Science.gov

Sample records for 2-related factor nrf2

  1. The transcription factor NF-E2-related Factor 2 (Nrf2): a protooncogene?

    PubMed Central

    Shelton, Phillip; Jaiswal, Anil K.

    2013-01-01

    The transcription factor Nrf2 is responsible for regulating a battery of antioxidant and cellular protective genes, primarily in response to oxidative stress. A member of the cap 'n' collar family of transcription factors, Nrf2 activation is tightly controlled by a series of signaling events. These events can be separated into the basal state, a preinduction response, gene induction, and finally a postinduction response, culminating in the restoration of redox homeostasis. However, despite the immensely intricate level of control the cellular environment imposes on Nrf2 activity, there are many opportunities for perturbations to arise in the signaling events that favor carcinogenesis and, therefore, implicate Nrf2 as both a tumor suppressor and a protooncogene. Herein, we highlight the ways in which Nrf2 is regulated, and discuss some of the Nrf2-inducible antioxidant (NQO1, NQO2, HO-1, GCLC), antiapoptotic (Bcl-2), metabolic (G6PD, TKT, PPARγ), and drug efflux transporter (ABCG2, MRP3, MRP4) genes. In addition, we focus on how Nrf2 functions as a tumor suppressor under normal conditions and how its ability to detoxify the cellular environment makes it an attractive target for other oncogenes either via stabilization or degradation of the transcription factor. Finally, we discuss some of the ways in which Nrf2 is being considered as a therapeutic target for cancer treatment.—Shelton, P., Jaiswal, A. K. The transcription factor NF-E2-related factor 2 (Nrf2): a protooncogene? PMID:23109674

  2. Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) Mediates Neuroprotection in Traumatic Brain Injury at Least in Part by Inactivating Microglia.

    PubMed

    Wu, Gang; Liu, Zongying

    2016-01-01

    BACKGROUND Microglial activation has been reported to be involved in traumatic brain injury (TBI). Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a significant role in protecting against TBI-induced secondary brain injury. However, the exact mechanism is not clearly understood. The present study aimed to explore whether Nrf2 protects against TBI partly by regulating microglia function. MATERIAL AND METHODS Microglia cells were isolated from C57BL/6 mouse brains (postnatal day 1-3). The expression of Nrf2 was suppressed by transfection with Nrf2-specific small interfering RNA (siRNA), and overexpressed by transfections with pcDNA3.1-Nrf2. The expression of Nrf2 was confirmed by real-time PCR and Western blotting. After transfection, cell viability, phagocytic ability, and the expression of pro-inflammatory cytokines (tumor necrosis factor (TNF)-α and interleukin (IL)-6) were determined by 3-(4, 5-dimethylthiazol-2-yl)-2, 5- diphenyltetrazolium bromide (MTT) colorimetric assay, phagocytosis assay, and enzyme-linked immunosorbent assay (ELISA), respectively. RESULTS mRNA and protein expression levels of Nrf2 were significantly reduced by transfection with Nrf2-specific siRNA (both P<0.05) but were elevated by transfection with pcDNA3.1-Nrf2 (both P<0.01). The cell viability, phagocytic ability, and the expression of TNF-α and IL-6 were all significantly reduced by overexpression of Nrf2 but were significantly increased by silencing of Nrf2 compared with the control group. CONCLUSIONS Our results suggest that Nrf2 protects against TBI, at least part by regulating microglia function. PMID:27336674

  3. Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) Mediates Neuroprotection in Traumatic Brain Injury at Least in Part by Inactivating Microglia

    PubMed Central

    Wu, Gang; Liu, Zongying

    2016-01-01

    Background Microglial activation has been reported to be involved in traumatic brain injury (TBI). Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a significant role in protecting against TBI-induced secondary brain injury. However, the exact mechanism is not clearly understood. The present study aimed to explore whether Nrf2 protects against TBI partly by regulating microglia function. Material/Methods Microglia cells were isolated from C57BL/6 mouse brains (postnatal day 1–3). The expression of Nrf2 was suppressed by transfection with Nrf2-specific small interfering RNA (siRNA), and overexpressed by transfections with pcDNA3.1-Nrf2. The expression of Nrf2 was confirmed by real-time PCR and Western blotting. After transfection, cell viability, phagocytic ability, and the expression of pro-inflammatory cytokines (tumor necrosis factor (TNF)-α and interleukin (IL)-6) were determined by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) colorimetric assay, phagocytosis assay, and enzyme-linked immunosorbent assay (ELISA), respectively. Results mRNA and protein expression levels of Nrf2 were significantly reduced by transfection with Nrf2-specific siRNA (both P<0.05) but were elevated by transfection with pcDNA3.1-Nrf2 (both P<0.01). The cell viability, phagocytic ability, and the expression of TNF-α and IL-6 were all significantly reduced by overexpression of Nrf2 but were significantly increased by silencing of Nrf2 compared with the control group. Conclusions Our results suggest that Nrf2 protects against TBI, at least part by regulating microglia function. PMID:27336674

  4. Bromodomain and Extra-Terminal (BET) proteins suppress nuclear factor E2-related factor 2 (Nrf2) -mediated antioxidant gene expression

    PubMed Central

    Clarke, Colin; Bhavsar, Pankaj K; Adcock, Ian M; Barnes, Peter J; Chung, Kian Fan

    2014-01-01

    Oxidative stress, a pathogenetic factor in many conditions including chronic obstructive pulmonary disease (COPD) arises due to accumulation of reactive oxygen species (ROS) and defective antioxidant defences in the lungs. The latter is due, at least in part, to impaired activation of nuclear factor E2-related factor 2 (Nrf2), a transcription factor involved in the activation of antioxidant and cytoprotective genes. The bromodomain and extra-terminal (BET) proteins, Brd2, Brd3, Brd4 and BrdT, bind to acetylated lysine residues on histone or non-histone proteins recruiting transcriptional regulators and thus activating or repressing gene transcription. We investigated whether BET proteins modulate the regulation of Nrf2-dependent gene expression in primary human airway smooth muscle cells (ASMCs) and the human monocytic cell line, THP-1. Inhibition of BET protein bromodomains using the inhibitor JQ1+, or attenuation of Brd2 and Brd4 expression using siRNA led to activation of Nrf2-dependent transcription and expression of the antioxidant proteins heme oxygenase (HO)-1, NADPH quinone oxidoreductase 1 (NQO1) and glutamate-cysteine ligase catalytic subunit (GCLC). Also, JQ1+ prevented hydrogen peroxide (H2O2)-induced intracellular ROS production. By co-immunoprecipitation, BET proteins were found to be complexed with Nrf2, whilst chromatin-immunoprecipitation studies indicated recruitment of Brd2 and Brd4 to Nrf2-binding sites on the promoters of HO-1 and NQO1. BET proteins, particularly Brd2 and Brd4, may play a key role in the regulation of Nrf2-dependent antioxidant gene transcription and are hence an important target for augmenting antioxidant responses in oxidative stress-mediated diseases. PMID:24733848

  5. A novel nuclear factor erythroid 2-related factor 2 (Nrf2) activator RS9 attenuates brain injury after ischemia reperfusion in mice.

    PubMed

    Yamauchi, Keita; Nakano, Yusuke; Imai, Takahiko; Takagi, Toshinori; Tsuruma, Kazuhiro; Shimazawa, Masamitsu; Iwama, Toru; Hara, Hideaki

    2016-10-01

    Recanalization of occluded vessels leads to ischemia-reperfusion injury (IRI), with oxidative stress as one of the main causes of injury, despite the fact that recanalization therapy is the most effective treatment for ischemic stroke. The nuclear factor erythroid 2-related factor 2 (Nrf2) is one of the transcription factors which has an essential role in protection against oxidative stress. RS9 is a novel Nrf2 activator obtained from bardoxolone methyl (BARD), an Nrf2 activator that has already been tested in a clinical trial, using a biotransformation technique. RS9 has been reported to lead to higher Nrf2 activation and less cytotoxicity than BARD. In this study, we investigated the effects of RS9 on IRI. Mice were intraperitoneally treated immediately after 2h of transient middle cerebral artery occlusion (MCAO) with a vehicle solution or 0.2mg/kg of RS9. Post-onset treatment of RS9 attenuated the infarct volume and improved neurological deficits 22h after reperfusion. RS9 activated Nrf2 2 and 6h after reperfusion and activated heme oxygenase-1 at 6 and 22h after reperfusion. RS9 also attenuated the phosphorylation of NF-κB p65 2 and 6h after reperfusion. Finally, RS9 improved the survival rate and neurological deficits 7days after MCAO. Our results suggest that the activation of Nrf2 by RS9 has a neuroprotective effect, mediated by attenuating both oxidative stress and neuroinflammation, and that RS9 is an effective therapeutic candidate for the treatment of IRI. PMID:27474227

  6. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2).

    PubMed

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y

    2016-04-01

    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. PMID:26841864

  7. Identifying panaxynol, a natural activator of nuclear factor erythroid-2 related factor 2 (Nrf2) from American ginseng as a suppressor of inflamed macrophage-induced cardiomyocyte hypertrophy

    PubMed Central

    Qu, Chen; Li, Bin; Lai, Yimu; Li, Hechu; Windust, Anthony; Hofseth, Lorne J.; Nagarkatti, Mitzi; Nagarkatti, Prakash; Wang, Xing Li; Tang, Dongqi; Janicki, Joseph S.; Tian, Xingsong; Cui, Taixing

    2015-01-01

    Ethnopharmacological relevance American ginseng is capable of ameliorating cardiac dysfunction and activating Nrf2, a master regulator of antioxidant defense, in the heart. This study was designed to isolate compounds from American ginseng and to determine those responsible for the Nrf2-mediated resolution of inflamed macrophage-induced cardiomyocyte hypertrophy. Materials and methods A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. A bioassay-based fractionization of American ginseng was performed to identify the putative substances which could activate Nrf2-mediated suppression of pro-inflammatory cytokine expression in macrophages and macrophage-mediated pro-hypertrophic growth in cardiomyocytes. Results A hexane fraction of an anti-inflammatory crude extract of American ginseng was found to be most effective in suppressing the inflammatory responses in macrophages. Preparative, reverse-phase HPLC and a comparative analysis by analytical scale LC–UV/MS revealed the hexane fraction contains predominantly C17 polyacetylenes and linolenic acid. Panaxynol, one of the major polyacetylenes, was found to be a potent Nrf2 activator. Panaxynol posttranscriptionally activated Nrf2 by inhibiting Kelch-like ECH-associated protein (Keap) 1-mediated degradation without affecting the binding of Keap1 and Nrf2. Moreover, panaxynol suppressed a selected set of cytokine expression via the activation of Nrf2 while minimally regulating nuclear factor-kappa B (NF-κB)-mediated cytokine expression in macrophages. It also dramatically inhibited the inflamed macrophage-mediated cardiomyocyte death and hypertrophy by activating Nrf2 in macrophages. Conclusions These results demonstrate that American ginseng-derived panaxynol is a specific Nrf2 activator and panaxynol-activated Nrf2 signaling is at least partly responsible for American ginseng-induced health benefit in the heart. PMID

  8. p62/Sequestosome-1, Autophagy-related Gene 8, and Autophagy in Drosophila Are Regulated by Nuclear Factor Erythroid 2-related Factor 2 (NRF2), Independent of Transcription Factor TFEB*

    PubMed Central

    Jain, Ashish; Rusten, Tor Erik; Katheder, Nadja; Elvenes, Julianne; Bruun, Jack-Ansgar; Sjøttem, Eva; Lamark, Trond; Johansen, Terje

    2015-01-01

    The selective autophagy receptor p62/sequestosome 1 (SQSTM1) interacts directly with LC3 and is involved in oxidative stress signaling in two ways in mammals. First, p62 is transcriptionally induced upon oxidative stress by the NF-E2-related factor 2 (NRF2) by direct binding to an antioxidant response element in the p62 promoter. Second, p62 accumulation, occurring when autophagy is impaired, leads to increased p62 binding to the NRF2 inhibitor KEAP1, resulting in reduced proteasomal turnover of NRF2. This gives chronic oxidative stress signaling through a feed forward loop. Here, we show that the Drosophila p62/SQSTM1 orthologue, Ref(2)P, interacts directly with DmAtg8a via an LC3-interacting region motif, supporting a role for Ref(2)P in selective autophagy. The ref(2)P promoter also contains a functional antioxidant response element that is directly bound by the NRF2 orthologue, CncC, which can induce ref(2)P expression along with the oxidative stress-associated gene gstD1. However, distinct from the situation in mammals, Ref(2)P does not interact directly with DmKeap1 via a KEAP1-interacting region motif; nor does ectopically expressed Ref(2)P or autophagy deficiency activate the oxidative stress response. Instead, DmAtg8a interacts directly with DmKeap1, and DmKeap1 is removed upon programmed autophagy in Drosophila gut cells. Strikingly, CncC induced increased Atg8a levels and autophagy independent of TFEB/MitF in fat body and larval gut tissues. Thus, these results extend the intimate relationship between oxidative stress-sensing NRF2/CncC transcription factors and autophagy and suggest that NRF2/CncC may regulate autophagic activity in other organisms too. PMID:25931115

  9. Acetylation-deacetylation of the transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) regulates its transcriptional activity and nucleocytoplasmic localization.

    PubMed

    Kawai, Yumiko; Garduño, Lakisha; Theodore, Melanie; Yang, Jianqi; Arinze, Ifeanyi J

    2011-03-01

    Activation of Nrf2 by covalent modifications that release it from its inhibitor protein Keap1 has been extensively documented. In contrast, covalent modifications that may regulate its action after its release from Keap1 have received little attention. Here we show that CREB-binding protein induced acetylation of Nrf2, increased binding of Nrf2 to its cognate response element in a target gene promoter, and increased Nrf2-dependent transcription from target gene promoters. Heterologous sirtuin 1 (SIRT1) decreased acetylation of Nrf2 as well as Nrf2-dependent gene transcription, and its effects were overridden by dominant negative SIRT1 (SIRT1-H355A). The SIRT1-selective inhibitors EX-527 and nicotinamide stimulated Nrf2-dependent gene transcription, whereas resveratrol, a putative activator of SIRT1, was inhibitory, mimicking the effect of SIRT1. Mutating lysine to alanine or to arginine at Lys(588) and Lys(591) of Nrf2 resulted in decreased Nrf2-dependent gene transcription and abrogated the transcription-activating effect of CREB-binding protein. Furthermore, SIRT1 had no effect on transcription induced by these mutants, indicating that these sites are acetylation sites. Microscope imaging of GFP-Nrf2 in HepG2 cells as well as immunoblotting for Nrf2 showed that acetylation conditions resulted in increased nuclear localization of Nrf2, whereas deacetylation conditions enhanced its cytoplasmic rather than its nuclear localization. We posit that Nrf2 in the nucleus undergoes acetylation, resulting in binding, with basic-region leucine zipper protein(s), to the antioxidant response element and consequently in gene transcription, whereas deacetylation disengages it from the antioxidant response element, thereby resulting in transcriptional termination and subsequently in its nuclear export. PMID:21196497

  10. Synthesis of piperlongumine analogues and discovery of nuclear factor erythroid 2-related factor 2 (Nrf2) activators as potential neuroprotective agents.

    PubMed

    Peng, Shoujiao; Zhang, Baoxin; Meng, Xianke; Yao, Juan; Fang, Jianguo

    2015-07-01

    The cellular antioxidant system plays key roles in blocking or retarding the pathogenesis of adult neurodegenerative disorders as elevated oxidative stress has been implicated in the pathophysiology of such diseases. Molecules with the ability in enhancing the antioxidant defense thus are promising candidates as neuroprotective agents. We reported herein the synthesis of piperlongumine analogues and evaluation of their cytoprotection against hydrogen peroxide- and 6-hydroxydopamine-induced neuronal cell oxidative damage in the neuron-like PC12 cells. The structure-activity relationship was delineated after the cytotoxicity and protection screening. Two compounds (4 and 5) displayed low cytotoxicity and confer potent protection of PC12 cells from the oxidative injury via upregulation of a panel of cellular antioxidant molecules. Genetically silencing the transcription factor Nrf2, a master regulator of the cellular stress responses, suppresses the cytoprotection, indicating the critical involvement of Nrf2 for the cellular action of compounds 4 and 5 in PC12 cells. PMID:26079183

  11. Activation of the Kelch-like ECH-associated protein 1 (Keap1)/NF-E2-related factor 2 (Nrf2) pathway through covalent modification of the 2-alkenal group of aliphatic electrophiles in Coriandrum sativum L.

    PubMed

    Abiko, Yumi; Mizokawa, Mai; Kumagai, Yoshito

    2014-11-12

    Phytochemicals able to activate the transcription factor NF-E2-related factor 2 (Nrf2) were isolated from an extract of Coriandrum sativum L. (C. sativum) leaves by preparative octadecyl silica column chromatography. Ultraperformance liquid chromatography and liquid chromatography-tandem mass spectrometry analysis of the isolated components after derivatization with 2-diphenylacetyl-1,3-inandione-1-hydrazone and experiments with HepG2 cells revealed that (E)-2-alkenals with different carbon numbers play a role in Nrf2 activation in these cells. Such Nrf2 activation appears to be attributable to S-alkylation of Kelch-like ECH-associated protein 1 (Keap1), the negative regulator for Nrf2, as determined by a biotin-PEAC5-maleimide assay. Interestingly, (E)-2-butenal caused Keap1 modification and Nrf2 activation, whereas butanal did not. These results suggest that (E)-2-alkenals with an α,β-unsaturated aldehyde moiety, which is a common substituent in phytochemicals isolated from C. sativum leaves, activate the Keap1/Nrf2 pathway associated with cellular protection. PMID:25307732

  12. Monascin attenuates oxidative stress-mediated lung inflammation via peroxisome proliferator-activated receptor-gamma (PPAR-γ) and nuclear factor-erythroid 2 related factor 2 (Nrf-2) modulation.

    PubMed

    Hsu, Wei-Hsuan; Lee, Bao-Hong; Pan, Tzu-Ming

    2014-06-11

    We speculated that peroxisome proliferator-activated receptor (PPAR)-γ agonists may modulate the oxidative stress pathway to ameliorate the development of airway inflammation. The effect of Monascus-fermented metabolite monascin (MS) and rosiglitazone (Rosi) on oxidative stress-induced lung inflammation was evaluated. Luciferase assay and DNA binding activity assay were used to point out that MS may be a novel PPAR-γ agonist and nuclear factor-erythroid 2 related factor 2 (Nrf-2) activator. We used hydrogen peroxide (H2O2) to induce inflammation in lung epithelial cells. MS and Rosi prevented H2O2-induced ROS generation in A549 epithelial cells through PPAR-γ translocation, avoiding inflammatory mediator expression via inhibiting nuclear factor (NF)-κB translocation. The regulatory ability of MS was abolished by siRNA against PPAR-γ. MS also elevated antioxidant enzyme expression via Nrf-2 activation. Both PPAR-γ and Nrf-2 might have benefits against lung inflammation. MS regulated PPAR-γ and Nrf-2 to improve lung oxidative inflammation. PMID:24865672

  13. Sulforaphane Attenuates Muscle Inflammation in Dystrophin-deficient mdx Mice via NF-E2-related Factor 2 (Nrf2)-mediated Inhibition of NF-κB Signaling Pathway.

    PubMed

    Sun, Cheng-Cao; Li, Shu-Jun; Yang, Cui-Li; Xue, Rui-Lin; Xi, Yong-Yong; Wang, Liang; Zhao, Qian-Long; Li, De-Jia

    2015-07-17

    Inflammation is widely distributed in patients with Duchenne muscular dystrophy and ultimately leads to progressive deterioration of muscle function with chronic muscle damage, oxidative stress, and reduced oxidative capacity. NF-E2-related factor 2 (Nrf2) plays a critical role in defending against inflammation in different tissues via activation of phase II enzyme heme oxygenase-1 and inhibition of the NF-κB signaling pathway. However, the role of Nrf2 in the inflammation of dystrophic muscle remains unknown. To determine whether Nrf2 may counteract inflammation in dystrophic muscle, we treated 4-week-old male mdx mice with the Nrf2 activator sulforaphane (SFN) by gavage (2 mg/kg of body weight/day) for 4 weeks. The experimental results demonstrated that SFN treatment increased the expression of muscle phase II enzyme heme oxygenase-1 in an Nrf2-dependent manner. Inflammation in mice was reduced by SFN treatment as indicated by decreased infiltration of immune cells and expression of the inflammatory cytokine CD45 and proinflammatory cytokines tumor necrosis factor-α, interleukin-1β, and interleukin-6 in the skeletal muscles of mdx mice. In addition, SFN treatment also decreased the expression of NF-κB(p65) and phosphorylated IκB kinase-α as well as increased inhibitor of κB-α expression in mdx mice in an Nrf2-dependent manner. Collectively, these results show that SFN-induced Nrf2 can alleviate muscle inflammation in mdx mice by inhibiting the NF-κB signaling pathway. PMID:26013831

  14. Src Subfamily Kinases Regulate Nuclear Export and Degradation of Transcription Factor Nrf2 to Switch Off Nrf2-mediated Antioxidant Activation of Cytoprotective Gene Expression*

    PubMed Central

    Niture, Suryakant K.; Jain, Abhinav K.; Shelton, Phillip M.; Jaiswal, Anil K.

    2011-01-01

    Nrf2 (NF-E2-related factor 2) is a nuclear transcription factor that in response to chemical and radiation stress regulates coordinated induction of a battery of cytoprotective gene expressions leading to cellular protection. In this study, we investigated the role of Src kinases in the regulation of Nrf2 and downstream signaling. siRNA-mediated inhibition of Fyn, Src, Yes, and Fgr, but not Lyn, in mouse hepatoma Hepa-1 cells, led to nuclear accumulation of Nrf2 and up-regulation of Nrf2 downstream gene expression. Mouse embryonic fibroblasts with combined deficiency of Fyn/Src/Yes/Fgr supported results from siRNA. In addition, steady-state overexpression of Fyn, Src, and Yes phosphorylated Nrf2Tyr568 that triggered nuclear export and degradation of Nrf2 and down-regulation of Nrf2 downstream gene expression. Exposure of cells to antioxidant, oxidant, or UV radiation increased nuclear import of Fyn, Src, and Yes kinases, which phosphorylated Nrf2Tyr568 resulting in nuclear export and degradation of Nrf2. Further analysis revealed that stress-activated GSK3β acted upstream to the Src kinases and phosphorylated the Src kinases, leading to their nuclear localization and Nrf2 phosphorylation. The overexpression of Src kinases in Hepa-1 cells led to decreased Nrf2, increased apoptosis, and decreased cell survival. Mouse embryonic fibroblasts deficient in Src kinases showed nuclear accumulation of Nrf2, induction of Nrf2 and downstream gene expression, reduced apoptosis, and increased cell survival. The studies together demonstrate that Src kinases play a critical role in nuclear export and degradation of Nrf2, thereby providing a negative feedback mechanism to switch off Nrf2 activation and restore normal cellular homeostasis. PMID:21690096

  15. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2).

    PubMed

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3h of exposure, returning to normality at 24h. Additionally, BZL increased glutathione peroxidase activity at 12h and the oxidized glutathione/total glutathione (GSSG/GSSG+GSH) ratio that reached a peak at 24h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG+GSH returned to control values at 48h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48h, explaining normalization of GSSG/GSSG+GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. PMID:27180241

  16. Frequency modulated translocational oscillations of Nrf2, a transcription factor functioning like a wireless sensor.

    PubMed

    Xue, Mingzhan; Momiji, Hiroshi; Rabbani, Naila; Bretschneider, Till; Rand, David A; Thornalley, Paul J

    2015-08-01

    The discovery that nuclear factor erythroid 2-related factor 2 (Nrf2) undergoes translocational oscillations from cytoplasm to nucleus in human cells with frequency modulation linked to activation of a stress-stimulated cytoprotective response raises the prospect that the Nrf2 works mechanistically analogous to a wireless sensor. Herein, we consider how this new model of Nrf2 oscillation resolves previous inexplicable experimental findings on Nrf2 regulation and why it is fit-for-purpose. Further investigation is required to assess how generally applicable the oscillatory mechanism is and if characteristics of this regulatory control can be found in vivo. It suggests there are multiple, potentially re-enforcing receptors for Nrf2 activation, indicating that potent Nrf2 activation for improved health and treatment of disease may be achieved through combination of Nrf2 system stimulants. PMID:26551710

  17. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    SciTech Connect

    Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching

    2013-11-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS

  18. Hydrogen Sulfide Levels and Nuclear Factor-Erythroid 2-Related Factor 2 (NRF2) Activity Are Attenuated in the Setting of Critical Limb Ischemia (CLI)

    PubMed Central

    Islam, Kazi N; Polhemus, David J; Donnarumma, Erminia; Brewster, Luke P; Lefer, David J

    2015-01-01

    Background Cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase are endogenous enzymatic sources of hydrogen sulfide (H2S). Functions of H2S are mediated by several targets including ion channels and signaling proteins. Nuclear factor-erythroid 2-related factor 2 is responsible for the expression of antioxidant response element–regulated genes and is known to be upregulated by H2S. We examined the levels of H2S, H2S-producing enzymes, and nuclear factor-erythroid 2-related factor 2 activation status in skeletal muscle obtained from critical limb ischemia (CLI) patients. Methods and Results Gastrocnemius tissues were attained postamputation from human CLI and healthy control patients. We found mRNA and protein levels of cystathionine γ-lyase, cystathionine β-synthase, and 3-mercaptopyruvate sulfurtransferase were significantly decreased in skeletal muscle of CLI patients as compared to control. H2S and sulfane sulfur levels were significantly decreased in skeletal muscle of CLI patients. We also observed significant reductions in nuclear factor-erythroid 2-related factor 2 activation as well as antioxidant proteins, such as Cu, Zn-superoxide dismutase, catalase, and glutathione peroxidase in skeletal muscle of CLI patients. Biomarkers of oxidative stress, such as malondialdehyde and protein carbonyl formation, were significantly increased in skeletal muscle of CLI patients as compared to healthy controls. Conclusions The data demonstrate that H2S bioavailability and nuclear factor-erythroid 2-related factor 2 activation are both attenuated in CLI tissues concomitant with significantly increased oxidative stress. Reductions in the activity of H2S-producing enzymes may contribute to the pathogenesis of CLI. PMID:25977470

  19. Glucose availability is a decisive factor for Nrf2-mediated gene expression.

    PubMed

    Heiss, Elke H; Schachner, Daniel; Zimmermann, Kristin; Dirsch, Verena M

    2013-01-01

    Activation of the transcription factor Nrf2 (nuclear factor-erythroid 2-related factor 2) is one of the major cellular defense lines against oxidative and xenobiotic stress, but also influences genes involved in lipid and glucose metabolism. It is unresolved whether the cytoprotective and metabolic responses mediated by Nrf2 are connected or separable events in non-malignant cells. In this study we show that activation of Nrf2, either by the small molecule sulforaphane or knockout of the Nrf2 inhibitor Keap1, leads to increased cellular glucose uptake and increased glucose addiction in fibroblasts. Upon Nrf2 activation glucose is preferentially metabolized through the pentose phosphate pathway with increased production of NADPH. Interference with the supply of glucose or the pentose phosphate pathway and NADPH generation not only hampers Nrf2-mediated detoxification of reactive oxygen species on the enzyme level but also Nrf2-initiated expression of antioxidant defense proteins, such as glutathione reductase and heme-oxygenase1. We conclude that the Nrf2-dependent protection against oxidative stress relies on an intact pentose phosphate pathway and that there is crosstalk between metabolism and detoxification already at the level of gene expression in mammalian cells. PMID:24024172

  20. Glucose availability is a decisive factor for Nrf2-mediated gene expression☆

    PubMed Central

    Heiss, Elke H.; Schachner, Daniel; Zimmermann, Kristin; Dirsch, Verena M.

    2013-01-01

    Activation of the transcription factor Nrf2 (nuclear factor-erythroid 2-related factor 2) is one of the major cellular defense lines against oxidative and xenobiotic stress, but also influences genes involved in lipid and glucose metabolism. It is unresolved whether the cytoprotective and metabolic responses mediated by Nrf2 are connected or separable events in non-malignant cells. In this study we show that activation of Nrf2, either by the small molecule sulforaphane or knockout of the Nrf2 inhibitor Keap1, leads to increased cellular glucose uptake and increased glucose addiction in fibroblasts. Upon Nrf2 activation glucose is preferentially metabolized through the pentose phosphate pathway with increased production of NADPH. Interference with the supply of glucose or the pentose phosphate pathway and NADPH generation not only hampers Nrf2-mediated detoxification of reactive oxygen species on the enzyme level but also Nrf2-initiated expression of antioxidant defense proteins, such as glutathione reductase and heme-oxygenase1. We conclude that the Nrf2-dependent protection against oxidative stress relies on an intact pentose phosphate pathway and that there is crosstalk between metabolism and detoxification already at the level of gene expression in mammalian cells. PMID:24024172

  1. The novel triterpenoid RTA 408 protects human retinal pigment epithelial cells against H2O2-induced cell injury via NF-E2-related factor 2 (Nrf2) activation

    PubMed Central

    Liu, Xiaobin; Ward, Keith; Xavier, Christy; Jann, Jamieson; Clark, Abbot F.; Pang, Iok-Hou; Wu, Hongli

    2015-01-01

    Oxidative stress-induced retinal pigment epithelial (RPE) cell damage is an important factor in the pathogenesis of age-related macular degeneration (AMD). Previous studies have shown that RTA 408, a synthetic triterpenoid compound, potently activates Nrf2. This study aimed to investigate the protective effects of RTA 408 in cultured RPE cells during oxidative stress and to determine the effects of RTA 408 on Nrf2 and its downstream target genes. Primary human RPE cells were pretreated with RTA 408 and then incubated in 200 μM H2O2 for 6 h. Cell viability was measured with the WST-8 assay. Apoptosis was quantitatively measured by annexin V/propidium iodide (PI) double staining and Hoechst 33342 fluorescent staining. Reduced (GSH) and oxidized glutathione (GSSG) were measured using colorimetric assays. Nrf2 activation and its downstream effects on phase II enzymes were examined by Western blot. Treatment of RPE cells with nanomolar ranges (10 and 100 nM) of RTA 408 markedly attenuated H2O2-induced viability loss and apoptosis. RTA 408 pretreatment significantly protected cells from oxidative stress-induced GSH loss, GSSG formation and decreased ROS production. RTA 408 activated Nrf2 and increased the expression of its downstream genes, such as HO-1, NQO1, SOD2, catalase, Grx1, and Trx1. Consequently, the enzyme activities of NQO1, Grx1, and Trx1 were fully protected by RTA 408 pretreatment under oxidative stress. Moreover, knockdown of Nrf2 by siRNA significantly reduced the cytoprotective effects of RTA 408. In conclusion, our data suggest that RTA 408 protect primary human RPE cells from oxidative stress-induced damage by activating Nrf2 and its downstream genes. PMID:26773873

  2. The novel triterpenoid RTA 408 protects human retinal pigment epithelial cells against H2O2-induced cell injury via NF-E2-related factor 2 (Nrf2) activation.

    PubMed

    Liu, Xiaobin; Ward, Keith; Xavier, Christy; Jann, Jamieson; Clark, Abbot F; Pang, Iok-Hou; Wu, Hongli

    2016-08-01

    Oxidative stress-induced retinal pigment epithelial (RPE) cell damage is an important factor in the pathogenesis of age-related macular degeneration (AMD). Previous studies have shown that RTA 408, a synthetic triterpenoid compound, potently activates Nrf2. This study aimed to investigate the protective effects of RTA 408 in cultured RPE cells during oxidative stress and to determine the effects of RTA 408 on Nrf2 and its downstream target genes. Primary human RPE cells were pretreated with RTA 408 and then incubated in 200μM H2O2 for 6h. Cell viability was measured with the WST-8 assay. Apoptosis was quantitatively measured by annexin V/propidium iodide (PI) double staining and Hoechst 33342 fluorescent staining. Reduced (GSH) and oxidized glutathione (GSSG) were measured using colorimetric assays. Nrf2 activation and its downstream effects on phase II enzymes were examined by Western blot. Treatment of RPE cells with nanomolar ranges (10 and 100nM) of RTA 408 markedly attenuated H2O2-induced viability loss and apoptosis. RTA 408 pretreatment significantly protected cells from oxidative stress-induced GSH loss, GSSG formation and decreased ROS production. RTA 408 activated Nrf2 and increased the expression of its downstream genes, such as HO-1, NQO1, SOD2, catalase, Grx1, and Trx1. Consequently, the enzyme activities of NQO1, Grx1, and Trx1 were fully protected by RTA 408 pretreatment under oxidative stress. Moreover, knockdown of Nrf2 by siRNA significantly reduced the cytoprotective effects of RTA 408. In conclusion, our data suggest that RTA 408 protect primary human RPE cells from oxidative stress-induced damage by activating Nrf2 and its downstream genes. PMID:26773873

  3. Myeloid-Derived Suppressor Cell Survival and Function Are Regulated by the Transcription Factor Nrf2.

    PubMed

    Beury, Daniel W; Carter, Kayla A; Nelson, Cassandra; Sinha, Pratima; Hanson, Erica; Nyandjo, Maeva; Fitzgerald, Phillip J; Majeed, Amry; Wali, Neha; Ostrand-Rosenberg, Suzanne

    2016-04-15

    Tumor-induced myeloid-derived suppressor cells (MDSC) contribute to immune suppression in tumor-bearing individuals and are a major obstacle to effective immunotherapy. Reactive oxygen species (ROS) are one of the mechanisms used by MDSC to suppress T cell activation. Although ROS are toxic to most cells, MDSC survive despite their elevated content and release of ROS. NF erythroid 2-related factor 2 (Nrf2) is a transcription factor that regulates a battery of genes that attenuate oxidative stress. Therefore, we hypothesized that MDSC resistance to ROS may be regulated by Nrf2. To test this hypothesis, we used Nrf2(+/+)and Nrf2(-/-)BALB/c and C57BL/6 mice bearing 4T1 mammary carcinoma and MC38 colon carcinoma, respectively. Nrf2 enhanced MDSC suppressive activity by increasing MDSC production of H2O2, and it increased the quantity of tumor-infiltrating MDSC by reducing their oxidative stress and rate of apoptosis. Nrf2 did not affect circulating levels of MDSC in tumor-bearing mice because the decreased apoptotic rate of tumor-infiltrating MDSC was balanced by a decreased rate of differentiation from bone marrow progenitor cells. These results demonstrate that Nrf2 regulates the generation, survival, and suppressive potency of MDSC, and that a feedback homeostatic mechanism maintains a steady-state level of circulating MDSC in tumor-bearing individuals. PMID:26936880

  4. Aldosterone Activates Transcription Factor Nrf2 in Kidney Cells Both In Vitro and In Vivo

    PubMed Central

    Oteiza, Patricia I.; Link, Samuel; Hey, Valentin; Stopper, Helga; Schupp, Nicole

    2014-01-01

    Abstract Aims: An increased kidney cancer risk was found in hypertensive patients, who frequently exhibit hyperaldosteronism, known to contribute to kidney injury, with oxidative stress playing an important role. The capacity of kidney cells to up-regulate transcription factor nuclear factor-erythroid-2-related factor 2 (Nrf2), a key regulator of the cellular antioxidative defense, as a prevention of aldosterone-induced oxidative damage was investigated both in vitro and in vivo. Results: Aldosterone activated Nrf2 and increased the expression of enzymes involved in glutathione (GSH) synthesis and detoxification. This activation depended on the mineralocorticoid receptor (MR) and oxidative stress. In vitro, Nrf2 activation, GSH amounts, and target gene levels decreased after 24 h, while oxidant levels remained high. Nrf2 activation could not protect cells against oxidative DNA damage, as aldosterone-induced double-strand breaks and 7,8-dihydro-8-oxo-guanine (8-oxodG) lesions steadily rose. The Nrf2 activator sulforaphane enhanced the Nrf2 response both in vitro and in vivo, thereby preventing aldosterone-induced DNA damage. In vivo, Nrf2 activation further had beneficial effects on the aldosterone-caused blood pressure increase and loss of kidney function. Innovation: This is the first study showing the activation of Nrf2 by aldosterone. Moreover, the results identify sulforaphane as a substance that is capable of preventing aldosterone-induced damage both in vivo and in vitro. Conclusion: Aldosterone-induced Nrf2 adaptive response cannot neutralize oxidative actions of chronically increased aldosterone, which, therefore could be causally involved in the increased cancer incidence of hypertensive individuals. Enhancing the cellular antioxidative defense with sulforaphane might exhibit beneficial effects. Antioxid. Redox Signal. 21, 2126–2142. PMID:24512358

  5. Hyaluronic acid regulates a key redox control factor Nrf2 via phosphorylation of Akt in bovine articular chondrocytes

    PubMed Central

    Onodera, Yuta; Teramura, Takeshi; Takehara, Toshiyuki; Fukuda, Kanji

    2015-01-01

    One important pharmacological function of hyaluronic acid (HA) in chondrocytes is reduction of cellular superoxide generation and accumulation. Here we demonstrated a relationship between HA supplementation and accumulation of Nuclear factor-erythroid-2-related factor 2 (Nrf2), which is a master transcription factor in cellular redox reactions, in cultured chondrocytes derived from bovine joint cartilage. In HA-treated chondrocytes, expression of Nrf2 and its downstream genes was upregulated. In HA-treated chondrocytes, Akt was phosphorylated, and inhibition of Akt activity or suppression of HA receptors CD44 and/or RHAMM with siRNAs prevented HA-mediated Nrf2 accumulation. Furthermore, Nrf2 siRNA inhibited the HA effect on antioxidant enzymes. These results show that HA might contribute to ROS reduction through Nrf2 regulation by activating Akt. Our study suggests a new mechanism for extracellular matrix (ECM)-mediated redox systems in chondrocytes. PMID:26106522

  6. Monoacidic Inhibitors of the Kelch-like ECH-Associated Protein 1: Nuclear Factor Erythroid 2-Related Factor 2 (KEAP1:NRF2) Protein-Protein Interaction with High Cell Potency Identified by Fragment-Based Discovery.

