed “anti-oxidant response elements” or “electrophile response elements” to initiate transcription of cytoprotective genes. Acute oxidative stress to the brain, such as stroke and traumatic brain injury is increased in animals that are deficient in NRF2. Insufficient NRF2 activation in humans has been linked to chronic diseases such as Parkinson’s disease, Alzheimer’s disease and amyotrophic lateral sclerosis. New findings have also linked activation of the NRF2 system to anti-inflammatory effects via interactions with NF-κB. Here we review literature on cellular mechanisms of NRF2 regulation, how to maintain and restore NRF2 function and the relationship between NRF2 regulation and brain damage. We bring forward the hypothesis that inflammation via prolonged activation of key kinases (p38 and GSK-3β) and activation of histone deacetylases gives rise to dysregulation of the NRF2 system in the brain, which contributes to oxidative stress and injury. PMID:24262633

  18. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    SciTech Connect

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H.; Mattson, Mark P.; Camandola, Simonetta

    2013-04-19

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity.

  19. Nrf2 and Redox Status in Prediabetic and Diabetic Patients

    PubMed Central

    Jiménez-Osorio, Angélica S.; Picazo, Alejandra; González-Reyes, Susana; Barrera-Oviedo, Diana; Rodríguez-Arellano, Martha E.; Pedraza-Chaverri, José

    2014-01-01

    The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2) was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS) in plasma and erythrocytes, glutathione (GSH) and malondialdehyde (MDA) content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC). Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients. PMID:25383674

  20. The complexity of the Nrf2 pathway: Beyond the antioxidant response

    PubMed Central

    Huang, Ying; Li, Wenji; Su, Zheng-yuan; Kong, Ah-Ng Tony

    2016-01-01

    The NF-E2-related factor 2 (Nrf2)-mediated signaling pathway provides living organisms an efficient and pivotal line of defensive to counteract environmental insults and endogenous stressors. Nrf2 coordinates the basal and inducible expression of antioxidant and phase II detoxification enzymes to adapt to different stress conditions. The stability and cellular distribution of Nrf2 is tightly controlled by its inhibitory binding protein Kelch-like ECH-associated protein 1 (Keap1). Nrf2 signaling is also regulated by post-translational, transcriptional, translational and epigenetic mechanisms, as well as by other protein partners, including p62, p21 and IQ motif-containing GTPase activating protein 1 (IQGAP1). Many studies have demonstrated that Nrf2 is a promising target for preventing carcinogenesis and other chronic diseases, including cardiovascular diseases, neurodegenerative diseases, and pulmonary injury. However, constitutive activation of Nrf2 in advanced cancer cells may confer drug resistance. Here, we review the molecular mechanisms of Nrf2 signaling, the diverse classes of Nrf2 activators, including bioactive nutrients and other chemicals and the cellular functions and disease relevance of Nrf2 and discuss the dual role of Nrf2 in different contexts. PMID:26419687

  1. Nrf2 expression in endometrial serous carcinomas and its precancers.

    PubMed

    Chen, Ning; Yi, Xiaofang; Abushahin, Nisreen; Pang, Shujie; Zhang, Donna; Kong, Beihua; Zheng, Wenxin

    2010-12-24

    Endometrial serous carcinoma (ESC) is the most aggressive subtype of endometrial cancer. Its aggressive behavior and poor clinical outcome may be partially attributed to lack of early diagnostic markers and unclear patho-genesis. The transcription factor Erythroid-E2-related factor 2 (Nrf2) is a recently identified protein marker, which plays a role in carcinogenesis as well as responsible for poor prognosis of many human cancers. The aim of this study is to determine the Nrf2 expression in benign endometrium (n=28), endometrial cancers (n=122) as well as their precursor lesions (n=81) trying to see whether Nrf2 has any diagnostic usage and is potentially involved in endometrial carcinogenesis. The level of Nrf2 was evaluated by immunohistochemical (IHC) and verified by using Western blots. Among the malignant cases, Nrf2 was positive in 28 (68%) of 50 ESCs, which was significantly more than in 3 (6%) of 50 endometrioid carcinomas (p < 0.001) and 2 (13%) of 15 clear cell carcinomas (p = 0.001) and other histologic types of endometrial cancers. Among endometrial precursor lesions, both serous endometrial glandular dysplasia (EmGD, 40%) and serous endometrial intraepithelial carcinoma (EIC, 44%) showed a significantly higher Nrf2 expression than that in atypical endometrial hyperplasia or endometrial intraepithelial neoplasia (0%), clear cell EmGD (10%), and clear cell EIC (25%), respectively. We conclude that Nrf2 overexpression is closely associated with endometrial neoplasms with serous differentiation. Alteration of Nrf2 expression may represent one of the early molecular events in ESC carcinogenesis and overexpression of Nrf2 may used as a diagnostic marker in surgical pathology.

  2. Strange Bedfellows: Nuclear Factor, Erythroid 2-Like 2 (Nrf2) and Hypoxia-Inducible Factor 1 (HIF-1) in Tumor Hypoxia.

    PubMed

    Toth, Rachel K; Warfel, Noel A

    2017-04-06

    The importance of the tumor microenvironment for cancer progression and therapeutic resistance is an emerging focus of cancer biology. Hypoxia, or low oxygen, is a hallmark of solid tumors that promotes metastasis and represents a significant obstacle to successful cancer therapy. In response to hypoxia, cancer cells activate a transcriptional program that allows them to survive and thrive in this harsh microenvironment. Hypoxia-inducible factor 1 (HIF-1) is considered the main effector of the cellular response to hypoxia, stimulating the transcription of genes involved in promoting angiogenesis and altering cellular metabolism. However, growing evidence suggests that the cellular response to hypoxia is much more complex, involving coordinated signaling through stress response pathways. One key signaling molecule that is activated in response to hypoxia is nuclear factor, erythroid 2 like-2 (Nrf2). Nrf2 is a transcription factor that controls the expression of antioxidant-response genes, allowing the cell to regulate reactive oxygen species. Nrf2 is also activated in various cancer types due to genetic and epigenetic alterations, and is associated with poor survival and resistance to therapy. Emerging evidence suggests that coordinated signaling through Nrf2 and HIF-1 is critical for tumor survival and progression. In this review, we discuss the distinct and overlapping roles of HIF-1 and Nrf2 in the cellular response to hypoxia, with a focus on how targeting Nrf2 could provide novel chemotherapeutic modalities for treating solid tumors.

  3. Frequency Modulated Translocational Oscillations of Nrf2 Mediate the Antioxidant Response Element Cytoprotective Transcriptional Response

    PubMed Central

    Xue, Mingzhan; Momiji, Hiroshi; Rabbani, Naila; Barker, Guy; Bretschneider, Till; Shmygol, Anatoly; Rand, David A.

    2015-01-01

    Abstract Aims: Stress responsive signaling coordinated by nuclear factor erythroid 2-related factor 2 (Nrf2) provides an adaptive response for protection of cells against toxic insults, oxidative stress and metabolic dysfunction. Nrf2 regulates a battery of protective genes by binding to regulatory antioxidant response elements (AREs). The aim of this study was to examine how Nrf2 signals cell stress status and regulates transcription to maintain homeostasis. Results: In live cell microscopy we observed that Nrf2 undergoes autonomous translocational frequency-modulated oscillations between cytoplasm and nucleus. Oscillations occurred in quiescence and when cells were stimulated at physiological levels of activators, they decrease in period and amplitude and then evoke a cytoprotective transcriptional response. We propose a mechanism whereby oscillations are produced by negative feedback involving successive de-phosphorylation and phosphorylation steps. Nrf2 was inactivated in the nucleus and reactivated on return to the cytoplasm. Increased frequency of Nrf2 on return to the cytoplasm with increased reactivation or refresh-rate under stress conditions activated the transcriptional response mediating cytoprotective effects. The serine/threonine-protein phosphatase PGAM5, member of the Nrf2 interactome, was a key regulatory component. Innovation: We found that Nrf2 is activated in cells without change in total cellular Nrf2 protein concentration. Regulation of ARE-linked protective gene transcription occurs rather through translocational oscillations of Nrf2. We discovered cytoplasmic refresh rate of Nrf2 is important in maintaining and regulating the transcriptional response and links stress challenge to increased cytoplasmic surveillance. We found silencing and inhibition of PGAM5 provides potent activation of Nrf2. Conclusion: Frequency modulated translocational oscillations of Nrf2 mediate the ARE-linked cytoprotective transcriptional response. Antioxid. Redox

  4. Nrf2 is critical in defense against high glucose-induced oxidative damage in cardiomyocytes.

    PubMed

    He, Xiaoqing; Kan, Hong; Cai, Lu; Ma, Qiang

    2009-01-01

    Exposure to high levels of glucose induces the production of reactive oxygen species (ROS) in cardiomyocytes that may contribute to the development of cardiomyopathy in diabetes. Nuclear factor erythroid 2-related factor 2 (Nrf2) controls the antioxidant response element (ARE)-dependent gene regulation in response to oxidative stress. The role of Nrf2 in defense against high glucose-induced oxidative damage in cardiomyocytes was investigated. Glucose at high concentrations induced ROS production in both primary neonatal and adult cardiomyocytes from the Nrf2 wild type (WT) mouse heart, whereas, in Nrf2 knockout (KO) cells, ROS was significantly higher under basal conditions and high glucose markedly further increased ROS production in concentration and time-dependent manners. Concomitantly, high glucose induced significantly higher levels of apoptosis at lower concentrations and in shorter time in Nrf2 KO cells than in WT cells. Primary adult cardiomyocytes from control and diabetic mice also showed dependence on Nrf2 function for isoproterenol-stimulated contraction. Additionally, cardiomyocytes from Nrf2 KO mice exhibited increased sensitivity to 3-nitropropionic acid, an inhibitor of mitochondrial respiratory complex II, for both ROS production and apoptosis compared with Nrf2 WT cells, further emphasizing the role of Nrf2 in ROS defense in the cells. Mechanistically, Nrf2 was shown to mediate the basal expression and induction of ARE-controlled cytoprotective genes, Nqo1 and Ho1, at both mRNA and protein levels in cardiomyocytes, as both the basal and inducible expressions of the genes were lost in Nrf2 KO cells or largely reduced by Nrf2 SiRNA. The findings, for the first time, established Nrf2 as a critical regulator of defense against ROS in normal and diabetic hearts.

  5. The Effects of Sequence Variation on Genome-wide NRF2 Binding—New Target Genes and Regulatory SNPs

    PubMed Central

    Kuosmanen, Suvi M.; Viitala, Sari; Laitinen, Tuomo; Peräkylä, Mikael; Pölönen, Petri; Kansanen, Emilia; Leinonen, Hanna; Raju, Suresh; Wienecke-Baldacchino, Anke; Närvänen, Ale; Poso, Antti; Heinäniemi, Merja; Heikkinen, Sami; Levonen, Anna-Liisa

    2016-01-01

    Transcription factor binding specificity is crucial for proper target gene regulation. Motif discovery algorithms identify the main features of the binding patterns, but the accuracy on the lower affinity sites is often poor. Nuclear factor E2-related factor 2 (NRF2) is a ubiquitous redox-activated transcription factor having a key protective role against endogenous and exogenous oxidant and electrophile stress. Herein, we decipher the effects of sequence variation on the DNA binding sequence of NRF2, in order to identify both genome-wide binding sites for NRF2 and disease-associated regulatory SNPs (rSNPs) with drastic effects on NRF2 binding. Interactions between NRF2 and DNA were studied using molecular modelling, and NRF2 chromatin immunoprecipitation-sequence datasets together with protein binding microarray measurements were utilized to study binding sequence variation in detail. The binding model thus generated was used to identify genome-wide binding sites for NRF2, and genomic binding sites with rSNPs that have strong effects on NRF2 binding and reside on active regulatory elements in human cells. As a proof of concept, miR-126–3p and -5p were identified as NRF2 target microRNAs, and a rSNP (rs113067944) residing on NRF2 target gene (Ferritin, light polypeptide, FTL) promoter was experimentally verified to decrease NRF2 binding and result in decreased transcriptional activity. PMID:26826707

  6. GSK-3beta acts upstream of Fyn kinase in regulation of nuclear export and degradation of NF-E2 related factor 2.

    PubMed

    Jain, Abhinav K; Jaiswal, Anil K

    2007-06-01

    NF-E2-related factor 2 (Nrf2) regulates expression and coordinated induction of a battery of chemoprotective genes in response to oxidative and electrophilic stress. This leads to protection against oxidative stress and neoplastic diseases. Nuclear import and export of Nrf2 play a significant role in control of nuclear levels of Nrf2 and thus the expression of Nrf2 down-stream genes. Tyrosine kinase Fyn phosphorylates tyrosine 568 of Nrf2 that leads to the nuclear export of Nrf2. In this study, we investigated the upstream factor(s) in regulation of Fyn and Fyn-mediated nuclear export of Nrf2. The investigations shed light on a novel mechanism of Nrf2 regulation in response to oxidative stress. We demonstrate that GSK-3beta acts upstream of Fyn kinase in control of nuclear export of Nrf2. Chemical and short interfering RNA-mediated inhibition of GSK-3beta led to nuclear accumulation of Nrf2 and transcriptional activation of the Nrf2 downstream gene nqo1. Chemical and short interfering RNA inhibition of GSK-3beta and Fyn individually and in combination revealed that both kinases follow the same pathway to regulate nuclear export of Nrf2. We further demonstrate that hydrogen peroxide phosphorylates tyrosine 216 of GSK-3beta. This leads to activation of GSK-3beta. The activated GSK-3beta phosphorylates Fyn at threonine residue(s). Phosphorylated Fyn accumulates in the nucleus and phosphorylates Nrf2 at tyrosine 568. This leads to nuclear export, ubiquitination, and degradation of Nrf2.

  7. Glucocorticoid Receptor Signaling Represses the Antioxidant Response by Inhibiting Histone Acetylation Mediated by the Transcriptional Activator NRF2.

    PubMed

    Alam, Md Morshedul; Okazaki, Keito; Nguyen, Linh Thi Thao; Ota, Nao; Kitamura, Hiroshi; Murakami, Shohei; Shima, Hiroki; Igarashi, Kazuhiko; Sekine, Hiroki; Motohashi, Hozumi

    2017-03-17

    NRF2 (nuclear factor erythroid 2-related factor 2) is a key transcriptional activator that mediates the inducible expression of antioxidant genes. NRF2 is normally ubiquitinated by KEAP1 (Kelch-like ECH-associated protein 1) and subsequently degraded by proteasomes. Inactivation of KEAP1 by oxidative stress or electrophilic chemicals allows NRF2 to activate transcription through binding to antioxidant response elements (AREs) and recruiting histone acetyltransferase CBP (CREB-binding protein). While KEAP1-dependent regulation is a major determinant of NRF2 activity, NRF2-mediated transcriptional activation varies from context to context, suggesting other intracellular signaling cascades may impact NRF2 function. To identify a signaling pathway that modifies NRF2 activity, we immunoprecipitated endogenous NRF2 and its interacting proteins from mouse liver and identified glucocorticoid receptor (GR) as a novel NRF2-binding partner. We found that glucocorticoids (GC), dexamethasone (Dex) and betamethasone (Bet), antagonize diethyl maleate (DEM)-induced activation of NRF2 target genes in a GR-dependent manner. Dex treatment enhanced GR recruitment to AREs without affecting chromatin binding of NRF2, resulting in the inhibition of CBP recruitment and histone acetylation at AREs. This repressive effect was canceled by the addition of HDAC inhibitors. Thus, GR signaling decreases NRF2 transcriptional activation through reducing the NRF2-dependent histone acetylation. Consistent with these observations, GR signaling blocked NRF2-mediated cytoprotection from oxidative stress. This study suggests that an impaired antioxidant response by NRF2 and a resulting decrease in cellular antioxidant capacity account for the side effects of GCs, providing a novel viewpoint for the pathogenesis of hypercorticosteroidism.

  8. Nrf2-Mediated Regulation of Skeletal Muscle Glycogen Metabolism

    PubMed Central

    Yagishita, Yoko; Katsuoka, Fumiki; Kitajima, Yasuo; Nunomiya, Aki; Nagatomi, Ryoichi; Pi, Jingbo; Biswal, Shyam S.

    2016-01-01

    Nrf2 (NF-E2-related factor 2) contributes to the maintenance of glucose homeostasis in vivo. Nrf2 suppresses blood glucose levels by protecting pancreatic β cells from oxidative stress and improving peripheral tissue glucose utilization. To elucidate the molecular mechanisms by which Nrf2 contributes to the maintenance of glucose homeostasis, we generated skeletal muscle (SkM)-specific Keap1 knockout (Keap1MuKO) mice that express abundant Nrf2 in their SkM and then examined Nrf2 target gene expression in that tissue. In Keap1MuKO mice, blood glucose levels were significantly downregulated and the levels of the glycogen branching enzyme (Gbe1) and muscle-type PhKα subunit (Phka1) mRNAs, along with those of the glycogen branching enzyme (GBE) and the phosphorylase b kinase α subunit (PhKα) protein, were significantly upregulated in mouse SkM. Consistent with this result, chemical Nrf2 inducers promoted Gbe1 and Phka1 mRNA expression in both mouse SkM and C2C12 myotubes. Chromatin immunoprecipitation analysis demonstrated that Nrf2 binds the Gbe1 and Phka1 upstream promoter regions. In Keap1MuKO mice, muscle glycogen content was strongly reduced and forced GBE expression in C2C12 myotubes promoted glucose uptake. Therefore, our results demonstrate that Nrf2 induction in SkM increases GBE and PhKα expression and reduces muscle glycogen content, resulting in improved glucose tolerance. Our results also indicate that Nrf2 differentially regulates glycogen metabolism in SkM and the liver. PMID:27044864

  9. Nrf2 Transcription Factor Can Directly Regulate mTOR: LINKING CYTOPROTECTIVE GENE EXPRESSION TO A MAJOR METABOLIC REGULATOR THAT GENERATES REDOX ACTIVITY.

    PubMed

    Bendavit, Gabriel; Aboulkassim, Tahar; Hilmi, Khalid; Shah, Sujay; Batist, Gerald

    2016-12-02

    Nrf2 is a master transcription factor that regulates a wide variety of cellular proteins by recognizing and binding to antioxidant response elements (AREs) in their gene promoter regions. In this study we show that increasing cellular Nrf2 results in transcriptional activation of the gene for mTOR, which is central to the PI3K signaling pathway. This is the case in cells with normal physiological PI3K. However, in cells with abnormally active PI3K increased cellular Nrf2 levels have no effect on mTOR. ChIP assays results show that increased Nrf2 binding is associated with decreased p65 binding and H3-K27me3 signal (marker of gene repression) as well as increased H3-K4me3 signal (marker of gene activation). However, in cells with PI3K activation, no effect of cellular Nrf2 increase on mTOR transcription was observed. In these cells, increasing Nrf2 levels increases Nrf2 promoter binding marginally, whereas p65 binding and H3-K27me3 mark were significantly increased, and H3-K4me3 signal is reduced. Together, these data show for the first time that Nrf2 directly regulates mTOR transcription when the PI3K pathway is intact, whereas this function is lost when PI3K is activated. We have identified a link between the Nrf2 system of sensing environmental stress and mTOR, which is a key cellular protein in metabolism. Studies in cells with activating mutations in the PI3K pathway suggest that Nrf2 transcriptional regulation of mTOR is related to promoter binding of p65 and of methylation of histone residues permissive of transcription.

  10. Activation of the transcription factor Nrf2 in macrophages, Caco-2 cells and intact human gut tissue by Maillard reaction products and coffee.

    PubMed

    Sauer, Tanja; Raithel, Martin; Kressel, Jürgen; Münch, Gerald; Pischetsrieder, Monika

    2013-06-01

    In addition to direct antioxidative effects, Maillard reaction products (MRPs) could increase the antioxidative capacity of cells through the induction of cytoprotective enzymes. Since many of those enzymes are regulated by the transcription factor Nrf2, the effect of MRPs on nuclear translocation of Nrf2 in macrophages and Caco-2 cells was investigated. Stimulation of both cell types by MRPs showed a concentration-dependent significant increase in nuclear translocation of Nrf2 up to fivefold after short-term (2 h) and up to 50-fold after long-term treatment (24 h). In intact human gut tissue, nuclear translocation of Nrf2 was significantly twofold increased after short-term incubation. To study the activation mechanisms, macrophages and Caco-2 cells were stimulated with MRPs in the presence of catalase, which significantly suppressed Nrf2 activation. Thus, activation was related to extracellular H2O2 continuously formed from MRPs. Short-term incubation with coffee, a MRP-rich beverage, led to a trend towards Nrf2 activation in macrophages, but not in Caco-2 cells or intact human gut tissue. Long-term incubation with coffee (1-4 mg/mL) significantly increased nuclear Nrf2 up to 17-fold. Since raw coffee was inactive under the tested conditions, the effect was related to roasting products. Coffee-induced Nrf2 translocation was, however, only slightly reversed by catalase. Therefore, the Nrf2 activity of coffee can only partially be explained by MRP-induced, H2O2-dependent mechanisms. Thus, it can be concluded that MRPs may increase the antioxidative capacity inside the cell by inducing Nrf2-regulated signalling pathways not only in different cell types, but also in intact gut tissue.

  11. Transcription factor Nrf2 mediates an adaptive response to sulforaphane that protects fibroblasts in vitro against the cytotoxic effects of electrophiles, peroxides and redox-cycling agents

    SciTech Connect

    Higgins, Larry G.; Kelleher, Michael O.; Eggleston, Ian M.; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.

    2009-06-15

    Sulforaphane can stimulate cellular adaptation to redox stressors through transcription factor Nrf2. Using mouse embryonic fibroblasts (MEFs) as a model, we show herein that the normal homeostatic level of glutathione in Nrf2{sup -/-} MEFs was only 20% of that in their wild-type counterparts. Furthermore, the rate of glutathione synthesis following its acute depletion upon treatment with 3 {mu}mol/l sulforaphane was very substantially lower in Nrf2{sup -/-} MEFs than in wild-type cells, and the rebound leading to a {approx} 1.9-fold increase in glutathione that occurred 12-24 h after Nrf2{sup +/+} MEFs were treated with sulforaphane was not observed in Nrf2{sup -/-} fibroblasts. Wild-type MEFs that had been pre-treated for 24 h with 3 {mu}mol/l sulforaphane exhibited between 1.4- and 3.2-fold resistance against thiol-reactive electrophiles, including isothiocyanates, {alpha},{beta}-unsaturated carbonyl compounds (e.g. acrolein), aryl halides and alkene epoxides. Pre-treatment of Nrf2{sup +/+} MEFs with sulforaphane also protected against hydroperoxides (e.g. cumene hydroperoxide, CuOOH), free radical-generating compounds (e.g. menadione), and genotoxic electrophiles (e.g. chlorambucil). By contrast, Nrf2{sup -/-} MEFs were typically {approx} 50% less tolerant of these agents than wild-type fibroblasts, and sulforaphane pre-treatment did not protect the mutant cells against xenobiotics. To test whether Nrf2-mediated up-regulation of glutathione represents the major cytoprotective mechanism stimulated by sulforaphane, 5 {mu}mol/l buthionine sulfoximine (BSO) was used to inhibit glutathione synthesis. In Nrf2{sup +/+} MEFs pre-treated with sulforaphane, BSO diminished intrinsic resistance and abolished inducible resistance to acrolein, CuOOH and chlorambucil, but not menadione. Thus Nrf2-dependent up-regulation of GSH is the principal mechanism by which sulforaphane pre-treatment induced resistance to acrolein, CuOOH and chlorambucil, but not menadione.

  12. Activation of AKT pathway by Nrf2/PDGFA feedback loop contributes to HCC progression.

    PubMed

    Liu, Danyang; Zhang, Yonglong; Wei, Yingze; Liu, Guoyuan; Liu, Yufeng; Gao, Qiongmei; Zou, Liping; Zeng, Wenjiao; Zhang, Nong

    2016-10-04

    Nuclear factor erythroid-2-related factor 2 (Nrf2), a master transcription factor in the antioxidant response, has been found to be ubiquitously expressed in various cancer cells and in the regulation tumor proliferation, invasion, and chemoresistance activities. The regulatory roles of Nrf2 in controlling Hepatocellular carcinoma (HCC) progression remain unclear. In this study, we demonstrated that Nrf2 was significantly elevated in HCC cells and tissues and was correlated with poor prognosis of HCCs. Consistently, Nrf2 significantly promoted HCC cell growth both in vitro and in vivo. Further investigation suggested a novel association of Nrf2 with Platelet-Derived Growth Factor-A (PDGFA). Nrf2 promoted PDGFA transcription by recruiting specificity protein 1 (Sp1) to its promoter, resulting in increased activation of the AKT/p21 pathway and cell cycle progression of HCC cells. As a feedback loop, PDGFA enhanced Nrf2 expression and activation in an AKT dependent manner. In line with these findings, expression of Nrf2 and PDGFA were positively correlated in HCC tissues. Taken together, this study uncovers a novel mechanism of the Nrf2/PDGFA regulatory loop that is crucial for AKT-dependent HCC progression, and thereby provides potential targets for HCC therapy.

  13. Activation of AKT pathway by Nrf2/PDGFA feedback loop contributes to HCC progression

    PubMed Central

    Wei, Yingze; Liu, Guoyuan; Liu, Yufeng; Gao, Qiongmei; Zou, Liping; Zeng, Wenjiao; Zhang, Nong

    2016-01-01

    Nuclear factor erythroid-2-related factor 2 (Nrf2), a master transcription factor in the antioxidant response, has been found to be ubiquitously expressed in various cancer cells and in the regulation tumor proliferation, invasion, and chemoresistance activities. The regulatory roles of Nrf2 in controlling Hepatocellular carcinoma (HCC) progression remain unclear. In this study, we demonstrated that Nrf2 was significantly elevated in HCC cells and tissues and was correlated with poor prognosis of HCCs. Consistently, Nrf2 significantly promoted HCC cell growth both in vitro and in vivo. Further investigation suggested a novel association of Nrf2 with Platelet-Derived Growth Factor-A (PDGFA). Nrf2 promoted PDGFA transcription by recruiting specificity protein 1 (Sp1) to its promoter, resulting in increased activation of the AKT/p21 pathway and cell cycle progression of HCC cells. As a feedback loop, PDGFA enhanced Nrf2 expression and activation in an AKT dependent manner. In line with these findings, expression of Nrf2 and PDGFA were positively correlated in HCC tissues. Taken together, this study uncovers a novel mechanism of the Nrf2/PDGFA regulatory loop that is crucial for AKT-dependent HCC progression, and thereby provides potential targets for HCC therapy. PMID:27588483

  14. Transcription factor NFE2L2/NRF2 is a regulator of macroautophagy genes.

    PubMed

    Pajares, Marta; Jiménez-Moreno, Natalia; García-Yagüe, Ángel J; Escoll, Maribel; de Ceballos, María L; Van Leuven, Fred; Rábano, Alberto; Yamamoto, Masayuki; Rojo, Ana I; Cuadrado, Antonio

    2016-10-02

    Autophagy is a highly coordinated process that is controlled at several levels including transcriptional regulation. Here, we identify the transcription factor NFE2L2/NRF2 (nuclear factor, erythroid 2 like 2) as a regulator of autophagy gene expression and its relevance in a mouse model of Alzheimer disease (AD) that reproduces impaired APP (amyloid β precursor protein) and human (Hs)MAPT/TAU processing, clearance and aggregation. We screened the chromatin immunoprecipitation database ENCODE for 2 proteins, MAFK and BACH1, that bind the NFE2L2-regulated enhancer antioxidant response element (ARE). Using a script generated from the JASPAR's consensus ARE sequence, we identified 27 putative AREs in 16 autophagy-related genes. Twelve of these sequences were validated as NFE2L2 regulated AREs in 9 autophagy genes by additional ChIP assays and quantitative RT-PCR on human and mouse cells after NFE2L2 activation with sulforaphane. Mouse embryo fibroblasts of nfe2l2-knockout mice exhibited reduced expression of autophagy genes, which was rescued by an NFE2L2 expressing lentivirus, and impaired autophagy flux when exposed to hydrogen peroxide. NFE2L2-deficient mice co-expressing HsAPP(V717I) and HsMAPT(P301L), exhibited more intracellular aggregates of these proteins and reduced neuronal levels of SQSTM1/p62, CALCOCO2/NDP52, ULK1, ATG5 and GABARAPL1. Also, colocalization of HsAPP(V717I) and HsMAPT(P301L) with the NFE2L2-regulated autophagy marker SQSTM1/p62 was reduced in the absence of NFE2L2. In AD patients, neurons expressing high levels of APP or MAPT also expressed SQSTM1/p62 and nuclear NFE2L2, suggesting their attempt to degrade intraneuronal aggregates through autophagy. This study shows that NFE2L2 modulates autophagy gene expression and suggests a new strategy to combat proteinopathies.

  15. Transcription factor NFE2L2/NRF2 is a regulator of macroautophagy genes

    PubMed Central

    Pajares, Marta; Jiménez-Moreno, Natalia; García-Yagüe, Ángel J.; Escoll, Maribel; de Ceballos, María L.; Van Leuven, Fred; Rábano, Alberto; Yamamoto, Masayuki; Rojo, Ana I.; Cuadrado, Antonio

    2016-01-01

    ABSTRACT Autophagy is a highly coordinated process that is controlled at several levels including transcriptional regulation. Here, we identify the transcription factor NFE2L2/NRF2 (nuclear factor, erythroid 2 like 2) as a regulator of autophagy gene expression and its relevance in a mouse model of Alzheimer disease (AD) that reproduces impaired APP (amyloid β precursor protein) and human (Hs)MAPT/TAU processing, clearance and aggregation. We screened the chromatin immunoprecipitation database ENCODE for 2 proteins, MAFK and BACH1, that bind the NFE2L2-regulated enhancer antioxidant response element (ARE). Using a script generated from the JASPAR's consensus ARE sequence, we identified 27 putative AREs in 16 autophagy-related genes. Twelve of these sequences were validated as NFE2L2 regulated AREs in 9 autophagy genes by additional ChIP assays and quantitative RT-PCR on human and mouse cells after NFE2L2 activation with sulforaphane. Mouse embryo fibroblasts of nfe2l2-knockout mice exhibited reduced expression of autophagy genes, which was rescued by an NFE2L2 expressing lentivirus, and impaired autophagy flux when exposed to hydrogen peroxide. NFE2L2-deficient mice co-expressing HsAPPV717I and HsMAPTP301L, exhibited more intracellular aggregates of these proteins and reduced neuronal levels of SQSTM1/p62, CALCOCO2/NDP52, ULK1, ATG5 and GABARAPL1. Also, colocalization of HsAPPV717I and HsMAPTP301L with the NFE2L2-regulated autophagy marker SQSTM1/p62 was reduced in the absence of NFE2L2. In AD patients, neurons expressing high levels of APP or MAPT also expressed SQSTM1/p62 and nuclear NFE2L2, suggesting their attempt to degrade intraneuronal aggregates through autophagy. This study shows that NFE2L2 modulates autophagy gene expression and suggests a new strategy to combat proteinopathies. PMID:27427974

  16. The antioxidant transcription factor Nrf2 contributes to the protective effect of mild thermotolerance (40°C) against heat shock-induced apoptosis.

    PubMed

    Glory, Audrey; Averill-Bates, Diana A

    2016-10-01

    The exposure of cells to low doses of stress induces adaptive survival responses that protect cells against subsequent exposure to toxic stress. The ability of cells to resist subsequent toxic stress following exposure to low dose heat stress at 40°C is known as mild thermotolerance. Mild thermotolerance involves increased expression of heat shock proteins and antioxidants, but the initiating factors in this response are not understood. This study aims to understand the role of the Nrf2 antioxidant pathway in acquisition of mild thermotolerance at 40°C, and secondly, whether the Nrf2 pathway could be involved in the protective effect of thermotolerance against heat-shock (42°C)-induced apoptosis. During cell preconditioning at 40°C, protein expression of the Nrf2 transcription factor increased after 15-60min. In addition, levels of the Nrf2 targets MnSOD, catalase, heme oxygenase-1, glutamate cysteine ligase and Hsp70 increased at 40°C. Levels of these Nrf2 targets were enhanced by Nrf2 activator oltipraz and decreased by shRNA targeting Nrf2. Levels of pro-oxidants increased after 30-60min at 40°C. Pro-oxidant levels were decreased by oltipraz and increased by knockdown of Nrf2. Increased Nrf2 expression and catalase activity at 40°C were inhibited by the antioxidant PEG-catalase and by p53 inhibitor pifithrin-α. These results suggest that mild thermotolerance (40°C) increases cellular pro-oxidant levels, which in turn activate Nrf2 and its target genes. Moreover, Nrf2 contributes to the protective effect of thermotolerance against heat-shock (42°C)-induced apoptosis, because Nrf2 activation by oltipraz enhanced thermotolerance, whereas Nrf2 knockdown partly reversed thermotolerance. Improved knowledge about the different protective mechanisms that mild thermotolerance can activate is crucial for the potential use of this adaptive survival response to treat stress-related diseases.

  17. Astrocyte-Specific Overexpression of Nrf2 Protects Striatal Neurons from Mitochondrial Complex II Inhibition

    PubMed Central

    Calkins, Marcus J.; Vargas, Marcelo R.; Johnson, Delinda A.; Johnson, Jeffrey A.

    2010-01-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that is known to regulate a variety of cytoprotective genes through the antioxidant response element (ARE). This endogenous response is one of the major pathways by which cells are protected from xenobiotic or innate oxidative insults. Furthermore, in neural systems, astrocyte-specific activation of Nrf2 is known to protect neurons. In previous work, our laboratory found that Nrf2 protects from intrastriatal injections of the mitochondrial complex II inhibitor malonate. Here, we extend these results to show that multiple methods of astrocyte-specific Nrf2 overexpression provide protection from neurotoxicity in vivo. GFAP-Nrf2 transgenic mice are significantly more resistant to malonate lesioning. This outcome is associated with an increased basal resistance, but more so, an enhanced Nrf2 response to lesioning that attenuated the ensuing neurotoxicity. Furthermore, striatal transplantation of neuroprogenitor cells overexpressing Nrf2 that differentiate into astrocytes after grafting also significantly reduced malonate toxicity. Overall, these data establish that enhanced astrocytic Nrf2 response and Nrf2 preconditioning are both sufficient to protect from acute lesions from mitochondrial complex II inhibition. PMID:20211941

  18. Nrf2 inhibits epithelial-mesenchymal transition by suppressing snail expression during pulmonary fibrosis

    PubMed Central

    Zhou, Wencheng; Mo, Xiaoting; Cui, Wenhui; Zhang, Zhihui; Li, Delin; Li, Liucheng; Xu, Liang; Yao, Hongwei; Gao, Jian

    2016-01-01

    Epithelial-mesenchymal transition (EMT) is a phenotype conversion that plays a critical role in the development of pulmonary fibrosis (PF). It is known that snail could regulate the progression of EMT. Nuclear factor erythroid 2 related factor 2 (Nrf2), a key regulator of antioxidant defense system, protects cells against oxidative stress. However, it is not known whether Nrf2 regulates snail thereby modulating the development of PF. Here, bleomycin (BLM) was intratracheally injected into both Nrf2-knockout (Nrf2−/−) and wild-type mice to compare the development of PF. Rat type II alveolar epithelial cells (RLE-6TN) were treated with a specific Nrf2 activator sulforaphane, or transfected with Nrf2 and snail siRNAs to determine their effects on transforming growth factor β1 (TGF-β1)-induced EMT. We found that BLM-induced EMT and lung fibrosis were more severe in Nrf2−/− mice compared to wild-type mice. In vitro, sulforaphane treatment attenuated TGF-β1-induced EMT, accompanied by the down-regulation of snail. Inversely, silencing Nrf2 by siRNA enhanced TGF-β1-induced EMT along with increased expression of snail. Interestingly, when snail was silenced by siRNA, sulforaphane treatment was unable to reduce the progression of EMT in RLE-6TN cells. These findings suggest that Nrf2 attenuates EMT and fibrosis process by regulating the expression of snail in PF. PMID:27982105

  19. Nrf2 is essential for timely M phase entry of replicating hepatocytes during liver regeneration

    PubMed Central

    Zou, Yuhong; Hu, Min; Lee, Joonyong; Nambiar, Shashank Manohar; Garcia, Veronica; Bao, Qi; Chan, Jefferson Y.

    2014-01-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) regulates various cellular activities, including redox balance, detoxification, metabolism, autophagy, proliferation, and apoptosis. Several studies have demonstrated that Nrf2 regulates hepatocyte proliferation during liver regeneration. The aim of this study was to investigate how Nrf2 modulates the cell cycle of replicating hepatocytes in regenerating livers. Wild-type and Nrf2 null mice were subjected to 2/3 partial hepatectomy (PH) and killed at multiple time points for various analyses. Nrf2 null mice exhibited delayed liver regrowth, although the lost liver mass was eventually restored 7 days after PH. Nrf2 deficiency did not affect the number of hepatocytes entering the cell cycle but did delay hepatocyte mitosis. Mechanistically, the lack of Nrf2 resulted in increased mRNA and protein levels of hepatic cyclin A2 when the remaining hepatocytes were replicating in response to PH. Moreover, Nrf2 deficiency in regenerating livers caused dysregulation of Wee1, Cdc2, and cyclin B1 mRNA and protein expression, leading to decreased Cdc2 activity. Thus, Nrf2 is required for timely M phase entry of replicating hepatocytes by ensuring proper regulation of cyclin A2 and the Wee1/Cdc2/cyclin B1 pathway during liver regeneration. PMID:25524062

  20. Gain of Nrf2 function in non-small-cell lung cancer cells confers radioresistance.

    PubMed

    Singh, Anju; Bodas, Manish; Wakabayashi, Nobunao; Bunz, Fred; Biswal, Shyam

    2010-12-01

    Nuclear factor erythroid-2 related factor 2 (Nrf2), a redox-sensitive transcription factor, regulates the expression of antioxidant enzymes and several anti-apoptotic proteins, which confer cytoprotection against oxidative stress and apoptosis. Constitutive activation of Nrf2 in lung cancer cells promotes tumorigenicity and contributes to chemoresistance by upregulation of glutathione, thioredoxin, and the drug efflux pathways involved in detoxification of electrophiles and broad spectrum of drugs. In this study, we show that RNAi-mediated lowering of Nrf2 levels in non-small-cell lung cancer (NSCLC) cell lines (A549 and H460) led to a dramatic increase in endogenous reactive oxygen species (ROS) levels. Similarly, γ-irradiation-induced formation of protein carbonyls were significantly higher in Nrf2-depleted lung cancer cells, suggesting increased lethality of ionizing radiation in the absence of Nrf2. Radiation-induced protein oxidation in Nrf2shRNA cells correlated with reduced survival as measured by clonogenic assay. Radiation-induced cell death was abrogated by pretreatment with antioxidants such as N-acetyl-L-cysteine, glutathione, and vitamin-E, highlighting the importance of antioxidants in conferring protection against radiation injury. Using genetically-modified gain and loss of function models of Nrf2, in mouse embryonic fibroblasts, we establish that constitutive activation of Nrf2 protects against ionizing radiation toxicity and confers radioresistance. Thus, targeting Nrf2 activity in radioresistant tumors could be a promising strategy to circumvent radioresistance.

  1. Gain of Nrf2 Function in Non-Small-Cell Lung Cancer Cells Confers Radioresistance

    PubMed Central

    Singh, Anju; Bodas, Manish; Wakabayashi, Nobunao; Bunz, Fred

    2010-01-01

    Abstract Nuclear factor erythroid-2 related factor 2 (Nrf2), a redox-sensitive transcription factor, regulates the expression of antioxidant enzymes and several anti-apoptotic proteins, which confer cytoprotection against oxidative stress and apoptosis. Constitutive activation of Nrf2 in lung cancer cells promotes tumorigenicity and contributes to chemoresistance by upregulation of glutathione, thioredoxin, and the drug efflux pathways involved in detoxification of electrophiles and broad spectrum of drugs. In this study, we show that RNAi-mediated lowering of Nrf2 levels in non-small-cell lung cancer (NSCLC) cell lines (A549 and H460) led to a dramatic increase in endogenous reactive oxygen species (ROS) levels. Similarly, γ-irradiation-induced formation of protein carbonyls were significantly higher in Nrf2-depleted lung cancer cells, suggesting increased lethality of ionizing radiation in the absence of Nrf2. Radiation-induced protein oxidation in Nrf2shRNA cells correlated with reduced survival as measured by clonogenic assay. Radiation-induced cell death was abrogated by pretreatment with antioxidants such as N-acetyl-L-cysteine, glutathione, and vitamin-E, highlighting the importance of antioxidants in conferring protection against radiation injury. Using genetically-modified gain and loss of function models of Nrf2, in mouse embryonic fibroblasts, we establish that constitutive activation of Nrf2 protects against ionizing radiation toxicity and confers radioresistance. Thus, targeting Nrf2 activity in radioresistant tumors could be a promising strategy to circumvent radioresistance. Antioxid. Redox Signal. 13, 1627–1637. PMID:20446773

  2. Deletion of Nrf2 reduces skeletal mechanical properties and decreases load-driven bone formation.

    PubMed

    Sun, Yong-Xin; Li, Lei; Corry, Kylie A; Zhang, Pei; Yang, Yang; Himes, Evan; Mihuti, Cristina Layla; Nelson, Cecilia; Dai, Guoli; Li, Jiliang

    2015-05-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor expressed in many cell types, including osteoblasts, osteocytes, and osteoclasts. Nrf2 has been considered a master regulator of cytoprotective genes against oxidative and chemical insults. The lack of Nrf2 can induce pathologies in multiple organs. The aim of this study was to investigate the role of Nrf2 in load-driven bone metabolism using Nrf2 knockout (KO) mice. Compared to age-matched littermate wild-type controls, Nrf2 KO mice have significantly lowered femoral bone mineral density (-7%, p<0.05), bone formation rate (-40%, p<0.05), as well as ultimate force (-11%, p<0.01). The ulna loading experiment showed that Nrf2 KO mice were less responsive than littermate controls, as indicated by reduction in relative mineralizing surface (rMS/BS, -69%, p<0.01) and relative bone formation rate (rBFR/BS, -84%, p<0.01). Furthermore, deletion of Nrf2 suppressed the load-driven gene expression of antioxidant enzymes and Wnt5a in cultured primary osteoblasts. Taken together, the results suggest that the loss-of-function mutation of Nrf2 in bone impairs bone metabolism and diminishes load-driven bone formation.

  3. DNA Demethylation Upregulated Nrf2 Expression in Alzheimer’s Disease Cellular Model

    PubMed Central

    Cao, Huimin; Wang, Li; Chen, Beibei; Zheng, Peng; He, Yi; Ding, Yubin; Deng, Yushuang; Lu, Xi; Guo, Xiuming; Zhang, Yuping; Li, Yu; Yu, Gang

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer’s disease (AD). Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts) inhibitor 5-aza-2′-deoxycytidine (5-Aza) to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe). We found 5-Aza treatment increased Nrf2 at both messenger RNA and protein levels via downregulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza-mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(P)H:quinone oxidoreductas (NQO1). Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development. PMID:26779013

  4. Astrocyte-specific overexpression of Nrf2 protects striatal neurons from mitochondrial complex II inhibition.

    PubMed

    Calkins, Marcus J; Vargas, Marcelo R; Johnson, Delinda A; Johnson, Jeffrey A

    2010-06-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that is known to regulate a variety of cytoprotective genes through the antioxidant response element (ARE). This endogenous response is one of the major pathways by which cells are protected from xenobiotic or innate oxidative insults. Furthermore, in neural systems, astrocyte-specific activation of Nrf2 is known to protect neurons. In previous work, our laboratory found that Nrf2 protects from intrastriatal injections of the mitochondrial complex II inhibitor malonate. Here, we extend these results to show that multiple methods of astrocyte-specific Nrf2 overexpression provide protection from neurotoxicity in vivo. GFAP-Nrf2 transgenic mice are significantly more resistant to malonate lesioning. This outcome is associated with an increased basal resistance, but more so, an enhanced Nrf2 response to lesioning that attenuated the ensuing neurotoxicity. Furthermore, striatal transplantation of neuroprogenitor cells overexpressing Nrf2 that differentiate into astrocytes after grafting also significantly reduced malonate toxicity. Overall, these data establish that enhanced astrocytic Nrf2 response and Nrf2 preconditioning are both sufficient to protect from acute lesions from mitochondrial complex II inhibition.

  5. Antioxidants for Healthy Skin: The Emerging Role of Aryl Hydrocarbon Receptors and Nuclear Factor-Erythroid 2-Related Factor-2

    PubMed Central

    Furue, Masutaka; Uchi, Hiroshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Chiba, Takahito; Ito, Takamichi; Nakahara, Takeshi; Tsuji, Gaku

    2017-01-01

    Skin is the outermost part of the body and is, thus, inevitably exposed to UV rays and environmental pollutants. Oxidative stress by these hazardous factors accelerates skin aging and induces skin inflammation and carcinogenesis. Aryl hydrocarbon receptors (AHRs) are chemical sensors that are abundantly expressed in epidermal keratinocytes and mediate the production of reactive oxygen species. To neutralize or minimize oxidative stress, the keratinocytes also express nuclear factor-erythroid 2-related factor-2 (NRF2), which is a master switch for antioxidant signaling. Notably, there is fine-tuned crosstalk between AHR and NRF2, which mutually increase or decrease their activation states. Many NRF2-mediated antioxidant phytochemicals are capable of up- and downmodulating AHR signaling. The precise mechanisms by which these phytochemicals differentially affect the AHR and NRF2 system remain largely unknown and warrant future investigation. PMID:28273792

  6. Antioxidants for Healthy Skin: The Emerging Role of Aryl Hydrocarbon Receptors and Nuclear Factor-Erythroid 2-Related Factor-2.

    PubMed

    Furue, Masutaka; Uchi, Hiroshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Chiba, Takahito; Ito, Takamichi; Nakahara, Takeshi; Tsuji, Gaku

    2017-03-03

    Skin is the outermost part of the body and is, thus, inevitably exposed to UV rays and environmental pollutants. Oxidative stress by these hazardous factors accelerates skin aging and induces skin inflammation and carcinogenesis. Aryl hydrocarbon receptors (AHRs) are chemical sensors that are abundantly expressed in epidermal keratinocytes and mediate the production of reactive oxygen species. To neutralize or minimize oxidative stress, the keratinocytes also express nuclear factor-erythroid 2-related factor-2 (NRF2), which is a master switch for antioxidant signaling. Notably, there is fine-tuned crosstalk between AHR and NRF2, which mutually increase or decrease their activation states. Many NRF2-mediated antioxidant phytochemicals are capable of up- and downmodulating AHR signaling. The precise mechanisms by which these phytochemicals differentially affect the AHR and NRF2 system remain largely unknown and warrant future investigation.

  7. Enhanced sensitivity of A549 cells to the cytotoxic action of anticancer drugs via suppression of Nrf2 by procyanidins from Cinnamomi Cortex extract

    SciTech Connect

    Ohnuma, Tomokazu; Matsumoto, Takashi; Itoi, Ayano; Kawana, Ayako; Nishiyama, Takahito; Ogura, Kenichiro; Hiratsuka, Akira

    2011-10-07

    Highlights: {yields} We found a novel inhibitor of Nrf2 known as a chemoresistance factor. {yields} Overexpressed Nrf2 in lung cancer cells was suppressed by Cinnamomi Cortex extract. {yields} Cytotoxic action of anticancer drugs in cells treated with the extract was enhanced. {yields} Procyanidin tetramers and pentamers were active components in suppressing Nrf2. -- Abstract: Nuclear factor-E2-related factor 2 (Nrf2) is an important cytoprotective transcription factor because Nrf2-regulated enzymes play a key role in antioxidant and detoxification processes. Recent studies have reported that lung cancer cells overexpressing Nrf2 exhibit increased resistance to chemotherapy. Suppression of overexpressed Nrf2 is needed for a new therapeutic approach against lung cancers. In the present study, we found that Cinnamomi Cortex extract (CCE) has an ability to suppress Nrf2-regulated enzyme activity and Nrf2 expression in human lung cancer A549 cells with high Nrf2 activity. Moreover, we demonstrated that CCE significantly enhances sensitivity of A549 cells to the cytotoxic action of doxorubicin and etoposide as well as increasing the intracellular accumulation of both drugs. These results suggest that CCE might be an effective concomitant agent to reduce anticancer drug resistance derived from Nrf2 overexpression. Bioactivity-guided fractionation revealed that procyanidin tetramers and pentamers contained in CCE were active components in suppressing Nrf2.

  8. RETRACTED: 6-OHDA-induced apoptosis and mitochondrial dysfunction are mediated by early modulation of intracellular signals and interaction of Nrf2 and NF-κB factors.

    PubMed

    Tobón-Velasco, Julio C; Limón-Pacheco, Jorge H; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F; Cuadrado, Antonio; Pedraza-Chaverrí, José; Santamaría, Abel

    2013-02-08

    6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage.

  9. Induction of Mrp3 and Mrp4 transporters during acetaminophen hepatotoxicity is dependent on Nrf2

    SciTech Connect

    Aleksunes, Lauren M. Slitt, Angela L. Maher, Jonathan M. Augustine, Lisa M. Goedken, Michael J. Chan, Jefferson Y. Cherrington, Nathan J. Klaassen, Curtis D. Manautou, Jose E.

    2008-01-01

    The transcription factor NFE2-related factor 2 (Nrf2) mediates detoxification and antioxidant gene transcription following electrophile exposure and oxidative stress. Mice deficient in Nrf2 (Nrf2-null) are highly susceptible to acetaminophen (APAP) hepatotoxicity and exhibit lower basal and inducible expression of cytoprotective genes, including NADPH quinone oxidoreductase 1 (Nqo1) and glutamate cysteine ligase (catalytic subunit, or Gclc). Administration of toxic APAP doses to C57BL/6J mice generates electrophilic stress and subsequently increases levels of hepatic Nqo1, Gclc and the efflux multidrug resistance-associated protein transporters 1-4 (Mrp1-4). It was hypothesized that induction of hepatic Mrp1-4 expression following APAP is Nrf2 dependent. Plasma and livers from wild-type (WT) and Nrf2-null mice were collected 4, 24 and 48 h after APAP. As expected, hepatotoxicity was greater in Nrf2-null compared to WT mice. Gene and protein expression of Mrp1-4 and the Nrf2 targets, Nqo1 and Gclc, was measured. Induction of Nqo1 and Gclc mRNA and protein after APAP was dependent on Nrf2 expression. Similarly, APAP treatment increased hepatic Mrp3 and Mrp4 mRNA and protein in WT, but not Nrf2-null mice. Mrp1 was induced in both genotypes after APAP, suggesting that elevated expression of this transporter was independent of Nrf2. Mrp2 was not induced in either genotype at the mRNA or protein levels. These results show that Nrf2 mediates induction of Mrp3 and Mrp4 after APAP but does not affect Mrp1 or Mrp2. Thus coordinated regulation of detoxification enzymes and transporters by Nrf2 during APAP hepatotoxicity is a mechanism by which hepatocytes may limit intracellular accumulation of potentially toxic chemicals.

  10. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    SciTech Connect

    Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2012-11-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs{sup 3+}) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs{sup 3+} exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs{sup 3+} and monomethylarsonous acid (MMA{sup 3+})-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs{sup 3+}-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs{sup 3+}. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs{sup 3+} in β-cells. ► Deficiency of Nrf2 in

  11. A Comparative Study on Antioxidant System in Fish Hepatopancreas and Intestine Affected by Choline Deficiency: Different Change Patterns of Varied Antioxidant Enzyme Genes and Nrf2 Signaling Factors

    PubMed Central

    Wu, Pei; Liu, Yang; Jiang, Wei-Dan; Jiang, Jun; Zhao, Juan; Zhang, Yong-An; Zhou, Xiao-Qiu; Feng, Lin

    2017-01-01

    The liver and intestine are susceptible to the oxidative damage which could result in several diseases. Choline deficiency induced oxidative damage in rat liver cells. Thus, this study aimed to investigate the potential molecular mechanisms responsible for choline deficiency-induced oxidative damage. Juvenile Jian carp were fed diets differing in choline content [165 (deficient group), 310, 607, 896, 1167 and 1820 mg/kg diet] respectively for 65 days. Oxidative damage, antioxidant enzyme activities and related gene expressions in the hepatopancreas and intestine were measured. Choline deficiency decreased choline and phosphatidylcholine contents, and induced oxidative damage in both organs, as evidenced by increased levels of oxidative-stress markers (malondialdehyde, protein carbonyl and 8-hydroxydeoxyguanosine), coupled with decreased activities of antioxidant enzymes [Copper-zinc superoxide dismutase (CuZnSOD), manganese superoxide dismutase (MnSOD), glutathione peroxidase (GPx) and glutathione-S-transferase (GST)]. However, choline deficiency increased glutathione contents in the hepatopancreas and intestine. Furthermore, dietary choline deficiency downregulated mRNA levels of MnSOD, GPx1b, GST-rho, mGST3 and Kelch-like ECH associating protein 1 (Keap1b) in the hepatopancreas, MnSOD, GPx1b, GPx4a, GPx4b, GST-rho, GST-theta, GST-mu, GST-alpha, GST-pi and GST-kappa in the intestine, as well as intestinal Nrf2 protein levels. In contrast, choline deficiency upregulated the mRNA levels of GPx4a, GPx4b, mGST1, mGST2, GST-theta, GST-mu, Keap1a and PKC in the hepatopancreas, mGST3, nuclear factor erythoid 2-related factor 2 (Nrf2) and Keap1a in the intestine, as well as hepatopancreatic Nrf2 protein levels. This study provides new evidence that choline deficiency-induced oxidative damage is associated with changes in the transcription of antioxidant enzyme and Nrf2/Keap1 signaling molecules in the hepatopancreas and intestine. Additionally, this study firstly

  12. Sulforaphane Inhibits HIV Infection of Macrophages through Nrf2.

    PubMed

    Furuya, Andrea Kinga Marias; Sharifi, Hamayun J; Jellinger, Robert M; Cristofano, Paul; Shi, Binshan; de Noronha, Carlos M C

    2016-04-01

    Marburg virus, the Kaposi's sarcoma-associated herpesvirus (KSHV) and Dengue virus all activate, and benefit from, expression of the transcription regulator nuclear erythroid 2-related factor 2 (Nrf2). The impact of Nrf2 activation on human immunodeficiency virus (HIV) infection has not been tested. Sulforaphane (SFN), produced in cruciferous vegetables after mechanical damage, mobilizes Nrf2 to potently reprogram cellular gene expression. Here we show for the first time that SFN blocks HIV infection in primary macrophages but not in primary T cells. Similarly SFN blocks infection in PMA-differentiated promonocytic cell lines, but not in other cell lines tested. siRNA-mediated depletion of Nrf2 boosted HIV infectivity in primary macrophages and reduced the anti-viral effects of SFN treatment. This supports a model in which anti-viral activity is mediated through Nrf2 after it is mobilized by SFN. We further found that, like the type I interferon-induced cellular anti-viral proteins SAMHD1 and MX2, SFN treatment blocks infection after entry, but before formation of 2-LTR circles. Interestingly however, neither SAMHD1 nor MX2 were upregulated. This shows for the first time that Nrf2 action can potently block HIV infection and highlights a novel way to trigger this inhibition.