    PubMed

    Davies, Thomas G; Wixted, William E; Coyle, Joseph E; Griffiths-Jones, Charlotte; Hearn, Keisha; McMenamin, Rachel; Norton, David; Rich, Sharna J; Richardson, Caroline; Saxty, Gordon; Willems, Henriëtte M G; Woolford, Alison J-A; Cottom, Joshua E; Kou, Jen-Pyng; Yonchuk, John G; Feldser, Heidi G; Sanchez, Yolanda; Foley, Joseph P; Bolognese, Brian J; Logan, Gregory; Podolin, Patricia L; Yan, Hongxing; Callahan, James F; Heightman, Tom D; Kerns, Jeffrey K

    2016-04-28

    KEAP1 is the key regulator of the NRF2-mediated cytoprotective response, and increasingly recognized as a target for diseases involving oxidative stress. Pharmacological intervention has focused on molecules that decrease NRF2-ubiquitination through covalent modification of KEAP1 cysteine residues, but such electrophilic compounds lack selectivity and may be associated with off-target toxicity. We report here the first use of a fragment-based approach to directly target the KEAP1 Kelch-NRF2 interaction. X-ray crystallographic screening identified three distinct "hot-spots" for fragment binding within the NRF2 binding pocket of KEAP1, allowing progression of a weak fragment hit to molecules with nanomolar affinity for KEAP1 while maintaining drug-like properties. This work resulted in a promising lead compound which exhibits tight and selective binding to KEAP1, and activates the NRF2 antioxidant response in cellular and in vivo models, thereby providing a high quality chemical probe to explore the therapeutic potential of disrupting the KEAP1-NRF2 interaction. PMID:27031670

  7. What is Known Regarding the Participation of Factor Nrf-2 in Liver Regeneration?

    PubMed Central

    Morales-González, José A.; Madrigal-Santillán, Eduardo; Morales-González, Ángel; Bautista, Mirandeli; Gayosso-Islas, Evila; Sánchez-Moreno, Cecilia

    2015-01-01

    It has been known for years that, after chemical damage or surgical removal of its tissue, the liver initiates a series of changes that, taken together, are known as regeneration, which are focused on the recovery of lost or affected tissue in terms of the anatomical or functional aspect. The Nuclear factor-erythroid 2-related factor (Nrf-2) is a reduction-oxidation reaction (redox)-sensitive transcriptional factor, with the basic leucine Zipper domain (bZIP) motif, encoding the NFE2L2 gene. The Keap1-Nrf2-ARE pathway is transcendental in the regulation of various cellular processes, such as antioxidant defenses, redox equilibrium, the inflammatory process, the apoptotic processes, intermediate metabolism, detoxification, and cellular proliferation. Some reports have demonstrated the regulator role of Nrf-2 in the cellular cycle of the hepatocyte, as well as in the modulation of the antioxidant response and of apoptotic processes during liver regeneration. It has been reported that there is a delay in liver regeneration after Partial hepatectomy (PH) in the absence of Nrf-2, and similarly as a regulator of hepatic cytoprotection due to diverse chemical or biological agents, and in diseases such as hepatitis, fibrosis, cirrhosis, and liver cancer. This regulator/protector capacity is due to the modulation of the Antioxidant response elements (ARE). It is postulated that oxidative stress (OS) can participate in the initial stages of liver regeneration and that Nrf-2 can probably participate. Studies are lacking on the different initiation stages, maintenance, and the termination of liver regeneration alone or with ethanol. PMID:26010752

  8. Nrf2-dependent suppression of azoxymethane/dextran sulfate sodium-induced colon carcinogenesis by the cinnamon-derived dietary factor cinnamaldehyde.

    PubMed

    Long, Min; Tao, Shasha; Rojo de la Vega, Montserrat; Jiang, Tao; Wen, Qing; Park, Sophia L; Zhang, Donna D; Wondrak, Georg T

    2015-05-01

    The progressive nature of colorectal cancer and poor prognosis associated with the metastatic phase of the disease create an urgent need for the development of more efficacious strategies targeting colorectal carcinogenesis. Cumulative evidence suggests that the redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defence, represents a promising molecular target for colorectal cancer chemoprevention. Recently, we have identified cinnamon, the ground bark of Cinnamomum aromaticum (cassia cinnamon) and Cinnamomum verum (Ceylon cinnamon), as a rich dietary source of the Nrf2 inducer cinnamaldehyde (CA) eliciting the Nrf2-regulated antioxidant response in human epithelial colon cells, conferring cytoprotection against electrophilic and genotoxic insult. Here, we have explored the molecular mechanism underlying CA-induced Nrf2 activation in colorectal epithelial cells and have examined the chemopreventive potential of CA in a murine colorectal cancer model comparing Nrf2(+/+) with Nrf2(-/-) mice. In HCT116 cells, CA caused a Keap1-C151-dependent increase in Nrf2 protein half-life via blockage of ubiquitination with upregulation of cytoprotective Nrf2 target genes and elevation of cellular glutathione. After optimizing colorectal Nrf2 activation and target gene expression by dietary CA-supplementation regimens, we demonstrated that CA suppresses AOM/DSS-induced inflammatory colon carcinogenesis with modulation of molecular markers of colorectal carcinogenesis. Dietary suppression of colorectal cancer using CA supplementation was achieved in Nrf2(+/+) but not in Nrf2(-/-) mice confirming the Nrf2 dependence of CA-induced chemopreventive effects. Taken together, our data suggest feasibility of colorectal cancer suppression by dietary CA, an FDA-approved food additive derived from the third most consumed spice in the world. PMID:25712056

  9. Nrf2-dependent suppression of azoxymethane/dextran sulfate sodium-induced colon carcinogenesis by the cinnamon-derived dietary factor cinnamaldehyde

    PubMed Central

    Long, Min; Tao, Shasha; de la Vega, Montserrat Rojo; Jiang, Tao; Wen, Qing; Park, Sophia L.; Zhang, Donna D.; Wondrak, Georg T.

    2015-01-01

    The progressive nature of colorectal cancer (CRC) and poor prognosis associated with the metastatic phase of the disease create an urgent need for the development of more efficacious strategies targeting colorectal carcinogenesis. Cumulative evidence suggests that the redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defence, represents a promising molecular target for CRC chemoprevention. Recently, we have identified cinnamon, the ground bark of Cinnamomum aromaticum (cassia cinnamon) and Cinnamomum verum (Ceylon cinnamon), as a rich dietary source of the Nrf2 inducer cinnamaldehyde (CA) eliciting the Nrf2-regulated antioxidant response in human epithelial colon cells, conferring cytoprotection against electrophilic and genotoxic insult. Here, we have explored the molecular mechanism underlying CA-induced Nrf2 activation in colorectal epithelial cells and have examined the chemopreventive potential of CA in a murine CRC model comparing Nrf2+/+ and Nrf2−/− mice. In HCT116 cells, CA caused a Keap1-C151-dependent increase in Nrf2 protein half-life via blockage of ubiquitination with upregulation of cytoprotective Nrf2 target genes and elevation of cellular glutathione. After optimizing colorectal Nrf2 activation and target gene expression by dietary CA-supplementation regimens, we demonstrated that CA suppresses AOM/DSS-induced inflammatory colon carcinogenesis with modulation of molecular markers of colorectal carcinogenesis. Dietary suppression of CRC using CA supplementation was achieved in Nrf2+/+ but not in Nrf2−/− mice confirming the Nrf2-dependence of CA-induced chemopreventive effects. Taken together, our data suggest feasibility of CRC suppression by dietary CA, an FDA-approved food additive derived from the third most consumed spice in the world. PMID:25712056

  10. Allergic skin inflammation induced by chemical sensitizers is controlled by the transcription factor Nrf2.

    PubMed

    El Ali, Zeina; Gerbeix, Cédric; Hemon, Patrice; Esser, Philipp R; Martin, Stefan F; Pallardy, Marc; Kerdine-Römer, Saadia

    2013-07-01

    Allergic contact dermatitis (ACD) is induced by low-molecular weight electrophilic chemicals and metal ions. Chemical contact sensitizers trigger reactive oxygen species production and provoke electrophilic stress, leading to the accumulation of the transcription factor nuclear-related factor 2 (Nrf2) in innate immune cell types. The objective of this work was to identify the role of Nrf2 in the regulation of ACD. We used the local lymph node assay (LLNA) and the mouse ear swelling test (MEST) to study the role of Nrf2 in both the sensitization and elicitation phase in nrf2 knockout (nrf2(-/-)) and wild-type (nrf2(+/+)) mice. Five chemicals were used: two compounds known to react with cysteine residues, 2,4-dinitrochlorobenzene (DNCB) and cinnamaldehyde (CinA); one sensitizer known to exhibit mixed reactivity to cysteine and lysine residues, isophorone diisocyanate; and one reacting specifically with lysine residues, trimellitic anhydride and croton oil, a well-known irritant. In the MEST assay, DNCB (1 and 2%) induced a significant increase in ear thickness in nrf2(-/-) compared with nrf2(+/+) mice, suggesting a role for Nrf2 in the control of the inflammatory process. When DNCB was used at 0.25 and 0.5% or when mice were treated with CinA, inflammation was found only in nrf2(-/-) mice. In the LLNA, all chemical sensitizers induced an increase of lymphocyte proliferation in nrf2(-/-) compared with nrf2(+/+) mice for the same chemical concentration. These results reveal an important role for Nrf2 in controlling ACD and lymphocyte proliferation in response to sensitizers. PMID:23564646

  11. Targeting Nrf2 Signaling to Combat Chemoresistance

    PubMed Central

    No, Jae Hong; Kim, Yong-Beom; Song, Yong Sang

    2014-01-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that upregulates expression of a battery of genes to combat oxidative and electrophilic stress. Modification of Kelch-like ECH-associated protein 1 (Keap1) by reactive oxygen species stabilizes Nrf2 by escaping from degradation. Nrf2 then binds to antioxidant response elements (AREs) on the promoter region of various genes. Activation of the Keap1-Nrf2-ARE pathway plays critical roles in the chemopreventive effect of various phytochemicals. However, Nrf2 can protect cancer cells from oxidative stress and promote cell proliferation. Moreover, recent studies reveal that activation of the Nrf2 pathway is critical for resistance to chemotherapeutic agents. The aim of this review is to provide a molecular basis for the use of Nrf2 inhibitors in overcoming chemoresistance. PMID:25337579

  12. NRF2, cancer and calorie restriction

    PubMed Central

    Martín-Montalvo, A; Villalba, JM; Navas, P; de Cabo, R

    2015-01-01

    The transcription factor NF-E2-related factor (NRF2) is a key regulator of several enzymatic pathways, including cytoprotective enzymes in highly metabolic organs. In this review, we summarize the ongoing research related to NRF2 activity in cancer development, focusing on in vivo studies using NRF2 knockout (KO) mice, which have helped in defining the crucial role of NRF2 in chemoprevention. The lower cancer protection observed in NRF2 KO mice under calorie restriction (CR) suggests that most of the beneficial effects of CR on the carcinogenesis process are likely mediated by NRF2. We propose that future interventions in cancer treatment would be carried out through the activation of NRF2 in somatic cells, which will lead to a delay or prevention of the onset of some forms of human cancers, and subsequently an extension of health- and lifespan. PMID:21057541

  13. Glycosylation enables aesculin to activate Nrf2.

    PubMed

    Kim, Kyun Ha; Park, Hyunsu; Park, Hee Jin; Choi, Kyoung-Hwa; Sadikot, Ruxana T; Cha, Jaeho; Joo, Myungsoo

    2016-01-01

    Since aesculin, 6,7-dihydroxycoumarin-6-O-β-glucopyranoside, suppresses inflammation, we asked whether its anti-inflammatory activity is associated with the activation of nuclear factor-E2-related factor 2 (Nrf2), a key anti-inflammatory factor. Our results, however, show that aesculin marginally activated Nrf2. Since glycosylation can enhance the function of a compound, we then asked whether adding a glucose makes aesculin activate Nrf2. Our results show that the glycosylated aesculin, 3-O-β-d-glycosyl aesculin, robustly activated Nrf2, inducing the expression of Nrf2-dependent genes, such as heme oxygenase-1, glutamate-cysteine ligase catalytic subunit, and NAD(P)H quinone oxidoreductase 1 in macrophages. Mechanistically, 3-O-β-d-glycosyl aesculin suppressed ubiquitination of Nrf2, retarding degradation of Nrf2. Unlike aesculin, 3-O-β-d-glycosyl aesculin significantly suppressed neutrophilic lung inflammation, a hallmark of acute lung injury (ALI), in mice, which was not recapitulated in Nrf2 knockout mice, suggesting that the anti-inflammatory function of the compound largely acts through Nrf2. In a mouse model of sepsis, a major cause of ALI, 3-O-β-d-glycosyl aesculin significantly enhanced the survival of mice, compared with aesculin. Together, these results show that glycosylation could confer the ability to activate Nrf2 on aesculin, enhancing the anti-inflammatory function of aesculin. These results suggest that glycosylation can be a way to improve or alter the function of aesculin. PMID:27417293

  14. Glycosylation enables aesculin to activate Nrf2

    PubMed Central

    Kim, Kyun Ha; Park, Hyunsu; Park, Hee Jin; Choi, Kyoung-Hwa; Sadikot, Ruxana T.; Cha, Jaeho; Joo, Myungsoo

    2016-01-01

    Since aesculin, 6,7-dihydroxycoumarin-6-O-β-glucopyranoside, suppresses inflammation, we asked whether its anti-inflammatory activity is associated with the activation of nuclear factor-E2-related factor 2 (Nrf2), a key anti-inflammatory factor. Our results, however, show that aesculin marginally activated Nrf2. Since glycosylation can enhance the function of a compound, we then asked whether adding a glucose makes aesculin activate Nrf2. Our results show that the glycosylated aesculin, 3-O-β-d-glycosyl aesculin, robustly activated Nrf2, inducing the expression of Nrf2-dependent genes, such as heme oxygenase-1, glutamate-cysteine ligase catalytic subunit, and NAD(P)H quinone oxidoreductase 1 in macrophages. Mechanistically, 3-O-β-d-glycosyl aesculin suppressed ubiquitination of Nrf2, retarding degradation of Nrf2. Unlike aesculin, 3-O-β-d-glycosyl aesculin significantly suppressed neutrophilic lung inflammation, a hallmark of acute lung injury (ALI), in mice, which was not recapitulated in Nrf2 knockout mice, suggesting that the anti-inflammatory function of the compound largely acts through Nrf2. In a mouse model of sepsis, a major cause of ALI, 3-O-β-d-glycosyl aesculin significantly enhanced the survival of mice, compared with aesculin. Together, these results show that glycosylation could confer the ability to activate Nrf2 on aesculin, enhancing the anti-inflammatory function of aesculin. These results suggest that glycosylation can be a way to improve or alter the function of aesculin. PMID:27417293

  15. Inhibition of cytochrome P450 2E1 and activation of transcription factor Nrf2 are renoprotective in myoglobinuric acute kidney injury.

    PubMed

    Wang, Zhe; Shah, Sudhir V; Liu, Hua; Baliga, Radhakrishna

    2014-08-01

    Rhabdomyolysis accounts for ∼10% of acute kidney injuries. In glycerol-induced myoglobinuric acute kidney injury, we found an increase in the nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear protein, a key redox-sensitive transcription factor, and Nrf2-regulated genes and proteins including upregulation of heme oxygenase-1. In in vitro studies, pretreatment of LLC-PK1 cells with an activator of Nrf2 before myoglobin exposure significantly decreased oxidant generation and cytotoxicity, whereas Nrf2 inhibition and gene silencing exacerbated the injury. Chlormethiazole, a specific CYP2E1 transcription inhibitor, prevented an increase in catalytic iron in the kidneys, decreased oxidative stress, blocked nuclear translocation of the Nrf2 protein, decreased heme oxygenase-1 upregulation, and provided functional and histological protection against acute kidney injury. CYP2E1 inhibitors and gene silencing in renal tubular epithelial cells significantly decreased reactive oxygen species generation and provided marked protection against myoglobin-induced cytotoxicity. Thus, during CYP2E1-induced oxidative stress, the transcription factor Nrf2 has a pivotal role in the early adaptive response. Inhibition of CYP2E1 coupled with the prior induction of Nrf2 may be a valuable tool to reduce CYP2E1-mediated rhabdomyolysis-induced acute kidney injury. PMID:24717297

  16. Nrf2 protects against airway disorders

    SciTech Connect

    Cho, Hye-Youn; Kleeberger, Steven R.

    2010-04-01

    Nuclear factor-erythroid 2 related factor 2 (Nrf2) is a ubiquitous master transcription factor that regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. In the unstressed condition, Kelch-like ECH-associated protein 1 (Keap1) suppresses cellular Nrf2 in cytoplasm and drives its proteasomal degradation. Nrf2 can be activated by diverse stimuli including oxidants, pro-oxidants, antioxidants, and chemopreventive agents. Nrf2 induces cellular rescue pathways against oxidative injury, abnormal inflammatory and immune responses, apoptosis, and carcinogenesis. Application of Nrf2 germ-line mutant mice has identified an extensive range of protective roles for Nrf2 in experimental models of human disorders in the liver, gastrointestinal tract, airway, kidney, brain, circulation, and immune or nerve system. In the lung, lack of Nrf2 exacerbated toxicity caused by multiple oxidative insults including supplemental respiratory therapy (e.g., hyperoxia, mechanical ventilation), cigarette smoke, allergen, virus, bacterial endotoxin and other inflammatory agents (e.g., carrageenin), environmental pollution (e.g., particles), and a fibrotic agent bleomycin. Microarray analyses and bioinformatic studies elucidated functional AREs and Nrf2-directed genes that are critical components of signaling mechanisms in pulmonary protection by Nrf2. Association of loss of function with promoter polymorphisms in NRF2 or somatic and epigenetic mutations in KEAP1 and NRF2 has been found in cohorts of patients with acute lung injury/acute respiratory distress syndrome or lung cancer, which further supports the role for NRF2 in these lung diseases. In the current review, we address the role of Nrf2 in airways based on emerging evidence from experimental oxidative disease models and human studies.

  17. Effects of blueberry on hepatic fibrosis and transcription factor Nrf2 in rats

    PubMed Central

    Wang, Yu-Ping; Cheng, Ming-Liang; Zhang, Bao-Fang; Mu, Mao; Wu, Jun

    2010-01-01

    AIM: To investigate the effects of blueberry on hepatic fibrosis and NF-E2-related factor 2 (Nrf2) transcription factor in rats. METHODS: Forty-five male Sprague-Dawley rats were randomly divided into control group (A); CCl4-induced hepatic fibrosis group (B); blueberry prevention group (C); Dan-shao-hua-xian capsule (DSHX) prevention group (D); and blueberry + DSHX prevention group (E). Liver fibrosis was induced in rats by subcutaneous injection of CCl4 and a high-lipid/low-protein diet for 8 wk (except the control group). The level of hyaluronic acid (HA) and alanine aminotransferase (ALT) in serum was examined. The activity of superoxide dismutase (SOD), glutathione-S-transferase (GST) and malondialdehyde (MDA) in liver homogenates was determined. The degree of hepatic fibrosis was evaluated by hematoxylin and eosin and Masson staining. Expression of Nrf2 and NADPH quinone oxidoreductase 1 (Nqo1) was detected by real-time reversed transcribed-polymerase chain reaction, immunohistochemical techniques, and western blotting. RESULTS: Compared with group B, liver indices, levels of serum HA and ALT of groups C, D and E were reduced (liver indices: 0.038 ± 0.008, 0.036 ± 0.007, 0.036 ± 0.005 vs 0.054 ± 0.009, P < 0.05; HA: 502.33 ± 110.57 ng/mL, 524.25 ± 255.42 ng/mL, 499.25 ± 198.10 ng/mL vs 828.50 ± 237.83 ng/mL, P < 0.05; ALT: 149.44 ± 16.51 U/L, 136.88 ± 10.07 U/L, 127.38 ± 11.03 U/L vs 203.25 ± 31.62 U/L, P < 0.05), and SOD level was significantly higher, but MDA level was lower, in liver homogenates (SOD: 1.36 ± 0.09 U/mg, 1.42 ± 0.13 U/mg, 1.50 ± 0.15 U/mg vs 1.08 ± 0.19 U/mg, P < 0.05; MDA: 0.294 ± 0.026 nmol/mg, 0.285 ± 0.025 nmol/mg, 0.284 ± 0.028 nmol/mg vs 0.335 ± 0.056 nmol/mg, P < 0.05). Meanwhile, the stage of hepatic fibrosis was significantly weakened (P < 0.05). Compared with group A, the activity of GST liver homogenates and expression levels of Nrf2 and Nqo1 in group B were elevated (P < 0.05). The expression level of Nrf2 and

  18. Nrf2, a master regulator of detoxification and also antioxidant, anti-inflammatory and other cytoprotective mechanisms, is raised by health promoting factors.

    PubMed

    Pall, Martin L; Levine, Stephen

    2015-02-25

    The transcription factor Nrf2, nuclear factor erythroid-2-related factor 2, activates the transcription of over 500 genes in the human genome, most of which have cytoprotective functions. Nrf2 produces cytoprotection by detoxification mechanisms leading to increased detoxification and excretion of both organic xenobiotics and toxic metals; its action via over two dozen genes increases highly coordinated antioxidant activities; it produces major anti-inflammatory changes; it stimulates mitochondrial biogenesis and otherwise improves mitochondrial function; and it stimulates autophagy, removing toxic protein aggregates and dysfunctional organelles. Health-promoting nutrients and other factors act, at least in part by raising Nrf2 including: many phenolic antioxidants; gamma- and delta-tocopherols and tocotrienols; long chain omega-3 fatty acids DHA and EPA; many carotenoids of which lycopene may be the most active; isothiocyanates from cruciferous vegetables; sulfur compounds from allium vegetables; terpenoids. Other health promoting, Nrf2 raising factors include low level oxidative stress (hormesis), exercise and caloric restriction. Raising Nrf2 has been found to prevent and/or treat a large number of chronic inflammatory diseases in animal models and/or humans including various cardiovascular diseases, kidney diseases, lung diseases, diseases of toxic liver damage, cancer (prevention), diabetes/metabolic syndrome/obesity, sepsis, autoimmune diseases, inflammatory bowel disease, HIV/AIDS and epilepsy. Lesser evidence suggests that raising Nrf2 may lower 16 other diseases. Many of these diseases are probable NO/ONOO(-) cycle diseases and Nrf2 lowers effects of NO/ONOO(-) cycle elements. The most healthful diets known, traditional Mediterranean and Okinawan, are rich in Nrf2 raising nutrients as apparently was the Paleolithic diet that our ancestors ate. Modern diets are deficient in such nutrients. Nrf2 is argued to be both lifespan and healthspan extending

  19. The role of transcription factor Nrf2 in skin cells metabolism.

    PubMed

    Gęgotek, Agnieszka; Skrzydlewska, Elżbieta

    2015-07-01

    Skin, which is a protective layer of the body, is in constant contact with physical and chemical environmental factors. Exposure of the skin to highly adverse conditions often leads to oxidative stress. Moreover, it has been observed that skin cells are also exposed to reactive oxygen species generated during cell metabolism particularly in relation to the synthesis of melanin or the metabolism in immune system cells. However, skin cells have special features that protect them against oxidative modifications including transcription factor Nrf2, which is responsible for the transcription of the antioxidant protein genes such as antioxidant enzymes, small molecular antioxidant proteins or interleukins, and multidrug response protein. In the present study, the mechanisms of Nrf2 activation have been compared in the cells forming the various layers of the skin: keratinocytes, melanocytes, and fibroblasts. The primary mechanism of control of Nrf2 activity is its binding by cytoplasmic inhibitor Keap1, while cells have also other controlling mechanisms, such as phosphorylation of Nrf2 and modifications of its activators (e.g., Maf, IKKβ) or inhibitors (e.g., Bach1, caveolae, TGF-β). Moreover, there are a number of drugs (e.g., ketoconazole) used in the pharmacotherapy of skin diseases based on the activation of Nrf2, but they may also induce oxidative stress. Therefore, it is important to look for compounds that cause a selective activation of Nrf2 particularly natural substances such as curcumin, sulforaphane, or extracts from the broccoli leaves without side effects. These findings could be helpful in the searching for new drugs for people with vitiligo or even melanoma. PMID:25708189

  20. Mining a human transcriptome database for Nrf2 modulators

    EPA Science Inventory

    Nuclear factor erythroid-2 related factor 2 (Nrf2) is a key transcription factor important in the protection against oxidative stress. We developed computational procedures to enable the identification of chemical, genetic and environmental modulators of Nrf2 in a large database ...

  1. Targeting NRF2 signaling for cancer chemoprevention

    SciTech Connect

    Kwak, Mi-Kyoung; Kensler, Thomas W.

    2010-04-01

    Modulation of the metabolism and disposition of carcinogens through induction of cytoprotective enzymes is one of several promising strategies to prevent cancer. Chemopreventive efficacies of inducers such as dithiolethiones and sulforaphane have been extensively studied in animals as well as in humans. The KEAP1-NRF2 system is a key, but not unilateral, molecular target for these chemopreventive agents. The transcription factor NRF2 (NF-E2-related factor 2) is a master regulator of the expression of a subset of genes, which produce proteins responsible for the detoxication of electrophiles and reactive oxygen species as well as the removal or repair of some of their damage products. It is believed that chemopreventive enzyme inducers affect the interaction between KEAP1 and NRF2 through either mediating conformational changes of the KEAP1 protein or activating phosphorylation cascades targeting the KEAP1-NRF2 complex. These events in turn affect NRF2 stability and trafficking. Recent advances elucidating the underlying structural biology of KEAP1-NRF2 signaling and identification of the gene clusters under the transcriptional control of NRF2 are facilitating understanding of the potential pleiotropic effects of NRF2 activators and discovery of novel classes of potent chemopreventive agents such as the triterpenoids. Although there is appropriately a concern regarding a deleterious role of the KEAP1-NRF2 system in cancer cell biology, especially as the pathway affects cell survival and drug resistance, the development and the use of NRF2 activators as chemopreventive agents still holds a great promise for protection of normal cells from a diversity of environmental stresses that contribute to the burden of cancer and other chronic, degenerative diseases.

  2. The emerging role of the Nrf2–Keap1 signaling pathway in cancer

    PubMed Central

    Jaramillo, Melba C.; Zhang, Donna D.

    2013-01-01

    The Nrf2 (nuclear factor erythroid 2 [NF-E2]-related factor 2 [Nrf2])–Keap1 (Kelch-like erythroid cell-derived protein with CNC homology [ECH]-associated protein 1) signaling pathway is one of the most important cell defense and survival pathways. Nrf2 can protect cells and tissues from a variety of toxicants and carcinogens by increasing the expression of a number of cytoprotective genes. As a result, several Nrf2 activators are currently being tested as chemopreventive compounds in clinical trials. Just as Nrf2 protects normal cells, studies have shown that Nrf2 may also protect cancer cells from chemotherapeutic agents and facilitate cancer progression. Nrf2 is aberrantly accumulated in many types of cancer, and its expression is associated with a poor prognosis in patients. In addition, Nrf2 expression is induced during the course of drug resistance. Collectively, these studies suggest that Nrf2 contributes to both intrinsic and acquired chemoresistance. This discovery has opened up a broad spectrum of research geared toward a better understanding of the role of Nrf2 in cancer. This review provides an overview of (1) the Nrf2–Keap1 signaling pathway, (2) the dual role of Nrf2 in cancer, (3) the molecular basis of Nrf2 activation in cancer cells, and (4) the challenges in the development of Nrf2-based drugs for chemoprevention and chemotherapy. PMID:24142871

  3. Nrf2 activation prevents cadmium-induced acute liver injury

    SciTech Connect

    Wu, Kai C.; Liu, Jie J.; Klaassen, Curtis D.

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  4. Functional Role of NRF2 in Cervical Carcinogenesis

    PubMed Central

    Jiao, Shu-Juan; Zheng, Jian-He; xiao, Jing-Bao; Hasim, Ayshamgul

    2015-01-01

    Nuclear factor erythroid-2-related factor 2 (NFE2L2) is a transcription factor associated with resistance to chemotherapy and increased tumor growth. NRF2 is repressed by the inhibitor Keap1. The Keap1-NRF2 pathway is dysfunctional in multiple tumor types. Among Uighur women, the incidence of cervical squamous cell carcinoma (CSCC) and cervical intraepithelial neoplasia (CIN) was associated with elevated nuclear expression of NRF2 and decreased cytoplasmic expression of Keap1. Up-regulation of nuclear NRF2 was significantly associated with reduced cytoplasmic Keap1 expression. NRF2 positivity and Keap1 negativity were frequently associated with more advanced tumors (i.e., higher histological grade, lymph node involvement, and higher tumor stages) (p<0.05 for all). Methylated CpG islands in the Keap1 gene promoter in cervical cancer tissue were identified using MassARRAY. Moreover, promoter hypermethylation of this gene was significantly associated with decreased protein expression and increased nuclear NRF2 expression in cervical cancer tissues. Overexpression and knockdown of NRF2 in CSCC cell lines showed that NRF2 promotes proliferation, inhibits apoptosis, and enhances migration and invasion. These studies support the concept that epigenetic changes regulate expression of Keap1 in cervical cancer tissues. The association of NRF2 expression with aggressive tumor behavior suggests that NRF2 may be a marker of poor prognosis in patients with cervical cancer. PMID:26247201

  5. Translational control of Nrf2 within the open reading frame

    PubMed Central

    Perez-Leal, Oscar; Barrero, Carlos A.; Merali, Salim

    2013-01-01

    Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required - a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3’ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state. PMID:23806685

  6. The emerging role of Nrf2 in dermatotoxicology

    PubMed Central

    Tan, Nguan S; Wahli, Walter

    2014-01-01

    The nuclear factor erythroid 2-related factor 2 (Nrf2) is best known for its role in resistance to oxidant stress. In this issue of EMBO Molecular Medicine, Nrf2-prolonged genetic activation is shown with devastating effects on skin homeostasis. The study provides novel molecular insights into poison-induced chloracne and metabolizing acquired dioxin-induced skin hamartomas or MADISH. PMID:24521743

  7. Protolichesterinic acid derivatives: α-methylene-γ-lactones as potent dual activators of PPARγ and Nrf2 transcriptional factors.

    PubMed

    Le Lamer, Anne-Cécile; Authier, Hélène; Rouaud, Isabelle; Coste, Agnès; Boustie, Joël; Pipy, Bernard; Gouault, Nicolas

    2014-08-15

    PPARγ and Nrf2 are important transcriptional factors involved in many signaling pathways, especially in the anti-infectious response of macrophages. Compounds bearing a Michael acceptor moiety are well known to activate such transcriptional factors, we thus evaluated the potency of α,β-unsaturated lactones synthesized using fluorous phase organic synthesis. Compounds were first screened for their cytotoxicity in order to select lactones for PPARγ and Nrf2 activation evaluation. Among them, two α-methylene-γ-lactones were identified as potent dual activators of PPARγ and Nrf2 in macrophages. PMID:25027935

  8. The Nrf2-ARE pathway: a valuable therapeutic target for the treatment of neurodegenerative diseases

    PubMed Central

    Joshi, Gururaj; Johnson, Jeffrey A.