  13. Apurinic/Apyrimidinic Endonuclease/Redox Factor-1 (APE1/Ref-1) Redox Function Negatively Regulates NRF2*

    PubMed Central

    Fishel, Melissa L.; Wu, Xue; Devlin, Cecilia M.; Logsdon, Derek P.; Jiang, Yanlin; Luo, Meihua; He, Ying; Yu, Zhangsheng; Tong, Yan; Lipking, Kelsey P.; Maitra, Anirban; Rajeshkumar, N. V.; Scandura, Glenda; Kelley, Mark R.; Ivan, Mircea

    2015-01-01

    Apurinic/apyrimidinic endonuclease/redox factor-1 (APE1/Ref-1) (henceforth referred to as Ref-1) is a multifunctional protein that in addition to its base excision DNA repair activity exerts redox control of multiple transcription factors, including nuclear factor κ-light chain enhancer of activated B cells (NF-κB), STAT3, activator protein-1 (AP-1), hypoxia-inducible factor-1 (HIF-1), and tumor protein 53 (p53). In recent years, Ref-1 has emerged as a promising therapeutic target in cancer, particularly in pancreatic ductal carcinoma. Although a significant amount of research has centered on Ref-1, no wide-ranging approach had been performed on the effects of Ref-1 inhibition and transcription factor activity perturbation. Starting with a broader approach, we identified a previously unsuspected effect on the nuclear factor erythroid-related factor 2 (NRF2), a critical regulator of cellular defenses against oxidative stress. Based on genetic and small molecule inhibitor-based methodologies, we demonstrated that repression of Ref-1 potently activates NRF2 and its downstream targets in a dose-dependent fashion, and that the redox, rather than the DNA repair function of Ref-1 is critical for this effect. Intriguingly, our results also indicate that this pathway does not involve reactive oxygen species. The link between Ref-1 and NRF2 appears to be present in all cells tested in vitro, noncancerous and cancerous, including patient-derived tumor samples. In particular, we focused on understanding the implications of the novel interaction between these two pathways in primary pancreatic ductal adenocarcinoma tumor cells and provide the first evidence that this mechanism has implications for overcoming the resistance against experimental drugs targeting Ref-1 activity, with clear translational implications. PMID:25492865

  14. NRF2 promotes breast cancer cell proliferation and metastasis by increasing RhoA/ROCK pathway signal transduction.

    PubMed

    Zhang, Chao; Wang, Hui-Jie; Bao, Qi-Chao; Wang, Lei; Guo, Tian-Kun; Chen, Wei-Lin; Xu, Li-Li; Zhou, Hai-Shan; Bian, Jin-Lei; Yang, Ying-Rui; Sun, Hao-Peng; Xu, Xiao-Li; You, Qi-Dong

    2016-11-08

    Nuclear factor erythroid 2-related factor (NRF2) is an important transcription factor in oxidative stress regulation. Overexpression of NRF2 is associated with human breast carcinogenesis, and increased NRF2 mRNA levels predict poor patient outcome for breast cancer. However, the mechanisms linking gain of NRF2 expression and poor prognosis in breast cancer are still unclear. Here, we provide evidence that NRF2 deletion inhibits proliferation and metastasis of breast cancer cells by down-regulating RhoA. Restoration of RhoA in MCF7 and MDA-MB-231 cells induced NRF2 knockdown-suppressed cell growth and metastasis in vitro, and NRF2 silencing suppressed stress fiber and focal adhesion formation leading to decreased cell migration and invasion. Mechanistic studies showed that NRF2 binds to the promoter region of estrogen-related receptor α (ERR1) and may function as a silencer. This may enhance RhoA protein stability and lead to RhoA overexpression in breast cancer cell. Our findings indicate that NRF2 silencing-mediated reduction of RhoA expression contributes, at least in part, to the poor outcome of breast cancer patients with high NRF2 expression.

  15. NRF2 promotes breast cancer cell proliferation and metastasis by increasing RhoA/ROCK pathway signal transduction

    PubMed Central

    Zhang, Chao; Wang, Hui-Jie; Bao, Qi-Chao; Wang, Lei; Guo, Tian-Kun; Chen, Wei-Lin; Xu, Li-Li; Zhou, Hai-Shan; Bian, Jin-Lei; Yang, Ying-Rui; Sun, Hao-Peng; Xu, Xiao-Li; You, Qi-Dong

    2016-01-01

    Nuclear factor erythroid 2-related factor (NRF2) is an important transcription factor in oxidative stress regulation. Overexpression of NRF2 is associated with human breast carcinogenesis, and increased NRF2 mRNA levels predict poor patient outcome for breast cancer. However, the mechanisms linking gain of NRF2 expression and poor prognosis in breast cancer are still unclear. Here, we provide evidence that NRF2 deletion inhibits proliferation and metastasis of breast cancer cells by down-regulating RhoA. Restoration of RhoA in MCF7 and MDA-MB-231 cells induced NRF2 knockdown-suppressed cell growth and metastasis in vitro, and NRF2 silencing suppressed stress fiber and focal adhesion formation leading to decreased cell migration and invasion. Mechanistic studies showed that NRF2 binds to the promoter region of estrogen-related receptor α (ERR1) and may function as a silencer. This may enhance RhoA protein stability and lead to RhoA overexpression in breast cancer cell. Our findings indicate that NRF2 silencing-mediated reduction of RhoA expression contributes, at least in part, to the poor outcome of breast cancer patients with high NRF2 expression. PMID:27713154

  16. Competition of nuclear factor-erythroid 2 factors related transcription factor isoforms, Nrf1 and Nrf2, in antioxidant enzyme induction.

    PubMed

    Chepelev, Nikolai L; Zhang, Hongqiao; Liu, Honglei; McBride, Skye; Seal, Andrew J; Morgan, Todd E; Finch, Caleb E; Willmore, William G; Davies, Kelvin J A; Forman, Henry Jay

    2013-01-01

    Although the Nrf2 (nuclear factor-erythroid 2 p45 subunit-related factor 2) regulated expression of multiple antioxidant and cytoprotective genes through the electrophile responsive element (EpRE) is well established, interaction of Nrf2/EpRE with Nrf1, a closely-related transcription factor, is less well understood. Due to either proteolysis or alternative translation, Nrf1 has been found as proteins of varying size, p120, p95, and p65, which have been described as either activators of EpRE or competitive inhibitors of Nrf2. We investigated the effect of Nrf1 on EpRE-regulated gene expression using the catalytic and modifier subunits of glutamate cysteine ligase (GCLC and GCLM) as models and explored the potential role of Nrf1 in altering their expression in aging and upon chronic exposure to airborne nano-sized particulate matter (nPM). Nrf1 knockout resulted in the increased expression of GCLC and GCLM in human bronchial epithelial (HBE1) cells. Overexpression Nrf2 in combination with either p120 or p65 diminished or failed to further increase the GCLC- and GLCM-EpRE luciferase activity. All known forms of Nrf1 protein, remained unchanged in the lungs of mice with age or in response to nPM. Our study shows that Nrf1 could inhibit EpRE activity in vitro, whereas the precise role of Nrf1 in vivo requires further investigations. We conclude that Nrf1 may not be directly responsible for the loss of Nrf2-dependent inducibility of antioxidant and cytoprotective genes observed in aged animals.

  17. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  18. Induction of cancer chemopreventive enzymes by coffee is mediated by transcription factor Nrf2. Evidence that the coffee-specific diterpenes cafestol and kahweol confer protection against acrolein

    SciTech Connect

    Higgins, Larry G. Cavin, Christophe; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.

    2008-02-01

    Mice fed diets containing 3% or 6% coffee for 5 days had increased levels of mRNA for NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutathione S-transferase class Alpha 1 (GSTA1) of between 4- and 20-fold in the liver and small intestine. Mice fed 6% coffee also had increased amounts of mRNA for UDP-glucuronosyl transferase 1A6 (UGT1A6) and the glutamate cysteine ligase catalytic (GCLC) subunit of between 3- and 10-fold in the small intestine. Up-regulation of these mRNAs was significantly greater in mice possessing Nrf2 (NF-E2 p45 subunit-related factor 2) than those lacking the transcription factor. Basal levels of mRNAs for NQO1, GSTA1, UGT1A6 and GCLC were lower in tissues from nrf2{sup -/-} mice than from nrf2{sup +/+} mice, but modest induction occurred in the mutant animals. Treatment of mouse embryonic fibroblasts (MEFs) from nrf2{sup +/+} mice with either coffee or the coffee-specific diterpenes cafestol and kahweol (C + K) increased NQO1 mRNA up to 9-fold. MEFs from nrf2{sup -/-} mice expressed less NQO1 mRNA than did wild-type MEFs, but NQO1 was induced modestly by coffee or C + K in the mutant fibroblasts. Transfection of MEFs with nqo1-luciferase reporter constructs showed that induction by C + K was mediated primarily by Nrf2 and required the presence of an antioxidant response element in the 5'-upstream region of the gene. Luciferase reporter activity did not increase following treatment of MEFs with 100 {mu}mol/l furan, suggesting that this ring structure within C + K is insufficient for gene induction. Priming of nrf2{sup +/+} MEFs, but not nrf2{sup -/-} MEFs, with C + K conferred 2-fold resistance towards acrolein.

  19. Multidrug Resistant Protein-Three Gene Regulation by the Transcription Factor Nrf2 in Human Bronchial Epithelial and Non-Small Cell Lung Carcinoma

    PubMed Central

    Mahaffey, Christopher M.; Zhang, Hongqiao; Rinna, Alessandra; Holland, William; Mack, Philip C.; Forman, Henry Jay

    2009-01-01

    Multidrug Resistant Proteins (MRP) are members of the ATP-binding cassette superfamily that facilitate detoxification by transporting toxic compounds, including chemotherapeutic drugs, out of cells. Chemotherapy, radiation, and other xenobiotic stresses have been shown to increase levels of select MRPs, although, the underlying mechanism remains largely unknown. Additionally, MRP3 is suspected of playing a role in the drug resistance of non-small cell lung carcinoma (NSCLC). Analysis of the MRP3 promoter revealed the presence of multiple putative electrophile responsive elements (EpRE), sequences that suggested possible regulation of this gene by Nrf2, the key transcription factor that binds to EpRE. The goal of this investigation was to determine whether MRP3 induction was dependent upon the transcription factor Nrf2. Keap1, a key regulator of Nrf2, sequesters Nrf2 in the cytoplasm, preventing entry into the nucleus. The electrophilic lipid peroxidation product, 4-hydroxy-2-nonenal (HNE) has been shown to modify Keap1 allowing Nrf2 to enter the nucleus. We found that HNE up-regulated MRP3 mRNA and protein levels in cell lines with wild type Keap1 (human bronchial epithelial cell line HBE1 and the NSCLC cell line H358), but not in the Keap1 mutant NSCLC cell lines (A549 and H460). Cell lines with mutant Keap1 had constitutively higher MRP3 that was not increased by HNE treatment. In HBE1 cells, silencing of Nrf2 with siRNA inhibited induction of MRP3 and by HNE. Finally, we found that silencing Nrf2 also increased the toxicity of cisplatin in H358 cells. The combined results therefore support the hypothesis that MRP3 induction by HNE involves Nrf2 activation. PMID:19345732

  20. Methamphetamine oxidative stress, neurotoxicity, and functional deficits are modulated by nuclear factor-E2-related factor 2.

    PubMed

    Ramkissoon, Annmarie; Wells, Peter G

    2015-12-01

    Activation of redox-sensitive transcription factors like nuclear factor-E2-related factor 2 (Nrf2) can enhance the transcription of cytoprotective genes during oxidative stress. We investigated whether Nrf2 is activated by methamphetamine (METH) thereby altering neurotoxicity in Nrf2 +/+ and -/- adult mouse brain. A single dose of METH can induce the mRNA levels of Nrf2-regulated antioxidant and cytoprotective proteins in mouse brain. Multiple-day dosing with METH enhanced DNA oxidation and decreased tyrosine hydroxylase and dopamine transporter staining in the striatum, indicating dopaminergic nerve terminal toxicity, which was more severe in -/- mice, as were deficits in motor coordination and olfactory discrimination. These Nrf2-dependent effects were independent of changes in METH metabolism or the induction of hyperthermia. Similarly, METH increased striatal glial fibrillary acidic protein, indicating neurotoxicity. METH neurotoxicity was also observed in the glial cells and in the GABAergic system of the olfactory bulbs and was enhanced in -/- mice, whereas dopaminergic parameters were unaffected. With one-day dosing of METH, there were no differences between +/+ and -/- mice in either basal or METH-enhanced DNA oxidation and neurotoxicity markers. Nrf2-mediated pathways accordingly may protect against the neurodegenerative effects and functional deficits initiated by METH and perhaps other reactive oxygen species-enhancing neurotoxicants, when there is time for transcriptional activation and protein induction. In human users of METH, this mechanism may be essential when differences in drug abuse patterns may alter the induction and duration of Nrf2 activation thereby modulating susceptibility to the neurotoxic effects of METH.

  1. Phosphorylation of Nrf2 in the transcription activation domain by casein kinase 2 (CK2) is critical for the nuclear translocation and transcription activation function of Nrf2 in IMR-32 neuroblastoma cells.

    PubMed

    Apopa, Patrick L; He, Xiaoqing; Ma, Qiang

    2008-02-01

    The antioxidant-activated transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) regulates the induction of cytoprotective genes against chemical toxicity and oxidative injuries. The role of phosphorylation in Nrf2 activation has been suggested but remains elusive. We report that phenolic antioxidant/pro-oxidant tert-butylhydroquinone (tBHQ) induced two forms of the Nrf2 protein in neuroblastoma cells (IMR-32), which migrated as distinctive bands on SDS-PAGE. In vitro treatment with lambda phosphatase eliminated the slower migrating form and increased the amount of the faster migrating form of Nrf2. In vivo (32)Pi-phosphorylation resulted in (32)Pi-labeling of the Nrf2 protein in the presence of tBHQ that can be dephosphorylated by lambda phosphotase, indicating that the slower migrating form is a phosphorylated Nrf2 protein and the faster form an unphosphorylated Nrf2. Unphosphorylated Nrf2 predominated in the cytoplasm, whereas the phosphorylated form preferentially localized in the nucleus. Nuclear Nrf2 can be dephosphorylated by lambda phosphotase in vitro and be converted to the faster migrating form, implicating phosphorylation of Nrf2 in the cytoplasmic-nuclear translocation of the protein. Deletional analyses from both the carboxyl- and amino-ends revealed the transcription activation (TA) domains Neh4 (Nrf2-ECH homology 4) and Neh5 (Nrf2-ECH homology 5) as a major region necessary for the phosphorylation. The TA domains are characterized by the presence of multiple phosphorylation sites of casein kinase 2 (CK2). Moreover, CK2 phosphorylated the TA domains in vitro. Treatment with CK2 inhibitor 2-dimethylamino-4,5,6,7,-tetrabromo-1H-benzimidazole (DMAT) blocked the induction of endogenous target genes of Nrf2 in cells and inhibited the TA activities of both the full length and the TA domains of Nrf2 to a large extent. Finally, phosphorylation of the TA domains correlated with the nuclear translocation of Nrf2 that was inhibited by DMAT in a

  2. Amelioration of inflammation and tissue damage in sickle cell model mice by Nrf2 activation

    PubMed Central

    Keleku-Lukwete, Nadine; Suzuki, Mikiko; Otsuki, Akihito; Tsuchida, Kouhei; Katayama, Saori; Hayashi, Makiko; Naganuma, Eriko; Moriguchi, Takashi; Tanabe, Osamu; Engel, James Douglas; Imaizumi, Masue; Yamamoto, Masayuki

    2015-01-01

    Sickle cell disease (SCD) is an inherited disorder caused by a point mutation in the β-globin gene, leading to the production of abnormally shaped red blood cells. Sickle cells are prone to hemolysis and thereby release free heme into plasma, causing oxidative stress and inflammation that in turn result in damage to multiple organs. The transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) is a master regulator of the antioxidant cell-defense system. Here we show that constitutive Nrf2 activation by ablation of its negative regulator Keap1 (kelch-like ECH-associated protein 1) significantly improves symptoms in SCD model mice. SCD mice exhibit severe liver damage and lung inflammation associated with high expression levels of proinflammatory cytokines and adhesion molecules compared with normal mice. Importantly, these symptoms subsided after Nrf2 activation. Although hemolysis and stress erythropoiesis did not change substantially in the Nrf2-activated SCD mice, Nrf2 promoted the elimination of plasma heme released by sickle cells’ hemolysis and thereby reduced oxidative stress and inflammation, demonstrating that Nrf2 activation reduces organ damage and segregates inflammation from prevention of hemolysis in SCD mice. Furthermore, administration of the Nrf2 inducer CDDO-Im (2-cyano-3, 12 dioxooleana-1, 9 diene-28-imidazolide) also relieved inflammation and organ failure in SCD mice. These results support the contention that Nrf2 induction may be an important means to protect organs from the pathophysiology of sickle cell-induced damage. PMID:26371321

  3. Nrf2 activity as a potential biomarker for the pan-epigenetic anticancer agent, RRx-001

    PubMed Central

    Ning, Shoucheng; Sekar, Thillai Veerapazham; Scicinski, Jan; Oronsky, Bryan; Peehl, Donna M.; Knox, Susan J.; Paulmurugan, Ramasamy

    2015-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a master regulatory transcription factor that plays an important role in the antioxidant response pathway against anticancer drug-induced cytotoxic effects. RRx-001 is a new anticancer agent that generates reactive oxygen and nitrogen species, and leads to epigenetic alterations in cancer cells. Here we report the RRx-001 mediated nuclear translocation of Nrf2 and the activation of expression of its downstream enzymes HO-1 and NQO1 in tumor cells. Inhibition of intrinsic Nrf2 expression by Nrf2-specific siRNA increased cell sensitivity to RRx-001. Molecular imaging of tumor cells co-expressing pARE-Firefly luciferase and pCMV-Renilla luciferase-mRFP in vitro and in vivo in mice revealed that RRx-001 significantly increased ARE-FLUC signal in cells in a dose- and time-dependent manner, suggesting that RRx-001 is an effective activator of the Nrf2-ARE signaling pathway. The pre-treatment level of ARE-FLUC signal in cells, reflecting basal activity of Nrf2, negatively correlated with the tumor response to RRx-001. The results support the concept that RRx-001 activates Nrf2-ARE antioxidant signaling pathways in tumor cells. Hence measurement of Nrf2-mediated activation of downstream target genes through ARE signaling may constitute a useful molecular biomarker for the early prediction of response to RRx-001 treatment, and thereby guide therapeutic decision-making. PMID:26280276

  4. NRF2 Regulates HER2 and HER3 Signaling Pathway to Modulate Sensitivity to Targeted Immunotherapies.

    PubMed

    Khalil, Hilal S; Langdon, Simon P; Kankia, Ibrahim H; Bown, James; Deeni, Yusuf Y

    2016-01-01

    NF-E2 related factor-2 (NRF2) is an essential transcription factor for multiple genes encoding antioxidants and detoxification enzymes. NRF2 is implicated in promoting cancer therapeutic resistance by its detoxification function and crosstalk with proproliferative pathways. However, the exact mechanism of this intricate connectivity between NRF2 and growth factor induced proliferative pathway remains elusive. Here, we have demonstrated that pharmacological activation of NRF2 by tert-butylhydroquinone (tBHQ) upregulates the HER family receptors, HER2 and HER3 expression, elevates pAKT levels, and enhances the proliferation of ovarian cancer cells. Preactivation of NRF2 also attenuates the combined growth inhibitory effects of HER2 targeting monoclonal antibodies, Pertuzumab and Trastuzumab. Further, tBHQ caused transcriptional induction of HER2 and HER3, while SiRNA-mediated knockdown of NRF2 prevented this and further caused transcriptional repression and enhanced cytotoxicity of the HER2 inhibitors. Hence, NRF2 regulates both HER2 and HER3 receptors to influence cellular responses to HER2 targeting monoclonal antibodies. This deciphered crosstalk mechanism reinforces the role of NRF2 in drug resistance and as a relevant anticancer target.

  5. Amelioration of inflammation and tissue damage in sickle cell model mice by Nrf2 activation.

    PubMed

    Keleku-Lukwete, Nadine; Suzuki, Mikiko; Otsuki, Akihito; Tsuchida, Kouhei; Katayama, Saori; Hayashi, Makiko; Naganuma, Eriko; Moriguchi, Takashi; Tanabe, Osamu; Engel, James Douglas; Imaizumi, Masue; Yamamoto, Masayuki

    2015-09-29

    Sickle cell disease (SCD) is an inherited disorder caused by a point mutation in the β-globin gene, leading to the production of abnormally shaped red blood cells. Sickle cells are prone to hemolysis and thereby release free heme into plasma, causing oxidative stress and inflammation that in turn result in damage to multiple organs. The transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) is a master regulator of the antioxidant cell-defense system. Here we show that constitutive Nrf2 activation by ablation of its negative regulator Keap1 (kelch-like ECH-associated protein 1) significantly improves symptoms in SCD model mice. SCD mice exhibit severe liver damage and lung inflammation associated with high expression levels of proinflammatory cytokines and adhesion molecules compared with normal mice. Importantly, these symptoms subsided after Nrf2 activation. Although hemolysis and stress erythropoiesis did not change substantially in the Nrf2-activated SCD mice, Nrf2 promoted the elimination of plasma heme released by sickle cells' hemolysis and thereby reduced oxidative stress and inflammation, demonstrating that Nrf2 activation reduces organ damage and segregates inflammation from prevention of hemolysis in SCD mice. Furthermore, administration of the Nrf2 inducer CDDO-Im (2-cyano-3, 12 dioxooleana-1, 9 diene-28-imidazolide) also relieved inflammation and organ failure in SCD mice. These results support the contention that Nrf2 induction may be an important means to protect organs from the pathophysiology of sickle cell-induced damage.

  6. Genetic polymorphism in the NRF2 gene as a prognosis marker for cancer chemotherapy.

    PubMed

    Ishikawa, Toshihisa

    2014-01-01

    NF-E2-related factor 2 (NRF2) is a transcription factor that controls the expression of a variety of antioxidant and detoxification genes. Accumulating evidence strongly suggests that NRF2 mediates cancer cell proliferation and drug resistance, as well. Single nucleotide polymorphism (SNP) -617C > A in the anti-oxidant response element-like loci of the human NRF2 gene play a pivotal role in the positive feedback loop of transcriptional activation of the NRF2 gene. Since the SNP (-617A) reportedly decreases the binding affinity to the transcription factors of NRF2/small multiple alignment format (MafK), the homozygous -617A/A allele may attenuate the positive feedback loop of transcriptional activation of the NRF2 gene and reduce the NRF2 protein level. As the consequence, cancer cells are considered to become more sensitive to therapy and less aggressive than cancer cells harboring the -617C (WT) allele. Indeed, Japanese lung cancer patients carrying SNP homozygous alleles (c. -617A/A) exhibited remarkable survival over 1,700 days after surgical operation (log-rank p = 0.021). The genetic polymorphism in the human NRF2 gene is considered as one of prognosis markers for cancer therapy.

  7. Sulforaphane inhibits platelet-derived growth factor-induced vascular smooth muscle cell proliferation by targeting mTOR/p70S6kinase signaling independent of Nrf2 activation.

    PubMed

    Shawky, Noha M; Segar, Lakshman

    2017-02-14

    Activation of nuclear factor erythroid 2-related factor 2 (Nrf2, a transcription factor) and/or inhibition of mammalian target of rapamycin (mTOR) are implicated in the suppression of vascular smooth muscle cell (VSMC) proliferation. The present study has examined the likely regulatory effects of sulforaphane (SFN, an antioxidant) on Nrf2 activation and platelet-derived growth factor (PDGF)-induced mTOR signaling in VSMCs. Using human aortic VSMCs, nuclear extraction and siRNA-mediated downregulation studies were performed to determine the role of Nrf2 on SFN regulation of PDGF-induced proliferative signaling. Immunoprecipitation and/or immunoblot studies were carried out to determine how SFN regulates PDGF-induced mTOR/p70S6K/S6 versus ERK and Akt signaling. Immunohistochemical analysis was performed to determine SFN regulation of S6 phosphorylation in the injured mouse femoral artery. SFN (5μM) inhibits PDGF-induced activation of mTOR without affecting mTOR association with raptor in VSMCs. While SFN inhibits PDGF-induced phosphorylation of p70S6K and 4E-BP1 (downstream targets of mTOR), it does not affect ERK or Akt phosphorylation. In addition, SFN diminishes exaggerated phosphorylation of S6 ribosomal protein (a downstream target of p70S6K) in VSMCs in vitro and in the neointimal layer of injured artery in vivo. Although SFN promotes Nrf2 accumulation to upregulate cytoprotective genes (e.g., heme oxygenase-1 and thioredoxin-1), downregulation of endogenous Nrf2 by target-specific siRNA reveals an Nrf2-independent effect for SFN-mediated inhibition of mTOR/p70S6K/S6 signaling and suppression of VSMC proliferation. Strategies that utilize local delivery of SFN at the lesion site may limit restenosis after angioplasty by targeting mTOR/p70S6K/S6 axis in VSMCs independent of Nrf2 activation.

  8. Possible involvement of nuclear factor erythroid 2-related factor 2 in the gene expression of Cyp2b10 and Cyp2a5.

    PubMed

    Ashino, Takashi; Ohkubo-Morita, Haruyo; Yamamoto, Masayuki; Yoshida, Takemi; Numazawa, Satoshi

    2014-01-01

    Cytochrome P450 gene expression is altered by various chemical compounds. In this study, we used nuclear factor erythroid 2-related factor 2 (Nrf2)-deficient (Nrf2(-⧸-)) mice to investigate the involvement of Nrf2 in Cyp2b10 and Cyp2a5 gene expression. Phorone, an Nrf2 activator, strongly increased Cyp2b10 and Cyp2a5 mRNA as well as Nrf2 target genes, including NAD(P)H-quinone oxidoreductase-1 and heme oxygenase-1, in wild-type mouse livers 8 h after treatment. The phorone-induced mRNA levels in Nrf2(-⧸-) mouse livers were lower than that in wild-type mouse livers. Nrf2(-⧸-) mice showed attenuated Cyp2b10 and Cyp2a5 induction by phenobarbital, a classical Cyp2b inducer. These findings suggest that the Nrf2 pathway is involved in Cyp2b10 and Cyp2a5 gene expression.

  9. Coordinated induction of Nrf2 target genes protects against iron nitrilotriacetate (FeNTA)-induced nephrotoxicity

    SciTech Connect

    Tanaka, Yuji; Aleksunes, Lauren M. |; Goedken, Michael J.; Chen, Chuan; Reisman, Scott A.; Manautou, Jose E.; Klaassen, Curtis D.

    2008-09-15

    The iron chelate, ferric nitrilotriacetate (FeNTA), induces acute proximal tubular necrosis as a consequence of lipid peroxidation and oxidative tissue damage. Chronic exposure of FeNTA leads to a high incidence of renal adenocarcinomas in rodents. NF-E2-related factor 2 (Nrf2) is a transcription factor that is activated by oxidative stress and electrophiles, and regulates the basal and inducible expression of numerous detoxifying and antioxidant genes. To determine the roles of Nrf2 in regulating renal gene expression and protecting against oxidative stress-induced kidney damage, wild-type and Nrf2-null mice were administered FeNTA. Renal Nrf2 protein translocated to the nucleus at 6h after FeNTA treatment. FeNTA increased mRNA levels of Nrf2 target genes, including NQO1, GCLC, GSTpi1/2, Mrp1, 2, and 4 in kidneys from wild-type mice, but not Nrf2-null mice. Protein expression of NQO1, a prototypical Nrf2 target gene, was increased in wild-type mice, with no change in Nrf2-null mice. FeNTA produced more nephrotoxicity in Nrf2-null mice than wild-type mice as indicated by higher serum urea nitrogen and creatinine levels, as more urinary NAG, stronger 4-hydroxynonenal protein adduct staining, and more extensive proximal tubule damage. Furthermore, pretreatment with CDDO-Im, a potent small molecule Nrf2 activator, protected mice against FeNTA-induced renal toxicity. Collectively, these results suggest that activation of Nrf2 protects mouse kidneys from FeNTA-induced oxidative stress damage by coordinately up-regulating the expression of cytoprotective genes.

  10. Molecular basis of electrophilic and oxidative defense: promises and perils of Nrf2.

    PubMed

    Ma, Qiang; He, Xiaoqing

    2012-10-01

    Induction of drug-metabolizing enzymes through the antioxidant response element (ARE)-dependent transcription was initially implicated in chemoprevention against cancer by antioxidants. Recent progress in understanding the biology and mechanism of induction revealed a critical role of induction in cellular defense against electrophilic and oxidative stress. Induction is mediated through a novel signaling pathway via two regulatory proteins, the nuclear factor erythroid 2-related factor 2 (Nrf2) and the Kelch-like erythroid cell-derived protein with CNC homology-associated protein 1 (Keap1). Nrf2 binds to Keap1 at a two site-binding interface and is ubiquitinated by the Keap1/cullin 3/ring box protein-1-ubiquitin ligase, resulting in a rapid turnover of Nrf2 protein. Electrophiles and oxidants modify critical cysteine thiols of Keap1 and Nrf2 to inhibit Nrf2 ubiquitination, leading to Nrf2 activation and induction. Induction increases stress resistance critical for cell survival, because knockout of Nrf2 in mice increased susceptibility to a variety of toxicity and disease processes. Collateral to diverse functions of Nrf2, genome-wide search has led to the identification of a plethora of ARE-dependent genes regulated by Nrf2 in an inducer-, tissue-, and disease-dependent manner to control drug metabolism, antioxidant defense, stress response, proteasomal degradation, and cell proliferation. The protective nature of Nrf2 could also be hijacked in a number of pathological conditions by means of somatic mutation, epigenetic alteration, and accumulation of disruptor proteins, promoting drug resistance in cancer and pathologic liver features in autophagy deficiency. The repertoire of ARE inducers has expanded enormously; the therapeutic potential of the inducers has been examined beyond cancer prevention. Developing potent and specific ARE inducers and Nrf2 inhibitors holds certain new promise for the prevention and therapy against cancer, chronic disease, and toxicity.

  11. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    SciTech Connect

    Jing, Xu; Ren, Dongmei; Wei, Xinbing; Shi, Huanying; Zhang, Xiumei; Perez, Ruth G.; Lou, Haiyan; Lou, Hongxiang

    2013-12-15

    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury.

  12. Insulin Inhibits Nrf2 Gene Expression via Heterogeneous Nuclear Ribonucleoprotein F/K in Diabetic Mice.

    PubMed

    Ghosh, Anindya; Abdo, Shaaban; Zhao, Shuiling; Wu, Chin-Han; Shi, Yixuan; Lo, Chao-Sheng; Chenier, Isabelle; Alquier, Thierry; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao-Ling; Chan, John S D

    2017-01-23

    Oxidative stress induces endogenous antioxidants via nuclear factor erythroid 2-related factor 2 (Nrf2), potentially preventing tissue injury. We investigated whether insulin affects renal Nrf2 expression in type 1 diabetes (T1D) and studied its underlying mechanism. Insulin normalized hyperglycemia, hypertension, oxidative stress and renal injury, inhibited renal Nrf2 and angiotensinogen (Agt) gene expression and up-regulated heterogeneous nuclear ribonucleoprotein F (hnRNP F) and hnRNP K expression in Akita mice with T1D. In immortalized rat renal proximal tubular cells, insulin suppressed Nrf2 and Agt but stimulated hnRNP F and hnRNP K gene transcription in high glucose via p44/42 mitogen-activated protein kinase signalling. Transfection with small interfering RNAs of p44/42 MAPK, hnRNP F or hnRNP K blocked insulin inhibition of Nrf2 gene transcription. Insulin curbed Nrf2 promoter activity via a specific DNA-responsive element that binds hnRNP F/K, and hnRNP F/K overexpression curtailed Nrf2 promoter activity. In hyperinsulinemic-euglycemic mice, renal Nrf2 and Agt expression was down-regulated, whereas hnRNP F/K expression was up-regulated. Thus, the beneficial actions of insulin in diabetic nephropathy appear to be mediated, in part, by suppressing renal Nrf2 and Agt gene transcription and preventing Nrf2 stimulation of Agt expression via hnRNP F/K. These findings identify hnRNP F/K and Nrf2 as potential therapeutic targets in diabetes.

  13. Activation of NRF2 by p62 and proteasome reduction in sphere-forming breast carcinoma cells

    PubMed Central

    Ryoo, In-geun; Choi, Bo-hyun; Kwak, Mi-Kyoung

    2015-01-01

    Cancer stem cells (CSCs) express high levels of drug efflux transporters and antioxidant genes, and are therefore believed to be responsible for cancer recurrence following chemo/radiotherapy intervention. In this study, we investigated the role of NF-E2-related factor 2 (NRF2), a master regulator of antioxidant gene expression, in the growth and stress resistance of CSC-enriched mammosphere. The MCF7 mammospheres expressed significantly higher levels of the NRF2 protein and target gene expression compared to the monolayer. As underlying mechanisms, we observed that proteolytic activity and expression of the proteasome catalytic subunits were decreased in the mammospheres. Additionally, mammospheres retained a high level of p62 and the silencing of p62 was observed to attenuate NRF2 activation. NRF2 increase was confirmed in sphere-cultures of the colon and ovarian cancer cells. The functional implication of NRF2 was demonstrated in NRF2-knockdown mammospheres. NRF2-silenced mammospheres demonstrated increased cell death and retarded sphere growth as a result of target gene repression. Moreover, unlike the control mammospheres, NRF2-knockdown mammospheres did not develop anticancer drug resistance. Collectively, these results indicated that altered proteasome function and p62 expression caused NRF2 activation in CSC-enriched mammospheres. In addition, NRF2 appeared to play a role in CSC survival and anticancer drug resistance. PMID:25717032

  14. Generation of a New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B1 Toxicity.

    PubMed

    Taguchi, Keiko; Takaku, Misaki; Egner, Patricia A; Morita, Masanobu; Kaneko, Takehito; Mashimo, Tomoji; Kensler, Thomas W; Yamamoto, Masayuki

    2016-07-01

    THE TRANSCRIPTION FACTOR NRF2: (NF-E2-related-factor 2) REGULATES A BATTERY OF ANTIOXIDATIVE STRESS-RESPONSE GENES AND DETOXICATION GENES, AND NRF2 KNOCKOUT LINES OF MICE HAVE BEEN CONTRIBUTING CRITICALLY TO THE CLARIFICATION OF ROLES THAT NRF2 PLAYS FOR CELL PROTECTION HOWEVER, THERE ARE APPARENT LIMITATIONS IN USE OF THE MOUSE MODELS FOR INSTANCE, RATS EXHIBIT MORE SUITABLE FEATURES FOR TOXICOLOGICAL OR PHYSIOLOGICAL EXAMINATIONS THAN MICE IN THIS STUDY, WE GENERATED 2 LINES OF NRF2 KNOCKOUT RATS BY USING A GENOME EDITING TECHNOLOGY; 1 LINE HARBORS A 7-BP DELETION Δ7 AND THE OTHER LINE HARBORS A 1-BP INSERTION +1 IN THE NRF2 GENE IN THE LIVERS OF RATS HOMOZYGOUSLY DELETING THE NRF2 GENE, AN ACTIVATOR OF NRF2 SIGNALING, CDDO-IM, COULD NOT INDUCE EXPRESSION OF REPRESENTATIVE NRF2 TARGET GENES TO EXAMINE ALTERED TOXICOLOGICAL RESPONSE, WE TREATED THE NRF2 KNOCKOUT RATS WITH AFLATOXIN B1 AFB1, A CARCINOGENIC MYCOTOXIN THAT ELICITS GENE MUTATIONS THROUGH BINDING OF ITS METABOLITES TO DNA AND FOR WHICH THE RAT HAS BEEN PROPOSED AS A REASONABLE SURROGATE FOR HUMAN TOXICITY INDEED, IN THE NRF2 KNOCKOUT RAT LIVERS THE ENZYMES OF THE AFB1 DETOXICATION PATHWAY WERE SIGNIFICANTLY DOWNREGULATED SINGLE DOSE ADMINISTRATION OF AFB1 INCREASED HEPATOTOXICITY AND BINDING OF AFB1-N7-GUANINE TO HEPATIC DNA IN NRF2 KNOCKOUT RATS COMPARED WITH WILD-TYPE NRF2 KNOCKOUT RATS REPEATEDLY TREATED WITH AFB1 WERE PRONE TO LETHALITY AND CDDO-IM WAS NO LONGER PROTECTIVE THESE RESULTS DEMONSTRATE THAT NRF2 KNOCKOUT RATS ARE QUITE SENSITIVE TO AFB1 TOXICITIES AND THIS RAT GENOTYPE EMERGES AS A NEW MODEL ANIMAL IN TOXICOLOGY.

  15. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    SciTech Connect

    Li, Bin; Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S.; Ward, Keith W.; Meyer, Colin J.; Wang, Xing Li; Tang, Dongqi; Cui, Taixing

    2014-02-21

    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  16. Salidroside Suppresses HUVECs Cell Injury Induced by Oxidative Stress through Activating the Nrf2 Signaling Pathway.

    PubMed

    Zhu, Yao; Zhang, Ya-Jie; Liu, Wei-Wei; Shi, Ai-Wu; Gu, Ning

    2016-08-09

    Oxidative stress plays an important role in the pathogenesis of cardiovascular diseases. Salidroside (SAL), one of the main effective constituents of Rhodiola rosea, has been reported to suppress oxidative stress-induced cardiomyocyte injury and necrosis by promoting transcription of nuclear factor E2-related factor 2 (Nrf2)-regulated genes such as heme oxygenase-1 (HO-1) and NAD(P)H dehydrogenase (quinone1) (NQO1). However, it has not been indicated whether SAL might ameliorate endothelial injury induced by oxidative stress. Here, our study demonstrated that SAL might suppress HUVEC cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. The results of our study indicated that SAL decreased the levels of intercellular reactive oxygen species (ROS) and malondialdehyde (MDA), and improved the activities of superoxide dismutase (SOD) and catalase (CAT), resulting in protective effects against oxidative stress-induced cell damage in HUVECs. It suppressed oxidative stress damage by inducing Nrf2 nuclear translocation and activating the expression of Nrf2-regulated antioxidant enzyme genes such as HO-1 and NQO1 in HUVECs. Knockdown of Nrf2 with siRNA abolished the cytoprotective effects against oxidative stress, decreased the expression of Nrf2, HO-1, and NQO1, and inhibited the nucleus translocation of Nrf2 in HUVECs. This study is the first to demonstrate that SAL suppresses HUVECs cell injury induced by oxidative stress through activating the Nrf2 signaling pathway.

  17. The Keap1-Nrf2 system prevents onset of diabetes mellitus.

    PubMed

    Uruno, Akira; Furusawa, Yuki; Yagishita, Yoko; Fukutomi, Toshiaki; Muramatsu, Hiroyuki; Negishi, Takaaki; Sugawara, Akira; Kensler, Thomas W; Yamamoto, Masayuki

    2013-08-01

    Transcription factor Nrf2 (NF-E2-related factor 2) regulates a broad cytoprotective response to environmental stresses. Keap1 (Kelch-like ECH-associated protein 1) is an adaptor protein for cullin3-based ubiquitin E3 ligase and negatively regulates Nrf2. Whereas the Keap1-Nrf2 system plays important roles in oxidative stress response and metabolism, the roles Nrf2 plays in the prevention of diabetes mellitus remain elusive. Here we show that genetic activation of Nrf2 signaling by Keap1 gene hypomorphic knockdown (Keap1flox/-) markedly suppresses the onset of diabetes. When Keap1flox/- mice were crossed with diabetic db/db mice, blood glucose levels became lower through improvement of both insulin secretion and insulin resistance. Keap1flox/- also prevented high-calorie-diet-induced diabetes. Oral administration of the Nrf2 inducer CDDO-Im {oleanolic acid 1-[2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oyl] imidazole} also attenuated diabetes in db/db mice. Nrf2 induction altered antioxidant-, energy consumption-, and gluconeogenesis-related gene expression in metabolic tissues. Thus, the Keap1-Nrf2 system is a critical target for preventing the onset of diabetes mellitus.

  18. Neuronal development is promoted by weakened intrinsic antioxidant defences due to epigenetic repression of Nrf2

    PubMed Central

    Bell, Karen F.S.; Al-Mubarak, Bashayer; Martel, Marc-André; McKay, Sean; Wheelan, Nicola; Hasel, Philip; Márkus, Nóra M.; Baxter, Paul; Deighton, Ruth F.; Serio, Andrea; Bilican, Bilada; Chowdhry, Sudhir; Meakin, Paul J.; Ashford, Michael L.J.; Wyllie, David J.A.; Scannevin, Robert H.; Chandran, Siddharthan; Hayes, John D.; Hardingham, Giles E.

    2015-01-01

    Forebrain neurons have weak intrinsic antioxidant defences compared with astrocytes, but the molecular basis and purpose of this is poorly understood. We show that early in mouse cortical neuronal development in vitro and in vivo, expression of the master-regulator of antioxidant genes, transcription factor NF-E2-related-factor-2 (Nrf2), is repressed by epigenetic inactivation of its promoter. Consequently, in contrast to astrocytes or young neurons, maturing neurons possess negligible Nrf2-dependent antioxidant defences, and exhibit no transcriptional responses to Nrf2 activators, or to ablation of Nrf2's inhibitor Keap1. Neuronal Nrf2 inactivation seems to be required for proper development: in maturing neurons, ectopic Nrf2 expression inhibits neurite outgrowth and aborization, and electrophysiological maturation, including synaptogenesis. These defects arise because Nrf2 activity buffers neuronal redox status, inhibiting maturation processes dependent on redox-sensitive JNK and Wnt pathways. Thus, developmental epigenetic Nrf2 repression weakens neuronal antioxidant defences but is necessary to create an environment that supports neuronal development. PMID:25967870

  19. Genetic silencing of Nrf2 enhances X-ROS in dysferlin-deficient muscle

    PubMed Central

    Kombairaju, Ponvijay; Kerr, Jaclyn P.; Roche, Joseph A.; Pratt, Stephen J. P.; Lovering, Richard M.; Sussan, Thomas E.; Kim, Jung-Hyun; Shi, Guoli; Biswal, Shyam; Ward, Christopher W.

    2014-01-01

    Oxidative stress is a critical disease modifier in the muscular dystrophies. Recently, we discovered a pathway by which mechanical stretch activates NADPH Oxidase 2 (Nox2) dependent ROS generation (X-ROS). Our work in dystrophic skeletal muscle revealed that X-ROS is excessive in dystrophin-deficient (mdx) skeletal muscle and contributes to muscle injury susceptibility, a hallmark of the dystrophic process. We also observed widespread alterations in the expression of genes associated with the X-ROS pathway and redox homeostasis in muscles from both Duchenne muscular dystrophy patients and mdx mice. As nuclear factor erythroid 2-related factor 2 (Nrf2) plays an essential role in the transcriptional regulation of genes involved in redox homeostasis, we hypothesized that Nrf2 deficiency may contribute to enhanced X-ROS signaling by reducing redox buffering. To directly test the effect of diminished Nrf2 activity, Nrf2 was genetically silenced in the A/J model of dysferlinopathy—a model with a mild histopathologic and functional phenotype. Nrf2-deficient A/J mice exhibited significant muscle-specific functional deficits, histopathologic abnormalities, and dramatically enhanced X-ROS compared to control A/J and WT mice, both with functional Nrf2. Having identified that reduced Nrf2 activity is a negative disease modifier, we propose that strategies targeting Nrf2 activation may address the generalized reduction in redox homeostasis to halt or slow dystrophic progression. PMID:24600403

  20. Oxidative Stress, Nrf2, and Epigenetic Modification Contribute to Anticancer Drug Resistance.

    PubMed

    Kang, Kyoung Ah; Hyun, Jin Won

    2017-01-01

    Nuclear factor E2-related factor 2 (Nrf2), a transcription factor, controls the expression of genes encoding cytoprotective proteins, including antioxidant enzymes that combat oxidative and electrophilic stress to maintain redox homeostasis. However, recent studies demonstrated that, in cancer, aberrant activation of Nrf2 by epigenetic alterations promotes high expression of cytoprotective proteins, which can decrease the efficacy of anticancer drugs used for chemotherapy. In this review, we summarize recent findings regarding the relationship between oxidative stress, Nrf2, epigenetic modification, and anticancer drug resistance, which should aid in development of new strategies to improve chemotherapeutic efficacy.

  1. Oxidative Stress, Nrf2, and Epigenetic Modification Contribute to Anticancer Drug Resistance

    PubMed Central

    Kang, Kyoung Ah; Hyun, Jin Won

    2017-01-01

    Nuclear factor E2-related factor 2 (Nrf2), a transcription factor, controls the expression of genes encoding cytoprotective proteins, including antioxidant enzymes that combat oxidative and electrophilic stress to maintain redox homeostasis. However, recent studies demonstrated that, in cancer, aberrant activation of Nrf2 by epigenetic alterations promotes high expression of cytoprotective proteins, which can decrease the efficacy of anticancer drugs used for chemotherapy. In this review, we summarize recent findings regarding the relationship between oxidative stress, Nrf2, epigenetic modification, and anticancer drug resistance, which should aid in development of new strategies to improve chemotherapeutic efficacy. PMID:28133507

  2. Overview of Nrf2 as Therapeutic Target in Epilepsy

    PubMed Central

    Carmona-Aparicio, Liliana; Pérez-Cruz, Claudia; Zavala-Tecuapetla, Cecilia; Granados-Rojas, Leticia; Rivera-Espinosa, Liliana; Montesinos-Correa, Hortencia; Hernández-Damián, Jacqueline; Pedraza-Chaverri, José; Sampieri, Aristides III; Coballase-Urrutia, Elvia; Cárdenas-Rodríguez, Noemí

    2015-01-01

    Oxidative stress is a biochemical state of imbalance in the production of reactive oxygen and nitrogen species and antioxidant defenses. It is involved in the physiopathology of degenerative and chronic neuronal disorders, such as epilepsy. Experimental evidence in humans and animals support the involvement of oxidative stress before and after seizures. In the past few years, research has increasingly focused on the molecular pathways of this process, such as that involving transcription factor nuclear factor E2-related factor 2 (Nrf2), which plays a central role in the regulation of antioxidant response elements (ARE) and modulates cellular redox status. The aim of this review is to present experimental evidence on the role of Nrf2 in this neurological disorder and to further determine the therapeutic impact of Nrf2 in epilepsy. PMID:26262608

  3. Overview of Nrf2 as Therapeutic Target in Epilepsy.

    PubMed

    Carmona-Aparicio, Liliana; Pérez-Cruz, Claudia; Zavala-Tecuapetla, Cecilia; Granados-Rojas, Leticia; Rivera-Espinosa, Liliana; Montesinos-Correa, Hortencia; Hernández-Damián, Jacqueline; Pedraza-Chaverri, José; Sampieri, Aristides; Coballase-Urrutia, Elvia; Cárdenas-Rodríguez, Noemí

    2015-08-07

    Oxidative stress is a biochemical state of imbalance in the production of reactive oxygen and nitrogen species and antioxidant defenses. It is involved in the physiopathology of degenerative and chronic neuronal disorders, such as epilepsy. Experimental evidence in humans and animals support the involvement of oxidative stress before and after seizures. In the past few years, research has increasingly focused on the molecular pathways of this process, such as that involving transcription factor nuclear factor E2-related factor 2 (Nrf2), which plays a central role in the regulation of antioxidant response elements (ARE) and modulates cellular redox status. The aim of this review is to present experimental evidence on the role of Nrf2 in this neurological disorder and to further determine the therapeutic impact of Nrf2 in epilepsy.

  4. Fisetin stimulates autophagic degradation of phosphorylated tau via the activation of TFEB and Nrf2 transcription factors.

    PubMed

    Kim, Sunhyo; Choi, Ki Ju; Cho, Sun-Jung; Yun, Sang-Moon; Jeon, Jae-Pil; Koh, Young Ho; Song, Jihyun; Johnson, Gail V W; Jo, Chulman

    2016-04-26

    The neuronal accumulation of phosphorylated tau plays a critical role in the pathogenesis of Alzheimer's disease (AD). Here, we examined the effect of fisetin, a flavonol, on tau levels. Treatment of cortical cells or primary neurons with fisetin resulted in significant decreases in the levels of phosphorylated tau. In addition, fisetin decreased the levels of sarkosyl-insoluble tau in an active GSK-3β-induced tau aggregation model. However, there was no difference in activities of tau kinases and phosphatases such as protein phosphatase 2A, irrespective of fisetin treatment. Fisetin activated autophagy together with the activation of transcription factor EB (TFEB) and Nrf2 transcriptional factors. The activation of autophagy including TFEB is likely due to fisetin-mediated mammalian target of rapamycin complex 1 (mTORC1) inhibition, since the phosphorylation levels of p70S6 kinase and 4E-BP1 were decreased in the presence of fisetin. Indeed, fisetin-induced phosphorylated tau degradation was attenuated by chemical inhibitors of the autophagy-lysosome pathway. Together the results indicate that fisetin reduces levels of phosphorylated tau through the autophagy pathway activated by TFEB and Nrf2. Our result suggests fisetin should be evaluated further as a potential preventive and therapeutic drug candidate for AD.

  5. Fisetin stimulates autophagic degradation of phosphorylated tau via the activation of TFEB and Nrf2 transcription factors

    PubMed Central

    Kim, Sunhyo; Choi, Ki Ju; Cho, Sun-Jung; Yun, Sang-Moon; Jeon, Jae-Pil; Koh, Young Ho; Song, Jihyun; Johnson, Gail V. W.; Jo, Chulman

    2016-01-01

    The neuronal accumulation of phosphorylated tau plays a critical role in the pathogenesis of Alzheimer’s disease (AD). Here, we examined the effect of fisetin, a flavonol, on tau levels. Treatment of cortical cells or primary neurons with fisetin resulted in significant decreases in the levels of phosphorylated tau. In addition, fisetin decreased the levels of sarkosyl-insoluble tau in an active GSK-3β-induced tau aggregation model. However, there was no difference in activities of tau kinases and phosphatases such as protein phosphatase 2A, irrespective of fisetin treatment. Fisetin activated autophagy together with the activation of transcription factor EB (TFEB) and Nrf2 transcriptional factors. The activation of autophagy including TFEB is likely due to fisetin-mediated mammalian target of rapamycin complex 1 (mTORC1) inhibition, since the phosphorylation levels of p70S6 kinase and 4E-BP1 were decreased in the presence of fisetin. Indeed, fisetin-induced phosphorylated tau degradation was attenuated by chemical inhibitors of the autophagy-lysosome pathway. Together the results indicate that fisetin reduces levels of phosphorylated tau through the autophagy pathway activated by TFEB and Nrf2. Our result suggests fisetin should be evaluated further as a potential preventive and therapeutic drug candidate for AD. PMID:27112200

  6. Phytochemical activation of Nrf2 protects human coronary artery endothelial cells against an oxidative challenge.

    PubMed

    Donovan, Elise L; McCord, Joe M; Reuland, Danielle J; Miller, Benjamin F; Hamilton, Karyn L

    2012-01-01

    Activation of NF-E2-related factor 2 (Nrf2) is a potential therapeutic intervention against endothelial cell oxidative stress and associated vascular disease. We hypothesized that treatment with the phytochemicals in the patented dietary supplement Protandim would induce Nrf2 nuclear localization and phase II antioxidant enzyme protein in human coronary artery endothelial cells (HCAECs), protecting against an oxidant challenge in an Nrf2- dependent manner. Protandim treatment induced Nrf2 nuclear localization, and HO-1 (778% of control ± 82.25 P < 0.01), SOD1 (125.9% of control ± 6.05 P < 0.01), NQO1 (126% of control ± 6.5 P < 0.01), and GR (119.5% of control ± 7.00 P < 0.05) protein expression in HCAEC. Treatment of HCAEC with H(2)O(2) induced apoptosis in 34% of cells while pretreatment with Protandim resulted in only 6% apoptotic cells (P < 0.01). Nrf2 silencing significantly decreased the Protandim-induced increase in HO-1 protein (P < 0.01). Nrf2 silencing also significantly decreased the protection afforded by Protandim against H(2)O(2)- induced apoptosis (P < 0.01 compared to no RNA, and P < 0.05 compared to control RNA). These results show that Protandim induces Nrf2 nuclear localization and antioxidant enzyme expression, and protection of HCAEC from an oxidative challenge is Nrf2 dependent.

  7. Phytochemical Activation of Nrf2 Protects Human Coronary Artery Endothelial Cells against an Oxidative Challenge

    PubMed Central

    Donovan, Elise L.; McCord, Joe M.; Reuland, Danielle J.; Miller, Benjamin F.; Hamilton, Karyn L.

    2012-01-01

    Activation of NF-E2-related factor 2 (Nrf2) is a potential therapeutic intervention against endothelial cell oxidative stress and associated vascular disease. We hypothesized that treatment with the phytochemicals in the patented dietary supplement Protandim would induce Nrf2 nuclear localization and phase II antioxidant enzyme protein in human coronary artery endothelial cells (HCAECs), protecting against an oxidant challenge in an Nrf2- dependent manner. Protandim treatment induced Nrf2 nuclear localization, and HO-1 (778% of control ± 82.25 P < 0.01), SOD1 (125.9% of control ± 6.05 P < 0.01), NQO1 (126% of control ± 6.5 P < 0.01), and GR (119.5% of control ± 7.00 P < 0.05) protein expression in HCAEC. Treatment of HCAEC with H2O2 induced apoptosis in 34% of cells while pretreatment with Protandim resulted in only 6% apoptotic cells (P < 0.01). Nrf2 silencing significantly decreased the Protandim-induced increase in HO-1 protein (P < 0.01). Nrf2 silencing also significantly decreased the protection afforded by Protandim against H2O2- induced apoptosis (P < 0.01 compared to no RNA, and P < 0.05 compared to control RNA). These results show that Protandim induces Nrf2 nuclear localization and antioxidant enzyme expression, and protection of HCAEC from an oxidative challenge is Nrf2 dependent. PMID:22685617

  8. The rise of antioxidant signaling-The evolution and hormetic actions of Nrf2

    SciTech Connect

    Maher, Jonathan; Yamamoto, Masayuki

    2010-04-01

    Organisms have evolved sophisticated and redundant mechanisms to manage oxidative and electrophilic challenges that arise from internal metabolism or xenobiotic challenge for survival. NF-E2-related factor 2 (Nrf2) is a transcription factor that has evolved over millennia from primitive origins, with homologues traceable back to invertebrate Caenorhabditis and Drosophila species. The ancestry of Nrf2 clearly has deep-seated roots in hematopoiesis, yet has diversified into a transcription factor that can mediate a multitude of antioxidant signaling and detoxification genes. In higher organisms, a more sophisticated means of tightly regulating Nrf2 activity was introduced via the cysteine-rich kelch-like ECH-associated protein 1 (Keap1), thus suggesting a need to modulate Nrf2 activity. This is evidenced in Keap1{sup -/-} mice, which succumb to juvenile mortality due to hyperkeratosis of the gastrointestinal tract. Although Nrf2 activation protects against acute toxicity and prevents or attenuates several disease states, constitutive activation in some tumors leads to poor clinical outcomes, suggesting Nrf2 has evolved in response to a multitude of selective pressures. The purpose of this review is to examine the origins of Nrf2, while highlighting the versatility and protective abilities elicited upon activation. Various model systems in which Nrf2 is normally beneficial but in which exaggerated pharmacology exacerbates a physiological or pathological condition will be addressed. Although Darwinian principles have selected Nrf2 activity for maximal beneficial effect based on environmental and oxidative challenge, both sub- or super-physiological effects have been noted to be detrimental. The functions of Nrf2 thus suggest a hormetic factor that has evolved empirically over time.

  9. Ascorbic acid partly antagonizes resveratrol mediated heme oxygenase-1 but not paraoxonase-1 induction in cultured hepatocytes - role of the redox-regulated transcription factor Nrf2

    PubMed Central

    2011-01-01

    Background Both resveratrol and vitamin C (ascorbic acid) are frequently used in complementary and alternative medicine. However, little is known about the underlying mechanisms for potential health benefits of resveratrol and its interactions with ascorbic acid. Methods The antioxidant enzymes heme oxygenase-1 and paraoxonase-1 were analysed for their mRNA and protein levels in HUH7 liver cells treated with 10 and 25 μmol/l resveratrol in the absence and presence of 100 and 1000 μmol/l ascorbic acid. Additionally the transactivation of the transcription factor Nrf2 and paraoxonase-1 were determined by reporter gene assays. Results Here, we demonstrate that resveratrol induces the antioxidant enzymes heme oxygenase-1 and paraoxonase-1 in cultured hepatocytes. Heme oxygenase-1 induction by resveratrol was accompanied by an increase in Nrf2 transactivation. Resveratrol mediated Nrf2 transactivation as well as heme oxygenase-1 induction were partly antagonized by 1000 μmol/l ascorbic acid. Conclusions Unlike heme oxygenase-1 (which is highly regulated by Nrf2) paraoxonase-1 (which exhibits fewer ARE/Nrf2 binding sites in its promoter) induction by resveratrol was not counteracted by ascorbic acid. Addition of resveratrol to the cell culture medium produced relatively low levels of hydrogen peroxide which may be a positive hormetic redox-signal for Nrf2 dependent gene expression thereby driving heme oxygenase-1 induction. However, high concentrations of ascorbic acid manifold increased hydrogen peroxide production in the cell culture medium which may be a stress signal thereby disrupting the Nrf2 signalling pathway. PMID:21199573

  10. Role of the Nrf2-ARE Pathway in Liver Diseases

    PubMed Central

    Yang, Ji Hye; Ki, Sung Hwan

    2013-01-01

    The liver is a central organ that performs a wide range of functions such as detoxification and metabolic homeostasis. Since it is a metabolically active organ, liver is particularly susceptible to oxidative stress. It is well documented that liver diseases including hepatitis, fibrosis, cirrhosis, and hepatocellular carcinoma are highly associated with antioxidant capacity. NF-E2-related factor-2 (Nrf2) is an essential transcription factor that regulates an array of detoxifying and antioxidant defense genes expression in the liver. It is activated in response to electrophiles and induces its target genes by binding to the antioxidant response element (ARE). Therefore, the roles of the Nrf2-ARE pathway in liver diseases have been extensively investigated. Studies from several animal models suggest that the Nrf2-ARE pathway collectively exhibits diverse biological functions against viral hepatitis, alcoholic and nonalcoholic liver disease, fibrosis, and cancer via target gene expression. In this review, we will discuss the role of the Nrf2-ARE pathway in liver pathophysiology and the potential application of Nrf2 as a therapeutic target to prevent and treat liver diseases. PMID:23766860

  11. Nrf2: friend or foe for chemoprevention?

    PubMed Central

    Kensler, Thomas W.; Wakabayashi, Nobunao

    2010-01-01

    Health reflects the ability of an organism to adapt to stress. Stresses—metabolic, proteotoxic, mitotic, oxidative and DNA-damage stresses—not only contribute to the etiology of cancer and other chronic degenerative diseases but are also hallmarks of the cancer phenotype. Activation of the Kelch-like ECH-associated protein 1 (KEAP1)–NF-E2-related factor 2 (NRF2)-signaling pathway is an adaptive response to environmental and endogenous stresses and serves to render animals resistant to chemical carcinogenesis and other forms of toxicity, whilst disruption of the pathway exacerbates these outcomes. This pathway can be induced by thiol-reactive small molecules that demonstrate protective efficacy in preclinical chemoprevention models and in clinical trials. However, mutations and epigenetic modifications affecting the regulation and fate of NRF2 can lead to constitutive dominant hyperactivation of signaling that preserves rather than attenuates cancer phenotypes by providing selective resistance to stresses. This review provides a synopsis of KEAP1–NRF2 signaling, compares the impact of genetic versus pharmacologic activation and considers both the attributes and concerns of targeting the pathway in chemoprevention. PMID:19793802

  12. Increase in antioxidant activity by sheep/goat whey protein through nuclear factor-like 2 (Nrf2) is cell type dependent.