    2013-01-01

    Modulation of NF-E2 related factor 2 (Nrf2) has been shown in several neurodegenerative disorders. The overexpression of Nrf2 has become a potential therapeutic avenue for various neurodegenerative disorders such as Parkinson, Amyotrophic lateral sclerosis, and Alzheimer’s disease. The expression of phase II detoxification enzymes is governed by the cis-acting regulatory element known as antioxidant response element (ARE). The transcription factor Nrf2 binds to ARE thereby transcribing multitude of antioxidant genes. Keap1, a culin 3-based E3 ligase that targets Nrf2 for degradation, sequesters Nrf2 in cytoplasm. Disruption of Keap1-Nrf2 interaction or genetic overexpression of Nrf2 can increase the endogenous antioxidant capacity of the brain thereby rendering protection against oxidative stress in neurodegenerative disorders. This review primarily focuses on targeted Nrf2 overexpression as a promising therapeutic strategy for the treatment of neurodegenerative disorders. PMID:22742419

  9. Translational control of Nrf2 within the open reading frame

    SciTech Connect

    Perez-Leal, Oscar Barrero, Carlos A.; Merali, Salim

    2013-07-19

    Highlights: •Identification of a novel Nrf2 translational repression mechanism. •The repressor is within the 3′ portion of the Nrf2 ORF. •The translation of Nrf2 or eGFP is reduced by the regulatory element. •The translational repression can be reversed with synonymous codon substitutions. •The molecular mechanism requires the mRNA sequence, but not the encoded amino acids. -- Abstract: Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required – a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3′ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state.

  10. Oxidative stress and dysfunctional NRF2 underlie pachyonychia congenita phenotypes.

    PubMed

    Kerns, Michelle L; Hakim, Jill M C; Lu, Rosemary G; Guo, Yajuan; Berroth, Andreas; Kaspar, Roger L; Coulombe, Pierre A

    2016-06-01

    Palmoplantar keratoderma (PPK) are debilitating lesions that arise in individuals with pachyonychia congenita (PC) and feature upregulation of danger-associated molecular patterns and skin barrier regulators. The defining features of PC-associated PPK are reproduced in mice null for keratin 16 (Krt16), which is commonly mutated in PC patients. Here, we have shown that PPK onset is preceded by oxidative stress in footpad skin of Krt16-/- mice and correlates with an inability of keratinocytes to sustain nuclear factor erythroid-derived 2 related factor 2-dependent (NRF2-dependent) synthesis of the cellular antioxidant glutathione (GSH). Additionally, examination of plantar skin biopsies from individuals with PC confirmed the presence of high levels of hypophosphorylated NRF2 in lesional tissue. In Krt16-/- mice, genetic ablation of Nrf2 worsened spontaneous skin lesions and accelerated PPK development in footpad skin. Hypoactivity of NRF2 in Krt16-/- footpad skin correlated with decreased levels or activity of upstream NRF2 activators, including PKCδ, receptor for activated C kinase 1 (RACK1), and p21. Topical application of the NRF2 activator sulforaphane to the footpad of Krt16-/- mice prevented the development of PPK and normalized redox balance via regeneration of GSH from existing cellular pools. Together, these findings point to oxidative stress and dysfunctional NRF2 as contributors to PPK pathogenesis, identify K16 as a regulator of NRF2 activation, and suggest that pharmacological activation of NRF2 should be further explored for PC treatment. PMID:27183391

  11. Trafficking of the transcription factor Nrf2 to promyelocytic leukemia-nuclear bodies: implications for degradation of NRF2 in the nucleus.

    PubMed

    Malloy, Melanie Theodore; McIntosh, Deneshia J; Walters, Treniqka S; Flores, Andrea; Goodwin, J Shawn; Arinze, Ifeanyi J

    2013-05-17

    Ubiquitylation of Nrf2 by the Keap1-Cullin3/RING box1 (Cul3-Rbx1) E3 ubiquitin ligase complex targets Nrf2 for proteasomal degradation in the cytoplasm and is an extensively studied mechanism for regulating the cellular level of Nrf2. Although mechanistic details are lacking, reports abound that Nrf2 can also be degraded in the nucleus. Here, we demonstrate that Nrf2 is a target for sumoylation by both SUMO-1 and SUMO-2. HepG2 cells treated with As2O3, which enhances attachment of SUMO-2/3 to target proteins, increased SUMO-2/3-modification (polysumoylation) of Nrf2. We show that Nrf2 traffics, in part, to promyelocytic leukemia-nuclear bodies (PML-NBs). Cell fractions harboring key components of PML-NBs did not contain biologically active Keap1 but contained modified Nrf2 as well as RING finger protein 4 (RNF4), a poly-SUMO-specific E3 ubiquitin ligase. Overexpression of wild-type RNF4, but not the catalytically inactive mutant, decreased the steady-state levels of Nrf2, measured in the PML-NB-enriched cell fraction. The proteasome inhibitor MG-132 interfered with this decrease, resulting in elevated levels of polysumoylated Nrf2 that was also ubiquitylated. Wild-type RNF4 accelerated the half-life (t½) of Nrf2, measured in PML-NB-enriched cell fractions. These results suggest that RNF4 mediates polyubiquitylation of polysumoylated Nrf2, leading to its subsequent degradation in PML-NBs. Overall, this work identifies Nrf2 as a target for sumoylation and provides a novel mechanism for its degradation in the nucleus, independent of Keap1. PMID:23543742

  12. The Cinnamon-derived Dietary Factor Cinnamic Aldehyde Activates the Nrf2-dependent Antioxidant Response in Human Epithelial Colon Cells

    PubMed Central

    Wondrak, Georg T.; Villeneuve, Nicole F.; Lamore, Sarah D.; Bause, Alexandra S.; Jiang, Tao; Zhang, Donna D.

    2011-01-01

    Colorectal cancer (CRC) is a major cause of tumor-related morbidity and mortality worldwide. Recent research suggests that pharmacological intervention using dietary factors that activate the redox sensitive Nrf2/Keap1-ARE signaling pathway may represent a promising strategy for chemoprevention of human cancer including CRC. In our search for dietary Nrf2 activators with potential chemopreventive activity targeting CRC, we have focused our studies on trans-cinnamic aldehyde (cinnamaldeyde, CA), the key flavor compound in cinnamon essential oil. Here we demonstrate that CA and an ethanolic extract (CE) prepared from Cinnamomum cassia bark, standardized for CA content by GC-MS analysis, display equipotent activity as inducers of Nrf2 transcriptional activity. In human colon cancer cells (HCT116, HT29) and non-immortalized primary fetal colon cells (FHC), CA- and CE-treatment upregulated cellular protein levels of Nrf2 and established Nrf2 targets involved in the antioxidant response including heme oxygenase 1 (HO-1) and γ-glutamylcysteine synthetase (γ-GCS, catalytic subunit). CA- and CE-pretreatment strongly upregulated cellular glutathione levels and protected HCT116 cells against hydrogen peroxide-induced genotoxicity and arsenic-induced oxidative insult. Taken together our data demonstrate that the cinnamon-derived food factor CA is a potent activator of the Nrf2-orchestrated antioxidant response in cultured human epithelial colon cells. CA may therefore represent an underappreciated chemopreventive dietary factor targeting colorectal carcinogenesis. PMID:20657484

  13. Resveratrol preconditioning protects against cerebral ischemic injury via Nrf2

    PubMed Central

    Narayanan, Srinivasan V.; Dave, Kunjan R.; Saul, Isa; Perez-Pinzon, Miguel A.

    2015-01-01

    Background and Purpose Nuclear erythroid 2 related factor 2 (Nrf2) is an astrocyte-enriched transcription factor that has previously been shown to upregulate cellular antioxidant systems in response to ischemia. While resveratrol preconditioning (RPC) has emerged as a potential neuroprotective therapy, the involvement of Nrf2 in RPC-induced neuroprotection and mitochondrial reactive oxygen species (ROS) production following cerebral ischemia remains unclear. The goal of our study was to study the contribution of Nrf2 to RPC and its effects on mitochondrial function. Methods We used rodent astrocyte cultures and an in vivo stroke model with RPC. An Nrf2 DNA-binding ELISA and protein analysis via Western blotting of downstream Nrf2 targets were performed to determine RPC-induced activation of Nrf2 in rat and mouse astrocytes. Following RPC, mitochondrial function was determined by measuring ROS production and mitochondrial respiration in both wild-type (WT) and Nrf2−/− mice. Infarct volume was measured to determine neuroprotection, while protein levels were measured by immunoblotting. Results We report that Nrf2 is activated by RPC in rodent astrocyte cultures, and that loss of Nrf2 reduced RPC-mediated neuroprotection in a mouse model of focal cerebral ischemia. In addition, we observed that wild-type and Nrf2−/− cortical mitochondria exhibited increased uncoupling and ROS production following RPC treatments, Finally, Nrf2−/− astrocytes exhibited decreased mitochondrial antioxidant expression and were unable to upregulate cellular antioxidants following RPC treatment. Conclusion Nrf2 contributes to RPC-induced neuroprotection through maintaining mitochondrial coupling and antioxidant protein expression. PMID:25908459

  14. Oxidative Damage and Nuclear Factor Erythroid 2-Related Factor 2 Protein Expression in Normal Skin and Keloid Tissue

    PubMed Central

    Lee, Yoon Jin; Kwon, Sun Bum; Kim, Chul Han; Cho, Hyun Deuk; Nam, Hae Seon; Lee, Sang Han; Lee, Mi Woo; Nam, Doo Hyun; Choi, Chang Yong

    2015-01-01

    Background Reactive oxygen species (ROS) play an important role in the induction of apoptosis under pathological conditions. Recently, a significant increase in ROS production and disrupted apoptosis mechanisms in keloids have been reported. Nuclear factor erythroid 2-related factor 2 (Nrf2) represents one of the most important cellular defense mechanisms against oxidative stress and is implicated in the regulation of apoptosis. Recently, it has been reported that Nrf2 upregulates Bcl-2, an anti-apoptotic protein. Objective To compare Nrf2 protein expression in normal skin tissues to keloid tissues. Methods ROS generation in keloid tissues was evaluated with OxyBlot analysis. Western blotting and/or immunohistochemical staining approaches were used to study expression of Nrf2 or Bcl-2 in keloid and normal skin tissues. Cellular fractionation was performed to examine subcellular distribution of Nrf2. Transfection of fibroblasts with Nrf2-specific small interfering RNA (siRNA) was conducted to understand the relationship between Nrf2 expression and apoptosis induction. Results Protein oxidation, a marker of oxidative stress, is increased in keloid tissues. Western blot analysis clearly showed that Nrf2 and Bcl-2 are downregulated in keloid tissues. Immunohistochemical staining of Nrf2 confirmed the results of the western blot analysis. Transfection of fibroblasts with the Nrf2-specific siRNA results in increased apoptosis and decreased cell viability. Conclusion Collectively, our data indicate that Nrf2 expression is downregulated in keloid tissues, and that Nrf2 is involved in the development of apoptosis in Nrf2 siRNA-transfected fibroblasts. We propose that a defective antioxidant system and apoptotic dysregulation may participate in keloid pathogenesis. PMID:26512164

  15. Regulatory Nexus of Synthesis and Degradation Deciphers Cellular Nrf2 Expression Levels

    PubMed Central

    Suzuki, Takafumi; Shibata, Tatsuhiro; Takaya, Kai; Shiraishi, Kouya; Kohno, Takashi; Kunitoh, Hideo; Tsuta, Koji; Furuta, Koh; Goto, Koichi; Hosoda, Fumie; Sakamoto, Hiromi; Motohashi, Hozumi

    2013-01-01

    Transcription factor Nrf2 (NF-E2-related factor 2) is essential for oxidative and electrophilic stress responses. While it has been well characterized that Nrf2 activity is tightly regulated at the protein level through proteasomal degradation via Keap1 (Kelch-like ECH-associated protein 1)-mediated ubiquitination, not much attention has been paid to the supply side of Nrf2, especially regulation of Nrf2 gene transcription. Here we report that manipulation of Nrf2 transcription is effective in changing the final Nrf2 protein level and activity of cellular defense against oxidative stress even in the presence of Keap1 and under efficient Nrf2 degradation, determined using genetically engineered mouse models. In excellent agreement with this finding, we found that minor A/A homozygotes of a single nucleotide polymorphism (SNP) in the human NRF2 upstream promoter region (rs6721961) exhibited significantly diminished NRF2 gene expression and, consequently, an increased risk of lung cancer, especially those who had ever smoked. Our results support the notion that in addition to control over proteasomal degradation and derepression from degradation/repression, the transcriptional level of the Nrf2 gene acts as another important regulatory point to define cellular Nrf2 levels. These results thus verify the critical importance of human SNPs that influence the levels of transcription of the NRF2 gene for future personalized medicine. PMID:23572560

  16. Regulatory nexus of synthesis and degradation deciphers cellular Nrf2 expression levels.

    PubMed

    Suzuki, Takafumi; Shibata, Tatsuhiro; Takaya, Kai; Shiraishi, Kouya; Kohno, Takashi; Kunitoh, Hideo; Tsuta, Koji; Furuta, Koh; Goto, Koichi; Hosoda, Fumie; Sakamoto, Hiromi; Motohashi, Hozumi; Yamamoto, Masayuki

    2013-06-01

    Transcription factor Nrf2 (NF-E2-related factor 2) is essential for oxidative and electrophilic stress responses. While it has been well characterized that Nrf2 activity is tightly regulated at the protein level through proteasomal degradation via Keap1 (Kelch-like ECH-associated protein 1)-mediated ubiquitination, not much attention has been paid to the supply side of Nrf2, especially regulation of Nrf2 gene transcription. Here we report that manipulation of Nrf2 transcription is effective in changing the final Nrf2 protein level and activity of cellular defense against oxidative stress even in the presence of Keap1 and under efficient Nrf2 degradation, determined using genetically engineered mouse models. In excellent agreement with this finding, we found that minor A/A homozygotes of a single nucleotide polymorphism (SNP) in the human NRF2 upstream promoter region (rs6721961) exhibited significantly diminished NRF2 gene expression and, consequently, an increased risk of lung cancer, especially those who had ever smoked. Our results support the notion that in addition to control over proteasomal degradation and derepression from degradation/repression, the transcriptional level of the Nrf2 gene acts as another important regulatory point to define cellular Nrf2 levels. These results thus verify the critical importance of human SNPs that influence the levels of transcription of the NRF2 gene for future personalized medicine. PMID:23572560

  17. The ubiquitin-conjugating enzyme UBE2E3 and its import receptor importin-11 regulate the localization and activity of the antioxidant transcription factor NRF2

    PubMed Central

    Plafker, Kendra S.; Plafker, Scott M.

    2015-01-01

    The transcription factor NF-E2 p45–related factor (Nrf2) induces the expression of cytoprotective proteins that maintain and restore redox homeostasis. Nrf2 levels and activity are tightly regulated, and three subcellular populations of the transcription factor have been identified. During homeostasis, the majority of Nrf2 is degraded in the cytoplasm by ubiquitin (Ub)-mediated degradation. A second population is transcriptionally active in the nucleus, and a third population localizes to the outer mitochondrial membrane. Still unresolved are the mechanisms and factors that govern Nrf2 distribution between its subcellular locales. We show here that the Ub-conjugating enzyme UBE2E3 and its nuclear import receptor importin 11 (Imp-11) regulate Nrf2 distribution and activity. Knockdown of UBE2E3 reduces nuclear Nrf2, decreases Nrf2 target gene expression, and relocalizes the transcription factor to a perinuclear cluster of mitochondria. In a complementary manner, Imp-11 functions to restrict KEAP1, the major suppressor of Nrf2, from prematurely extracting the transcription factor off of a subset of target gene promoters. These findings identify a novel pathway of Nrf2 modulation during homeostasis and support a model in which UBE2E3 and Imp-11 promote Nrf2 transcriptional activity by restricting the transcription factor from partitioning to the mitochondria and limiting the repressive activity of nuclear KEAP1. PMID:25378586

  18. Inhibition of liver fibrosis by solubilized coenzyme Q10: Role of Nrf2 activation in inhibiting transforming growth factor-beta1 expression

    SciTech Connect

    Choi, Hoo-Kyun; Pokharel, Yuba Raj; Lim, Sung Chul; Han, Hyo-Kyung; Ryu, Chang Seon; Kim, Sang Kyum; Kwak, Mi Kyong; Kang, Keon Wook

    2009-11-01

    Coenzyme Q10 (CoQ10), an endogenous antioxidant, is important in oxidative phosphorylation in mitochondria. It has anti-diabetic and anti-cardiovascular disease effects, but its ability to protect against liver fibrosis has not been studied. Here, we assessed the ability of solubilized CoQ10 to improve dimethylnitrosamine (DMN)-induced liver fibrogenesis in mice. DMN treatments for 3 weeks produced a marked liver fibrosis as assessed by histopathological examination and tissue 4-hydroxyproline content. Solubilized CoQ10 (10 and 30 mg/kg) significantly inhibited both the increases in fibrosis score and 4-hydroxyproline content induced by DMN. Reverse transcription-polymerase chain reaction and Western blot analyses revealed that solubilized CoQ10 inhibited increases in the transforming growth factor-beta1 (TGF-beta1) mRNA and alpha-smooth muscle actin (alpha-SMA) protein by DMN. Interestingly, hepatic glutamate-cysteine ligase (GCL) and glutathione S-transferase A2 (GSTA2) were up-regulated in mice treated with CoQ10. Solubilized CoQ10 also up-regulated antioxidant enzymes such as catalytic subunits of GCL and GSTA2 via activating NF-E2 related factor2 (Nrf2)/antioxidant response element (ARE) in H4IIE hepatoma cells. Moreover, CoQ10's inhibition of alpha-SMA and TGF-beta1 expressions disappeared in Nrf2-null MEF cells. In contrast, Nrf2 overexpression significantly decreased the basal expression levels of alpha-SMA and TGF-beta1 in Nrf2-null MEF cells. These results demonstrated that solubilized CoQ10 inhibited DMN-induced liver fibrosis through suppression of TGF-beta1 expression via Nrf2/ARE activation.

  19. Role of Nrf2 in preventing ethanol-induced oxidative stress and lipid accumulation

    SciTech Connect

    Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-08-01

    Oxidative stress and lipid accumulation play important roles in alcohol-induced liver injury. Previous reports showed that, in livers of nuclear factor erythroid 2-related factor 2 (Nrf2)-activated mice, genes involved in antioxidant defense are induced, whereas genes involved in lipid biosynthesis are suppressed. To investigate the role of Nrf2 in ethanol-induced hepatic alterations, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation, were treated with ethanol (5 g/kg, po). Blood and liver samples were collected 6 h thereafter. Ethanol increased alanine aminotransferase and lactate dehydrogenase activities as well as thiobarbituric acid reactive substances in serum of Nrf2-null and wild-type mice, but not in Nrf2-enhanced mice. After ethanol administration, mitochondrial glutathione concentrations decreased markedly in Nrf2-null mice but not in Nrf2-enhanced mice. H{sub 2}DCFDA staining of primary hepatocytes isolated from the four genotypes of mice indicates that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. Ethanol increased serum triglycerides and hepatic free fatty acids in Nrf2-null mice, and these increases were blunted in Nrf2-enhanced mice. In addition, the basal mRNA and nuclear protein levels of sterol regulatory element-binding protein 1(Srebp-1) were decreased with graded Nrf2 activation. Ethanol further induced Srebp-1 mRNA in Nrf2-null mice but not in Nrf2-enhanced mice. In conclusion, Nrf2 activation prevented alcohol-induced oxidative stress and accumulation of free fatty acids in liver by increasing genes involved in antioxidant defense and decreasing genes involved in lipogenesis. -- Highlights: ► Ethanol depleted mitochondrial GSH in Nrf2-null mice but not in Keap1-KD mice. ► Ethanol increased ROS in hepatocytes isolated from Nrf2-null and wild

  20. Trafficking of the Transcription Factor Nrf2 to Promyelocytic Leukemia-Nuclear Bodies

    PubMed Central

    Malloy, Melanie Theodore; McIntosh, Deneshia J.; Walters, Treniqka S.; Flores, Andrea; Goodwin, J. Shawn; Arinze, Ifeanyi J.

    2013-01-01

    Ubiquitylation of Nrf2 by the Keap1-Cullin3/RING box1 (Cul3-Rbx1) E3 ubiquitin ligase complex targets Nrf2 for proteasomal degradation in the cytoplasm and is an extensively studied mechanism for regulating the cellular level of Nrf2. Although mechanistic details are lacking, reports abound that Nrf2 can also be degraded in the nucleus. Here, we demonstrate that Nrf2 is a target for sumoylation by both SUMO-1 and SUMO-2. HepG2 cells treated with As2O3, which enhances attachment of SUMO-2/3 to target proteins, increased SUMO-2/3-modification (polysumoylation) of Nrf2. We show that Nrf2 traffics, in part, to promyelocytic leukemia-nuclear bodies (PML-NBs). Cell fractions harboring key components of PML-NBs did not contain biologically active Keap1 but contained modified Nrf2 as well as RING finger protein 4 (RNF4), a poly-SUMO-specific E3 ubiquitin ligase. Overexpression of wild-type RNF4, but not the catalytically inactive mutant, decreased the steady-state levels of Nrf2, measured in the PML-NB-enriched cell fraction. The proteasome inhibitor MG-132 interfered with this decrease, resulting in elevated levels of polysumoylated Nrf2 that was also ubiquitylated. Wild-type RNF4 accelerated the half-life (t½) of Nrf2, measured in PML-NB-enriched cell fractions. These results suggest that RNF4 mediates polyubiquitylation of polysumoylated Nrf2, leading to its subsequent degradation in PML-NBs. Overall, this work identifies Nrf2 as a target for sumoylation and provides a novel mechanism for its degradation in the nucleus, independent of Keap1. PMID:23543742

  1. Induction of the Nrf2-driven antioxidant response confers neuroprotection during mitochondrial stress in vivo.

    PubMed

    Shih, Andy Y; Imbeault, Sophie; Barakauskas, Vilte; Erb, Heidi; Jiang, Lei; Li, Ping; Murphy, Timothy H

    2005-06-17

    NF-E2 related factor (Nrf2) controls a pleiotropic cellular defense, where multiple antioxidant/detoxification pathways are up-regulated in unison. Although small molecule inducers of Nrf2 activity have been reported to protect neurons in vitro, whether similar pathways can be accessed in vivo is not known. We have investigated whether in vivo toxicity of the mitochondrial complex II inhibitor 3-nitropropionic acid (3-NP) can be attenuated by constitutive and inducible Nrf2 activity. The absence of Nrf2 function in Nrf2(-/-) mice resulted in 3-NP hypersensitivity that became apparent with time and increasing dose, causing motor deficits and striatal lesions on a more rapid time scale than identically treated Nrf2(+/+) and Nrf2(+/-) controls. Striatal succinate dehydrogenase activity, the target of 3-NP, was inhibited to the same extent in all genotypes by a single acute dose of 3-NP, suggesting that brain concentrations of 3-NP were similar. Dietary supplementation with the Nrf2 inducer tert-butylhydroquinone attenuated 3-NP toxicity in Nrf2(+/-) mice, but not Nrf2(-/-), confirming the Nrf2-specific action of the inducer in vivo. Increased Nrf2 activity alone was sufficient to protect animals from 3-NP toxicity because intrastriatal adenovirus-mediated Nrf2 overexpression significantly reduced lesion size compared with green fluorescent protein overexpressing controls. In cultured astrocytes, 3-NP was found to increase Nrf2 activity leading to antioxidant response element-dependent gene expression providing a potential mechanism for the increased sensitivity of Nrf2(-/-) animals to 3-NP toxicity in vivo. We conclude that Nrf2 may underlie a feedback system limiting oxidative load during chronic metabolic stress. PMID:15840590

  2. An Essential Role of NRF2 in Diabetic Wound Healing.

    PubMed

    Long, Min; Rojo de la Vega, Montserrat; Wen, Qing; Bharara, Manish; Jiang, Tao; Zhang, Rui; Zhou, Shiwen; Wong, Pak K; Wondrak, Georg T; Zheng, Hongting; Zhang, Donna D

    2016-03-01

    The high mortality and disability of diabetic nonhealing skin ulcers create an urgent need for the development of more efficacious strategies targeting diabetic wound healing. In the current study, using human clinical specimens, we show that perilesional skin tissues from patients with diabetes are under more severe oxidative stress and display higher activation of the nuclear factor-E2-related factor 2 (NRF2)-mediated antioxidant response than perilesional skin tissues from normoglycemic patients. In a streptozotocin-induced diabetes mouse model, Nrf2(-/-) mice have delayed wound closure rates compared with Nrf2(+/+) mice, which is, at least partially, due to greater oxidative DNA damage, low transforming growth factor-β1 (TGF-β1) and high matrix metalloproteinase 9 (MMP9) expression, and increased apoptosis. More importantly, pharmacological activation of the NRF2 pathway significantly improves diabetic wound healing. In vitro experiments in human immortalized keratinocyte cells confirm that NRF2 contributes to wound healing by alleviating oxidative stress, increasing proliferation and migration, decreasing apoptosis, and increasing the expression of TGF-β1 and lowering MMP9 under high-glucose conditions. This study indicates an essential role for NRF2 in diabetic wound healing and the therapeutic benefits of activating NRF2 in this disease, laying the foundation for future clinical trials using NRF2 activators in treating diabetic skin ulcers. PMID:26718502

  3. Mitochondrial permeabilization without caspase activation mediates the increase of basal apoptosis in cells lacking Nrf2.

    PubMed

    Ariza, Julia; González-Reyes, José A; Jódar, Laura; Díaz-Ruiz, Alberto; de Cabo, Rafael; Villalba, José Manuel

    2016-06-01

    Nuclear factor E2-related factor-2 (Nrf2) is a cap'n'collar/basic leucine zipper (b-ZIP) transcription factor which acts as sensor of oxidative and electrophilic stress. Low levels of Nrf2 predispose cells to chemical carcinogenesis but a dark side of Nrf2 function also exists because its unrestrained activation may allow the survival of potentially dangerous damaged cells. Since Nrf2 inhibition may be of therapeutic interest in cancer, and a decrease of Nrf2 activity may be related with degenerative changes associated with aging, it is important to investigate how the lack of Nrf2 function activates molecular mechanisms mediating cell death. Murine Embryonic Fibroblasts (MEFs) bearing a Nrf2 deletion (Nrf2KO) displayed diminished cellular growth rate and shortened lifespan compared with wild-type MEFs. Basal rates of DNA fragmentation and histone H2A.X phosphorylation were higher in Nrf2KO MEFs, although steady-state levels of reactive oxygen species were not significantly increased. Enhanced rates of apoptotic DNA fragmentation were confirmed in liver and lung tissues from Nrf2KO mice. Apoptosis in Nrf2KO MEFs was associated with a decrease of Bcl-2 but not Bax levels, and with the release of the mitochondrial pro-apoptotic factors cytochrome c and AIF. Procaspase-9 and Apaf-1 were also increased in Nrf2KO MEFs but caspase-3 was not activated. Inhibition of XIAP increased death in Nrf2KO but not in wild-type MEFs. Mitochondrial ultrastructure was also altered in Nrf2KO MEFs. Our results support that Nrf2 deletion produces mitochondrial dysfunction associated with mitochondrial permeabilization, increasing basal apoptosis through a caspase-independent and AIF-dependent pathway. PMID:27016073

  4. Cytochrome P450 2A5 constitutive expression and induction by heavy metals is dependent on redox-sensitive transcription factor Nrf2 in liver.

    PubMed

    Lämsä, Virpi; Levonen, Anna-Liisa; Leinonen, Hanna; Ylä-Herttuala, Seppo; Yamamoto, Masayuki; Hakkola, Jukka

    2010-05-17

    Mouse cytochrome P450 2A5 (CYP2A5) is upregulated in various pathophysiological liver diseases and induced by structurally variable hepatotoxic chemicals. A putative common feature for all of these conditions is altered cellular redox status. Nuclear factor erythroid 2-like 2 (Nrf2) is a transcription factor that is post-translationally regulated by oxidative stress and controls the transcription of numerous protective target genes. In the present study, we have extensively characterized the regulation of Cyp2a5 by Nrf2 and compared it to a well-characterized target gene Hmox1. The treatment of mouse primary hepatocytes with lead chloride, methylmercury chloride, or phenethyl isothiocyanate all leads to nuclear accumulation of Nrf2. Both CYP2A5 and HMOX1 were induced by all three compounds; however, HMOX1 responded more rapidly and transiently as compared to CYP2A5. Experiments in Nrf2(-/-) primary hepatocytes showed that Nrf2 is crucial for CYP2A5 induction but not for elevation of HMOX1. Both CYP2A5 and HMOX1 were upregulated by Nrf2 overexpression and downregulated by Keap1 or Bach1 overexpression. However, in all cases, CYP2A5 responded much more potently. Results in Nrf2-deficient animals showed that CYP2A5 expression is significantly attenuated in the absence of Nrf2, while expression of HMOX1 was unaffected. Therefore, Cyp2a5 joins the group of genes constitutively regulated by Nrf2. Our current results unequivocally show that expression of CYP2A5 is tightly controlled by Nrf2 in liver. Nrf2 is needed for constitutive expression of CYP2A5, and CYP2A5 is also sensitively upregulated by an increased level of Nrf2 protein. Therefore, CYP2A5 upregulation could be a useful indicator for hepatic activation of the Nrf2 pathway. PMID:20402460

  5. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    SciTech Connect

    Mercado, Nicolas; Thimmulappa, Rajesh; Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E.; Biswal, Shyam; Ito, Kazuhiro; Barnes, Peter J.

    2011-03-11

    Research highlights: {yields} Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. {yields} HDAC inhibition decreases Nrf2 protein stability. {yields} HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. {yields} HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H{sub 2}O{sub 2}) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H{sub 2}O{sub 2}-induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  6. Nuclear Factor-Erythroid-2-Related Factor 2 in Aging and Lung Fibrosis.

    PubMed

    Swamy, Shobha M; Rajasekaran, Namakkal S; Thannickal, Victor J

    2016-07-01

    Aging and age-related diseases have been associated with elevated oxidative stress, which may be related to increased production of reactive species and/or a deficiency in antioxidant defenses. The nuclear factor-erythroid-2-related factor 2 (Nrf2)-mediated antioxidant response pathway maintains cellular reduction-oxidation homeostasis by inducing the transcription of an array of cytoprotective genes. However, there is evidence of impaired Nrf2 response in aging contributing to age-related fibrotic diseases. Herein, we review mechanisms for the dysregulation of Nrf2 signaling in aging. This understanding will pave the way for the design of novel therapeutic strategies that restore Nrf2 signaling to reestablish cellular homeostasis in aging and age-related fibrotic diseases. PMID:27338106

  7. Nrf2 suppresses macrophage inflammatory response by blocking proinflammatory cytokine transcription

    PubMed Central

    Kobayashi, Eri H.; Suzuki, Takafumi; Funayama, Ryo; Nagashima, Takeshi; Hayashi, Makiko; Sekine, Hiroki; Tanaka, Nobuyuki; Moriguchi, Takashi; Motohashi, Hozumi; Nakayama, Keiko; Yamamoto, Masayuki

    2016-01-01

    Nrf2 (NF-E2-related factor-2) transcription factor regulates oxidative/xenobiotic stress response and also represses inflammation. However, the mechanisms how Nrf2 alleviates inflammation are still unclear. Here, we demonstrate that Nrf2 interferes with lipopolysaccharide-induced transcriptional upregulation of proinflammatory cytokines, including IL-6 and IL-1β. Chromatin immunoprecipitation (ChIP)-seq and ChIP-qPCR analyses revealed that Nrf2 binds to the proximity of these genes in macrophages and inhibits RNA Pol II recruitment. Further, we found that Nrf2-mediated inhibition is independent of the Nrf2-binding motif and reactive oxygen species level. Murine inflammatory models further demonstrated that Nrf2 interferes with IL6 induction and inflammatory phenotypes in vivo. Thus, contrary to the widely accepted view that Nrf2 suppresses inflammation through redox control, we demonstrate here that Nrf2 opposes transcriptional upregulation of proinflammatory cytokine genes. This study identifies Nrf2 as the upstream regulator of cytokine production and establishes a molecular basis for an Nrf2-mediated anti-inflammation approach. PMID:27211851

  8. Early modulation of the transcription factor Nrf2 in rodent striatal slices by quinolinic acid, a toxic metabolite of the kynurenine pathway.

    PubMed

    Colín-González, A L; Luna-López, A; Königsberg, M; Ali, S F; Pedraza-Chaverrí, J; Santamaría, A

    2014-02-28

    Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) is a transcription factor involved in the orchestration of antioxidant responses. Although its pharmacological activation has been largely hypothesized as a promising tool to ameliorate the progression of neurodegenerative events, the actual knowledge about its modulation in neurotoxic paradigms remains scarce. In this study, we investigated the early profile of Nrf2 modulation in striatal slices of rodents incubated in the presence of the toxic kynurenine pathway metabolite, quinolinic acid (QUIN). Tissue slices from rats and mice were obtained and used throughout the experiments in order to compare inter-species responses. Nuclear Nrf2 protein levels and oxidative damage to lipids were compared. Time- and concentration-response curves of all markers were explored. Nrf2 nuclear activation was corroborated through phase 2 antioxidant protein expression. The effects of QUIN on Nrf2 modulation and oxidative stress were also compared between slices of wild-type (Nrf2(+/+)) and Nrf2 knock-out (Nrf2(-/-)) mice. The possible involvement of the N-methyl-d-aspartate receptor (NMDAr) in the Nrf2 modulation and lipid peroxidation was further explored in mice striatal slices. In rat striatal slices, QUIN stimulated the Nrf2 nuclear translocation. This effect was accompanied by augmented lipid peroxidation. In the mouse striatum, QUIN per se exerted an induction of Nrf2 factor only at 1h of incubation, and a concentration-response effect on lipid peroxidation after 3h of incubation. QUIN stimulated the striatal content of phase 2 enzymes. Nrf2(-/-) mice were slightly more responsive than Nrf2(+/+) mice to the QUIN-induced oxidative damage, and completely unresponsive to the NMDAr antagonist MK-801 when tested against QUIN. Findings of this study indicate that: (1) Nrf2 is modulated in rodent striatal tissue in response to QUIN; (2) Nrf2(-/-) striatal tissue was moderately more vulnerable to oxidative damage than the Wt

  9. Genetic or Pharmacologic Amplification of Nrf2 Signaling Inhibits Acute Inflammatory Liver Injury in Mice

    PubMed Central

    Osburn, William O.; Yates, Melinda S.; Dolan, Patrick D.; Liby, Karen T.; Sporn, Michael B.; Taguchi, Keiko; Yamamoto, Masayuki; Kensler, Thomas W.

    2008-01-01

    Oxidative stress-mediated destruction of normal parenchymal cells during hepatic inflammatory responses contributes to the pathogenesis of immune-mediated hepatitis and is implicated in the progression of acute inflammatory liver injury to chronic inflammatory liver disease. The transcription factor NF-E2-related factor 2 (Nrf2) regulates the expression of a battery of antioxidative enzymes and Nrf2 signaling can be activated by small-molecule drugs that disrupt Keap1-mediated repression of Nrf2 signaling. Therefore, genetic and pharmacologic approaches were used to activate Nrf2 signaling to assess protection against inflammatory liver injury. Profound increases in ind of cell death were observed in both Nrf2 wild-type (Nrf2-WT) mice and Nrf2-disrupted (Nrf2-KO) mice 24-hr following intravenous injection of concanavalin A (12.5 mg/kg, ConA), a model for T cell-mediated acute inflammatory liver injury. However, hepatocyte-specific conditional Keap1 null (Alb-Cre:Keap1flox/−, cKeap1-KO) mice with constitutively enhanced expression of Nrf2-regulated antioxidative genes as well as Nrf2-WT mice but not Nrf2-KO mice pretreated with three daily doses of a triterpenoid that potently activates Nrf2 (30 µmole/kg, CDDO-Im) were highly resistant to ConA-mediated inflammatory liver injury. CDDO-Im pretreatment of both Nrf2-WT and Nrf2-KO mice resulted in equivalent suppression of serum pro-inflammatory soluble proteins suggesting that the hepatoprotection afforded by CDDO-Im pretreatment of Nrf2-WT mice but not Nrf2-KO mice was not due to suppression of systemic pro-inflammatory signaling, but instead was due to activation of Nrf2 signaling in the liver. Enhanced hepatic expression of Nrf2-regulated antioxidative genes inhibited inflammation-mediated oxidative stress, thereby preventing hepatocyte necrosis. Attenuation of hepatocyte death in cKeap1-KO mice and CDDO-Im pretreated Nrf2-WT mice resulted in decreased late-phase pro-inflammatory gene expression in the liver

  10. Antioxidant-induced modification of INrf2 cysteine 151 and PKC-δ-mediated phosphorylation of Nrf2 serine 40 are both required for stabilization and nuclear translocation of Nrf2 and increased drug resistance

    PubMed Central

    Niture, Suryakant K.; Jain, Abhinav K.; Jaiswal, Anil K.

    2009-01-01

    Summary Antioxidants cause dissociation of nuclear factor erythroid 2-related factor 2 (Nrf2) from inhibitor of Nrf2 (INrf2) and so Nrf2:INrf2 can serve as a sensor of oxidative stress. Nrf2 translocates to the nucleus, binds to antioxidant response element (ARE) and activates defensive gene expression, which protects cells. Controversies exist regarding the role of antioxidant-induced modification of INrf2 cysteine 151 or protein kinase C (PKC)-mediated phosphorylation of Nrf2 serine 40 in the release of Nrf2 from INrf2. In addition, the PKC isoform that phosphorylates Nrf2S40 remains unknown. Here, we demonstrate that antioxidant-induced PKC-δ-mediated phosphorylation of Nrf2S40 leads to release of Nrf2 from INrf2. This was evident from specific chemical inhibitors of PKC isoenzymes in reporter assays, in vitro kinase assays with purified Nrf2 and PKC isoenzymes, in vivo analysis with dominant-negative mutants and siRNA against PKC isoforms, use of PKC-δ+/+ and PKC-δ–/– cells, and use of Nrf2S40 phospho-specific antibody. The studies also showed that antioxidant-induced INrf2C151 modification was insufficient for the dissociation of Nrf2 from INrf2. PKC-δ-mediated Nrf2S40 phosphorylation was also required. Nrf2 and mutant Nrf2S40A both bind to INrf2. However, antioxidant treatment led to release of Nrf2 but not Nrf2S40A from INrf2. In addition, Nrf2 and mutant Nrf2S40A both failed to dissociate from mutant INrf2C151A. Furthermore, antioxidant-induced ubiquitylation of INrf2 in PKC-δ+/+ and PKC-δ–/– cells occurred, but Nrf2 failed to be released in PKC-δ–/– cells. The antioxidant activation of Nrf2 reduced etoposide-mediated DNA fragmentation and promoted cell survival in PKC-δ+/+ but not in PKC-δ–/– cells. These data together demonstrate that both modification of INrf2C151 and PKC-δ-mediated phosphorylation of Nrf2S40 play crucial roles in Nrf2 release from INrf2, antioxidant induction of defensive gene expression, promoting cell

  11. Nuclear Factor Erythroid 2-Related Factor 2 Deficiency Results in Amplification of the Liver Fat-Lowering Effect of Estrogen.

    PubMed

    Rui, Wenjuan; Zou, Yuhong; Lee, Joonyong; Nambiar, Shashank Manohar; Lin, Jingmei; Zhang, Linjie; Yang, Yan; Dai, Guoli

    2016-07-01

    Transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) regulates multiple biologic processes, including hepatic lipid metabolism. Estrogen exerts actions affecting energy homeostasis, including a liver fat-lowering effect. Increasing evidence indicates the crosstalk between these two molecules. The aim of this study was to evaluate whether Nrf2 modulates estrogen signaling in hepatic lipid metabolism. Nonalcoholic fatty liver disease (NAFLD) was induced in wild-type and Nrf2-null mice fed a high-fat diet and the liver fat-lowering effect of exogenous estrogen was subsequently assessed. We found that exogenous estrogen eliminated 49% and 90% of hepatic triglycerides in wild-type and Nrf2-null mice with NAFLD, respectively. This observation demonstrates that Nrf2 signaling is antagonistic to estrogen signaling in hepatic fat metabolism; thus, Nrf2 absence results in striking amplification of the liver fat-lowering effect of estrogen. In addition, we found the association of trefoil factor 3 and fatty acid binding protein 5 with the liver fat-lowering effect of estrogen. In summary, we identified Nrf2 as a novel and potent inhibitor of estrogen signaling in hepatic lipid metabolism. Our finding may provide a potential strategy to treat NAFLD by dually targeting Nrf2 and estrogen signaling. PMID:27189962

  12. The antioxidant transcription factor Nrf2 negatively regulates autophagy and growth arrest induced by the anticancer redox agent mitoquinone.

    PubMed

    Rao, V Ashutosh; Klein, Sarah R; Bonar, Spencer J; Zielonka, Jacek; Mizuno, Naoko; Dickey, Jennifer S; Keller, Paul W; Joseph, Joy; Kalyanaraman, Balaraman; Shacter, Emily

    2010-11-01

    Mitoquinone (MitoQ) is a synthetically modified, redox-active ubiquinone compound that accumulates predominantly in mitochondria. We found that MitoQ is 30-fold more cytotoxic to breast cancer cells than to healthy mammary cells. MitoQ treatment led to irreversible inhibition of clonogenic growth of breast cancer cells through a combination of autophagy and apoptotic cell death mechanisms. Relatively limited cytotoxicity was seen with the parent ubiquinone coenzyme Q(10.) Inhibition of cancer cell growth by MitoQ was associated with G(1)/S cell cycle arrest and phosphorylation of the checkpoint kinases Chk1 and Chk2. The possible role of oxidative stress in MitoQ activity was investigated by measuring the products of hydroethidine oxidation. Increases in ethidium and dihydroethidium levels, markers of one-electron oxidation of hydroethidine, were observed at cytotoxic concentrations of MitoQ. Keap1, an oxidative stress sensor protein that regulates the antioxidant transcription factor Nrf2, underwent oxidation, degradation, and dissociation from Nrf2 in MitoQ-treated cells. Nrf2 protein levels, nuclear localization, and transcriptional activity also increased following MitoQ treatment. Knockdown of Nrf2 caused a 2-fold increase in autophagy and an increase in G(1) cell cycle arrest in response to MitoQ but had no apparent effect on apoptosis. The Nrf2-regulated enzyme NQO1 is partly responsible for controlling the level of autophagy. Keap1 and Nrf2 act as redox sensors for oxidative perturbations that lead to autophagy. MitoQ and similar compounds should be further evaluated for novel anticancer activity. PMID:20805228

  13. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae)

    PubMed Central

    Liu, Di; Irwin, David M.; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet. PMID:26735303

  14. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    PubMed

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet. PMID:26735303

  15. Nrf2-Mediated Cardiac Maladaptive Remodeling and Dysfunction in a Setting of Autophagy Insufficiency.

    PubMed

    Qin, Qingyun; Qu, Chen; Niu, Ting; Zang, Huimei; Qi, Lei; Lyu, Linmao; Wang, Xuejun; Nagarkatti, Mitzi; Nagarkatti, Prakash; Janicki, Joseph S; Wang, Xing Li; Cui, Taixing

    2016-01-01

    Nuclear factor erythroid-2-related factor 2 (Nrf2) appears to exert either a protective or detrimental effect on the heart; however, the underlying mechanism remains poorly understood. Herein, we uncovered a novel mechanism for turning off the Nrf2-mediated cardioprotection and switching on Nrf2-mediated cardiac dysfunction. In a murine model of pressure overload-induced cardiac remodeling and dysfunction via transverse aortic arch constriction, knockout of Nrf2 enhanced myocardial necrosis and death rate during an initial stage of cardiac adaptation when myocardial autophagy function is intact. However, knockout of Nrf2 turned out to be cardioprotective throughout the later stage of cardiac maladaptive remodeling when myocardial autophagy function became insufficient. Transverse aortic arch constriction -induced activation of Nrf2 was dramatically enhanced in the heart with impaired autophagy, which is induced by cardiomyocyte-specific knockout of autophagy-related gene (Atg)5. Notably, Nrf2 activation coincided with the upregulation of angiotensinogen (Agt) only in the autophagy-impaired heart after transverse aortic arch constriction. Agt5 and Nrf2 gene loss-of-function approaches in combination with Jak2 and Fyn kinase inhibitors revealed that suppression of autophagy inactivated Jak2 and Fyn and nuclear translocation of Fyn, while enhancing nuclear translocation of Nrf2 and Nrf2-driven Agt expression in cardiomyocytes. Taken together, these results indicate that the pathophysiological consequences of Nrf2 activation are closely linked with the functional integrity of myocardial autophagy during cardiac remodeling. When autophagy is intact, Nrf2 is required for cardiac adaptive responses; however, autophagy impairment most likely turns off Fyn-operated Nrf2 nuclear export thus activating Nrf2-driven Agt transcription, which exacerbates cardiac maladaptation leading to dysfunction. PMID:26573705

  16. Activation of nuclear factor E2-related factor 2 in hereditary tyrosinemia type 1 and its role in survival and tumor development.

    PubMed

    Marhenke, Silke; Lamlé, Jutta; Buitrago-Molina, Laura Elisa; Cañón, José Manuel Fernández; Geffers, Robert; Finegold, Milton; Sporn, Michael; Yamamoto, Masayuki; Manns, Michael P; Grompe, Markus; Vogel, Arndt

    2008-08-01

    In tyrosinemia type 1 (HT1), accumulation of toxic metabolites results in oxidative stress and DNA damage, leading to a high incidence of hepatocellular carcinomas. Nuclear factor erythroid-2 related factor 2 (Nrf2) is a key transcription factor important for cellular protection against oxidative stress and chemical induced liver damage. To specifically address the role of Nrf2 in HT1, fumarylacetoacetate hydrolase (Fah)/Nrf2(-/-) mice were generated. In acute HT1, loss of Nrf2 elicited a strong inflammatory response and dramatically increased the mortality of mice. Following low grade injury, Fah/Nrf2(-/-) mice develop a more severe hepatitis and liver fibrosis. The glutathione and cellular detoxification system was significantly impaired in Fah/Nrf2(-/-) mice, resulting in increased oxidative stress and DNA damage. Consequently, tumor development was significantly accelerated by loss of Nrf2. Potent pharmacological inducers of Nrf2 such as the triterpenoid analogs 1[2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oyl]imidazole have been developed as cancer chemoprevention agents. Pretreatment with 1[2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oyl]imidazole dramatically protected Fah(-/-) mice against fumarylacetoacetate (Faa)-induced toxicity. Our data establish a central role for Nrf2 in the protection against Faa-induced liver injury; the Nrf2 regulated cellular defense not only prevents acute Faa-induced liver failure but also delays hepatocarcinogenesis in HT1. PMID:18666252

  17. Nrf2 protects mitochondrial decay by oxidative stress.

    PubMed

    Strom, Joshua; Xu, Beibei; Tian, Xiuqing; Chen, Qin M

    2016-01-01

    Sublethal levels of oxidative stress are commonly associated with various pathophysiological conditions. Cardiomyocytes have the highest content of mitochondria among all cell types, allowing the study of mitochondria in cells surviving oxidative stress and address whether nuclear factor-erythroid-derived 2-related factor 2 (Nrf2) can reverse these changes. Mitochondria normally exist in elaborated networks, which were replaced by predominately individual punctuate mitochondria 24 h after exposure to a nonlethal dose of H2O2. Electron microscopy revealed that cells surviving H2O2 show swelling of mitochondria with disorganized cristae and areas of condensation. Measurements of functional mitochondria showed a H2O2 dose-dependent decrease over a course of 5 d. At the protein and mRNA levels, cells surviving H2O2 treatment show a reduction of mitochondrial components, cytochrome c, and cytochrome b. Nrf2 overexpression prevented H2O2 from inducing mitochondria morphologic changes and reduction of cytochrome b/c. Although Nrf2 is known as a transcription factor regulating antioxidant and detoxification genes, Nrf2 overexpression did not significantly reduce the level of protein oxidation. Instead, Nrf2 was found to associate with the outer mitochondrial membrane. Mitochondria prepared from the myocardium of Nrf2 knockout mice are more sensitive to permeability transition. Our data suggest that Nrf2 protects mitochondria from oxidant injury likely through direct interaction with mitochondria. PMID:26340923

  18. Association of Nrf2 Polymorphism Haplotypes with Acute Lung Injury Phenotypes in Inbred Strains of Mice

    PubMed Central

    Jedlicka, Anne E.; Gladwell, Wesley; Marzec, Jacqui; McCaw, Zackary R.; Bienstock, Rachelle J.; Kleeberger, Steven R.

    2015-01-01

    Abstract Aims: Nrf2 is a master transcription factor for antioxidant response element (ARE)-mediated cytoprotective gene induction. A protective role for pulmonary Nrf2 was determined in model oxidative disorders, including hyperoxia-induced acute lung injury (ALI). To obtain additional insights into the function and genetic regulation of Nrf2, we assessed functional single nucleotide polymorphisms (SNPs) of Nrf2 in inbred mouse strains and tested whether sequence variation is associated with hyperoxia susceptibility. Results: Nrf2 SNPs were compiled from publicly available databases and by re-sequencing DNA from inbred strains. Hierarchical clustering of Nrf2 SNPs categorized the strains into three major haplotypes. Hyperoxia susceptibility was greater in haplotypes 2 and 3 strains than in haplotype 1 strains. A promoter SNP −103 T/C adding an Sp1 binding site in haplotype 2 diminished promoter activation basally and under hyperoxia. Haplotype 3 mice bearing nonsynonymous coding SNPs located in (1862 A/T, His543Gln) and adjacent to (1417 T/C, Thr395Ile) the Neh1 domain showed suppressed nuclear transactivation of pulmonary Nrf2 relative to other strains, and overexpression of haplotype 3 Nrf2 showed lower ARE responsiveness than overexpression of haplotype 1 Nrf2 in airway cells. Importantly, we found a significant correlation of Nrf2 haplotypes and hyperoxic lung injury phenotypes. Innovation and Conclusion: The results indicate significant influence of Nrf2 polymorphisms and haplotypes on gene function and hyperoxia susceptibility. Our findings further support Nrf2 as a genetic determinant in ALI pathogenesis and provide useful tools for investigators who use mouse strains classified by Nrf2 haplotypes to elucidate the role for Nrf2 in oxidative disorders. Antioxid. Redox Signal. 22, 325–338. PMID:25268541

  19. NRF2 and cancer: the good, the bad and the importance of context

    PubMed Central

    Sporn, Michael B.; Liby, Karen T.

    2013-01-01

    Many studies of chemopreventive drugs have suggested that their beneficial effects on suppression of carcinogenesis and many other chronic diseases are mediated through activation of the transcription factor NFE2- related factor 2 (NRF2). More recently, genetic analyses of human tumours have indicated that NRF2 may conversely be oncogenic and cause resistance to chemotherapy. It is therefore controversial whether the activation, or alternatively the inhibition, of NRF2 is a useful strategy for the prevention or treatment of cancer. This Opinion article aims to rationalize these conflicting perspectives by critiquing the context dependence of NRF2 functions and the experimental methods behind these conflicting data. PMID:22810811

  20. Fasting Induces Nuclear Factor E2-Related Factor 2 and ATP-Binding Cassette Transporters via Protein Kinase A and Sirtuin-1 in Mouse and Human

    PubMed Central

    Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling

    2014-01-01

    Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046

  1. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    PubMed Central

    Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2012-01-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of Type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs3+) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs3+ exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs3+ and monomethylarsonous acid (MMA3+)-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs3+-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N-acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs3+. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. PMID:23000044

  2. NRF2 activation by antioxidant antidiabetic agents accelerates tumor metastasis.

    PubMed

    Wang, Hui; Liu, Xiufei; Long, Min; Huang, Yi; Zhang, Linlin; Zhang, Rui; Zheng, Yi; Liao, Xiaoyu; Wang, Yuren; Liao, Qian; Li, Wenjie; Tang, Zili; Tong, Qiang; Wang, Xiaocui; Fang, Fang; Rojo de la Vega, Montserrat; Ouyang, Qin; Zhang, Donna D; Yu, Shicang; Zheng, Hongting

    2016-04-13

    Cancer is a common comorbidity of diabetic patients; however, little is known about the effects that antidiabetic drugs have on tumors. We discovered that common classes of drugs used in type 2 diabetes mellitus, the hypoglycemic dipeptidyl peptidase-4 inhibitors (DPP-4i) saxagliptin and sitagliptin, as well as the antineuropathic α-lipoic acid (ALA), do not increase tumor incidence but increase the risk of metastasis of existing tumors. Specifically, these drugs induce prolonged activation of the nuclear factor E2-related factor 2 (NRF2)-mediated antioxidant response through inhibition of KEAP1-C151-dependent ubiquitination and subsequent degradation of NRF2, resulting in up-regulated expression of metastasis-associated proteins, increased cancer cell migration, and promotion of metastasis in xenograft mouse models. Accordingly, knockdown of NRF2 attenuated naturally occurring and DPP-4i-induced tumor metastasis, whereas NRF2 activation accelerated metastasis. Furthermore, in human liver cancer tissue samples, increased NRF2 expression correlated with metastasis. Our findings suggest that antioxidants that activate NRF2 signaling may need to be administered with caution in cancer patients, such as diabetic patients with cancer. Moreover, NRF2 may be a potential biomarker and therapeutic target for tumor metastasis. PMID:27075625

  3. Design and synthesis of new hybrid molecules that activate the transcription factor Nrf2 and simultaneously release carbon monoxide.

    PubMed

    Wilson, Jayne Louise; Fayad Kobeissi, Sarah; Oudir, Souhila; Haas, Benjamin; Michel, Brian; Dubois Randé, Jean-Luc; Ollivier, Anthony; Martens, Thierry; Rivard, Michael; Motterlini, Roberto; Foresti, Roberta

    2014-11-01

    The transcription factor Nrf2 and its downstream target heme oxygenase-1 (HO-1) are essential protective systems against oxidative stress and inflammation. The products of HO-1 enzymatic activity, biliverdin and carbon monoxide (CO), actively contribute to this protection, suggesting that exploitation of these cellular systems may offer new therapeutic avenues in a variety of diseases. Starting from a CO-releasing compound and a chemical scaffold exhibiting electrophilic characteristics (esters of fumaric acid), we report the synthesis of hybrid molecules that simultaneously activate Nrf2 and liberate CO. These hybrid compounds, which we termed "HYCOs", release CO to myoglobin and activate the CO-sensitive fluorescent probe COP-1, while also potently inducing nuclear accumulation of Nrf2 and HO-1 expression and activity in different cell types. Thus, we provide here the first example of a new class of pharmacologically active molecules that target the HO-1 pathway by combining an Nrf2 activator coordinated to a CO-releasing group. PMID:25224540

  4. The Keap1-Nrf2-ARE Pathway As a Potential Preventive and Therapeutic Target: An Update.

    PubMed

    Lu, Meng-Chen; Ji, Jian-Ai; Jiang, Zheng-Yu; You, Qi-Dong

    2016-09-01

    The Keap1-Nrf2-ARE ((Kelch-like ECH-Associating protein 1) nuclear factor erythroid 2 related factor 2-antioxidant response element) pathway is one of the most important defense mechanisms against oxidative and/or electrophilic stresses, and it is closely associated with inflammatory diseases, including cancer, neurodegenerative diseases, cardiovascular diseases, and aging. In recent years, progress has been made in strategies aimed at modulating the Keap1-Nrf2-ARE pathway. The Nrf2 activator DMF (Dimethylfumarates) has been approved by the FDA as a new first-line oral drug to treat patients with relapsing forms of multiple sclerosis, while a phase 3 study of another promising candidate, CDDO-Me, was terminated for safety reasons. Directly inhibiting Keap1-Nrf2 protein-protein interactions as a novel Nrf2-modulating strategy has many advantages over using electrophilic Nrf2 activators. The development of Keap1-Nrf2 protein-protein interaction inhibitors has become a topic of intense research, and potent inhibitors of this target have been identified. In addition, inhibiting Nrf2 activity has attracted an increasing amount of attention because it may provide an alternative cancer therapy. This review summarizes the molecular mechanisms and biological functions of the Keap1-Nrf2-ARE system. The main focus of this review is on recent progress in studies of agents that target the Keap1-Nrf2-ARE pathway and the therapeutic applications of such agents. PMID:27192495

  5. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    SciTech Connect

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H.; Mattson, Mark P.; Camandola, Simonetta

    2013-04-19

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity.

  6. Nrf2 and Redox Status in Prediabetic and Diabetic Patients

    PubMed Central

    Jiménez-Osorio, Angélica S.; Picazo, Alejandra; González-Reyes, Susana; Barrera-Oviedo, Diana; Rodríguez-Arellano, Martha E.; Pedraza-Chaverri, José

    2014-01-01

    The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2) was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS) in plasma and erythrocytes, glutathione (GSH) and malondialdehyde (MDA) content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC). Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients. PMID:25383674

  7. Frequency Modulated Translocational Oscillations of Nrf2 Mediate the Antioxidant Response Element Cytoprotective Transcriptional Response

    PubMed Central

    Xue, Mingzhan; Momiji, Hiroshi; Rabbani, Naila; Barker, Guy; Bretschneider, Till; Shmygol, Anatoly; Rand, David A.

    2015-01-01

    Abstract Aims: Stress responsive signaling coordinated by nuclear factor erythroid 2-related factor 2 (Nrf2) provides an adaptive response for protection of cells against toxic insults, oxidative stress and metabolic dysfunction. Nrf2 regulates a battery of protective genes by binding to regulatory antioxidant response elements (AREs). The aim of this study was to examine how Nrf2 signals cell stress status and regulates transcription to maintain homeostasis. Results: In live cell microscopy we observed that Nrf2 undergoes autonomous translocational frequency-modulated oscillations between cytoplasm and nucleus. Oscillations occurred in quiescence and when cells were stimulated at physiological levels of activators, they decrease in period and amplitude and then evoke a cytoprotective transcriptional response. We propose a mechanism whereby oscillations are produced by negative feedback involving successive de-phosphorylation and phosphorylation steps. Nrf2 was inactivated in the nucleus and reactivated on return to the cytoplasm. Increased frequency of Nrf2 on return to the cytoplasm with increased reactivation or refresh-rate under stress conditions activated the transcriptional response mediating cytoprotective effects. The serine/threonine-protein phosphatase PGAM5, member of the Nrf2 interactome, was a key regulatory component. Innovation: We found that Nrf2 is activated in cells without change in total cellular Nrf2 protein concentration. Regulation of ARE-linked protective gene transcription occurs rather through translocational oscillations of Nrf2. We discovered cytoplasmic refresh rate of Nrf2 is important in maintaining and regulating the transcriptional response and links stress challenge to increased cytoplasmic surveillance. We found silencing and inhibition of PGAM5 provides potent activation of Nrf2. Conclusion: Frequency modulated translocational oscillations of Nrf2 mediate the ARE-linked cytoprotective transcriptional response. Antioxid. Redox

  8. The Effects of Sequence Variation on Genome-wide NRF2 Binding—New Target Genes and Regulatory SNPs

    PubMed Central

    Kuosmanen, Suvi M.; Viitala, Sari; Laitinen, Tuomo; Peräkylä, Mikael; Pölönen, Petri; Kansanen, Emilia; Leinonen, Hanna; Raju, Suresh; Wienecke-Baldacchino, Anke; Närvänen, Ale; Poso, Antti; Heinäniemi, Merja; Heikkinen, Sami; Levonen, Anna-Liisa

    2016-01-01

    Transcription factor binding specificity is crucial for proper target gene regulation. Motif discovery algorithms identify the main features of the binding patterns, but the accuracy on the lower affinity sites is often poor. Nuclear factor E2-related factor 2 (NRF2) is a ubiquitous redox-activated transcription factor having a key protective role against endogenous and exogenous oxidant and electrophile stress. Herein, we decipher the effects of sequence variation on the DNA binding sequence of NRF2, in order to identify both genome-wide binding sites for NRF2 and disease-associated regulatory SNPs (rSNPs) with drastic effects on NRF2 binding. Interactions between NRF2 and DNA were studied using molecular modelling, and NRF2 chromatin immunoprecipitation-sequence datasets together with protein binding microarray measurements were utilized to study binding sequence variation in detail. The binding model thus generated was used to identify genome-wide binding sites for NRF2, and genomic binding sites with rSNPs that have strong effects on NRF2 binding and reside on active regulatory elements in human cells. As a proof of concept, miR-126–3p and -5p were identified as NRF2 target microRNAs, and a rSNP (rs113067944) residing on NRF2 target gene (Ferritin, light polypeptide, FTL) promoter was experimentally verified to decrease NRF2 binding and result in decreased transcriptional activity. PMID:26826707

  9. Oxidative stress and dysfunctional NRF2 underlie pachyonychia congenita phenotypes

    PubMed Central

    Kerns, Michelle L.; Hakim, Jill M.C.; Lu, Rosemary G.; Guo, Yajuan; Berroth, Andreas; Kaspar, Roger L.

    2016-01-01

    Palmoplantar keratoderma (PPK) are debilitating lesions that arise in individuals with pachyonychia congenita (PC) and feature upregulation of danger-associated molecular patterns and skin barrier regulators. The defining features of PC-associated PPK are reproduced in mice null for keratin 16 (Krt16), which is commonly mutated in PC patients. Here, we have shown that PPK onset is preceded by oxidative stress in footpad skin of Krt16–/– mice and correlates with an inability of keratinocytes to sustain nuclear factor erythroid–derived 2 related factor 2–dependent (NRF2-dependent) synthesis of the cellular antioxidant glutathione (GSH). Additionally, examination of plantar skin biopsies from individuals with PC confirmed the presence of high levels of hypophosphorylated NRF2 in lesional tissue. In Krt16–/– mice, genetic ablation of Nrf2 worsened spontaneous skin lesions and accelerated PPK development in footpad skin. Hypoactivity of NRF2 in Krt16–/– footpad skin correlated with decreased levels or activity of upstream NRF2 activators, including PKCδ, receptor for activated C kinase 1 (RACK1), and p21. Topical application of the NRF2 activator sulforaphane to the footpad of Krt16–/– mice prevented the development of PPK and normalized redox balance via regeneration of GSH from existing cellular pools. Together, these findings point to oxidative stress and dysfunctional NRF2 as contributors to PPK pathogenesis, identify K16 as a regulator of NRF2 activation, and suggest that pharmacological activation of NRF2 should be further explored for PC treatment. PMID:27183391

  10. Role of Nrf2 in retinal vascular development and the vaso-obliterative phase of oxygen-induced retinopathy

    PubMed Central

    Uno, Koichi; Prow, Tarl W.; Bhutto, Imran A.; Yerrapureddy, Adi; McLeod, D. Scott; Yamamoto, Masayuki; Reddy, Sekhar P.; Lutty, Gerard A.

    2016-01-01

    In the initial stage of retinopathy of prematurity (ROP), hyperoxia causes retinal blood vessel obliteration. This is thought to occur in part through oxidative stress-induced apoptosis of endothelial cells. This study was designed to determine what role NF-E2-related factor 2 (Nrf2) plays in this process. Nrf2 is a transcription factor of the anti-oxidant response element that, if induced, may protect the retina from hyperoxia-induced oxidative stress. Nrf2 knockout mice (Nrf2−/−), Nrf2 wild type control mice (Nrf2 +/+), and C57BL/6 mice were exposed to hyperoxia (75% O2) or normoxia from P7 through P12. Mice were sacrificed on P9 and P12 and the retinas were stained with GSA lectin-Cy3 to visualize retinal blood vessels. Hyperoxia exposed retinas were flat mounted and photographed, then the size of the avascular areas was determined. Additionally, retinas were cryopreserved after lectin staining and area analysis and then sectioned. Secondary or deep capillaries were then hand-counted in sections. In hyperoxia-treated mice, the avascular areas in Nrf2−/− P9 mice were significantly larger than those in Nrf2+/+ P9 mice (P = 0.01). However, there was no significant difference between Nrf2−/− and Nrf2+/+ mice at P12. Avascular areas at P12 were significantly smaller than that at P9 in Nrf2−/−, Nrf2+/+, and C57BL/6 mice (P = 0.0011, P = 0.009, and P = 0.001 respectively). The numbers of deep or secondary capillaries in air-reared Nrf2−/− mice were significantly decreased, when compared to Nrf2+/+ mice at P9 (P = 0.0082). On the other hand, there was no significant difference in deep capillary formation between air-reared Nrf2−/− and Nrf2+/+ mice at P12. Akt signaling activates Nrf2 and Akt was localized to retinal blood vessels in all animals and was increased in Nrf2+/+ and Nrf2−/− mice exposed to hyperoxia as compared to normoxia mice. Interestingly, during normal development this protection by Nrf2 occurs in a specific window of time

  11. Nrf2-Mediated Regulation of Skeletal Muscle Glycogen Metabolism.

    PubMed

    Uruno, Akira; Yagishita, Yoko; Katsuoka, Fumiki; Kitajima, Yasuo; Nunomiya, Aki; Nagatomi, Ryoichi; Pi, Jingbo; Biswal, Shyam S; Yamamoto, Masayuki

    2016-06-01

    Nrf2 (NF-E2-related factor 2) contributes to the maintenance of glucose homeostasis in vivo Nrf2 suppresses blood glucose levels by protecting pancreatic β cells from oxidative stress and improving peripheral tissue glucose utilization. To elucidate the molecular mechanisms by which Nrf2 contributes to the maintenance of glucose homeostasis, we generated skeletal muscle (SkM)-specific Keap1 knockout (Keap1MuKO) mice that express abundant Nrf2 in their SkM and then examined Nrf2 target gene expression in that tissue. In Keap1MuKO mice, blood glucose levels were significantly downregulated and the levels of the glycogen branching enzyme (Gbe1) and muscle-type PhKα subunit (Phka1) mRNAs, along with those of the glycogen branching enzyme (GBE) and the phosphorylase b kinase α subunit (PhKα) protein, were significantly upregulated in mouse SkM. Consistent with this result, chemical Nrf2 inducers promoted Gbe1 and Phka1 mRNA expression in both mouse SkM and C2C12 myotubes. Chromatin immunoprecipitation analysis demonstrated that Nrf2 binds the Gbe1 and Phka1 upstream promoter regions. In Keap1MuKO mice, muscle glycogen content was strongly reduced and forced GBE expression in C2C12 myotubes promoted glucose uptake. Therefore, our results demonstrate that Nrf2 induction in SkM increases GBE and PhKα expression and reduces muscle glycogen content, resulting in improved glucose tolerance. Our results also indicate that Nrf2 differentially regulates glycogen metabolism in SkM and the liver. PMID:27044864

  12. Transcription factor Nrf2 mediates an adaptive response to sulforaphane that protects fibroblasts in vitro against the cytotoxic effects of electrophiles, peroxides and redox-cycling agents

    SciTech Connect

    Higgins, Larry G.; Kelleher, Michael O.; Eggleston, Ian M.; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.

    2009-06-15

    Sulforaphane can stimulate cellular adaptation to redox stressors through transcription factor Nrf2. Using mouse embryonic fibroblasts (MEFs) as a model, we show herein that the normal homeostatic level of glutathione in Nrf2{sup -/-} MEFs was only 20% of that in their wild-type counterparts. Furthermore, the rate of glutathione synthesis following its acute depletion upon treatment with 3 {mu}mol/l sulforaphane was very substantially lower in Nrf2{sup -/-} MEFs than in wild-type cells, and the rebound leading to a {approx} 1.9-fold increase in glutathione that occurred 12-24 h after Nrf2{sup +/+} MEFs were treated with sulforaphane was not observed in Nrf2{sup -/-} fibroblasts. Wild-type MEFs that had been pre-treated for 24 h with 3 {mu}mol/l sulforaphane exhibited between 1.4- and 3.2-fold resistance against thiol-reactive electrophiles, including isothiocyanates, {alpha},{beta}-unsaturated carbonyl compounds (e.g. acrolein), aryl halides and alkene epoxides. Pre-treatment of Nrf2{sup +/+} MEFs with sulforaphane also protected against hydroperoxides (e.g. cumene hydroperoxide, CuOOH), free radical-generating compounds (e.g. menadione), and genotoxic electrophiles (e.g. chlorambucil). By contrast, Nrf2{sup -/-} MEFs were typically {approx} 50% less tolerant of these agents than wild-type fibroblasts, and sulforaphane pre-treatment did not protect the mutant cells against xenobiotics. To test whether Nrf2-mediated up-regulation of glutathione represents the major cytoprotective mechanism stimulated by sulforaphane, 5 {mu}mol/l buthionine sulfoximine (BSO) was used to inhibit glutathione synthesis. In Nrf2{sup +/+} MEFs pre-treated with sulforaphane, BSO diminished intrinsic resistance and abolished inducible resistance to acrolein, CuOOH and chlorambucil, but not menadione. Thus Nrf2-dependent up-regulation of GSH is the principal mechanism by which sulforaphane pre-treatment induced resistance to acrolein, CuOOH and chlorambucil, but not menadione.