    PubMed

    Kerasioti, Efthalia; Stagos, Dimitrios; Tzimi, Aggeliki; Kouretas, Dimitrios

    2016-11-01

    The aim of the present study was to investigate the molecular mechanisms through which sheep/goat whey protein exerts its antioxidant activity. Thus, it was examined whey protein's effects on the expression of transcription factor, nuclear factor-like 2 (Nrf2) and on the expression and activity of a number of antioxidant and phase II enzymes, superoxide dismutase (SOD), catalase (CAT), heme oxygenase 1 (HO-1), synthase glutamyl cysteine (GCS) and glutathione-s-transferase (GST), in muscle C2C12 and EA.hy926 endothelial cells. C2C12 and EA.hy926 cells were treated with sheep/goat whey protein (0.78 and 3.12 mg/ml) and incubated for 3, 6, 12, 18 and 24 h. Whey protein increased significantly the expression of Nrf2 only in EA.hy926 cells. Also, the expression of SOD, HO-1, CAT and the activity of SOD, CAT and GST were increased significantly in both cells types. The expression of GCS was increased significantly only in C2C12 cells. Sheep/goat whey protein was shown for the first time to exert its antioxidant activity through Nrf2-dependent mechanism in endothelial cells and Nrf2-independent mechanism in muscle cells. Thus, Nrf2 could be a target for food supplements containing whey protein in order to prevent oxidative stress damages and diseases related to endothelium.

  13. Nuclear Factor E2-Related Factor-2 Negatively Regulates NLRP3 Inflammasome Activity by Inhibiting Reactive Oxygen Species-Induced NLRP3 Priming

    PubMed Central

    Liu, Xiuting; Zhang, Xin; Ding, Yang; Zhou, Wei; Tao, Lei; Lu, Ping; Wang, Yajing

    2017-01-01

    Abstract Aims: The NLRP3 inflammasome is a multiprotein complex that protects hosts against a variety of pathogens. However, the molecular mechanisms of modulating NLRP3 inflammasome activation, especially at the priming step, are still poorly understood. This study was designed to elucidate the negative regulation of nuclear factor E2-related factor-2 (Nrf2) on the activation of NLRP3 inflammasome. Results: We reported that Nrf2 activation inhibited NLRP3 expression, caspase-1 cleavage, and subsequent IL-1β generation. Compared with normal cells, Nrf2-deficient cells showed upregulated cleaved caspase-1, which were attributed to the increased transcription of NLRP3 caused by excess reactive oxygen species (ROS). Furthermore, priming of the NLRP3 inflammasome was sensitive to the exogenous ROS levels induced by H2O2 or rotenone. Combined with adenosine triphosphate, rotenone triggered higher activity of the NLRP3 inflammasome compared with lipopolysaccharide, suggesting that ROS promoted the priming step. In addition, Nrf2-induced NQO1 was involved in the inhibition of the NLRP3 inflammasome. In an in vivo alum-induced peritonitis mouse model, Nrf2 activation suppressed typical IL-1 signaling-dependent inflammation, whereas Nrf2−/− mice exhibited a significant increase in the recruitment of immune cell and the generation of IL-1β compared with wild-type mice. Innovation: We elucidated the effects and possible mechanisms of Nrf2 activation-induced NQO1 expression on NLRP3 inflammasome inactivation and established a novel regulatory role of the Nrf2 pathway in ROS-induced NLRP3 priming. Conclusions: We demonstrated Nrf2 negatively regulating NLRP3 inflammasome activity by inhibiting the priming step and suggested that Nrf2 could be a potential target for some uncontrolled inflammasome activation-associated diseases. Antioxid. Redox Signal. 26, 28–43. PMID:27308893

  14. Nrf2 inhibition sensitizes cholangiocarcinoma cells to cytotoxic and antiproliferative activities of chemotherapeutic agents.

    PubMed

    Samatiwat, Papavee; Prawan, Auemduan; Senggunprai, Laddawan; Kukongviriyapan, Upa; Kukongviriyapan, Veerapol

    2016-08-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription factor regulating antioxidant, cytoprotective, and metabolic enzymes, plays important roles in drug resistance and proliferation in cancer cells. The present study was aimed to examine the expression of Nrf2 in connection with chemotherapeutic drug sensitivity on cholangiocarcinoma (CCA) cells. The basal levels of Nrf2 protein in cytosol and nuclear fractions of CCA cells were determined using Western blot analysis. Nrf2 mRNA expression of KKU-M156 and KKU-100 cells, representatives of low and high-Nrf2-expressing CCA cells, were silenced using siRNA. After knockdown of Nrf2, the sensitivity of those cells to the cytotoxicity of cisplatin (Cis) was enhanced in association with the increased release of AIF and downregulation of Bcl-xl in both cells. Also, knockdown of Nrf2 suppressed the replicative capability of those cells in colony-forming assay and enhanced their sensitivity to antiproliferative activity of Cis and 5-fluorouracil. The chemosensitizing effect was associated with the suppressed expression of Nrf2-regulated and Cis-induced antioxidant and metabolic genes including NQO1, HO-1, GCLC, TXN, MRP2, TKT, and G6PD. In cell cycle analysis, Nrf2 knockdown cells were arrested at G0/G1 phase and combination with Cis increased the accumulation of cells at S phase. The suppression of KKU-M156 cell proliferation was associated with the downregulation of cyclin D1 and increased level of p21. Inhibition of Nrf2 could be a novel strategy in enhancing antitumor activity of chemotherapeutic agent in control of resistant cancer.

  15. Novel Nrf2 activators from microbial transformation products inhibit blood–retinal barrier permeability in rabbits

    PubMed Central

    Nakagami, Yasuhiro; Masuda, Kayoko; Hatano, Emiko; Inoue, Tatsuya; Matsuyama, Takuya; Iizuka, Mayumi; Ono, Yasunori; Ohnuki, Takashi; Murakami, Yoko; Iwasaki, Masaru; Yoshida, Kazuhiro; Kasuya, Yuji; Komoriya, Satoshi

    2015-01-01

    Background and Purpose Nuclear factor erythroid 2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that binds to antioxidant response elements located in the promoter region of genes encoding many antioxidant enzymes and phase II detoxifying enzymes. Activation of the Nrf2 pathway seems protective for many organs, and although a well-known Nrf2 activator, bardoxolone methyl, was evaluated clinically for treating chronic kidney disease, it was found to induce adverse events. Many bardoxolone methyl derivatives, mostly derived by chemical modifications, have already been studied. However, we adopted a biotransformation technique to obtain a novel Nrf2 activator. Experimental Approach The potent novel Nrf2 activator, RS9, was obtained from microbial transformation products. Its Nrf2 activity was evaluated by determining NADPH:quinone oxidoreductase-1 induction activity in Hepa1c1c7 cells. We also investigated the effects of RS9 on oxygen-induced retinopathy in rats and glycated albumin-induced blood–retinal barrier permeability in rabbits because many ocular diseases are associated with oxidative stress and inflammation. Key Results Bardoxolone methyl doubled the specific activity of Nrf2 in Hepa1c1c7 cells at a much higher concentration than RS9. Moreover, the induction of Nrf2-targeted genes was observed at a one-tenth lower concentration of RS9. Interestingly, the cytotoxicity of RS9 was substantially reduced compared with bardoxolone methyl. Oral and intravitreal administration of RS9 ameliorated the pathological scores and leakage in the models of retinopathy in rats and ocular inflammation in rabbits respectively. Conclusion and Implications Nrf2 activators are applicable for treating ocular diseases and novel Nrf2 activators have potential as a unique method for prevention and treatment of retinovascular disease. PMID:25363737

  16. Metallothionein Is Downstream of Nrf2 and Partially Mediates Sulforaphane Prevention of Diabetic Cardiomyopathy.

    PubMed

    Gu, Junlian; Cheng, Yanli; Wu, Hao; Kong, Lili; Wang, Shudong; Xu, Zheng; Zhang, Zhiguo; Tan, Yi; Keller, Bradley B; Zhou, Honglan; Wang, Yuehui; Xu, Zhonggao; Cai, Lu

    2017-02-01

    We have reported that sulforaphane (SFN) prevented diabetic cardiomyopathy in both type 1 and type 2 diabetes (T2DM) animal models via the upregulation of nuclear transcription factor erythroid 2-related factor 2 (Nrf2) and metallothionein (MT). In this study, we tested whether SFN protects the heart from T2DM directly through Nrf2, MT, or both. Using Nrf2-knockout (KO), MT-KO, and wild-type (WT) mice, T2DM was induced by feeding a high-fat diet for 3 months followed by a small dose of streptozotocin. Age-matched controls were given a normal diet. Both T2DM and control mice were then treated with or without SFN for 4 months by continually feeding a high-fat or normal diet. SFN prevented diabetes-induced cardiac dysfunction as well as diabetes-associated cardiac oxidative damage, inflammation, fibrosis, and hypertrophy, with increases in Nrf2 and MT expressions in the WT mice. Both Nrf2-KO and MT-KO diabetic mice exhibited greater cardiac damage than WT diabetic mice. SFN did not provide cardiac protection in Nrf2-KO mice, but partially or completely protected the heart from diabetes in MT-KO mice. SFN did not induce MT expression in Nrf2-KO mice, but stimulated Nrf2 function in MT-KO mice. These results suggest that Nrf2 plays the indispensable role for SFN cardiac protection from T2DM with significant induction of MT and other antioxidants. MT expression induced by SFN is Nrf2 dependent, but is not indispensable for SFN-induced cardiac protection from T2DM.

  17. Oxidative stress, mammospheres and Nrf2-new implication for breast cancer therapy?

    PubMed

    Wu, Tongde; Harder, Bryan G; Wong, Pak K; Lang, Julie E; Zhang, Donna D

    2015-11-01

    Mammosphere culture of breast cancer cell lines is an important approach used for enrichment of cancer stem cells (CSCs), which exhibit high tumorigenicity and chemoresistance features. Evidence shows that CSCs maintain lower ROS levels due to elevated expression of ROS-scavenging molecules and antioxidative enzymes, which favors the survival of the CSCs and their chemoresistance. The transcription factor NF-E2-related factor 2 (Nrf2) has emerged as the master regulator of cellular redox homeostasis, by up-regulating antioxidant response element (ARE)-bearing genes products. Although Nrf2 has long-term been regarded as a beneficial defense mechanism, accumulating studies have revealed the "dark side" of Nrf2. High constitutive levels of Nrf2 was observed in many types of tumors and cancer cell lines promoting their resistance to chemotherapeutics. In this study, we report a high expression of Nrf2 and its target genes in mammospheres compared to corresponding adherent cells. In MCF-7 and MDA-MB-231 mammmosphere cells, the Nrf2-mediated cellular protective response is significantly elevated which is associated with increased resistance to taxol and anchorage-independent growth. Brusatol, an inhibitor of the Nrf2 pathway, suppressed the protein level of Nrf2 and its target genes, enhanced intracellular ROS and sensitized mammospheres to taxol, and reduced the anchorage-independent growth. These results suggest that mammospheres rely on abnormal up-regulation of Nrf2 to maintain low intracellular ROS levels. Nrf2 inhibitors, such as brusatol, have the potential to be developed into novel adjuvant chemotherapeutic drug combinations in order to combat refractory tumor initiating CSCs.

  18. Activation of Nrf2/ARE pathway protects endothelial cells from oxidant injury and inhibits inflammatory gene expression.

    PubMed

    Chen, Xi-Lin; Dodd, Geraldine; Thomas, Suzanne; Zhang, Xiaolan; Wasserman, Martin A; Rovin, Brad H; Kunsch, Charles

    2006-05-01

    The antioxidant response element (ARE) is a transcriptional control element that mediates expression of a set of antioxidant proteins. NF-E2-related factor 2 (Nrf2) is a transcription factor that activates ARE-containing genes. In endothelial cells, the ARE-mediated genes are upregulated by atheroprotective laminar flow through a Nrf2-dependent mechanism. We tested the hypothesis that activation of ARE-regulated genes via adenovirus-mediated expression of Nrf2 may suppress redox-sensitive inflammatory gene expression. Expression of Nrf2 in human aortic endothelial cells (HAECs) resulted in a marked increase in ARE-driven transcriptional activity and protected HAECs from H2O2-mediated cytotoxicity. Nrf2 suppressed TNF-alpha-induced monocyte chemoattractant protein (MCP)-1 and VCAM-1 mRNA and protein expression in a dose-dependent manner and inhibited TNF-alpha-induced monocytic U937 cell adhesion to HAECs. Nrf2 also inhibited IL-1beta-induced MCP-1 gene expression in human mesangial cells. Expression of Nrf2 inhibited TNF-alpha-induced activation of p38 MAP kinase. Furthermore, expression of a constitutively active form of MKK6 (an upstream kinase for p38 MAP kinase) partially reversed Nrf2-mediated inhibition of VCAM-1 expression, suggesting that p38 MAP kinase, at least in part, mediates Nrf2's anti-inflammatory action. In contrast, Nrf2 did not inhibit TNF-alpha-induced NF-kappaB activation. These data identify the Nrf2/ARE pathway as an endogenous atheroprotective system for antioxidant protection and suppression of redox-sensitive inflammatory genes, suggesting that targeting the Nrf2/ARE pathway may represent a novel therapeutic approach for the treatment of inflammatory diseases such as atherosclerosis.

  19. Ultraviolet A irradiation induces NF-E2-related factor 2 activation in dermal fibroblasts: protective role in UVA-induced apoptosis.

    PubMed

    Hirota, Ayako; Kawachi, Yasuhiro; Itoh, Ken; Nakamura, Yasuhiro; Xu, Xuezhu; Banno, Tomohiro; Takahashi, Takenori; Yamamoto, Masayuki; Otsuka, Fujio

    2005-04-01

    Ultraviolet (UV) radiation is one of the most important environmental factors involved in the pathogenesis of skin aging and cancer. Many harmful effects of UV radiation are associated with the generation of reactive oxygen species, and cellular antioxidants act to prevent the occurrence and reduce the severity of UV-induced skin disorders. Transcription factor NF-E2-related Factor 2 (Nrf2) and its cytoplasmic anchor protein Kelch-like-ECH-associated protein 1 (Keap1) are central regulators of the cellular antioxidant response. In this study, we investigated the effects of UV irradiation on the activation of Nrf2 in dermal fibroblasts. We found that UVA irradiation, but not UVB, causes nuclear translocation and accumulation of Nrf2 by a factor of 6.5 as compared with unirradiated controls. The nuclear accumulation of Nrf2 induced by UVA was enhanced by the photosensitizer hematoporphyrin. To evaluate the protective role of Nrf2 against UVA radiation, we examined UVA-induced apoptosis using dermal fibroblasts derived from nrf2 or keap1 gene knockout mice. Whereas disruption of nrf2 increased the number of apoptotic cells following UVA irradiation by 1.7-fold, disruption of keap1 decreased the apoptotic cell number by half as compared with wild-type controls. These findings thus demonstrate that the Nrf2-Keap1 pathway plays an important role in the protection of the skin against UVA irradiation.

  20. Nuclear factor erythroid 2-related factor 2 signaling in Parkinson disease: a promising multi therapeutic target against oxidative stress, neuroinflammation and cell death.

    PubMed

    Kumar, Hemant; Koppula, Sushruta; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug

    2012-12-01

    Parkinson's disease (PD) is the second most common progressive neurodegenerative disorder with increased oxidative stress as central component. Till date, treatments related to PD are based on restoring dopamine either by targeting neurotransmitter and/or at receptor levels. These therapeutic approaches try to repair damage but do not address the underlying processes such as oxidative stress and neuroinflammation that contribute to cell death. The central nervous system maintains a robust antioxidant defense mechanism consisting of several cytoprotective genes and enzymes whose expression is controlled by antioxidant response element (ARE) which further depends on activation of nuclear factor erythroid 2-related factor 2 (Nrf2). In response to oxidative or electrophilic stress transcription factor Nrf2 binds to ARE and rescues the cells from oxidative stress and neuroinflammation. Recently, Nrf2 has been utilized as a drug target and some agents are currently under clinical trial. Owing to the potential role of Nrf2 in counteracting oxidative stress and neuroinflammation seen in PD, here we have focused on the molecular mechanism of the Nrf2/ARE antioxidant defense pathway in PD. Further, we also summarize published reports on the potential inducers of Nrf2 that demonstrate neuroprotective effects in experimental models of PD with possible future strategies to increase the transcriptional level of Nrf2 as a therapeutic strategy to provide neuroprotection of damaged dopaminergic neurons in PD.

  1. Induction of cereblon by NF-E2-related factor 2 in neuroblastoma cells exposed to hypoxia-reoxygenation.

    PubMed

    Lee, Kyung Jin; Lee, Kwang Min; Jo, Sooyeon; Kang, Keon Wook; Park, Chul-Seung

    2010-09-03

    Cereblon is a protein encoded by the CRBN gene, which has been associated with human autosomal recessive nonsyndromic mental retardation. However, little is known about the regulation of CRBN expression. Following exposure of mouse neuroblastoma N2A cells to hypoxia/reoxygenation (H/R), mRNA and protein expression of CRBN were increased. To better understand how CRBN expression is regulated, the promoter region of the mouse CRBN gene was characterized functionally. Deletion mutations and site-directed mutagenesis led to the identification of a functional NF-E2-related factor 2 (Nrf2)-binding site. Electrophoretic mobility shift analysis indicated that Nrf2 binds to a putative binding site in the CRBN promoter. Nrf2 overexpression and tert-butylhydroquinone treatment enhanced CRBN protein expression. These results imply that Nrf2 stimulates CRBN gene transcription under H/R conditions in neuronal cells.

  2. Downregulation of Nrf2 promotes autophagy-dependent osteoblastic differentiation of adipose-derived mesenchymal stem cells.

    PubMed

    Tao, Jiang; Wang, Haining; Zhai, Yue; Park, Hyun; Wang, Jian; Ji, Fang; Zhang, Zhiyong

    2016-12-10

    Adipose derived stem cells (ADSCs) are an important source of stem cells for tissue repair and regeneration; therefore, understanding the mechanisms that regulate stem cell differentiation into a specific lineage is critical. The NF-E2-related factor 2 (Nrf2) pathway and autophagy promote cell survival in response to oxidative stress. However, the roles of Nrf2 and autophagy in bone metabolism under oxidative stress are controversial. Here, we explored the involvement of Nrf2 signaling and autophagy on the differentiation of ADSCs under conditions of oxidative stress. Exposure of ADSCs to H2O2 promoted reactive oxygen species (ROS) accumulation concomitant with the reduction of cell viability, upregulation of Nrf2, the induction of apoptosis and autophagy, and the promotion of osteogenesis. Suppression of autophagic activity at particular stages resulted in the activation of the Nrf2 pathway, whereas osteoblastic differentiation of ADSCs was inhibited upon ROS stimulation. Silencing of Nrf2 promoted autophagy and osteoblastic differentiation upon ROS stimulation in vitro, and this effect was confirmed in vivo in a mouse model, in which bone formation was enhanced in mice receiving Nrf2-knockdown ADSCs. Taken together, these findings indicate that a negative interaction between the Nrf2 pathway and autophagy may modulate oxidative stress-induced ADSC osteogenesis, and suggest that Nrf2 is a potential target to regulate the differentiation of ADSCs into a specific lineage.

  3. Resveratrol protects quail hepatocytes against heat stress: modulation of the Nrf2 transcription factor and heat shock proteins.

    PubMed

    Sahin, K; Orhan, C; Akdemir, F; Tuzcu, M; Iben, C; Sahin, N

    2012-02-01

    In the present study, the effects of dietary resveratrol on the induction of heat shock proteins, transcription factors and antioxidative enzyme system in liver of quails under heat stress were investigated. A total of 180 (55-day-old) female Japanese quails (Coturnix coturnix japonica) were reared either at 22 °C for 24 h/day (thermoneutral, TN) or 34 °C for 8 h/day (heat stress, HS; 09:00-17:00 hours) for 12 weeks. Birds in both environments were randomly fed one of three diets: basal diet and basal diet added with either 200 or 400 mg of resveratrol per kg of diet. The results showed that exposure to high ambient temperature induced decreases in feed intake, egg production, and hepatic superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px) activities but increases in hepatic malondialdehyde (MDA) concentrations (p < 0.001). Liver Hsp70, Hsp90 and NF-κB expression was greater while Nrf2 expression was lower for quails reared under the heat stress than for those reared under the TN environment (p < 0.0001). There were linear increases in feed intake, egg production, hepatic SOD, CAT, and GSH-Px activities as well as Nrf2 expression, but linear decreases in hepatic MDA concentrations and Hsp70, Hsp90, and NF-κB expressions with increasing supplemental resveratrol level (p < 0.0001). Two-way treatment interactions revealed that the degree of restorations in all response variables was more notable under the high ambient temperature than that of the TN environment as dietary resveratrol concentration was increased. The results of the present study suggest that supplemental resveratrol reduces oxidative stress in heat-stressed quails through modulating the hepatic heat shock proteins and nuclear transcription factors.

  4. Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver

    SciTech Connect

    Klaassen, Curtis D.; Reisman, Scott A.

    2010-04-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that positively regulates the basal and inducible expression of a large battery of cytoprotective genes. These gene products include proteins that catalyze reduction reactions (NAD(P)H:quinone oxidoreductase 1, Nqo1), conjugation reactions (glutathione-S-transferases, Gsts and UDP-glucuronosyltransferases, Ugts), as well as the efflux of potentially toxic xenobiotics and xenobiotic conjugates (multidrug resistance-associated proteins, Mrps). The significance of Nrf2 in the liver has been established, as livers of Nrf2-null mice are more susceptible to various oxidative/electrophilic stress-induced pathologies than wild-type mice. In contrast, both pharmacological and genetic models of hepatic Nrf2 activation are protective against oxidative/electrophilic stress. Furthermore, because certain Nrf2-target genes in the liver could affect the distribution, metabolism, and excretion of xenobiotics, the effects of Nrf2 on the kinetics of drugs and other xenobiotics should also be considered, with a special emphasis on metabolism and excretion. Therefore, this review highlights the research that has contributed to the understanding of the importance of Nrf2 in toxicodynamics and toxicokinetics, especially that which pertains to the liver.

  5. Nrf2 the Rescue: Effects of the Antioxidative/Electrophilic Response on the Liver

    PubMed Central

    Klaassen, Curtis D.; Reisman, Scott A.

    2010-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that positively regulates the basal and inducible expression of a large battery of cytoprotective genes. These gene products include proteins that catalyze reduction reactions (NAD(P)H:quinone oxidoreductase 1, Nqo1), conjugation reactions (glutathione-S-transferases, Gsts and UDP-glucuronosyltransferases, Ugts), as well as the efflux of potentially toxic xenobiotics and xenobiotic conjugates (multidrug resistance-associated proteins, Mrps). The significance of Nrf2 in the liver has been established, as livers of Nrf2-null mice are more susceptible to various oxidative/electrophilic stress-induced pathologies than wild-type mice. In contrast, both pharmacological and genetic models of hepatic Nrf2 activation are protective against oxidative/electrophilic stress. Furthermore, because certain Nrf2-target genes in the liver could affect the distribution, metabolism, and excretion of xenobiotics, the effects of Nrf2 on the kinetics of drugs and other xenobiotics should also be considered, with a special emphasis on metabolism and excretion. Therefore, this review highlights the research that has contributed to the understanding of the importance of Nrf2 in toxicodynamics and toxicokinetics, especially that which pertains to the liver. PMID:20122946

  6. Protection from mitochondrial complex II inhibition in vitro and in vivo by Nrf2-mediated transcription.

    PubMed

    Calkins, Marcus J; Jakel, Rebekah J; Johnson, Delinda A; Chan, Kaimin; Kan, Yuet Wai; Johnson, Jeffrey A

    2005-01-04

    Complex II inhibitors 3-nitropropionic acid (3NP) and malonate cause striatal damage reminiscent of Huntington's disease and have been shown to involve oxidative stress in their pathogenesis. Because nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent transcriptional activation by means of the antioxidant response element is known to coordinate the up-regulation of cytoprotective genes involved in combating oxidative stress, we investigated the significance of Nrf2 in complex II-induced toxicity. We found that Nrf2-deficient cells and Nrf2 knockout mice are significantly more vulnerable to malonate and 3NP and demonstrate increased antioxidant response element (ARE)-regulated transcription mediated by astrocytes. Furthermore, ARE preactivation by means of intrastriatal transplantation of Nrf2-overexpressing astrocytes before lesioning conferred dramatic protection against complex II inhibition. These observations implicate Nrf2 as an essential inducible factor in the protection against complex II inhibitor-mediated neurotoxicity. These data also introduce Nrf2-mediated ARE transcription as a potential target of preventative therapy in neurodegenerative disorders such as Huntington's disease.

  7. Nrf2-mediated transcriptional induction of antioxidant response in mouse embryos exposed to ethanol in vivo: implications for the prevention of fetal alcohol spectrum disorders.

    PubMed

    Dong, Jian; Sulik, Kathleen K; Chen, Shao-Yu

    2008-12-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that is important in protection against oxidative stress. This study was designed to determine the role of Nrf2 signaling in transcriptional activation of detoxifying and antioxidant genes in an in vivo mouse fetal alcohol syndrome model. Maternal ethanol treatment was found to increase both Nrf2 protein levels and Nrf2-ARE binding in mouse embryos. It also resulted in a moderate increase in the mRNA expression of Nrf2 downstream target detoxifying and antioxidant genes as well as an increase in the expression of antioxidant proteins. Pretreatment with the Nrf2 inducer, 3H-1,2 dithiole-3-thione (D3T), significantly increased Nrf2 protein levels and Nrf2-ARE binding, and strongly induced the mRNA expression of Nrf2 downstream target genes. It also increased the expression of antioxidant proteins and the activities of the antioxidant enzymes. Additionally, D3T pretreatment resulted in a significant decrease in ethanol-induced reactive oxygen species generation and apoptosis in mouse embryos. These results demonstrate that Nrf2 signaling is involved in the induction of antioxidant response in ethanol-exposed embryos. In addition, the potency of D3T in inducing antioxidants as well as in diminishing ethanol-induced apoptosis suggests that further exploration of the antiteratogenic effect of this compound will be fruitful.

  8. Discovery of a novel Nrf2 inhibitor that induces apoptosis of human acute myeloid leukemia cells.

    PubMed

    Zhang, JinFeng; Su, Le; Ye, Qing; Zhang, ShangLi; Kung, HsiangFu; Jiang, Fan; Jiang, GuoSheng; Miao, JunYing; Zhao, BaoXiang

    2017-01-31

    Nuclear factor-erythroid 2-related factor 2 (Nrf2) is persistently activated in many human tumors including acute myeloid leukemia (AML). Therefore, inhibition of Nrf2 activity may be a promising target in leukemia therapy. Here, we used an antioxidant response element-luciferase reporter system to identify a novel pyrazolyl hydroxamic acid derivative, 1-(4-(tert-Butyl)benzyl)-3-(4-chlorophenyl)-N-hydroxy-1H pyrazole-5-carboxamide (4f), that inhibited Nrf2 activity. 4f had a profound growth-inhibitory effect on three AML cell lines, THP-1, HL-60 and U937, and a similar anti-growth effect in a chick embryo model. Moreover, flow cytometry of AML cells revealed increased apoptosis with 4f (10 μM) treatment for 48 h. The protein levels of cleaved caspase-3 and cleaved poly (ADP-ribose) polymerase were enhanced in all three AML cell types. Furthermore, Nrf2 protein level was downregulated by 4f. Upregulation of Nrf2 by tert-butylhydroquinone (tBHQ) or Nrf2 overexpression could ameliorate 4f-induced growth inhibition and apoptosis. Treatment with 4f reduced both B-cell lymphoma-2 (Bcl-2) expression and Bcl-2/Bcl-2-associated X protein (Bax) ratio, which indicated that 4f induced apoptosis, at least in part, via mitochondrial-dependent signaling. Therefore, as an Nrf2 inhibitor, the pyrazolyl hydroxamic acid derivative 4f may be a promising agent in AML therapy.

  9. Ursolic Acid Ameliorates Early Brain Injury After Experimental Traumatic Brain Injury in Mice by Activating the Nrf2 Pathway.

    PubMed

    Ding, Hui; Wang, Handong; Zhu, Lin; Wei, Wuting

    2017-02-01

    Previous studies have indicated oxidative stress and inflammatory injury as significant contributors to the secondary damage associated with traumatic brain injury (TBI). Ursolic acid (UA) has been demonstrated to exert anti-oxidative and anti-inflammatory effects on cerebral ischemia by activating the nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway. However, the effects of UA on TBI remain unclear. The aim of this study is to evaluate the potential roles of UA in the activation of the Nrf2 pathway using an experimental TBI model and the underlying mechanism. Wild-type (WT) and Nrf2((-/-)) mice were divided into eight groups: (1) sham; (2) TBI; (3) TBI + vehicle; (4) TBI + 50 mg/kg UA; (5) TBI + 100 mg/kg UA; (6) TBI + 150 mg/kg UA; (7) TBI + Nrf2((-/-)) + vehicle; (8) TBI + Nrf2((-/-)) + UA. All mice underwent the TBI with the exception of the sham group. The neurologic outcomes of the mice were evaluated at 24 h after TBI, as well as the expression of Nrf2, NQO1, HO1,SOD, GPx, and MDA. Treatment of UA significantly ameliorated brain edema and the neurological insufficiencies after TBI. In addition, UA treatment markedly strengthened the nuclear translocation of Nrf2 protein and increased the expression of NQO1 and HO1. Moreover, UA significantly increased the expression of AKT, an Nrf2 upstream factor, suggesting that UA play a neuroprotective role through the activation of the Nrf2-ARE signal pathway. On the contrary, UA showed no neuroprotective effect on the Nrf2((-/-)) mice. These data indicated that UA increases the activity of antioxidant enzymes and attenuated brain injury via Nrf2 factor.

  10. The Involvement of NRF2 in Lung Cancer

    PubMed Central

    Bauer, Alison K.; Hill, Thomas

    2013-01-01

    Nuclear factor, erythroid-derived 2, like 2 (NRF2) is a key regulator of antioxidants and cellular stress responses. The role of NRF2 in pulmonary neoplasia, a diverse disease for which few biomarkers exist, is complicated and appears to depend on several main factors including the existence of activating mutations in NRF2 and/or loss of function mutations in KEAP1 and the stage of carcinogenesis studied, particularly in the mouse models tested. Therapeutic strategies for lung cancer targeting NRF2 have observed mixed results, both anti- and protumorigenic effects; however, these differences seem to reflect the mutation status of NRF2 or KEAP1. In this paper, we will discuss the studies on human NRF2 and the mechanisms proposed, several mouse models using various mice deficient in NRF2, as well as xenograft models, and the chemotherapeutic strategies using the NRF2 pathway. PMID:23577226

  11. Nutritional strategies to modulate inflammation and oxidative stress pathways via activation of the master antioxidant switch Nrf2.

    PubMed

    Cardozo, Ludmila F M F; Pedruzzi, Liliana M; Stenvinkel, Peter; Stockler-Pinto, Milena B; Daleprane, Julio B; Leite, Maurilo; Mafra, Denise

    2013-08-01

    The nuclear factor E2-related factor 2 (Nrf2) plays an important role in cellular protection against cancer, renal, pulmonary, cardiovascular and neurodegenerative diseases where oxidative stress and inflammation are common conditions. The Nrf2 regulates the expression of detoxifying enzymes by recognizing the human Antioxidant Response Element (ARE) binding site and it can regulate antioxidant and anti-inflammatory cellular responses, playing an important protective role on the development of the diseases. Studies designed to investigate how effective Nrf2 activators or modulators are need to be initiated. Several recent studies have shown that nutritional compounds can modulate the activation of Nrf2-Keap1 system. This review aims to discuss some of the key nutritional compounds that promote the activation of Nrf2, which may have impact on the human health.

  12. Nrf2 in ischemic neurons promotes retinal vascular regeneration through regulation of semaphorin 6A

    PubMed Central

    Wei, Yanhong; Gong, Junsong; Xu, Zhenhua; Thimmulappa, Rajesh K.; Mitchell, Katherine L.; Welsbie, Derek S.; Biswal, Shyam; Duh, Elia J.

    2015-01-01

    Delayed revascularization of ischemic neural tissue is a major impediment to preservation of function in central nervous system (CNS) diseases including stroke and ischemic retinopathies. Therapeutic strategies allowing rapid revascularization are greatly needed to reduce ischemia-induced cellular damage and suppress harmful pathologic neovascularization. However, key mechanisms governing vascular recovery in ischemic CNS, including regulatory molecules governing the transition from tissue injury to tissue repair, are largely unknown. NF-E2-related factor 2 (Nrf2) is a major stress-response transcription factor well known for its cell-intrinsic cytoprotective function. However, its role in cell–cell crosstalk is less appreciated. Here we report that Nrf2 is highly activated in ischemic retina and promotes revascularization by modulating neurons in their paracrine regulation of endothelial cells. Global Nrf2 deficiency strongly suppresses retinal revascularization and increases pathologic neovascularization in a mouse model of ischemic retinopathy. Conditional knockout studies demonstrate a major role for neuronal Nrf2 in vascular regrowth into avascular retina. Deletion of neuronal Nrf2 results in semaphorin 6A (Sema6A) induction in hypoxic/ischemic retinal ganglion cells in a hypoxia-inducible factor-1 alpha (HIF-1α)-dependent fashion. Sema6A expression increases in avascular inner retina and colocalizes with Nrf2 in human fetal eyes. Extracellular Sema6A leads to dose-dependent suppression of the migratory phenotype of endothelial cells through activation of Notch signaling. Lentiviral-mediated delivery of Sema6A small hairpin RNA (shRNA) abrogates the defective retinal revascularization in Nrf2-deficient mice. Importantly, pharmacologic Nrf2 activation promotes reparative angiogenesis and suppresses pathologic neovascularization. Our findings reveal a unique function of Nrf2 in reprogramming ischemic tissue toward neurovascular repair via Sema6A regulation

  13. Nrf2 activation: a potential strategy for the prevention of acute mountain sickness.

    PubMed

    Lisk, Christina; McCord, Joe; Bose, Swapan; Sullivan, Tim; Loomis, Zoe; Nozik-Grayck, Eva; Schroeder, Thies; Hamilton, Karyn; Irwin, David C

    2013-10-01

    Reactive oxygen species (ROS) formed during acute high altitude exposure contribute to cerebral vascular leak and development of acute mountain sickness (AMS). Nuclear factor (erythroid-derived 2)-related factor 2 (Nrf2) is a transcription factor that regulates expression of greater than 90% of antioxidant genes, but prophylactic treatment with Nrf2 activators has not yet been tested as an AMS therapy. We hypothesized that prophylactic activation of the antioxidant genome with Nrf2 activators would attenuate high-altitude-induced ROS formation and cerebral vascular leak and that some drugs currently used to treat AMS symptoms have an additional trait of Nrf2 activation. Drugs commonly used to treat AMS were screened with a luciferase reporter cell system for their effectiveness to activate Nrf2, as well as being tested for their ability to decrease high altitude cerebral vascular leak in vivo. Compounds that showed favorable results for Nrf2 activation from our screen and attenuated high altitude cerebral vascular leak in vivo were further tested in brain microvascular endothelial cells (BMECs) to determine if they attenuated hypoxia-induced ROS production and monolayer permeability. Of nine drugs tested, with the exception of dexamethasone, only drugs that showed the ability to activate Nrf2 (Protandim, methazolamide, nifedipine, amlodipine, ambrisentan, and sitaxentan) decreased high-altitude-induced cerebral vascular leak in vivo. In vitro, Nrf2 activation in BMECs before 24h hypoxia exposure attenuated hypoxic-induced hydrogen peroxide production and permeability. Prophylactic Nrf2 activation is effective at reducing brain vascular leak from acute high altitude exposures. Compared to acetazolamide, methazolamide may offer better protection against AMS. Nifedipine, in addition to its known vasodilatory activities in the lung and protection against high altitude pulmonary edema, may provide protection against brain vascular leak as well.

  14. Nrf2 Activation: A potential strategy for the prevention of Acute Mountain Sickness

    PubMed Central

    Lisk, Christina; McCord, Joe; Bose, Swapan; Sullivan, Tim; Loomis, Zoe; Nozik-Grayck, Eva; Schroeder, Thies; Hamilton, Karyn; Irwin, David C.

    2014-01-01

    Introduction Reactive oxygen species (ROS) formed during acute high altitude exposure contributes to cerebral vascular leak and development of acute mountain sickness (AMS). Nuclear factor (erythroid-derived 2)-related factor 2 (Nrf2) is a transcription factor that regulates expression of greater than 90% of antioxidant genes, but prophylactic treatment with Nrf2 activators has not yet been tested as an AMS therapy. We hypothesized that prophylactic activation of the antioxidant genome with Nrf2 activators would attenuate high altitude-induced ROS formation and cerebral vascular leak, and that some drugs currently used to treat AMS symptoms have an additional trait of Nrf2 activation. Methods Drugs commonly used to treat AMS were screened with a luciferase reporter cell system for their effectiveness to activate Nrf2, as well as tested for their ability to decrease high altitude cerebral vascular leak in vivo. Compounds that showed favorable results for Nrf2 activation from our screen and attenuated high altitude cerebral vascular leak in vivo were further tested in brain microvascular endothelial cells (BMEC) to determine if they attenuated hypoxia-induced ROS production and monolayer permeability. Results Of 9 drugs tested, with the exception of dexamethasone, only drugs that showed the ability to activate Nrf2 (Protandim, methazolamide, nifedipine, amlodipine, ambrisentan, and sitaxentan) decreased high altitude-induced cerebral vascular leak in vivo. In vitro, Nrf2 activation in BMEC prior to 24 h hypoxia exposure attenuated hypoxic-induced hydrogen peroxide production and permeability. Conclusions Prophylactic Nrf2 activation is effective at reducing brain vascular leak from acute high altitude exposures. Compared to acetazolamide, methazolamide may offer better protection against AMS. Nifedipine, in addition to its known vasodilatory activities in the lung and protection against high altitude pulmonary edema, may provide protection against brain vascular leak

  15. Nrf2 is required to maintain the self-renewal of glioma stem cells

    PubMed Central

    2013-01-01

    Background Glioblastomas are deadly cancers that display a functional cellular hierarchy maintained by self-renewing glioma stem cells (GSCs). Self-renewal is a complex biological process necessary for maintaining the glioma stem cells. Nuclear factor rythroid 2-related factor 2(Nrf2) plays a significant role in protecting cells from endogenous and exogenous stresses. Nrf2 is a key nuclear transcription factor that regulates antioxidant response element (ARE)-containing genes. Previous studies have demonstrated the significant role of Nrf2 in the proliferation of glioblastoma, and in their resistance to radioactive therapies. We examined the effect of knocking down Nrf2 in GSCs. Methods Nrf2 expression was down-regulated by shRNA transinfected with lentivirus. Expression levels of Nestin, Nrf2, BMI-1, Sox2 and Cyclin E were assessed by western blotting, quantitative polymerase chain reaction (qPCR) and immunohistochemistry analysis. The capacity for self-renewal in vitro was assessed by genesis of colonies. The capacity for self-renewal in vivo was analyzed by tumor genesis of xenografts in nude mice. Results Knockdown of Nrf2 inhibited the proliferation of GSCs, and significantly reduced the expression of BMI-1, Sox2 and CyclinE. Knocking down of Nrf2 changed the cell cycle distribution of GSCs by causing an uncharacteristic increase in the proportion of cells in the G2 phase and a decrease in the proportion of cells in the S phase of the cell cycle. Conclusions Nrf2 is required to maintain the self-renewal of GSCs, and its down-regulation can attenuate the self-renewal of GSCs significantly. PMID:23937621

  16. Ferrous Iron Induces Nrf2 Expression in Mouse Brain Astrocytes to Prevent Neurotoxicity.

    PubMed

    Cui, Zhenwen; Zhong, Zhihong; Yang, Yong; Wang, Baofeng; Sun, Yuhao; Sun, Qingfang; Yang, Guo-Yuan; Bian, Liuguan

    2016-08-01

    Free radical damage caused by ferrous iron is involved in the pathogenesis of secondary brain injury after intracerebral hemorrhage (ICH). NF-E2-related factor 2 (Nrf2), a major phase II gene regulator that binds to antioxidant response element, represents an important cellular cytoprotective mechanism against oxidative damage. We hypothesized that Nrf2 might protect astrocytes from damage by Fe(2+) . Therefore, we examined cytotoxicity in primary astrocytes induced by iron overload and evaluated the effects of Fe(2+) on Nrf2 expression. The results demonstrated that 24-h Fe(2+) exposure exerted time- and concentration-dependent cytotoxicity in astrocytes. Furthermore, Fe(2+) exposure in astrocytes resulted in time- and concentration-dependent increases in Nrf2 expression, which preceded Fe(2+) toxicity. Nrf2-specific siRNA further knocked down Nrf2 levels, resulting in greater Fe(2+) -induced astrocyte cytotoxicity. These data indicate that induction of Nrf2 expression could serve as an adaptive self-defense mechanism, although it is insufficient to completely protect primary astrocytes from Fe(2+) -induced neurotoxicity.

  17. Cervical Cancer Cell Line Secretome Highlights the Roles of Transforming Growth Factor-Beta-Induced Protein ig-h3, Peroxiredoxin-2, and NRF2 on Cervical Carcinogenesis

    PubMed Central

    Zoidakis, Jerome; Makridakis, Manousos; Lygirou, Vasiliki; Mermelekas, George; Vougas, Konstantinos; Drakakis, Peter

    2017-01-01

    Cancer cells acquire unique secretome compositions that contribute to tumor development and metastasis. The aim of our study was to elucidate the biological processes involved in cervical cancer, by performing a proteomic analysis of the secretome from the following informative cervical cell lines: SiHa (HPV16+), HeLa (HPV18+), C33A (HPV−), and HCK1T (normal). Proteins were analyzed by 2D gel electrophoresis coupled to MALDI-TOF-MS. Enrichment of secreted proteins with characteristic profiles for each cell line was followed by the identification of differentially expressed proteins. Particularly, transforming growth factor-beta-induced protein ig-h3 (Beta ig-h3) and peroxiredoxin-2 (PRDX2) overexpression in the secretome of cancer cell lines was detected and confirmed by Western blot. Bioinformatics analysis identified the transcription factor NRF2 as a regulator of differentially expressed proteins in the cervical cancer secretome. NRF2 levels were measured by both Western blot and Multiple Reaction Monitoring (MRM) in the total cell extract of the four cell lines. NRF2 was upregulated in SiHa and C33A compared to HCK1T. In conclusion, the secreted proteins identified in cervical cancer cell lines indicate that aberrant NRF2-mediated oxidative stress response (OSR) is a prominent feature of cervical carcinogenesis. PMID:28261610

  18. Naturally Occurring Nrf2 Activators: Potential in Treatment of Liver Injury

    PubMed Central

    2016-01-01

    Oxidative stress plays a major role in acute and chronic liver injury. In hepatocytes, oxidative stress frequently triggers antioxidant response by activating nuclear erythroid 2-related factor 2 (Nrf2), a transcription factor, which upregulates various cytoprotective genes. Thus, Nrf2 is considered a potential therapeutic target to halt liver injury. Several studies indicate that activation of Nrf2 signaling pathway ameliorates liver injury. The hepatoprotective potential of naturally occurring compounds has been investigated in various models of liver injuries. In this review, we comprehensively appraise various phytochemicals that have been assessed for their potential to halt acute and chronic liver injury by enhancing the activation of Nrf2 and have the potential for use in humans. PMID:28101296

  19. Nrf2 activation protects the liver from ischemia/ reperfusion injury in mice

    PubMed Central

    Kudoh, Kazuhiro; Uchinami, Hiroshi; Yoshioka, Masato; Seki, Ekihiro; Yamamoto, Yuzo

    2014-01-01

    Objective To investigate the role of Nrf2 in the pathogenesis of hepatic ischemia-reperfusion (I/R) injury. Summary Background Data Hepatic I/R injury is a serious complication that leads to liver failure after liver surgery. NF-E2-related factor 2 (Nrf2) is a transcription factor that plays a critical role in protecting cells against oxidative stress. Therefore, it is suggested that Nrf2 activation protects the liver from I/R injury. Methods Wild-type (WT) and Nrf2-deficient mice were treated with 15-deoxy-Δ12, 14-prostaglandin J2 (15d-PGJ2), or a vehicle. Subsequently, these mice were subjected to 60 min hepatic 70% ischemia followed by reperfusion. Liver and blood samples were collected to evaluate liver injury and mRNA expressions. Results After hepatic I/R, Nrf2-deficient livers exhibited enhanced tissue damage, impaired GSTm1, NQO1, and GCLc inductions, disturbed redox state, and aggravated TNF-α mRNA expression in comparison to WT livers. 15d-PGJ2 treatment protected the livers of WT mice from I/R injury via increased expressions of GSTm1, NQO1 and GCLc, maintained redox status, and decreased TNF-α induction. These effects induced by 15d-PGJ2 were not seen in the livers of Nrf2−/− mice and were not annulled by PPARγ antagonist in Nrf2+/+ mice, suggesting that the protective effect of 15d-PGJ2 is mediated by Nrf2-dependent antioxidant response. Conclusions Nrf2 plays a critical role in the mechanism of hepatic I/R injury and would be a new therapeutic target for preventing hepatic I/R injury during liver surgery. PMID:24368646

  20. Activated AMPK boosts the Nrf2/HO-1 signaling axis—A role for the unfolded protein response

    PubMed Central

    Zimmermann, Kristin; Baldinger, Johannes; Mayerhofer, Barbara; Atanasov, Atanas G.; Dirsch, Verena M.; Heiss, Elke H.

    2015-01-01

    In light of the emerging interplay between redox and metabolic signaling pathways we investigated the potential cross talk between nuclear factor E2-related factor 2 (Nrf2) and AMP-activated kinase (AMPK), central regulators of the cellular redox and energy balance, respectively. Making use of xanthohumol (XN) as an activator of both the AMPK and the Nrf2 signaling pathway we show that AMPK exerts a positive influence on Nrf2/heme oxygenase (HO)-1 signaling in mouse embryonic fibroblasts. Genetic ablation and pharmacological inhibition of AMPK blunts Nrf2-dependent HO-1 expression by XN already at the mRNA level. XN leads to AMPK activation via interference with mitochondrial function and activation of liver kinase B1 as upstream AMPK kinase. The subsequent AMPK-mediated enhancement of the Nrf2/HO-1 response does not depend on inhibition of the mammalian target of rapamycin, inhibition of glycogen synthase kinase 3β, or altered abundance of Nrf2 (total and nuclear). However, reduced endoplasmic reticulum stress was identified and elaborated as a step in the AMPK-augmented Nrf2/HO-1 response. Overall, we shed more light on the hitherto incompletely understood cross talk between the LKB1/AMPK and the Nrf2/HO-1 axis revealing for the first time involvement of the unfolded protein response as an additional player and suggesting tight cooperation between signaling pathways controlling cellular redox, energy, or protein homeostasis. PMID:25843659

  1. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    SciTech Connect

    Han, Jae Yun; Cho, Seung Sik; Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho; Park, Da Eon; Bang, Joon Seok; Jung, Young Suk; Ki, Sung Hwan

    2015-08-15

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  2. Nrf2 promotes survival following exposure to ionizing radiation.

    PubMed

    Sekhar, Konjeti R; Freeman, Michael L

    2015-11-01

    Nrf2 is a transcription factor that promotes antioxidant and drug-metabolizing gene expression. It also regulates the transcription of genes involved in carbohydrate and lipid metabolism, NADPH regeneration, and heme and iron metabolism, as well as proteasome metabolism. Emerging research has identified Nrf2 as a critical factor for promoting survival of mammalian cells subjected to ionizing radiation. At a mechanistic level, Nrf2 promotes the repair of DNA damage and drives detoxification of superoxide that is generated hours to days after irradiation. This review summarizes research in these areas and discusses targeting of Nrf2 in radiation-resistant cancer and Nrf2׳s role in mitigating acute radiation syndrome.

  3. Mechanisms of activation of the transcription factor Nrf2 by redox stressors, nutrient cues, and energy status and the pathways through which it attenuates degenerative disease

    PubMed Central

    Tebay, Lauren E.; Robertson, Holly; Durant, Stephen T.; Vitale, Steven R.; Penning, Trevor M.; Dinkova-Kostova, Albena T.; Hayes, John D.

    2015-01-01

    Nuclear factor-erythroid 2 p45-related factor 2 (Nrf2) regulates the basal and stress-inducible expression of a battery of genes encoding key components of the glutathione-based and thioredoxin-based anti-oxidant systems, as well as aldo-keto reductase, glutathione S-transferase, and NAD(P)H:quinone oxi-doreductase-1 drug-metabolizing isoenzymes along with multidrug-resistance-associated efflux pumps. It therefore plays a pivotal role in both intrinsic resistance and cellular adaptation to reactive oxygen species (ROS) and xenobiotics. Activation of Nrf2 can, however, serve as a double-edged sword because some of the genes it induces may contribute to chemical carcinogenesis by promoting futile redox cycling of polycyclic aromatic hydrocarbon metabolites or confer resistance to chemotherapeutic drugs by increasing the expression of efflux pumps, suggesting its cytoprotective effects will vary in a context-specific fashion. In addition to cytoprotection, Nrf2 also controls genes involved in intermediary metabolism, positively regulating those involved in NADPH generation, purine biosynthesis, and the β-oxidation of fatty acids, while suppressing those involved in lipogenesis and gluconeogenesis. Nrf2 is subject to regulation at multiple levels. Its ability to orchestrate adaptation to oxidants and electrophiles is due principally to stress-stimulated modification of thiols within one of its repressors, the Kelch-like ECH-associated protein 1 (Keap1), which is present in the cullin-3 RING ubiquitin ligase (CRL) complex CRLKeap1. Thus modification of Cys residues in Keap1 blocks CRLKeap1 activity, allowing newly translated Nrf2 to accumulate rapidly and induce its target genes. The ability of Keap1 to repress Nrf2 can be attenuated by p62/sequestosome-1 in a mechanistic target of rapamycin complex 1 (mTORC1)-depen-dent manner, thereby allowing refeeding after fasting to increase Nrf2-target gene expression. In parallel with repression by Keap1, Nrf2 is also repressed

  4. Nrf2-related gene expression and exposure to traffic-related air pollution in elderly subjects with cardiovascular disease: An exploratory panel study

    PubMed Central

    Wittkopp, Sharine; Staimer, Norbert; Tjoa, Thomas; Stinchcombe, Timothy; Daher, Nancy; Schauer, James J.; Shafer, Martin M.; Sioutas, Constantinos; Gillen, Daniel L.; Delfino, Ralph J.

    2015-01-01

    Gene expression changes are linked to air pollutant exposures in in vitro and animal experiments. However, limited data are available on how these outcomes relate to ambient air pollutant exposures in humans. We performed an exploratory analysis testing whether gene expression levels were associated with air pollution exposures in a Los Angeles area cohort of elderly subjects with coronary artery disease. Candidate genes (35) were selected from published studies of gene expression-pollutant associations. Expression levels were measured weekly in 43 subjects (≤12 weeks) using quantitative PCR. Exposures included gaseous pollutants O3, nitrogen oxides (NOx), and CO; particulate matter (PM) pollutants elemental and black carbon (EC, BC); and size-fractionated PM mass. We measured organic compounds from PM filter extracts, including polycyclic aromatic hydrocarbons (PAHs), and determined the in vitro oxidative potential of particle extracts. Associations between exposures and gene expression levels were analyzed using mixed-effects regression models. We found positive associations of traffic-related pollutants (EC, BC, primary organic carbon, PM0.25-2.5 PAH and/or PM0.25 PAH, and NOx) with NFE2L2, Nrf2-mediated genes (HMOX1, NQO1, and SOD2), CYP1B1, IL1B, and SELP. Findings suggest that NFE2L2 gene expression links associations of traffic-related air pollution with phase I and II enzyme genes at the promoter transcription level. PMID:25564368

  5. Oxidative Stress and the Nrf2 Anti-Oxidant Transcription Factor in Age-Related Macular Degeneration.

    PubMed

    Lambros, Mandy L; Plafker, Scott M

    2016-01-01

    Age-related macular degeneration (AMD) is the leading cause of acquired and irreversible blindness among elderly Americans. Most AMD patients have the dry form of the disease (dAMD) for which reliable therapies are lacking. A major obstacle to the development of effective treatments is a deficit in our understanding of what triggers dAMD onset. This is particularly the case with respect to the events that cause retinal pigment epithelial (RPE) cells to transition from a state of health and homeostasis to one of dysfunction and atrophy. These cells provide critical support to the photoreceptors and their atrophy often precipitates photoreceptor death in dAMD. Chronic oxidative stress is a primary driver of age-dependent, RPE atrophy. Sources of this stress have been identified (e.g., cigarette smoke, photooxidized bisretinoids), but we still do not understand how these stressors damage RPE constituents or what age-dependent changes undermine the cytoprotective systems in the RPE. This review focuses on Nrf2, the master antioxidant transcription factor, and its role in the RPE during aging and dAMD onset.

  6. 3′,4′,5′,5,7-Pentamethoxyflavone Sensitizes Cisplatin-Resistant A549 Cells to Cisplatin by Inhibition of Nrf2 Pathway

    PubMed Central

    Hou, Xiangyu; Bai, Xupeng; Gou, Xiaoli; Zeng, Hang; Xia, Chen; Zhuang, Wei; Chen, Xinmeng; Zhao, Zhongxiang; Huang, Min; Jin, Jing

    2015-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is an important redox-sensitive transcription factor that regulates the expression of several cytoprotective genes. More recently, genetic analyses of human tumors have indicated that Nrf2 may cause resistance to chemotherapy. In this study, we found that the expression levels of Nrf2 and its target genes GCLC, HO-1, NQO1 were significantly higher in cisplatin-resistant A549 (A549/CDDP) cells than those in A549 cells, and this resistance was partially reversed by Nrf2 siRNA. 3′,4′,5′,5,7-Pentamethoxyflavone (PMF), a natural flavonoid extracted from Rutaceae plants, sensitized A549/CDDP to CDDP and substantially induced apoptosis compared with that of CDDP alone treated group, and this reversal effect decreased when Nrf2 was downregulated by siRNA. Mechanistically, PMF reduced Nrf2 expression leading to a reduction of Nrf2 downstream genes, and in contrast, this effect was decreased by blocking Nrf2 with siRNA. Taken together, these results demonstrated that PMF could be used as an effective adjuvant sensitizer to increase the efficacy of chemotherapeutic drugs by downregulating Nrf2 signaling pathway. PMID:25843086

  7. Activation of Keap1/Nrf2 signaling pathway by nuclear epidermal growth factor receptor in cancer cells

    PubMed Central

    Huo, Longfei; Li, Chia-Wei; Huang, Tzu-Hsuan; Lam, Yung Carmen; Xia, Weiya; Tu, Chun; Chang, Wei-Chao; Hsu, Jennifer L; Lee, Dung-Fang; Nie, Lei; Yamaguchi, Hirohito; Wang, Yan; Lang, Jingyu; Li, Long-Yuan; Chen, Chung-Hsuan; Mishra, Lopa; Hung, Mien-Chie

    2014-01-01

    Nuclear translocation of EGFR has been shown to be important for tumor cell growth, survival, and therapeutic resistance. Previously, we detected the association of EGFR with Keap1 in the nucleus. Keap1 is a Kelch-like ECH-associated protein, which plays an important role in cellular response to chemical and oxidative stress by regulating Nrf2 protein stability and nuclear translocation. In this study, we investigate the role of EGFR in regulating Keap1/Nrf2 cascade in the nucleus and provide evidence to show that nuclear EGFR interacts with and phosphorylates nuclear Keap1 to reduce its nuclear protein level. The reduction of nuclear Keap1 consequently stabilizes nuclear Nrf2 and increases its transcriptional activity in cancer cells, which contributes to tumor cell resistance to chemotherapy. PMID:25628777

  8. Pathophysiological processes in multiple sclerosis: focus on nuclear factor erythroid-2-related factor 2 and emerging pathways

    PubMed Central

    Arnold, Philipp; Mojumder, Deb; DeToledo, John; Lucius, Ralph; Wilms, Henrik

    2014-01-01

    Multiple sclerosis (MS) is a disease of the central nervous system that is characterized by the demyelination of neuronal axons. Four different patterns of demyelination have been described, showing the heterogeneity in the immunopathologic processes involved in the demyelination. This review will focus on reactive oxygen species (ROS)-related inflammation in MS. Special emphasis will be placed on the nuclear factor erythroid-2-related factor 2 (Nrf2) as it regulates the transcription of ROS-protective genes. In the cytosol, Nrf2 binds to Keap1 (Kelch-like ECH-associated protein 1), and together they are degraded by the 26S proteasome after ubiquitination. If challenged by ROS Nrf2, binding to Keap1 is abrogated, and it translocates into the nucleus. Here it binds to the antioxidant response element and to a small protein termed Maf (musculoaponeurotic fibrosarcoma oncogene homolog). This leads to an enhanced transcription of ROS protective genes and represents the physiological answer against ROS challenge. It has been shown that dimethyl fumarate (DMF) has the same effect and leads to an enhanced transcription of ROS-protective genes. This response is mediated through a reduced binding of Nrf2 to Keap1, thus resulting in a higher level of free Nrf2 in the cytosol. Consequently, more Nrf2 translocates to the nucleus, promoting transcription of its target genes. DMF has been used for the treatment of psoriasis for many years in Germany without the occurrence of major side effects. In psoriasis, DMF reduces ROS-related inflammation in skin. A DMF analog, BG-12, was recently approved for the treatment of relapsing-remitting MS by the European Union and the US Food and Drug Administration. As an oral formulation, it gives patients a convenient and effective alternative to the injectable immune modulators in the long-term treatment of MS. PMID:24591852

  9. Nrf2 protects against furosemide-induced hepatotoxicity.

    PubMed

    Qu, Qiang; Liu, Jie; Zhou, Hong-Hao; Klaassen, Curtis D

    2014-10-03

    Furosemide is a diuretic drug, but its reactive intermediates lead to acute liver injury in mice. Given the essential role of Nrf2 as a cellular defense regulator, we investigated whether Nrf2 would protect against furosemide-induced liver injury using the Nrf2 "gene-dose response" mouse model (Nrf2-null with Nrf2 knock-out, wild-type with normal expression of Nrf2, Keap1-KD with enhanced Nrf2 activation and Keap1-HKO mice with maximum Nrf2 activation). Twenty-four hours after furosemide administration (250mg/kg, i.p.), serum ALT activities and histopathological analysis indicated severe hepatotoxicity in Nrf2-null and WT mice, but significantly less in the Nrf2-overexpressing Keap1-KD and Keap1-HKO mice. Furosemide increased the mRNA of genes involved in the acute phase response (hemeoxygenase-1 and metallothionein-1), ER stress (C/Ebp-homologous protein and Growth arrest and DNA-damage-inducible protein), inflammatory cytokine (interleukin 1 beta), chemokines (macrophage inflammatory protein 2 and mouse keratinocyte-derived chemokine), as well as apoptosis (early growth response factor and BCL2-associated X protein) in livers of Nrf2-null and wild-type mice, but these genes increased less in mice with more Nrf2. The two genotypes of over-expressed Nrf2 mice had increased expression of the Nrf2 target genes Gclm, Gclc and Nqo1 prior to furosemide administration, and the expressions of these genes were increased further after furosemide administration. Thus, our findings provide strong evidence that over-expression of Nrf2 in Keap1-KD and Keap1-HKO mice and the increases in mRNA of a number of genes involved in anti-oxidative stress, anti-inflammation, anti-ER stress and anti-apoptosis protect against furosemide-induced hepatotoxicity.

  10. Nuclear Factor Erythroid 2-related Factor 2 Deficiency Exacerbates Lupus Nephritis in B6/lpr mice by Regulating Th17 Cell Function

    PubMed Central

    Zhao, Mei; Chen, Huanpeng; Ding, Qingfeng; Xu, Xiaoxie; Yu, Bolan; Huang, Zhaofeng

    2016-01-01

    Lupus nephritis (LN) is the major clinical manifestation of systemic lupus erythematosus. LN is promoted by T helper 17 (Th17) cells, which are the major pro-inflammatory T cell subset contributing to autoimmunity regulation. Nuclear factor erythroid 2-related factor 2 (NRF2) is critical for suppressing reactive oxygen species (ROS) and relieving oxidant stress by regulating antioxidant gene expression. Previous studies have demonstrated that Nrf2 deficiency promotes drug-induced or spontaneous LN. However, whether NRF2 regulates Th17 function during LN development is still unclear. In this study, we introduced Nrf2 deficiency into a well-known LN model, the B6/lpr mouse strain, and found that it promoted early-stage LN with altered Th17 activation. Th17 cells and their relevant cytokines were dramatically increased in these double-mutant mice. We also demonstrated that naïve T cells from the double-mutant mice showed significantly increased differentiation into Th17 cells in vitro, with decreased expression of the Th17 differentiation suppressor Socs3 and increased phosphorylation of STAT3. Our results demonstrated that Nrf2 deficiency promoted Th17 differentiation and function during LN development. Moreover, our results suggested that the regulation of Th17 differentiation via NRF2 could be a therapeutic target for the treatment of subclinical LN patients. PMID:27941837

  11. MDA-7/IL-24 inhibits Nrf2-mediated antioxidant response through activation of p38 pathway and inhibition of ERK pathway involved in cancer cell apoptosis.

    PubMed

    Tian, H; Zhang, D; Gao, Z; Li, H; Zhang, B; Zhang, Q; Li, L; Cheng, Q; Pei, D; Zheng, J

    2014-10-01

    Reactive oxygen species (ROS) have a crucial role in melanoma differentiation-associated gene-7 (MDA-7)/interleukin-24 (IL-24)-induced cancer cell apoptosis. However, cancer cell has a series of protective mechanisms to resist ROS damage. Nuclear factor erythroid 2-related factor 2 (Nrf2) activates antioxidant response element (ARE)-mediated gene expression involved in cellular protection against oxidative stress. As the Nrf2 repressor, Kelch-like ECH-associated protein-1 (Keap1) sequesters Nrf2 in cytoplasm to block Nrf2 nuclear translocation. In the present study, administration of MDA-7/IL-24 by means of tumor-selective replicating adenovirus (ZD55-IL-24) was used to investigate whether ZD55-IL-24 could attenuate Nrf2-mediated oxidative stress response in cancer cell. We found that ZD55-IL-24 effectively strengthened the association between Nrf2 and Keap1 to restrict Nrf2 nuclear translocation, thereby inhibiting ARE-dependent transcriptional response. To evaluate the detailed mechanism underlying the suppression of ZD55-IL-24 on Nrf2-mediated oxidative stress response, we further tested three different mitogen-activated protein kinase (MAPK) signaling pathways in A549 and HeLa cells transfected by ZD55-IL-24. Our data showed that ZD55-IL-24 inhibited extracellular signal-regulated kinase (ERK) signal pathway but activated p38 and c-Jun-NH2-kinase (JNK) signal pathways to exert the tumor-specific apoptosis. Moreover, ERK pathway inhibitor U0126 prevented Nrf2 phosphorylation at Ser40 to retard Nrf2 nuclear translocation, thus decreasing antioxidant gene transcription. In contrast, p38 pathway inhibitor SB203580 obviously promoted the dissociation of Nrf2 from Keap1 to promote antioxidant gene transcription. However, JNK pathway had no effect on Nrf2 subcellular localization or the association of Nrf2 with Keap1. Conclusively, our results indicate that ZD55-IL-24 inhibits Nrf2-mediated oxidative stress response not only by activating p38 signal pathway to

  12. Aldo-keto reductases are biomarkers of NRF2 activity and are co-ordinately overexpressed in non-small cell lung cancer

    PubMed Central

    MacLeod, A Kenneth; Acosta-Jimenez, Lourdes; Coates, Philip J; McMahon, Michael; Carey, Frank A; Honda, Tadashi; Henderson, Colin J; Wolf, C Roland

    2016-01-01

    Background: Although the nuclear factor-erythroid 2-related factor 2 (NRF2) pathway is one of the most frequently dysregulated in cancer, it is not clear whether mutational status is a good predictor of NRF2 activity. Here we utilise four members of the aldo-keto reductase (AKR) superfamily as biomarkers to address this question. Methods: Twenty-three cell lines of diverse origin and NRF2-pathway mutational status were used to determine the relationship between AKR expression and NRF2 activity. AKR expression was evaluated in lung cancer biopsies and Cancer Genome Atlas (TCGA) and Oncomine data sets. Results: AKRs were expressed at a high basal level in cell lines carrying mutations in the NRF2 pathway. In non-mutant cell lines, co-ordinate induction of AKRs was consistently observed following activation of NRF2. Immunohistochemical analysis of lung tumour biopsies and interrogation of TCGA data revealed that AKRs are enriched in both squamous cell carcinomas (SCCs) and adenocarcinomas that contain somatic alterations in the NRF2 pathway but, in the case of SCC, AKRs were also enriched in most other tumours. Conclusions: An AKR biomarker panel can be used to determine NRF2 status in tumours. Hyperactivation of the NRF2 pathway is far more prevalent in lung SCC than previously predicted by genomic analyses. PMID:27824809

  13. The status of Nrf2-based therapeutics: current perspectives and future prospects

    PubMed Central

    Gazaryan, Irina G.; Thomas, Bobby

    2016-01-01

    This mini-review presents the authors' vision on the current status and future trends in the development of neuroprotective agents working via activation of nuclear factor erythroid 2-related factor 2 (Nrf2), and in particular, via disruption of Nrf2-Keap1 interaction. There are two opposite “chemical” mechanisms underlying such activation: the first one is a non-specific covalent modification of Keap1 thiols, resulting in side effects of varied severity, and the second one is the shift of the Nrf2-Kelch-like ECH associated protein-1 (Keap1) binding equilibrium in the presence of a competitive and chemically benign displacement agent. At this point, no displacement activators exhibit sufficient biological activity in comparison with common Nrf2 activators working via Keap1 thiol modification. Hence, the hope in therapeutics is now linked to the FDA approved dimethylfumarate, whose derivative, monomethylfumarate, as we demonstrated recently, is much less toxic but equally biologically potent and an ideal candidate for clinical trials right now. A newly emerging player is a nuclear inhibitor of Nrf2, BTB domain and CNC homolog 1 (Bach1). The commercially developed Bach1 inhibitors are currently under investigation in our laboratory showing promising results. In our viewpoint, the perfect future drug will present the combination of a displacement activator and Bach1 inhibitor to insure safety and efficiency of Nrf2 activation. PMID:28123399

  14. Acute oxidative stress and systemic Nrf2 activation by the ketogenic diet.

    PubMed

    Milder, Julie B; Liang, Li-Ping; Patel, Manisha

    2010-10-01

    The mechanisms underlying the efficacy of the ketogenic diet (KD) remain unknown. Recently, we showed that the KD increased glutathione (GSH) biosynthesis. Since the NF E2-related factor 2 (Nrf2) transcription factor is a primary responder to cellular stress and can upregulate GSH biosynthesis, we asked whether the KD activates the Nrf2 pathway. Here we report that rats consuming a KD show acute production of H(2)O(2) from hippocampal mitochondria, which decreases below control levels by 3 weeks, suggestive of an adaptive response. 4-Hydroxy-2-nonenal (4-HNE), an electrophilic lipid peroxidation end product known to activate the Nrf2 detoxification pathway, was also acutely increased by the KD. Nrf2 nuclear accumulation was evident in both the hippocampus and liver, and the Nrf2 target, NAD(P)H:quinone oxidoreductase (NQO1), exhibited increased activity in both the hippocampus and liver after 3 weeks. We also found chronic depletion of liver tissue GSH, while liver mitochondrial antioxidant capacity was preserved. These data suggest that the KD initially produces mild oxidative and electrophilic stress, which may systemically activate the Nrf2 pathway via redox signaling, leading to chronic cellular adaptation, induction of protective proteins, and improvement of the mitochondrial redox state.

  15. Design, synthesis, and evaluation of curcumin derivatives as Nrf2 activators and cytoprotectors against oxidative death.

    PubMed

    Tu, Zhi-Shan; Wang, Qi; Sun, Dan-Dan; Dai, Fang; Zhou, Bo

    2017-04-05

    Activation of nuclear factor erythroid-2-related factor 2 (Nrf2) has been proven to be an effective means to prevent the development of cancer, and natural curcumin stands out as a potent Nrf2 activator and cancer chemopreventive agent. In this study, we synthesized a series of curcumin analogs by introducing the geminal dimethyl substituents on the active methylene group to find more potent Nrf2 activators and cytoprotectors against oxidative death. The geminally dimethylated and catechol-type curcumin analog (compound 3) was identified as a promising lead molecule in terms of its increased stability and cytoprotective activity against the tert-butyl hydroperoxide (t-BHP)-induced death of HepG2 cells. Mechanism studies indicate that its cytoprotective effects are mediated by activating the Nrf2 signaling pathway in the Michael acceptor- and catechol-dependent manners. Additionally, we verified by using copper and iron ion chelators that the two metal ion-mediated oxidations of compound 3 to its corresponding electrophilic o-quinone, contribute significantly to its Nrf2-dependent cytoprotection. This work provides an example of successfully designing natural curcumin-directed Nrf2 activators by a stability-increasing and proelectrophilic strategy.

  16. Nrf2 mediates redox adaptation in NOX4-overexpressed non-small cell lung cancer cells.

    PubMed

    Wu, Qipeng; Yao, Bei; Li, Ning; Ma, Lei; Deng, Yanchao; Yang, Yang; Zeng, Cheng; Yang, Zhicheng; Liu, Bing

    2017-02-11

    The redox adaptation mechanisms in cancer cells are very complex and remain largely unclear. Our previous studies have confirmed that NADPH oxidase 4 (NOX4) is abundantly expressed in non-small cell lung cancer (NSCLC) and confers apoptosis resistance on NSCLC cells. However, the comprehensive mechanisms for NOX4-mediated oxidative resistance of cancer cells remain still undentified. The present study found that NOX4-derived H2O2 enhanced the nuclear factor erythroid 2-related factor 2 (Nrf2) stability via disruption of redox-dependent proteasomal degradation and stimulated its activity through activation of PI3K signaling. Specifically, the results showed that ectopic NOX4 expression did not induce apoptosis of A549 cells; however, inhibition of Nrf2 resulted in obvious apoptotic death of NOX4-overexpressed A549 cells, accompanied by a significant increase in H2O2 level and decrease in GSH content. Besides, inhibition of Nrf2 could suppress cell growth and efficiently reverse the enhancement effect of NOX4 on cell growth. The in vivo data confirmed that inhibition of Nrf2 could interfere apoptosis resistance in NOX4-overexpressed A549 tumors and led to cell growth inhibition. In conclusion, these results reveal that Nrf2 is critically involved in redox adaptation regulation in NOX4-overexpressed NSCLC cells. Therefore, NOX4 and Nrf2 may be promising combination targets against malignant progression of NSCLC.

  17. Nrf2 regulates gene-environment interactions in an animal model of intrauterine inflammation: Implications for preterm birth and prematurity

    PubMed Central

    Sussan, Thomas E.; Sudini, Kuladeep; Talbot, C. Conover; Wang, Xiaobin; Wills-Karp, Marsha; Burd, Irina; Biswal, Shyam

    2017-01-01

    Preterm birth (PTB) is the leading cause of neonatal mortality, and surviving infants are at increased risk for lifelong disabilities. Intrauterine inflammation is an etiological factor that drives PTB, and oxidative stress is associated with PTB. Nuclear erythroid 2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that is the key regulator of the response to oxidative and inflammatory stress. Here, we used the established mouse model of intrauterine inflammation-induced PTB to determine whether Nrf2 is a modifier of susceptibility to PTB and prematurity-related morbidity and mortality in the offspring. We determined that Nr2-deficient (Nrf2−/−) mice exhibited a greater sensitivity to intrauterine inflammation, as indicated by decreased time to delivery, reduced birthweight, and 100% mortality. Placentas from preterm Nrf2−/− mice showed elevated levels of markers of inflammation, oxidative stress, and cell death, and transcriptomic analysis identified numerous key signaling pathways that were differentially expressed between wild-type (WT) and Nrf2−/− mice in both preterm and control samples. Thus, Nrf2 could be a critical factor for gene-environment interactions that may determine susceptibility to PTB. Further studies are needed to determine if Nrf2 is a viable therapeutic target in women who are at risk for PTB and associated complications in the affected offspring. PMID:28071748

  18. Bovine embryo survival under oxidative-stress conditions is associated with activity of the NRF2-mediated oxidative-stress-response pathway.

    PubMed

    Amin, Ahmed; Gad, Ahmed; Salilew-Wondim, Dessie; Prastowo, Sigit; Held, Eva; Hoelker, Michael; Rings, Franca; Tholen, Ernst; Neuhoff, Christiane; Looft, Christian; Schellander, Karl; Tesfaye, Dawit

    2014-06-01

    In present study, we sought to examine the ability of preimplantation bovine embryos to activate the NF-E2-related factor 2 (NRF2)-mediated oxidative-stress response under an oxidative stress environment. In vitro 2-, 4-, 8-, 16-cell-, and blastocyst-stage embryos were cultured under low (5%) or high (20%) oxygen levels. The expression of NRF2, KEAP1 (NRF2 inhibitor), antioxidants downstream of NRF2, and genes associated with embryo metabolism were analyzed between the embryo groups using real-time quantitative PCR. NRF2 and KEAP1 protein abundance, mitochondrial activity, and accumulation of reactive oxygen species (ROS) were also investigated in blastocysts of varying competence that were derived from high- or low-oxygen levels. The expression levels of NRF2 and its downstream antioxidant genes were higher in 8-cell, 16-cell, and blastocyst stages under high oxygen tension, whereas KEAP1 expression was down-regulated under the same conditions. Higher expression of NRF2 and lower ROS levels were detected in early (competent) blastocysts compared to their late (noncompetent) counterparts in both oxygen-tension groups. Similarly, higher levels of active nuclear NRF2 protein were detected in competent blastocysts compared to their noncompetent counterparts. Thus, the survival and developmental competence of embryos cultured under oxidative stress are associated with activity of the NRF2-mediated oxidative stress response pathway during bovine pre-implantation embryo development.

  19. The Nrf2-antioxidant response element pathway: a target for regulating energy metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that responds to oxidative stress by binding to the antioxidant response element (ARE) in the promoter of genes coding for antioxidant enzymes like NAD(P)H:quinone oxidoreductase 1 (NQO1) and proteins for glutathione synthesis. ...

  20. Wogonin reversed resistant human myelogenous leukemia cells via inhibiting Nrf2 signaling by Stat3/NF-κB inactivation

    PubMed Central

    Xu, Xuefen; Zhang, Xiaobo; Zhang, Yi; Yang, Lin; Liu, Yicheng; Huang, Shaoliang; Lu, Lu; Kong, Lingyi; Li, Zhiyu; Guo, Qinglong; Zhao, Li

    2017-01-01

    Constitutive NF-E2-related factor 2 (Nrf2, NFE2L2) activation has been recently reported to play a pivotal role in enhancing cell survival and resistance to anticancer drugs in many tumors. Wogonin had strong reversal potency via reduction of Nrf2 mRNA in Adriamycin (ADR)-induced resistant human chronic myelogenous leukemia (CML) K562/A02, but the mechanism of reduction of Nrf2 mRNA was still unclear. In this study, we aimed to delineate the mechanism by which Wogonin suppressed transcription of Nrf2 in resistant CML cells and further evaluate the reversal effects of Wogonin on the established animal models. Data indicated that Wogonin suppressed transcription of Nrf2 by NF-κB inactivation. Wogonin inhibited the binding of p65 to Nrf2 by suppression of the κB-binding activity. Further research revealed the κB2 site was responsible for the decreased Nrf2 by Wogonin in resistant K562 cells. Furthermore, reduction of pY705-Stat3 was involved in inhibition of the binding of p65 to Nrf2 by Wogonin. In vivo, Wogonin potentiated the inhibitory effect of ADR on leukemia development by suppressing pY705-Stat3 and Nrf2 signaling. In summary, these results demonstrated Wogonin could combat chemoresistance effectively through inhibiting Nrf2 via Stat3/NF-κB signaling, and supported that Wogonin can be developed into an efficient natural sensitizer for resistant human myelogenous leukemia. PMID:28150717

  1. Identification of an unintended consequence of Nrf2-directed cytoprotection against a key tobacco carcinogen plus a counteracting chemopreventive intervention.

    PubMed

    Paonessa, Joseph D; Ding, Yi; Randall, Kristen L; Munday, Rex; Argoti, Dayana; Vouros, Paul; Zhang, Yuesheng

    2011-06-01

    NF-E2-related factor 2 (Nrf2) is a major cytoprotective gene and is a key chemopreventive target against cancer and other diseases. Here we show that Nrf2 faces a dilemma in defense against 4-aminobiphenyl (ABP), a major human bladder carcinogen from tobacco smoke and other environmental sources. Although Nrf2 protected mouse liver against ABP (which is metabolically activated in liver), the bladder level of N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP), the predominant ABP-DNA adduct formed in bladder cells and tissues, was markedly higher in Nrf2(+/+) mice than in Nrf2(-/-) mice after ABP exposure. Notably, Nrf2 protected bladder cells against ABP in vitro. Mechanistic investigations showed that the dichotomous effects of Nrf2 could be explained at least partly by upregulation of UDP-glucuronosyltransferase (UGT). Nrf2 promoted conjugation of ABP with glucuronic acid in the liver, increasing urinary excretion of the conjugate. Although glucuronidation of ABP and its metabolites is a detoxification process, these conjugates, which are excreted in urine, are known to be unstable in acidic urine, leading to delivery of the parent compounds to bladder. Hence, although higher liver UGT activity may protect the liver against ABP, it increases bladder exposure to ABP. These findings raise concerns of potential bladder toxicity when Nrf2-activating chemopreventive agents are used in humans exposed to ABP, especially in smokers. We further show that 5,6-dihydrocyclopenta[c][1,2]-dithiole-3(4H)-thione (CPDT) significantly inhibits dG-C8-ABP formation in bladder cells and tissues but does not seem to significantly modulate ABP-catalyzing UGT in liver. Thus, CPDT exemplifies a counteracting solution to the dilemma posed by Nrf2.

  2. Acetylcarnitine induces heme oxygenase in rat astrocytes and protects against oxidative stress: involvement of the transcription factor Nrf2.

    PubMed

    Calabrese, Vittorio; Ravagna, Agrippino; Colombrita, Claudia; Scapagnini, Giovanni; Guagliano, Eleonora; Calvani, Menotti; Butterfield, D Allan; Giuffrida Stella, Anna Maria

    2005-02-15

    Efficient functioning of maintenance and repair processes seem to be crucial for both survival and physical quality of life. This is accomplished by a complex network of the so-called longevity assurance processes, under control of several genes termed vitagenes. These include members of the heat shock protein system, and there is now evidence that the heat shock response contributes to establishing a cytoprotective state in a wide variety of human conditions, including inflammation, neurodegenerative disorders, and aging. Among the various heat shock proteins, heme oxygenase-1 has received considerable attention; it has been recently demonstrated that heme oxygenase-1 induction, by generating the vasoactive molecule carbon monoxide and the potent antioxidant bilirubin, could represent a protective system potentially active against brain oxidative injury. Acetyl-L-carnitine is proposed as a therapeutic agent for several neurodegenerative disorders. Accordingly, we report here that treatment of astrocytes with acetyl-L-carnitine induces heme oxygenase-1 in a dose- and time-dependent manner and that this effect was associated with up-regulation of heat shock protein 60 as well as high expression of the redox-sensitive transcription factor Nrf2 in the nuclear fraction of treated cells. In addition, we show that addition of acetyl-L-carnitine to astrocytes, prior to proinflammatory lipopolysaccharide- and interferon-gamma-induced nitrosative stress, prevents changes in mitochondrial respiratory chain complex activity, protein nitrosation and antioxidant status induced by inflammatory cytokine insult. Given the broad cytoprotective properties of the heat shock response, molecules inducing this defense mechanism appear to be possible candidates for novel cytoprotective strategies. Particularly, manipulation of endogenous cellular defense mechanisms via acetyl-L-carnitine may represent an innovative approach to therapeutic intervention in diseases causing tissue damage

  3. NADPH Oxidase 4 (Nox4) Suppresses Mitochondrial Biogenesis and Bioenergetics in Lung Fibroblasts via a Nuclear Factor Erythroid-derived 2-like 2 (Nrf2)-dependent Pathway.

    PubMed

    Bernard, Karen; Logsdon, Naomi J; Miguel, Veronica; Benavides, Gloria A; Zhang, Jianhua; Carter, A Brent; Darley-Usmar, Victor M; Thannickal, Victor J

    2017-02-17

    Mitochondrial bioenergetics are critical for cellular homeostasis and stress responses. The reactive oxygen species-generating enzyme, NADPH oxidase 4 (Nox4), regulates a number of physiological and pathological processes, including cellular differentiation, host defense, and tissue fibrosis. In this study we explored the role of constitutive Nox4 activity in regulating mitochondrial function. An increase in mitochondrial oxygen consumption and reserve capacity was observed in murine and human lung fibroblasts with genetic deficiency (or silencing) of Nox4. Inhibition of Nox4 expression/activity by genetic or pharmacological approaches resulted in stimulation of mitochondrial biogenesis, as evidenced by elevated mitochondrial-to-nuclear DNA ratio and increased expression of the mitochondrial markers transcription factor A (TFAM), citrate synthase, voltage-dependent anion channel (VDAC), and cytochrome c oxidase subunit 4 (COX IV). Induction of mitochondrial biogenesis was dependent on TFAM up-regulation but was independent of the activation of the peroxisome proliferator-activated receptor γ coactivator 1-α (PGC-1α). The enhancement of mitochondrial bioenergetics as well as the increase in mitochondrial proteins in Nox4-deficient lung fibroblasts is inhibited by silencing of nuclear factor erythroid-derived 2-like 2 (Nrf2), supporting a key role for Nrf2 in control of mitochondrial biogenesis. Together, these results indicate a critical role for both Nox4 and Nrf2 in counter-regulation of mitochondrial biogenesis and metabolism.

  4. Compensatory role of the Nrf2-ARE pathway against paraquat toxicity: Relevance of 26S proteasome activity.

    PubMed

    Izumi, Yasuhiko; Yamamoto, Noriyuki; Matsushima, Sayaka; Yamamoto, Takamori; Takada-Takatori, Yuki; Akaike, Akinori; Kume, Toshiaki

    2015-11-01

    Oxidative stress and the ubiquitin-proteasome system play a key role in the pathogenesis of Parkinson disease. Although the herbicide paraquat is an environmental factor that is involved in the etiology of Parkinson disease, the role of 26S proteasome in paraquat toxicity remains to be determined. Using PC12 cells overexpressing a fluorescent protein fused to the proteasome degradation signal, we report here that paraquat yielded an inhibitory effect on 26S proteasome activity without an obvious decline in 20S proteasome activity. Relative low concentrations of proteasome inhibitors caused the accumulation of nuclear factor erythroid 2-related factor 2 (Nrf2), which is targeted to the ubiquitin-proteasome system, and activated the antioxidant response element (ARE)-dependent transcription. Paraquat also upregulated the protein level of Nrf2 without increased expression of Nrf2 mRNA, and activated the Nrf2-ARE pathway. Consequently, paraquat induced expression of Nrf2-dependent ARE-driven genes, such as γ-glutamylcysteine synthetase, catalase, and hemeoxygenase-1. Knockdown of Nrf2 or inhibition of γ-glutamylcysteine synthetase and catalase exacerbated paraquat-induced toxicity, whereas suppression of hemeoxygenase-1 did not. These data indicate that the compensatory activation of the Nrf2-ARE pathway via inhibition of 26S proteasome serves as part of a cellular defense mechanism to protect against paraquat toxicity.

  5. Suppression of radiation-induced migration of non-small cell lung cancer through inhibition of Nrf2-Notch Axis.

    PubMed

    Zhao, Qiuyue; Mao, Aihong; Guo, Ruoshui; Zhang, Liping; Yan, Jiawei; Sun, Chao; Tang, Jinzhou; Ye, Yancheng; Zhang, Yanshan; Zhang, Hong

    2017-03-28

    Nuclear factor E2 related factor 2 (Nrf2) is a transcription factor that is associated with tumor growth and resistance to radiation. The canonical Notch signaling pathway is also crucial for maintaining non-small cell lung cancer (NSCLC). Aberrant Nrf2 and Notch signaling has repeatedly been showed to facilitate metastasis of NSCLC. Here, we show that radiation induce Nrf2 and Notch1 expression in NSCLC. Knockdown of Nrf2 enhanced radiosensitivity of NSCLC and reduced epithelial-to-mesenchymal transition. Importantly, we found that knockdown of Nrf2 dramatically decreased radiation-induced NSCLC invasion and significantly increased E-cadherin, but reduced N-cadherin and matrix metalloproteinase (MMP)-2/9 expression. We found that Notch1 knockdown also upregulated E-cadherin and suppressed N-cadherin expression. Nrf2 contributes to NSCLC cell metastatic properties and this inhibition correlated with reduced Notch1 expression. These results establish that Nrf2 and Notch1 downregulation synergistically inhibit radiation-induced migratory and invasive properties of NSCLC cells.

  6. Reactive Oxygen Species and Nuclear Factor Erythroid 2-Related Factor 2 Activation in Diabetic Nephropathy: A Hidden Target

    PubMed Central

    Abdo, Shaaban; Zhang, Shao-Ling; Chan, John S.D.

    2015-01-01

    Hyperglycemia, oxidative stress and renin-angiotensin system (RAS) dysfunction have been implicated in diabetic nephropathy (DN) progression, but the underlying molecular mechanisms are far from being fully understood. In addition to the systemic RAS, the existence of a local intrarenal RAS in renal proximal tubular cells has been recognized. Angiotensinogen is the sole precursor of all angiotensins (Ang). Intrarenal reactive oxygen species (ROS) generation, Ang II level and RAS gene expression are up-regulated in diabetes, indicating that intrarenal ROS and RAS activation play an important role in DN. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is one of the major protective processes that occurs in response to intracellular oxidative stress. Nrf2 stimulates an array of antioxidant enzymes that convert excessive ROS to less reactive or less damaging forms. Recent studies have, however, revealed that Nrf2 activation might have other undesirable effects in diabetic animals and in diabetic patients with chronic kidney disease. This mini-review summarizes current knowledge of the relationship between ROS, Nrf2 and intra renal RAS activation in DN progression as well as possible novel target(s) for DN treatment. PMID:26213634

  7. Chronic Activation of Hepatic Nrf2 Has No Major Effect on Fatty Acid and Glucose Metabolism in Adult Mice

    PubMed Central

    Winkel, Angelika F.; Polack, James; Tang, Hui; Brachs, Maria; Margerie, Daniel; Brunner, Bodo; Jahn-Hofmann, Kerstin; Ruetten, Hartmut; Spranger, Joachim; Schmoll, Dieter

    2016-01-01

    The transcription factor NF-E2-related factor 2 (Nrf2) induces cytoprotective genes, but has also been linked to the regulation of hepatic energy metabolism. In order to assess the pharmacological potential of hepatic Nrf2 activation in metabolic disease, Nrf2 was activated over 7 weeks in mice on Western diet using two different siRNAs against kelch-like ECH-associated protein 1 (Keap1), the inhibitory protein of Nrf2. Whole genome expression analysis followed by pathway analysis demonstrated successful knock-down of Keap1 expression and induction of Nrf2-dependent genes involved in anti-oxidative stress defense and biotransformation, proving the activation of Nrf2 by the siRNAs against Keap1. Neither the expression of fatty acid- nor carbohydrate-handling proteins was regulated by Keap1 knock-down. Metabolic profiling of the animals did also not show effects on plasma and hepatic lipids, energy expenditure or glucose tolerance. The data indicate that hepatic Keap1/Nrf2 is not a major regulator of glucose or lipid metabolism in mice. PMID:27814396

  8. Estrogen increases Nrf2 activity through activation of the PI3K pathway in MCF-7 breast cancer cells

    SciTech Connect

    Wu, Juanjuan; Williams, Devin; Walter, Grant A.; Thompson, Winston E.; Sidell, Neil

    2014-11-01

    The actions of the transcription factor Nuclear factor erythroid 2-related factor (Nrf2) in breast cancer have been shown to include both pro-oncogenic and anti-oncogenic activities which is influenced, at least in part, by the hormonal environment. However, direct regulation of Nrf2 by steroid hormones (estrogen and progesterone) has received only scant attention. Nrf2 is known to be regulated by its cytosolic binding protein, Kelch-like ECH-associated protein 1 (Keap1), and by a Keap1-independent mechanism involving a series of phosphorylation steps mediated by phosphatidylinositol 3-kinase (PI3K) and glycogen synthase kinase 3 beta (GSK3β). Here, we report that estrogen (E2) increases Nrf2 activity in MCF7 breast cancer cells through activation of the PI3K/GSK3β pathway. Utilizing antioxidant response element (ARE)-containing luciferase reporter constructs as read-outs for Nrf2 activity, our data indicated that E2 increased ARE activity >14-fold and enhanced the action of the Nrf2 activators, tertiary butylhydroquinone (tBHQ) and sulforaphane (Sul) 4 to 9 fold compared with cells treated with tBHQ or Sul as single agents. This activity was shown to be an estrogen receptor-mediated phenomenon and was antagonized by progesterone. In addition to its action on the reporter constructs, mRNA and protein levels of heme oxygenase 1, an endogenous target gene of Nrf2, was markedly upregulated by E2 both alone and in combination with tBHQ. Importantly, E2-induced Nrf2 activation was completely suppressed by the PI3K inhibitors LY294002 and Wortmannin while the GSK3β inhibitor CT99021 upregulated Nrf2 activity. Confirmation that E2 was, at least partly, acting through the PI3K/GSK3β pathway was indicated by our finding that E2 increased the phosphorylation status of both GSK3β and Akt, a well-characterized downstream target of PI3K. Together, these results demonstrate a novel mechanism by which E2 can regulate Nrf2 activity in estrogen receptor-positive breast cancer

  9. RETRACTED: S-allyl cysteine protects against 6-hydroxydopamine-induced neurotoxicity in the rat striatum: involvement of Nrf2 transcription factor activation and modulation of signaling kinase cascades.

    PubMed

    Tobón-Velasco, Julio César; Vázquez-Victorio, Genaro; Macías-Silva, Marina; Cuevas, Elvis; Ali, Syed F; Maldonado, Perla D; González-Trujano, María Eva; Cuadrado, Antonio; Pedraza-Chaverrí, José; Santamaría, Abel

    2012-09-01

    Pharmacological activation at the basal ganglia of the transcription factor Nrf2, guardian of redox homeostasis, holds a strong promise for the slow progression of Parkinson's disease (PD). However, a potent Nrf2 activator in the brain still must be found. In this study, we have investigated the potential use of the antioxidant compound S-allyl cysteine (SAC) in the activation of Nrf2 in 6-hydoxydopamine (6-OHDA)-intoxicated rats. In the rat striatum, SAC by itself promoted the Nrf2 dissociation of Keap-1, its nuclear translocation, the subsequent association with small MafK protein, and further binding of the Nrf2/MafK complex to ARE sequence, as well as the up-regulation of Nrf2-dependent genes encoding the antioxidant enzymes HO-1, NQO-1, GR, and SOD-1. In vivo and in vitro experiments to identify signaling pathways activated by SAC pointed to Akt as the most likely kinase participating in Nrf2 activation by SAC. In PC12 cells, SAC stimulated the activation of Akt and ERK1/2 and inhibited JNK1/2/3 activation. In the rat striatum, the SAC-induced activation of Nrf2 is likely to contribute to inhibit the toxic effects of 6-OHDA evidenced by phase 2 antioxidant enzymes up-regulation, glutathione recovery, and attenuation of reactive oxygen species (ROS), nitric oxide (NO), and lipid peroxides formation. These early protective effects correlated with the long-term preservation of the cellular redox status, the striatal dopamine (DA) and tyrosine hydroxylase (TH) levels, and the improvement of motor skills. Therefore, this study indicates that, in addition to direct scavenging actions, the activation of Nrf2 by SAC might confer neuroprotective responses through the modulation of kinase signaling pathways in rodent models of PD, and suggests that this antioxidant molecule may have a therapeutic value in this human pathology.

  10. The Keap1/Nrf2 Protein Axis Plays a Role in Osteoclast Differentiation by Regulating Intracellular Reactive Oxygen Species Signaling*

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kajiya, Mikihito; Kodama, Tetsuya

    2013-01-01

    Reactive oxygen species (ROS) act as intracellular signaling molecules in the regulation of receptor activator of nuclear factor-κB ligand (RANKL)-dependent osteoclast differentiation, but they also have cytotoxic effects that include peroxidation of lipids and oxidative damage to proteins and DNA. Cellular protective mechanisms against oxidative stress include transcriptional control of cytoprotective enzymes by the transcription factor, nuclear factor E2-related factor 2 (Nrf2). This study investigated the relationship between Nrf2 and osteoclastogenesis. Stimulation of osteoclast precursors (mouse primary peritoneal macrophages and RAW 264.7 cells) with RANKL resulted in the up-regulation of kelch-like ECH-associated protein 1 (Keap1), a negative regulator of Nrf2. It also decreased the Nrf2/Keap1 ratio, and it down-regulated cytoprotective enzymes (heme oxygenase-1, γ-glutamylcysteine synthetase, and glucose-6-phosphate dehydrogenase). Nrf2 overexpression up-regulated the expression of cytoprotective enzymes, decreased ROS levels, decreased the number of tartrate-resistant acid phosphatase-positive multinucleated cells, reduced marker genes for osteoclast differentiation, and attenuated bone destruction in both in vitro and in vivo models. Overexpression of Keap1 or RNAi knockdown of Nrf2 exerted the opposite actions. In addition, in vivo local Nrf2 overexpression attenuated lipopolysaccharide-mediated RANKL-dependent cranial bone destruction in vivo. This is the first study to show that the Keap1/Nrf2 axis regulates RANKL-dependent osteoclastogenesis through modulation of intracellular ROS signaling via expression of cytoprotective enzymes. This raises the exciting possibility that the Keap1-Nrf2 axis may be a therapeutic target for the treatment of bone destructive disease. PMID:23801334

  11. Electrophilic nitro-fatty acids prevent astrocyte-mediated toxicity to motor neurons in a cell model of familial amyotrophic lateral sclerosis via nuclear factor erythroid 2-related factor activation.

    PubMed

    Diaz-Amarilla, Pablo; Miquel, Ernesto; Trostchansky, Andrés; Trias, Emiliano; Ferreira, Ana M; Freeman, Bruce A; Cassina, Patricia; Barbeito, Luis; Vargas, Marcelo R; Rubbo, Homero

    2016-06-01

    Nitro-fatty acids (NO2-FA) are electrophilic signaling mediators formed in tissues during inflammation, which are able to induce pleiotropic cytoprotective and antioxidant pathways including up regulation of Nuclear factor erythroid 2-related factor 2 (Nrf2) responsive genes. Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease characterized by the loss of motor neurons associated to an inflammatory process that usually aggravates the disease progression. In ALS animal models, the activation of the transcription factor Nrf2 in astrocytes confers protection to neighboring neurons. It is currently unknown whether NO2-FA can exert protective activity in ALS through Nrf2 activation. Herein we demonstrate that nitro-arachidonic acid (NO2-AA) or nitro-oleic acid (NO2-OA) administrated to astrocytes expressing the ALS-linked hSOD1(G93A) induce antioxidant phase II enzyme expression through Nrf2 activation concomitant with increasing intracellular glutathione levels. Furthermore, treatment of hSOD1(G93A)-expressing astrocytes with NO2-FA prevented their toxicity to motor neurons. Transfection of siRNA targeted to Nrf2 mRNA supported the involvement of Nrf2 activation in NO2-FA-mediated protective effects. Our results show for the first time that NO2-FA induce a potent Nrf2-dependent antioxidant response in astrocytes capable of preventing motor neurons death in a culture model of ALS.

  12. S-allyl cysteine activates the Nrf2-dependent antioxidant response and protects neurons against ischemic injury in vitro and in vivo.

    PubMed

    Shi, Huanying; Jing, Xu; Wei, Xinbing; Perez, Ruth G; Ren, Manru; Zhang, Xiumei; Lou, Haiyan

    2015-04-01

    Stroke is a devastating clinical condition for which an effective neuroprotective treatment is currently unavailable. S-allyl cysteine (SAC), the most abundant organosulfur compound in aged garlic extract, has been reported to possess neuroprotective effects against stroke. However, the mechanisms underlying its beneficial effects remain poorly defined. The present study tests the hypothesis that SAC attenuates ischemic neuronal injury by activating the nuclear factor erythroid-2-related factor 2 (Nrf2)-dependent antioxidant response in both in vitro and in vivo models. Our findings demonstrate that SAC treatment resulted in an increase in Nrf2 protein levels and subsequent activation of antioxidant response element pathway genes in primary cultured neurons and mice. Exposure of primary neurons to SAC provided protection against oxygen and glucose deprivation-induced oxidative insults. In wild-type (Nrf2(+/+) ) mice, systemic administration of SAC attenuated middle cerebral artery occlusion-induced ischemic damage, a protective effect not observed in Nrf2 knockout (Nrf2(-/-) ) mice. Taken together, these findings provide the first evidence that activation of the Nrf2 antioxidant response by SAC is strongly associated with its neuroprotective effects against experimental stroke and suggest that targeting the Nrf2 pathway may provide therapeutic benefit for the treatment of stroke. The transcription factor Nrf2 is involved in cerebral ischemic disease and may be a promising target for the treatment of stroke. We provide novel evidence that SAC confers neuroprotection against ischemic stroke by activating the antioxidant Nrf2 signaling pathway. ARE, antioxidant response element; GCLC, glutathione cysteine ligase regulatory subunit; GCLM, glutathione cysteine ligase modulatory subunit; HO-1, heme oxygenase-1; JNK, c-Jun N-terminal kinase; Keap1, Kelch-like ECH-associated protein 1; Maf, musculoaponeurotic fibrosarcoma; Nrf2, nuclear factor erythroid-2-related factor 2

  13. Nrf2 regulates mass accrual and the antioxidant endogenous response in bone differently depending on the sex and age

    PubMed Central

    Pellegrini, Gretel Gisela; Cregor, Meloney; McAndrews, Kevin; Morales, Cynthya Carolina; McCabe, Linda Doyle; McCabe, George P.; Peacock, Munro; Burr, David; Weaver, Connie; Bellido, Teresita

    2017-01-01

    Accumulation of reactive oxygen species (ROS) is an important pathogenic mechanism underling the loss of bone mass and strength with aging and other conditions leading to osteoporosis. The transcription factor erythroid 2-related factor2 (Nrf2) plays a central role in activating the cellular response to ROS. Here, we examined the endogenous response of bone regulated by Nrf2, and its relationship with bone mass and architecture in the male and female murine skeleton. Young (3 month-old) and old (15 month-old) Nrf2 knockout (KO) mice of either sex exhibited the expected reduction in Nrf2 mRNA expression compared to wild type (WT) littermates. Nrf2 deletion did not lead to compensatory increase in Nrf1 or Nrf3, other members of this transcription factor family; and instead, Nrf1 expression was lower in KO mice. Compared to the respective WT littermate controls, female KO mice, young and old, exhibited lower expression of both detoxifying and antioxidant enzymes; young male KO mice, displayed lower expression of detoxifying enzymes but not antioxidant enzymes; and old male KO mice showed no differences in either detoxifying or antioxidant enzymes. Moreover, old male WT mice exhibited lower Nrf2 levels, and consequently lower expression of both detoxifying and antioxidant enzymes, compared to old female WT mice. These endogenous antioxidant responses lead to delayed rate of bone acquisition in female KO mice and higher bone acquisition in male KO mice as quantified by DXA and μCT, demonstrating that Nrf2 is required for full bone accrual in the female skeleton but unnecessary and even detrimental in the male skeleton. Therefore, Nrf2 regulates the antioxidant endogenous response and bone accrual differently depending on sex and age. These findings suggest that therapeutic interventions that target Nrf2 could be developed to enhance the endogenous antioxidant response in a sex- and age-selective manner. PMID:28152064

  14. Nrf2 and Notch Signaling in Lung Cancer: Near the Crossroad

    PubMed Central

    Sparaneo, Angelo; Fabrizio, Federico Pio

    2016-01-01

    The transcription factor Nrf2 (NF-E2 related factor 2) is a master regulator of the cell antioxidant response associated with tumor growth and resistance to cytotoxic treatments. In particular, Nrf2 induces upregulation of cytoprotective genes by interacting with the closely situated AREs (Antioxidant Response Elements) in response to endogenous or exogenous stress stimuli and takes part to several oncogenic signaling pathways. Among these, the crosstalk with Notch pathway has been shown to enhance cytoprotection and maintenance of cellular homeostasis, tissue organization by modulating cell proliferation kinetics, and stem cell self-renewal in several organs. The role of Notch and Nrf2 related pathways in tumorigenesis is highly variable and when they are both abnormally activated they can synergistically cause neoplastic proliferation by promoting cell survival, differentiation, invasion, and metastases. NFE2L2, KEAP1, and NOTCH genes family appear in the list of significantly mutated genes in tumors in both combined and individual sets, supporting the crucial role that the aberrant Nrf2-Notch crosstalk might have in cancerogenesis. In this review, we summarize current knowledge about the alterations of Nrf2 and Notch pathways and their reciprocal transcriptional regulation throughout tumorigenesis and progression of lung tumors, supporting the potentiality of putative biomarkers and therapeutic targets. PMID:27847554

  15. Structure activity relationship of phenolic diterpenes from Salvia officinalis as activators of the nuclear factor E2-related factor 2 pathway.

    PubMed

    Fischedick, Justin T; Standiford, Miranda; Johnson, Delinda A; Johnson, Jeffrey A

    2013-05-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor known to activate cytoprotective genes which may be useful in the treatment of neurodegenerative disease. In order to better understand the structure activity relationship of phenolic diterpenes from Salvia officinalis L., we isolated carnosic acid, carnosol, epirosmanol, rosmanol, 12-methoxy-carnosic acid, sageone, and carnosaldehyde using polyamide column, centrifugal partition chromatography, and semi-preparative high performance liquid chromatography. Isolated compounds were screened in vitro for their ability to active the Nrf2 and general cellular toxicity using mouse primary cortical cultures. All compounds except 12-methoxy-carnosic acid were able to activate the antioxidant response element. Furthermore both carnosol and carnoasldehyde were able to induce Nrf2-dependent gene expression as well as protect mouse primary cortical neuronal cultures from H(2)O(2) induced cell death.

  16. Sulforaphane Ameliorates Okadaic Acid-Induced Memory Impairment in Rats by Activating the Nrf2/HO-1 Antioxidant Pathway.

    PubMed

    Dwivedi, Subhash; Rajasekar, N; Hanif, Kashif; Nath, Chandishwar; Shukla, Rakesh

    2016-10-01

    Okadaic acid (OKA) causes memory impairment and attenuates nuclear factor erythroid 2-related factor 2 (Nrf2) along with oxidative stress and neuroinflammation in rats. Sulforaphane (dietary isothiocyanate compound), an activator of Nrf2 signaling, exhibits neuroprotective effects. However, the protective effect of sulforaphane in OKA-induced neurotoxicity remains uninvestigated. Therefore, in the present study, the role of sulforaphane in OKA-induced memory impairment in rats was explored. A significant increased Nrf2 expression in the hippocampus and cerebral cortex was observed in trained (Morris water maze) rats, and a significant decreased Nrf2 expression in memory-impaired (OKA, 200 ng icv) rats indicated its involvement in memory function. Sulforaphane administration (5 and 10 mg/kg, ip, days 1 and 2) ameliorates OKA-induced memory impairment in rats. The treatment also restored Nrf2 and its downstream antioxidant protein expression (GCLC, HO-1) and attenuated oxidative stress (ROS, nitrite, GSH), neuroinflammation (NF-κB, TNF-α, IL-10), and neuronal apoptosis in the cerebral cortex and hippocampus of OKA-treated rats. Further, to determine whether modulation of Nrf2 signaling is responsible for the protective effect of sulforaphane, in vitro, Nrf2 siRNA and its downstream HO-1 inhibition studies were carried out in a rat astrocytoma cell line (C6). The protective effects of sulforaphane were abolished with Nrf2 siRNA and HO-1 inhibition in astrocytes. The results suggest that Nrf2-dependent activation of cellular antioxidant machinery results in sulforaphane-mediated protection against OKA-induced memory impairment in rats. Graphical Abstract ᅟ.

  17. Neuroprotective effects of the drug GVT (monosodium luminol) are mediated by the stabilization of Nrf2 in astrocytes.

    PubMed

    Reddy, Pichili Vijaya Bhaskar; Lungu, Gina; Kuang, Xianghong; Stoica, George; Wong, Paul K Y

    2010-01-01

    Oxidative stress is implicated in various kinds of neurological disorders, including human immunodeficiency virus (HIV) associated dementia (HAD). Our laboratory has been studying the murine retrovirus ts1, a pathogenic mutant of the Moloney murine leukemia virus (MoMuLV), as a model for HAD. Like HIV in humans, ts1 induces oxidative stress and progressive neurodegeneration in mice. We have shown previously that an antioxidant and anti-inflammatory drug GVT or MSL (monosodium luminol) suppresses ts1-induced oxidative stress, attenuates the development of spongiform encephalopathy, and delays hind limb paralysis in infected mice. It is known that upregulation of the nuclear transcription factor NF-E2-related factor 2 (Nrf2) is involved in upregulating cellular antioxidant defenses. Since Nrf2 is associated with elevation of antioxidant defenses in general, and since GVT suppresses ts1-induced neurodegeneration, our aim in this study was to determine whether GVT neuroprotection is linked to Nrf2 upregulation in the brain. We report here that GVT upregulates the levels of Nrf2, both in primary astrocyte cultures and in brainstem of ts1-infected mice. Significant upregulation of Nrf2 expression by GVT occurs in both the cytosolic and nuclear fractions of cultured astrocytes and brainstem cells. Notably, although GVT treatment increases Nrf2 protein levels in cultured astrocytes and brainstem tissues, Nrf2 mRNA levels are not altered. This suggests that the neuroprotective effects of GVT may be mediated by the stabilization of the Nrf2 protein, allowing continuous upregulation of Nrf2 levels in the astrocytes.

  18. A Curcumin Derivative That Inhibits Vinyl Carbamate-Induced Lung Carcinogenesis via Activation of the Nrf2 Protective Response

    PubMed Central

    Shen, Tao; Jiang, Tao; Long, Min; Chen, Jun; Ren, Dong-Mei; Wong, Pak Kin

    2015-01-01

    Abstract Aims: Lung cancer has a high worldwide morbidity and mortality. The employment of chemopreventive agents is effective to reduce lung cancer. Nuclear factor erythroid 2-related factor 2 (Nrf2) mitigates insults from both exogenous and endogenous sources and thus has been verified as a target for chemoprevention. Curcumin has long been recognized as a chemopreventive agent, but poor bioavailability and weak Nrf2 induction have prohibited clinical application. Thus, we have developed new curcumin derivatives and tested their Nrf2 induction. Results: Based on curcumin, we synthesized curcumin analogs with five carbon linkages and established a structure–activity relationship for Nrf2 induction. Among these derivatives, bis[2-hydroxybenzylidene]acetone (BHBA) was one of the most potent Nrf2 inducers with minimal toxicity and improved pharmacological properties and was thus selected for further investigation. BHBA activated the Nrf2 pathway in the canonical Keap1-Cys151-dependent manner. Furthermore, BHBA was able to protect human lung epithelial cells against sodium arsenite [As(III)]-induced cytotoxicity. More importantly, in an in vivo vinyl carbamate-induced lung cancer model in A/J mice, preadministration of BHBA significantly reduced lung adenocarcinoma, while curcumin failed to show any effects even at high doses. Innovation: The curcumin derivative, BHBA, is a potent inducer of Nrf2. It was demonstrated to protect against As(III) toxicity in lung epithelial cells in an Nrf2-dependent manner. Furthermore, compared with curcumin, BHBA displayed improved chemopreventive activities in a carcinogen-induced lung cancer model. Conclusion: Taken together, our results demonstrate that BHBA, a curcumin analog with improved Nrf2-activating and chemopreventive activities both in vitro and in vivo, could be developed into a chemoprotective pharmacological agent. Antioxid. Redox Signal. 23, 651–664. PMID:25891177

  19. Toxico-pharmacological perspective of the Nrf2-Keap1 defense system against oxidative stress in kidney diseases.

    PubMed

    Saito, Hideyuki

    2013-04-01

    Oxidative stress, including the generation of reactive oxygen species (ROS), appears to be responsible for the high incidence of cardiovascular events in patients with chronic kidney disease (CKD), and for the progression of CKD to end-stage renal disease. The processes for oxidative stress include increased generation and decreased elimination of ROS that could be caused by an impaired antioxidant defense system. Nuclear factor-erythroid-2-related factor 2 (Nrf2) helps protect the kidney against oxidative stress by playing a pivotal role in the cooperative induction of genes that encode antioxidant and detoxifying enzymes. Nrf2 is confined to the cytoplasm as an inactive complex bound to a repressor Kelch-like ECH-associated protein 1 (Keap1), which facilitates ubiquitination of Nrf2. Studies using CKD model animals showed that despite stimulated oxidative stress the nuclear Nrf2 level was suppressed, which led to downregulation of the antioxidant enzymes. Hence, deterioration in Nrf2-Keap1 signaling could contribute to the severity of oxidative stress and the progression of CKD. By contrast, acute kidney injury (AKI) induces activation of renal Nrf2. Nrf2 activators or its proteasomal degradation inhibitors enhance nuclear Nrf2 translocation, inducing potential renoprotective actions against CKD and AKI. In both chronic and acute kidney diseases, sulfate-conjugated uremic toxins appear to enhance ROS production when accumulated in renal cells. An intestinal indole adsorbent ameliorates the progression of CKD by decreasing accumulation of indoxyl sulfate. Therapeutic approaches to prevent oxidative stress via activation of the Nrf2-Keap1 signaling and/or suppression of uremic toxin-induced ROS production could be effective strategies for maintaining kidney function.

  20. A role for Nrf2 in UVA-mediated heme oxygenase induction and protection from membrane damage in human skin fibroblasts

    NASA Astrophysics Data System (ADS)

    Li, Haibin; Li, Linhao; Deng, Linhong; Singh, Gurinder; Tyrrell, Rex M.; Zhong, J. Li

    2010-11-01

    Our previous study has shown that Ultraviolet-A (UVA) irradiation induces heme oxygenase 1 (HO-1) expression in cultured human primary skin fibroblasts FEK4. In the present study, we demonstrate a coordinated induction of HO-1 and NF-E2-related factor 2 (Nrf2) following UVA irradiation or hemin treatment. The induction of HO-1 by either UVA irradiation or hemin treatment was largely abolished by down-regulation of Nrf2 with its targeted short interfering RNA (siNrf2). The study further reveals that knockdown of Nrf2 protein increased UVA-induced cell death measured by MTS assay. These findings together indicate that Nrf2-mediated induction of HO-1 expression may provide a cytoprotection for human skin cells from oxidative damage.

  1. Development of Neh2-Luciferase Reporter and Its Application for High Throughput Screening and Real-Time Monitoring of Nrf2 Activators

    PubMed Central

    Smirnova, Natalya A.; Haskew-Layton, Renee E.; Basso, Manuela; Hushpulian, Dmitry M.; Payappilly, Jimmy B.; Speer, Rachel E.; Ahn, Young-Hoon; Rakhman, Ilay; Cole, Philip A.; Pinto, John T.; Ratan, Rajiv R.; Gazaryan, Irina G.