  13. Nuclear erythroid 2-related factor 2: a novel potential therapeutic target for liver fibrosis.

    PubMed

    Yang, Jing-Jing; Tao, Hui; Huang, Cheng; Li, Jun

    2013-09-01

    Hepatic stellate cells (HSC) are the key fibrogenic cells of the liver. HSC activation is a process of cellular transdifferentiation that occurs upon liver injury, but the mechanisms underlying liver fibrosis are unknown. Nuclear erythroid 2-related factor 2 (Nrf2) is an oxidative stress-mediated transcription factor with a variety of downstream targets aimed at cytoprotection. However, Nrf2 has recently been implicated as a new therapeutic target for the treatment of liver fibrosis. This review focuses on the transcriptional repressors that either control liver injury or regulate specific fibrogenic functions of liver fibrosis. We also show that Nrf2 may reveal significant gene expression changes, suggesting that Nrf2 activation may ameliorate liver fibrosis. PMID:23793039

  14. Hepatic Gene Expression Profiling in Nrf2 Knockout Mice after Long-Term High-Fat Diet-Induced Obesity

    PubMed Central

    Chartoumpekis, Dionysios V.; Ziros, Panos G.; Zaravinos, Apostolos; Iskrenova, Ralitsa P.; Psyrogiannis, Agathoklis I.; Kyriazopoulou, Venetsana E.; Sykiotis, Gerasimos P.; Habeos, Ioannis G.

    2013-01-01

    Introduction. The transcription factor NFE2-related factor 2 (Nrf2) is a central regulator of antioxidant and detoxification gene expression in response to electrophilic or oxidative stress. Nrf2 has recently been shown to cross-talk with metabolic pathways, and its gene deletion protected mice from high-fat-diet-(HFD-) induced obesity and insulin resistance. This study aimed to identify potential Nrf2-regulated genes of metabolic interest by comparing gene expression profiles of livers of wild-type (WT) versus Nrf2 knockout (Nrf2-KO) mice after a long-term HFD. Methods. WT and Nrf2-KO mice were fed an HFD for 180 days; total RNA was prepared from liver and used for microarray analysis and quantitative real-time RT-PCR (qRT-PCR). Results. The microarray analysis identified 601 genes that were differentially expressed between WT and Nrf2-KO mice after long-term HFD. Selected genes, including ones known to be involved in metabolic regulation, were prioritized for verification by qRT-PCR: Cyp7a1 and Fabp5 were significantly overexpressed in Nrf2-KO mice; in contrast, Car, Cyp2b10, Lipocalin 13, Aquaporin 8, Cbr3, Me1, and Nqo1 were significantly underexpressed in Nrf2-KO mice. Conclusion. Transcriptome profiling after HFD-induced obesity confirms that Nrf2 is implicated in liver metabolic gene networks. The specific genes identified here may provide insights into Nrf2-dependent mechanisms of metabolic regulation. PMID:23710285

  15. Astrocyte-Specific Overexpression of Nrf2 Protects Striatal Neurons from Mitochondrial Complex II Inhibition

    PubMed Central

    Calkins, Marcus J.; Vargas, Marcelo R.; Johnson, Delinda A.; Johnson, Jeffrey A.

    2010-01-01

    Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that is known to regulate a variety of cytoprotective genes through the antioxidant response element (ARE). This endogenous response is one of the major pathways by which cells are protected from xenobiotic or innate oxidative insults. Furthermore, in neural systems, astrocyte-specific activation of Nrf2 is known to protect neurons. In previous work, our laboratory found that Nrf2 protects from intrastriatal injections of the mitochondrial complex II inhibitor malonate. Here, we extend these results to show that multiple methods of astrocyte-specific Nrf2 overexpression provide protection from neurotoxicity in vivo. GFAP-Nrf2 transgenic mice are significantly more resistant to malonate lesioning. This outcome is associated with an increased basal resistance, but more so, an enhanced Nrf2 response to lesioning that attenuated the ensuing neurotoxicity. Furthermore, striatal transplantation of neuroprogenitor cells overexpressing Nrf2 that differentiate into astrocytes after grafting also significantly reduced malonate toxicity. Overall, these data establish that enhanced astrocytic Nrf2 response and Nrf2 preconditioning are both sufficient to protect from acute lesions from mitochondrial complex II inhibition. PMID:20211941

  16. DNA Demethylation Upregulated Nrf2 Expression in Alzheimer’s Disease Cellular Model

    PubMed Central

    Cao, Huimin; Wang, Li; Chen, Beibei; Zheng, Peng; He, Yi; Ding, Yubin; Deng, Yushuang; Lu, Xi; Guo, Xiuming; Zhang, Yuping; Li, Yu; Yu, Gang

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer’s disease (AD). Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts) inhibitor 5-aza-2′-deoxycytidine (5-Aza) to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe). We found 5-Aza treatment increased Nrf2 at both messenger RNA and protein levels via downregulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza-mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(P)H:quinone oxidoreductas (NQO1). Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development. PMID:26779013

  17. Enhanced sensitivity of A549 cells to the cytotoxic action of anticancer drugs via suppression of Nrf2 by procyanidins from Cinnamomi Cortex extract

    SciTech Connect

    Ohnuma, Tomokazu; Matsumoto, Takashi; Itoi, Ayano; Kawana, Ayako; Nishiyama, Takahito; Ogura, Kenichiro; Hiratsuka, Akira

    2011-10-07

    Highlights: {yields} We found a novel inhibitor of Nrf2 known as a chemoresistance factor. {yields} Overexpressed Nrf2 in lung cancer cells was suppressed by Cinnamomi Cortex extract. {yields} Cytotoxic action of anticancer drugs in cells treated with the extract was enhanced. {yields} Procyanidin tetramers and pentamers were active components in suppressing Nrf2. -- Abstract: Nuclear factor-E2-related factor 2 (Nrf2) is an important cytoprotective transcription factor because Nrf2-regulated enzymes play a key role in antioxidant and detoxification processes. Recent studies have reported that lung cancer cells overexpressing Nrf2 exhibit increased resistance to chemotherapy. Suppression of overexpressed Nrf2 is needed for a new therapeutic approach against lung cancers. In the present study, we found that Cinnamomi Cortex extract (CCE) has an ability to suppress Nrf2-regulated enzyme activity and Nrf2 expression in human lung cancer A549 cells with high Nrf2 activity. Moreover, we demonstrated that CCE significantly enhances sensitivity of A549 cells to the cytotoxic action of doxorubicin and etoposide as well as increasing the intracellular accumulation of both drugs. These results suggest that CCE might be an effective concomitant agent to reduce anticancer drug resistance derived from Nrf2 overexpression. Bioactivity-guided fractionation revealed that procyanidin tetramers and pentamers contained in CCE were active components in suppressing Nrf2.

  18. Nrf2 as a Chemopreventive Target in Colorectal Cancer

    PubMed Central

    Saw, Constance Lay Lay; Kong, Tony Ah-Ng

    2012-01-01

    Introduction Numerous epidemiological studies have linked consumption of cruciferous vegetables to a reduced risk of colorectal cancer (CRC) in individuals. It is currently well accepted that chronic inflammation is a contributing factor in 15-20% malignancies including CRC. Many chemopreventive compounds are effective in preclinical systems and many on-going clinical trials are showing promising findings. Many of these compounds could activate the antioxidant responsive element (ARE), a critical regulatory element for phase II protective/detoxification and anti-oxidative stress enzymes mediated by nuclear factor-erythroid 2-related factor 2 (Nrf2). Recently, Nrf2 has emerged as a novel target for the prevention of CRC. Areas covered A full literature search was performed using PubMed with the key words ‘ARE, Nrf2, colon, colorectal cancer, chemoprevention, cancer prevention’, and all relevant publications are included. Expert opinion The use of Nrf2 knockout mice has provided key insights into the toxicological and chemopreventive importance of this pathway. Mounting evidence has revealed that Nrf2 is a critical regulator of inflammation as well, a major driving force for CRC progression and formation. Targeting the Nrf2/ARE pathway may present a novel therapeutic approach for the treatment of not only colorectal inflammatory diseases but the frequent subsequent development of CRC as well. PMID:21261563

  19. 6-OHDA-induced apoptosis and mitochondrial dysfunction are mediated by early modulation of intracellular signals and interaction of Nrf2 and NF-κB factors.

    PubMed

    Tobón-Velasco, Julio C; Limón-Pacheco, Jorge H; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F; Cuadrado, Antonio; Pedraza-Chaverrí, José; Santamaría, Abel

    2013-02-01

    6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage. PMID:23274087

  20. Nrf2 Expressions Correlate with WHO Grades in Gliomas and Meningiomas

    PubMed Central

    Tsai, Wen-Chiuan; Hueng, Dueng-Yuan; Lin, Chii-Ruey; Yang, Thomas C. K.; Gao, Hong-Wei

    2016-01-01

    Background: Nuclear factor erythroid 2-related factor 2 (NFE2L2, also known as Nrf2) is associated with cellular progression and chemotherapeutic resistance in some human cancers. We tested the relationship between Nrf2 expression and survival of patients with primary brain tumors (PBTs). Methods: In order to realize Nrf2 protein expression in gliomas, Western blot analysis was performed in normal brain tissue and U87MG, LN229, GBM8401 and U118MG glioma cell lines protein lysates. Then, U87MG, LN229, and GBM8401 mRNA were applied to performed quantitative RT-PCR for detect Nrf2 gene expression in glioma cell lines. At last, immunohistochemical analysis was used to determine the expression of Nrf2 in samples from 178 PBTs and 10 non-neoplastic brain tissues. Results: In these included in vitro studies, both Nrf2 protein and mRNA expression in all human glioma cell lines were higher than normal brain tissue. Similarly, on the viewpoint of immunohistochemistry, Nrf2 expression in gliomas were positively correlated with World Health Organization (WHO) grades. Additionally, compared with the expression of Nrf2 in non-neoplastic brain tissue, expression in meningiomas was of a stronger intensity and was present in a higher percentage of cells. Furthermore, scores were significantly higher in WHO grade II than in WHO grade I meningiomas. Finally, overall survival tended to be shorter in patients whose PBTs had higher expression of Nrf2, although the correlation was not statistically significant. Conclusions: Nrf2 overexpression positively correlated with WHO grade in gliomas and meningiomas. On the other hand, Nrf2 immunohistochemical stain could help pathologists to differentiate atypical meningiomas from benign tumors. Therefore, Nrf2 expression may be a useful biomarker to predict WHO grade and cellular behavior of PBTs. PMID:27187376

  1. Induction of Mrp3 and Mrp4 transporters during acetaminophen hepatotoxicity is dependent on Nrf2

    SciTech Connect

    Aleksunes, Lauren M. Slitt, Angela L. Maher, Jonathan M. Augustine, Lisa M. Goedken, Michael J. Chan, Jefferson Y. Cherrington, Nathan J. Klaassen, Curtis D. Manautou, Jose E.

    2008-01-01

    The transcription factor NFE2-related factor 2 (Nrf2) mediates detoxification and antioxidant gene transcription following electrophile exposure and oxidative stress. Mice deficient in Nrf2 (Nrf2-null) are highly susceptible to acetaminophen (APAP) hepatotoxicity and exhibit lower basal and inducible expression of cytoprotective genes, including NADPH quinone oxidoreductase 1 (Nqo1) and glutamate cysteine ligase (catalytic subunit, or Gclc). Administration of toxic APAP doses to C57BL/6J mice generates electrophilic stress and subsequently increases levels of hepatic Nqo1, Gclc and the efflux multidrug resistance-associated protein transporters 1-4 (Mrp1-4). It was hypothesized that induction of hepatic Mrp1-4 expression following APAP is Nrf2 dependent. Plasma and livers from wild-type (WT) and Nrf2-null mice were collected 4, 24 and 48 h after APAP. As expected, hepatotoxicity was greater in Nrf2-null compared to WT mice. Gene and protein expression of Mrp1-4 and the Nrf2 targets, Nqo1 and Gclc, was measured. Induction of Nqo1 and Gclc mRNA and protein after APAP was dependent on Nrf2 expression. Similarly, APAP treatment increased hepatic Mrp3 and Mrp4 mRNA and protein in WT, but not Nrf2-null mice. Mrp1 was induced in both genotypes after APAP, suggesting that elevated expression of this transporter was independent of Nrf2. Mrp2 was not induced in either genotype at the mRNA or protein levels. These results show that Nrf2 mediates induction of Mrp3 and Mrp4 after APAP but does not affect Mrp1 or Mrp2. Thus coordinated regulation of detoxification enzymes and transporters by Nrf2 during APAP hepatotoxicity is a mechanism by which hepatocytes may limit intracellular accumulation of potentially toxic chemicals.

  2. Systemic administration of the apocarotenoid bixin protects skin against solar UV-induced damage through activation of NRF2.

    PubMed

    Tao, Shasha; Park, Sophia L; Rojo de la Vega, Montserrat; Zhang, Donna D; Wondrak, Georg T

    2015-12-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photodamage and carcinogenesis, and an urgent need exists for improved molecular photoprotective strategies different from (or synergistic with) photon absorption. Recent studies suggest a photoprotective role of cutaneous gene expression orchestrated by the transcription factor NRF2 (nuclear factor-E2-related factor 2). Here we have explored the molecular mechanism underlying carotenoid-based systemic skin photoprotection in SKH-1 mice and provide genetic evidence that photoprotection achieved by the FDA-approved apocarotenoid and food additive bixin depends on NRF2 activation. Bixin activates NRF2 through the critical Cys-151 sensor residue in KEAP1, orchestrating a broad cytoprotective response in cultured human keratinocytes as revealed by antioxidant gene expression array analysis. Following dose optimization studies for cutaneous NRF2 activation by systemic administration of bixin, feasibility of bixin-based suppression of acute cutaneous photodamage from solar UV exposure was investigated in Nrf2(+/+) versus Nrf2(-/-) SKH-1 mice. Systemic administration of bixin suppressed skin photodamage, attenuating epidermal oxidative DNA damage and inflammatory responses in Nrf2(+/+) but not in Nrf2(-/-) mice, confirming the NRF2-dependence of bixin-based cytoprotection. Taken together, these data demonstrate feasibility of achieving NRF2-dependent cutaneous photoprotection by systemic administration of the apocarotenoid bixin, a natural food additive consumed worldwide. PMID:26456052

  3. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    SciTech Connect

    Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2012-11-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs{sup 3+}) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs{sup 3+} exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs{sup 3+} and monomethylarsonous acid (MMA{sup 3+})-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs{sup 3+}-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs{sup 3+}. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs{sup 3+} in β-cells. ► Deficiency of Nrf2 in

  4. S-allyl cysteine protects against 6-hydroxydopamine-induced neurotoxicity in the rat striatum: involvement of Nrf2 transcription factor activation and modulation of signaling kinase cascades.

    PubMed

    Tobón-Velasco, Julio César; Vázquez-Victorio, Genaro; Macías-Silva, Marina; Cuevas, Elvis; Ali, Syed F; Maldonado, Perla D; González-Trujano, María Eva; Cuadrado, Antonio; Pedraza-Chaverrí, José; Santamaría, Abel

    2012-09-01

    Pharmacological activation at the basal ganglia of the transcription factor Nrf2, guardian of redox homeostasis, holds a strong promise for the slow progression of Parkinson's disease (PD). However, a potent Nrf2 activator in the brain still must be found. In this study, we have investigated the potential use of the antioxidant compound S-allyl cysteine (SAC) in the activation of Nrf2 in 6-hydoxydopamine (6-OHDA)-intoxicated rats. In the rat striatum, SAC by itself promoted the Nrf2 dissociation of Keap-1, its nuclear translocation, the subsequent association with small MafK protein, and further binding of the Nrf2/MafK complex to ARE sequence, as well as the up-regulation of Nrf2-dependent genes encoding the antioxidant enzymes HO-1, NQO-1, GR, and SOD-1. In vivo and in vitro experiments to identify signaling pathways activated by SAC pointed to Akt as the most likely kinase participating in Nrf2 activation by SAC. In PC12 cells, SAC stimulated the activation of Akt and ERK1/2 and inhibited JNK1/2/3 activation. In the rat striatum, the SAC-induced activation of Nrf2 is likely to contribute to inhibit the toxic effects of 6-OHDA evidenced by phase 2 antioxidant enzymes up-regulation, glutathione recovery, and attenuation of reactive oxygen species (ROS), nitric oxide (NO), and lipid peroxides formation. These early protective effects correlated with the long-term preservation of the cellular redox status, the striatal dopamine (DA) and tyrosine hydroxylase (TH) levels, and the improvement of motor skills. Therefore, this study indicates that, in addition to direct scavenging actions, the activation of Nrf2 by SAC might confer neuroprotective responses through the modulation of kinase signaling pathways in rodent models of PD, and suggests that this antioxidant molecule may have a therapeutic value in this human pathology. PMID:22781654

  5. Sulforaphane Inhibits HIV Infection of Macrophages through Nrf2

    PubMed Central

    Furuya, Andrea Kinga Marias; Sharifi, Hamayun J.; Jellinger, Robert M.; Cristofano, Paul; Shi, Binshan; de Noronha, Carlos M. C.

    2016-01-01

    Marburg virus, the Kaposi's sarcoma-associated herpesvirus (KSHV) and Dengue virus all activate, and benefit from, expression of the transcription regulator nuclear erythroid 2-related factor 2 (Nrf2). The impact of Nrf2 activation on human immunodeficiency virus (HIV) infection has not been tested. Sulforaphane (SFN), produced in cruciferous vegetables after mechanical damage, mobilizes Nrf2 to potently reprogram cellular gene expression. Here we show for the first time that SFN blocks HIV infection in primary macrophages but not in primary T cells. Similarly SFN blocks infection in PMA-differentiated promonocytic cell lines, but not in other cell lines tested. siRNA-mediated depletion of Nrf2 boosted HIV infectivity in primary macrophages and reduced the anti-viral effects of SFN treatment. This supports a model in which anti-viral activity is mediated through Nrf2 after it is mobilized by SFN. We further found that, like the type I interferon-induced cellular anti-viral proteins SAMHD1 and MX2, SFN treatment blocks infection after entry, but before formation of 2-LTR circles. Interestingly however, neither SAMHD1 nor MX2 were upregulated. This shows for the first time that Nrf2 action can potently block HIV infection and highlights a novel way to trigger this inhibition. PMID:27093399

  6. Role of Nrf2 in chronic liver disease

    PubMed Central

    Tang, Wei; Jiang, Yong-Fang; Ponnusamy, Murugavel; Diallo, Mamadou

    2014-01-01

    Nuclear erythroid 2-related factor 2 (Nrf2) is a central regulator of antioxidative response elements-mediated gene expression. It has a significant role in adaptive responses to oxidative stress by interacting with the antioxidant response element, which induces the expression of a variety of downstream targets aimed at cytoprotection. Previous studies suggested oxidative stress and associated damage could represent a common link between different forms of diseases. Oxidative stress has been implicated in various liver diseases, including viral hepatitis, nonalcoholic fatty liver disease/steatohepatitis, alcoholic liver disease and drug-induced liver injury. Nrf2 activation is initiated by oxidative or electrophilic stress, and aids in the detoxification and elimination of potentially harmful exogenous chemicals and their metabolites. The expression of Nrf2 has been observed throughout human tissue, with high expression in detoxification organs, especially the liver. Thus, Nrf2 may serve as a major regulator of several cellular defense associated pathways by which hepatic cells combat oxidative stress. We review the relevant literature concerning the crucial role of Nrf2 and its signaling pathways against oxidative stress to protect hepatic cell from oxidative damage during development of common chronic liver diseases. We also review the use of Nrf2 as a therapeutic target to prevent and treat liver diseases. PMID:25278702

  7. Sulforaphane Inhibits HIV Infection of Macrophages through Nrf2.

    PubMed

    Furuya, Andrea Kinga Marias; Sharifi, Hamayun J; Jellinger, Robert M; Cristofano, Paul; Shi, Binshan; de Noronha, Carlos M C

    2016-04-01

    Marburg virus, the Kaposi's sarcoma-associated herpesvirus (KSHV) and Dengue virus all activate, and benefit from, expression of the transcription regulator nuclear erythroid 2-related factor 2 (Nrf2). The impact of Nrf2 activation on human immunodeficiency virus (HIV) infection has not been tested. Sulforaphane (SFN), produced in cruciferous vegetables after mechanical damage, mobilizes Nrf2 to potently reprogram cellular gene expression. Here we show for the first time that SFN blocks HIV infection in primary macrophages but not in primary T cells. Similarly SFN blocks infection in PMA-differentiated promonocytic cell lines, but not in other cell lines tested. siRNA-mediated depletion of Nrf2 boosted HIV infectivity in primary macrophages and reduced the anti-viral effects of SFN treatment. This supports a model in which anti-viral activity is mediated through Nrf2 after it is mobilized by SFN. We further found that, like the type I interferon-induced cellular anti-viral proteins SAMHD1 and MX2, SFN treatment blocks infection after entry, but before formation of 2-LTR circles. Interestingly however, neither SAMHD1 nor MX2 were upregulated. This shows for the first time that Nrf2 action can potently block HIV infection and highlights a novel way to trigger this inhibition. PMID:27093399

  8. Discovery of potent, novel Nrf2 inducers via quantum modeling, virtual screening and in vitro experimental validation

    PubMed Central

    Williamson, Tracy P.; Amirahmadi, Sara; Joshi, Gururaj; Kaludov, Nikola K.; Martinov, Martin N.; Johnson, Delinda A.; Johnson, Jeffrey A.

    2012-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is the master transcription factor of the antioxidant response element (ARE) pathway, coordinating the induction of detoxifying and antioxidant enzymes. Nrf2 is normally sequestered in the cytoplasm by Kelch-like ECH associating protein 1 (Keap1). To identify novel small molecules that will disturb Nrf2:Keap1 binding and promote activation of the Nrf2-ARE pathway, we generated a quantum model based on the structures of known Nrf2-ARE activators. We used the quantum model to perform in silico screening on over 18 million commercially available chemicals to identify the structures predicted to activate the Nrf2-ARE pathway based on the quantum model. The top hits were tested in vitro and half of the predicted hits activated the Nrf2-ARE pathway significantly in primary cell culture. In addition, we identified a new family of Nrf2-ARE activating structures that all have comparable activity to tBHQ and protect against oxidative stress and dopaminergic toxins in vitro. The improved ability to identify potent activators of Nrf2 through the combination of in silico and in vitro screening described here improves the speed and cost associated with screening Nrf2-ARE activating compounds for drug development. PMID:22925725

  9. Apurinic/Apyrimidinic Endonuclease/Redox Factor-1 (APE1/Ref-1) Redox Function Negatively Regulates NRF2*

    PubMed Central

    Fishel, Melissa L.; Wu, Xue; Devlin, Cecilia M.; Logsdon, Derek P.; Jiang, Yanlin; Luo, Meihua; He, Ying; Yu, Zhangsheng; Tong, Yan; Lipking, Kelsey P.; Maitra, Anirban; Rajeshkumar, N. V.; Scandura, Glenda; Kelley, Mark R.; Ivan, Mircea

    2015-01-01

    Apurinic/apyrimidinic endonuclease/redox factor-1 (APE1/Ref-1) (henceforth referred to as Ref-1) is a multifunctional protein that in addition to its base excision DNA repair activity exerts redox control of multiple transcription factors, including nuclear factor κ-light chain enhancer of activated B cells (NF-κB), STAT3, activator protein-1 (AP-1), hypoxia-inducible factor-1 (HIF-1), and tumor protein 53 (p53). In recent years, Ref-1 has emerged as a promising therapeutic target in cancer, particularly in pancreatic ductal carcinoma. Although a significant amount of research has centered on Ref-1, no wide-ranging approach had been performed on the effects of Ref-1 inhibition and transcription factor activity perturbation. Starting with a broader approach, we identified a previously unsuspected effect on the nuclear factor erythroid-related factor 2 (NRF2), a critical regulator of cellular defenses against oxidative stress. Based on genetic and small molecule inhibitor-based methodologies, we demonstrated that repression of Ref-1 potently activates NRF2 and its downstream targets in a dose-dependent fashion, and that the redox, rather than the DNA repair function of Ref-1 is critical for this effect. Intriguingly, our results also indicate that this pathway does not involve reactive oxygen species. The link between Ref-1 and NRF2 appears to be present in all cells tested in vitro, noncancerous and cancerous, including patient-derived tumor samples. In particular, we focused on understanding the implications of the novel interaction between these two pathways in primary pancreatic ductal adenocarcinoma tumor cells and provide the first evidence that this mechanism has implications for overcoming the resistance against experimental drugs targeting Ref-1 activity, with clear translational implications. PMID:25492865

  10. Cytoprotective Role of Nrf2 in Electrical Pulse Stimulated C2C12 Myotube

    PubMed Central

    Horie, Masaki; Warabi, Eiji; Komine, Shoichi; Oh, Sechang; Shoda, Junichi

    2015-01-01

    Regular physical exercise is central to a healthy lifestyle. However, exercise-related muscle contraction can induce reactive oxygen species and reactive nitrogen species (ROS/RNS) production in skeletal muscle. The nuclear factor-E2-related factor-2 (Nrf2) transcription factor is a cellular sensor for oxidative stress. Regulation of nuclear Nrf2 signaling regulates antioxidant responses and protects organ structure and function. However, the role of Nrf2 in exercise- or contraction-induced ROS/RNS production in skeletal muscle is not clear. In this study, using differentiated C2C12 cells and electrical pulse stimulation (EPS) of muscle contraction, we explored whether Nrf2 plays a role in the skeletal muscle response to muscle contraction-induced ROS/RNS. We found that EPS (40 V, 1 Hz, 2 ms) stimulated ROS/RNS accumulation and Nrf2 activation. We also showed that expression of NQO1, HO-1 and GCLM increased after EPS-induced muscle contraction and was remarkably suppressed in cells with Nrf2 knockdown. We also found that the antioxidant N-acetylcysteine (NAC) significantly attenuated Nrf2 activation after EPS, whereas the nitric oxide synthetase inhibitor Nω-nitro-L-arginine methyl ester (L-NAME) did not. Furthermore, Nrf2 knockdown after EPS markedly decreased ROS/RNS redox potential and cell viability and increased expression of the apoptosis marker Annexin V in C2C12 myotubes. These results indicate that Nrf2 activation and expression of Nrf2 regulated-genes protected muscle against the increased ROS caused by EPS-induced muscle contraction. Thus, our findings suggest that Nrf2 may be a key factor for preservation of muscle function during muscle contraction. PMID:26658309

  11. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  12. Induction of cancer chemopreventive enzymes by coffee is mediated by transcription factor Nrf2. Evidence that the coffee-specific diterpenes cafestol and kahweol confer protection against acrolein

    SciTech Connect

    Higgins, Larry G. Cavin, Christophe; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.

    2008-02-01

    Mice fed diets containing 3% or 6% coffee for 5 days had increased levels of mRNA for NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutathione S-transferase class Alpha 1 (GSTA1) of between 4- and 20-fold in the liver and small intestine. Mice fed 6% coffee also had increased amounts of mRNA for UDP-glucuronosyl transferase 1A6 (UGT1A6) and the glutamate cysteine ligase catalytic (GCLC) subunit of between 3- and 10-fold in the small intestine. Up-regulation of these mRNAs was significantly greater in mice possessing Nrf2 (NF-E2 p45 subunit-related factor 2) than those lacking the transcription factor. Basal levels of mRNAs for NQO1, GSTA1, UGT1A6 and GCLC were lower in tissues from nrf2{sup -/-} mice than from nrf2{sup +/+} mice, but modest induction occurred in the mutant animals. Treatment of mouse embryonic fibroblasts (MEFs) from nrf2{sup +/+} mice with either coffee or the coffee-specific diterpenes cafestol and kahweol (C + K) increased NQO1 mRNA up to 9-fold. MEFs from nrf2{sup -/-} mice expressed less NQO1 mRNA than did wild-type MEFs, but NQO1 was induced modestly by coffee or C + K in the mutant fibroblasts. Transfection of MEFs with nqo1-luciferase reporter constructs showed that induction by C + K was mediated primarily by Nrf2 and required the presence of an antioxidant response element in the 5'-upstream region of the gene. Luciferase reporter activity did not increase following treatment of MEFs with 100 {mu}mol/l furan, suggesting that this ring structure within C + K is insufficient for gene induction. Priming of nrf2{sup +/+} MEFs, but not nrf2{sup -/-} MEFs, with C + K conferred 2-fold resistance towards acrolein.

  13. Intrahippocampal injection of a lentiviral vector expressing Nrf2 improves spatial learning in a mouse model of Alzheimer's disease

    PubMed Central

    Kanninen, Katja; Heikkinen, Riikka; Malm, Tarja; Rolova, Taisia; Kuhmonen, Susanna; Leinonen, Hanna; Ylä-Herttuala, Seppo; Tanila, Heikki; Levonen, Anna-Liisa; Koistinaho, Milla; Koistinaho, Jari

    2009-01-01

    The amyloid hypothesis of Alzheimer's disease (AD) postulates that amyloid-β (Aβ) deposition and neurotoxicity play a causative role in AD; oxidative injury is thought to be central in the pathogenesis. An endogenous defense system against oxidative stress is induced by binding of the transcription factor nuclear factor E2-related factor 2 (Nrf2) to the antioxidant response element (ARE) enhancer sequence. The Nrf2-ARE pathway is activated in response to reactive oxygen species to trigger the simultaneous expression of numerous protective enzymes and scavengers. To exploit the Nrf2-ARE pathway therapeutically, we delivered Nrf2 bilaterally into the hippocampus of 9-month-old transgenic AD mice (APP/PS1 mice) using a lentiviral vector encoding human Nrf2. The data indicate that significant reductions in spatial learning deficits of aged APP/PS1 mice in a Morris Water Maze can be achieved by modulating levels of Nrf2 in the brain. Memory improvement in APP/PS1 mice after Nrf2 transduction shifts the balance between soluble and insoluble Aβ toward an insoluble Aβ pool without concomitant change in total brain Aβ burden. Nrf2 gene transfer is associated with a robust reduction in astrocytic but not microglial activation and induction of Nrf2 target gene heme oxygenase 1, indicating overall activation of the Nrf2-ARE pathway in hippocampal neurons 6 months after injection. Results warrant further exploration of the Nrf2-ARE pathway for treatment of AD and suggest that the Nrf2-ARE pathway may represent a potential therapeutic strategy to pursue in AD in humans, particularly in view of the multiple mechanisms by which Nrf2 can exert its protective effects. PMID:19805328

  14. Methamphetamine oxidative stress, neurotoxicity, and functional deficits are modulated by nuclear factor-E2-related factor 2.

    PubMed

    Ramkissoon, Annmarie; Wells, Peter G

    2015-12-01

    Activation of redox-sensitive transcription factors like nuclear factor-E2-related factor 2 (Nrf2) can enhance the transcription of cytoprotective genes during oxidative stress. We investigated whether Nrf2 is activated by methamphetamine (METH) thereby altering neurotoxicity in Nrf2 +/+ and -/- adult mouse brain. A single dose of METH can induce the mRNA levels of Nrf2-regulated antioxidant and cytoprotective proteins in mouse brain. Multiple-day dosing with METH enhanced DNA oxidation and decreased tyrosine hydroxylase and dopamine transporter staining in the striatum, indicating dopaminergic nerve terminal toxicity, which was more severe in -/- mice, as were deficits in motor coordination and olfactory discrimination. These Nrf2-dependent effects were independent of changes in METH metabolism or the induction of hyperthermia. Similarly, METH increased striatal glial fibrillary acidic protein, indicating neurotoxicity. METH neurotoxicity was also observed in the glial cells and in the GABAergic system of the olfactory bulbs and was enhanced in -/- mice, whereas dopaminergic parameters were unaffected. With one-day dosing of METH, there were no differences between +/+ and -/- mice in either basal or METH-enhanced DNA oxidation and neurotoxicity markers. Nrf2-mediated pathways accordingly may protect against the neurodegenerative effects and functional deficits initiated by METH and perhaps other reactive oxygen species-enhancing neurotoxicants, when there is time for transcriptional activation and protein induction. In human users of METH, this mechanism may be essential when differences in drug abuse patterns may alter the induction and duration of Nrf2 activation thereby modulating susceptibility to the neurotoxic effects of METH. PMID:26427884

  15. Regulation of Nrf2 – An update

    PubMed Central

    Niture, Suryakant K.; Khatri, Raju; Jaiswal, Anil K.

    2013-01-01

    Nrf2:INrf2 (Keap1) are cellular sensors of oxidative and electrophilic stress. Nrf2 is a nuclear factor that controls the expression and coordinated induction of a battery of genes which encode detoxifying enzymes, drug transporters (MRPs), anti-apoptotic proteins and proteasomes. In the basal state, Nrf2 is constantly degraded in the cytoplasm by its inhibitor, INrf2. INrf2 functions as an adapter for Cul3/Rbx1 E3 ubiquitin ligase mediated degradation of Nrf2. Chemicals including antioxidants, tocopherols including α-tocopherol (vitamin E), phytochemicals and radiations antagonize the Nrf2:INrf2 interaction and leads to the stabilization and activation of Nrf2. The signaling events involve pre-induction, induction and post-induction responses that tightly control Nrf2 activation and repression back to the basal state. Oxidative/electrophilic signals activate unknown tyrosine kinase(s) in a pre-induction response which phosphorylates specific residues on Nrf2 negative-regulators, INrf2, Fyn and Bach1, leading to their nuclear export, ubiquitination and degradation. This prepares nuclei for unhindered import of Nrf2. Oxidative/electrophilic modification of INrf2cysteine151 followed by PKC phosphorylation of Nrf2serine40 in the induction response results in the escape or release of Nrf2 from INrf2. Nrf2 is thus stabilized and translocates to the nucleus resulting in a coordinated activation of gene expression. This is followed by a post-induction response that controls the ‘switching off’ of Nrf2-activated gene expression. GSK3β under the control of AKT and PI3K, phosphorylates Fyn leading to Fyn nuclear localization. Fyn phosphorylates Nrf2Y568 resulting in nuclear export and degradation of Nrf2. The activation and repression of Nrf2 provides protection against oxidative/electrophilic stress and associated diseases, including cancer. However, deregulation of INrf2 and Nrf2 due to mutations may lead to nuclear accumulation of Nrf2 that reduces apoptosis and

  16. Epigallocatechin-3-gallate attenuates transforming growth factor-β1 induced epithelial-mesenchymal transition via Nrf2 regulation in renal tubular epithelial cells.

    PubMed

    Wang, Yanqiu; Liu, Na; Su, Xuesong; Zhou, Guangyu; Sun, Guangping; Du, Feng; Bian, Xiaohui; Wang, Bowen

    2015-03-01

    Transforming growth factor-β1 (TGF-β1) induced epithelial-mesenchymal transition (EMT) plays an important role in renal fibrotic process regulation. Epigallocatechin-3-gallate (EGCG) exerts a protective effect against acute renal damage through its anti-oxidative effect by activating the Nrf2 signaling pathway. This study aims to investigate whether EGCG prevents TGF-β1 induced EMT and whether this effect acts via the Nrf2-mediated suppression of TGF-β1 signaling. MTT was used for cytotoxicity of EGCG examination and Western blotting and immunofluorescence were used for protein expression analysis. Results showed that EGCG prevented TGF-β1 mediated EMT and Smad 2 and Smad 3 phosphorylation in a dose dependent manner in NRK-52E cells. In addition, EGCG increased Nrf2 nuclear accumulation. Overexpression of Nrf2 blocked the phosphorylation of Smad 2 and Smad 3 mediated by TGF-β1 and decreased protein expression of plasminogen activator inhibitor 1 (PAI-1) and α-smooth muscle actin (α-SMA). Furthermore, siRNA-mediated knockdown of Nrf2 gene completely blocked the effects of EGCG, indicated by the reduced expressions of type I collagen (Col-I) and α-SMA were restored. In summary, EGCG inhibits TGF-β1 induced EMT and fibrotic proteins expression by Nrf2 activation. This study reveals a possible underlying mechanism of the renal protective effects of EGCG, and may provide a potential candidate to renal fibrosis therapy. PMID:25776510

  17. Amelioration of inflammation and tissue damage in sickle cell model mice by Nrf2 activation.

    PubMed

    Keleku-Lukwete, Nadine; Suzuki, Mikiko; Otsuki, Akihito; Tsuchida, Kouhei; Katayama, Saori; Hayashi, Makiko; Naganuma, Eriko; Moriguchi, Takashi; Tanabe, Osamu; Engel, James Douglas; Imaizumi, Masue; Yamamoto, Masayuki

    2015-09-29

    Sickle cell disease (SCD) is an inherited disorder caused by a point mutation in the β-globin gene, leading to the production of abnormally shaped red blood cells. Sickle cells are prone to hemolysis and thereby release free heme into plasma, causing oxidative stress and inflammation that in turn result in damage to multiple organs. The transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) is a master regulator of the antioxidant cell-defense system. Here we show that constitutive Nrf2 activation by ablation of its negative regulator Keap1 (kelch-like ECH-associated protein 1) significantly improves symptoms in SCD model mice. SCD mice exhibit severe liver damage and lung inflammation associated with high expression levels of proinflammatory cytokines and adhesion molecules compared with normal mice. Importantly, these symptoms subsided after Nrf2 activation. Although hemolysis and stress erythropoiesis did not change substantially in the Nrf2-activated SCD mice, Nrf2 promoted the elimination of plasma heme released by sickle cells' hemolysis and thereby reduced oxidative stress and inflammation, demonstrating that Nrf2 activation reduces organ damage and segregates inflammation from prevention of hemolysis in SCD mice. Furthermore, administration of the Nrf2 inducer CDDO-Im (2-cyano-3, 12 dioxooleana-1, 9 diene-28-imidazolide) also relieved inflammation and organ failure in SCD mice. These results support the contention that Nrf2 induction may be an important means to protect organs from the pathophysiology of sickle cell-induced damage. PMID:26371321

  18. NRF2 Regulates HER2 and HER3 Signaling Pathway to Modulate Sensitivity to Targeted Immunotherapies

    PubMed Central

    Khalil, Hilal S.; Langdon, Simon P.; Kankia, Ibrahim H.; Bown, James; Deeni, Yusuf Y.

    2016-01-01

    NF-E2 related factor-2 (NRF2) is an essential transcription factor for multiple genes encoding antioxidants and detoxification enzymes. NRF2 is implicated in promoting cancer therapeutic resistance by its detoxification function and crosstalk with proproliferative pathways. However, the exact mechanism of this intricate connectivity between NRF2 and growth factor induced proliferative pathway remains elusive. Here, we have demonstrated that pharmacological activation of NRF2 by tert-butylhydroquinone (tBHQ) upregulates the HER family receptors, HER2 and HER3 expression, elevates pAKT levels, and enhances the proliferation of ovarian cancer cells. Preactivation of NRF2 also attenuates the combined growth inhibitory effects of HER2 targeting monoclonal antibodies, Pertuzumab and Trastuzumab. Further, tBHQ caused transcriptional induction of HER2 and HER3, while SiRNA-mediated knockdown of NRF2 prevented this and further caused transcriptional repression and enhanced cytotoxicity of the HER2 inhibitors. Hence, NRF2 regulates both HER2 and HER3 receptors to influence cellular responses to HER2 targeting monoclonal antibodies. This deciphered crosstalk mechanism reinforces the role of NRF2 in drug resistance and as a relevant anticancer target. PMID:26770651

  19. Nrf2 activity as a potential biomarker for the pan-epigenetic anticancer agent, RRx-001

    PubMed Central

    Ning, Shoucheng; Sekar, Thillai Veerapazham; Scicinski, Jan; Oronsky, Bryan; Peehl, Donna M.; Knox, Susan J.; Paulmurugan, Ramasamy

    2015-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a master regulatory transcription factor that plays an important role in the antioxidant response pathway against anticancer drug-induced cytotoxic effects. RRx-001 is a new anticancer agent that generates reactive oxygen and nitrogen species, and leads to epigenetic alterations in cancer cells. Here we report the RRx-001 mediated nuclear translocation of Nrf2 and the activation of expression of its downstream enzymes HO-1 and NQO1 in tumor cells. Inhibition of intrinsic Nrf2 expression by Nrf2-specific siRNA increased cell sensitivity to RRx-001. Molecular imaging of tumor cells co-expressing pARE-Firefly luciferase and pCMV-Renilla luciferase-mRFP in vitro and in vivo in mice revealed that RRx-001 significantly increased ARE-FLUC signal in cells in a dose- and time-dependent manner, suggesting that RRx-001 is an effective activator of the Nrf2-ARE signaling pathway. The pre-treatment level of ARE-FLUC signal in cells, reflecting basal activity of Nrf2, negatively correlated with the tumor response to RRx-001. The results support the concept that RRx-001 activates Nrf2-ARE antioxidant signaling pathways in tumor cells. Hence measurement of Nrf2-mediated activation of downstream target genes through ARE signaling may constitute a useful molecular biomarker for the early prediction of response to RRx-001 treatment, and thereby guide therapeutic decision-making. PMID:26280276

  20. GSK-3β downregulates Nrf2 in cultured cortical neurons and in a rat model of cerebral ischemia-reperfusion

    PubMed Central

    Chen, Xi; Liu, Yuanling; Zhu, Jin; Lei, Shipeng; Dong, Yuan; Li, Lingyu; Jiang, Beibei; Tan, Li; Wu, Jingxian; Yu, Shanshan; Zhao, Yong

    2016-01-01

    The NF-E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway plays a critical role in protecting against oxidative stress in brain ischemia and reperfusion injury. Glycogen synthase kinase 3β (GSK-3β) may play a critical role in regulating Nrf2 in a Kelch-like ECH-associated protein 1 (Keap1)-independent manner. However, the relationship between GSK-3β and Nrf2 in brain ischemia and reperfusion injury is not clear. In this study, we explored the mechanisms through which GSK-3β regulates Nrf2 and Nrf-2/ARE pathways in vitro and in vivo. We used oxygen and glucose deprivation/reoxygenation (OGD/R) in primary cultured cortical neurons and a middle cerebral artery occlusion-reperfusion (MCAO/R) rat model to mimic ischemic insult. In this study, GSK-3β siRNA and inhibitors (SB216763 and LiCl) were used to inhibit GSK-3β in vitro and in vivo. After inhibiting GSK-3β, expression of total and nuclear Nrf2, Nrf2-ARE binding activity, and expression of Nrf2/ARE pathway-driven genes HO-1 and NQO-1 increased. Overexpression of GSK-3β yielded opposite results. These results suggest that GSK-3β downregulates Nrf2 and the Nrf2/ARE pathway in brain ischemia and reperfusion injury. GSK-3β may be an endogenous antioxidant relevant protein, and may represent a new therapeutic target in treatment of ischemia and reperfusion injury. PMID:26838164

  1. Molecular Basis of Electrophilic and Oxidative Defense: Promises and Perils of Nrf2

    PubMed Central

    Ma, Qiang; He, Xiaoqing

    2015-01-01

    Induction of drug-metabolizing enzymes through the antioxidant response element (ARE)-dependent transcription was initially implicated in chemoprevention against cancer by antioxidants. Recent progress in understanding the biology and mechanism of induction revealed a critical role of induction in cellular defense against electrophilic and oxidative stress. Induction is mediated through a novel signaling pathway via two regulatory proteins, the nuclear factor erythroid 2-related factor 2 (Nrf2) and the Kelch-like erythroid cell-derived protein with CNC homology-associated protein 1 (Keap1). Nrf2 binds to Keap1 at a two site-binding interface and is ubiquitinated by the Keap1/cullin 3/ring box protein-1-ubiquitin ligase, resulting in a rapid turnover of Nrf2 protein. Electrophiles and oxidants modify critical cysteine thiols of Keap1 and Nrf2 to inhibit Nrf2 ubiquitination, leading to Nrf2 activation and induction. Induction increases stress resistance critical for cell survival, because knockout of Nrf2 in mice increased susceptibility to a variety of toxicity and disease processes. Collateral to diverse functions of Nrf2, genome-wide search has led to the identification of a plethora of ARE-dependent genes regulated by Nrf2 in an inducer-, tissue-, and disease-dependent manner to control drug metabolism, antioxidant defense, stress response, proteasomal degradation, and cell proliferation. The protective nature of Nrf2 could also be hijacked in a number of pathological conditions by means of somatic mutation, epigenetic alteration, and accumulation of disruptor proteins, promoting drug resistance in cancer and pathologic liver features in autophagy deficiency. The repertoire of ARE inducers has expanded enormously; the therapeutic potential of the inducers has been examined beyond cancer prevention. Developing potent and specific ARE inducers and Nrf2 inhibitors holds certain new promise for the prevention and therapy against cancer, chronic disease, and toxicity

  2. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    SciTech Connect

    Jing, Xu; Ren, Dongmei; Wei, Xinbing; Shi, Huanying; Zhang, Xiumei; Perez, Ruth G.; Lou, Haiyan; Lou, Hongxiang

    2013-12-15

    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury.

  3. Coordinated induction of Nrf2 target genes protects against iron nitrilotriacetate (FeNTA)-induced nephrotoxicity

    SciTech Connect

    Tanaka, Yuji; Aleksunes, Lauren M. |; Goedken, Michael J.; Chen, Chuan; Reisman, Scott A.; Manautou, Jose E.; Klaassen, Curtis D.

    2008-09-15

    The iron chelate, ferric nitrilotriacetate (FeNTA), induces acute proximal tubular necrosis as a consequence of lipid peroxidation and oxidative tissue damage. Chronic exposure of FeNTA leads to a high incidence of renal adenocarcinomas in rodents. NF-E2-related factor 2 (Nrf2) is a transcription factor that is activated by oxidative stress and electrophiles, and regulates the basal and inducible expression of numerous detoxifying and antioxidant genes. To determine the roles of Nrf2 in regulating renal gene expression and protecting against oxidative stress-induced kidney damage, wild-type and Nrf2-null mice were administered FeNTA. Renal Nrf2 protein translocated to the nucleus at 6h after FeNTA treatment. FeNTA increased mRNA levels of Nrf2 target genes, including NQO1, GCLC, GSTpi1/2, Mrp1, 2, and 4 in kidneys from wild-type mice, but not Nrf2-null mice. Protein expression of NQO1, a prototypical Nrf2 target gene, was increased in wild-type mice, with no change in Nrf2-null mice. FeNTA produced more nephrotoxicity in Nrf2-null mice than wild-type mice as indicated by higher serum urea nitrogen and creatinine levels, as more urinary NAG, stronger 4-hydroxynonenal protein adduct staining, and more extensive proximal tubule damage. Furthermore, pretreatment with CDDO-Im, a potent small molecule Nrf2 activator, protected mice against FeNTA-induced renal toxicity. Collectively, these results suggest that activation of Nrf2 protects mouse kidneys from FeNTA-induced oxidative stress damage by coordinately up-regulating the expression of cytoprotective genes.

  4. Generation of a New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B1 Toxicity.

    PubMed

    Taguchi, Keiko; Takaku, Misaki; Egner, Patricia A; Morita, Masanobu; Kaneko, Takehito; Mashimo, Tomoji; Kensler, Thomas W; Yamamoto, Masayuki

    2016-07-01

    THE TRANSCRIPTION FACTOR NRF2: (NF-E2-related-factor 2) REGULATES A BATTERY OF ANTIOXIDATIVE STRESS-RESPONSE GENES AND DETOXICATION GENES, AND NRF2 KNOCKOUT LINES OF MICE HAVE BEEN CONTRIBUTING CRITICALLY TO THE CLARIFICATION OF ROLES THAT NRF2 PLAYS FOR CELL PROTECTION HOWEVER, THERE ARE APPARENT LIMITATIONS IN USE OF THE MOUSE MODELS FOR INSTANCE, RATS EXHIBIT MORE SUITABLE FEATURES FOR TOXICOLOGICAL OR PHYSIOLOGICAL EXAMINATIONS THAN MICE IN THIS STUDY, WE GENERATED 2 LINES OF NRF2 KNOCKOUT RATS BY USING A GENOME EDITING TECHNOLOGY; 1 LINE HARBORS A 7-BP DELETION Δ7 AND THE OTHER LINE HARBORS A 1-BP INSERTION +1 IN THE NRF2 GENE IN THE LIVERS OF RATS HOMOZYGOUSLY DELETING THE NRF2 GENE, AN ACTIVATOR OF NRF2 SIGNALING, CDDO-IM, COULD NOT INDUCE EXPRESSION OF REPRESENTATIVE NRF2 TARGET GENES TO EXAMINE ALTERED TOXICOLOGICAL RESPONSE, WE TREATED THE NRF2 KNOCKOUT RATS WITH AFLATOXIN B1 AFB1, A CARCINOGENIC MYCOTOXIN THAT ELICITS GENE MUTATIONS THROUGH BINDING OF ITS METABOLITES TO DNA AND FOR WHICH THE RAT HAS BEEN PROPOSED AS A REASONABLE SURROGATE FOR HUMAN TOXICITY INDEED, IN THE NRF2 KNOCKOUT RAT LIVERS THE ENZYMES OF THE AFB1 DETOXICATION PATHWAY WERE SIGNIFICANTLY DOWNREGULATED SINGLE DOSE ADMINISTRATION OF AFB1 INCREASED HEPATOTOXICITY AND BINDING OF AFB1-N7-GUANINE TO HEPATIC DNA IN NRF2 KNOCKOUT RATS COMPARED WITH WILD-TYPE NRF2 KNOCKOUT RATS REPEATEDLY TREATED WITH AFB1 WERE PRONE TO LETHALITY AND CDDO-IM WAS NO LONGER PROTECTIVE THESE RESULTS DEMONSTRATE THAT NRF2 KNOCKOUT RATS ARE QUITE SENSITIVE TO AFB1 TOXICITIES AND THIS RAT GENOTYPE EMERGES AS A NEW MODEL ANIMAL IN TOXICOLOGY. PMID:27071940

  5. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    SciTech Connect

    Li, Bin; Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S.; Ward, Keith W.; Meyer, Colin J.; Wang, Xing Li; Tang, Dongqi; Cui, Taixing

    2014-02-21

    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  6. The Keap1-Nrf2 System Prevents Onset of Diabetes Mellitus

    PubMed Central

    Uruno, Akira; Furusawa, Yuki; Yagishita, Yoko; Fukutomi, Toshiaki; Muramatsu, Hiroyuki; Negishi, Takaaki; Sugawara, Akira; Kensler, Thomas W.

    2013-01-01

    Transcription factor Nrf2 (NF-E2-related factor 2) regulates a broad cytoprotective response to environmental stresses. Keap1 (Kelch-like ECH-associated protein 1) is an adaptor protein for cullin3-based ubiquitin E3 ligase and negatively regulates Nrf2. Whereas the Keap1-Nrf2 system plays important roles in oxidative stress response and metabolism, the roles Nrf2 plays in the prevention of diabetes mellitus remain elusive. Here we show that genetic activation of Nrf2 signaling by Keap1 gene hypomorphic knockdown (Keap1flox/−) markedly suppresses the onset of diabetes. When Keap1flox/− mice were crossed with diabetic db/db mice, blood glucose levels became lower through improvement of both insulin secretion and insulin resistance. Keap1flox/− also prevented high-calorie-diet-induced diabetes. Oral administration of the Nrf2 inducer CDDO-Im {oleanolic acid 1-[2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oyl] imidazole} also attenuated diabetes in db/db mice. Nrf2 induction altered antioxidant-, energy consumption-, and gluconeogenesis-related gene expression in metabolic tissues. Thus, the Keap1-Nrf2 system is a critical target for preventing the onset of diabetes mellitus. PMID:23716596

  7. Nrf2 is the key to chemotherapy resistance in MCF7 breast cancer cells under hypoxia

    PubMed Central

    Syu, Jhih-Pu; Chi, Jen-Tsan; Kung, Hsiu-Ni

    2016-01-01

    Hypoxia leads to reactive oxygen species (ROS) imbalance, which is proposed to associate with drug resistance and oncogenesis. Inhibition of enzymes of antioxidant balancing system in tumor cells was shown to reduce chemoresistance under hypoxia. However, the underlying mechanism remains unknown. The key regulator of antioxidant balancing system is nuclear factor erythroid 2-related factor 2 (NFE2L2, Nrf2). In this study, we showed that hypoxia induced ROS production and increased the Nrf2 activity. Nrf2 activation increased levels of its downstream target antioxidant enzymes, including GCLC and GCLM. The Nrf2-overexpressing also confers chemo-resistant MCF7 cells under normoxia. The in vivo mouse model also demonstrated that the chemical inhibition of Nrf2 can increase cisplatin (CDDP) cytotoxicity. Together, these results showed that Nrf2 serves as a key regulator in chemotherapeutic resistance under hypoxia through ROS-Nrf2-GCLC-GSH pathway. Therefore, targeting Nrf2 can be a potential treatment for hypoxia-induced drug resistance in breast cancer cells. PMID:26894974

  8. Neuronal development is promoted by weakened intrinsic antioxidant defences due to epigenetic repression of Nrf2

    PubMed Central

    Bell, Karen F.S.; Al-Mubarak, Bashayer; Martel, Marc-André; McKay, Sean; Wheelan, Nicola; Hasel, Philip; Márkus, Nóra M.; Baxter, Paul; Deighton, Ruth F.; Serio, Andrea; Bilican, Bilada; Chowdhry, Sudhir; Meakin, Paul J.; Ashford, Michael L.J.; Wyllie, David J.A.; Scannevin, Robert H.; Chandran, Siddharthan; Hayes, John D.; Hardingham, Giles E.

    2015-01-01

    Forebrain neurons have weak intrinsic antioxidant defences compared with astrocytes, but the molecular basis and purpose of this is poorly understood. We show that early in mouse cortical neuronal development in vitro and in vivo, expression of the master-regulator of antioxidant genes, transcription factor NF-E2-related-factor-2 (Nrf2), is repressed by epigenetic inactivation of its promoter. Consequently, in contrast to astrocytes or young neurons, maturing neurons possess negligible Nrf2-dependent antioxidant defences, and exhibit no transcriptional responses to Nrf2 activators, or to ablation of Nrf2's inhibitor Keap1. Neuronal Nrf2 inactivation seems to be required for proper development: in maturing neurons, ectopic Nrf2 expression inhibits neurite outgrowth and aborization, and electrophysiological maturation, including synaptogenesis. These defects arise because Nrf2 activity buffers neuronal redox status, inhibiting maturation processes dependent on redox-sensitive JNK and Wnt pathways. Thus, developmental epigenetic Nrf2 repression weakens neuronal antioxidant defences but is necessary to create an environment that supports neuronal development. PMID:25967870

  9. Salidroside Suppresses HUVECs Cell Injury Induced by Oxidative Stress through Activating the Nrf2 Signaling Pathway.

    PubMed

    Zhu, Yao; Zhang, Ya-Jie; Liu, Wei-Wei; Shi, Ai-Wu; Gu, Ning

    2016-01-01

    Oxidative stress plays an important role in the pathogenesis of cardiovascular diseases. Salidroside (SAL), one of the main effective constituents of Rhodiola rosea, has been reported to suppress oxidative stress-induced cardiomyocyte injury and necrosis by promoting transcription of nuclear factor E2-related factor 2 (Nrf2)-regulated genes such as heme oxygenase-1 (HO-1) and NAD(P)H dehydrogenase (quinone1) (NQO1). However, it has not been indicated whether SAL might ameliorate endothelial injury induced by oxidative stress. Here, our study demonstrated that SAL might suppress HUVEC cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. The results of our study indicated that SAL decreased the levels of intercellular reactive oxygen species (ROS) and malondialdehyde (MDA), and improved the activities of superoxide dismutase (SOD) and catalase (CAT), resulting in protective effects against oxidative stress-induced cell damage in HUVECs. It suppressed oxidative stress damage by inducing Nrf2 nuclear translocation and activating the expression of Nrf2-regulated antioxidant enzyme genes such as HO-1 and NQO1 in HUVECs. Knockdown of Nrf2 with siRNA abolished the cytoprotective effects against oxidative stress, decreased the expression of Nrf2, HO-1, and NQO1, and inhibited the nucleus translocation of Nrf2 in HUVECs. This study is the first to demonstrate that SAL suppresses HUVECs cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. PMID:27517893

  10. Overview of Nrf2 as Therapeutic Target in Epilepsy

    PubMed Central

    Carmona-Aparicio, Liliana; Pérez-Cruz, Claudia; Zavala-Tecuapetla, Cecilia; Granados-Rojas, Leticia; Rivera-Espinosa, Liliana; Montesinos-Correa, Hortencia; Hernández-Damián, Jacqueline; Pedraza-Chaverri, José; Sampieri, Aristides III; Coballase-Urrutia, Elvia; Cárdenas-Rodríguez, Noemí

    2015-01-01

    Oxidative stress is a biochemical state of imbalance in the production of reactive oxygen and nitrogen species and antioxidant defenses. It is involved in the physiopathology of degenerative and chronic neuronal disorders, such as epilepsy. Experimental evidence in humans and animals support the involvement of oxidative stress before and after seizures. In the past few years, research has increasingly focused on the molecular pathways of this process, such as that involving transcription factor nuclear factor E2-related factor 2 (Nrf2), which plays a central role in the regulation of antioxidant response elements (ARE) and modulates cellular redox status. The aim of this review is to present experimental evidence on the role of Nrf2 in this neurological disorder and to further determine the therapeutic impact of Nrf2 in epilepsy. PMID:26262608

  11. Lithium Promotes Longevity through GSK3/NRF2-Dependent Hormesis

    PubMed Central

    Castillo-Quan, Jorge Iván; Li, Li; Kinghorn, Kerri J.; Ivanov, Dobril K.; Tain, Luke S.; Slack, Cathy; Kerr, Fiona; Nespital, Tobias; Thornton, Janet; Hardy, John; Bjedov, Ivana; Partridge, Linda

    2016-01-01

    Summary The quest to extend healthspan via pharmacological means is becoming increasingly urgent, both from a health and economic perspective. Here we show that lithium, a drug approved for human use, promotes longevity and healthspan. We demonstrate that lithium extends lifespan in female and male Drosophila, when administered throughout adulthood or only later in life. The life-extending mechanism involves the inhibition of glycogen synthase kinase-3 (GSK-3) and activation of the transcription factor nuclear factor erythroid 2-related factor (NRF-2). Combining genetic loss of the NRF-2 repressor Kelch-like ECH-associated protein 1 (Keap1) with lithium treatment revealed that high levels of NRF-2 activation conferred stress resistance, while low levels additionally promoted longevity. The discovery of GSK-3 as a therapeutic target for aging will likely lead to more effective treatments that can modulate mammalian aging and further improve health in later life. PMID:27068460

  12. Lithium Promotes Longevity through GSK3/NRF2-Dependent Hormesis.

    PubMed

    Castillo-Quan, Jorge Iván; Li, Li; Kinghorn, Kerri J; Ivanov, Dobril K; Tain, Luke S; Slack, Cathy; Kerr, Fiona; Nespital, Tobias; Thornton, Janet; Hardy, John; Bjedov, Ivana; Partridge, Linda

    2016-04-19

    The quest to extend healthspan via pharmacological means is becoming increasingly urgent, both from a health and economic perspective. Here we show that lithium, a drug approved for human use, promotes longevity and healthspan. We demonstrate that lithium extends lifespan in female and male Drosophila, when administered throughout adulthood or only later in life. The life-extending mechanism involves the inhibition of glycogen synthase kinase-3 (GSK-3) and activation of the transcription factor nuclear factor erythroid 2-related factor (NRF-2). Combining genetic loss of the NRF-2 repressor Kelch-like ECH-associated protein 1 (Keap1) with lithium treatment revealed that high levels of NRF-2 activation conferred stress resistance, while low levels additionally promoted longevity. The discovery of GSK-3 as a therapeutic target for aging will likely lead to more effective treatments that can modulate mammalian aging and further improve health in later life. PMID:27068460

  13. Fisetin stimulates autophagic degradation of phosphorylated tau via the activation of TFEB and Nrf2 transcription factors

    PubMed Central

    Kim, Sunhyo; Choi, Ki Ju; Cho, Sun-Jung; Yun, Sang-Moon; Jeon, Jae-Pil; Koh, Young Ho; Song, Jihyun; Johnson, Gail V. W.; Jo, Chulman

    2016-01-01

    The neuronal accumulation of phosphorylated tau plays a critical role in the pathogenesis of Alzheimer’s disease (AD). Here, we examined the effect of fisetin, a flavonol, on tau levels. Treatment of cortical cells or primary neurons with fisetin resulted in significant decreases in the levels of phosphorylated tau. In addition, fisetin decreased the levels of sarkosyl-insoluble tau in an active GSK-3β-induced tau aggregation model. However, there was no difference in activities of tau kinases and phosphatases such as protein phosphatase 2A, irrespective of fisetin treatment. Fisetin activated autophagy together with the activation of transcription factor EB (TFEB) and Nrf2 transcriptional factors. The activation of autophagy including TFEB is likely due to fisetin-mediated mammalian target of rapamycin complex 1 (mTORC1) inhibition, since the phosphorylation levels of p70S6 kinase and 4E-BP1 were decreased in the presence of fisetin. Indeed, fisetin-induced phosphorylated tau degradation was attenuated by chemical inhibitors of the autophagy-lysosome pathway. Together the results indicate that fisetin reduces levels of phosphorylated tau through the autophagy pathway activated by TFEB and Nrf2. Our result suggests fisetin should be evaluated further as a potential preventive and therapeutic drug candidate for AD. PMID:27112200

  14. Protective Role of Nuclear Factor E2-Related Factor 2 against Acute Oxidative Stress-Induced Pancreatic β -Cell Damage.

    PubMed

    Fu, Jingqi; Zheng, Hongzhi; Wang, Huihui; Yang, Bei; Zhao, Rui; Lu, Chunwei; Liu, Zhiyuan; Hou, Yongyong; Xu, Yuanyuan; Zhang, Qiang; Qu, Weidong; Pi, Jingbo

    2015-01-01

    Oxidative stress is implicated in the pathogenesis of pancreatic β-cell dysfunction that occurs in both type 1 and type 2 diabetes. Nuclear factor E2-related factor 2 (NRF2) is a master regulator in the cellular adaptive response to oxidative stress. The present study found that MIN6 β-cells with stable knockdown of Nrf2 (Nrf2-KD) and islets isolated from Nrf2-knockout mice expressed substantially reduced levels of antioxidant enzymes in response to a variety of stressors. In scramble MIN6 cells or wild-type islets, acute exposure to oxidative stressors, including hydrogen peroxide (H2O2) and S-nitroso-N-acetylpenicillamine, resulted in cell damage as determined by decrease in cell viability, reduced ATP content, morphology changes of islets, and/or alterations of apoptotic biomarkers in a concentration- and/or time-dependent manner. In contrast, silencing of Nrf2 sensitized MIN6 cells or islets to the damage. In addition, pretreatment of MIN6 β-cells with NRF2 activators, including CDDO-Im, dimethyl fumarate (DMF), and tert-butylhydroquinone (tBHQ), protected the cells from high levels of H2O2-induced cell damage. Given that reactive oxygen species (ROS) are involved in regulating glucose-stimulated insulin secretion (GSIS) and persistent activation of NRF2 blunts glucose-triggered ROS signaling and GSIS, the present study highlights the distinct roles that NRF2 may play in pancreatic β-cell dysfunction that occurs in different stages of diabetes. PMID:25949772

  15. A polymethoxy flavonoids-rich Citrus aurantium extract ameliorates ethanol-induced liver injury through modulation of AMPK and Nrf2-related signals in a binge drinking mouse model.

    PubMed

    Choi, Bong-Keun; Kim, Tae-Won; Lee, Dong-Ryung; Jung, Woon-Ha; Lim, Jong-Hwan; Jung, Ju-Young; Yang, Seung Hwan; Suh, Joo-Won

    2015-10-01

    Nobiletin and tangeretin are polymethoxy flavonoids (PMFs), found in rich quantities in the peel of citrus fruits. In the present study, we assessed the biological effect of the PMFs on liver damage using a mouse model of binge drinking. First, we extracted PMFs from the peels of Citrus aurantium to make Citrus aurantium extract (CAE). Male C57BL/6 mice were orally treated with silymarin and CAE (50, 100, and 200 mg/kg) for 3 days prior to ethanol (5 g/kg, total of 3 doses) oral gavage. Liver injury was observed in the ethanol alone group, as evidenced by increases in serum hepatic enzymes and histopathologic alteration, as well as by hepatic oxidative status disruption. CAE improved serum marker and hepatic structure and restored oxidative status by enhancing antioxidant enzyme levels and by reducing lipid peroxidation levels. In addition, CAE evidently suppressed inflammation and apoptosis in the livers of mice administered with ethanol, by 85% (tumor necrosis factor-α) and 44% compared to the control group, respectively. Furthermore, CAE activated lipid metabolism related signals and enhanced phosphorylation of AMP-activated protein kinase (AMPK) and nuclear factor E2-related factor 2 (Nrf2) with several cytoprotective proteins including heme oxygenase-1, NAD(P)H quinone oxidoreductase 1, and γ-glutamylcysteine synthetase. Taken together, the present study demonstrated that, CAE possesses antioxidant, anti-inflammatory, and antiapoptotic activity against ethanol-induced liver injury. PMID:26178909

  16. The rise of antioxidant signaling-The evolution and hormetic actions of Nrf2

    SciTech Connect

    Maher, Jonathan; Yamamoto, Masayuki

    2010-04-01

    Organisms have evolved sophisticated and redundant mechanisms to manage oxidative and electrophilic challenges that arise from internal metabolism or xenobiotic challenge for survival. NF-E2-related factor 2 (Nrf2) is a transcription factor that has evolved over millennia from primitive origins, with homologues traceable back to invertebrate Caenorhabditis and Drosophila species. The ancestry of Nrf2 clearly has deep-seated roots in hematopoiesis, yet has diversified into a transcription factor that can mediate a multitude of antioxidant signaling and detoxification genes. In higher organisms, a more sophisticated means of tightly regulating Nrf2 activity was introduced via the cysteine-rich kelch-like ECH-associated protein 1 (Keap1), thus suggesting a need to modulate Nrf2 activity. This is evidenced in Keap1{sup -/-} mice, which succumb to juvenile mortality due to hyperkeratosis of the gastrointestinal tract. Although Nrf2 activation protects against acute toxicity and prevents or attenuates several disease states, constitutive activation in some tumors leads to poor clinical outcomes, suggesting Nrf2 has evolved in response to a multitude of selective pressures. The purpose of this review is to examine the origins of Nrf2, while highlighting the versatility and protective abilities elicited upon activation. Various model systems in which Nrf2 is normally beneficial but in which exaggerated pharmacology exacerbates a physiological or pathological condition will be addressed. Although Darwinian principles have selected Nrf2 activity for maximal beneficial effect based on environmental and oxidative challenge, both sub- or super-physiological effects have been noted to be detrimental. The functions of Nrf2 thus suggest a hormetic factor that has evolved empirically over time.

  17. Fibroblast growth factor 21 (FGF21) inhibits macrophage-mediated inflammation by activating Nrf2 and suppressing the NF-κB signaling pathway.