    2011-01-01

    SUMMARY The NF-E2-related factor 2 (Nrf2) is a key transcriptional regulator of antioxidant defense and detoxification. To directly monitor stabilization of Nrf2, we fused its Neh2 domain, responsible for the interaction with its nucleocytoplasmic regulator, Keap1, to firefly luciferase (Neh2-luciferase). We show that Neh2 domain is sufficient for recognition, ubiquitination, and proteasomal degradation of Neh2-luciferase fusion protein. The Neh2-luc reporter system allows direct monitoring of the adaptive response to redox stress and classification of drugs based on the time course of reporter activation. The reporter was used to screen the Spectrum library of 2000 biologically active compounds to identify activators of Nrf2. The most robust and yet nontoxic Nrf2 activators found—nordihydroguaiaretic acid, fisetin, and gedunin—induced astrocyte-dependent neuroprotection from oxidative stress via an Nrf2-dependent mechanism. PMID:21700211

  2. Absence of Nrf2 or Its Selective Overexpression in Neurons and Muscle Does Not Affect Survival in ALS-Linked Mutant hSOD1 Mouse Models

    PubMed Central

    Vargas, Marcelo R.; Burton, Neal C.; Gan, Li; Johnson, Delinda A.; Schäfer, Matthias; Werner, Sabine; Johnson, Jeffrey A.

    2013-01-01

    The nuclear factor erythroid 2-related factor 2 (Nrf2) governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1) cause familial forms of amyotrophic lateral sclerosis (ALS), a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1G93A mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS. PMID:23418589

  3. Regulation of Nrf2 signaling and longevity in naturally long-lived rodents.

    PubMed

    Lewis, Kaitlyn N; Wason, Emily; Edrey, Yael H; Kristan, Deborah M; Nevo, Eviatar; Buffenstein, Rochelle

    2015-03-24

    The preternaturally long-lived naked mole-rat, like other long-lived species and experimental models of extended longevity, is resistant to both endogenous (e.g., reactive oxygen species) and environmental stressors and also resists age-related diseases such as cancer, cardiovascular disease, and neurodegeneration. The mechanisms behind the universal resilience of longer-lived organisms to stress, however, remain elusive. We hypothesize that this resilience is linked to the activity of a highly conserved transcription factor, nuclear factor erythroid 2-related factor (Nrf2). Nrf2 regulates the transcription of several hundred cytoprotective molecules, including antioxidants, detoxicants, and molecular chaperones (heat shock proteins). Nrf2 itself is tightly regulated by mechanisms that either promote its activity or increase its degradation. We used a comparative approach and examined Nrf2-signaling activity in naked mole-rats and nine other rodent species with varying maximum lifespan potential (MLSP). We found that constitutive Nrf2-signaling activity was positively correlated (P = 0.0285) with MLSP and that this activity was also manifested in high levels of downstream gene expression and activity. Surprisingly, we found that species longevity was not linked to the protein levels of Nrf2 itself, but rather showed a significant (P < 0.01) negative relationship with the regulators Kelch-like ECH-Associated Protein 1 (Keap1) and β-transducin repeat-containing protein (βTrCP), which target Nrf2 for degradation. These findings highlight the use of a comparative biology approach for the identification of evolved mechanisms that contribute to health span, aging, and longevity.

  4. Enhanced muscle nutrient content and flesh quality, resulting from tryptophan, is associated with anti-oxidative damage referred to the Nrf2 and TOR signalling factors in young grass carp (Ctenopharyngodon idella): Avoid tryptophan deficiency or excess.

    PubMed

    Jiang, Wei-Dan; Wen, Hai-Lang; Liu, Yang; Jiang, Jun; Wu, Pei; Zhao, Juan; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu; Feng, Lin

    2016-05-15

    Flesh quality, muscle antioxidant status and related signalling molecule expressions were investigated in young grass carp fed six levels of tryptophan (Trp) for 8 weeks. The results indicated that fish fed 0.7 (deficiency) and 6.1g Trp g/kg (excess) diets exhibited lower muscle water-holding capacity, tenderness, cathepsin activity, protein levels, lipids and collagen contents. Optimal Trp reversed these negative effects, which were related to enhanced glutathione (GSH) content and glutathione peroxidase (GPx) activities regulated at gene transcription levels, rather than to superoxide dismutase (SOD) or catalase (CAT). The expression of signalling molecules [Kelch-like ECH-associated protein 1, target of rapamycin (TOR) and ribosomal S6 protein kinase 1] involved in the NF-E2-related factor 2 (Nrf2) pathway revealed a potential method of Trp-enhanced antioxidant defence. Collectively, the present study indicated that appropriate Trp levels improved flesh quality partly related to the enhancement of antioxidant ability through Nrf2 and TOR signalling.

  5. Modulation of mitochondrial dysfunction in neurodegenerative diseases via activation of nuclear factor erythroid-2-related factor 2 by food-derived compounds.

    PubMed

    Denzer, Isabel; Münch, Gerald; Friedland, Kristina

    2016-01-01

    Oxidative stress and mitochondrial dysfunction are early events in the pathogenesis of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and amyotrophic lateral sclerosis (ALS). Mitochondria are important key players in cellular function based on mitochondrial energy production and their major role in cell physiology. Since neurons are highly depending on mitochondrial energy production due to their high energy demand and their reduced glycolytic capacity mitochondrial dysfunction has fatal consequences for neuronal function and survival. The transcription factor nuclear factor erythroid-2-related factor 2 (Nrf2) is the major regulator of cellular response to oxidative stress. Activation of Nrf2 induces the transcriptional regulation of antioxidant response element (ARE)-dependent expression of a battery of cytoprotective and antioxidant enzymes and proteins. Moreover, activation of Nrf2 protects mitochondria from dysfunction and promotes mitochondrial biogenesis. Therefore, the Nrf2/ARE pathway has become an attractive target for the prevention and treatment of oxidative stress-related neurodegenerative diseases. Small food-derived inducers of the Nrf2/ARE pathway including l-sulforaphane from broccoli and isoliquiritigenin from licorice displayed promising protection of mitochondrial function in models of oxidative stress and neurodegenerative diseases and represent a novel approach to prevent and treat aging-associated neurodegenerative diseases.

  6. Halofuginone enhances the chemo-sensitivity of cancer cells by suppressing NRF2 accumulation.

    PubMed

    Tsuchida, Kouhei; Tsujita, Tadayuki; Hayashi, Makiko; Ojima, Asaka; Keleku-Lukwete, Nadine; Katsuoka, Fumiki; Otsuki, Akihito; Kikuchi, Haruhisa; Oshima, Yoshiteru; Suzuki, Mikiko; Yamamoto, Masayuki

    2017-02-01

    The KEAP1-NRF2 system regulates the cellular defence against oxidative and xenobiotic stresses. NRF2 is a transcription factor that activates the expression of cytoprotective genes encoding antioxidative, detoxifying and metabolic enzymes as well as transporters. Under normal conditions, KEAP1 represses NRF2 activity by degrading the NRF2 protein. When cells are exposed to stresses, KEAP1 stops promoting NRF2 degradation, and NRF2 rapidly accumulates and activates the transcription of target genes. Constitutive accumulation of NRF2 via a variety of mechanisms that disrupt KEAP1-mediated NRF2 degradation has been observed in various cancer types. Constitutive NRF2 accumulation confers cancer cells with a proliferative advantage as well as resistance to anti-cancer drugs and radiotherapies. To suppress the chemo- and radio-resistance of cancer cells caused by NRF2 accumulation, we conducted high-throughput chemical library screening for NRF2 inhibitors and identified febrifugine derivatives. We found that application of the less-toxic derivative halofuginone in a low dose range rapidly reduced NRF2 protein levels. Halofuginone induced a cellular amino acid starvation response that repressed global protein synthesis and rapidly depleted NRF2. Halofuginone treatment ameliorated the resistance of NRF2-addicted cancer cells to anti-cancer drugs both in vitro and in vivo. These results provide preclinical proof-of-concept evidence for halofuginone as an NRF2 inhibitor applicable to treatment of chemo- and radio-resistant forms of cancer.

  7. Role of Nrf2 signaling pathway in the radiation tolerance of patients with head and neck squamous cell carcinoma: an in vivo and in vitro study

    PubMed Central

    Wang, Tao; Hu, Peng; Li, Bo; Zhang, Jun-Peng; Cheng, Yu-Feng; Liang, Ye-Min

    2017-01-01

    We aimed to investigate the relationship between the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway and the radiation tolerance of patients with head and neck squamous cell carcinoma (HNSCC). From January 2015 to January 2016, 117 patients with HNSCC were enrolled in our study and assigned into the sensitive and tolerance groups based on curative effect. Immunohistochemistry (IHC) was conducted to measure protein expressions of Nrf2, heme oxygenase-1 (HO1), NADPH quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST). Human squamous cell carcinoma cell line, HSC-4, was induced by radiation to construct the HSC-4-radiation resistance (RR) cell line. HSC-4 and HSC-4-RR were also assigned into the blank, negative control (NC) and Nrf2 siRNA groups. Cell Counting Kit-8 (CCK-8), quantitative real-time polymerase chain reaction (qRT-PCR) and Western blotting were employed to detect cell viability, mRNA expression and protein expression, respectively, of Nrf2, HO1, NQO1 and GST. A total of 40 nude mice were equally assigned into the untreated, Nrf2 siRNA, radiation therapy (RT) and RT + Nrf2 siRNA groups. Compared with the sensitive group, patients in the tolerance group had upregulated Nrf2, HO1, NQO1 and GST expressions. HSC-4-RR cell line had improved cell viability and higher protein and mRNA expressions of Nrf2, HO1, NQO1 and GST compared with HSC-4 cell line. Compared with the HSC-4-NC and HSC-4-blank groups, the HSC-4-Nrf2 siRNA group had downregulated cell viability. Compared with the HSC-4-RR-NC and HSC-4-RR-blank groups, the HSC-4-RR-Nrf2 siRNA group had lower cell viability. However, the HSC-4-RR-Nrf2 siRNA group had elevated cell viability than the HSC-4-Nrf2 siRNA group. Tumor volume and tumor weight in the RT and RT + Nrf2 siRNA groups decreased evidently. The RT + Nrf2 siRNA group exhibited decreased tumor volume and tumor weight in comparison with the RT group. Our data demonstrated that downregulation of HO1, NQO1 and

  8. Role of Nrf2 signaling pathway in the radiation tolerance of patients with head and neck squamous cell carcinoma: an in vivo and in vitro study.

    PubMed

    Wang, Tao; Hu, Peng; Li, Bo; Zhang, Jun-Peng; Cheng, Yu-Feng; Liang, Ye-Min

    2017-01-01

    We aimed to investigate the relationship between the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway and the radiation tolerance of patients with head and neck squamous cell carcinoma (HNSCC). From January 2015 to January 2016, 117 patients with HNSCC were enrolled in our study and assigned into the sensitive and tolerance groups based on curative effect. Immunohistochemistry (IHC) was conducted to measure protein expressions of Nrf2, heme oxygenase-1 (HO1), NADPH quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST). Human squamous cell carcinoma cell line, HSC-4, was induced by radiation to construct the HSC-4-radiation resistance (RR) cell line. HSC-4 and HSC-4-RR were also assigned into the blank, negative control (NC) and Nrf2 siRNA groups. Cell Counting Kit-8 (CCK-8), quantitative real-time polymerase chain reaction (qRT-PCR) and Western blotting were employed to detect cell viability, mRNA expression and protein expression, respectively, of Nrf2, HO1, NQO1 and GST. A total of 40 nude mice were equally assigned into the untreated, Nrf2 siRNA, radiation therapy (RT) and RT + Nrf2 siRNA groups. Compared with the sensitive group, patients in the tolerance group had upregulated Nrf2, HO1, NQO1 and GST expressions. HSC-4-RR cell line had improved cell viability and higher protein and mRNA expressions of Nrf2, HO1, NQO1 and GST compared with HSC-4 cell line. Compared with the HSC-4-NC and HSC-4-blank groups, the HSC-4-Nrf2 siRNA group had downregulated cell viability. Compared with the HSC-4-RR-NC and HSC-4-RR-blank groups, the HSC-4-RR-Nrf2 siRNA group had lower cell viability. However, the HSC-4-RR-Nrf2 siRNA group had elevated cell viability than the HSC-4-Nrf2 siRNA group. Tumor volume and tumor weight in the RT and RT + Nrf2 siRNA groups decreased evidently. The RT + Nrf2 siRNA group exhibited decreased tumor volume and tumor weight in comparison with the RT group. Our data demonstrated that downregulation of HO1, NQO1 and

  9. Role of the Nrf2-heme oxygenase-1 pathway in silver nanoparticle-mediated cytotoxicity

    SciTech Connect

    Kang, Su Jin; Ryoo, In-geun; Lee, Young Joon; Kwak, Mi-Kyoung

    2012-01-01

    Silver nanoparticles (nano-Ag) have been widely used in various commercial products including textiles, electronic appliances and biomedical products. However, there remains insufficient information on the potential risk of nano-Ag to human health and environment. In the current study, we have investigated the role of NF-E2-related factor 2 (Nrf2) transcription factor in nano-Ag-induced cytotoxicity. When Nrf2 expression was blocked using interring RNA expression in ovarian carcinoma cell line, nano-Ag treatment showed a substantial decrease in cell viability with concomitant increases in apoptosis and DNA damage compared to the control cells. Target gene analysis revealed that the expression of heme oxygenase-1 (HO-1) was highly elevated by nano-Ag in nonspecific shRNA expressing cells, while Nrf2 knockdown cells (NRF2i) did not increase HO-1 expression. The role of HO-1 in cytoprotection against nano-Ag was reinforced by results using pharmacological inducer of HO-1: cobalt protoporphyrin-mediated HO-1 activation in the NRF2i cells prevented nano-Ag-mediated cell death. Similarly, pharmacological or genetic inhibition of HO-1 in nonspecific control cells exacerbated nano-Ag toxicity. As the upstream signaling mechanism, nano-Ag required the phosphoinositide 3-kinase (PI3K) and p38MAPK signaling cascades for HO-1 induction. The treatment with either PI3K inhibitor or p38MAPK inhibitor suppressed HO-1 induction and intensified nano-Ag-induced cell death. Taken together, these results suggest that Nrf2-dependent HO-1 up-regulation plays a protective role in nano-Ag-induced DNA damage and consequent cell death. In addition, nano-Ag-mediated HO-1 induction is associated with the PI3K and p38MAPK signaling pathways. -- Highlights: ► Role of Nrf2 signaling in silver nanoparticle toxicity. ► Silver nanoparticle toxicity is increased by Nrf2 blockade. ► Nrf2-dependent HO-1 induction protects cells from silver nanoparticle toxicity. ► PI3K and p38MAPK cascades are

  10. Nrf2 activation attenuates both orthodontic tooth movement and relapse.

    PubMed

    Kanzaki, H; Shinohara, F; Itohiya-Kasuya, K; Ishikawa, M; Nakamura, Y

    2015-06-01

    During orthodontic tooth movement, osteoclasts resorb the alveolar bone at the compress side of periodontium. Reactive oxygen species (ROS) works as intracellular signaling molecules of RANKL during osteoclastogenesis, although ROS has cytotoxicity against cells such as lipid oxidation. To deal with oxidative stress, cells have a defense system that is scavenging ROS by augmented antioxidative stress enzymes via transcriptional regulation with nuclear factor E2-related factor 2 (Nrf2). Previously, we reported that augmented antioxidative stress enzymes by Nrf2-gene transfer inhibited bone destruction. In the present study, we examined the effects of Nrf2 activation on osteoclastogenesis and, thereby, orthodontic tooth movement and orthodontic relapse. Mouse macrophage cell line RAW264.7 cells were used as osteoclast progenitor cells and stimulated with recombinant RANKL (100 ng/mL) with or without Nrf2 activator sulforaphane (SFN) and epigallocatechin gallate (EGCG) or ROS scavenger catechin. Osteoclastogenesis, resorption activity, and osteoclast marker gene expression were examined. Intracellular ROS was analyzed by flow cytometry. Maxillary first molars of C57BL6 male mice were moved palatally with 0.012-inch NiTi wire (100-mN force); SFN or EGCG was injected into the palatal gingiva once a week; and phosphate buffered saline was injected on the contralateral side. Tooth movement was monitored using a stone model with precise impression, and the amount of the tooth movement was compared among groups. SFN and EGCG significantly, but catechin weakly, inhibited RANKL-mediated osteoclastogenesis in vitro. Western blot analysis revealed that SFN and EGCG augmented the nuclear translocation of Nrf2 and the expression of anti-oxidative stress enzymes such as HO-1, although catechin did not. SFN and EGCG significantly, but catechin weakly, attenuated the intracellular ROS. Finally, animal experiment revealed that both SFN and EGCG successfully inhibited the orthodontic

  11. Activation of nuclear factor erythroid 2-related factor 2 coordinates dimethylarginine dimethylaminohydrolase/PPAR-γ/endothelial nitric oxide synthase pathways that enhance nitric oxide generation in human glomerular endothelial cells.

    PubMed

    Luo, Zaiming; Aslam, Shakil; Welch, William J; Wilcox, Christopher S

    2015-04-01

    Dimethylarginine dimethylaminohydrolase (DDAH) degrades asymmetric dimethylarginine, which inhibits nitric oxide (NO) synthase (NOS). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that binds to antioxidant response elements and transcribes many antioxidant genes. Because the promoters of the human DDAH-1 and DDAH-2, endothelial NOS (eNOS) and PPAR-γ genes contain 2 to 3 putative antioxidant response elements, we hypothesized that they were regulated by Nrf2/antioxidant response element. Incubation of human renal glomerular endothelial cells with the Nrf2 activator tert-butylhydroquinone (20 μmol·L(-1)) significantly (P<0.05) increased NO and activities of NOS and DDAH and decreased asymmetric dimethylarginine. It upregulated genes for hemoxygenase-1, eNOS, DDAH-1, DDAH-2, and PPAR-γ and partitioned Nrf2 into the nucleus. Knockdown of Nrf2 abolished these effects. Nrf2 bound to one antioxidant response element on DDAH-1 and DDAH-2 and PPAR-γ promoters but not to the eNOS promoter. An increased eNOS and phosphorylated eNOS (P-eNOSser-1177) expression with tert-butylhydroquinone was prevented by knockdown of PPAR-γ. Expression of Nrf2 was reduced by knockdown of PPAR-γ, whereas PPAR-γ was reduced by knockdown of Nrf2, thereby demonstrating 2-way positive interactions. Thus, Nrf2 transcribes HO-1 and other genes to reduce reactive oxygen species, and DDAH-1 and DDAH-2 to reduce asymmetric dimethylarginine and PPAR-γ to increase eNOS and its phosphorylation and activity thereby coordinating 3 pathways that enhance endothelial NO generation.

  12. Inorganic Arsenic Induces NRF2-Regulated Antioxidant Defenses in Both Cerebral Cortex and Hippocampus in Vivo.

    PubMed

    Zhang, Yang; Duan, Xiaoxu; Li, Jinlong; Zhao, Shuo; Li, Wei; Zhao, Lu; Li, Wei; Nie, Huifang; Sun, Guifang; Li, Bing

    2016-08-01

    Inorganic arsenic is reported to induce the reactive oxygen species-mediated oxidative stress, which is supposed to be one of the main mechanisms of arsenic-related neurological diseases. Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of antioxidant defense systems, up-regulates the expression of target genes to fight against oxidative damages caused by harmful substances, including metals. In the present study, mice were used as a model to investigate the oxidative stress levels and the expressions of NRF2-regulated antioxidant substances in both cerebral cortex and hippocampus with 5, 10 and 20 mg/kg NaAsO2 exposure intra-gastrically. Our results showed that acute NaAsO2 treatment resulted in decreased total anti-oxidative capacity (T-AOC) and increased maleic dialdehyde production in the nervous system. We also detected rapidly elevation of NRF2 protein levels by enhancement of Nrf2 transcription, especially at 20 mg/kg NaAsO2 exposure group. In the meantime, mRNA and protein levels of Nrf2 encoding antioxidant enzymes heme oxygenase-1 (HO-1), NAD(P)H: quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) were consistently elevated time- and dose-dependently both in the cerebral cortex and hippocampus. Taken together, the presence study demonstrated the activation of NRF2 pathway, an early antioxidant defensive response, in both cerebral cortex and hippocampus upon inorganic arsenic (iAs) exposure in vivo. A better knowledge on the roles of NRF2 pathway in maintaining cellular redox homeostasis would be helpful for the strategies on improvement of neurotoxicity related to this metalloid.

  13. Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo

    SciTech Connect

    Chian, Song; Thapa, Ruby; Chi, Zhexu; Wang, Xiu Jun; Tang, Xiuwen

    2014-05-16

    Highlights: • Luteolin inhibits the Nrf2 pathway in mouse liver and in xenografted tumors. • Luteolin markedly inhibits the growth of xenograft tumors. • Luteolin enhances the anti-cancer effect of cisplatin in mice in vivo. • Luteolin could serve as an adjuvant in the chemotherapy of NSCLC. - Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) is over-expressed in many types of tumor, promotes tumor growth, and confers resistance to anticancer therapy. Hence, Nrf2 is regarded as a novel therapeutic target in cancer. Previously, we reported that luteolin is a strong inhibitor of Nrf2 in vitro. Here, we showed that luteolin reduced the constitutive expression of NAD(P)H quinone oxidoreductase 1 in mouse liver in a time- and dose-dependent manner. Further, luteolin inhibited the expression of antioxidant enzymes and glutathione transferases, decreasing the reduced glutathione in the liver of wild-type mice under both constitutive and butylated hydroxyanisole-induced conditions. In contrast, such distinct responses were not detected in Nrf2{sup −/−} mice. In addition, oral administration of luteolin, either alone or combined with intraperitoneal injection of the cytotoxic drug cisplatin, greatly inhibited the growth of xenograft tumors from non-small-cell lung cancer (NSCLC) cell line A549 cells grown subcutaneously in athymic nude mice. Cell proliferation, the expression of Nrf2, and antioxidant enzymes were all reduced in tumor xenograft tissues. Furthermore, luteolin enhanced the anti-cancer effect of cisplatin. Together, our findings demonstrated that luteolin inhibits the Nrf2 pathway in vivo and can serve as an adjuvant in the chemotherapy of NSCLC.

  14. Resveratrol inhibits estrogen-induced breast carcinogenesis through induction of NRF2-mediated protective pathways

    PubMed Central

    Singh, Bhupendra; Shoulson, Rivka; Chatterjee, Anwesha; Ronghe, Amruta; Bhat, Nimee K.; Dim, Daniel C.; Bhat, Hari K.

    2014-01-01

    The importance of estrogens in the etiology of breast cancer is widely recognized. Estrogen-induced oxidative stress has been implicated in this carcinogenic process. Resveratrol (Res), a natural antioxidant phytoestrogen has chemopreventive effects against a variety of illnesses including cancer. The objective of the present study was to characterize the mechanism(s) of Res-mediated protection against estrogen-induced breast carcinogenesis. Female August Copenhagen Irish rats were treated with 17β-estradiol (E2), Res and Res + E2 for 8 months. Cotreatment of rats with Res and E2 inhibited E2-mediated proliferative changes in mammary tissues and significantly increased tumor latency and reduced E2-induced breast tumor development. Resveratrol treatment alone or in combination with E2 significantly upregulated expression of nuclear factor erythroid 2-related factor 2 (NRF2) in mammary tissues. Expression of NRF2-regulated antioxidant genes NQO1, SOD3 and OGG1 that are involved in protection against oxidative DNA damage was increased in Res- and Res + E2-treated mammary tissues. Resveratrol also prevented E2-mediated inhibition of detoxification genes AOX1 and FMO1. Inhibition of E2-mediated alterations in NRF2 promoter methylation and expression of NRF2 targeting miR-93 after Res treatment indicated Res-mediated epigenetic regulation of NRF2 during E2-induced breast carcinogenesis. Resveratrol treatment also induced apoptosis and inhibited E2-mediated increase in DNA damage in mammary tissues. Increased apoptosis and decreased DNA damage, cell migration, colony and mammosphere formation in Res- and Res + E2-treated MCF-10A cells suggested a protective role of Res against E2-induced mammary carcinogenesis. Small-interfering RNA-mediated silencing of NRF2 inhibited Res-mediated preventive effects on the colony and mammosphere formation. Taken together, these results suggest that Res inhibits E2-induced breast carcinogenesis via induction of NRF2-mediated protective

  15. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician's Expectation Be Matched by the Reality?

    PubMed Central

    Houghton, Christine A.; Fassett, Robert G.; Coombes, Jeff S.

    2016-01-01

    The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements. PMID:26881038

  16. Nrf2 amplifies oxidative stress via induction of Klf9

    PubMed Central

    Bianchi-Smiraglia, Anna; Bogner, Paul N.; Wawrzyniak, Joseph A.; Foley, Colleen; Leonova, Katerina I.; Grimm, Melissa J.; Moparthy, Kalyana; Ionov, Yurij; Wang, Jianmin; Liu, Song; Sexton, Sandra; Kandel, Eugene S.; Bakin, Andrei V.; Zhang, Yuesheng; Kaminski, Naftali; Segal, Brahm H.; Nikiforov, Mikhail A.

    2014-01-01

    Summary Reactive oxygen species (ROS) activate NF-E2-related transcription factor 2 (Nrf2), a key transcriptional regulator driving antioxidant gene expression and protection from oxidant injury. Here we report that in response to elevation of intracellular ROS above a critical threshold, Nrf2 stimulates expression of transcription Kruppel-like factor 9 (Klf9), resulting in further Klf9-dependent increases in ROS and subsequent cell death. We demonstrated that Klf9 independently causes increased ROS levels in various types of cultured cells and in mouse tissues and is required for pathogenesis of bleomycin-induced pulmonary fibrosis in mice. Mechanistically, Klf9 binds to the promoters and alters the expression of several genes involved in the metabolism of ROS, including suppression of thioredoxin reductase 2, an enzyme participating in ROS clearance. Our data reveal an Nrf2-dependent feed-forward regulation of ROS and identify Klf9 as a novel ubiquitous regulator of oxidative stress and lung injury. PMID:24613345

  17. Sofalcone, a gastric mucosa protective agent, increases vascular endothelial growth factor via the Nrf2-heme-oxygenase-1 dependent pathway in gastric epithelial cells

    SciTech Connect

    Shibuya, Akiko; Onda, Kenji; Kawahara, Hirofumi; Uchiyama, Yuka; Nakayama, Hiroko; Omi, Takamasa; Nagaoka, Masayoshi; Matsui, Hirofumi; Hirano, Toshihiko

    2010-07-30

    Research highlights: {yields} Sofalcone increases HO-1 in gastric epithelial cells. {yields} The induction of HO-1 by sofalcone treatment follows the activation of Nrf2. {yields} The production of VEGF by sofalcone treatment is mediated by HO-1 induction. -- Abstract: Sofalcone, 2'-carboxymethoxy-4,4-bis(3-methyl-2-butenyloxy)chalcone, is an anti-ulcer agent that is classified as a gastric mucosa protective agent. Recent studies indicate heat shock proteins such as HSP32, also known as heme-oxygenase-1(HO-1), play important roles in protecting gastrointestinal tissues from several stresses. We have previously reported that sofalcone increases the expression of HO-1 in adipocytes and pre-adipocytes, although the effect of sofalcone on HO-1 induction in gastrointestinal tissues is not clear. In the current study, we investigated the effects of sofalcone on the expression of HO-1 and its functional role in rat gastric epithelial (RGM-1) cells. We found that sofalcone increased HO-1 expression in RGM-1 cells in both time- and concentration-dependent manners. The HO-1 induction was associated with the nuclear translocation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) in RGM-1 cells. We also observed that sofalcone increased vascular endothelial growth factor (VEGF) production in the culture medium. Treatment of RGM-1 cells with an HO-1 inhibitor (tin-protoporphyrin), or HO-1 siRNA inhibited sofalcone-induced VEGF production, suggesting that the effect of sofalcone on VEGF expression is mediated by the HO-1 pathway. These results suggest that the gastroprotective effects of sofalcone are partly exerted via Nrf2-HO-1 activation followed by VEGF production.

  18. Recent Updates on Acetaminophen Hepatotoxicity: The Role of Nrf2 in Hepatoprotection

    PubMed Central

    Gum, Sang Il

    2013-01-01

    Acetaminophen (APAP) known as paracetamol is the main ingredient in Tylenol, which has analgesic and anti-pyretic properties. Inappropriate use of APAP causes major morbidity and mortality secondary to hepatic failure. Overdose of APAP depletes the hepatic glutathione (GSH) rapidly, and the metabolic intermediate leads to hepatocellular death. This article reviews the mechanisms of hepatotoxicity and provides an overview of current research studies. Pharmacokinetics including metabolism (activation and detoxification), subsequent transport (efflux)-facilitating excretion, and some other aspects related to toxicity are discussed. Nuclear factor erythroid 2-related factor 2 (Nrf2)-regulated gene battery plays a critical role in the multiple steps associated with the mitigation of APAP toxicity. The role of Nrf2 as a protective target is described, and potential natural products inhibiting APAP toxicity are outlined. This review provides an update on the mechanism of APAP toxicity and highlights the beneficial role of Nrf2 and specific natural products in hepatoprotection. PMID:24386516

  19. Antioxidative effects of diallyl trisulfide on hydrogen peroxide-induced cytotoxicity through regulation of nuclear factor-E2-related factor-mediated thioredoxin reductase 1 expression in C2C12 skeletal muscle myoblast cells.

    PubMed

    Kang, Ji Sook; Kim, Gi-Yiung; Kim, Byung Woo; Choi, Yung Hyun

    2017-04-01

    Diallyl trisulfide (DATS) is one of the major sulfur-containing compounds in garlic oil. In this study, we analyzed the effects of DATS against hydrogen peroxide (H2O2)-induced oxidative stress in C2C12 myoblasts. DATS preconditioning significantly attenuated H2O2-induced growth inhibition and DNA damage, as well as apoptosis by decreasing the generation of ROS. Treatment with DATS alone effectively upregulated the expression of nuclear factor-erythroid 2-related factor 2 (Nrf2) and thioredoxin reductase 1 (TrxR1), which was associated with the increased phosphorylation of Nrf2. However, the protective effects of DATS against H2O2-induced growth reduction and ROS accumulation were significantly abolished by auranofin, an inhibitor of TrxR activity. Moreover, DATS-mediated phosphorylation of Nrf2 and induction of TrxR1 were markedly reduced by genetic silencing of Nrf2. DATS treatment also induced the phosphorylation extracellular signal-regulating kinase (ERK), and analysis using specific inhibitors of cellular signaling pathways demonstrated that only ERK activation was involved in Nrf2 phosphorylation and TrxR1 induction. In addition, the cytoprotective potentials were abrogated in C2C12 cells pretreated with an ERK specific inhibitor. The results demonstrate that DATS protects against oxidative stress-induced DNA damage and apoptosis in C2C12 cells in part through the activation of Nrf2-mediated TrxR1 induction via the ERK signaling pathway.

  20. Phytoestrogens modulate hepcidin expression by Nrf2: Implications for dietary control of iron absorption.

    PubMed

    Bayele, Henry K; Balesaria, Sara; Srai, Surjit K S

    2015-12-01

    Hepcidin is a liver-derived antimicrobial peptide that regulates iron absorption and is also an integral part of the acute phase response. In a previous report, we found evidence that this peptide could also be induced by toxic heavy metals and xenobiotics, thus broadening its teleological role as a defensin. However it remained unclear how its sensing of disparate biotic and abiotic stressors might be integrated at the transcriptional level. We hypothesized that its function in cytoprotection may be regulated by NFE2-related factor 2 (Nrf2), the master transcriptional controller of cellular stress defenses. In this report, we show that hepcidin regulation is inextricably linked to the acute stress response through Nrf2 signaling. Nrf2 regulates hepcidin expression from a prototypical antioxidant response element in its promoter, and by synergizing with other basic leucine-zipper transcription factors. We also show that polyphenolic small molecules or phytoestrogens commonly found in fruits and vegetables including the red wine constituent resveratrol can induce hepcidin expression in vitro and post-prandially, with concomitant reductions in circulating iron levels and transferrin saturation by one such polyphenol quercetin. Furthermore, these molecules derepress hepcidin promoter activity when its transcription by Nrf2 is repressed by Keap1. Taken together, the data show that hepcidin is a prototypical antioxidant response or cytoprotective gene within the Nrf2 transcriptional circuitry. The ability of phytoestrogens to modulate hepcidin expression in vivo suggests a novel mechanism by which diet may impact iron homeostasis.

  1. Astrocyte NMDA receptors' activity sustains neuronal survival through a Cdk5–Nrf2 pathway

    PubMed Central

    Jimenez-Blasco, D; Santofimia-Castaño, P; Gonzalez, A; Almeida, A; Bolaños, J P

    2015-01-01

    Neurotransmission unavoidably increases mitochondrial reactive oxygen species. However, the intrinsic antioxidant defense of neurons is weak and hence the mechanism whereby these cells are physiologically protected against oxidative damage is unknown. Here we found that the antioxidant defense of neurons is repressed owing to the continuous protein destabilization of the master antioxidant transcriptional activator, nuclear factor-erythroid 2-related factor-2 (Nrf2). By contrast, Nrf2 is highly stable in neighbor astrocytes explaining their robust antioxidant defense and resistance against oxidative stress. We also show that subtle and persistent stimulation of N-methyl-d-aspartate receptors (NMDAR) in astrocytes, through a mechanism not requiring extracellular Ca2+ influx, upregulates a signal transduction pathway involving phospholipase C-mediated endoplasmic reticulum release of Ca2+ and protein kinase Cδ activation. Active protein kinase Cδ promotes, by phosphorylation, the stabilization of p35, a cyclin-dependent kinase-5 (Cdk5) cofactor. Active p35/Cdk5 complex in the cytosol phosphorylates Nrf2 at Thr395, Ser433 and Thr439 that is sufficient to promote Nrf2 translocation to the nucleus and induce the expression of antioxidant genes. Furthermore, this Cdk5–Nrf2 transduction pathway boosts glutathione metabolism in astrocytes efficiently protecting closely spaced neurons against oxidative damage. Thus, intercellular communication through NMDAR couples neurotransmission with neuronal survival. PMID:25909891

  2. Hepatoprotective effect of 7-Hydroxycoumarin against Methyl glyoxal toxicity via activation of Nrf2.

    PubMed

    Li, Dan; Wang, Na; Zhang, Jingdong; Ma, Shuren; Zhao, Zhuangzhuang; Ellis, Elizabeth M

    2017-03-02

    Methyl glyoxal (MG), a major precursor of advanced glycation end-products, has been identified as significant in the progression of several diseases including aging, diabetes and neurodegenerative diseases as well as causing hepatic damages. 7-hydroxycoumarin (7-HC), a natural-occurring derivative of coumarin from fruits and plants, has been reported to exert antioxidant and free radical-scavenging properties, protecting cells from aldehydes and oxidants. In this study, the ability of 7-HC to protect human HepG2 cells against MG-induced toxicity and oxidative stress was investigated. Results show that 7-HC pretreatment significantly attenuates MG-induced cytotoxicity, apoptotic changes and ROS accumulation and that this protection is shown to be associated with the induction of the nuclear factor erythroid 2-related factor 2 (NRF2) and its downstream detoxifying enzymes. In response to 7-HC, NRF2 protein translocates from cytosol to the nuclei. In addition, depletion of NRF2 by siRNA significantly reduces the protective effect of 7-HC against MG, suggesting that NRF2 plays an important role in the protective function of 7-HC. These findings highlight the potential for the interventional activation of the NRF2 induction via the non-toxic natural phytochemical 7-HC as a novel therapeutic approach towards the detoxification of MG, with the aim of halting the progression of diseases in which MG has been implicated.

  3. Identification of Chromomoric Acid C-I as an Nrf2 Activator in Chromolaena odorata

    PubMed Central

    2014-01-01

    Activation of nuclear factor-erythroid 2-related factor 2 (Nrf2) contributes to several beneficial bioactivities of natural products, including induction of an increased cellular stress resistance and prevention or resolution of inflammation. In this study, the potential of a crude leaf extract of Chromolaena odorata, traditionally used against inflammation and skin lesions, was examined for Nrf2 activation. Guided by an Nrf2-dependent luciferase reporter gene assay, the phytoprostane chromomoric acid C-I (1) was identified as a potent Nrf2 activator from C. odorata with a CD (concentration doubling the response of vehicle-treated cells) of 5.2 μM. When tested at 1–10 μM, 1 was able to induce the endogenous Nrf2 target gene heme oxygenase 1 (HO-1) in fibroblasts. Between 2 and 5 μM, compound 1 induced HO-1 in vascular smooth muscle cells (VSMC) and inhibited their proliferation in a HO-1-dependent manner, without eliciting signs of cytotoxicity. PMID:24476568

  4. The Nrf2 activator oltipraz also activates the constitutive androstane receptor.

    PubMed

    Merrell, Matthew D; Jackson, Jonathan P; Augustine, Lisa M; Fisher, Craig D; Slitt, Angela L; Maher, Jonathan M; Huang, Wendong; Moore, David D; Zhang, Youcai; Klaassen, Curtis D; Cherrington, Nathan J

    2008-08-01

    Oltipraz (OPZ) is a well known inducer of NAD(P)H:quinone oxidoreductase (NQO1) along with other enzymes that comprise the nuclear factor E2-related factor 2 (Nrf2) battery of detoxification genes. However, OPZ treatment also induces expression of CYP2B, a gene regulated by the constitutive androstane receptor (CAR). Therefore, this study was designed to determine whether OPZ induces gene expression in the mouse liver through activation of CAR in addition to Nrf2. OPZ increased the mRNA expression of both Cyp2b10 and Nqo1 in C57BL/6 mouse livers. As expected, in livers from Nrf2-/- mice, OPZ induction of Nqo1 was reduced, indicating Nqo1 induction is dependent on Nrf2 activation, whereas Cyp2b10 induction was unchanged. The robust induction of Cyp2b10 by OPZ in wild-type mice was completely absent in CAR-/- mice, revealing a CAR-dependent induction by OPZ. OPZ also induced transcription of the human CYP2B6 promoter-reporter containing the phenobarbital (PB) responsive element in mouse liver using an in vivo transcription assay. Additionally, OPZ induced in vivo nuclear accumulation of CAR at 3 h but, as with PB, was unable to reverse androstanol repression of mouse CAR constitutive activity in transiently transfected HepG2 cells. In summary, OPZ induces expression of Cyp2b10 and Nqo1 via the activation of CAR and Nrf2, respectively.

  5. Nrf2 Protects Against TWEAK-mediated Skeletal Muscle Wasting

    NASA Astrophysics Data System (ADS)

    Al-Sawaf, Othman; Fragoulis, Athanassios; Rosen, Christian; Kan, Yuet Wai; Sönmez, Tolga Taha; Pufe, Thomas; Wruck, Christoph Jan

    2014-01-01

    Skeletal muscle (SM) regeneration after injury is impaired by excessive inflammation. Particularly, the inflammatory cytokine tumour necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) is a potent inducer of skeletal muscle wasting and fibrosis. In this study we investigated the role of Nrf2, a major regulator of oxidative stress defence, in SM ischemia/reperfusion (I/R) injury and TWEAK induced atrophy. We explored the time-dependent expression of TWEAK after I/R in SM of Nrf2-wildtype (WT) and knockout (KO) mice. Nrf2-KO mice expressed significant higher levels of TWEAK as compared to WT mice. Consequently, Nrf2-KO mice present an insufficient regeneration as compared to Nrf2-WT mice. Moreover, TWEAK stimulation activates Nrf2 in the mouse myoblast cell line C2C12. This Nrf2 activation inhibits TWEAK induced atrophy in C2C12 differentiated myotubes. In summary, we show that Nrf2 protects SM from TWEAK-induced cell death in vitro and that Nrf2-deficient mice therefore have poorer muscle regeneration.

  6. Opposing effects of Nrf2 and Nrf2-activating compounds on the NLRP3 inflammasome independent of Nrf2-mediated gene expression.

    PubMed

    Garstkiewicz, Martha; Strittmatter, Gerhard E; Grossi, Serena; Sand, Jennifer; Fenini, Gabriele; Werner, Sabine; French, Lars E; Beer, Hans-Dietmar

    2017-03-01

    The transcription factor Nrf2 regulates the expression of genes required for protection from xenobiotic and oxidative stress. Under normal conditions Nrf2 is constantly degraded upon ubiquitination, mediated by the Nrf2 inhibitor Keap1. Inflammasomes represent stress-induced protein complexes. They are critically involved in acute and chronic inflammation through caspase-1-mediated activation of pro-inflammatory cytokines. Here, we demonstrate that Nrf2 is as a positive regulator of the NLRP3 inflammasome. In contrast, Nrf2-activating compounds, including the anti-inflammatory drug dimethyl fumarate (DMF), inhibit inflammasome activation. Both effects are independent of the transcriptional activity of Nrf2 and, at least in part, not interdependent. On the other hand, NLRP3 inflammasome activation induces a rapid and partly caspase-1- and Keap1-independent degradation of Nrf2. These data argue against a simultaneous activation of both stress-related pathways. Finally, we provide evidence that the cross-regulation of both pathways is controlled by a physical interaction between the Nrf2/Keap1 and NLRP3 complexes. This article is protected by copyright. All rights reserved.

  7. The anti-ageing hormone klotho induces Nrf2-mediated antioxidant defences in human aortic smooth muscle cells.

    PubMed

    Maltese, Giuseppe; Psefteli, Paraskevi-Maria; Rizzo, Benedetta; Srivastava, Salil; Gnudi, Luigi; Mann, Giovanni E; Siow, Richard C M

    2017-03-01

    Vascular ageing in conditions such as atherosclerosis, diabetes and chronic kidney disease, is associated with the activation of the renin angiotensin system (RAS) and diminished expression of antioxidant defences mediated by the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2). The anti-ageing hormone klotho promotes longevity and protects against cardiovascular and renal diseases. Klotho has been shown to activate Nrf2 and attenuate oxidative damage in neuronal cells, however, the mechanisms by which it protects against vascular smooth muscle cell VSMC dysfunction elicited by Angiotensin II (AngII) remain to be elucidated. AngII contributes to vascular ageing and atherogenesis by enhancing VSMC oxidative stress, senescence and apoptosis. This study demonstrates that soluble klotho (1 nM, 24 hrs) significantly induces expression of Nrf2 and the antioxidant enzymes haeme oxygenase (HO-1) and peroxiredoxin-1 (Prx-1) and enhances glutathione levels in human aortic smooth muscle cells (HASMC). Silencing of Nrf2 attenuated the induction of HO-1 and Prx-1 expression by soluble klotho. Furthermore, soluble klotho protected against AngII-mediated HASMC apoptosis and senescence via activation of Nrf2. Thus, our findings highlight a novel Nrf2-mediated mechanism underlying the protective actions of soluble klotho in HAMSC. Targeting klotho may thus represent a therapeutic strategy against VSMC dysfunction and cardiovascular ageing.

  8. A conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative stress adaptation in mammals, Caenorhabditis elegans and Drosophila melanogaster

    PubMed Central

    Pickering, Andrew M.; Staab, Trisha A.; Tower, John; Sieburth, Derek; Davies, Kelvin J. A.

    2013-01-01

    SUMMARY In mammalian cells, hydrogen peroxide (H2O2)-induced adaptation to oxidative stress is strongly dependent on an Nrf2 transcription factor-mediated increase in the 20S proteasome. Here, we report that both Caenorhabditis elegans nematode worms and Drosophila melanogaster fruit flies are also capable of adapting to oxidative stress with H2O2 pre-treatment. As in mammalian cells, this adaptive response in worms and flies involves an increase in proteolytic activity and increased expression of the 20S proteasome, but not of the 26S proteasome. We also found that the increase in 20S proteasome expression in both worms and flies, as in mammalian cells, is important for the adaptive response, and that it is mediated by the SKN-1 and CNC-C orthologs of the mammalian Nrf2 transcription factor, respectively. These studies demonstrate that stress mechanisms operative in cell culture also apply in disparate intact organisms across a wide biological diversity. PMID:23038734

  9. Epicatechin induces NF-kappaB, activator protein-1 (AP-1) and nuclear transcription factor erythroid 2p45-related factor-2 (Nrf2) via phosphatidylinositol-3-kinase/protein kinase B (PI3K/AKT) and extracellular regulated kinase (ERK) signalling in HepG2 cells.

    PubMed

    Granado-Serrano, Ana Belén; Martín, María Angeles; Haegeman, Guy; Goya, Luis; Bravo, Laura; Ramos, Sonia

    2010-01-01

    The dietary flavonoid epicatechin has been reported to exhibit a wide range of biological activities. The objective of the present study was to investigate the time-dependent regulation by epicatechin on the activity of the main transcription factors (NF-kappaB, activator protein-1 (AP-1) and nuclear transcription factor erythroid 2p45-related factor (Nrf2)) related to antioxidant defence and survival and proliferation pathways in HepG2 cells. Treatment of cells with 10 microm-epicatechin induced the NF-kappaB pathway in a time-dependent manner characterised by increased levels of IkappaB kinase (IKK) and phosphorylated inhibitor of kappaB subunit-alpha (p-IkappaBalpha) and proteolytic degradation of IkappaB, which was consistent with an up-regulation of the NF-kappaB-binding activity. Time-dependent activation of the AP-1 pathway, in concert with enhanced c-Jun nuclear levels and induction of Nrf2 translocation and phosphorylation were also demonstrated. Additionally, epicatechin-induced NF-kappaB and Nrf2 were connected to reactive oxygen species intracellular levels and to the activation of cell survival and proliferation pathways, being phosphatidylinositol-3-kinase/protein kinase B (PI3K/AKT) and extracellular regulated kinase (ERK) associated to Nrf2 modulation and ERK to NF-kappaB induction. These data suggest that the epicatechin-induced survival effect occurs by the induction of redox-sensitive transcription factors through a tight regulation of survival and proliferation pathways.

  10. Neuroprotective Effects of the Triterpenoid, CDDO Methyl Amide, a Potent Inducer of Nrf2-Mediated Transcription

    PubMed Central

    Yang, Lichuan; Calingasan, Noel Y.; Thomas, Bobby; Chaturvedi, Rajnish K.; Kiaei, Mahmoud; Wille, Elizabeth J.; Liby, Karen T.; Williams, Charlotte; Royce, Darlene; Risingsong, Renee; Musiek, Eric S.; Morrow, Jason D.; Sporn, Michael; Beal, M. Flint

    2009-01-01

    The NF-E2-related factor-2 (Nrf2)/antioxidant response element (ARE) signaling pathway regulates phase 2 detoxification genes, including a variety of antioxidative enzymes. We tested neuroprotective effects of the synthetic triterpenoid CDDO-MA, a potent activator of the Nrf2/ARE signaling. CDDO-MA treatment of neuroblastoma SH-SY5Y cells resulted in Nrf2 upregulation and translocation from cytosol to nucleus and subsequent activation of ARE pathway genes. CDDO-MA blocked t-butylhydroperoxide-induced production of reactive oxygen species (ROS) by activation of ARE genes only in wild type, but not Nrf2 knockout mouse embryonic fibroblasts. Oral administration of CDDO-MA resulted in significant protection against MPTP-induced nigrostriatal dopaminergic neurodegeneration, pathological alpha-synuclein accumulation and oxidative damage in mice. Additionally, CDDO-MA treatment in rats produced significant rescue against striatal lesions caused by the neurotoxin 3-NP, and associated increases in the oxidative damage markers malondialdehyde, F2-Isoprostanes, 8-hydroxy-2-deoxyguanosine, 3-nitrotyrosine, and impaired glutathione homeostasis. Our results indicate that the CDDO-MA renders its neuroprotective effects through its potent activation of the Nrf2/ARE pathway, and suggest that triterpenoids may be beneficial for the treatment of neurodegenerative diseases like Parkinson's disease and Huntington's disease. PMID:19484125

  11. Role of pterostilbene in attenuating immune mediated devastation of pancreatic beta cells via Nrf2 signaling cascade.

    PubMed

    Sireesh, Dornadula; Ganesh, Munuswamy-Ramanujam; Dhamodharan, Umapathy; Sakthivadivel, Murugesan; Sivasubramanian, Srinivasan; Gunasekaran, Palani; Ramkumar, Kunka Mohanram

    2017-03-06

    Nrf2 (nuclear factor erythroid 2-related factor-2) is a transcription factor that regulates oxidative/xenobiotic stress response and also suppress inflammation. Nrf2 signaling is associated with an increased susceptibility to various kinds of stress. Nrf2 has been shown as a promising therapeutic target in various human diseases including diabetes. Our earlier studies showed Pterostilbene (PTS) as a potent Nrf2 activator, and it protects the pancreatic β-cells against oxidative stress. In this study, we investigated PTS confer protection against cytokine-induced β-cell apoptosis and its role on insulin secretion in streptozotocin (STZ)-induced diabetic mice. The Nrf2 activation potential of PTS was assessed by dissociation of the Nrf2-Keap1 complex and by expression of ARE-driven downstream target genes in MIN6 cells. Further, the nuclear Nrf2 translocation and blockage of apoptotic signaling as demonstrated by the reduction of BAX/Bcl-2 ratio, Annexin-V positive cells and caspase-3 activity conferred the cyto-protection of PTS against cytokine-induced cellular damage. In addition, PTS treatment markedly improved glucose homeostasis and abated inflammatory response evidenced by the reduction of proinflammatory cytokines in diabetic mice. The inhibition of β-cell apoptosis by PTS as assessed by BAX/Bcl-2 ratio and caspase-3 activity in the pancreas was associated with the activation of Nrf2 and the expression of its downstream target genes. PTS also inhibited the activation of iNOS and decreased nitric oxide (NO) formation in the pancreas of diabetic animals. The results obtained from both in vitro and in vivo experiments showed that PTS improves β-cell function and survival against cytokine stress and also prevents STZ-induced diabetes.

  12. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    SciTech Connect

    Lo, Raymond; Matthews, Jason

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  13. An Essential Role of NRF2 in Diabetic Wound Healing

    PubMed Central

    Long, Min; Rojo de la Vega, Montserrat; Wen, Qing; Bharara, Manish; Jiang, Tao; Zhang, Rui; Zhou, Shiwen; Wong, Pak K.

    2016-01-01

    The high mortality and disability of diabetic nonhealing skin ulcers create an urgent need for the development of more efficacious strategies targeting diabetic wound healing. In the current study, using human clinical specimens, we show that perilesional skin tissues from patients with diabetes are under more severe oxidative stress and display higher activation of the nuclear factor-E2–related factor 2 (NRF2)–mediated antioxidant response than perilesional skin tissues from normoglycemic patients. In a streptozotocin-induced diabetes mouse model, Nrf2−/− mice have delayed wound closure rates compared with Nrf2+/+ mice, which is, at least partially, due to greater oxidative DNA damage, low transforming growth factor-β1 (TGF-β1) and high matrix metalloproteinase 9 (MMP9) expression, and increased apoptosis. More importantly, pharmacological activation of the NRF2 pathway significantly improves diabetic wound healing. In vitro experiments in human immortalized keratinocyte cells confirm that NRF2 contributes to wound healing by alleviating oxidative stress, increasing proliferation and migration, decreasing apoptosis, and increasing the expression of TGF-β1 and lowering MMP9 under high-glucose conditions. This study indicates an essential role for NRF2 in diabetic wound healing and the therapeutic benefits of activating NRF2 in this disease, laying the foundation for future clinical trials using NRF2 activators in treating diabetic skin ulcers. PMID:26718502

  14. Nrf2 signalling and autophagy are involved in diabetes mellitus-induced defects in the development of mouse placenta

    PubMed Central

    Han, Sha-sha; Jin, Ya; Li, He; Wu, Xia; Ma, Zheng-lai; cheng, Xin; Tang, Xiuwen

    2016-01-01

    It is widely accepted that diabetes mellitus impairs placental development, but the mechanism by which the disease operates to impair development remains controversial. In this study, we demonstrated that pregestational diabetes mellitus (PGDM)-induced defects in placental development in mice are mainly characterized by the changes of morphological structure of placenta. The alteration of differentiation-related gene expressions in trophoblast cells rather than cell proliferation/apoptosis is responsible for the phenotypes found in mouse placenta. Meanwhile, excess reactive oxygen species (ROS) production and activated nuclear factor erythroid2-related factor 2 (Nrf2) signalling were observed in the placenta of mice suffering from PGDM. Using BeWo cells, we also demonstrated that excess ROS was produced and Nrf2 signalling molecules were activated in settings characterized by a high concentration of glucose. More interestingly, differentiation-related gene expressions in trophoblast cells were altered when endogenous Nrf2 expression is manipulated by transfecting Nrf2-wt or Nrf2-shRNA. In addition, PGDM interferes with autophagy in both mouse placenta and BeWo cells, implying that autophagy is also involved, directly or indirectly, in PGDM-induced placental phenotypes. Therefore, we revealed that dysfunctional oxidative stress-activated Nrf2 signalling and autophagy are probably responsible for PGDM-induced defects in the placental development of mice. The mechanism was through the interference with differentiation-related gene expression in trophoblast cells. PMID:27383629

  15. Antisense Oligonucleotide Against GSK-3β in Brain of SAMP8 Mice Improves Learning and Memory and Decreases Oxidative Stress: Involvement of Transcription Factor Nrf2 and Implications for Alzheimer Disease

    PubMed Central

    Farr, Susan A.; Ripley, Jessica L.; Sultana, Rukhsana; Zhang, Zhaoshu; Niehoff, Michael L.; Platt, Thomas L.; Murphy, M. Paul; Morley, John E.; Kumar, Vijaya; Butterfield, D. Allan

    2014-01-01

    Glycogen synthase kinase (GSK) -3β is a multifunctional protein that has been implicated in the pathological characteristics of Alzheimer’s disease (AD), including the heightened levels of neurofibrillary tangles, amyloid-beta (Aβ) and neurodegeneration. In this study we used 12 month old SAMP8 mice, an AD model, to examine the effects GSK-3β may cause regarding the cognitive impairment and oxidative stress associated with AD. To suppress the level of GSK-3β, SAMP8 mice were treated with an antisense oligonucleotide (GAO) directed at this kinase. We measured a decreased level of GSK-3β in the cortex of the mice, indicating the success of the antisense treatment. Learning and memory assessments of the SAMP8 mice were tested post-antisense treatment using an aversive T-maze and object recognition test, both of which observably improved. In cortex samples of the SAMP8 mice, decreased levels of protein carbonyl and protein-bound HNE were measured indicating decreased oxidative stress. Nuclear factor erythroid -2-related factor 2 (Nrf2) is a transcription factor known to increase the level of many antioxidants, including glutathione-S transferase (GST), and is negatively regulated by the activity of GSK-3β. Our results indicated the increased nuclear localization of Nrf2 and level of GST, suggesting the increased activity of the transcription factor as a result of GSK-3β suppression, consistent with the decreased oxidative stress observed. Consistent with the improved learning and memory, and consistent with GSK-3b being a tau kinase, we observed decreased tau phosphorylation in brain of GAO-treated SAMP8 mice compared to that of RAO-treated SAMP8 mice. Lastly, we examined the ability of GAO to cross the blood-brain barrier and determined it to be possible. The results presented in this study demonstrate that reducing GSK-3 with a phosphorothionated antisense against GSK-3 improves learning and memory, reduces oxidative stress, possibly coincident with

  16. Antisense oligonucleotide against GSK-3β in brain of SAMP8 mice improves learning and memory and decreases oxidative stress: Involvement of transcription factor Nrf2 and implications for Alzheimer disease.