    PubMed

    Yu, Yinhang; He, Jinjiao; Li, Siming; Song, Liying; Guo, Xiaochen; Yao, Wenbing; Zou, Dehua; Gao, Xinyu; Liu, Yunye; Bai, Fuliang; Ren, Guiping; Li, Deshan

    2016-09-01

    Our previous report has shown that FGF21 has anti-inflammatory properties in a collagen-induced arthritis (CIA) model. In this study, the underlying molecular mechanisms of action were also investigated using RAW 264.7 cells, a murine monocyte-macrophage. RAW 264.7 cells were pre-incubated with various concentrations (2000, 500, 100ng/ml) of FGF21 and stimulated with LPS to induce oxidative stress and inflammation. The result of flow cytometry showed that β-Klotho, FGF21 specific receptor, was expressed in murine splenic macrophages and RAW 264.7. In vitro, FGF21 reduced the expression of TNF-α, IL-1β, IL-6 and IFN-γ and increased the level of IL-10 in a dose-dependent manner in LPS-stimulated RAW 264.7 macrophages. FGF21 also suppressed profound elevation of ROS production and oxidative stress, as evidenced by an increase of the MDA level and depletion of the intracellular GSH level, and restored the activities of antioxidant enzymes SOD and GSH-Px in LPS-stimulated RAW 264.7 macrophages. Moreover, FGF21 inhibited LPS-induced nuclear factor-κB (NF-κB) activation, including degradation of I-κB and nuclear translocation of p65. In addition, the result of Western blot and real-time PCR showed that FGF21 induced heme oxygenase-1 (HO-1) expression and increased the nuclear transcription factor-E2-related factor 2 (Nrf2) levels in a dose-dependent manner in LPS-stimulated RAW 264.7 macrophages. In conclusion, the results suggest that macrophages are the targets for the anti-inflammatory effects of FGF21, and FGF21 exerted an anti-inflammatory effect mainly via enhancing Nrf2-mediated anti-oxidant capacity and suppressing NF-κB signaling pathway. PMID:27276443

  18. Ascorbic acid partly antagonizes resveratrol mediated heme oxygenase-1 but not paraoxonase-1 induction in cultured hepatocytes - role of the redox-regulated transcription factor Nrf2

    PubMed Central

    2011-01-01

    Background Both resveratrol and vitamin C (ascorbic acid) are frequently used in complementary and alternative medicine. However, little is known about the underlying mechanisms for potential health benefits of resveratrol and its interactions with ascorbic acid. Methods The antioxidant enzymes heme oxygenase-1 and paraoxonase-1 were analysed for their mRNA and protein levels in HUH7 liver cells treated with 10 and 25 μmol/l resveratrol in the absence and presence of 100 and 1000 μmol/l ascorbic acid. Additionally the transactivation of the transcription factor Nrf2 and paraoxonase-1 were determined by reporter gene assays. Results Here, we demonstrate that resveratrol induces the antioxidant enzymes heme oxygenase-1 and paraoxonase-1 in cultured hepatocytes. Heme oxygenase-1 induction by resveratrol was accompanied by an increase in Nrf2 transactivation. Resveratrol mediated Nrf2 transactivation as well as heme oxygenase-1 induction were partly antagonized by 1000 μmol/l ascorbic acid. Conclusions Unlike heme oxygenase-1 (which is highly regulated by Nrf2) paraoxonase-1 (which exhibits fewer ARE/Nrf2 binding sites in its promoter) induction by resveratrol was not counteracted by ascorbic acid. Addition of resveratrol to the cell culture medium produced relatively low levels of hydrogen peroxide which may be a positive hormetic redox-signal for Nrf2 dependent gene expression thereby driving heme oxygenase-1 induction. However, high concentrations of ascorbic acid manifold increased hydrogen peroxide production in the cell culture medium which may be a stress signal thereby disrupting the Nrf2 signalling pathway. PMID:21199573

  19. Novel Nrf2 activators from microbial transformation products inhibit blood–retinal barrier permeability in rabbits

    PubMed Central

    Nakagami, Yasuhiro; Masuda, Kayoko; Hatano, Emiko; Inoue, Tatsuya; Matsuyama, Takuya; Iizuka, Mayumi; Ono, Yasunori; Ohnuki, Takashi; Murakami, Yoko; Iwasaki, Masaru; Yoshida, Kazuhiro; Kasuya, Yuji; Komoriya, Satoshi

    2015-01-01

    Background and Purpose Nuclear factor erythroid 2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that binds to antioxidant response elements located in the promoter region of genes encoding many antioxidant enzymes and phase II detoxifying enzymes. Activation of the Nrf2 pathway seems protective for many organs, and although a well-known Nrf2 activator, bardoxolone methyl, was evaluated clinically for treating chronic kidney disease, it was found to induce adverse events. Many bardoxolone methyl derivatives, mostly derived by chemical modifications, have already been studied. However, we adopted a biotransformation technique to obtain a novel Nrf2 activator. Experimental Approach The potent novel Nrf2 activator, RS9, was obtained from microbial transformation products. Its Nrf2 activity was evaluated by determining NADPH:quinone oxidoreductase-1 induction activity in Hepa1c1c7 cells. We also investigated the effects of RS9 on oxygen-induced retinopathy in rats and glycated albumin-induced blood–retinal barrier permeability in rabbits because many ocular diseases are associated with oxidative stress and inflammation. Key Results Bardoxolone methyl doubled the specific activity of Nrf2 in Hepa1c1c7 cells at a much higher concentration than RS9. Moreover, the induction of Nrf2-targeted genes was observed at a one-tenth lower concentration of RS9. Interestingly, the cytotoxicity of RS9 was substantially reduced compared with bardoxolone methyl. Oral and intravitreal administration of RS9 ameliorated the pathological scores and leakage in the models of retinopathy in rats and ocular inflammation in rabbits respectively. Conclusion and Implications Nrf2 activators are applicable for treating ocular diseases and novel Nrf2 activators have potential as a unique method for prevention and treatment of retinovascular disease. PMID:25363737

  20. Nrf2: friend or foe for chemoprevention?

    PubMed Central

    Kensler, Thomas W.; Wakabayashi, Nobunao

    2010-01-01

    Health reflects the ability of an organism to adapt to stress. Stresses—metabolic, proteotoxic, mitotic, oxidative and DNA-damage stresses—not only contribute to the etiology of cancer and other chronic degenerative diseases but are also hallmarks of the cancer phenotype. Activation of the Kelch-like ECH-associated protein 1 (KEAP1)–NF-E2-related factor 2 (NRF2)-signaling pathway is an adaptive response to environmental and endogenous stresses and serves to render animals resistant to chemical carcinogenesis and other forms of toxicity, whilst disruption of the pathway exacerbates these outcomes. This pathway can be induced by thiol-reactive small molecules that demonstrate protective efficacy in preclinical chemoprevention models and in clinical trials. However, mutations and epigenetic modifications affecting the regulation and fate of NRF2 can lead to constitutive dominant hyperactivation of signaling that preserves rather than attenuates cancer phenotypes by providing selective resistance to stresses. This review provides a synopsis of KEAP1–NRF2 signaling, compares the impact of genetic versus pharmacologic activation and considers both the attributes and concerns of targeting the pathway in chemoprevention. PMID:19793802

  1. Keap1-Nrf2 Activation in the Presence and Absence of DJ-1

    PubMed Central

    Gan, Li; Johnson, Delinda A.; Johnson, Jeffrey A.

    2012-01-01

    The molecular mechanisms leading to neurodegeneration in Parkinson’s disease remain elusive. Deletion and mutations of DJ-1 (PARK7) have been reported to cause autosomal recessive familial Parkinson’s disease. Wildtype DJ-1 scavenges H2O2 by cysteine oxidation in response to oxidative stress, and thus confers neuroprotection. Activation of the transcription factor NF-E2 related factor-2 (Nrf2) has also been shown to be important for protection against oxidative stress in many models of neurodegenerative diseases. Previous data indicate that DJ-1 affects the transcriptional functions and stability of Nrf2. However, this observation has not been confirmed. In the current study, the role of DJ-1 in the regulation of Nrf2 is examined in primary cultured neurons, astrocytes and in vivo. The prototypical Nrf2 activator, tBHQ, protected primary cortical neurons derived from DJ-1 knockout (KO) as well as DJ-1 wildtype mice by activation of Nrf2-ARE pathway. Nrf2 nuclear translocation, robust increases of canonical Nrf2-driven genes and proteins, and dramatic activation of the ARE reporter gene, hPAP, were observed after tBHQ treatment. These results were further confirmed by siRNA mediated DJ-1 knockdown in primary cortical astrocytes from ARE-hPAP mice and tBHQ administration into the striatum of mouse brain. In addition, over-expression of Nrf2 with adenovirus preferentially in astrocytes from DJ-1 KO mice enhanced survival of neurons under oxidative insults. These findings indicate that activation of the Nrf2-ARE pathway is independent of DJ-1, and Nrf2 activation is a potential therapeutic target to prevent neurodegeneration in sporadic and DJ-1 familial Parkinson’s disease. PMID:20377612

  2. The Relevance of Nrf2 Pathway and Autophagy in Pancreatic Cancer Cells upon Stimulation of Reactive Oxygen Species

    PubMed Central

    2016-01-01

    Nrf2 (NF-E2-related factor 2) pathway and autophagy both can respond to oxidative stress to promote cancer cells to survive in the tumor microenvironment. We, therefore, explored the relevance between Nrf2 pathway and autophagy in pancreatic cancer cells upon stimulation of reactive oxygen species (ROS). Pancreatic cancer cells were cultured under controlled ROS stressing condition or basal condition. Different inhibitors were used to prevent autophagy at particular stages. Nrf2 siRNA was used to inhibit Nrf2 pathway activation. Ad-mRFP-GFP-LC3 infection was used to monitor autophagic flux. The result shows that a small amount of exogenous hydrogen peroxide (H2O2) can significantly improve the level of intracellular ROS. Moreover, our findings indicate that ROS promotes the activation of both Nrf2 pathway and autophagy in pancreatic cancer cells. Moreover, our data demonstrate that suppression of autophagic activity at particular stages results in an increased promotion of Nrf2 pathway activation upon ROS stimulation. Furthermore, we found that silencing of Nrf2 promotes autophagy upon ROS stimulation. In addition, Nrf2 interference effectively promotes autophagic flux upon ROS stimulation. In summary, our findings suggest that Nrf2 pathway and autophagy have a negative interaction with each other upon ROS stimulation. PMID:26682003

  3. [Recent advances in the study of Nrf2 and inflammatory respiratory diseases].

    PubMed

    Xie, Jian-lin; Lin, Ming-bao; Hou, Qi

    2015-09-01

    Nuclear factor-erythroid 2 related factor 2 (Nrf2) is an ubiquitous and important transcription factor. It regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. A large body of research showed that Nrf2-Keap1 (Kelch-like ECH-associated protein 1, Keap 1)-ARE signaling pathway is involved in the endogenous antioxidant defense mechanisms. Nrf2 increases the expression of a number of cytoprotective genes, protects cells and tissues from the injury of a variety of toxicants and carcinogens. As a result, Nrf2 enhances the expression of glutathione and antioxidants such as superoxide dismutase and glutathione S-transferase, and subsequently scavenging free radicals. Air pollution especially from PM2.5 particles, is associated with an increasing morbidity of inflammatory pulmonary diseases and their deterioration. More and more studies demonstrated that Nrf2 was a novel signaling molecule in the modulation of inflammatory responses in these inflammatory respiratory diseases, such as asthma, acute lung injury (ALI) and COPD. Therefore, Nrf2 targeting might be a therapeutic target, which will provide clinical benefit by reducing both oxidative stress and inflammation in asthma, acute lung injury (ALI) and COPD. This review focused on the relationship between Nrf2 and inflammatory respiratory diseases and oxidative stress. PMID:26757542

  4. Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver

    SciTech Connect

    Klaassen, Curtis D.; Reisman, Scott A.

    2010-04-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that positively regulates the basal and inducible expression of a large battery of cytoprotective genes. These gene products include proteins that catalyze reduction reactions (NAD(P)H:quinone oxidoreductase 1, Nqo1), conjugation reactions (glutathione-S-transferases, Gsts and UDP-glucuronosyltransferases, Ugts), as well as the efflux of potentially toxic xenobiotics and xenobiotic conjugates (multidrug resistance-associated proteins, Mrps). The significance of Nrf2 in the liver has been established, as livers of Nrf2-null mice are more susceptible to various oxidative/electrophilic stress-induced pathologies than wild-type mice. In contrast, both pharmacological and genetic models of hepatic Nrf2 activation are protective against oxidative/electrophilic stress. Furthermore, because certain Nrf2-target genes in the liver could affect the distribution, metabolism, and excretion of xenobiotics, the effects of Nrf2 on the kinetics of drugs and other xenobiotics should also be considered, with a special emphasis on metabolism and excretion. Therefore, this review highlights the research that has contributed to the understanding of the importance of Nrf2 in toxicodynamics and toxicokinetics, especially that which pertains to the liver.

  5. The role of nuclear factor E2-Related factor 2 and uncoupling protein 2 in glutathione metabolism: Evidence from an in vivo gene knockout study.

    PubMed

    Chen, Yanyan; Xu, Yuanyuan; Zheng, Hongzhi; Fu, Jingqi; Hou, Yongyong; Wang, Huihui; Zhang, Qiang; Yamamoto, Masayuki; Pi, Jingbo

    2016-09-01

    Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. PMID:27453341

  6. Nuclear factor-E2-related factor 2 is a major determinant of bile acid homeostasis in the liver and intestine

    PubMed Central

    Weerachayaphorn, Jittima; Mennone, Albert; Soroka, Carol J.; Harry, Kathy; Hagey, Lee R.; Kensler, Thomas W.

    2012-01-01

    The transcription factor nuclear factor-E2-related factor 2 (Nrf2) is a key regulator for induction of hepatic detoxification and antioxidant mechanisms, as well as for certain hepatobiliary transporters. To examine the role of Nrf2 in bile acid homeostasis and cholestasis, we assessed the determinants of bile secretion and bile acid synthesis and transport before and after bile duct ligation (BDL) in Nrf2−/− mice. Our findings indicate reduced rates of biliary bile acid and GSH excretion, higher levels of intrahepatic bile acids, and decreased expression of regulators of bile acid synthesis, Cyp7a1 and Cyp8b1, in Nrf2−/− compared with wild-type control mice. The mRNA expression of the bile acid transporters bile salt export pump (Bsep) and organic solute transporter (Ostα) were increased in the face of impaired expression of the multidrug resistance-associated proteins Mrp3 and Mrp4. Deletion of Nrf2 also decreased ileal apical sodium-dependent bile acid transporter (Asbt) expression, leading to reduced bile acid reabsorption and increased loss of bile acid in feces. Finally, when cholestasis is induced by BDL, liver injury was not different from that in wild-type BDL mice. These Nrf2−/− mice also had increased pregnane X receptor (Pxr) and Cyp3a11 mRNA expression in association with enhanced hepatic bile acid hydroxylation. In conclusion, this study finds that Nrf2 plays a major role in the regulation of bile acid homeostasis in the liver and intestine. Deletion of Nrf2 results in a cholestatic phenotype but does not augment liver injury following BDL. PMID:22345550

  7. Effects of Nrf2 Deficiency on Bone Microarchitecture in an Experimental Model of Osteoporosis

    PubMed Central

    Ibáñez, Lidia; Ferrándiz, María Luisa; Brines, Rita; Alcaraz, Maria José

    2014-01-01

    Objective. Redox imbalance contributes to bone fragility. We have evaluated the in vivo role of nuclear factor erythroid derived 2-related factor-2 (Nrf2), an important regulator of cellular responses to oxidative stress, in bone metabolism using a model of postmenopausal osteoporosis. Methods. Ovariectomy was performed in both wild-type and mice deficient in Nrf2 (Nrf2−/−). Bone microarchitecture was analyzed by μCT. Serum markers of bone metabolism were also measured. Reactive oxygen species production was determined using dihydrorhodamine 123. Results. Sham-operated or ovariectomized Nrf2−/− mice exhibit a loss in trabecular bone mineral density in femur, accompanied by a reduction in cortical area in vertebrae. Nrf2 deficiency tended to increase osteoblastic markers and significantly enhanced osteoclastic markers in sham-operated animals indicating an increased bone turnover with a main effect on bone resorption. We have also shown an increased production of oxidative stress in bone marrow-derived cells from sham-operated or ovariectomized Nrf2−/− mice and a higher responsiveness of bone marrow-derived cells to osteoclastogenic stimuli in vitro. Conclusion. We have demonstrated in vivo a key role of Nrf2 in the maintenance of bone microarchitecture. PMID:25120886

  8. Altered behavioral development in Nrf2 knockout mice following early postnatal exposure to valproic acid

    PubMed Central

    Furnari, Melody A.; Saw, Constance Lay-Lay; Kong, Ah-Ng; Wagner, George C

    2015-01-01

    Early exposure to valproic acid results in autism-like neural and behavioral deficits in humans and other animals through oxidative stress-induced neural damage. In the present study, valproic acid was administered to genetically altered mice lacking the Nrf2 (nuclear factor-erythroid 2 related factor 2) gene on postnatal day 14 (P14). Nrf2 is a transcription factor that induces genes that protect against oxidative stress. It was found that valproic acid-treated Nrf2 knockout mice were less active in open field activity chambers, less successful on the rotorod, and had deficits in learning and memory in the Morris water maze compared to the valproic acid-treated wild type mice. Given these results, it appears that Nrf2 knockout mice were more sensitive to the neural damage caused by valproic acid administered during early development. PMID:25454122

  9. Nutritional strategies to modulate inflammation and oxidative stress pathways via activation of the master antioxidant switch Nrf2.

    PubMed

    Cardozo, Ludmila F M F; Pedruzzi, Liliana M; Stenvinkel, Peter; Stockler-Pinto, Milena B; Daleprane, Julio B; Leite, Maurilo; Mafra, Denise

    2013-08-01

    The nuclear factor E2-related factor 2 (Nrf2) plays an important role in cellular protection against cancer, renal, pulmonary, cardiovascular and neurodegenerative diseases where oxidative stress and inflammation are common conditions. The Nrf2 regulates the expression of detoxifying enzymes by recognizing the human Antioxidant Response Element (ARE) binding site and it can regulate antioxidant and anti-inflammatory cellular responses, playing an important protective role on the development of the diseases. Studies designed to investigate how effective Nrf2 activators or modulators are need to be initiated. Several recent studies have shown that nutritional compounds can modulate the activation of Nrf2-Keap1 system. This review aims to discuss some of the key nutritional compounds that promote the activation of Nrf2, which may have impact on the human health. PMID:23643732

  10. Nrf2 in ischemic neurons promotes retinal vascular regeneration through regulation of semaphorin 6A

    PubMed Central

    Wei, Yanhong; Gong, Junsong; Xu, Zhenhua; Thimmulappa, Rajesh K.; Mitchell, Katherine L.; Welsbie, Derek S.; Biswal, Shyam; Duh, Elia J.

    2015-01-01

    Delayed revascularization of ischemic neural tissue is a major impediment to preservation of function in central nervous system (CNS) diseases including stroke and ischemic retinopathies. Therapeutic strategies allowing rapid revascularization are greatly needed to reduce ischemia-induced cellular damage and suppress harmful pathologic neovascularization. However, key mechanisms governing vascular recovery in ischemic CNS, including regulatory molecules governing the transition from tissue injury to tissue repair, are largely unknown. NF-E2-related factor 2 (Nrf2) is a major stress-response transcription factor well known for its cell-intrinsic cytoprotective function. However, its role in cell–cell crosstalk is less appreciated. Here we report that Nrf2 is highly activated in ischemic retina and promotes revascularization by modulating neurons in their paracrine regulation of endothelial cells. Global Nrf2 deficiency strongly suppresses retinal revascularization and increases pathologic neovascularization in a mouse model of ischemic retinopathy. Conditional knockout studies demonstrate a major role for neuronal Nrf2 in vascular regrowth into avascular retina. Deletion of neuronal Nrf2 results in semaphorin 6A (Sema6A) induction in hypoxic/ischemic retinal ganglion cells in a hypoxia-inducible factor-1 alpha (HIF-1α)-dependent fashion. Sema6A expression increases in avascular inner retina and colocalizes with Nrf2 in human fetal eyes. Extracellular Sema6A leads to dose-dependent suppression of the migratory phenotype of endothelial cells through activation of Notch signaling. Lentiviral-mediated delivery of Sema6A small hairpin RNA (shRNA) abrogates the defective retinal revascularization in Nrf2-deficient mice. Importantly, pharmacologic Nrf2 activation promotes reparative angiogenesis and suppresses pathologic neovascularization. Our findings reveal a unique function of Nrf2 in reprogramming ischemic tissue toward neurovascular repair via Sema6A regulation

  11. Ferrous Iron Induces Nrf2 Expression in Mouse Brain Astrocytes to Prevent Neurotoxicity.

    PubMed

    Cui, Zhenwen; Zhong, Zhihong; Yang, Yong; Wang, Baofeng; Sun, Yuhao; Sun, Qingfang; Yang, Guo-Yuan; Bian, Liuguan

    2016-08-01

    Free radical damage caused by ferrous iron is involved in the pathogenesis of secondary brain injury after intracerebral hemorrhage (ICH). NF-E2-related factor 2 (Nrf2), a major phase II gene regulator that binds to antioxidant response element, represents an important cellular cytoprotective mechanism against oxidative damage. We hypothesized that Nrf2 might protect astrocytes from damage by Fe(2+) . Therefore, we examined cytotoxicity in primary astrocytes induced by iron overload and evaluated the effects of Fe(2+) on Nrf2 expression. The results demonstrated that 24-h Fe(2+) exposure exerted time- and concentration-dependent cytotoxicity in astrocytes. Furthermore, Fe(2+) exposure in astrocytes resulted in time- and concentration-dependent increases in Nrf2 expression, which preceded Fe(2+) toxicity. Nrf2-specific siRNA further knocked down Nrf2 levels, resulting in greater Fe(2+) -induced astrocyte cytotoxicity. These data indicate that induction of Nrf2 expression could serve as an adaptive self-defense mechanism, although it is insufficient to completely protect primary astrocytes from Fe(2+) -induced neurotoxicity. PMID:27037625

  12. Fumarate hydratase inactivation in renal tumors: HIF1α, NRF2, and "cryptic targets" of transcription factors.

    PubMed

    Ooi, Aikseng; Furge, Kyle A

    2012-09-01

    Biallelic inactivation of fumarate hydratase(FH) causes type 2 papillary renal cell carcinoma (PRCC2), uterine fibroids, and cutaneous leimyomas, a condition known as hereditary leiomyomatosis and renal cell cancer(HLRCC). The most direct effect of FH inactivation is intracellular fumarate accumulation. A majority of studies on FH inactivation over the past decade have focused on the theory that intracellular fumarate stabilizes hypoxia-inducible factor 1α(HIF1A) through competitive inhibition of HIF prolyl hydroxylases. Recently, a competing theory that intracellular fumarate activates nuclear factor (erythroid-derived 2)-like 2(NRF2) through post-translational modification of its negative regulator. Kelch-like ECH-associated protein 1(KEAP1) has emerged from a computational modeling study and mouse model studies. This review dissects the origin of these two governing theories and highlights the presence of chromatin-structure-regulated targets of transcription factors, which we refer to as "cryptic targets" of transcription factors. One such cryptic target is heme oxygenase I(HMOX1), the expression of which is known to be modulated by the gene product of SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily a, member 4 (SMARCA4, also known as BRG1). PMID:22776233

  13. Activated AMPK boosts the Nrf2/HO-1 signaling axis—A role for the unfolded protein response

    PubMed Central

    Zimmermann, Kristin; Baldinger, Johannes; Mayerhofer, Barbara; Atanasov, Atanas G.; Dirsch, Verena M.; Heiss, Elke H.

    2015-01-01

    In light of the emerging interplay between redox and metabolic signaling pathways we investigated the potential cross talk between nuclear factor E2-related factor 2 (Nrf2) and AMP-activated kinase (AMPK), central regulators of the cellular redox and energy balance, respectively. Making use of xanthohumol (XN) as an activator of both the AMPK and the Nrf2 signaling pathway we show that AMPK exerts a positive influence on Nrf2/heme oxygenase (HO)-1 signaling in mouse embryonic fibroblasts. Genetic ablation and pharmacological inhibition of AMPK blunts Nrf2-dependent HO-1 expression by XN already at the mRNA level. XN leads to AMPK activation via interference with mitochondrial function and activation of liver kinase B1 as upstream AMPK kinase. The subsequent AMPK-mediated enhancement of the Nrf2/HO-1 response does not depend on inhibition of the mammalian target of rapamycin, inhibition of glycogen synthase kinase 3β, or altered abundance of Nrf2 (total and nuclear). However, reduced endoplasmic reticulum stress was identified and elaborated as a step in the AMPK-augmented Nrf2/HO-1 response. Overall, we shed more light on the hitherto incompletely understood cross talk between the LKB1/AMPK and the Nrf2/HO-1 axis revealing for the first time involvement of the unfolded protein response as an additional player and suggesting tight cooperation between signaling pathways controlling cellular redox, energy, or protein homeostasis. PMID:25843659

  14. Gestational diabetes mellitus impairs Nrf2-mediated adaptive antioxidant defenses and redox signaling in fetal endothelial cells in utero.

    PubMed

    Cheng, Xinghua; Chapple, Sarah J; Patel, Bijal; Puszyk, William; Sugden, David; Yin, Xiaoke; Mayr, Manuel; Siow, Richard C M; Mann, Giovanni E

    2013-12-01

    In utero exposure to gestational diabetes mellitus (GDM) is associated with an increased risk of type 2 diabetes and cardiovascular disease in later life, yet the underlying mechanisms remain to be elucidated. We examined the effects of GDM on the proteome, redox status, and nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidant gene expression in human fetal endothelial cells. Proteomic analysis revealed that proteins involved in redox homeostasis were significantly altered in GDM and associated with increased mitochondrial superoxide generation, protein oxidation, DNA damage, and diminished glutathione (GSH) synthesis. In GDM cells, the lipid peroxidation product 4-hydroxynonenal (HNE) failed to induce nuclear Nrf2 accumulation and mRNA and/or protein expression of Nrf2 and its target genes NAD(P)H:quinone oxidoreductase 1 (NQO1), Bach1, cystine/glutamate transporter, and glutamate cysteine ligase. Although methylation of CpG islands in Nrf2 or NQO1 promoters was unaltered by GDM, decreased DJ-1 and increased phosphorylated glycogen synthase kinase 3β levels may account for impaired Nrf2 signaling. HNE-induced increases in GSH and NQO1 levels were abrogated by Nrf2 small interfering RNA in normal cells, and overexpression of Nrf2 in GDM cells partially restored NQO1 induction. Dysregulation of Nrf2 in fetal endothelium may contribute to the increased risk of type 2 diabetes and cardiovascular disease in offspring. PMID:23974919

  15. Structural and Functional Characterization of Nrf2 Degradation by the Glycogen Synthase Kinase 3/β-TrCP Axis

    PubMed Central

    Rada, Patricia; Rojo, Ana I.; Evrard-Todeschi, Nathalie; Innamorato, Nadia G.; Cotte, Axelle; Jaworski, Tomasz; Tobón-Velasco, Julio C.; Devijver, Herman; García-Mayoral, María Flor; Van Leuven, Fred; Hayes, John D.

    2012-01-01

    The transcription factor NF-E2-related factor 2 (Nrf2) is a master regulator of a genetic program, termed the phase 2 response, that controls redox homeostasis and participates in multiple aspects of physiology and pathology. Nrf2 protein stability is regulated by two E3 ubiquitin ligase adaptors, Keap1 and β-TrCP, the latter of which was only recently reported. Here, two-dimensional (2D) gel electrophoresis and site-directed mutagenesis allowed us to identify two serines of Nrf2 that are phosphorylated by glycogen synthase kinase 3β (GSK-3β) in the sequence DSGISL. Nuclear magnetic resonance studies defined key residues of this phosphosequence involved in docking to the WD40 propeller of β-TrCP, through electrostatic and hydrophobic interactions. We also identified three arginine residues of β-TrCP that participate in Nrf2 docking. Intraperitoneal injection of the GSK-3 inhibitor SB216763 led to increased Nrf2 and heme oxygenase-1 levels in liver and hippocampus. Moreover, mice with hippocampal absence of GSK-3β exhibited increased levels of Nrf2 and phase 2 gene products, reduced glutathione, and decreased levels of carbonylated proteins and malondialdehyde. This study establishes the structural parameters of the interaction of Nrf2 with the GSK-3/β-TrCP axis and its functional relevance in the regulation of Nrf2 by the signaling pathways that impinge on GSK-3. PMID:22751928

  16. Activation of the Nrf2 Pathway by Inorganic Arsenic in Human Hepatocytes and the Role of Transcriptional Repressor Bach1

    PubMed Central

    Liu, Dan; Duan, Xiaoxu; Dong, Dandan; Bai, Caijun; Li, Xin; Sun, Guifan; Li, Bing

    2013-01-01

    Previous studies have proved that the environmental toxicant, inorganic arsenic, activates nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in many different cell types. This study tried to explore the hepatic Nrf2 pathway upon arsenic treatment comprehensively, since liver is one of the major target organs of arsenical toxicity. Our results showed that inorganic arsenic significantly induced Nrf2 protein and mRNA expression in Chang human hepatocytes. We also observed a dose-dependent increase of antioxidant response element- (ARE-) luciferase activity. Both the mRNA and protein levels of NAD(P)H:quinone oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1) were all upregulated dramatically. On the other hand, entry and accumulation of Nrf2 protein in the nucleus, while exportting the transcriptional repressor BTB and CNC homology 1 (Bach1) from nucleus to cytoplasm, were also confirmed by western blot and immunofluorescence assay. Our results therefore confirmed the arsenic-induced Nrf2 pathway activation in hepatocytes and also suggested that the translocation of Bach1 was associated with the regulation of Nrf2 pathway by arsenic. Hepatic Nrf2 pathway plays indispensable roles for cellular defenses against arsenic hepatotoxicity, and the interplay of Bach1 and Nrf2 may be helpful to understand the self-defensive responses and the diverse biological effects of arsenicals. PMID:23738048

  17. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    SciTech Connect

    Han, Jae Yun; Cho, Seung Sik; Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho; Park, Da Eon; Bang, Joon Seok; Jung, Young Suk; Ki, Sung Hwan

    2015-08-15

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  18. Over-expression of Nrf2 diminishes ethanol-induced oxidative stress and apoptosis in neural crest cells by inducing an antioxidant response

    PubMed Central

    Chen, Xiaopan; Liu, Jie; Chen, Shao-yu

    2013-01-01

    Nuclear factor erythroid 2-related factor (Nrf2) is a key transcription factor that regulates antioxidant defense in cells. In this study, we investigated whether over-expression of Nrf2 can prevent ethanol-induced oxidative stress and apoptosis in neural crest cells (NCCs). We found that transfection of NCCs with pcDNA3.1-Nrf2 resulted in statistically significant increases in the Nrf2 protein levels in control and ethanol-exposed NCCs as compared to the cells transfected with control vector. Luciferase reporter gene assay revealed that over-expression of Nrf2 significantly increased the antioxidant response element (ARE) promoter activity in NCCs. Nrf2 over-expression also increased the protein expression and activities of Nrf2 target antioxidants in NCCs. In addition, over-expression of Nrf2 significantly decreased ROS generation and diminished apoptosis in ethanol-exposed NCCs. These results demonstrate that over-expression of Nrf2 can confer protection against ethanol-induced oxidative stress and apoptosis in NCCs by the induction of an antioxidant response. PMID:23994065

  19. Oxidative Stress and the Nrf2 Anti-Oxidant Transcription Factor in Age-Related Macular Degeneration.

    PubMed

    Lambros, Mandy L; Plafker, Scott M

    2016-01-01

    Age-related macular degeneration (AMD) is the leading cause of acquired and irreversible blindness among elderly Americans. Most AMD patients have the dry form of the disease (dAMD) for which reliable therapies are lacking. A major obstacle to the development of effective treatments is a deficit in our understanding of what triggers dAMD onset. This is particularly the case with respect to the events that cause retinal pigment epithelial (RPE) cells to transition from a state of health and homeostasis to one of dysfunction and atrophy. These cells provide critical support to the photoreceptors and their atrophy often precipitates photoreceptor death in dAMD. Chronic oxidative stress is a primary driver of age-dependent, RPE atrophy. Sources of this stress have been identified (e.g., cigarette smoke, photooxidized bisretinoids), but we still do not understand how these stressors damage RPE constituents or what age-dependent changes undermine the cytoprotective systems in the RPE. This review focuses on Nrf2, the master antioxidant transcription factor, and its role in the RPE during aging and dAMD onset. PMID:26427395

  20. Nrf2-related gene expression and exposure to traffic-related air pollution in elderly subjects with cardiovascular disease: An exploratory panel study.

    PubMed

    Wittkopp, Sharine; Staimer, Norbert; Tjoa, Thomas; Stinchcombe, Timothy; Daher, Nancy; Schauer, James J; Shafer, Martin M; Sioutas, Constantinos; Gillen, Daniel L; Delfino, Ralph J

    2016-01-01

    Gene expression changes are linked to air pollutant exposures in in vitro and animal experiments. However, limited data are available on how these outcomes relate to ambient air pollutant exposures in humans. We performed an exploratory analysis testing whether gene expression levels were associated with air pollution exposures in a Los Angeles area cohort of elderly subjects with coronary artery disease. Candidate genes (35) were selected from published studies of gene expression-pollutant associations. Expression levels were measured weekly in 43 subjects (≤ 12 weeks) using quantitative PCR. Exposures included gaseous pollutants O3, nitrogen oxides (NOx), and CO; particulate matter (PM) pollutants elemental and black carbon (EC, BC); and size-fractionated PM mass. We measured organic compounds from PM filter extracts, including polycyclic aromatic hydrocarbons (PAHs), and determined the in vitro oxidative potential of particle extracts. Associations between exposures and gene expression levels were analyzed using mixed-effects regression models. We found positive associations of traffic-related pollutants (EC, BC, primary organic carbon, PM 0.25-2.5 PAH and/or PM 0.25 PAH, and NOx) with NFE2L2, Nrf2-mediated genes (HMOX1, NQO1, and SOD2), CYP1B1, IL1B, and SELP. Findings suggest that NFE2L2 gene expression links associations of traffic-related air pollution with phase I and II enzyme genes at the promoter transcription level. PMID:25564368

  1. Nrf2-related gene expression and exposure to traffic-related air pollution in elderly subjects with cardiovascular disease: An exploratory panel study

    PubMed Central

    Wittkopp, Sharine; Staimer, Norbert; Tjoa, Thomas; Stinchcombe, Timothy; Daher, Nancy; Schauer, James J.; Shafer, Martin M.; Sioutas, Constantinos; Gillen, Daniel L.; Delfino, Ralph J.

    2015-01-01

    Gene expression changes are linked to air pollutant exposures in in vitro and animal experiments. However, limited data are available on how these outcomes relate to ambient air pollutant exposures in humans. We performed an exploratory analysis testing whether gene expression levels were associated with air pollution exposures in a Los Angeles area cohort of elderly subjects with coronary artery disease. Candidate genes (35) were selected from published studies of gene expression-pollutant associations. Expression levels were measured weekly in 43 subjects (≤12 weeks) using quantitative PCR. Exposures included gaseous pollutants O3, nitrogen oxides (NOx), and CO; particulate matter (PM) pollutants elemental and black carbon (EC, BC); and size-fractionated PM mass. We measured organic compounds from PM filter extracts, including polycyclic aromatic hydrocarbons (PAHs), and determined the in vitro oxidative potential of particle extracts. Associations between exposures and gene expression levels were analyzed using mixed-effects regression models. We found positive associations of traffic-related pollutants (EC, BC, primary organic carbon, PM0.25-2.5 PAH and/or PM0.25 PAH, and NOx) with NFE2L2, Nrf2-mediated genes (HMOX1, NQO1, and SOD2), CYP1B1, IL1B, and SELP. Findings suggest that NFE2L2 gene expression links associations of traffic-related air pollution with phase I and II enzyme genes at the promoter transcription level. PMID:25564368

  2. Nuclear Factor Erythroid 2-Related Factor 2 Down-Regulation in Oral Neutrophils Is Associated with Periodontal Oxidative Damage and Severe Chronic Periodontitis.