    PubMed

    Farr, Susan A; Ripley, Jessica L; Sultana, Rukhsana; Zhang, Zhaoshu; Niehoff, Michael L; Platt, Thomas L; Murphy, M Paul; Morley, John E; Kumar, Vijaya; Butterfield, D Allan

    2014-02-01

    Glycogen synthase kinase (GSK)-3β is a multifunctional protein that has been implicated in the pathological characteristics of Alzheimer's disease (AD), including the heightened levels of neurofibrillary tangles, amyloid-beta (Aβ), and neurodegeneration. In this study we used 12-month-old SAMP8 mice, an AD model, to examine the effects GSK-3β may cause regarding the cognitive impairment and oxidative stress associated with AD. To suppress the level of GSK-3β, SAMP8 mice were treated with an antisense oligonucleotide (GAO) directed at this kinase. We measured a decreased level of GSK-3β in the cortex of the mice, indicating the success of the antisense treatment. Learning and memory assessments of the SAMP8 mice were tested post-antisense treatment using an aversive T-maze and object recognition test, both of which observably improved. In cortex samples of the SAMP8 mice, decreased levels of protein carbonyl and protein-bound HNE were measured, indicating decreased oxidative stress. Nuclear factor erythroid-2-related factor 2 (Nrf2) is a transcription factor known to increase the level of many antioxidants, including glutathione-S transferase (GST), and is negatively regulated by the activity of GSK-3β. Our results indicated the increased nuclear localization of Nrf2 and level of GST, suggesting the increased activity of the transcription factor as a result of GSK-3β suppression, consistent with the decreased oxidative stress observed. Consistent with the improved learning and memory, and consistent with GSK-3b being a tau kinase, we observed decreased tau phosphorylation in brain of GAO-treated SAMP8 mice compared to that of RAO-treated SAMP8 mice. Lastly, we examined the ability of GAO to cross the blood-brain barrier and determined it to be possible. The results presented in this study demonstrate that reducing GSK-3 with a phosphorothionated antisense against GSK-3 improves learning and memory, reduces oxidative stress, possibly coincident with increased

  17. Schisandrol B protects against acetaminophen-induced acute hepatotoxicity in mice via activation of the NRF2/ARE signaling pathway

    PubMed Central

    Jiang, Yi-ming; Wang, Ying; Tan, Hua-sen; Yu, Tao; Fan, Xiao-mei; Chen, Pan; Zeng, Hang; Huang, Min; Bi, Hui-chang

    2016-01-01

    Aim: The nuclear factor erythroid 2-related factor 2 (NRF2) acts through the antioxidant response element (ARE) to regulate the expression of many detoxifying and antioxidant genes responsible for cytoprotective processes. We previously reported that Schisandrol B (SolB) isolated from Schisandra sphenanthera produced a protective effect against acetaminophen (APAP)-induced liver injury. In this study we investigated whether the NRF2/ARE signaling pathway was involved in this hepato-protective effect. Methods: Male C57BL/6 mice were treated with SolB (200 mg·kg−1·d−1, ig) for 3 d before injection of APAP (400 mg/kg, ip). Serum and liver tissue samples were collected 6 h later. The mRNA and protein expression were measured using qRT-PCR and Western blot assay, respectively. The activation of NRF2 was examined in HepG2 cells using luciferase reporter gene assay. Results: SolB pretreatment significantly alleviated the hepatic injury (large patchy necrosis and hyperemia of the hepatic sinus), the increase of serum AST, ALT levels and hepatic MDA contents, and the decrease of liver and mitochondrial glutathione levels in APAP-treated mice. Furthermore, SolB pretreatment significantly increased nuclear accumulation of NRF2 and increased hepatic expression of NRF2 downstream proteins, including GCLC, GSR, NQO1, GSTs, MRP2, MRP3 and MRP4 in APAP-treated mice. Moreover, treatment with SolB (2.5–20 μmol/L) dose-dependently increased the activity of NRF2 reporter gene in HepG2 cells. Conclusion: SolB exhibits a remarkable protective effect against APAP-induced hepatotoxicity, partially via activation of the NRF2/ARE pathway and regulation of NRF2 target genes, which induce detoxification and increase antioxidant capacity. PMID:26806302

  18. Caspase-independent apoptosis in infected macrophages triggered by sulforaphane via Nrf2/p38 signaling pathways

    PubMed Central

    Bonay, M; Roux, A-L; Floquet, J; Retory, Y; Herrmann, J-L; Lofaso, F; Deramaudt, TB

    2015-01-01

    Mycobacterium abscessus (Mabs), a non-tuberculous mycobacterium, is an emerging and rapidly growing opportunistic pathogen that is frequently found in patients with cystic fibrosis and in immunosuppressed patients. Its high tolerance to antibiotics is of great concern for public health. In this study, our results showed that human THP-1-derived macrophages infected with M. abscessus presented an increase in ROS production and cell necrosis. In addition, M. abscessus infection triggered activation of the Nuclear factor E2-related factor 2 (Nrf2) signaling pathway, and the induction of HO-1 and NQO1 expression levels. Interestingly, pretreatment of macrophages with sulforaphane (SFN), an activator of the antioxidant key regulator Nrf2, followed by M. abscessus infection significantly decreased mycobacterial burden. We demonstrated that this reduction in mycobacterial growth was due to an activation in cell apoptosis in SFN-pretreated and M. abscessus-infected macrophages. Pretreatment with specific MAPK inhibitors, PD98059, SP600125, and SB203580 to ERK, JNK, and p38 respectively, failed to inhibit induction of Nrf2 expression, suggesting that Nrf2 signaling pathway was upstream of MAPK signaling. Activation of cell apoptosis was caspase 3/7 independent but p38 MAPK dependent. Moreover, p38 MAPK induction was abolished in macrophages transfected with Nrf2 siRNA. In addition, p38 inhibitor abolished Nrf2-dependent apoptosis in infected macrophages. Taken together, our results indicate that modulation of the Nrf2 signaling using Nrf2 activators may help potentiate the actual drug therapies used to treat mycobacterial infection. PMID:27551455

  19. NF-E2-related factor 2 regulates the stress response to UVA-1-oxidized phospholipids in skin cells.

    PubMed

    Gruber, Florian; Mayer, Herbert; Lengauer, Barbara; Mlitz, Veronika; Sanders, John M; Kadl, Alexandra; Bilban, Martin; de Martin, Rainer; Wagner, Oswald; Kensler, Thomas W; Yamamoto, Masayuki; Leitinger, Norbert; Tschachler, Erwin

    2010-01-01

    Long-wavelength ultraviolet (UVA-1) radiation causes oxidative stress that modifies cellular molecules. To defend themselves against noxious oxidation products, skin cells produce detoxifying enzymes and antioxidants. We have recently shown that UVA-1 oxidized the abundant membrane phospholipid 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine (PAPC), which then induced the stress-response protein heme oxygenase 1 (HO-1) in dermal fibroblasts. Here we examined the effects of UVA-1- and UV-oxidized phospholipids on global gene expression in human dermal fibroblasts and keratinocytes. We identified a cluster of genes that were coinduced by UVA-1-oxidized PAPC and UVA-1 radiation. The cluster included HO-1, glutamate-cysteine ligase modifier subunit, aldo-keto reductases-1-C1 and -C2, and IL-8. These genes are members of the cellular stress response system termed "antioxidant response." Accordingly, the regulatory regions of all of these genes contain binding sites for NF-E2-related factor 2 (NRF2), a major regulator of the antioxidant response. Both UVA-1 irradiation and treatment with oxidized lipids led to increased nuclear accumulation and DNA binding of NRF2. Silencing and deficiency of NRF2 suppressed the antioxidant response. Taken together, our data show that UVA-1-mediated lipid oxidation induces expression of antioxidant response genes, which is dependent on the redox-regulated transcription factor NRF2. Our findings suggest a different view on UV-generated lipid mediators that were commonly regarded as detrimental

  20. Neuroprotective effects of salidroside on focal cerebral ischemia/reperfusion injury involve the nuclear erythroid 2-related factor 2 pathway

    PubMed Central

    Han, Jing; Xiao, Qing; Lin, Yan-hua; Zheng, Zhen-zhu; He, Zhao-dong; Hu, Juan; Chen, Li-dian

    2015-01-01

    Salidroside, the main active ingredient extracted from Rhodiola crenulata, has been shown to be neuroprotective in ischemic cerebral injury, but the underlying mechanism for this neuroprotection is poorly understood. In the current study, the neuroprotective effect of salidroside on cerebral ischemia-induced oxidative stress and the role of the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway was investigated in a rat model of middle cerebral artery occlusion. Salidroside (30 mg/kg) reduced infarct size, improved neurological function and histological changes, increased activity of superoxide dismutase and glutathione-S-transferase, and reduced malon-dialdehyde levels after cerebral ischemia and reperfusion. Furthermore, salidroside apparently increased Nrf2 and heme oxygenase-1 expression. These results suggest that salidroside exerts its neuroprotective effect against cerebral ischemia through anti-oxidant mechanisms and that activation of the Nrf2 pathway is involved. The Nrf2/antioxidant response element pathway may become a new therapeutic target for the treatment of ischemic stroke. PMID:26889188

  1. Nrf2 deficiency prevents reductive stress-induced hypertrophic cardiomyopathy

    PubMed Central

    Kannan, Sankaranarayanan; Muthusamy, Vasanthi R.; Whitehead, Kevin J.; Wang, Li; Gomes, Aldrin V.; Litwin, Sheldon E.; Kensler, Thomas W.; Abel, E. Dale; Hoidal, John R.; Rajasekaran, Namakkal S.

    2013-01-01

    Aims Mutant protein aggregation (PA) cardiomyopathy (MPAC) is characterized by reductive stress (RS), PA (of chaperones and cytoskeletal components), and ventricular dysfunction in transgenic mice expressing human mutant CryAB (hmCryAB). Sustained activation of nuclear erythroid-2 like factor-2 (Nrf2) causes RS, which contributes to proteotoxic cardiac disease. The goals of this pre-clinical study were to (i) investigate whether disrupting Nrf2-antioxidant signalling prevents RS and rescues redox homeostasis in hearts expressing the mutant chaperone and (ii) elucidate mechanisms that could delay proteotoxic cardiac disease. Methods and results Non-transgenic (NTG), transgenic (TG) with MPAC and MPAC-TG:Nrf2-deficient (Nrf2-def) mice were used in this study. The effects of Nrf2 diminution (Nrf2±) on RS mediated MPAC in TG mice were assessed at 6–7 and 10 months of age. The diminution of Nrf2 prevented RS and prolonged the survival of TG mice (∼50 weeks) by an additional 20–25 weeks. The TG:Nrf2-def mice did not exhibit cardiac hypertrophy at even 60 weeks, while the MPAC-TG mice developed pathological hypertrophy and heart failure starting at 24–28 weeks of age. Aggregation of cardiac proteins was significantly reduced in TG:Nrf2-def when compared with TG mice at 7 months. Preventing RS and maintaining redox homeostasis in the TG:Nrf2-def mice ameliorated PA, leading to decreased ubiquitination of proteins. Conclusion Nrf2 deficiency rescues redox homeostasis, which reduces aggregation of mutant proteins, thereby delaying the proteotoxic pathological cardiac remodelling caused by RS and toxic protein aggregates. PMID:23761402

  2. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line.

    PubMed

    Park, Hae-Ryung; Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20μM BDE-47 for 24h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20μM BDE-47 for 24h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation.

  3. Nuclear lamins and progerin are dispensable for antioxidant Nrf2 response to arsenic and cadmium.

    PubMed

    Hashimoto, Kazunori; Majumdar, Rima; Tsuji, Yoshiaki

    2017-05-01

    Lamins are important constituents of the nuclear inner membrane and provide a platform for transcription factors and chromatin. Progerin, a C-terminal truncated lamin A mutant, causes premature aging termed Hutchinson-Gilford Progeria Syndrome (HGPS). Oxidative stress appears to be involved in the pathogenesis of HGPS, although the mechanistic role of progerin remains elusive. Here we examined whether nuclear lamins are important for a cellular antioxidant mechanism, and whether progerin compromises it. We investigated the activation of nuclear factor-E2-related factor 2 (Nrf2) which regulates various antioxidant genes including heme oxygenase-1 (HMOX1), following exposure to sodium arsenite or cadmium chloride in lamin knockdown human cell lines and primary HGPS human fibroblasts. Knocking down lamin A/C, or B, or all nuclear lamins simultaneously in three human cell lines (HaCaT, SW480, and K562) did not impair arsenite- or cadmium-induced activation of Nrf2. Progerin-expressing human primary HGPS fibroblasts showed lower basal levels of HMOX1 and NQO1 expression; however, in response to arsenic stress both normal and HGPS primary fibroblasts showed Nrf2 nuclear accumulation along with upregulation and phosphorylation of p62/SQSTM1 at Ser351, downregulation of Keap1, and comparable expression of an array of downstream Nrf2-regulated antioxidant genes. We also observed new forms of cleaved lamin A, B1 and B2 induced by cadmium stress although their roles in the Nrf2 antioxidant system need further investigation. These results suggest that the nuclear lamins and progerin have marginal roles in the activation of the antioxidant Nrf2 response to arsenic and cadmium.

  4. Nuclear Heme Oxygenase-1 (HO-1) Modulates Subcellular Distribution and Activation of Nrf2, Impacting Metabolic and Anti-oxidant Defenses*

    PubMed Central

    Biswas, Chhanda; Shah, Nidhi; Muthu, Manasa; La, Ping; Fernando, Amal P.; Sengupta, Shaon; Yang, Guang; Dennery, Phyllis A.

    2014-01-01

    With oxidative injury as well as in some solid tumors and myeloid leukemia cells, heme oxygenase-1 (HO-1), the anti-oxidant, anti-inflammatory, and anti-apoptotic microsomal stress protein, migrates to the nucleus in a truncated and enzymatically inactive form. However, the function of HO-1 in the nucleus is not completely clear. Nuclear factor erythroid 2-related factor 2 (Nrf2), a transcription factor and master regulator of numerous antioxidants and anti-apoptotic proteins, including HO-1, also accumulates in the nucleus with oxidative injury and in various types of cancer. Here we demonstrate that in oxidative stress, nuclear HO-1 interacts with Nrf2 and stabilizes it from glycogen synthase kinase 3β (GSK3β)-mediated phosphorylation coupled with ubiquitin-proteasomal degradation, thereby prolonging its accumulation in the nucleus. This regulation of Nrf2 post-induction by nuclear HO-1 is important for the preferential transcription of phase II detoxification enzymes such as NQO1 as well as glucose-6-phosphate dehydrogenase (G6PDH), a regulator of the pentose phosphate pathway. Using Nrf2 knock-out cells, we further demonstrate that nuclear HO-1-associated cytoprotection against oxidative stress depends on an HO-1/Nrf2 interaction. Although it is well known that Nrf2 induces HO-1 leading to mitigation of oxidant stress, we propose a novel mechanism by which HO-1, by modulating the activation of Nrf2, sets an adaptive reprogramming that enhances antioxidant defenses. PMID:25107906

  5. Negative regulation of the Nrf1 transcription factor by its N-terminal domain is independent of Keap1: Nrf1, but not Nrf2, is targeted to the endoplasmic reticulum

    PubMed Central

    Zhang, Yiguo; Crouch, Dorothy H.; Yamamoto, Masayuki; Hayes, John D.

    2006-01-01

    Nrf1 (nuclear factor-erythroid 2 p45 subunit-related factor 1) and Nrf2 regulate ARE (antioxidant response element)-driven genes. At its N-terminal end, Nrf1 contains 155 additional amino acids that are absent from Nrf2. This 155-amino-acid polypeptide includes the N-terminal domain (NTD, amino acids 1–124) and a region (amino acids 125–155) that is part of acidic domain 1 (amino acids 125–295). Within acidic domain 1, residues 156–242 share 43% identity with the Neh2 (Nrf2-ECH homology 2) degron of Nrf2 that serves to destabilize this latter transcription factor through an interaction with Keap1 (Kelch-like ECH-associated protein 1). We have examined the function of the 155-amino-acid N-terminal polypeptide in Nrf1, along with its adjacent Neh2-like subdomain. Activation of ARE-driven genes by Nrf1 was negatively controlled by the NTD (N-terminal domain) through its ability to direct Nrf1 to the endoplasmic reticulum. Ectopic expression of wild-type Nrf1 and mutants lacking either the NTD or portions of its Neh2-like subdomain into wild-type and mutant mouse embryonic fibroblasts indicated that Keap1 controls neither the activity of Nrf1 nor its subcellular distribution. Immunocytochemistry showed that whereas Nrf1 gave primarily cytoplasmic staining that was co-incident with that of an endoplasmic-reticulum marker, Nrf2 gave primarily nuclear staining. Attachment of the NTD from Nrf1 to the N-terminus of Nrf2 produced a fusion protein that was redirected from the nucleus to the endoplasmic reticulum. Although this NTD–Nrf2 fusion protein exhibited less transactivation activity than wild-type Nrf2, it was nevertheless still negatively regulated by Keap1. Thus Nrf1 and Nrf2 are targeted to different subcellular compartments and are negatively regulated by distinct mechanisms. PMID:16872277

  6. Oxidative Stress-responsive Transcription Factor NRF2 is Not Indispensable For The Human Hepatic Flavin-Containing Monooxygenase-3 (FMO3) Gene Expression in HepG2 Cells

    PubMed Central

    Rudraiah, Swetha; Gu, Xinsheng; Hines, Ronald N.; Manautou, José E.

    2015-01-01

    The flavin-containing monooxygenases (FMOs) are important for the oxidation of a variety of endogenous compounds and xenobiotics. The hepatic expression of FMO3 is highly variable and until recently, it was thought to be uninducible. In this study, human FMO3 gene regulation by the oxidative stress transcription factor, nuclear factor (erythroid-derived 2)-like 2 (NRF2) was examined. Constitutive FMO3 gene expression is repressed in HepG2 cells, thus this cell can be a good model for FMO3 gene regulation studies. Over-expression of NRF2 in HepG2 cells increased NRF2 target gene expression, heme oxygenase-1 (HMOX1) and NAD(P)H:quinone oxidoreductase-1 (NQO1), but did not alter FMO3 gene expression. Co-transfection studies with NRF2 or its cytosolic regulatory protein, Kelch-like ECH-associated protein 1 (KEAP1), expression vectors, along with FMO3 promoter luciferase reporter constructs of various lengths (5Kb or 6Kb), did not change FMO3 reporter gene activity significantly. Furthermore, treatment with tert-butyl hydroperoxide (tBHP) and tert-butyl hydroquinone (tBHQ) did not alter FMO3 reporter construct activity. In summary, in vitro results suggest that the transcriptional regulation of FMO3 might not involve the NRF2-KEAP1 regulatory pathway. PMID:26616280

  7. Plant Extracts of the Family Lauraceae: A Potential Resource for Chemopreventive Agents that Activate the Nuclear Factor-Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway

    PubMed Central

    Shen, Tao; Chen, Xue-Mei; Harder, Bryan; Long, Min; Wang, Xiao-Ning; Lou, Hong-Xiang; Wondrak, Georg T.; Ren, Dong-Mei; Zhang, Donna D.

    2015-01-01

    Cells and tissues counteract insults from exogenous or endogenous carcinogens through the expression of genes encoding antioxidants and phase II detoxifying enzymes regulated by antioxidant response element promoter regions. Nuclear factor-erythroid 2-related factor 2 plays a key role in regulating the antioxidant response elements-target gene expression. Hence, the Nrf2/ARE pathway represents a vital cellular defense mechanism against damage caused by oxidative stress and xenobiotics, and is recognized as a potential molecular target for discovering chemo-preventive agents. Using a stable antioxidant response element luciferase reporter cell line derived from human breast cancer MDA-MB-231 cells combined with a 96-well high-throughput screening system, we have identified a series of plant extracts from the family Lauraceae that harbor Nrf2-inducing effects. These extracts, including Litsea garrettii (ZK-08), Cinnamomum chartophyllum (ZK-02), C. mollifolium (ZK-04), C. camphora var. linaloolifera (ZK-05), and C. burmannii (ZK-10), promoted nuclear translocation of Nrf2, enhanced protein expression of Nrf2 and its target genes, and augmented intracellular glutathione levels. Cytoprotective activity of these extracts against two electrophilic toxicants, sodium arsenite and H2O2, was investigated. Treatment of human bronchial epithelial cells with extracts of ZK-02, ZK-05, and ZK-10 significantly improved cell survival in response to sodium arsenite and H2O2, while ZK-08 showed a protective effect against only H2O2. Importantly, their protective effects against insults from both sodium arsenite and H2O2 were Nrf2-dependent. Therefore, our data provide evidence that the selected plants from the family Lauraceae are potential sources for chemopreventive agents targeting the Nrf2/ARE pathway. PMID:24585092

  8. Pterostilbene attenuates high glucose-induced oxidative injury in hippocampal neuronal cells by activating nuclear factor erythroid 2-related factor 2.

    PubMed

    Yang, Yang; Fan, Chongxi; Wang, Bodong; Ma, Zhiqiang; Wang, Dongjin; Gong, Bing; Di, Shouyin; Jiang, Shuai; Li, Yue; Li, Tian; Yang, Zhi; Luo, Erping

    2017-04-01

    In the present study, neuroblastoma (SH-SY5Y) cells were used to investigate the mechanisms mediating the potential protective effects of pterostilbene (PTE) against mitochondrial metabolic impairment and oxidative stress induced by hyperglycemia for mimicking the diabetic encephalopathy. High glucose medium (100mM) decreased cellular viability after 24h incubation which was evidenced by: (i) reduced mitochondrial complex I and III activities; (ii) reduced mitochondrial cytochrome C; (iii) increased reactive oxygen species (ROS) generation; (iv) decreased mitochondrial membrane potential (ΔΨm); and (v) increased lactate dehydrogenase (LDH) levels. PTE (2.5, 5, and 10μM for 24h) was nontoxic and induced the nuclear transition of Nrf2. Pretreatment of PTE (2.5, 5, and 10μM for 2h) displayed a dose-dependently neuroprotective effect, as indicated by significantly prevented high glucose-induced loss of cellular viability, generation of ROS, reduced mitochondrial complex I and III activities, reduced mitochondrial cytochrome C, decreased ΔΨm, and increased LDH levels. Moreover, the levels of nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1) and glutathione S-transferase (GST) were elevated after PTE treatment. In addition, the elevation of nuclear Nrf2 by PTE treatment (10μM for 2h) was abolished by Nrf2 siRNA. Importantly, Nrf2 siRNA induced the opposite changes in mitochondrial complex I and III activities, mitochondrial cytochrome C, reactive species generation, ΔΨm, and LDH. Overall, the present findings were the first to show that pterostilbene attenuated high glucose-induced central nervous system injury in vitro through the activation of Nrf2 signaling, displaying protective effects against mitochondrial dysfunction-derived oxidative stress.

  9. Copper diethyldithiocarbamate as an activator of Nrf2 in cultured vascular endothelial cells.

    PubMed

    Fujie, Tomoya; Murakami, Masaki; Yoshida, Eiko; Tachinami, Tadashi; Shinkai, Yasuhiro; Fujiwara, Yasuyuki; Yamamoto, Chika; Kumagai, Yoshito; Naka, Hiroshi; Kaji, Toshiyuki

    2016-04-01

    The interest in organic-inorganic hybrid molecules as molecular probes for biological systems has been growing rapidly. Such hybrid molecules exhibit unique biological activities. Herein, copper(II) bis(diethyldithiocarbamate) (Cu10) was found to activate the transcription factor NF-E2-related factor 2 (Nrf2), which is responsible for regulating antioxidant and phase II xenobiotic enzymes, in vascular endothelial cells. The copper complex rapidly accumulated within cells and induced nuclear translocation of Nrf2, leading to upregulation of the expression of downstream proteins without cytotoxic effects. However, while copper bis(2-hydroxyethyl)dithiocarbamate activated Nrf2, copper ion, diethyldithiocarbamate ligand with or without zinc or iron failed to exhibit this activity. Intracellular accumulation of Cu10 was higher than that of Cu(II) and Cu(I). While the accumulation of copper(II) bis(dimethyldithiocarbamate) was reduced by small interfering RNA (siRNA)-mediated knockdown of the copper transporter CTR1, the knockdown did not affect Cu10 accumulation, indicating that Cu10 rapidly enters vascular endothelial cells via CTR1-independent mechanisms. In addition, copper and iron complexes with other ligands tested could not activate Nrf2, suggesting that the intramolecular interaction between copper and dithiocarbamate ligand is important for the activation of the transcription factor. Cu10 induced the expression of heme oxygenase-1, NAD(P)H quinone oxidoreductase 1, and γ-glutamylcysteine synthetase, downstream proteins of Nrf2. It was suggested that Cu10-induced activation of Nrf2 was due to proteasome inhibition as well as binding to Kelch-like ECH-associated protein 1. Since the effects of Cu10 on vascular endothelial cells are unique and diverse, the copper complex may be a good molecular probe to analyze the functions of the cells.

  10. Aged garlic extract enhances heme oxygenase-1 and glutamate-cysteine ligase modifier subunit expression via the nuclear factor erythroid 2-related factor 2-antioxidant response element signaling pathway in human endothelial cells.

    PubMed

    Hiramatsu, Kei; Tsuneyoshi, Tadamitsu; Ogawa, Takahiro; Morihara, Naoaki

    2016-02-01

    The nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway defends cells against oxidative stress and regulates the cellular redox balance. Activation of this pathway induces a variety of antioxidant enzymes, resulting in the protection of our bodies against oxidative damage. It has been reported that aged garlic extract (AGE), a garlic preparation that is rich in water-soluble cysteinyl moieties, reduces oxidative stress and helps to ameliorate of cardiovascular, renal and hepatic diseases. We hypothesized that AGE enhances the expression of antioxidant enzymes via the Nrf2-ARE pathway in human umbilical vein endothelial cells in culture. Gene expression of antioxidant enzymes was measured using real-time polymerase chain reaction. Nuclear accumulation of Nrf2 and antioxidant enzymes expression were evaluated using western blotting analyses. We found that AGE promoted the accumulation of Nrf2 into the nucleus in a time- and dose-dependent manner and increased the gene expression and polypeptide level of heme oxygenase-1 (HO-1) and glutamate-cysteine ligase modifier subunit (GCLM). Moreover, the effect of AGE in elevating the gene expression of HO-1 and GCLM was found to be mediated via Nrf2 activation in human umbilical vein endothelial cells. Taken together, these observations suggest that AGE induces the expression of HO-1 and GCLM, which are antioxidant enzymes, via activation of the Nrf2-ARE signaling pathway.

  11. S[+] Apomorphine is a CNS penetrating activator of the Nrf2-ARE pathway with activity in mouse and patient fibroblast models of amyotrophic lateral sclerosis.

    PubMed

    Mead, Richard J; Higginbottom, Adrian; Allen, Scott P; Kirby, Janine; Bennett, Ellen; Barber, Siân C; Heath, Paul R; Coluccia, Antonio; Patel, Neelam; Gardner, Iain; Brancale, Andrea; Grierson, Andrew J; Shaw, Pamela J

    2013-08-01

    Compelling evidence indicates that oxidative stress contributes to motor neuron injury in amyotrophic lateral sclerosis (ALS), but antioxidant therapies have not yet achieved therapeutic benefit in the clinic. The nuclear erythroid 2-related-factor 2 (Nrf2) transcription factor is a key regulator of an important neuroprotective response by driving the expression of multiple cytoprotective genes via its interaction with the antioxidant response element (ARE). Dysregulation of the Nrf2-ARE system has been identified in ALS models and human disease. Taking the Nrf2-ARE pathway as an attractive therapeutic target for neuroprotection in ALS, we aimed to identify CNS penetrating, small molecule activators of Nrf2-mediated transcription in a library of 2000 drugs and natural products. Compounds were screened extensively for Nrf2 activation, and antioxidant and neuroprotective properties in vitro. S[+]-Apomorphine, a receptor-inactive enantiomer of the clinically approved dopamine-receptor agonist (R[-]-apomorphine), was identified as a nontoxic Nrf2 activating molecule. In vivo S[+]-apomorphine demonstrated CNS penetrance, Nrf2 induction, and significant attenuation of motor dysfunction in the SOD1(G93A) transgenic mouse model of ALS. S[+]-apomorphine also reduced pathological oxidative stress and improved survival following an oxidative insult in fibroblasts from ALS patients. This molecule emerges as a promising candidate for evaluation as a potential neuroprotective agent in ALS patients in the clinic.

  12. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line

    SciTech Connect

    Park, Hae-Ryung Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential

  13. Overexpression of Nrf2 protects against microcystin-induced hepatotoxicity in mice.

    PubMed

    Lu, Yuan-Fu; Liu, Jie; Wu, Kai Connie; Qu, Qiang; Fan, Fang; Klaassen, Curtis D

    2014-01-01

    Oxidative stress and glutathione (GSH) depletion are implicated in mycocystin hepatotoxicity. To investigate the role of nuclear factor erythroid 2-related factor 2 (Nrf2) in microcystin-induced liver injury, Nrf2-null, wild-type, and Keap1-hepatocyte knockout (Keap1-HKO) mice were treated with microcystin (50 μg/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Microcystin increased serum alanine aminotransferase and aspartate aminotransferase activities, and caused extensive inflammation and necrosis in Nrf2-null and wild-type mice, but not in Keap1-HKO mice. Oxidative stress and inflammation are implicated in microcystin-induced hepatotoxicity, as evidenced by increased lipid peroxidation and increased expression of pro-inflammatory genes, such as neutrophil-specific chemokines mKC and MIP-2, and pro-inflammatory cytokines IL-1β and IL-6. The increased expression of these pro-inflammatory genes was attenuated in Keap1-HKO mice. Nrf2 and Nqo1 mRNA and protein were higher in Keap1-HKO mice at constitutive levels and after microcystin. To further investigate the mechanism of the protection, hepatic GSH and the mRNA of GSH-related enzymes were determined. Microcystin markedly depleted liver GSH by 60-70% in Nrf2 and WT mice but only 35% in Keap1-HKO mice. The mRNAs of GSH conjugation and peroxide reduction enzymes, such as Gstα1, Gstα4, Gstμ, and Gpx2 were higher in livers of Keap1-HKO mice, together with higher expression of the rate-limiting enzyme for GSH synthesis (Gclc). Organic anion transport polypeptides were increased by microcystin with the most increase in Keap1-HKO mice. In conclusion, this study demonstrates that higher basal levels of Nrf2 and GSH-related genes in Keap1-HKO mice prevented microcystin-induced oxidative stress and liver injury.

  14. Nuclear Factor Erythroid 2-Related Factor 2 Drives Podocyte-Specific Expression of Peroxisome Proliferator-Activated Receptor γ Essential for Resistance to Crescentic GN

    PubMed Central

    Bollee, Guillaume; Lenoir, Olivia; Dhaun, Neeraj; Camus, Marine; Chipont, Anna; Flosseau, Kathleen; Mandet, Chantal; Yamamoto, Masayuki; Karras, Alexandre; Thervet, Eric; Bruneval, Patrick; Nochy, Dominique; Mesnard, Laurent

    2016-01-01

    Necrotizing and crescentic rapidly progressive GN (RPGN) is a life-threatening syndrome characterized by a rapid loss of renal function. Evidence suggests that podocyte expression of the transcription factor peroxisome proliferator-activated receptor γ (PPARγ) may prevent podocyte injury, but the function of glomerular PPARγ in acute, severe inflammatory GN is unknown. Here, we observed marked loss of PPARγ abundance and transcriptional activity in glomerular podocytes in experimental RPGN. Blunted expression of PPARγ in podocyte nuclei was also found in kidneys from patients diagnosed with crescentic GN. Podocyte-specific Pparγ gene targeting accentuated glomerular damage, with increased urinary loss of albumin and severe kidney failure. Furthermore, a PPARγ gain-of-function approach achieved by systemic administration of thiazolidinedione (TZD) failed to prevent severe RPGN in mice with podocyte-specific Pparγ gene deficiency. In nuclear factor erythroid 2-related factor 2 (NRF2)–deficient mice, loss of podocyte PPARγ was observed at baseline. NRF2 deficiency markedly aggravated the course of RPGN, an effect that was partially prevented by TZD administration. Furthermore, delayed administration of TZD, initiated after the onset of RPGN, still alleviated the severity of experimental RPGN. These findings establish a requirement for the NRF2–PPARγ cascade in podocytes, and we suggest that these transcription factors have a role in augmenting the tolerance of glomeruli to severe immune-complex mediated injury. The NRF2–PPARγ pathway may be a therapeutic target for RPGN. PMID:25999406

  15. Betanin, a beetroot component, induces nuclear factor erythroid-2-related factor 2-mediated expression of detoxifying/antioxidant enzymes in human liver cell lines.

    PubMed

    Krajka-Kuźniak, Violetta; Paluszczak, Jarosław; Szaefer, Hanna; Baer-Dubowska, Wanda

    2013-12-01

    Our recent study has shown that beetroot juice protects against N-nitrosodimethylamine (NDEA)-induced liver injury and increases the activity of phase II enzymes, suggesting the activation of the nuclear factor erythroid-2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway. The aim of the present study was to further explore the mechanism of the activity of beetroot by evaluating the cytoprotective effects of its major component. The influence of betanin (BET) on the activation of Nrf2 and the expression of GSTA, GSTP, GSTM, GSTT, NQO1 and HO-1 was assessed in two hepatic cell lines: non-tumour THLE-2 and hepatoma-derived HepG2 cell lines. The level of the tumour suppressor p53 in both cell lines and the methylation of GSTP in HepG2 cells were also evaluated. Treatment of both cell lines with 2, 10 and 20 μm of BET resulted in the translocation of Nrf2 from the cytosol to the nucleus. The mRNA and nuclear protein levels of Nrf2 and the binding of Nrf2 to ARE sequences were increased only in the THLE-2 cells and were accompanied by the phosphorylation of serine/threonine kinase (AKT), c-Jun N-terminal kinase (JNK) and extracellular signal-regulated kinase (ERK). BET also significantly increased the mRNA and protein levels of GSTP, GSTT, GSTM and NQO1 in these cells. Conversely, besides the translocation of Nrf2 from the cytosol to the nucleus, BET did not modulate any of the other parameters measured in the HepG2 cells. BET did not change the methylation of GSTP1 in these cells either. These results indicate that BET through the activation of Nrf2 and subsequent induction of the expression of genes controlled by this factor may exert its hepatoprotective and anticarcinogenic effects. Moreover, the activation of mitogen-activated protein kinases may be responsible for the activation of Nrf2 in the THLE-2 cells.

  16. The role of Nrf2 in the attenuation of cardiovascular disease.

    PubMed

    Reuland, Danielle J; McCord, Joe M; Hamilton, Karyn L

    2013-07-01

    Oxidative stress is a component of many human diseases, including cardiovascular diseases (CVD). Exercise and various phytochemicals activate nuclear factor (erythroid-derived 2)-like 2 (Nrf2), the master regulator of antioxidant defenses, and attenuate CVD. This review highlights Nrf2 regulation by exercise and phytochemicals and the role of Nrf2 as a therapeutic target in CVD.

  17. Thyroid Hormone-Induced Cytosol-to-Nuclear Translocation of Rat Liver Nrf2 Is Dependent on Kupffer Cell Functioning

    PubMed Central

    Videla, Luis A.; Cornejo, Pamela; Romanque, Pamela; Santibáñez, Catherine; Castillo, Iván; Vargas, Romina

    2012-01-01

    L-3,3′,5-triiodothyronine (T3) administration upregulates nuclear factor-E2-related factor 2 (Nrf2) in rat liver, which is redox-sensitive transcription factor mediating cytoprotection. In this work, we studied the role of Kupffer cell respiratory burst activity, a process related to reactive oxygen species generation and liver homeostasis, in Nrf2 activation using the macrophage inactivator gadolinium chloride (GdCl3; 10 mg/kg i.v. 72 h before T3 [0.1 mg/kg i.p.]) or NADPH oxidase inhibitor apocynin (1.5 mmol/L added to the drinking water for 7 days before T3), and determinations were performed 2 h after T3. T3 increased nuclear/cytosolic Nrf2 content ratio and levels of heme oxygenase 1 (HO-1), catalytic subunit of glutamate cysteine ligase, and thioredoxin (Western blot) over control values, proteins whose gene transcription is induced by Nrf2. These changes were suppressed by GdCl3 treatment prior to T3, an agent-eliciting Kupffer-cell depletion, inhibition of colloidal carbon phagocytosis, and the associated respiratory burst activity, with enhancement in nuclear inhibitor of Nrf2 kelch-like ECH-associated protein 1 (Keap1)/Nrf2 content ratios suggesting Nrf2 degradation. Under these conditions, T3-induced tumor necrosis factor-α (TNF-α) response was eliminated by previous GdCl3 administration. Similar to GdCl3, apocynin given before T3 significantly reduced liver Nrf2 activation and HO-1 expression, a NADPH oxidase inhibitor eliciting abolishment of colloidal carbon-induced respiratory burst activity without altering carbon phagocytosis. It is concluded that Kupffer cell functioning is essential for upregulation of liver Nrf2-signaling pathway by T3. This contention is supported by suppression of the respiratory burst activity of Kupffer cells and the associated reactive oxygen species production by GdCl3 or apocynin given prior to T3, thus hindering Nrf2 activation. PMID:22649286

  18. Silica nanoparticles induce oxidative stress, inflammation, and endothelial dysfunction in vitro via activation of the MAPK/Nrf2 pathway and nuclear factor-κB signaling

    PubMed Central

    Guo, Caixia; Xia, Yinye; Niu, Piye; Jiang, Lizhen; Duan, Junchao; Yu, Yang; Zhou, Xianqing; Li, Yanbo; Sun, Zhiwei

    2015-01-01

    Despite the widespread application of silica nanoparticles (SiNPs) in industrial, commercial, and biomedical fields, their response to human cells has not been fully elucidated. Overall, little is known about the toxicological effects of SiNPs on the cardiovascular system. In this study, SiNPs with a 58 nm diameter were used to study their interaction with human umbilical vein endothelial cells (HUVECs). Dose- and time-dependent decrease in cell viability and damage on cell plasma-membrane integrity showed the cytotoxic potential of the SiNPs. SiNPs were found to induce oxidative stress, as evidenced by the significant elevation of reactive oxygen species generation and malondialdehyde production and downregulated activity in glutathione peroxidase. SiNPs also stimulated release of cytoprotective nitric oxide (NO) and upregulated inducible nitric oxide synthase (NOS) messenger ribonucleic acid, while downregulating endothelial NOS and ET-1 messenger ribonucleic acid, suggesting that SiNPs disturbed the NO/NOS system. SiNP-induced oxidative stress and NO/NOS imbalance resulted in endothelial dysfunction. SiNPs induced inflammation characterized by the upregulation of key inflammatory mediators, including IL-1β, IL-6, IL-8, TNFα, ICAM-1, VCAM-1, and MCP-1. In addition, SiNPs triggered the activation of the Nrf2-mediated antioxidant system, as evidenced by the induction of nuclear factor-κB and MAPK pathway activation. Our findings demonstrated that SiNPs could induce oxidative stress, inflammation, and NO/NOS system imbalance, and eventually lead to endothelial dysfunction via activation of the MAPK/Nrf2 pathway and nuclear factor-κB signaling. This study indicated a potential deleterious effect of SiNPs on the vascular endothelium, which warrants more careful assessment of SiNPs before their application. PMID:25759575

  19. Antimalarial Drug Artemether Inhibits Neuroinflammation in BV2 Microglia Through Nrf2-Dependent Mechanisms.

    PubMed

    Okorji, Uchechukwu P; Velagapudi, Ravikanth; El-Bakoush, Abdelmeneim; Fiebich, Bernd L; Olajide, Olumayokun A

    2016-11-01

    Artemether, a lipid-soluble derivative of artemisinin has been reported to possess anti-inflammatory properties. In this study, we have investigated the molecular mechanisms involved in the inhibition of neuroinflammation by the drug. The effects of artemether on neuroinflammation-mediated HT22 neuronal toxicity were also investigated in a BV2 microglia/HT22 neuron co-culture. To investigate effects on neuroinflammation, we used LPS-stimulated BV2 microglia treated with artemether (5-40 μM) for 24 h. ELISAs and western blotting were used to detect pro-inflammatory cytokines, nitric oxide, prostaglandin E2 (PGE2), inducible nitric oxide synthase (iNOS), cyclooxygenase (COX)-2 and microsomal prostaglandin E synthase-1 (mPGES-1). Beta-site amyloid precursor protein cleaving enzyme 1 (BACE-1) activity and Aβ levels were measured with ELISA kits. Protein levels of targets in nuclear factor kappa B (NF-κB) and p38 mitogen-activated protein kinase (MAPK) signalling, as well as heme oxygenase-1 (HO-1), NQO1 and nuclear factor-erythroid 2-related factor 2 (Nrf2) were also measured with western blot. NF-κB binding to the DNA was investigated using electrophoretic mobility shift assays (EMSA). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), DNA fragmentation and reactive oxygen species (ROS) assays in BV2-HT22 neuronal co-culture were used to evaluate the effects of artemether on neuroinflammation-induced neuronal death. The role of Nrf2 in the anti-inflammatory activity of artemether was investigated in BV2 cells transfected with Nrf2 siRNA. Artemether significantly suppressed pro-inflammatory mediators (NO/iNOS, PGE2/COX-2/mPGES-1, tumour necrosis factor-alpha (TNFα) and interleukin (IL)-6); Aβ and BACE-1 in BV2 cells following LPS stimulation. These effects of artemether were shown to be mediated through inhibition of NF-κB and p38 MAPK signalling. Artemether produced increased levels of HO-1, NQO1 and GSH in BV2 microglia. The drug activated

  20. Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients

    PubMed Central

    Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

    2016-01-01

    The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of NAD(P)H:quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients. PMID:27274779

  1. The Nrf2/ARE Pathway: A Promising Target to Counteract Mitochondrial Dysfunction in Parkinson's Disease

    PubMed Central

    Tufekci, Kemal Ugur; Civi Bayin, Ezgi; Genc, Sermin; Genc, Kursad

    2011-01-01

    Mitochondrial dysfunction is a prominent feature of various neurodegenerative diseases as strict regulation of integrated mitochondrial functions is essential for neuronal signaling, plasticity, and transmitter release. Many lines of evidence suggest that mitochondrial dysfunction plays a central role in the pathogenesis of Parkinson's disease (PD). Several PD-associated genes interface with mitochondrial dynamics regulating the structure and function of the mitochondrial network. Mitochondrial dysfunction can induce neuron death through a plethora of mechanisms. Both mitochondrial dysfunction and neuroinflammation, a common denominator of PD, lead to an increased production of reactive oxygen species, which are detrimental to neurons. The transcription factor nuclear factor E2-related factor 2 (Nrf2, NFE2L2) is an emerging target to counteract mitochondrial dysfunction and its consequences in PD. Nrf2 activates the antioxidant response element (ARE) pathway, including a battery of cytoprotective genes such as antioxidants and anti-inflammatory genes and several transcription factors involved in mitochondrial biogenesis. Here, the current knowledge about the role of mitochondrial dysfunction in PD, Nrf2/ARE stress-response mechanisms, and the evidence for specific links between this pathway and PD are summarized. The neuroprotection of nigral dopaminergic neurons by the activation of Nrf2 through several inducers in PD is also emphasized as a promising therapeutic approach. PMID:21403858

  2. Xanthohumol induces phase II enzymes via Nrf2 in human hepatocytes in vitro.

    PubMed

    Krajka-Kuźniak, Violetta; Paluszczak, Jarosław; Baer-Dubowska, Wanda

    2013-02-01

    The aim of this study was to investigate whether xanthohumol may exert chemoprotective activity through the modulation of the nuclear factor erythroid-2-related factor 2 (Nrf2) pathway in immortalized normal THLE-2 hepatocytes and a hepatocellular carcinoma HepG2 cell line. Cells were incubated in the presence of xanthohumol and the activation of Nrf2 and expression of genes controlled by this transcription factor were evaluated. Additionally, p53 level was assessed. Xanthohumol increased the expression and led to the activation of Nrf2 in both cell lines. However, in contrast to normal cells the expression of genes controlled by this transcription factor was not affected in HepG2 cells, except for GSTA and GSTP. Xanthohumol, beside the induction of GSTs and HO-1, significantly elevated NQO1 expression in concert with p53 level in normal hepatocytes. The activation of Nrf2 pathway and subsequently phase II enzymes in concert with p53 induction in normal hepatocytes may account for the molecular mechanism of the chemopreventive activity of xanthohumol. On the other hand its cytotoxicity towards HCC cells shown in this study indicates that it may also be considered as potentially chemotherapeutic.

  3. Prolonged metformin treatment leads to reduced transcription of Nrf2 and neurotrophic factors without cognitive impairment in older C57BL/6J mice.

    PubMed

    Allard, Joanne S; Perez, Evelyn J; Fukui, Koji; Carpenter, Priscilla; Ingram, Donald K; de Cabo, Rafael

    2016-03-15

    Long-term use of anti-diabetic agents has become commonplace as rates of obesity, metabolic syndrome and diabetes continue to escalate. Metformin, a commonly used anti-diabetic drug, has been shown to have many beneficial effects outside of its therapeutic regulation of glucose metabolism and insulin sensitivity. Studies on metformin's effects on the central nervous system are limited and predominantly consist of in vitro studies and a few in vivo studies with short-term treatment in relatively young animals; some provide support for metformin as a neuroprotective agent while others show evidence that metformin may be deleterious to neuronal survival. In this study, we examined the effect of long-term metformin treatment on brain neurotrophins and cognition in aged male C57Bl/6 mice. Mice were fed control (C), high-fat (HF) or a high-fat diet supplemented with metformin (HFM) for 6 months. Metformin decreased body fat composition and attenuated declines in motor function induced by a HF diet. Performance in the Morris water maze test of hippocampal based memory function, showed that metformin prevented impairment of spatial reference memory associated with the HF diet. Quantitative RT-PCR on brain homogenates revealed decreased transcription of BDNF, NGF and NTF3; however protein levels were not altered. Metformin treatment also decreased expression of the antioxidant pathway regulator, Nrf2. The decrease in transcription of neurotrophic factors and Nrf2 with chronic metformin intake, cautions of the possibility that extended metformin use may alter brain biochemistry in a manner that creates a vulnerable brain environment and warrants further investigation.

  4. Prolonged metformin treatment leads to reduced transcription of Nrf2 and neurotrophic factors without cognitive impairment in older C57BL/6J mice

    PubMed Central

    Allard, Joanne S.; Perez, Evelyn J; Fukui, Koji; Carpenter, Priscilla; Ingram, Donald K.; de Cabo, Rafael

    2016-01-01

    Long-term use of anti-diabetic agents has become commonplace as rates of obesity, metabolic syndrome and diabetes continue to escalate. Metformin, a commonly used anti-diabetic drug, has been shown to have many beneficial effects outside of its therapeutic regulation of glucose metabolism and insulin sensitivity. Studies on metformin’s effects on the central nervous system are limited and predominantly consist of in vitro studies and a few in vivo studies with short-term treatment in relatively young animals; some provide support for metformin as a neuroprotective agent while others show evidence that metformin may be deleterious to neuronal survival. In this study, we examined the effect of long-term metformin treatment on brain neurotrophins and cognition in aged male C57Bl/6 mice. Mice were fed control (C), high-fat (HF) or a high-fat diet supplemented with metformin (HFM) for 6 months. Metformin decreased body fat composition and attenuated declines in motor function induced by a HF diet. Performance in the Morris water maze test of hippocampal based memory function, showed that metformin prevented impairment of spatial reference memory associated with the HF diet. Quantitative RT-PCR on brain homogenates revealed decreased transcription of BDNF, NGF and NTF3; however protein levels were not altered. Metformin treatment also decreased expression of the antioxidant pathway regulator, Nrf2. The decrease in transcription of neurotrophic factors and Nrf2 with chronic metformin intake, cautions of the possibility that extended metformin use may alter brain biochemistry in a manner that creates a vulnerable brain environment and warrants further investigation. PMID:26698400

  5. l-carnitine protects human hepatocytes from oxidative stress-induced toxicity through Akt-mediated activation of Nrf2 signaling pathway.

    PubMed

    Li, Jinlian; Zhang, Yanli; Luan, Haiyun; Chen, Xuehong; Han, Yantao; Wang, Chunbo

    2016-05-01

    In our previous study, l-carnitine was shown to have cytoprotective effect against hydrogen peroxide (H2O2)-induced injury in human normal HL7702 hepatocytes. The aim of this study was to investigate whether the protective effect of l-carnitine was associated with the nuclear factor erythroid 2 (NFE2)-related factor 2 (Nrf2) pathway. Our results showed that pretreatment with l-carnitine augmented Nrf2 nuclear translocation, DNA binding activity and heme oxygenase-1 (HO-1) expression in H2O2-treated HL7702 cells, although l-carnitine treatment alone had no effect on them. Analysis using Nrf2 siRNA demonstrated that Nrf2 activation was involved in l-carnitine-induced HO-1 expression. In addition, l-carnitine-mediated protection against H2O2 toxicity was abrogated by Nrf2 siRNA, indicating the important role of Nrf2 in l-carnitine-induced cytoprotection. Further experiments revealed that l-carnitine pretreatment enhanced the phosphorylation of Akt in H2O2-treated cells. Blocking Akt pathway with inhibitor partly abrogated the protective effect of l-carnitine. Moreover, our finding demonstrated that the induction of Nrf2 translocation and HO-1 expression by l-carnitine directly correlated with the Akt pathway because Akt inhibitor showed inhibitory effects on the Nrf2 translocation and HO-1 expression. Altogether, these results demonstrate that l-carnitine protects HL7702 cells against H2O2-induced cell damage through Akt-mediated activation of Nrf2 signaling pathway.

  6. Pyrazole induced oxidative liver injury independent of CYP2E1/2A5 induction due to Nrf2 deficiency.

    PubMed

    Lu, Yongke; Gong, Pengfei; Cederbaum, Arthur I

    2008-10-30

    Pyrazole can induce CYP2E1 and 2A5, which produce reactive oxygen species (ROS). Nuclear factor erythroid 2-related factor 2 (Nrf2) regulates important antioxidant enzymes to remove ROS. In this study, we applied Nrf2 knockout mice to test the hypothesis that pyrazole will cause hepatotoxicity and elevate oxidative stress to a greater extent in Nrf2 knockout mice compared to wild type mice. Pyrazole induced severe oxidative liver damage in Nrf2 knockout mice but not in wild type mice. Activities and levels of CYP2E1 and 2A5 were elevated by pyrazole in the wild type mice but not in the Nrf2 knockout mice. However, expression or activity of Nrf2-regulated antioxidant enzymes, such as gamma-glutamylcysteine synthetase (GCS), heme oxygenase-1 (HO-1) and glutathione-S-transferase (GST), were upregulated in the pyrazole-treated wild type mice, but to a lesser extent or not at all in the pyrazole-treated Nrf2 knockout mice. Treatment with antioxidants such as vitamin C or S-adenosyl-l-methionine (SAM) or an inhibitor of iNOS prevented the pyrazole-induced oxidative liver damage, thus validating the role of oxidative/nitrosative stress in the pyrazole induced liver injury to the Nrf2 knockout mice. In summary, even though ROS-producing CYP2E1/2A5 were not elevated by pyrazole, impaired antioxidant capacity resulting from Nrf2 deficiency appear to be sufficient to promote pyrazole-induced oxidative liver injury.

  7. Nrf2 reduces levels of phosphorylated tau protein by inducing autophagy adaptor protein NDP52

    NASA Astrophysics Data System (ADS)

    Jo, Chulman; Gundemir, Soner; Pritchard, Susanne; Jin, Youngnam N.; Rahman, Irfan; Johnson, Gail V. W.

    2014-03-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a pivotal transcription factor in the defence against oxidative stress. Here we provide evidence that activation of the Nrf2 pathway reduces the levels of phosphorylated tau by induction of an autophagy adaptor protein NDP52 (also known as CALCOCO2) in neurons. The expression of NDP52, which we show has three antioxidant response elements (AREs) in its promoter region, is strongly induced by Nrf2, and its overexpression facilitates clearance of phosphorylated tau in the presence of an autophagy stimulator. In Nrf2-knockout mice, phosphorylated and sarkosyl-insoluble tau accumulates in the brains concurrent with decreased levels of NDP52. Moreover, NDP52 associates with phosphorylated tau from brain cortical samples of Alzheimer disease cases, and the amount of phosphorylated tau in sarkosyl-insoluble fractions is inversely proportional to that of NDP52. These results suggest that NDP52 plays a key role in autophagy-mediated degradation of phosphorylated tau in vivo.

  8. Resveratrol protects spinal cord dorsal column from hypoxic injury by activating Nrf-2.

    PubMed

    Kesherwani, V; Atif, F; Yousuf, S; Agrawal, S K

    2013-06-25

    Damage from oxidative stress plays a critical role in spinal cord injury. Nuclear factor erythroid 2-related factor (Nrf-2) signaling pathway can be activated by cellular oxidative stress. Resveratrol, a plant-derived polyphenolic compound found in red wine, has antioxidant properties. In the present study, we have examined the neuroprotective effect of resveratrol and the role of Nrf-2 in spinal cord hypoxic injury. The spinal cord was removed from adult male Wistar rats from T2-T10 and the dorsal column was used to induce hypoxic injury in vitro with and without treatment with resveratrol (50μM). Significant changes were found in the compound action potential (CAP) of spinal cord dorsal column, and hematoxyline and eosin (H&E) staining showed that resveratrol significantly improved neuronal injury. The biochemical assays showed significant changes in lipid peroxidase (LPO), reduced glutathione (GSH), superoxide dismutase (SOD), protein carbonyl (PC), mitochondrial ATP content, and mitochondrial Ca(++). Furthermore, using immunohistochemistry and Western blot, we found that after resveratrol treatment during hypoxic injury there was a significant activation of NrF-2 and down regulation of the glial fibrillary acidic protein (GFAP) content. The results show that resveratrol treatment has neuroprotective effects on CAP, Ca(++) loading, and biochemical parameters after hypoxic injury. The neuroprotective effect is likely to be exerted by increased activation of transcription factor Nrf-2 by resveratrol along with its direct antioxidant effect to ameliorate the oxidative damage and preserve mitochondrial function.

  9. Network Inference Algorithms Elucidate Nrf2 Regulation of Mouse Lung Oxidative Stress

    PubMed Central

    Singhal, Mudita; Malhotra, Deepti; Biswal, Shyam

    2008-01-01

    A variety of cardiovascular, neurological, and neoplastic conditions have been associated with oxidative stress, i.e., conditions under which levels of reactive oxygen species (ROS) are elevated over significant periods. Nuclear factor erythroid 2-related factor (Nrf2) regulates the transcription of several gene products involved in the protective response to oxidative stress. The transcriptional regulatory and signaling relationships linking gene products involved in the response to oxidative stress are, currently, only partially resolved. Microarray data constitute RNA abundance measures representing gene expression patterns. In some cases, these patterns can identify the molecular interactions of gene products. They can be, in effect, proxies for protein–protein and protein–DNA interactions. Traditional techniques used for clustering coregulated genes on high-throughput gene arrays are rarely capable of distinguishing between direct transcriptional regulatory interactions and indirect ones. In this study, newly developed information-theoretic algorithms that employ the concept of mutual information were used: the Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNE), and Context Likelihood of Relatedness (CLR). These algorithms captured dependencies in the gene expression profiles of the mouse lung, allowing the regulatory effect of Nrf2 in response to oxidative stress to be determined more precisely. In addition, a characterization of promoter sequences of Nrf2 regulatory targets was conducted using a Support Vector Machine classification algorithm to corroborate ARACNE and CLR predictions. Inferred networks were analyzed, compared, and integrated using the Collective Analysis of Biological Interaction Networks (CABIN) plug-in of Cytoscape. Using the two network inference algorithms and one machine learning algorithm, a number of both previously known and novel targets of Nrf2 transcriptional activation were identified. Genes predicted as

  10. Mechanisms and functions of Nrf2 signaling in Drosophila.

    PubMed

    Pitoniak, Andrew; Bohmann, Dirk

    2015-11-01

    The Nrf2 transcription factor belongs to the Cap'n'collar family, named after the founding member of this group, the product of the Drosophila Cap'n'collar gene. The encoded protein, Cap'n'collar, abbreviated Cnc, offers a convenient and accessible model to study the structure, function, and biology of Nrf2 transcription factors at the organismic, tissular, cellular, and molecular levels, using the powerful genetic, genomic, and biochemical tools available in Drosophila. In this review we provide an account of the original identification of Cnc as a regulator of embryonic development. We then describe the discovery of Nrf2-like functions of Cnc and its role in acute stress signaling and aging. The establishment of Drosophila as a model organism in which the mechanisms and functions of Nrf2 signaling can be studied has led to several discoveries: the regulation of stem cell activity by an Nrf2-mediated redox mechanism, the interaction of Nrf2 with p62 and Myc in the control of tissue growth and the unfolded protein response, and more. Several of these more recent lines of investigation are highlighted. Model organisms such as the fly and the worm remain powerful experimental platforms that can help to unravel the many remaining puzzles regarding the role of Nrf2 and its relatives in controlling the physiology and maintaining the health of multicellular organisms.

  11. Oxidative stress indicated by elevated expression of Nrf2 and 8-OHdG promotes hepatocellular carcinoma progression.

    PubMed

    Ma-On, Chakriwong; Sanpavat, Anapat; Whongsiri, Patcharawalai; Suwannasin, Surasit; Hirankarn, Nattiya; Tangkijvanich, Pisit; Boonla, Chanchai

    2017-04-01

    Reactive oxygen species (ROS) is excessively generated in tumors creating an oxidative stress in tumor microenvironment. We investigated hepatic expression of nuclear factor erythroid 2-related factor 2 (Nrf2) and 8-hydroxydeoxyguanosine (8-OHdG) in hepatocellular carcinoma (HCC) patients, and asked if ROS epigenetically upregulated Nrf2 and enhanced aggressiveness in HCC cells. Expression of Nrf2 (n = 100) and 8-OHdG (n = 53) was remarkably increased in HCC tissues compared with the noncancerous hepatic tissues. Elevated expression of 8-OHdG was associated with poor survival in HCC patients. H2O2, as ROS representative, provoked oxidative stress in HepG2 cells, indicated by increased protein carbonyl content and decreased total antioxidant capacity. Nrf2 expression and 8-OHdG formation were markedly increased in the H2O2-treated cells compared with the untreated control. Co-treatment with antioxidants, tocopheryl acetate (TA) and S-adenosylmethionine (SAM) effectively attenuated expression of Nrf2 and 8-OHdG in H2O2-treated cells. HepG2 cells treated with H2O2 had significantly higher migration and invasion capabilities than the untreated control cells, and this aggressiveness was significantly inhibited by TA and SAM. Bisulfite sequencing revealed that CpG dinucleotides in Nrf2 promoter were unmethylated in the H2O2-treated cells similar to the untreated control. In conclusion, robust histological evidence of increased antioxidative response and oxidative DNA damage in human HCC tissues was demonstrated. Elevated oxidative DNA lesion 8-OHdG was associated with shorter survival. Experimentally, ROS enhanced Nrf2 expression, 8-OHdG formation and tumor progression in HCC cells. These effects were inhibited by antioxidants. Therefore, oxidative stress-reducing regimens might be beneficial to diminish the ROS-induced HCC progression.

  12. miR-144 reverses chemoresistance of hepatocellular carcinoma cell lines by targeting Nrf2-dependent antioxidant pathway.

    PubMed

    Zhou, Suna; Ye, Wenguang; Zhang, Yanjun; Yu, Dequan; Shao, Qiuju; Liang, Jun; Zhang, Mingxin

    2016-01-01

    Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide. Chemoresistance occurrence is a major cause of treatment failure in HCC. Currently, extensive research has revealed diverse mechanisms for chemoresistance, but the molecular mechanisms underlying the role of miRNAs in resistance to 5-FU are not confirmed in HCC cells. By quantitative real-time polymerase chain reaction (qRT-PCR) analysis, we found that miR-144 was significantly decreased in HCC cell lines. It has been further demonstrated that miR-144 were significantly down-regulated in Bel-7402/5-FU cells compared with parental Bel-7402 cells by qRT-PCR and western blot. The expression of Nrf2 was reversely correlated to that of miR-144 in HCC cells. Moreover, Enhancement of 5-FU-induced cytotoxicity and apoptosis are resulted from the transfection with miR-144 mimics in Bel-7402/5-FU cells. Mechanically, miR-144 promoted nuclear factor erythroid-2-related factor-2 (Nrf2) mRNA degradation by directly targeting the Nrf2 3'untranslated region (3'UTR). In addition, ectopic expression of miR-144 in Bel-7402/5-FU cells reduced the levels of Nrf2 and inhibited the transcription of Nrf2-dependent HO-1 gene, thus contributing to 5-FU sensibilization. Conversely, re-expression of Nrf2 partly attenuated the chemosensibilization of miR-144. Our study showed that miR-144 serves as a potential chemoresistance-reversal agent in hepatocellular carcinoma cells, which is at least partly due to the down-regulation of Nrf2-dependent antioxidant pathway.

  13. Ursolic acid sensitizes cisplatin-resistant HepG2/DDP cells to cisplatin via inhibiting Nrf2/ARE pathway

    PubMed Central

    Wu, Shouhai; Zhang, Tianpeng; Du, Jingsheng

    2016-01-01

    Background Combinations of adjuvant sensitizers with anticancer drugs is a promising new strategy to reverse chemoresistance. Ursolic acid (UA) is one of the natural pentacyclic triterpene compounds known to have many pharmacological characteristics such as anti-inflammatory and anticancer properties. This study investigates whether UA can sensitize hepatocellular carcinoma cells to cisplatin. Materials and methods Cells were transfected with nuclear factor erythroid-2-related factor 2 (Nrf2) small interfering RNA and Nrf2 complementary DNA by using Lipofectin 2000. The cytotoxicity of cells was investigated by Cell Counting Kit 8 assay. Cell apoptosis, cell cycle, reactive oxygen species, and mitochondrial membrane potential were detected by flow cytometry fluorescence-activated cell sorting. The protein level of Nrf2, NAD(P)H quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and heme oxygenase-1 (HO-1) was detected by Western blot analysis. Results The results showed that the reverse index was 2.9- and 9.69-fold by UA of 1.125 μg/mL and 2.25 μg/mL, respectively, for cisplatin to HepG2/DDP cells. UA–cisplatin combination induced cell apoptosis and reactive oxygen species, blocked the cell cycle in G0/G1 phase, and reduced the mitochondrial membrane potential. Mechanistically, UA–cisplatin dramatically decreased the expression of Nrf2 and its downstream genes. The sensibilization of UA–cisplatin combination was diminished in Nrf2 small interfering RNA-transfected HepG2/DDP cells, as well as in Nrf2 complementary DNA-transfected HepG2/DDP cells. Conclusion The results confirmed the sensibilization of UA on HepG2/DDP cells to cisplatin, which was possibly mediated via the Nrf2/antioxidant response element pathway. PMID:27822011

  14. miR-144 reverses chemoresistance of hepatocellular carcinoma cell lines by targeting Nrf2-dependent antioxidant pathway

    PubMed Central

    Zhou, Suna; Ye, Wenguang; Zhang, Yanjun; Yu, Dequan; Shao, Qiuju; Liang, Jun; Zhang, Mingxin

    2016-01-01

    Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide. Chemoresistance occurrence is a major cause of treatment failure in HCC. Currently, extensive research has revealed diverse mechanisms for chemoresistance, but the molecular mechanisms underlying the role of miRNAs in resistance to 5-FU are not confirmed in HCC cells. By quantitative real-time polymerase chain reaction (qRT-PCR) analysis, we found that miR-144 was significantly decreased in HCC cell lines. It has been further demonstrated that miR-144 were significantly down-regulated in Bel-7402/5-FU cells compared with parental Bel-7402 cells by qRT-PCR and western blot. The expression of Nrf2 was reversely correlated to that of miR-144 in HCC cells. Moreover, Enhancement of 5-FU-induced cytotoxicity and apoptosis are resulted from the transfection with miR-144 mimics in Bel-7402/5-FU cells. Mechanically, miR-144 promoted nuclear factor erythroid-2-related factor-2 (Nrf2) mRNA degradation by directly targeting the Nrf2 3’untranslated region (3’UTR). In addition, ectopic expression of miR-144 in Bel-7402/5-FU cells reduced the levels of Nrf2 and inhibited the transcription of Nrf2-dependent HO-1 gene, thus contributing to 5-FU sensibilization. Conversely, re-expression of Nrf2 partly attenuated the chemosensibilization of miR-144. Our study showed that miR-144 serves as a potential chemoresistance-reversal agent in hepatocellular carcinoma cells, which is at least partly due to the down-regulation of Nrf2-dependent antioxidant pathway. PMID:27508019

  15. The Dual Role of Nrf2 in Nonalcoholic Fatty Liver Disease: Regulation of Antioxidant Defenses and Hepatic Lipid Metabolism.

    PubMed

    Chambel, Sílvia S; Santos-Gonçalves, Andreia; Duarte, Tiago L

    2015-01-01

    Nonalcoholic fatty liver disease (NAFLD) is a progressive liver disease with ever-growing incidence in the industrialized world. It starts with the simple accumulation of lipids in the hepatocyte and can progress to the more severe nonalcoholic steatohepatitis (NASH), which is associated with inflammation, fibrosis, and cirrhosis. There is increasing awareness that reactive oxygen species and electrophiles are implicated in the pathogenesis of NASH. Transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) is a positive regulator of the expression of a battery of genes involved in the protection against oxidative/electrophilic stress. In rodents, Nrf2 is also known to participate in hepatic fatty acid metabolism, as a negative regulator of genes that promote hepatosteatosis. We review relevant evidence in the literature that these two mechanisms may contribute to the protective role of Nrf2 in the development of hepatic steatosis and in the progression to steatohepatitis, particularly in young animals. We propose that age may be a key to explain contradictory findings in the literature. In summary, Nrf2 mediates the crosstalk between lipid metabolism and antioxidant defense mechanisms in experimental models of NAFLD, and the nutritional or pharmacological induction of Nrf2 represents a promising potential new strategy for its prevention and treatment.

  16. The Dual Role of Nrf2 in Nonalcoholic Fatty Liver Disease: Regulation of Antioxidant Defenses and Hepatic Lipid Metabolism

    PubMed Central

    Chambel, Sílvia S.; Santos-Gonçalves, Andreia; Duarte, Tiago L.

    2015-01-01

    Nonalcoholic fatty liver disease (NAFLD) is a progressive liver disease with ever-growing incidence in the industrialized world. It starts with the simple accumulation of lipids in the hepatocyte and can progress to the more severe nonalcoholic steatohepatitis (NASH), which is associated with inflammation, fibrosis, and cirrhosis. There is increasing awareness that reactive oxygen species and electrophiles are implicated in the pathogenesis of NASH. Transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) is a positive regulator of the expression of a battery of genes involved in the protection against oxidative/electrophilic stress. In rodents, Nrf2 is also known to participate in hepatic fatty acid metabolism, as a negative regulator of genes that promote hepatosteatosis. We review relevant evidence in the literature that these two mechanisms may contribute to the protective role of Nrf2 in the development of hepatic steatosis and in the progression to steatohepatitis, particularly in young animals. We propose that age may be a key to explain contradictory findings in the literature. In summary, Nrf2 mediates the crosstalk between lipid metabolism and antioxidant defense mechanisms in experimental models of NAFLD, and the nutritional or pharmacological induction of Nrf2 represents a promising potential new strategy for its prevention and treatment. PMID:26120584

  17. Silymarin protects against acrylamide-induced neurotoxicity via Nrf2 signalling in PC12 cells.

    PubMed

    Li, Liang; Sun, Hong-Yang; Liu, Wei; Zhao, Hong-Yu; Shao, Mei-Li

    2017-04-01

    Silymarin (SM) is a well-known antioxidant, anti-inflammatory and anti-cancer compound extracted from the milk thistle. Here, we investigated the protective effect of SM against acrylamide (AA)-induced neurotoxicity, mainly caused by oxidative stress, via activation of the nuclear transcription factor E2-related factor 2 (Nrf2) signalling pathway in PC12 cells. The MTT reduction assay was used to measure cell viability in various drug-treated groups and demonstrated that SM could increase cell viability in AA-treated PC12 cells. We then measured the reactive oxygen species (ROS) levels by the peroxide-sensitive fluorescent probe DCFH-DA and intracellular glutathione (GSH) and malondialdehyde (MDA) levels by absorption spectrophotometry. Our data revealed that SM could reduce ROS and MDA levels and increase GSH levels in AA-induced PC12 cells. To identify a potential mechanism for SM-induced protection, we measured the mRNA and protein expression levels of Nrf2 and its downstream target antioxidants glutathione peroxidase (Gpx), glutamate cysteine ligase catalytic subunit (GCLC) and glutamate cysteine ligase modifier subunit (GCLM) by quantitative real-time PCR and Western blot, respectively. The results suggested that SM could activate Nrf2 signalling and increase the expression of Nrf2, Gpx, GCLC and GCLM in AA-treated PC12 cells. In conclusion, SM can effectively alleviate AA-induced neurotoxicity in PC12 cells.

  18. Lutein Has a Protective Effect on Hepatotoxicity Induced by Arsenic via Nrf2 Signaling

    PubMed Central

    Li, Shugang; Ding, Yusong; Niu, Qiang; Xu, Shangzhi; Pang, Lijuan; Ma, Rulin; Jing, Mingxia; Feng, Gangling; Tang, Jing Xia; Zhang, Qian; Ma, Xiaomei; Yan, Yizhong; Wang, Hai Xia; Li, Feng; Guo, Shuxia

    2015-01-01

    Arsenic produces liver disease through the oxidative stress. While lutein can alleviate cytotoxic and oxidative injury, nuclear factor erythroid 2-related factor 2 (Nrf2) pathway plays a critical role in defending oxidative species. However, the mechanisms by which lutein protects the liver against the effect of arsenic are not known. Therefore, this study aims to investigate the mechanisms involved in the action of lutein using mice model in which hepatotoxicity was induced by arsenic. We found that mice treatment with lutein could reverse changes in morphological and liver indexes and result in a significant improvement in hepatic function comparing with arsenic trioxide group. Lutein treatment improved the activities of antioxidant enzymes and attenuated increasing of ROS and MDA induced by arsenic trioxide. Lutein could increase the mRNA and protein expression of Nrf2 signaling related genes (Nrf2, Nqo1, Ho-1, and Gst). These findings provide additional evidence that lutein may be useful for reducing reproductive injury associated with oxidative stress by the activation of Nrf2 signaling. Our findings suggest a possible mechanism of antioxidant lutein in preventing the hepatotoxicity, which implicate that a dietary lutein may be a potential treatment for liver diseases, especially for arsenicosis therapy. PMID:25815309

  19. Lutein has a protective effect on hepatotoxicity induced by arsenic via Nrf2 signaling.

    PubMed

    Li, Shugang; Ding, Yusong; Niu, Qiang; Xu, Shangzhi; Pang, Lijuan; Ma, Rulin; Jing, Mingxia; Feng, Gangling; Tang, Jing Xia; Zhang, Qian; Ma, Xiaomei; Yan, Yizhong; Zhang, Jingyu; Wei, Meng; Wang, Hai Xia; Li, Feng; Guo, Shuxia

    2015-01-01

    Arsenic produces liver disease through the oxidative stress. While lutein can alleviate cytotoxic and oxidative injury, nuclear factor erythroid 2-related factor 2 (Nrf2) pathway plays a critical role in defending oxidative species. However, the mechanisms by which lutein protects the liver against the effect of arsenic are not known. Therefore, this study aims to investigate the mechanisms involved in the action of lutein using mice model in which hepatotoxicity was induced by arsenic. We found that mice treatment with lutein could reverse changes in morphological and liver indexes and result in a significant improvement in hepatic function comparing with arsenic trioxide group. Lutein treatment improved the activities of antioxidant enzymes and attenuated increasing of ROS and MDA induced by arsenic trioxide. Lutein could increase the mRNA and protein expression of Nrf2 signaling related genes (Nrf2, Nqo1, Ho-1, and Gst). These findings provide additional evidence that lutein may be useful for reducing reproductive injury associated with oxidative stress by the activation of Nrf2 signaling. Our findings suggest a possible mechanism of antioxidant lutein in preventing the hepatotoxicity, which implicate that a dietary lutein may be a potential treatment for liver diseases, especially for arsenicosis therapy.

  20. Beyond antioxidant genes in the ancient NRF2 regulatory network

    PubMed Central

    Lacher, Sarah E.; Lee, Joslynn S.; Wang, Xuting; Campbell, Michelle R.; Bell, Douglas A.; Slattery, Matthew

    2016-01-01

    NRF2, a basic leucine zipper transcription factor encoded by the gene NFE2L2, is a master regulator of the transcriptional response to oxidative stress. NRF2 is structurally and functionally conserved from insects to humans, and it heterodimerizes with the small MAF transcription factors to bind a consensus DNA sequence (the antioxidant response element, or ARE) and regulate gene expression. We have used genome-wide chromatin immunoprecipitation (ChIP-seq) and gene expression data to identify direct NRF2 target genes in Drosophila and humans. These data have allowed us to construct the deeply conserved ancient NRF2 regulatory network – target genes that are conserved from Drosophila to human. The ancient network consists of canonical antioxidant genes, as well as genes related to proteasomal pathways, metabolism, and a number of less expected genes. We have also used enhancer reporter assays and electrophoretic mobility shift assays to confirm NRF2-mediated regulation of ARE (antioxidant response element) activity at a number of these novel target genes. Interestingly, the ancient network also highlights a prominent negative feedback loop; this, combined with the finding that and NRF2-mediated regulatory output is tightly linked to the quality of the ARE it is targeting, suggests that precise regulation of nuclear NRF2 concentration is necessary to achieve proper quantitative regulation of distinct gene sets. Together, these findings highlight the importance of balance in the NRF2-ARE pathway, and indicate that NRF2-mediated regulation of xenobiotic metabolism, glucose metabolism, and proteostasis have been central to this pathway since its inception. PMID:26163000

  1. Curcumin Protects Human Keratinocytes against Inorganic Arsenite-Induced Acute Cytotoxicity through an NRF2-Dependent Mechanism

    PubMed Central

    Zhao, Rui; Yang, Bei; Wang, Linlin; Xue, Peng; Deng, Baocheng; Zhang, Guohua; Jiang, Shukun; Zhang, Miao; Liu, Min; Pi, Jingbo; Guan, Dawei

    2013-01-01

    Human exposure to inorganic arsenic leads to various dermal disorders, including hyperkeratosis and skin cancer. Curcumin is demonstrated to induce remarkable antioxidant activity in a variety of cells and tissues. The present study aimed at identifying curcumin as a potent activator of nuclear factor erythroid 2-related factor 2 (NRF2) and demonstrating its protective effect against inorganic arsenite- (iAs3+-) induced cytotoxicity in human keratinocytes. We found that curcumin led to nuclear accumulation of NRF2 protein and increased the expression of antioxidant response element- (ARE-) regulated genes in HaCaT keratinocytes in concentration- and time-dependent manners. High concentration of curcumin (20 μM) also increased protein expression of long isoforms of NRF1. Treatment with low concentrations of curcumin (2.5 or 5 μM) effectively increased the viability and survival of HaCaT cells against iAs3+-induced cytotoxicity as assessed by the MTT assay and flow cytometry and also attenuated iAs3+-induced expression of cleaved caspase-3 and cleaved PARP protein. Selective knockdown of NRF2 or KEAP1 by lentiviral shRNAs significantly diminished the cytoprotection conferred by curcumin, suggesting that the protection against iAs3+-induced cytotoxicity is dependent on the activation of NRF2. Our results provided a proof of the concept of using curcumin to activate the NRF2 pathway to alleviate arsenic-induced dermal damage. PMID:23710286

  2. Taurine protects against As2O3-induced autophagy in pancreas of rat offsprings through Nrf2/Trx pathway.

    PubMed

    Bai, Jie; Yao, Xiaofeng; Jiang, Liping; Qiu, Tianming; Liu, Shuang; Qi, Baoxu; Zheng, Yue; Kong, Yuan; Yang, Guang; Chen, Min; Liu, Xiaofang; Sun, Xiance

    2016-04-01

    Arsenic was increasingly to blame as a risk factor for type 2 diabetes mellitus. In our previous study, we had found iAs stimulated autophagic flux and caused autophagic cell death through ROS pathway in INS-1 cells. Since NF-E2-related factor 2 (Nrf2) and the thioredoxin (Trx) system was a crucial line of defense against ROS, we investigated whether Nrf2/Trx pathway contributed to As2O3-stimulated autophagy and the role of taurine in this study. After treatment with 2 mg/kg BW-8 mg/kg BW As2O3 for 57 d, the expression of Nrf2 protein was decreased significantly in offsprings' pancreas. The expression of Trx gene was decreased significantly in pancreas subsequently. Finally, the generation of reactive oxygen species stimulated autophagy in arsenic-treated pancreas. Taurine could reverse arsenic-inhibited Nrf2 and Trx and inhibit autophagy. In short, inhibition of Nrf2/Trx pathway might play an important role in the pathogenesis of arsenic-related diabetes. Taurine could serve as nutrition supplementation against arsenic-related diabetes in high arsenic exposure area.

  3. Cerebroprotection of Flavanol (−)-Epicatechin after Traumatic Brain Injury via Nrf2-dependent and –independent Pathways

    PubMed Central

    Cheng, Tian; Wang, Wenzhu; Li, Qian; Han, Xiaoning; Xing, Jing; Qi, Cunfang; Lan, Xi; Wan, Jieru; Potts, Alexa; Guan, Fangxia; Wang, Jian

    2016-01-01

    Traumatic brain injury (TBI), which leads to disability, dysfunction, and even death, is a prominent health problem worldwide with no effective treatment. A brain-permeable flavonoid named (−)-epicatechin (EC) modulates redox/oxidative stress and has been shown to be beneficial for vascular and cognitive function in humans and for ischemic and hemorrhagic stroke in rodents. Here we examined whether EC is able to protect the brain against TBI-induced brain injury in mice and if so, whether it exerts neuroprotection by modulating the NF-E2-related factor (Nrf2) pathway. We used the controlled cortical impact model to mimic TBI. EC was administered orally at 3 h after TBI and then every 24 h for either 3 or 7 days. We evaluated lesion volume, brain edema, white matter injury, neurologic deficits, cognitive performance and emotion-like behaviors, neutrophil infiltration, reactive oxygen species (ROS), and a variety of injury-related protein markers. Nrf2 knockout mice were used to determine the role of the Nrf2 signaling pathway after EC treatment. In wild-type mice, EC significantly reduced lesion volume, edema, and cell death and improved neurologic function on days 3 and 28; cognitive performance and depression-like behaviors were also improved with EC administration. In addition, EC reduced white matter injury, heme oxygenase-1 expression, and ferric iron deposition after TBI. These changes were accompanied by attenuation of neutrophil infiltration and oxidative insults, reduced activity of matrix metalloproteinase 9, decreased Keap 1 expression, increased Nrf2 nuclear accumulation, and increased expression of superoxide dismutase 1 and quinone 1. However, EC did not significantly reduce lesion volume or improve neurologic deficits in Nrf2 knockout mice after TBI. Our results show that EC protects the TBI brain by activating the Nrf2 pathway, inhibiting heme oxygenase-1 protein expression, and reducing iron deposition. The latter two effects could represent an

  4. Role of migratory inhibition factor in age-related susceptibility to radiation lung injury via NF-E2-related factor-2 and antioxidant regulation.

    PubMed

    Mathew, Biji; Jacobson, Jeffrey R; Siegler, Jessica H; Moitra, Jaideep; Blasco, Michael; Xie, Lishi; Unzueta, Crystal; Zhou, Tong; Evenoski, Carrie; Al-Sakka, Mohammed; Sharma, Rajesh; Huey, Ben; Bulent, Aydogan; Smith, Brett; Jayaraman, Sundararajan; Reddy, Narsa M; Reddy, Shekhar P; Fingerle-Rowson, Günter; Bucala, Richard; Dudek, Steven M; Natarajan, Viswanathan; Weichselbaum, Ralph R; Garcia, Joe G N

    2013-08-01

    Microvascular injury and increased vascular leakage are prominent features of radiation-induced lung injury (RILI), and often follow cancer-associated thoracic irradiation. Our previous studies demonstrated that polymorphisms in the gene (MIF) encoding macrophage migratory inhibition factor (MIF), a multifunctional pleiotropic cytokine, confer susceptibility to acute inflammatory lung injury and increased vascular permeability, particularly in senescent mice. In this study, we exposed wild-type and genetically engineered mif(-/-) mice to 20 Gy single-fraction thoracic radiation to investigate the age-related role of MIF in murine RILI (mice were aged 8 wk, 8 mo, or 16 mo). Relative to 8-week-old mice, decreased MIF was observed in bronchoalveolar lavage fluid and lung tissue of 8- to 16-month-old wild-type mice. In addition, radiated 8- to 16-month-old mif(-/-) mice exhibited significantly decreased bronchoalveolar lavage fluid total antioxidant concentrations with progressive age-related decreases in the nuclear expression of NF-E2-related factor-2 (Nrf2), a transcription factor involved in antioxidant gene up-regulation in response to reactive oxygen species. This was accompanied by decreases in both protein concentrations (NQO1, GCLC, and heme oxygenase-1) and mRNA concentrations (Gpx1, Prdx1, and Txn1) of Nrf2-influenced antioxidant gene targets. In addition, MIF-silenced (short, interfering RNA) human lung endothelial cells failed to express Nrf2 after oxidative (H2O2) challenge, an effect reversed by recombinant MIF administration. However, treatment with an antioxidant (glutathione reduced ester), but not an Nrf2 substrate (N-acetyl cysteine), protected aged mif(-/-) mice from RILI. These findings implicate an important role for MIF in radiation-induced changes in lung-cell antioxidant concentrations via Nrf2, and suggest that MIF may contribute to age-related susceptibility to thoracic radiation.

  5. Carvedilol, a third-generation β-blocker prevents oxidative stress-induced neuronal death and activates Nrf2/ARE pathway in HT22 cells

    SciTech Connect

    Ouyang, Ying; Chen, Ziwei; Tan, Min; Liu, Anmin; Chen, Meihui; Liu, Jun; Pi, Rongbiao; Fang, Jianpei

    2013-11-29

    Highlights: •Carvedilol significantly prevented oxidative stress-induced cell death. •Carvedilol significantly decreased the production of ROS. •Carvedilol activated Nrf2/ARE pathway. •Carvedilol increased the protein levels of HO-1 and NQO-1. -- Abstract: Carvedilol, a nonselective β-adrenoreceptor blocker with pleiotropic activities has been shown to exert neuroprotective effect due to its antioxidant property. However, the neuroprotective mechanism of carvedilol is still not fully uncovered. Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. Here we investigated the effect of carvedilol on oxidative stress-induced cell death (glutamate 2 mM and H{sub 2}O{sub 2} 600 μM) and the activity of Nrf2/ARE pathway in HT22 hippocampal cells. Carvedilol significantly increased cell viability and decreased ROS in HT22 cells exposed to glutamate or H{sub 2}O{sub 2}. Furthermore, carvedilol activated the Nrf2/ARE pathway in a concentration-dependent manner, and increased the protein levels of heme oxygenase-1(HO-1) and NAD(P)H quinone oxidoreductase-1(NQO-1), two downstream factors of the Nrf2/ARE pathway. Collectively, our results indicate that carvedilol protects neuronal cell against glutamate- and H{sub 2}O{sub 2}-induced neurotoxicity possibly through activating the Nrf2/ARE signaling pathway.

  6. Mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after intracranial hemorrhage

    PubMed Central

    Yin, Xiao-ping; Chen, Zhi-ying; Zhou, Jun; Wu, Dan; Bao, Bing

    2015-01-01

    Background It has been found that nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2–ARE) signaling pathway plays a role in antioxidative response, anti-inflammatory response, and neuron-protection in intracerebral hemorrhage (ICH). The aim of this study is to explore mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after ICH. Methods There were a total of 90 rats with basal ganglia hemorrhage, which were randomly divided into the following four groups: ICH (Sprague–Dawley rats with autologous femoral arterial blood injection into the basal ganglia), sulforaphane (SFN) (SFN was intraperitoneally administered into rats), retinoic acid (RA) (RA was intraperitoneally administered into rats), and dimethyl sulfoxide (the rats were treated with dimethyl sulfoxide). We observed the neurological score of the rats in the different groups, and collected brain tissues for immunofluorescence, Western blot, and reverse transcription polymerase chain reaction to detect expression of Nrf2, heme oxygenase (HO-1), nuclear factor-κB (NF-κB), and tumor necrosis factor-α (TNF-α). Results The results indicated that neurological dysfunction of rats was significantly improved in the SFN group, and the expressions of Nrf2 and HO-1 in tissues surrounding the hemorrhage were increased. Also, the level of NF-κB and TNF-α were reduced compared to the ICH group. The RA group exhibited more severe neurological dysfunction and lower levels of Nrf2 and HO-1 than the SFN and ICH groups. Compared to the ICH group, the NF-κB and TNF-α expression in the RA groups was increased. In conclusion, RA inhibits Nrf2 dissociation and translocation into nucleus, thereby suppressing the anti-inflammatory effect of Nrf2–ARE signaling pathway. The activation of Nrf2–ARE signaling pathway by SFN can elevate expression of antioxidant enzyme HO-1, reduce perifocal inflammatory response after ICH, and thus may play a

  7. Nrf2 signaling and cell survival

    SciTech Connect

    Niture, Suryakant K.; Kaspar, James W.; Shen, Jun; Jaiswal, Anil K.

    2010-04-01

    Nrf2:INrf2 acts as a sensor for oxidative/electrophilic stress. INrf2 serves as an adaptor to link Nrf2 to the ubiquitin ligase Cul3-Rbx1 complex that ubiquitinate and degrade Nrf2. Under basal conditions, cytosolic INrf2/Cul3-Rbx1 is constantly degrading Nrf2. When a cell encounters stress Nrf2 dissociates from the INrf2 and translocates into the nucleus. Oxidative/electrophilic stress induced modification of INrf2Cysteine151 and/or protein kinase C (PKC)-mediated phosphorylation of Nrf2Serine40 controls Nrf2 release from INrf2 followed by stabilization and nuclear translocation of Nrf2. Nrf2 binds to the antioxidant response element (ARE) and activates a myriad of genes that protect cells against oxidative/electrophilic stress and neoplasia. A delayed response of oxidative/electrophilic stress activates GSK-3beta that phosphorylates Fyn at unknown threonine residue(s). Phosphorylated Fyn translocates to the nucleus and phosphorylates Nrf2Tyrosine568 that leads to nuclear export and degradation of Nrf2. Prothymosin-alpha mediated nuclear translocation of INrf2 also degrades nuclear Nrf2. The degradation of Nrf2 both in cytosol and nuclear compartments rapidly brings down its levels to normal resulting in suppression of Nrf2 downstream gene expression. An auto-regulatory loop between Nrf2 and INrf2 controls their cellular abundance. Nrf2 regulates INrf2 by controlling its transcription, and INrf2 controls Nrf2 by degrading it. In conclusion, switching on and off of Nrf2 combined with promoting an auto-regulatory loop between them regulates activation/deactivation of defensive genes leading to protection of cells against adverse effects of oxidative and electrophilic stress and promote cell survival.

  8. Broccoli sprout extract prevents diabetic cardiomyopathy via Nrf2 activation in db/db T2DM mice.

    PubMed

    Xu, Zheng; Wang, Shudong; Ji, Honglei; Zhang, Zhiguo; Chen, Jing; Tan, Yi; Wintergerst, Kupper; Zheng, Yang; Sun, Jian; Cai, Lu

    2016-07-26

    To develop a clinic-relevant protocol for systemic up-regulation of NFE2-related factor 2 (Nrf2) to prevent diabetic cardiomyopathy (DCM), male db/db and age-matched wild-type (WT) mice were given sulforaphane (SFN, an Nrf2 activator) and its natural source, broccoli sprout extract (BSE) by gavage every other day for 3 months, with four groups: vehicle (0.1 ml/10 g), BSE-low dose (estimated SFN availability at 0.5 mg/kg), BSE-high dose (estimated SFN availability at 1.0 mg/kg), and SFN (0.5 mg/kg). Cardiac function and pathological changes (hypertrophy, fibrosis, inflammation and oxidative damage) were assessed by echocardiography and histopathological examination along with Western blot and real-time PCR, respectively. Both BSE and SFN significantly prevented diabetes-induced cardiac dysfunction, hypertrophy and fibrosis. Mechanistically, BSE, like SFN, significantly up-regulated Nrf2 transcriptional activity, evidenced by the increased Nrf2 nuclear accumulation and its downstream gene expression. This resulted in a significant prevention of cardiac oxidative damage and inflammation. For all these preventive effects, BSE at high dose provided a similar effect as did SFN. These results indicated that BSE at high dose prevents DCM in a manner congruent with SFN treatment. Therefore, it suggests that BSE could potentially be used as a natural and safe treatment against DCM via Nrf2 activation.

  9. Hepatitis B Virus Induces Expression of Antioxidant Response Element-regulated Genes by Activation of Nrf2*

    PubMed Central

    Schaedler, Stephanie; Krause, Janis; Himmelsbach, Kiyoshi; Carvajal-Yepes, Monica; Lieder, Franziska; Klingel, Karin; Nassal, Michael; Weiss, Thomas S.; Werner, Sabine; Hildt, Eberhard

    2010-01-01

    The expression of a variety of cytoprotective genes is regulated by short cis-acting elements in their promoters, called antioxidant response elements (AREs). A central regulator of ARE-mediated gene expression is the NF-E2-related factor 2 (Nrf2). Human hepatitis B virus (HBV) induces a strong activation of Nrf2/ARE-regulated genes in vitro and in vivo. This is triggered by the HBV-regulatory proteins (HBx and LHBs) via c-Raf and MEK. The Nrf2/ARE-mediated induction of cytoprotective genes by HBV results in a better protection of HBV-positive cells against oxidative damage as compared with control cells. Furthermore, there is a significantly increased expression of the Nrf2/ARE-regulated proteasomal subunit PSMB5 in HBV-positive cells that is associated with a decreased level of the immunoproteasome subunit PSMB5i. In accordance with this finding, HBV-positive cells display a higher constitutive proteasome activity and a decreased activity of the immunoproteasome as compared with control cells even after interferon α/γ treatment. The HBV-dependent induction of Nrf2/ARE-regulated genes might ensure survival of the infected cell, shape the immune response to HBV, and thereby promote establishment of the infection. PMID:20956535

  10. MHY1485 ameliorates UV-induced skin cell damages via activating mTOR-Nrf2 signaling.

    PubMed

    Yang, Bo; Xu, Qiu-Yun; Guo, Chun-Yan; Huang, Jin-Wen; Wang, Shu-Mei; Li, Yong-Mei; Tu, Ying; He, Li; Bi, Zhi-Gang; Ji, Chao; Cheng, Bo

    2017-01-04

    Ultra Violet (UV)-caused skin cell damage is a main cause of skin cancer. Here, we studied the activity of MHY1485, a mTOR activator, in UV-treated skin cells. In primary human skin keratinocytes, HaCaT keratinocytes and human skin fibroblasts, MHY1485 ameliorated UV-induced cell death and apoptosis. mTOR activation is required for MHY1485-induced above cytoprotective actions. mTOR kinase inhibitors (OSI-027, AZD-8055 and AZD-2014) or mTOR shRNA knockdown almost abolished MHY1485-induced cytoprotection. Further, MHY1485 treatment in skin cells activated mTOR downstream NF-E2-related factor 2 (Nrf2) signaling, causing Nrf2 Ser-40 phosphorylation, stabilization/upregulation and nuclear translocation, as well as mRNA expression of Nrf2-dictated genes. Contrarily, Nrf2 knockdown or S40T mutation almost nullified MHY1485-induced cytoprotection. MHY1485 suppressed UV-induced reactive oxygen species production and DNA single strand breaks in skin keratinocytes and fibroblasts. Together, we conclude that MHY1485 inhibits UV-induced skin cell damages via activating mTOR-Nrf2 signaling.

  11. Resveratrol Ameliorated Vascular Calcification by Regulating Sirt-1 and Nrf2.

    PubMed

    Zhang, P; Li, Y; Du, Y; Li, G; Wang, L; Zhou, F

    2016-12-01

    Pathologic vascular calcification is a significant reason for mortality and morbidity in patients who suffer from end-stage renal disease (ESRD). Resveratrol, a scavenger for many free radicals, is a crucial compound for biomedicine. However, the role and mechanism of resveratrol in vascular calcification is still unknown. In this study, to mimic vascular calcification in ESRD, we used β-glyceophosphate to stimulate the rat vascular smooth muscle cells (RASMCs). We investigate the therapeutic role of resveratrol pretreatment in vascular calcification. In the current in vitro study, we observe the effects of resveratrol on improving intracellular calcium deposition and protecting against mitochondria dysfunction in calcific RASMCs. Resveratrol decreased the mRNA level of fibroblast growth factor-23, then increased the mRNA level of klotho and the nuclear transcription factor NF-E2-related factor 2 (nuclear factor-erythroid 2-related factor 2 [Nrf2]) in RASMCs after calcification. Further, resveratrol activated the expression of sirtuin-1 and Nrf2, and inhibited the expression of osteopontin, runt-related transcription factor 2, and heme oxygenase-1. Our study shows that resveratrol could ameliorate oxidative injury of RASMCs by preventing vascular calcification-induced calcium deposition and mitochondria dysfunction through involving sirtuin-1 and Nrf2. These results might indicate a novel role for resveratrol in resistance to oxidative stress for ESRD patients suffering from vascular calcification.

  12. Brusatol provokes a rapid and transient inhibition of Nrf2 signaling and sensitizes mammalian cells to chemical toxicity-implications for therapeutic targeting of Nrf2.

    PubMed

    Olayanju, Adedamola; Copple, Ian M; Bryan, Holly K; Edge, George T; Sison, Rowena L; Wong, Min Wei; Lai, Zheng-Quan; Lin, Zhi-Xiu; Dunn, Karen; Sanderson, Christopher M; Alghanem, Ahmad F; Cross, Michael J; Ellis, Ewa C; Ingelman-Sundberg, Magnus; Malik, Hassan Z; Kitteringham, Neil R; Goldring, Christopher E; Park, B Kevin

    2015-01-01

    The transcription factor Nrf2 regulates the basal and inducible expression of a battery of cytoprotective genes. Whereas numerous Nrf2-inducing small molecules have been reported, very few chemical inhibitors of Nrf2 have been identified to date. The quassinoid brusatol has recently been shown to inhibit Nrf2 and ameliorate chemoresistance in vitro and in vivo. Here, we show that brusatol provokes a rapid and transient depletion of Nrf2 protein, through a posttranscriptional mechanism, in mouse Hepa-1c1c7 hepatoma cells. Importantly, brusatol also inhibits Nrf2 in freshly isolated primary human hepatocytes. In keeping with its ability to inhibit Nrf2 signaling, brusatol sensitizes Hepa-1c1c7 cells to chemical stress provoked by 2,4-dinitrochlorobenzene, iodoacetamide, and N-acetyl-p-benzoquinone imine, the hepatotoxic metabolite of acetaminophen. The inhibitory effect of brusatol toward Nrf2 is shown to be independent of its repressor Keap1, the proteasomal and autophagic protein degradation systems, and protein kinase signaling pathways that are known to modulate Nrf2 activity, implying the involvement of a novel means of Nrf2 regulation. These findings substantiate brusatol as a useful experimental tool for the inhibition of Nrf2 signaling and highlight the potential for therapeutic inhibition of Nrf2 to alter the risk of adverse events by reducing the capacity of nontarget cells to buffer against chemical and oxidative insults. These data will inform a rational assessment of the risk:benefit ratio of inhibiting Nrf2 in relevant therapeutic contexts, which is essential if compounds such as brusatol are to be developed into efficacious and safe drugs.

  13. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages

    SciTech Connect

    Gu, Da-min; Lu, Pei-Hua; Zhang, Ke; Wang, Xiang; Sun, Min; Chen, Guo-Qian; Wang, Qiong

    2015-02-13

    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. - Highlights: • Pre-treatment of astragaloside IV (AS-IV) protects murine cortical neurons from OGD/R. • AS-IV activates Nrf2-ARE signaling in murine cortical neurons. • Nrf2 is required for AS-IV-mediated anti-oxidant and neuroprotective activities. • AS-IV stimulates HB-EGF release to trans-activate EGFR in murine cortical neurons. • EGFR mediates AS-IV-induced Nrf2 activation and neuroprotection against OGD/R.

  14. Adipose-specific ablation of Nrf2 transiently delayed high-fat diet-induced obesity by altering glucose, lipid and energy metabolism of male mice.

    PubMed

    Zhang, Le; Dasuri, Kalavathi; Fernandez-Kim, Sun-Ok; Bruce-Keller, Annadora J; Keller, Jeffrey N

    2016-01-01

    Nuclear factor E2-related factor 2 (NRF2) is a well-known master controller of the cellular adaptive antioxidant and detoxification response. Recent studies demonstrated altered glucose, lipid and energy metabolism in mice with a global Nrf2 knockout. In the present study, we aim to determine the effects of an adipose-specific ablation of Nrf2 (ASAN) on diet-induced obesity (DIO) in male mice. The 6-week-old adipose-specific Nrf2 knockout (NK) and its Nrf2 control (NC) mice were fed with either control diet (CD) or high-fat diet (HFD) for 14 weeks. NK mice exhibited transiently delayed body weight (BW) growth from week 5 to week 11 of HFD feeding, higher daily physical activity levels and preferential use of fat over carbohydrates as a source of energy at week 8 of the CD-feeding period. After 14 weeks of feeding, NK mice showed comparable results with NC mice with respect to the overall BW and body fat content, but exhibited reduced blood glucose, reduced number but increased size of adipocytes, accompanied with elevated expression of many genes and proteins in the visceral fat related to glucose, lipid and energy metabolism (e.g. Fgf21, Pgc1a). These results indicated that NRF2 is an important mediator for glucose, lipid and energy metabolism in adipose tissue, and ASAN could have beneficial effect for prevention of DIO during the early development of mice.

  15. Sulforaphane induces Nrf2 target genes and attenuates inflammatory gene expression in microglia from brain of young adult and aged mice

    PubMed Central

    Townsend, Brigitte E.; Johnson, Rodney W.

    2015-01-01

    Increased neuroinflammation and oxidative stress resulting from heightened microglial activation is associated with age-related cognitive impairment. The objectives of this study were to examine the effects of the bioactive sulforaphane (SFN) on the nuclear factor E2-related factor 2 (Nrf2) pathway in BV2 microglia and primary microglia, and to evaluate proinflammatory cytokine expression in lipopolysaccharide (LPS)-stimulated primary microglia from adult and aged mice. BV2 microglia and primary microglia isolated from young adult and aged mice were treated with SFN and LPS. Changes in Nrf2 activity, expression of Nrf2 target genes, and levels of proinflammatory markers were assessed by quantitative PCR and immunoassay. SFN increased Nrf2 DNA-binding activity and upregulated Nrf2 target genes in BV2 microglia, while reducing LPS-induced interleukin (IL-)1β, IL-6, and inducible nitric oxide synthase (iNOS). In primary microglia from adult and aged mice, SFN increased expression of Nrf2 target genes and attenuated IL-1β, IL-6, and iNOS induced by LPS. These data indicate that SFN is a potential beneficial supplement that may be useful for reducing microglial mediated neuroinflammation and oxidative stress associated with aging. PMID:26571201

  16. Suppression of antioxidant Nrf-2 and downstream pathway in H9c2 cells by advanced glycation end products (AGEs) via ERK phosphorylation.

    PubMed

    Ko, Shun-Yao; Chang, Shu-Shing; Lin, I-Hsuan; Chen, Hong-I

    2015-11-01

    Diabetic cardiomyopathy is related to oxidative stress and correlated with the presence of advanced glycation end products (AGEs). In a clinical setting, AGEs can be detected in patients presenting diabetic cardiomyopathy; however, the underlying mechanism has yet to be elucidated. In our previous study, AGEs increase cell hypertrophy via ERK phosphorylation in a process closely related to ROS production. Thus, we propose that AGEs regulate the antioxidant gene nuclear factor-erythroid 2-related factor (Nrf-2). In H9c2 cells treated with AGEs, the expression of Nrf-2 was reduced; however, ERK phosphorylation was shown to increase. Treatment with H2O2 was also shown to increase Nrf-2 and ERK phosphorylation. In cells pretreatment with ROS scavenger NAC, the effects of H2O2 were reduced; however, the effects of the AGEs remained largely unchanged. Conversely, when cells were pretreated with PD98059 (ERK inhibitor), the expression of Nrf-2 was recovered following treatment with AGEs. Our results suggest that AGEs inhibit Nrf-2 via the ERK pathway; however, this influence is partly associated with ROS. Our finding further indicated that AGEs possess both ROS-dependent and ROS-independent pathways, resulting in a reduction in Nrf-2. This report reveals an important mechanism underlying the regulation of diabetic cardiomyopathy progression by AGEs.

  17. Activation of NRF2 pathway in spleen, thymus as well as peripheral blood mononuclear cells by acute arsenic exposure in mice.

    PubMed

    Duan, Xiaoxu; Li, Jinlong; Zhang, Yang; Li, Wei; Zhao, Lu; Nie, Huifang; Sun, Guifan; Li, Bing

    2015-10-01

    Arsenic has already been demonstrated to activate the nuclear factor erythroid 2-related factor 2 (NRF2) in many different organs and cell lines. The present study tried to explore the expression of NRF2 pathway by acute arsenic exposure in immune system in vivo. Our results showed that treatment with arsenic (sodium arsenite, 5, 10 and 20mg/kg, intra-gastrically) increased the expression of NRF2 and its downstream targets heme oxygenase-1 (HO-1), glutathione-S-transferase (GST), glutamate-cysteine ligase (GCL) and glutathione reductase (GR) consistently in spleen, thymus, as well as peripheral blood mononuclear cells (PBMCs), as early as treatment from 6h. Arsenic was also detected to up-regulate the mRNA levels of Hmox1, NAD(P)H: quinine oxidoreductase 1 (Nqo1), Gclc and Gclm in spleen and thymus. Besides, we detected the enhancement of Kelch-like ECH-associated protein (KEAP1) expression in these immune organs and immunocytes. What's more, our results also found the imbalanced oxidative redox status under the circumstances that arsenic activated NRF2 pathway, reflected by the generation of lipid peroxidation, as well as the reduction of antioxidative capacities in both spleen and thymus. Taken together, our results here strongly suggested the expression and activation of NRF2 pathway by acute arsenic exposure in immune system in vivo. Further studies are being investigated to explore the possible roles and functions of NRF2 pathway stimulation in the regulation of immune responses of this metalloid.

  18. Adipose-specific ablation of Nrf2 transiently delayed high-fat diet-induced obesity by altering glucose, lipid and energy metabolism of male mice

    PubMed Central

    Zhang, Le; Dasuri, Kalavathi; Fernandez-Kim, Sun-Ok; Bruce-Keller, Annadora J; Keller, Jeffrey N

    2016-01-01

    Nuclear factor E2-related factor 2 (NRF2) is a well-known master controller of the cellular adaptive antioxidant and detoxification response. Recent studies demonstrated altered glucose, lipid and energy metabolism in mice with a global Nrf2 knockout. In the present study, we aim to determine the effects of an adipose-specific ablation of Nrf2 (ASAN) on diet-induced obesity (DIO) in male mice. The 6-week-old adipose-specific Nrf2 knockout (NK) and its Nrf2 control (NC) mice were fed with either control diet (CD) or high-fat diet (HFD) for 14 weeks. NK mice exhibited transiently delayed body weight (BW) growth from week 5 to week 11 of HFD feeding, higher daily physical activity levels and preferential use of fat over carbohydrates as a source of energy at week 8 of the CD-feeding period. After 14 weeks of feeding, NK mice showed comparable results with NC mice with respect to the overall BW and body fat content, but exhibited reduced blood glucose, reduced number but increased size of adipocytes, accompanied with elevated expression of many genes and proteins in the visceral fat related to glucose, lipid and energy metabolism (e.g. Fgf21, Pgc1a). These results indicated that NRF2 is an important mediator for glucose, lipid and energy metabolism in adipose tissue, and ASAN could have beneficial effect for prevention of DIO during the early development of mice. PMID:28078004

  19. Induction of the pi class of glutathione S-transferase by carnosic acid in rat Clone 9 cells via the p38/Nrf2 pathway.

    PubMed

    Lin, Chia-Yuan; Wu, Chi-Rei; Chang, Shu-Wei; Wang, Yu-Jung; Wu, Jia-Jiuan; Tsai, Chia-Wen

    2015-06-01

    Induction of phase II enzymes is important in cancer chemoprevention. We compared the effect of rosemary diterpenes on the expression of the pi class of glutathione S-transferase (GSTP) in rat liver Clone 9 cells and the signaling pathways involved. Culturing cells with 1, 5, 10, or 20 μM carnosic acid (CA) or carnosol (CS) for 24 h in a dose-dependent manner increased the GSTP expression. CA was more potent than CS. The RNA level and the enzyme activity of GSTP were also enhanced by CA treatment. Treatment with 10 μM CA highly induced the reporter activity of the enhancer element GPEI. Furthermore, CA markedly increased the translocation of nuclear factor erythroid-2 related factor 2 (Nrf2) from the cytosol to the nucleus after 30 to 60 min. CA the stimulated the protein induction of p38, nuclear Nrf2, and GSTP was diminished in the presence of SB203580 (a p38 inhibitor). In addition, SB203580 pretreatment or silencing of Nrf2 by siRNA suppressed the CA-induced GPEI-DNA binding activity and GSTP protein expression. Knockdown of p38 or Nrf2 by siRNA abolished the activation of p38 and Nrf2 as well as the protein induction and enzyme activity of GSTP by CA. These results suggest that CA up-regulates the expression and enzyme activity of GSTP via the p38/Nrf2/GPEI pathway.

  20. Oxidative stress responses and NRF2 in human leukaemia.

    PubMed

    Abdul-Aziz, Amina; MacEwan, David J; Bowles, Kristian M; Rushworth, Stuart A

    2015-01-01

    Oxidative stress as a result of elevated levels of reactive oxygen species (ROS) has been observed in almost all cancers, including leukaemia, where they contribute to disease development and progression. However, cancer cells also express increased levels of antioxidant proteins which detoxify ROS. This includes glutathione, the major antioxidant in human cells, which has recently been identified to have dysregulated metabolism in human leukaemia. This suggests that critical balance of intracellular ROS levels is required for cancer cell function, growth, and survival. Nuclear factor (erythroid-derived 2)-like 2 (NRF2) transcription factor plays a dual role in cancer. Primarily, NRF2 is a transcription factor functioning to protect nonmalignant cells from malignant transformation and oxidative stress through transcriptional activation of detoxifying and antioxidant enzymes. However, once malignant transformation has occurred within a cell, NRF2 functions to protect the tumour from oxidative stress and chemotherapy-induced cytotoxicity. Moreover, inhibition of the NRF2 oxidative stress pathway in leukaemia cells renders them more sensitive to cytotoxic chemotherapy. Our improved understanding of NRF2 biology in human leukaemia may permit mechanisms by which we could potentially improve future cancer therapies. This review highlights the mechanisms by which leukaemic cells exploit the NRF2/ROS response to promote their growth and survival.

  1. NRF2 and p53: Januses in cancer?

    PubMed Central

    Rotblat, Barak; Melino, Gerry; Knight, Richard A.

    2012-01-01

    The transcription factor nuclear factor (erythroid-derived 2)-like 2, also known as NFE2L2 or NRF2, is a master regulator of the anti-oxidative stress response and positively controls the expression of a battery of anti-oxidative stress response proteins and enzymes implicated in detoxification and glutathione generation. Although its detoxifying activity is important in cancer prevention, it has recently been shown that cancer cells also exploit its protective functions to thrive and resist chemotherapy. NRF2 was also shown to the pentose phosphate pathway and glutaminolysis, which promotes purine synthesis for supporting rapid proliferation and glutathione for providing anti-oxidative stress protection. Evidence obtained from cancer patients and cell lines suggest that NRF2 is highly active in a variety of human cancers and is associated with aggressiveness. p53 is a tumor suppressor that also promotes an anti-oxidative stress metabolic program and glutaminolysis. Here we will discuss the similarities between NRF2 and p53 and review evidence that p53 might be exploited by cancer cells to gain protection against oxidative stress, as is the case for NRF2. We discuss findings of co-regulation between these transcription factors and propose possible therapeutic strategies that can be used for treatment of cancers that harbor WT p53 and express high levels of NRF2. PMID:23174755

  2. Nrf2-dependent protection against acute sodium arsenite toxicity in zebrafish.

    PubMed

    Fuse, Yuji; Nguyen, Vu Thanh; Kobayashi, Makoto

    2016-08-15

    Transcription factor Nrf2 induces a number of detoxifying enzymes and antioxidant proteins to confer protection against the toxic effects of a diverse range of chemicals including inorganic arsenicals. Although a number of studies using cultured cells have demonstrated that Nrf2 has a cell-protective function against acute and high-dose arsenic toxicity, there is no clear in vivo evidence of this effect. In the present study, we genetically investigated the protective role of Nrf2 against acute sodium arsenite toxicity using the zebrafish Nrf2 mutant, nrf2a(fh318). After treatment with 1mM sodium arsenite, the survival of nrf2a(fh318) larvae was significantly shorter than that of wild-type siblings, suggesting that Nrf2 protected the zebrafish larvae against high-dose arsenite exposure. To understand the molecular basis of the Nrf2-dependent protection, we analyzed the gene expression profiles after arsenite exposure, and found that the genes involved in the antioxidative function (prdx1 and gclc), arsenic metabolism (gstp1) and xenobiotic elimination (abcc2) were induced in an Nrf2-dependent manner. Furthermore, pre-treatment with sulforaphane, a well-known Nrf2 activator improved the survival of zebrafish larvae after arsenic exposure. Based on these results, we concluded that Nrf2 plays a fundamental and conserved role in protection against acute sodium arsenite toxicity.

  3. Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation

    SciTech Connect

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han

    2015-09-25

    Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death.

  4. Nuclear factor erythroid-2 related factor 2 overexpressed mesenchymal stem cells transplantation, improves renal function, decreases injuries markers and increases repair markers in glycerol-induced Acute kidney injury rats

    PubMed Central

    Zhaleh, Fateme; Amiri, Fatemeh; Mohammadzadeh-Vardin, Mohammad; Bahadori, Marzie; Harati, Mitra Dehghan; Roudkenar, Mehryar Habibi; Saki, Sasan

    2016-01-01

    Objective(s): Recently cell therapy is a promising therapeutic modality for many types of disease including acute kidney injury (AKI). Due to the unique biological properties, mesenchymal stem cells (MSCs) are attractive cells in this regard. This study aims to transplant MSCs equipped with nuclear factor E2-related factor 2 (Nrf2) in rat experimental models of acute kidney and evaluate regeneration potential of injured kidney especially expression of injury and repaired biomarkers. Materials and methods: Nrf2 was overexpressed in bone marrow-derived MSCs by pcDNA.3.1 plasmid. AKI was induced using glycerol in rat models. The regenerative potential of Nrf2-overexpressed MSCs was evaluated in AKI-Induced animal models using biochemical and histological methods after transplantation. Expression of repaired genes, AQP1 and CK-18, as well as injury markers, Kim-1 and Cystatin C, was also assayed in engrafted kidney sections. Results: Our results revealed that transplantation of Nrf2-overexpressed MSCs into AKI-induced rats decreased blood urea nitrogen and creatinine and ameliorated kidney regeneration throughout 14 days. Upregulation of repaired markers and downregulation of injury markers were considerable 14 days after transplantation. Conclusions: Overexpression of Nrf2 in MSCs suggests a new strategy to increase efficiency of MSC-based cell therapy in AKI. PMID:27114803

  5. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet.

    PubMed

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D

    2012-11-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling.

  6. The protective role of Nrf2-Gadd45b against antimony-induced oxidative stress and apoptosis in HEK293 cells.

    PubMed

    Jiang, Xingkang; An, Zesheng; Lu, Chao; Chen, Yue; Du, E; Qi, Shiyong; Yang, Kuo; Zhang, Zhihong; Xu, Yong

    2016-08-10

    Antimony (Sb) is one of the most prevalent heavy metals and frequently causes biological toxicity. However, the specific mechanisms by which Sb elicits its toxic effects remains to be fully elucidated. In this study, we found antimony trioxide (Sb2O3) caused a dose-dependent cytotoxicity against HEK293 cells, and Sb2O3-induced excessive reactive oxygen species (ROS) was closely correlated with increased cell apoptosis. Mechanistic investigation manifested that nuclear factor NF-E2-related factor 2 (Nrf2) expression and nuclear translocation were significantly induced under Sb2O3 treatment in HEK293 cells, and Nrf2 knockdown aggregated Sb2O3-induced cell apoptosis. Moreover, elevated Gadd45b expression actives the phosphorylation of MAPKs upon Sb2O3 exposure, whereas Gadd45b knockdown diminished Sb2O3-induced activation of MAPKs and promoted cell apoptosis. In the meantime, however, the antioxidant N-acetylcysteine (NAC) was found to ameliorate Nrf2 expression and nuclear translocation as well as Gadd45b expression and MAPKs activation by repressing Sb2O3-induced ROS production. More importantly, we found Gadd45b was transcriptionally enhanced by Nrf2 through binding to three canonical antioxidant response elements (AREs) within its promoter region. Either Sb2O3 or TBHQ (a selective Nrf2 activator) treatment, Gadd45b expression was significantly increased by luciferase assay. Nrf2 inhibition greatly diminished Gadd45b expression due to reduced binding of Nrf2 in Gadd45b promoter under Sb2O3 treatment. To summarize, this study demonstrated the Nrf2-Gadd45b signaling axis exhibited a protective role in Sb-induced cell apoptosis.

  7. Activation of Nrf2 attenuates carbonyl stress induced by methylglyoxal in human neuroblastoma cells: Increase in GSH levels is a critical event for the detoxification mechanism.

    PubMed

    Nishimoto, Shoichi; Koike, Shin; Inoue, Naho; Suzuki, Toshihiro; Ogasawara, Yuki

    2017-02-05

    The present study focused on the methylglyoxal (MG) detoxification mechanism in neuroblastoma cells. The involvement of nuclear factor erythroid 2-related factor 2 (Nrf2)/Kelch-like ECH-associated protein 1 (Keap1) pathway as a defense response against the formation of MG-modified proteins, which is well-known evidence of carbonyl stress, was also examined. We found that MG treatment resulted in accumulation of modified proteins bearing the structure of advanced glycation end products (AGEs) derived from MG in SH-SY5Y cells. This accumulation was suppressed by activation of the Nrf2 pathway prior to MG exposure via pre-treatment with an Nrf2 activator, carnosic acid and CDDO-Im, confirming the involvement of the Nrf2 pathway in MG detoxification. Although pre-treatment with the Nrf2 activator did not affect mRNA levels of GLO1, AKR1B1, and AKR7A2, the expressions of GCL and xCT mRNA, involved in GSH synthesis, were induced prior to increase in GSH levels. Furthermore, we demonstrated that a GSH synthesis inhibitor eliminated the MG detoxification effect derived from pretreatment with the Nrf2 activator. These results indicated that increase in GSH levels, induced by pre-treatment with carnosic acid, promoted the formation of the GLO1 substrate, hemithioacetal, thereby accelerating MG metabolism via the glyoxalase system and suppressing its toxicity. It was, therefore, determined that promotion of GSH synthesis via the Nrf2/Keap1pathway is important in the MG detoxification mechanism against neuronal MG-induced carbonyl stress, and Nrf2 activators contribute to reduction in the accumulation and toxic expression of carbonyl proteins.

  8. ROS/Autophagy/Nrf2 Pathway Mediated Low-Dose Radiation Induced Radio-Resistance in Human Lung Adenocarcinoma A549 Cell.

    PubMed

    Chen, Ni; Wu, Lijun; Yuan, Hang; Wang, Jun

    2015-01-01

    Low-dose ionizing radiation (LDIR) can induce radio-resistance to following high dose radiation in various mammalian cells. The protective role of LDIR has been thought to be associated with the overall outcomes of cancer radiotherapy. NF-E2 related factor 2 (Nrf2) is a transcription factor that plays pivotal roles in maintaining cellular oxidative equilibrium. Since oxidative stress has been indicated to be a mediator of LDIR induced radio-resistance, the role of Nrf2 in this process was investigated in this research. Our results showed that in human lung adenocarcinoma A549 cell, 5cGy alpha particle induced radio-resistance to following 75cGy alpha particle radiation. The expression level of Nrf2 and its target Heme Oxygenase-1(HO-1) increased after 5cGy radiation. Both the shRNA of Nrf2 and the chemical inhibitor of HO-1 suppressed the induced radio-resistance, indicating the involvement of Nrf2 antioxidant pathway in this process. Further, we found 5cGy radiation stimulated autophagy process in A549. Inhibition of the autophagy process resulted in suppression of the radio-resistance and the induced expression of Nrf2 and HO-1. ROS scavenger N-acetyl-L-cysteine (NAC) blocked the autophagy process induced by 5cGy alpha particle, the upregulation of Nrf2 and HO-1, as well as the induced radio-resistance. In conclusion, ROS elevation caused by LDIR promoted Autophagy/Nrf2-HO-1 and conferred radio-resistance in A549.

  9. ROS/Autophagy/Nrf2 Pathway Mediated Low-Dose Radiation Induced Radio-Resistance in Human Lung Adenocarcinoma A549 Cell

    PubMed Central

    Chen, Ni; Wu, Lijun; Yuan, Hang; Wang, Jun

    2015-01-01

    Low-dose ionizing radiation (LDIR) can induce radio-resistance to following high dose radiation in various mammalian cells. The protective role of LDIR has been thought to be associated with the overall outcomes of cancer radiotherapy. NF-E2 related factor 2 (Nrf2) is a transcription factor that plays pivotal roles in maintaining cellular oxidative equilibrium. Since oxidative stress has been indicated to be a mediator of LDIR induced radio-resistance, the role of Nrf2 in this process was investigated in this research. Our results showed that in human lung adenocarcinoma A549 cell, 5cGy alpha particle induced radio-resistance to following 75cGy alpha particle radiation. The expression level of Nrf2 and its target Heme Oxygenase-1(HO-1) increased after 5cGy radiation. Both the shRNA of Nrf2 and the chemical inhibitor of HO-1 suppressed the induced radio-resistance, indicating the involvement of Nrf2 antioxidant pathway in this process. Further, we found 5cGy radiation stimulated autophagy process in A549. Inhibition of the autophagy process resulted in suppression of the radio-resistance and the induced expression of Nrf2 and HO-1. ROS scavenger N-acetyl-L-cysteine (NAC) blocked the autophagy process induced by 5cGy alpha particle, the upregulation of Nrf2 and HO-1, as well as the induced radio-resistance. In conclusion, ROS elevation caused by LDIR promoted Autophagy/Nrf2-HO-1 and conferred radio-resistance in A549. PMID:26078725

  10. miRNA-141 attenuates UV-induced oxidative stress via activating Keap1-Nrf2 signaling in human retinal pigment epithelium cells and retinal ganglion cells.

    PubMed

    Cheng, Li-Bo; Li, Ke-Ran; Yi, Nan; Li, Xiu-Miao; Wang, Feng; Xue, Bo; Pan, Ying-Shun; Yao, Jin; Jiang, Qin; Wu, Zhi-Feng

    2017-01-04

    Activation of NF-E2-related factor 2 (Nrf2) signaling could protect cells from ultra violet (UV) radiation. We aim to provoke Nrf2 activation via downregulating its inhibitor Keap1 by microRNA-141 ("miR-141"). In both human retinal pigment epithelium cells (RPEs) and retinal ganglion cells (RGCs), forced-expression of miR-141 downregulated Keap1, causing Nrf2 stabilization, accumulation and nuclear translocation, which led to transcription of multiple antioxidant-responsive element (ARE) genes (HO1, NOQ1 and GCLC). Further, UV-induced reactive oxygen species (ROS) production and cell death were significantly attenuated in miR-141-expressing RPEs and RGCs. On the other hand, depletion of miR-141 via expressing its inhibitor antagomiR-141 led to Keap1 upregulation and Nrf2 degradation, which aggravated UV-induced death of RPEs and RGCs. Significantly, Nrf2 shRNA knockdown almost abolished miR-141-mediated cytoprotection against UV in RPEs. These results demonstrate that miR-141 targets Keap1 to activate Nrf2 signaling, which protects RPEs and RGCs from UV radiation.

  11. Ectodermal-neural cortex 1 down-regulates Nrf2 at the translational level.

    PubMed

    Wang, Xiao-Jun; Zhang, Donna D

    2009-01-01

    The transcription factor Nrf2 is the master regulator of a cellular defense mechanism against environmental insults. The Nrf2-mediated antioxidant response is accomplished by the transcription of a battery of genes that encode phase II detoxifying enzymes, xenobiotic transporters, and antioxidants. Coordinated expression of these genes is critical in protecting cells from toxic and carcinogenic insults and in maintaining cellular redox homeostasis. Activation of the Nrf2 pathway is primarily controlled by Kelch-like ECH-associated protein 1 (Keap1), which is a molecular switch that turns on or off the Nrf2 signaling pathway according to intracellular redox conditions. Here we report our finding of a novel Nrf2 suppressor ectodermal-neural cortex 1 (ENC1), which is a BTB-Kelch protein and belongs to the same family as Keap1. Transient expression of ENC1 reduced steady-state levels of Nrf2 and its downstream gene expression. Although ENC1 interacted with Keap1 indirectly, the ENC1-mediated down-regulation of Nrf2 was independent of Keap1. The negative effect of ENC1 on Nrf2 was not due to a change in the stability of Nrf2 because neither proteasomal nor lysosomal inhibitors had any effects. Overexpression of ENC1 did not result in a change in the level of Nrf2 mRNA, rather, it caused a decrease in the rate of Nrf2 protein synthesis. These results demonstrate that ENC1 functions as a negative regulator of Nrf2 through suppressing Nrf2 protein translation, which adds another level of complexity in controlling the Nrf2 signaling pathway.

  12. Methylene blue upregulates Nrf2/ARE genes and prevents tau-related neurotoxicity

    PubMed Central

    Stack, Cliona; Jainuddin, Shari; Elipenahli, Ceyhan; Gerges, Meri; Starkova, Natalia; Starkov, Anatoly A.; Jové, Mariona; Portero-Otin, Manuel; Launay, Nathalie; Pujol, Aurora; Kaidery, Navneet Ammal; Thomas, Bobby; Tampellini, Davide; Beal, M. Flint; Dumont, Magali

    2014-01-01

    Methylene blue (MB, methylthioninium chloride) is a phenothiazine that crosses the blood brain barrier and acts as a redox cycler. Among its beneficial properties are its abilities to act as an antioxidant, to reduce tau protein aggregation and to improve energy metabolism. These actions are of particular interest for the treatment of neurodegenerative diseases with tau protein aggregates known as tauopathies. The present study examined the effects of MB in the P301S mouse model of tauopathy. Both 4 mg/kg MB (low dose) and 40 mg/kg MB (high dose) were administered in the diet ad libitum from 1 to 10 months of age. We assessed behavior, tau pathology, oxidative damage, inflammation and numbers of mitochondria. MB improved the behavioral abnormalities and reduced tau pathology, inflammation and oxidative damage in the P301S mice. These beneficial effects were associated with increased expression of genes regulated by NF-E2-related factor 2 (Nrf2)/antioxidant response element (ARE), which play an important role in antioxidant defenses, preventing protein aggregation, and reducing inflammation. The activation of Nrf2/ARE genes is neuroprotective in other transgenic mouse models of neurodegenerative diseases and it appears to be an important mediator of the neuroprotective effects of MB in P301S mice. Moreover, we used Nrf2 knock out fibroblasts to show that the upregulation of Nrf2/ARE genes by MB is Nrf2 dependent and not due to secondary effects of the compound. These findings provide further evidence that MB has important neuroprotective effects that may be beneficial in the treatment of human neurodegenerative diseases with tau pathology. PMID:24556215

  13. Heme oxygenase 1 plays role of neuron-protection by regulating Nrf2-ARE signaling post intracerebral hemorrhage.

    PubMed

    Yin, Xiao-Ping; Wu, Dan; Zhou, Jun; Chen, Zhi-Ying; Bao, Bing; Xie, Liang

    2015-01-01

    The NF-E2 related factor 2 (Nrf2) could be activated in intracerebral hemorrhage (ICH), and trigger the expression of ARE regulated heme oxygenase 1 (HO-1) subsequently. This study aims to explore neuroprotection of HO-1 protein in regulating the Nrf2-ARE signaling pathway in ICH. In this study, the femoral artery injection method was used to establish the ICH model. The zinc porphyrin-9 (ZPP-IX) was used to inhibit the HO-1 expression in ICH rats. The ICH rats were randomly divided into 3 groups, ICH group, ZPP-IX (10 mg/kg) + ICH group and DMSO (10 mg/kg) + ICH group. Neurological scores were evaluated for the 3 groups. Double immunofluorescence staining method was employed to observe the co-expression of HO-1, Nrf2, NF-κB and TNF-α and CD11b in glia cells. Western blot and RT-PCR assay were used to detect the total Nrf2, binding Nrf2, HO-1, NF-κB and TNF-α expression. The results indicated that ZPP-IX could aggravate the neurological dyafunstions of ICH rats. The HO-1 level in ZPP-IX group was significantly decreased compared to the ICH group (P < 0.05). The binding-Nrf2 protein was significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The NF-κB and TNF-α level were significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The ZPP-IX significantly inhibited the HO-1 and Nrf2, and enhanced NF-κB and TNF-α co-expressing with the CD11b compared to the ICH group (P < 0.05). In conclusion, HO-1 protein regulates the Nrf2-ARE pathway in ICH model by inhibiting the Nrf2 entering nucleus and activating the NF-κB and TNF-α expression.

  14. Heme oxygenase 1 plays role of neuron-protection by regulating Nrf2-ARE signaling post intracerebral hemorrhage

    PubMed Central

    Yin, Xiao-Ping; Wu, Dan; Zhou, Jun; Chen, Zhi-Ying; Bao, Bing; Xie, Liang

    2015-01-01

    The NF-E2 related factor 2 (Nrf2) could be activated in intracerebral hemorrhage (ICH), and trigger the expression of ARE regulated heme oxygenase 1 (HO-1) subsequently. This study aims to explore neuroprotection of HO-1 protein in regulating the Nrf2-ARE signaling pathway in ICH. In this study, the femoral artery injection method was used to establish the ICH model. The zinc porphyrin-9 (ZPP-IX) was used to inhibit the HO-1 expression in ICH rats. The ICH rats were randomly divided into 3 groups, ICH group, ZPP-IX (10 mg/kg) + ICH group and DMSO (10 mg/kg) + ICH group. Neurological scores were evaluated for the 3 groups. Double immunofluorescence staining method was employed to observe the co-expression of HO-1, Nrf2, NF-κB and TNF-α and CD11b in glia cells. Western blot and RT-PCR assay were used to detect the total Nrf2, binding Nrf2, HO-1, NF-κB and TNF-α expression. The results indicated that ZPP-IX could aggravate the neurological dyafunstions of ICH rats. The HO-1 level in ZPP-IX group was significantly decreased compared to the ICH group (P < 0.05). The binding-Nrf2 protein was significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The NF-κB and TNF-α level were significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The ZPP-IX significantly inhibited the HO-1 and Nrf2, and enhanced NF-κB and TNF-α co-expressing with the CD11b compared to the ICH group (P < 0.05). In conclusion, HO-1 protein regulates the Nrf2-ARE pathway in ICH model by inhibiting the Nrf2 entering nucleus and activating the NF-κB and TNF-α expression. PMID:26617723

  15. The histone acetylranseferase hMOF acetylates Nrf2 and regulates anti-drug responses in human non-small cell lung cancer

    PubMed Central

    Chen, Zhiwei; Ye, Xiangyun; Tang, Naiwang; Shen, Shengping; Li, Ziming; Niu, Xiaomin; Lu, Shun; Xu, Ling

    2014-01-01

    BACKGROUND AND PURPOSE The histone acetyltransferase MOF is a member of the MYST family. In mammals, MOF plays critical roles by acetylating histone H4 at K16 and non-histone substrates such as p53. Here we have investigated the role of MOF in human lung cancer and possible new substrates of hMOF. EXPERIMENTAL APPROACH Samples of human non-small cell lung cancer (NSCLC) were used to correlate MOF with clinicopathological parameters and NF–E2-related factor 2 (Nrf2) downstream genes. 293T-cells were used to study interactions between MOF and Nrf2, and acetylation of Nrf2 by MOF. Mouse embryonic fibroblast and A549 cells were utilized to assess involvement of MOF in antioxidative and anti-drug responses. A549 cells were used to analysis the role of MOF in anti-drug response in vitro and in vivo. KEY RESULTS hMOF was overexpressed in human NSCLC tissues and was associated with large tumour size, advanced disease stage and metastasis, and with poor prognosis. hMOF levels were positively correlated with Nrf2-downstream genes. MOF/hMOF physically interacted with and acetylated Nrf2 at Lys588. MOF-mediated acetylation increased nuclear retention of Nrf2 and transcription of its downstream genes. Importantly, MOF/hMOF was essential for anti-oxidative and anti-drug responses in vitro and regulated tumour growth and drug resistance in vivo in an Nrf2-dependent manner. CONCLUSION AND IMPLICATIONS hMOF was overexpressed in human NSCLC and was a predictor of poor survival. hMOF-mediated Nrf2 acetylation and nuclear retention are essential for anti-oxidative and anti-drug responses. hMOF may provide a therapeutic target for the treatment of NSCLC. PMID:24571482

  16. The Nrf2 activator tBHQ inhibits T cell activation of primary human CD4 T cells.

    PubMed

    Turley, Alexandra E; Zagorski, Joseph W; Rockwell, Cheryl E

    2015-02-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) regulates a battery of antioxidant, detoxification, and cell stress genes. It is activated by oxidative stress and a number of exogenous compounds, one of which is tert-butylhydroquinone (tBHQ), a widely used food preservative. Nrf2 modulates immune responses in numerous rodent models of inflammation, but its effects on human immune cells are not well characterized. The purpose of these studies was to evaluate the effects of the Nrf2 activator tBHQ on early events of T cell activation in primary human cells. Treatment with tBHQ induced mRNA expression of the Nrf2 target genes HMOX-1, GCLC, and NQO1, and also increased NRF2 mRNA expression, albeit to a lesser extent than the other target genes. tBHQ decreased production of the cytokines IL-2 and IFN-γ at both the protein and mRNA levels after stimulation with anti-CD3/anti-CD28 in human peripheral blood mononuclear cells and to an even greater extent in isolated CD4 T cells. Likewise, tBHQ decreased induction of CD25 and CD69 in peripheral blood mononuclear cells (PBMCs) and this decrease was even more marked in isolated CD4 T cells. In addition, tBHQ inhibited induction of NFκB DNA binding in anti-CD3/anti-CD28-activated PBMCs. Collectively, these data suggest that tBHQ inhibits activation of primary human CD4 T cells, which correlates with activation of Nrf2 and inhibition of NFκB DNA binding. Although these studies suggest the food additive tBHQ negatively impacts T cell activation, further studies will be needed to fully elucidate the effect of tBHQ on human immune responses.

  17. Distinct Nrf2 Signaling Mechanisms of Fumaric Acid Esters and Their Role in Neuroprotection against 1-Methyl-4-Phenyl-1,2,3,6-Tetrahydropyridine-Induced Experimental Parkinson's-Like Disease

    PubMed Central

    Ahuja, Manuj; Ammal Kaidery, Navneet; Yang, Lichuan; Calingasan, Noel; Smirnova, Natalya; Gaisin, Arsen; Gaisina, Irina N.; Gazaryan, Irina; Hushpulian, Dmitry M.; Kaddour-Djebbar, Ismail; Bollag, Wendy B.; Morgan, John C.; Ratan, Rajiv R.; Starkov, Anatoly A.; Beal, M. Flint

    2016-01-01

    A promising approach to neurotherapeutics involves activating the nuclear-factor-E2-related factor 2 (Nrf2)/antioxidant response element signaling, which regulates expression of antioxidant, anti-inflammatory, and cytoprotective genes. Tecfidera, a putative Nrf2 activator, is an oral formulation of dimethylfumarate (DMF) used to treat multiple sclerosis. We compared the effects of DMF and its bioactive metabolite monomethylfumarate (MMF) on Nrf2 signaling and their ability to block 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced experimental Parkinson's disease (PD). We show that in vitro DMF and MMF activate the Nrf2 pathway via S-alkylation of the Nrf2 inhibitor Keap1 and by causing nuclear exit of the Nrf2 repressor Bach1. Nrf2 activation by DMF but not MMF was associated with depletion of glutathione, decreased cell viability, and inhibition of mitochondrial oxygen consumption and glycolysis rates in a dose-dependent manner, whereas MMF increased these activities in vitro. However, both DMF and MMF upregulated mitochondrial biogenesis in vitro in an Nrf2-dependent manner. Despite the in vitro differences, both DMF and MMF exerted similar neuroprotective effects and blocked MPTP neurotoxicity in wild-type but not in Nrf2 null mice. Our data suggest that DMF and MMF exhibit neuroprotective effects against MPTP neurotoxicity because of their distinct Nrf2-mediated antioxidant, anti-inflammatory, and mitochondrial functional/biogenetic effects, but MMF does so without depleting glutathione and inhibiting mitochondrial and glycolytic functions. Given that oxidative damage, neuroinflammation, and mitochondrial dysfunction are all implicated in PD pathogenesis, our results provide preclinical evidence for the development of MMF rather than DMF as a novel PD therapeutic. SIGNIFICANCE STATEMENT Almost two centuries since its first description by James Parkinson, Parkinson's disease (PD) remains an incurable disease with limited symptomatic treatment. The

  18. p97 Negatively Regulates NRF2 by Extracting Ubiquitylated NRF2 from the KEAP1-CUL3 E3 Complex.

    PubMed

    Tao, Shasha; Liu, Pengfei; Luo, Gang; Rojo de la Vega, Montserrat; Chen, Heping; Wu, Tongde; Tillotson, Joseph; Chapman, Eli; Zhang, Donna D

    2017-04-15

    Activation of the stress-responsive transcription factor NRF2 is the major line of defense to combat oxidative or electrophilic insults. Under basal conditions, NRF2 is continuously ubiquitylated by the KEAP1-CUL3-RBX1 E3 ubiquitin ligase complex and is targeted to the proteasome for degradation (the canonical mechanism). However, the path from the CUL3 complex to ultimate proteasomal degradation was previously unknown. p97 is a ubiquitin-targeted ATP-dependent segregase that extracts ubiquitylated client proteins from membranes, protein complexes, or chromatin and has an essential role in autophagy and the ubiquitin proteasome system (UPS). In this study, we show that p97 negatively regulates NRF2 through the canonical pathway by extracting ubiquitylated NRF2 from the KEAP1-CUL3 E3 complex, with the aid of the heterodimeric cofactor UFD1/NPL4 and the UBA-UBX-containing protein UBXN7, for efficient proteasomal degradation. Given the role of NRF2 in chemoresistance and the surging interest in p97 inhibitors to treat cancers, our results indicate that dual p97/NRF2 inhibitors may offer a more potent and long-term avenue of p97-targeted treatment.

  19. A novel natural Nrf2 activator with PPARγ-agonist (monascin) attenuates the toxicity of methylglyoxal and hyperglycemia

    SciTech Connect

    Hsu, Wei-Hsuan; Lee, Bao-Hong; Chang, Yu-Ying; Hsu, Ya-Wen; Pan, Tzu-Ming

    2013-11-01

    Methylglyoxal (MG) is a toxic-glucose metabolite and a major precursor of advanced glycation endproducts (AGEs). MG has been reported to result in inflammation by activating receptor for AGEs (RAGE). We recently found that Monascus-fermented metabolite monascin acts as a novel natural peroxisome proliferator-activated receptor-γ (PPARγ) agonist that improves insulin sensitivity. We investigated the metabolic, biochemical, and molecular abnormalities characteristic of type 2 diabetes in MG-treated Wistar rats treated with oral administration of monascin or rosiglitazone. Monascin (a novel PPARγ agonist) activated nuclear factor-erythroid 2-related factor 2 (Nrf2) and down-regulated hyperinsulinmia in oral glucose tolerance test (OGTT). Monascin was able to elevate glyoxalase-1 expression via activation of hepatic Nrf2, hence, resulting in MG metabolism to D-lactic acid and protected from AGEs production in MG-treated rats. Rosiglitazone did not activate Nrf2 nor glyoxalase expression to lower serum and hepatic AGEs levels. Monascin acts as a novel natural Nrf2 activator with PPARγ-agonist activity were confirmed by Nrf2 and PPARγ reporter assays in Hep G2 cells. These findings suggest that monascin acts as an anti-diabetic and anti-oxidative stress agent to a greater degree than rosiglitazone and thus may have therapeutic potential for the prevention of diabetes. - Highlights: • Monascin acts as a PPARgamma agonist. • Monascin activates Nrf2 and AMPK. • Monascin promotes MG metabolism into D-lactic acid. • Monascin attenuates inflammation and diabetes in vivo.

  20. Epigenetic modifications of triterpenoid ursolic acid in activating Nrf2 and blocking cellular transformation of mouse epidermal cells.

    PubMed

    Kim, Hyuck; Ramirez, Christina N; Su, Zheng-Yuan; Kong, Ah-Ng Tony

    2016-07-01

    Ursolic acid (UA), a well-known natural triterpenoid found in abundance in blueberries, cranberries and apple peels, has been reported to possess many beneficial health effects. These effects include anticancer activity in various cancers, such as skin cancer. Skin cancer is the most common cancer in the world. Nuclear factor E2-related factor 2 (Nrf2) is a master regulator of antioxidative stress response with anticarcinogenic activity against UV- and chemical-induced tumor formation in the skin. Recent studies show that epigenetic modifications of Nrf2 play an important role in cancer prevention. However, the epigenetic impact of UA on Nrf2 signaling remains poorly understood in skin cancer. In this study, we investigated the epigenetic effects of UA on mouse epidermal JB6 P+ cells. UA inhibited cellular transformation by 12-O-tetradecanoylphorbol-13-acetate at a concentration at which the cytotoxicity was no more than 25%. Under this condition, UA induced the expression of the Nrf2-mediated detoxifying/antioxidant enzymes heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 and UDP-glucuronosyltransferase 1A1. DNA methylation analysis revealed that UA demethylated the first 15 CpG sites of the Nrf2 promoter region, which correlated with the reexpression of Nrf2. Furthermore, UA reduced the expression of epigenetic modifying enzymes, including the DNA methyltransferases DNMT1 and DNMT3a and the histone deacetylases (HDACs) HDAC1, HDAC2, HDAC3 and HDAC8 (Class I) and HDAC6 and HDAC7 (Class II), and HDAC activity. Taken together, these results suggest that the epigenetic effects of the triterpenoid UA could potentially contribute to its beneficial effects, including the prevention of skin cancer.

  1. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    SciTech Connect

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-11-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  2. The emerging role of Nrf2 in mitochondrial function

    PubMed Central

    Dinkova-Kostova, Albena T.; Abramov, Andrey Y.

    2015-01-01

    The transcription factor NF-E2 p45-related factor 2 (Nrf2; gene name NFE2L2) allows adaptation and survival under conditions of stress by regulating the gene expression of diverse networks of cytoprotective proteins, including antioxidant, anti-inflammatory, and detoxification enzymes as well as proteins that assist in the repair or removal of damaged macromolecules. Nrf2 has a crucial role in the maintenance of cellular redox homeostasis by regulating the biosynthesis, utilization, and regeneration of glutathione, thioredoxin, and NADPH and by controlling the production of reactive oxygen species by mitochondria and NADPH oxidase. Under homeostatic conditions, Nrf2 affects the mitochondrial membrane potential, fatty acid oxidation, availability of substrates (NADH and FADH2/succinate) for respiration, and ATP synthesis. Under conditions of stress or growth factor stimulation, activation of Nrf2 counteracts the increased reactive oxygen species production in mitochondria via transcriptional upregulation of uncoupling protein 3 and influences mitochondrial biogenesis by maintaining the levels of nuclear respiratory factor 1 and peroxisome proliferator-activated receptor γ coactivator 1α, as well as by promoting purine nucleotide biosynthesis. Pharmacological Nrf2 activators, such as the naturally occurring isothiocyanate sulforaphane, inhibit oxidant-mediated opening of the mitochondrial permeability transition pore and mitochondrial swelling. Curiously, a synthetic 1,4-diphenyl-1,2,3-triazole compound, originally designed as an Nrf2 activator, was found to promote mitophagy, thereby contributing to the overall mitochondrial homeostasis. Thus, Nrf2 is a prominent player in supporting the structural and functional integrity of the mitochondria, and this role is particularly crucial under conditions of stress. PMID:25975984

  3. Vitamin E prevents NRF2 suppression by allergens in asthmatic alveolar macrophages in vivo.

    PubMed

    Dworski, Ryszard; Han, Wei; Blackwell, Timothy S; Hoskins, Aimee; Freeman, Michael L

    2011-07-15

    Asthma is a chronic inflammatory airway disease associated with increased generation of reactive oxidant species and disturbed antioxidant defenses. NRF2 is the master transcription factor that regulates the expression of Phase II antioxidant and detoxifying enzymes. Disruption of NRF2 augments oxidative stress and inflammation in a mouse model of asthma, suggesting a protective role for NRF2 in the lungs in vivo. Yet, little is known about the regulation and function of NRF2 in human asthmatics. Using segmental allergen challenge, a well-established experimental model of IgE-mediated asthma exacerbation in human atopic asthmatics, we investigated the effects of a specific allergen and the modulatory role of vitamin E on NRF2 and a NRF2-target gene, superoxide dismutase, in alveolar macrophages recovered from the airways at 24h after allergen instillation in vivo. Allergen-provoked airway inflammation in sensitive asthmatics caused a profound inhibition of macrophage NRF2 activity and superoxide dismutase, rendering them incapable of responding to the NRF2 inducers. Prolonged treatment with high doses of the antioxidant vitamin E lessened this allergen-induced drop in alveolar macrophage NRF2. These results are the first to demonstrate that NRF2 expression in human asthmatics is compromised upon allergen challenge but can be rescued by vitamin E in vivo.

  4. WNT-3A Regulates an Axin1/NRF2 Complex That Regulates Antioxidant Metabolism in Hepatocytes

    PubMed Central

    Rada, Patricia; Rojo, Ana I.; Offergeld, Anika; Feng, Gui Jie; Velasco-Martín, Juan P.; González-Sancho, José Manuel; Valverde, Ángela M.; Dale, Trevor; Regadera, Javier

    2015-01-01

    Abstract Aims: Nuclear factor (erythroid-derived 2)-like 2 (NRF2) is a master regulator of oxidant and xenobiotic metabolism, but it is unknown how it is regulated to provide basal expression of this defense system. Here, we studied the putative connection between NRF2 and the canonical WNT pathway, which modulates hepatocyte metabolism. Results: WNT-3A increased the levels of NRF2 and its transcriptional signature in mouse hepatocytes and HEK293T cells. The use of short interfering RNAs in hepatocytes and mouse embryonic fibroblasts which are deficient in the redox sensor Kelch-like ECH-associated protein 1 (KEAP1) indicated that WNT-3A activates NRF2 in a β-Catenin- and KEAP1-independent manner. WNT-3A stabilized NRF2 by preventing its GSK-3-dependent phosphorylation and subsequent SCF/β-TrCP-dependent ubiquitination and proteasomal degradation. Axin1 and NRF2 were physically associated in a protein complex that was regulated by WNT-3A, involving the central region of Axin1 and the Neh4/Neh5 domains of NRF2. Axin1 knockdown increased NRF2 protein levels, while Axin1 stabilization with Tankyrase inhibitors blocked WNT/NRF2 signaling. The relevance of this novel pathway was assessed in mice with a conditional deletion of Axin1 in the liver, which showed upregulation of the NRF2 signature in hepatocytes and disruption of liver zonation of antioxidant metabolism. Innovation: NRF2 takes part in a protein complex with Axin1 that is regulated by the canonical WNT pathway. This new WNT-NRF2 axis controls the antioxidant metabolism of hepatocytes. Conclusion: These results uncover the participation of NRF2 in a WNT-regulated signalosome that participates in basal maintenance of hepatic antioxidant metabolism. Antioxid. Redox Signal. 22, 555–571. PMID:25336178

  5. Diabetic Wound Healing and Activation of Nrf2 by Herbal Medicine

    PubMed Central

    Senger, Donald R.; Cao, Shugeng

    2016-01-01

    Nrf2 defense is a very important cellular mechanism to control oxidative stress, which is implicated in wound healing. Nrf2 can induce many cytoprotective genes, including HO-1, NQO1 and G6PD. Among many natural products that have been reported as Nrf2 activators, sulforaphane and curcumin have been studied more widely than any others, and both are in clinical trials for non-cancerous disorders. Recently, we reported 4-ethyl catechol and 4-vinyl catechol as Nrf2 co-factors that can induce Nrf2 as potently as sulforaphane and curcumin. These new Nrf2 co-factors were identified in hot aqueous extract of an herbal medicine Barleria lupulina, and fermented Noni (Morinda citrifolia) juice, which are used traditionally for diabetic wound healing. PMID:27868087

  6. Nadroparin sodium activates Nrf2/HO-1 pathway in acetic acid-induced colitis in rats.

    PubMed

    Yalniz, Mehmet; Demirel, Ulvi; Orhan, Cemal; Bahcecioglu, Ibrahim Halil; Ozercan, Ibrahim Hanefi; Aygun, Cem; Tuzcu, Mehmet; Sahin, Kazim

    2012-06-01

    Effects of nadroparin sodium, a low molecular weight heparin, in colitis was investigated by analyzing proteins implicated in nuclear factor E2-related factor-2/heme oxygenase-1 (Nrf2/HO-1) and nuclear factor kappa B (NF-κB) pathways. Twenty-eight rats were used. Colitis was induced by acetic acid (AA). Nadroparin sodium was given to prevention and treatment groups in addition to AA. Colitis was assessed histologically and levels of proteins were analyzed with Western blot. Nadroparin not only prevented and ameliorated the AA-induced colitis histopathologically but also decreased expression of colon NF-κB, activator protein-1, cyclooxygenase-2, tumor necrosis factor-alpha, and IL-6, which were significantly increased in group AA compared to control. The accumulation of Nrf2 in nuclear fraction and HO-1 found low in group AA was increased with nadroparin (p < 0.05). The mean malondialdehyde level increased with AA and was decreased significantly with nadroparin prevention and treatment (p < 0.001). Nadroparin sodium has both protective and therapeutic effects against colonic inflammation via exerting anti-oxidative and anti-inflammatory effects by modulating Nrf2/HO-1 and NF-κB pathways.

  7. Melatonin downregulates nuclear erythroid 2-related factor 2 and nuclear factor-kappaB during prevention of oxidative liver injury in a dimethylnitrosamine model.

    PubMed

    Jung, Kyung Hee; Hong, Sang-Won; Zheng, Hong-Mei; Lee, Don-Haeng; Hong, Soon-Sun

    2009-09-01

    Melatonin has potent hepatoprotective effects as an antioxidant. However, the signaling pathway of melatonin in the induction of antioxidant enzymes against acute liver injury is not fully understood. The study aimed to determine whether melatonin could prevent dimethylnitrosamine (DMN)-induced liver injury through nuclear erythroid 2-related factor 2 (Nrf2) and inflammation. Liver injury was induced in rats by a single injection of DMN (30 mg/kg, i.p.). Melatonin treatment (50 mg/kg/daily, i.p.) was initiated 24 hr after DMN injection for 14 days, after which the rats were killed and samples were collected. Serum and antioxidant enzyme activities improved in melatonin-treated rats, compared with DMN-induced liver injury group (P < 0.01). Melatonin reduced the infiltration of inflammatory cells and necrosis in the liver, and increased the expression of NADPH: quinone oxidoreductase-1, heme oxygenase-1, and superoxide dismutase-2, which were decreased by DMN. Melatonin increased expression of novel transcription factor, Nrf2, and decreased expression of inflammatory mediators including tumor necrosis factor-alpha, interleukin (IL)-1beta, IL-6, and inducible nitric oxide synthase. The increased nuclear binding of nuclear factor-kappa B (NF-kappaB) in the DMN-induced liver injury group was inhibited by melatonin. Our results show that melatonin increases antioxidant enzymes and Nrf2 expression in parallel with the decrease of inflammatory mediators in DMN-induced liver injury, suggesting that melatonin may play a role of antioxidant defense via the Nrf2 pathway, by reducing inflammation by NF-kappaB inhibition.

  8. Reactivity of chemical sensitizers toward amino acids in cellulo plays a role in the activation of the Nrf2-ARE pathway in human monocyte dendritic cells and the THP-1 cell line.

    PubMed

    Migdal, Camille; Botton, Jérémie; El Ali, Zeina; Azoury, Marie-Eliane; Guldemann, Joan; Giménez-Arnau, Elena; Lepoittevin, Jean-Pierre; Kerdine-Römer, Saadia; Pallardy, Marc

    2013-06-01

    Allergic contact dermatitis resulting from skin sensitization is an inflammatory skin disease linked to the use of chemicals termed haptens. Chemical reactivity is necessary for a chemical to be a sensitizer, allowing both covalent binding to proteins and maturation of dendritic cells (DCs) by mimicking "danger signals." The aim of this study was to evaluate how the reactivity of chemical sensitizers toward amino acids translates into a biological response using the activation of the nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway, which was assessed by the induction of three Nrf2 target genes (ho-1, nqo1, and il-8) and Nrf2 protein accumulation. Nrf2 activation is known to play a role in numerous detoxification mechanisms that could regulate danger signal outcomes in myeloid cells. Monocyte-derived DCs and THP-1 cells were exposed to (a) haptens with cysteine, lysine, or cysteine/lysine reactivity, (b) pro-/prehaptens, and (c) nonsensitizing molecules with reducing or oxidative properties (17 molecules in total). Chemicals were classified as "Nrf2 pathway activators" when at least two Nrf2 target genes associated with Nrf2 protein expression were induced. Results showed that most chemical sensitizers having cysteine and cysteine/lysine affinities were inducers of the Nrf2 pathway in both cell models, whereas lysine-reactive chemicals were less efficient. In THP-1 cells, the Nrf2 pathway was also activated by pro-/prehaptens. Regression analysis revealed that ho-1 and nqo1 expressions were found to be associated with chemical sensitizer reactivity to cysteine, providing evidence of the importance of chemical reactivity, as a part of danger signals, in DC biology.

  9. Regulation of Ahr signaling by Nrf2 during development: Effects of Nrf2a deficiency on PCB126 embryotoxicity in zebrafish (Danio rerio).

    PubMed

    Rousseau, Michelle E; Sant, Karilyn E; Borden, Linnea R; Franks, Diana G; Hahn, Mark E; Timme-Laragy, Alicia R

    2015-10-01

    The embryotoxicity of co-planar PCBs is regulated by the aryl hydrocarbon receptor (Ahr), and has been reported to involve oxidative stress. Ahr participates in crosstalk with another transcription factor, Nfe2l2, or Nrf2. Nrf2 binds to antioxidant response elements to regulate the adaptive response to oxidative stress. To explore aspects of the crosstalk between Nrf2 and Ahr and its impact on development, we used zebrafish (Danio rerio) with a mutated DNA binding domain in Nrf2a (nrf2a(fh318/fh318)), rendering these embryos more sensitive to oxidative stress. Embryos were exposed to 2 nM or 5 nM PCB126 at 24 h post fertilization (prim-5 stage of pharyngula) and examined for gene expression and morphology at 4 days post fertilization (dpf; protruding - mouth stage). Nrf2a mutant eleutheroembryos were more sensitive to PCB126 toxicity at 4 dpf, and in the absence of treatment also displayed some subtle developmental differences from wildtype embryos, including delayed inflation of the swim bladder and smaller yolk sacs. We used qPCR to measure changes in expression of the nrf gene family, keap1a, keap1b, the ahr gene family, and known target genes. cyp1a induction by PCB126 was enhanced in the Nrf2a mutants (156-fold in wildtypes vs. 228-fold in mutants exposed to 5 nM). Decreased expression of heme oxygenase (decycling) 1 (hmox1) in the Nrf2a mutants was accompanied by increased nrf2b expression. Target genes of Nrf2a and AhR2, NAD(P)H:quinone oxidoreductase 1 (nqo1) and glutathione S-transferase, alpha-like (gsta1), showed a 2-5-fold increase in expression in the Nrf2a mutants as compared to wildtype. This study elucidates the interaction between two important transcription factor pathways in the developmental toxicity of co-planar PCBs.

  10. The effect of ex vivo CDDO-Me activation on nuclear factor erythroid 2-related factor 2 pathway in white blood cells from patients with septic shock.

    PubMed

    Noel, Sanjeev; Zheng, Laura; Navas-Acien, Ana; Fuchs, Ralph J

    2014-11-01

    Nuclear factor erythroid 2-related factor 2 (NRF2) has been shown to protect against experimental sepsis in mice and lipopolysaccharide (LPS)-induced inflammation in ex vivo white blood cells from healthy subjects by upregulating cellular antioxidant genes. The objective of this study was to test the hypothesis that ex vivo methyl 2-cyano-3,12-dioxoolean-1,9-dien-28-oate (CDDO-Me) activates NRF2-regulated antioxidant genes in white blood cells from patients with septic shock and protects against LPS-induced inflammation and reactive oxidative species production. Peripheral blood was collected from 18 patients with septic shock who were being treated in medical and surgical intensive care units. Real-time polymerase chain reaction was used to quantify the expression of NRF2 target genes (NQO1, HO-1, GCLM, and FTL) and IL-6 in peripheral blood mononuclear cells (PBMCs), monocytes, and neutrophils after CDDO-Me treatment alone or after subsequent LPS exposure. Superoxide anion (O2) was measured to assess the effect of CDDO-Me pretreatment on subsequent LPS exposure. Treatment with CDDO-Me increased the gene expression of NQO1 (P = 0.04) and decreased the expression of HO-1 (P = 0.03) in PBMCs from patients with septic shock. Purified monocytes exhibited significant increases in the expression of NQO1 (P = 0.01) and GCLM (P = 0.003) after CDDO-Me treatment. Levels of other NRF2 target genes (HO-1 and FTL) remained similar to those of vehicle-treated cells. Peripheral blood mononuclear cells showed a trend toward increased IL-6 gene expression after CDDO-Me treatment, whereas purified monocytes showed a trend toward decreased IL-6. There was no discernible trend in the IL-6 expression subsequent to LPS treatment in either vehicle-treated or CDDO-Me-treated PBMCs and monocytes. Treatment with CDDO-Me significantly increased O2 production in PBMCs (P = 0.04). Although CDDO-Me pretreatment significantly attenuated O2 production to subsequent LPS exposure (P = 0.03), the

  11. Nrf2 expression is increased in peripheral blood mononuclear cells derived from mild-moderate ex-smoker COPD patients with persistent oxidative stress.

    PubMed

    Fratta Pasini, Anna Maria; Ferrari, Marcello; Stranieri, Chiara; Vallerio, Paola; Mozzini, Chiara; Garbin, Ulisse; Zambon, Giorgia; Cominacini, Luciano

    2016-01-01

    Inadequacy of antioxidant nuclear factor-E2-related factor 2 (Nrf2) and endoplasmic reticulum stress-mediated unfolded protein response has been implicated in severe chronic obstructive pulmonary disease (COPD) and cigarette smoking-induced emphysema. As evidence suggests that the ability to upregulate Nrf2 expression may influence the progression of COPD and no data exist up to now in ex-smokers with mild-moderate COPD, this study was first aimed to evaluate Nrf2 and unfolded protein response expression in peripheral blood mononuclear cells (PBMC) of mild-moderate ex-smokers with COPD compared to smoking habit-matched non-COPD subjects. Then, we tested whether oxidative stress persists after cigarette smoking cessation and whether the concentrations of oxidized phospholipids (oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine [oxPAPC]) in the PBMC of the same subjects may have a causative role in determining the upregulation of Nrf2. The expression (mRNA and protein) of Nrf2 and of its related gene heme oxygenase-1 was significantly increased in COPD group without differences in the unfolded protein response. Plasma malondialdehyde, the circulating marker of oxidative stress, and oxPAPC in PBMC were significantly higher in COPD than in non-COPD subjects. The fact that the expression of p47phox, a subunit of NADPH oxidase, was increased in PBMC of COPD patients and that it was directly correlated with oxPAPC may indicate that oxPAPC may be one of the determinants of oxidative stress-induced Nrf2 upregulation. Finally, we also demonstrated that lung function inversely correlated with plasma malondialdehyde and with Nrf2 and heme oxygenase-1 mRNA expression in all subjects. Our results indicate that mild-moderate ex-smokers with COPD may be able to counteract oxidative stress by increasing the expression of Nrf2/antioxidant-response elements. Because Nrf2 failure significantly contributes to the development of COPD, our

  12. Activation of Nrf2 Reduces UVA-Mediated MMP-1 Upregulation via MAPK/AP-1 Signaling Cascades: The Photoprotective Effects of Sulforaphane and Hispidulin

    PubMed Central

    Chaiprasongsuk, Anyamanee; Lohakul, Jinaphat; Soontrapa, Kitipong; Sampattavanich, Somponnat; Akarasereenont, Pravit

    2017-01-01

    UVA irradiation plays a role in premature aging of the skin through triggering oxidative stress-associated stimulation of matrix metalloproteinase-1 (MMP-1) responsible for collagen degradation, a hallmark of photoaged skin. Compounds that can activate nuclear factor E2-related factor 2 (Nrf2), a transcription factor regulating antioxidant gene expression, should therefore serve as effective antiphotoaging agents. We investigated whether genetic silencing of Nrf2 could relieve UVA-mediated MMP-1 upregulation via activation of mitogen-activated protein kinase (MAPK)/activator protein 1 (AP-1) signaling using human keratinocyte cell line (HaCaT). Antiphotoaging effects of hispidulin (HPD) and sulforaphane (SFN) were assessed on their abilities to activate Nrf2 in controlling MMP-1 and collagen expressions in association with phosphorylation of MAPKs (extracellular signal-regulated kinase, c-Jun N-terminal kinase, and p38), c-Jun, and c-Fos, using the skin of BALB/c mice subjected to repetitive UVA irradiation. Our findings suggested that depletion of Nrf2 promoted both mRNA expression and activity of MMP-1 in the UVA-irradiated HaCaT cells. Treatment of Nrf2 knocked-down HaCaT cells with MAPK inhibitors significantly suppressed UVA-induced MMP-1 and AP-1 activities. Moreover, pretreatment of the mouse skin with HPD and SFN, which could activate Nrf2, provided protective effects against UVA-mediated MMP-1 induction and collagen depletion in correlation with the decreased levels of phosphorylated MAPKs, c-Jun, and c-Fos in the mouse skin. In conclusion, Nrf2 could influence UVA-mediated MMP-1 upregulation through the MAPK/AP-1 signaling cascades. HPD and SFN may therefore represent promising antiphotoaging candidates. PMID:28011874

  13. Role of Nrf2 and protective effects of Metformin against tobacco smoke-induced cerebrovascular toxicity.

    PubMed

    Prasad, Shikha; Sajja, Ravi K; Kaisar, Mohammad Abul; Park, Jee Hyun; Villalba, Heidi; Liles, Taylor; Abbruscato, Thomas; Cucullo, Luca

    2017-02-12

    Cigarette smoking (CS) is associated with vascular endothelial dysfunction in a causative way primarily related to the TS content of reactive oxygen species (ROS), nicotine, and inflammation. TS promotes glucose intolerance and increases the risk of developing type-2 diabetes mellitus (2DM) with which it shares other pathogenic traits including the high risk of cerebrovascular and neurological disorders like stroke via ROS generation, inflammation, and blood-brain barrier (BBB) impairment. Herein we provide evidence of the role played by nuclear factor erythroid 2-related factor (Nrf2) in CS-induced cerebrobvascular/BBB impairments and how these cerebrovascular harmful effects can be circumvented by the use of metformin (MF; a widely prescribed, firstline anti-diabetic drug) treatment. Our data in fact revealed that MF activates counteractive mechanisms primarily associated with the Nrf2 pathway which drastically reduce CS toxicity at the cerebrovascular level. These include the suppression of tight junction (TJ) protein downregulation and loss of BBB integrity induced by CS, reduction of inflammation and oxidative stress, renormalization of the expression levels of the major BBB glucose transporter Glut-1 and that of the anticoagulant factor thrombomodulin. Further, we provide additional insights on the controversial interplay between Nrf2 and AMPK.

  14. A novel Nrf2 activator from microbial transformation inhibits radiation-induced dermatitis in mice.

    PubMed

    Nakagami, Yasuhiro; Masuda, Kayoko

    2016-09-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that regulates many antioxidants, and we have recently succeeded in obtaining a novel Nrf2 activator, RS9, from microbial transformation. RS9 is categorized as a triterpenoid, and well-known triterpenoids such as RTA 402 (bardoxolone methyl) and RTA 408 have been tested in clinical trials. RTA 408 lotion is currently being tested in patients at risk for radiation dermatitis. This prompted us to study the profiles of RS9 in the skin. All the above triterpenoids increased the level of an Nrf2-targeted gene, NADPH:quinone oxidoreductase-1, in normal human epidermal keratinocytes. Among them, the activity of RS9 was prominent; furthermore, the cellular toxicity was less compared with RTA compounds. BALB/c mice were irradiated with 30 Gy/day on Day 0, and compounds were topically applied on the back once daily from Day 1 to Day 30. Dermatitis scores peaked on Day 18, with a score of 2.6 in vehicle-treated mice, and topical applications of 0.1% RTA 402, RTA 408 and RS9 reduced the scores to 1.8, 2.0 and 1.4, respectively. Moreover, the percentage of animals with scores ≥2 was analyzed, and 0.1% RS9 suppressed the percentage from 100% to 47%. These results imply that RS9 has potential efficacy for treating radiation dermatitis.

  15. A novel Nrf2 activator from microbial transformation inhibits radiation-induced dermatitis in mice

    PubMed Central

    Nakagami, Yasuhiro; Masuda, Kayoko

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that regulates many antioxidants, and we have recently succeeded in obtaining a novel Nrf2 activator, RS9, from microbial transformation. RS9 is categorized as a triterpenoid, and well-known triterpenoids such as RTA 402 (bardoxolone methyl) and RTA 408 have been tested in clinical trials. RTA 408 lotion is currently being tested in patients at risk for radiation dermatitis. This prompted us to study the profiles of RS9 in the skin. All the above triterpenoids increased the level of an Nrf2-targeted gene, NADPH:quinone oxidoreductase-1, in normal human epidermal keratinocytes. Among them, the activity of RS9 was prominent; furthermore, the cellular toxicity was less compared with RTA compounds. BALB/c mice were irradiated with 30 Gy/day on Day 0, and compounds were topically applied on the back once daily from Day 1 to Day 30. Dermatitis scores peaked on Day 18, with a score of 2.6 in vehicle-treated mice, and topical applications of 0.1% RTA 402, RTA 408 and RS9 reduced the scores to 1.8, 2.0 and 1.4, respectively. Moreover, the percentage of animals with scores ≥2 was analyzed, and 0.1% RS9 suppressed the percentage from 100% to 47%. These results imply that RS9 has potential efficacy for treating radiation dermatitis. PMID:27242339

  16. Characterization of the cancer chemopreventive NRF2-dependent gene battery in human keratinocytes: demonstration that the KEAP1-NRF2 pathway, and not the BACH1-NRF2 pathway, controls cytoprotection against electrophiles as well as redox-cycling compounds.

    PubMed

    MacLeod, A Kenneth; McMahon, Michael; Plummer, Simon M; Higgins, Larry G; Penning, Trevor M; Igarashi, Kazuhiko; Hayes, John D

    2009-09-01

    To better understand the role of transcription factor NF-E2-related factor (NRF) 2 in the human and its contribution to cancer chemoprevention, we have knocked down its negative regulators, Kelch-like ECH-associated protein 1 (KEAP1) and broad-complex, tramtrack and bric à brac and cap'n'collar homology 1 (BACH1), in HaCaT keratinocytes. Whole-genome microarray revealed that knockdown of KEAP1 resulted in 23 messenger RNAs (mRNAs) being up-regulated > or = 2.0-fold. mRNA for aldo-keto reductase (AKR) 1B10, AKR1C1, AKR1C2 and AKR1C3 were induced to the greatest extent, showing increases of between 12- and 16-fold, whereas mRNA for glutamate-cysteine ligase catalytic and modifier subunits, NAD(P)H:quinone oxidoreductase-1 and haem oxygenase-1 (HMOX1) were induced between 2.0- and 4.8-fold. Knockdown of BACH1 increased HMOX1 135-fold but induced the other genes examined to a maximum of only 2.7-fold. Activation of NRF2, by KEAP1 knockdown, caused a 75% increase in the amount of glutathione in HaCaT cells and a 1.4- to 1.6-fold increase in their resistance to the electrophiles acrolein, chlorambucil and cumene hydroperoxide (CuOOH), as well as the redox-cycling agent menadione. Inhibition of glutathione synthesis during KEAP1 knockdown, by treatment with buthionine sulfoximine, abrogated resistance to acrolein, chlorambucil and CuOOH, but not to menadione. In contrast, knockdown of BACH1 did not increase glutathione levels or resistance to xenobiotics. Knockdown of NRF2 in HaCaT cells decreased glutathione to approximately 80% of normal homeostatic levels and similarly reduced their tolerance of electrophiles. Thus, the KEAP1-NRF2 pathway determines resistance to electrophiles and redox-cycling compounds in human keratinocytes through glutathione-dependent and glutathione-independent mechanisms. This study also shows that AKR1B10, AKR1C1 and AKR1C2 proteins have potential utility as biomarkers for NRF2 activation in the human.

  17. Cinnamaldehyde inhibits the tumor necrosis factor-alpha-induced expression of cell adhesion molecules in endothelial cells by suppressing NF-kappaB activation: effects upon IkappaB and Nrf2.

    PubMed

    Liao, Being-Chyuan; Hsieh, Chia-Wen; Liu, Yen-Chin; Tzeng, Tsai-Teng; Sun, Yung-Wei; Wung, Being-Sun

    2008-06-01

    The production of adhesion molecules and subsequent attachment of leukocytes to endothelial cells (ECs) are critical early events in atherogenesis. These adhesion molecules thus play an important role in the development of this disease. Recent studies have highlighted the chemoprotective and anti-inflammatory effects of cinnamaldehyde, a Cinnamomum cassia Presl-specific diterpene. In our current study, we have examined the effects of both cinnamaldehyde and extracts of C. cassia on cytokine-induced monocyte/human endothelial cell interactions. We find that these compounds inhibit the adhesion of TNFalpha-induced monocytes to endothelial cells and suppress the expression of the cell adhesion molecules, VCAM-1 and ICAM-1, at the transcriptional level. Moreover, in TNFalpha-treated ECs, the principal downstream signal of VCAM-1 and ICAM-1, NF-kappaB, was also found to be abolished in a time-dependent manner. Interestingly, cinnamaldehyde exerts its anti-inflammatory effects by blocking the degradation of the inhibitory protein IkappaB-alpha, but only in short term pretreatments, whereas it does so via the induction of Nrf2-related genes, including heme-oxygenase-1 (HO-1), over long term pretreatments. Treating ECs with zinc protoporphyrin, a HO-1 inhibitor, partially blocks the anti-inflammatory effects of cinnamaldehyde. Elevated HO-1 protein levels were associated with the inhibition of TNFalpha-induced ICAM-1 expression. In addition to HO-1, we also found that cinnamaldehyde can upregulate Nrf2 in nuclear extracts, and can increase ARE-luciferase activity and upregulate thioredoxin reductase-1, another Nrf2-related gene. Moreover, cinnamaldehyde exposure rapidly reduces the cellular GSH levels in ECs over short term treatments but increases these levels after 9 h exposure. Hence, our present findings indicate that cinnamaldehyde suppresses TNF-induced singling pathways via two distinct mechanisms that are activated by different pretreatment periods.

  18. Fraxetin Induces Heme Oxygenase-1 Expression by Activation of Akt/Nrf2 or AMP-activated Protein Kinase α/Nrf2 Pathway in HaCaT Cells

    PubMed Central

    Kundu, Juthika; Chae, In Gyeong; Chun, Kyung-Soo

    2016-01-01

    Background Fraxetin (7,8-dihydroxy-6-methoxy coumarin), a coumarin derivative, has been reported to possess antioxidative, anti-inflammatory and neuroprotective effects. A number of recent observations suggest that the induction of heme oxygenase-1 (HO-1) inhibits inflammation and tumorigenesis. In the present study, we determined the effect of fraxetin on HO-1 expression in HaCaT human keratinocytes and investigated its underlying molecular mechanisms. Methods Reverse transcriptase-PCR and Western blot analysis were performed to detect HO-1 mRNA and protein expression, respectively. Cell viability was measured by the MTS test. The induction of intracellular reactive oxygen species (ROS) by fraxetin was evaluated by 2′,7′-dichlorofluorescin diacetate staining. Results Fraxetin upregulated mRNA and protein expression of HO-1. Incubation with fraxetin induced the localization of nuclear factor-erythroid-2-related factor-2 (Nrf2) in the nucleus and increased the antioxidant response element-reporter gene activity. Fraxetin also induced the phosphorylation of Akt and AMP-activated protein kinase (AMPK)α and diminished the expression of phosphatase and tensin homolog, a negative regulator of Akt. Pharmacological inhibition of Akt and AMPKα abrogated fraxetin-induced expression of HO-1 and nuclear localization of Nrf2. Furthermore, fraxetin generated ROS in a concentration-dependent manner. Conclusions Fraxetin induces HO-1 expression through activation of Akt/Nrf2 or AMPKα/Nrf2 pathway in HaCaT cells. PMID:27722139

  19. Exercise, Nrf2 and Antioxidant Signaling in Cardiac Aging

    PubMed Central

    Narasimhan, Madhusudhanan; Rajasekaran, Namakkal S.

    2016-01-01

    Aging is represented by a progressive decline in cellular functions. The age-related deformities in cardiac behaviors are the loss of cardiac myocytes through apoptosis or programmed cell death. Oxidative stress (OS) and its deleterious consequence contribute to age-related mechanical remodeling, reduced regenerative capacity, and apoptosis in cardiac tissue. The pathogenesis of OS in the elderly can predispose the heart to other cardiac complications such as atherosclerosis, hypertension, ischemic heart disease, cardiac myopathy, and so on. At the molecular level, oxidant-induced activation of Nrf2 (Nuclear erythroid-2-p45-related factor-2), a transcription factor, regulates several genes containing AREs (Antioxidant Response Element) and bring the respective translates to counteract the reactive radicals and establish homeostasis. Myriad of Nrf2 gene knockout studies in various organs such as lung, liver, kidney, brain, etc. have shown that dysregulation of Nrf2 severely affects the oxidant/ROS sensitivity and predispose the system to several pathological changes with aberrant cellular lesions. On the other hand, its gain of function chemical interventions exhibited oxidant stress resistance and cytoprotection. However, thus far, only a few investigations have shown the potential role of Nrf2 and its non-pharmacological induction in cardiac aging. Therefore, here we review the involvement of Nrf2 signaling along with its responses and ramifications on the cascade of OS under acute exercise stress (AES), moderate exercise training (MET), and endurance exercise stress (EES) conditions in the aging heart. PMID:27378947

  20. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    SciTech Connect

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun; Yang, Chung S.; Zhang, Jinsong

    2015-02-15

    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at