    PubMed

    Sima, Corneliu; Aboodi, Guy M; Lakschevitz, Flavia S; Sun, Chunxiang; Goldberg, Michael B; Glogauer, Michael

    2016-06-01

    The balance between reactive oxygen species and antioxidants plays an important role in periodontal health. We previously demonstrated that high reactive oxygen species production by oral polymorphonuclear neutrophils (oPMNs) in chronic periodontitis (CP) refractory to conventional therapy is associated with severe destruction of periodontium. Herein, we show that inhibition of antioxidant production through down-regulation of nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in oPMN, despite enhanced recruitment in the oral cavity, is associated with severe CP. Twenty-four genes in the Nrf2-mediated oxidative stress response pathway were down-regulated in PMNs of diseased patients. Downstream of Nrf2, levels of oPMN superoxide dismutase 1 and catalase were decreased in severe CP, despite increased recruitment. Nrf2(-/-) mice had more severe loss of periodontium in response to periodontitis-inducing subgingival ligatures compared with wild-types. Levels of 8-hydroxy-deoxyguanosine were increased in periodontal lesions of Nrf2(-/-) mice, indicating high oxidative damage. We report, for the first time, Nrf2 pathway down-regulation in oPMNs of patients with severe CP. PMNs of CP patients may be primed for low antioxidant response in the context of high recruitment in the oral cavity, resulting in increased oxidative tissue damage. PMID:27070823

  3. Cancer related mutations in NRF2 impair its recognition by Keap1-Cul3 E3 ligase and promote malignancy

    PubMed Central

    Shibata, Tatsuhiro; Ohta, Tsutomu; Tong, Kit I.; Kokubu, Akiko; Odogawa, Reiko; Tsuta, Koji; Asamura, Hisao; Yamamoto, Masayuki; Hirohashi, Setsuo

    2008-01-01

    The nuclear factor E2-related factor 2 (Nrf2) is a master transcriptional activator of genes encoding numerous cytoprotective enzymes that are induced in response to environmental and endogenously derived oxidative/electrophilic agents. Under normal, nonstressed circumstances, low cellular concentrations of Nrf2 are maintained by proteasomal degradation through a Keap1-Cul3-Roc1-dependent mechanism. A model for Nrf2 activation has been proposed in which two amino-terminal motifs, DLG and ETGE, promote efficient ubiquitination and rapid turnover; known as the two-site substrate recognition/hinge and latch model. Here, we show that in human cancer, somatic mutations occur in the coding region of NRF2, especially among patients with a history of smoking or suffering from squamous cell carcinoma; in the latter case, this leads to poor prognosis. These mutations specifically alter amino acids in the DLG or ETGE motifs, resulting in aberrant cellular accumulation of Nrf2. Mutant Nrf2 cells display constitutive induction of cytoprotective enzymes and drug efflux pumps, which are insensitive to Keap1-mediated regulation. Suppression of Nrf2 protein levels by siRNA knockdown sensitized cancer cells to oxidative stress and chemotherapeutic reagents. Our results strongly support the contention that constitutive Nrf2 activation affords cancer cells with undue protection from their inherently stressed microenvironment and anti-cancer treatments. Hence, inactivation of the Nrf2 pathway may represent a therapeutic strategy to reinforce current treatments for malignancy. Congruously, the present study also provides in vivo validation of the two-site substrate recognition model for Nrf2 activation by the Keap1-Cul3-based E3 ligase. PMID:18757741

  4. Methylation of arginine by PRMT1 regulates Nrf2 transcriptional activity during the antioxidative response.

    PubMed

    Liu, Xin; Li, Hongyuan; Liu, Lingxia; Lu, Yang; Gao, Yanyan; Geng, Pengyu; Li, Xiaoxue; Huang, Baiqu; Zhang, Yu; Lu, Jun

    2016-08-01

    The cap 'n' collar (CNC) family of transcription factors play important roles in resistance of oxidative and electrophilic stresses. Among the CNC family members, NF-E2-related factor 2 (Nrf2) is critical for regulating the antioxidant and phase II enzymes through antioxidant response element (ARE)-mediated transactivation. The activity of Nrf2 is controlled by a variety of post-translational modifications, including phosphorylation, ubiquitination, acetylation and sumoylation. Here we demonstrate that the arginine methyltransferase-1 (PRMT1) methylates Nrf2 protein at a single residue of arginine 437, both in vitro and in vivo. Using the heme oxygenase-1 (HO-1) as a model of phase II enzyme gene, we found that methylation of Nrf2 by PRMT1 led to a moderate increase of its DNA-binding activity and transactivation, which subsequently protected cells against the tBHP-induced glutathione depletion and cell death. Collectively, our results define a novel modification of Nrf2, which operates as a fine-tuning mechanism for the transcriptional activity of Nrf2 under the oxidative stress. PMID:27183873

  5. NRF2, a Key Regulator of Antioxidants with Two Faces towards Cancer

    PubMed Central

    2016-01-01

    While reactive oxygen species (ROS) is generally considered harmful, a relevant amount of ROS is necessary for a number of cellular functions, including the intracellular signal transduction. In order to deal with an excessive amount of ROS, organisms are equipped with a sufficient amount of antioxidants together with NF-E2-related factor-2 (NRF2), a transcription factor that plays a key role in the protection of organisms against environmental or intracellular stresses. While the NRF2 activity has been generally viewed as beneficial to preserve the integrity of organisms, recent studies have demonstrated that cancer cells hijack the NRF2 activity to survive under the oxidative stress and, therefore, a close check must be kept on the NRF2 activity in cancer. In the present review, we briefly highlight important progresses in understanding the molecular mechanism, structure, and function of KEAP1 and NRF2 interaction. In addition, we provide general perspectives that justify conflicting views on the NRF2 activity in cancer. PMID:27340506

  6. Downregulation of Nuclear Factor Erythroid 2-Related Factor and Associated Antioxidant Genes Contributes to Redox-Sensitive Vascular Dysfunction in Hypertension.

    PubMed

    Lopes, Rhéure A; Neves, Karla B; Tostes, Rita C; Montezano, Augusto C; Touyz, Rhian M

    2015-12-01

    Oxidative stress is implicated in vascular dysfunction in hypertension. Although mechanisms regulating vascular pro-oxidants are emerging, there is a paucity of information on antioxidant systems, particularly nuclear factor erythroid 2-related factor (Nrf2), a master regulator of antioxidants enzymes. We evaluated the vascular regulatory role of Nrf2 in hypertension and examined molecular mechanisms, whereby Nrf2 influences redox signaling in small arteries and vascular smooth muscle cells from Wistar Kyoto (WKY) and stroke-prone spontaneously hypertensive rats (SHRSP). Cells were stimulated with angiotensin II in the absence/presence of Nrf2 activators (bardoxolone/L-sulforaphane). Increased vascular reactive oxygen species production (chemiluminescence and amplex red) was associated with reduced Nrf2 activity in arteries (18%) and vascular smooth muscle cells (48%) in SHRSP (P<0.05 versus WKY). Expression of antioxidant enzymes, including superoxide dismutase-1 (64%), catalase (60%), peroxiredoxin 1 (75%), and glutathione peroxidase (54%), was reduced in SHRSP. L-sulforaphane reversed these effects. Angiotensin II increased nuclear accumulation of Nrf2 in vascular smooth muscle cells from WKY (197% versus vehicle), with blunted effects in SHRSP (44% versus vehicle). These responses were associated with increased antioxidant expression (superoxide dismutase-1, 32%; catalase, 42%; thioredoxin, 71%; peroxiredoxin, 1%-90%; quinone oxidoreductase, 84%; P<0.05 versus vehicle) and increased activity of superoxide dismutase-1, catalase, and thioredoxin in WKY but not in SHRSP, which exhibited increased Bach1 expression. Nrf2 activators blocked angiotensin II-induced reactive oxygen species generation. Vascular function demonstrated increased contractility (Emax WKY 113.4±5.6 versus SHRSP 159.0±8.3) and decreased endothelial-dependent relaxation (Emax WKY 88.6±3.1 versus SHRSP 74.6±3.2, P<0.05) in SHRSP, effects corrected by L-sulforaphane. Our findings suggest that

  7. Natural Nrf2 activators in diabetes.

    PubMed

    Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; Pedraza-Chaverri, José

    2015-08-25

    Prediabetes and diabetes are rising worldwide. Control of blood glucose is crucial to prevent or delay diabetic complications that frequently result in increased morbidity and mortality. Most strategies include medical treatment and changes in lifestyle and diet. Some nutraceutical compounds have been recognized as adjuvants in diabetes control. Many of them can activate the nuclear factor (erythroid-derived 2)-like 2 (Nrf2), which has been recognized as a master regulator of the antioxidant response. Recent studies have described the role of Nrf2 in obesity, metabolic syndrome, nephropathy, retinopathy and neuropathy, where its activation prevents the development of diabetes and its complications. It has been demonstrated that natural compounds derived from plants, vegetables, fungi and micronutrients (such as curcumin, sulforaphane, resveratrol and vitamin D among others) can activate Nrf2 and, thus, promote antioxidant pathways to mitigate oxidative stress and hyperglycemic damage. The role of some natural Nrf2 activators and its effect in diabetes is discussed. PMID:26165427

  8. Wogonin reverses multi-drug resistance of human myelogenous leukemia K562/A02 cells via downregulation of MRP1 expression by inhibiting Nrf2/ARE signaling pathway.

    PubMed

    Xu, Xuefen; Zhang, Yi; Li, Wei; Miao, Hanchi; Zhang, Haiwei; Zhou, Yuxin; Li, Zhiyu; You, Qidong; Zhao, Li; Guo, Qinglong

    2014-11-15

    Constitutive NF-E2-related factor 2 (Nrf2) activation has been recently reported to play a pivotal role in enhancing cell survival and resistance to anticancer drugs in many tumors. Previously, much effort has been devoted to the investigation of blocking Nrf2 function in cultured cells and cancer tissues, but few researches have been undertaken to evaluate the precise mechanism of flavonoids-induced sensitivity by inhibiting Nrf2. In this study, we investigated the reversal effect of Wogonin, a flavonoid isolated from the root of Scutellaria baicalensis Georgi, in resistant human myelogenous leukemia. Data indicated that Wogonin had strong reversal potency by inhibiting functional activity and expression of MRP1 at both protein and mRNA in adriamycin (ADR)-induced resistant human myelogenous leukemia K562/A02 cells. Consequently, the inhibition of MRP1 by Wogonin was dependent on Nrf2 through the decreased binding ability of Nrf2 to antioxidant response element (ARE). Further research revealed Wogonin modulated Nrf2 through the reduction of Nrf2mRNA at transcriptional processes rather than RNA degradation, which is regulated by the PI3K/Akt pathway. Moreover, DNA-PKcs was found to be involved in the Wogonin-induced downregulation of Nrf2 mRNA at transcriptional levels. In summary, these results clearly demonstrated the effectiveness of using Wogonin via inhibiting Nrf2 to combat chemoresistance and suggested that Wogonin can be developed into an efficient natural sensitizer for resistant human myelogenous leukemia. PMID:25264278

  9. Roles of Nrf2 in cell proliferation and differentiation.

    PubMed

    Murakami, Shohei; Motohashi, Hozumi

    2015-11-01

    The Keap1-Nrf2 system plays pivotal roles in defense mechanisms by regulating cellular redox homeostasis. Nrf2 is an inducible transcription factor that activates a battery of genes encoding antioxidant proteins and phase II enzymes in response to oxidative stress and electrophilic xenobiotics. The activity of Nrf2 is regulated by Keap1, which promotes the ubiquitination and subsequent degradation of Nrf2 under normal conditions and releases the inhibited Nrf2 activity upon exposure to the stresses. Though an impressive contribution of the Keap1-Nrf2 system to the protection from exogenous and endogenous electrophilic insults has been well established, a line of evidence has suggested that the Keap1-Nrf2 system has various novel functions, particularly in cell proliferation and differentiation. Because the proliferation and differentiation of diverse cell types are often influenced and modulated by the cellular redox balance, Nrf2 has been considered to control these cellular processes by regulating the cellular levels of reactive oxygen species (ROS). In addition, analyses of the genome-wide distribution of Nrf2 have identified new sets of Nrf2 target genes whose products are involved in cell proliferation and differentiation but not necessarily in the regulation of oxidative stress. Considering the most characteristic features of Nrf2 as an inducible transcription factor, a newly emerged concept proposes that the Keap1-Nrf2 system translates environmental stresses into regulatory network signals in cell fate determination. In this review, we introduce the contribution of Nrf2 to lineage-specific differentiation, maintenance and differentiation of stem cells, and proliferation of normal and cancer cells, and we discuss how the response to fluctuating environments modulates cell behavior through the Keap1-Nrf2 system. PMID:26119783

  10. Nrf2 induces cisplatin resistance through activation of autophagy in ovarian carcinoma

    PubMed Central

    Bao, Ling-Jie; Jaramillo, Melba C; Zhang, Zhen-Bo; Zheng, Yun-Xi; Yao, Ming; Zhang, Donna D; Yi, Xiao-Fang

    2014-01-01

    Cisplatin resistance is a major problem affecting ovarian carcinoma treatment. NF-E2-related factor 2 (Nrf2), a nuclear transcription factor, plays an important role in chemotherapy resistance. However, the underlying mechanism by which Nrf2 mediates cisplatin chemoresistance is unclear. Methods: The human ovarian carcinoma cell line, A2780, and its cisplatin-resistant variant, A2780cp were cultivated. Cell viability was determined with WST-8 assay. Western blot was applied to detect the expression of Nrf2, Nrf2 target genes, and autophagy-related proteins. RNA interference was used to knock down target genes. Annexin V and propidium iodide (PI) staining was utilized to quantify apoptosis. The ultrastructural analysis of autophagosomes was performed by transmission electron microscopy (TEM). Results: Nrf2 and its targeting genes, NQO1 and HO-1, are overexpressed in A2780cp cells compared with A2780 cells. Knocking down Nrf2 sensitized A2780cp cells to cisplatin treatment and decreased autophagy-related genes, Atg3, Atg6, Atg12 and p62 in both mRNA and protein levels. Furthermore, we demonstrated that in both cell lines cisplatin could induce the formation of autophagosomes and upregulate the expression of autophagy-related genes Atg3, Atg6 and Atg12. Treatment with an autophagy inhibitor, 3-Methyladenine (3-MA), or beclin 1 siRNA enhanced cisplatin-induced cell death in A2780cp cells, suggesting that inhibition of autophagy renders resistant cells to be more sensitive to cisplatin. Taken together, Nrf2 signaling may regulate cisplatin resistance by activating autophagy. Conclusions: Nrf2-activated autophagy may function as a novel mechanism causing cisplatin-resistance. PMID:24817946

  11. The Nrf2-antioxidant response element pathway: a target for regulating energy metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that responds to oxidative stress by binding to the antioxidant response element (ARE) in the promoter of genes coding for antioxidant enzymes like NAD(P)H:quinone oxidoreductase 1 (NQO1) and proteins for glutathione synthesis. ...

  12. Escin activates AKT-Nrf2 signaling to protect retinal pigment epithelium cells from oxidative stress.

    PubMed

    Wang, Kaijun; Jiang, Yiqian; Wang, Wei; Ma, Jian; Chen, Min

    2015-12-25

    Here we explored the anti-oxidative and cytoprotective potentials of escin, a natural triterpene-saponin, against hydrogen peroxide (H2O2) in retinal pigment epithelium (RPE) cells. We showed that escin remarkably attenuated H2O2-induced death and apoptosis of established (ARPE-19) and primary murine RPE cells. Meanwhile, ROS production and lipid peroxidation by H2O2 were remarkably inhibited by escin. Escin treatment in RPE cells resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by transcription of anti-oxidant-responsive element (ARE)-regulated genes, including HO-1, NQO-1 and SRXN-1. Knockdown of Nrf2 through targeted shRNAs/siRNAs alleviated escin-mediated ARE gene transcription, and almost abolished escin-mediated anti-oxidant activity and RPE cytoprotection against H2O2. Reversely, escin was more potent against H2O2 damages in Nrf2-over-expressed ARPE-19 cells. Further studies showed that escin-induced Nrf2 activation in RPE cells required AKT signaling. AKT inhibitors (LY294002 and perifosine) blocked escin-induced AKT activation, and dramatically inhibited Nrf2 phosphorylation, its cytosol accumulation and nuclear translocation in RPE cells. Escin-induced RPE cytoprotection against H2O2 was also alleviated by the AKT inhibitors. Together, these results demonstrate that escin protects RPE cells from oxidative stress possibly through activating AKT-Nrf2 signaling. PMID:26505797

  13. Estrogen increases Nrf2 activity through activation of the PI3K pathway in MCF-7 breast cancer cells

    SciTech Connect

    Wu, Juanjuan; Williams, Devin; Walter, Grant A.; Thompson, Winston E.; Sidell, Neil

    2014-11-01

    The actions of the transcription factor Nuclear factor erythroid 2-related factor (Nrf2) in breast cancer have been shown to include both pro-oncogenic and anti-oncogenic activities which is influenced, at least in part, by the hormonal environment. However, direct regulation of Nrf2 by steroid hormones (estrogen and progesterone) has received only scant attention. Nrf2 is known to be regulated by its cytosolic binding protein, Kelch-like ECH-associated protein 1 (Keap1), and by a Keap1-independent mechanism involving a series of phosphorylation steps mediated by phosphatidylinositol 3-kinase (PI3K) and glycogen synthase kinase 3 beta (GSK3β). Here, we report that estrogen (E2) increases Nrf2 activity in MCF7 breast cancer cells through activation of the PI3K/GSK3β pathway. Utilizing antioxidant response element (ARE)-containing luciferase reporter constructs as read-outs for Nrf2 activity, our data indicated that E2 increased ARE activity >14-fold and enhanced the action of the Nrf2 activators, tertiary butylhydroquinone (tBHQ) and sulforaphane (Sul) 4 to 9 fold compared with cells treated with tBHQ or Sul as single agents. This activity was shown to be an estrogen receptor-mediated phenomenon and was antagonized by progesterone. In addition to its action on the reporter constructs, mRNA and protein levels of heme oxygenase 1, an endogenous target gene of Nrf2, was markedly upregulated by E2 both alone and in combination with tBHQ. Importantly, E2-induced Nrf2 activation was completely suppressed by the PI3K inhibitors LY294002 and Wortmannin while the GSK3β inhibitor CT99021 upregulated Nrf2 activity. Confirmation that E2 was, at least partly, acting through the PI3K/GSK3β pathway was indicated by our finding that E2 increased the phosphorylation status of both GSK3β and Akt, a well-characterized downstream target of PI3K. Together, these results demonstrate a novel mechanism by which E2 can regulate Nrf2 activity in estrogen receptor-positive breast cancer

  14. Sulforaphane protects against ethanol-induced oxidative stress and apoptosis in neural crest cells by the induction of Nrf2-mediated antioxidant response

    PubMed Central

    Chen, X; Liu, J; Chen, S-Y

    2013-01-01

    Background and Purpose Nuclear factor erythroid 2-related factor (Nrf2) is a transcription factor that up-regulates a diverse array of antioxidant genes and protects cells from oxidative damage. This study is designed to determine whether D-L-sulforaphane (SFN) can protect neural crest cells (NCCs), an ethanol-sensitive cell population implicated in fetal alcohol spectrum disorders, against ethanol-induced apoptosis and whether protective effects of SFN are mediated by the induction of Nrf2-mediated antioxidant response. Experimental Approach Control, SFN-treated or Nrf2-siRNA transfected NCCs were exposed to ethanol. Nrf2 activation, the expression and activities of Nrf2 downstream antioxidant proteins, reactive oxygen species generation and apoptosis were determined in control and ethanol-exposed NCCs. Key Results Exposure of NCCs to SFN alone significantly increased Nrf2 activation and the expression of Nrf2 downstream antioxidants as well as the activities of the antioxidant enzymes. Treatment of NCCs with SFN along with ethanol significantly decreased ethanol-induced oxidative stress and apoptosis. In contrast, knockdown of Nrf2 by siRNA significantly increased the sensitivity of NCCs to ethanol-induced oxidative stress and apoptosis. Suppression of Nrf2 signalling in NCCs also significantly diminished SFN-mediated antioxidant response and abolished the protective effects of SFN on ethanol-induced oxidative stress and apoptosis. Conclusions and Implications These results demonstrated that Nrf2-mediated antioxidant response plays an important role in the susceptibility of NCCs to ethanol-induced oxidative stress and apoptosis and that the protection of SFN against ethanol-induced oxidative stress and apoptosis in NCCs is mediated by the induction of Nrf2 signalling. PMID:23425096

  15. S-allyl cysteine activates the Nrf2-dependent antioxidant response and protects neurons against ischemic injury in vitro and in vivo.

    PubMed

    Shi, Huanying; Jing, Xu; Wei, Xinbing; Perez, Ruth G; Ren, Manru; Zhang, Xiumei; Lou, Haiyan

    2015-04-01

    Stroke is a devastating clinical condition for which an effective neuroprotective treatment is currently unavailable. S-allyl cysteine (SAC), the most abundant organosulfur compound in aged garlic extract, has been reported to possess neuroprotective effects against stroke. However, the mechanisms underlying its beneficial effects remain poorly defined. The present study tests the hypothesis that SAC attenuates ischemic neuronal injury by activating the nuclear factor erythroid-2-related factor 2 (Nrf2)-dependent antioxidant response in both in vitro and in vivo models. Our findings demonstrate that SAC treatment resulted in an increase in Nrf2 protein levels and subsequent activation of antioxidant response element pathway genes in primary cultured neurons and mice. Exposure of primary neurons to SAC provided protection against oxygen and glucose deprivation-induced oxidative insults. In wild-type (Nrf2(+/+) ) mice, systemic administration of SAC attenuated middle cerebral artery occlusion-induced ischemic damage, a protective effect not observed in Nrf2 knockout (Nrf2(-/-) ) mice. Taken together, these findings provide the first evidence that activation of the Nrf2 antioxidant response by SAC is strongly associated with its neuroprotective effects against experimental stroke and suggest that targeting the Nrf2 pathway may provide therapeutic benefit for the treatment of stroke. The transcription factor Nrf2 is involved in cerebral ischemic disease and may be a promising target for the treatment of stroke. We provide novel evidence that SAC confers neuroprotection against ischemic stroke by activating the antioxidant Nrf2 signaling pathway. ARE, antioxidant response element; GCLC, glutathione cysteine ligase regulatory subunit; GCLM, glutathione cysteine ligase modulatory subunit; HO-1, heme oxygenase-1; JNK, c-Jun N-terminal kinase; Keap1, Kelch-like ECH-associated protein 1; Maf, musculoaponeurotic fibrosarcoma; Nrf2, nuclear factor erythroid-2-related factor 2

  16. Electrophilic nitro-fatty acids prevent astrocyte-mediated toxicity to motor neurons in a cell model of familial amyotrophic lateral sclerosis via nuclear factor erythroid 2-related factor activation.

    PubMed

    Diaz-Amarilla, Pablo; Miquel, Ernesto; Trostchansky, Andrés; Trias, Emiliano; Ferreira, Ana M; Freeman, Bruce A; Cassina, Patricia; Barbeito, Luis; Vargas, Marcelo R; Rubbo, Homero

    2016-06-01

    Nitro-fatty acids (NO2-FA) are electrophilic signaling mediators formed in tissues during inflammation, which are able to induce pleiotropic cytoprotective and antioxidant pathways including up regulation of Nuclear factor erythroid 2-related factor 2 (Nrf2) responsive genes. Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease characterized by the loss of motor neurons associated to an inflammatory process that usually aggravates the disease progression. In ALS animal models, the activation of the transcription factor Nrf2 in astrocytes confers protection to neighboring neurons. It is currently unknown whether NO2-FA can exert protective activity in ALS through Nrf2 activation. Herein we demonstrate that nitro-arachidonic acid (NO2-AA) or nitro-oleic acid (NO2-OA) administrated to astrocytes expressing the ALS-linked hSOD1(G93A) induce antioxidant phase II enzyme expression through Nrf2 activation concomitant with increasing intracellular glutathione levels. Furthermore, treatment of hSOD1(G93A)-expressing astrocytes with NO2-FA prevented their toxicity to motor neurons. Transfection of siRNA targeted to Nrf2 mRNA supported the involvement of Nrf2 activation in NO2-FA-mediated protective effects. Our results show for the first time that NO2-FA induce a potent Nrf2-dependent antioxidant response in astrocytes capable of preventing motor neurons death in a culture model of ALS. PMID:27012417

  17. Myocardial ischemic reperfusion induces de novo Nrf2 protein translation

    PubMed Central

    Xu, Beibei; Zhang, Jack; Strom, Joshua; Lee, Sang; Chen, Qin M.

    2016-01-01

    Nrf2 is a bZIP transcription factor regulating the expression of antioxidant and detoxification genes. We have found that Nrf2 knockout mice have an increased infarction size in response to regional ischemic reperfusion and have a reduced degree of cardiac protection by means of ischemic preconditioning. With cycles of brief ischemia and reperfusion (5′I/5′R) that induce cardiac protection in wild type mice, an elevated Nrf2 protein was observed without prior increases of Nrf2 mRNA. When an mRNA species is being translated into a protein, it is occupied by multiple ribosomes. The level of ribosome-associated Nrf2 mRNA increased following cycles of 5′I/5′R, supporting de novo Nrf2 protein translation. A dicistronic reporter assay indicated a role of the 5′ untranslated region (5′ UTR) of Nrf2 mRNA in oxidative stress induced Nrf2 protein translation in isolated cardiomyocytes. Western blot analyses after isolation of proteins binding to biotinylated Nrf2 5′ UTR from the myocardium or cultured cardiomyocytes demonstrated that cycles of 5′I/5′R or oxidants caused an increased association of La protein with Nrf2 5′ UTR. Ribonucleoprotein complex immunoprecipitation assays confirmed such association indeed occurring in vivo. Knocking down La using siRNA was able to prevent Nrf2 protein elevation by oxidants in cultured cardiomyocytes and by cycles of 5′I/5′R in the myocardium. Our data point out a novel mechanism of cardiac protection by de novo Nrf2 protein translation involving interaction of La protein with 5′ UTR of Nrf2 mRNA in cardiomyocytes. PMID:24915518

  18. Suppression of basal and carbon nanotube-induced oxidative stress, inflammation and fibrosis in mouse lungs by Nrf2.

    PubMed

    Dong, Jie; Ma, Qiang

    2016-08-01

    The lungs are susceptible to oxidative damage by inhaled pathogenic agents, including multi-walled carbon nanotubes (MWCNT). The nuclear factor erythroid 2-related factor 2 (Nrf2) has been implicated in regulating the body's defense against oxidative stress. Here, we analyzed the function of Nrf2 in the lungs. Under a basal condition, Nrf2 knockout (KO) mice showed apparent pulmonary infiltration of granulocytes, macrophages and B and T lymphocytes, and elevated deposition of collagen fibers. Exposure to MWCNT (XNRI MWNT-7, Mitsui, Tokyo, Japan) by pharyngeal aspiration elicited rapid inflammatory and fibrotic responses in a dose (0, 5, 20 and 40 μg) and time (1, 3, 7 and 14 d)-dependent manner. The responses reached peak levels on day 7 post-exposure to 40 μg MWCNT, evidenced by massive inflammatory infiltration and formation of inflammatory and fibrotic foci, which were more evident in Nrf2 KO than wild-type (WT) lungs. At the molecular level, Nrf2 protein was detected at a low level under a basal condition, and was dramatically increased by MWCNT in WT, but not Nrf2 KO, lungs. Activation of Nrf2 was inversely correlated with induced expression of fibrosis marker genes and profibrotic cytokines. Furthermore, the levels of ROS and oxidative stress were remarkably higher in Nrf2 KO than WT lungs under a physiological condition, and were dramatically increased by MWCNT, with the increase significantly more striking in KO lungs. The findings reveal that Nrf2 plays an important role in suppressing the basal and MWCNT-induced oxidant production, inflammation and fibrosis in the lungs, thereby protecting against MWCNT lung toxicity. PMID:26592091

  19. A Curcumin Derivative That Inhibits Vinyl Carbamate-Induced Lung Carcinogenesis via Activation of the Nrf2 Protective Response

    PubMed Central

    Shen, Tao; Jiang, Tao; Long, Min; Chen, Jun; Ren, Dong-Mei; Wong, Pak Kin

    2015-01-01

    Abstract Aims: Lung cancer has a high worldwide morbidity and mortality. The employment of chemopreventive agents is effective to reduce lung cancer. Nuclear factor erythroid 2-related factor 2 (Nrf2) mitigates insults from both exogenous and endogenous sources and thus has been verified as a target for chemoprevention. Curcumin has long been recognized as a chemopreventive agent, but poor bioavailability and weak Nrf2 induction have prohibited clinical application. Thus, we have developed new curcumin derivatives and tested their Nrf2 induction. Results: Based on curcumin, we synthesized curcumin analogs with five carbon linkages and established a structure–activity relationship for Nrf2 induction. Among these derivatives, bis[2-hydroxybenzylidene]acetone (BHBA) was one of the most potent Nrf2 inducers with minimal toxicity and improved pharmacological properties and was thus selected for further investigation. BHBA activated the Nrf2 pathway in the canonical Keap1-Cys151-dependent manner. Furthermore, BHBA was able to protect human lung epithelial cells against sodium arsenite [As(III)]-induced cytotoxicity. More importantly, in an in vivo vinyl carbamate-induced lung cancer model in A/J mice, preadministration of BHBA significantly reduced lung adenocarcinoma, while curcumin failed to show any effects even at high doses. Innovation: The curcumin derivative, BHBA, is a potent inducer of Nrf2. It was demonstrated to protect against As(III) toxicity in lung epithelial cells in an Nrf2-dependent manner. Furthermore, compared with curcumin, BHBA displayed improved chemopreventive activities in a carcinogen-induced lung cancer model. Conclusion: Taken together, our results demonstrate that BHBA, a curcumin analog with improved Nrf2-activating and chemopreventive activities both in vitro and in vivo, could be developed into a chemoprotective pharmacological agent. Antioxid. Redox Signal. 23, 651–664. PMID:25891177

  20. Development of Neh2-luciferase reporter and its application for high throughput screening and real-time monitoring of Nrf2 activators.

    PubMed

    Smirnova, Natalya A; Haskew-Layton, Renee E; Basso, Manuela; Hushpulian, Dmitry M; Payappilly, Jimmy B; Speer, Rachel E; Ahn, Young-Hoon; Rakhman, Ilay; Cole, Philip A; Pinto, John T; Ratan, Rajiv R; Gazaryan, Irina G

    2011-06-24

    The NF-E2-related factor 2 (Nrf2) is a key transcriptional regulator of antioxidant defense and detoxification. To directly monitor stabilization of Nrf2, we fused its Neh2 domain, responsible for the interaction with its nucleocytoplasmic regulator, Keap1, to firefly luciferase (Neh2-luciferase). We show that Neh2 domain is sufficient for recognition, ubiquitination, and proteasomal degradation of Neh2-luciferase fusion protein. The Neh2-luc reporter system allows direct monitoring of the adaptive response to redox stress and classification of drugs based on the time course of reporter activation. The reporter was used to screen the Spectrum library of 2000 biologically active compounds to identify activators of Nrf2. The most robust and yet nontoxic Nrf2 activators found--nordihydroguaiaretic acid, fisetin, and gedunin--induced astrocyte-dependent neuroprotection from oxidative stress via an Nrf2-dependent mechanism. PMID:21700211

  1. Development of Neh2-Luciferase Reporter and Its Application for High Throughput Screening and Real-Time Monitoring of Nrf2 Activators

    PubMed Central

    Smirnova, Natalya A.; Haskew-Layton, Renee E.; Basso, Manuela; Hushpulian, Dmitry M.; Payappilly, Jimmy B.; Speer, Rachel E.; Ahn, Young-Hoon; Rakhman, Ilay; Cole, Philip A.; Pinto, John T.; Ratan, Rajiv R.; Gazaryan, Irina G.

    2011-01-01

    SUMMARY The NF-E2-related factor 2 (Nrf2) is a key transcriptional regulator of antioxidant defense and detoxification. To directly monitor stabilization of Nrf2, we fused its Neh2 domain, responsible for the interaction with its nucleocytoplasmic regulator, Keap1, to firefly luciferase (Neh2-luciferase). We show that Neh2 domain is sufficient for recognition, ubiquitination, and proteasomal degradation of Neh2-luciferase fusion protein. The Neh2-luc reporter system allows direct monitoring of the adaptive response to redox stress and classification of drugs based on the time course of reporter activation. The reporter was used to screen the Spectrum library of 2000 biologically active compounds to identify activators of Nrf2. The most robust and yet nontoxic Nrf2 activators found—nordihydroguaiaretic acid, fisetin, and gedunin—induced astrocyte-dependent neuroprotection from oxidative stress via an Nrf2-dependent mechanism. PMID:21700211

  2. Regulation of Nrf2 signaling and longevity in naturally long-lived rodents.

    PubMed

    Lewis, Kaitlyn N; Wason, Emily; Edrey, Yael H; Kristan, Deborah M; Nevo, Eviatar; Buffenstein, Rochelle

    2015-03-24

    The preternaturally long-lived naked mole-rat, like other long-lived species and experimental models of extended longevity, is resistant to both endogenous (e.g., reactive oxygen species) and environmental stressors and also resists age-related diseases such as cancer, cardiovascular disease, and neurodegeneration. The mechanisms behind the universal resilience of longer-lived organisms to stress, however, remain elusive. We hypothesize that this resilience is linked to the activity of a highly conserved transcription factor, nuclear factor erythroid 2-related factor (Nrf2). Nrf2 regulates the transcription of several hundred cytoprotective molecules, including antioxidants, detoxicants, and molecular chaperones (heat shock proteins). Nrf2 itself is tightly regulated by mechanisms that either promote its activity or increase its degradation. We used a comparative approach and examined Nrf2-signaling activity in naked mole-rats and nine other rodent species with varying maximum lifespan potential (MLSP). We found that constitutive Nrf2-signaling activity was positively correlated (P = 0.0285) with MLSP and that this activity was also manifested in high levels of downstream gene expression and activity. Surprisingly, we found that species longevity was not linked to the protein levels of Nrf2 itself, but rather showed a significant (P < 0.01) negative relationship with the regulators Kelch-like ECH-Associated Protein 1 (Keap1) and β-transducin repeat-containing protein (βTrCP), which target Nrf2 for degradation. These findings highlight the use of a comparative biology approach for the identification of evolved mechanisms that contribute to health span, aging, and longevity. PMID:25775529

  3. Nrf2 activation diminishes during adipocyte differentiation of ST2 cells.

    PubMed

    Chartoumpekis, Dionysios V; Ziros, Panos G; Sykiotis, Gerasimos P; Zaravinos, Apostolos; Psyrogiannis, Agathoklis I; Kyriazopoulou, Venetsana E; Spandidos, Demetrios A; Habeos, Ioannis G

    2011-11-01

    Adipocyte differentiation (adipogenesis) is a highly controlled process known to be affected, among other factors, by the redox status of the cell. Nrf2 (NFE2-related factor 2) is a transcription factor that orchestrates the expression of a battery of antioxidant and detoxification genes under both basal and stress conditions. The present study investigated the activation of Nrf2 during adipocyte differentiation using as a model the mouse bone marrow-derived ST2 cell line. Treatment of ST2 cells with a differentiation cocktail containing IBMX, indomethacin, hydrocortisone and insulin induced differentiation into adipocytes over 5 days. During adipogenesis, the intracellular glutathione redox potential, which is an indicator of oxidative stress levels, became steadily more oxidized, as shown by real-time measurement in differentiating ST2 cells stably transfected with a redox-sensitive Grx1-roGFP2 fusion protein. The nuclear abundance of Nrf2 was assessed by Western immunoblotting and its DNA binding activity by EMSA (electrophoretic mobility shift assay) performed on nuclear protein extracts prepared every 24 h. The nuclear abundance of Nrf2 continuously decreased during adipogenesis in ST2 cells. Its DNA binding activity reached a nadir during the first two days of differentiation, after which it increased slightly without approaching its initial level. The pattern of Nrf2 DNA binding corresponded to its transcriptional activity as assessed in ST2 cells stably transfected with a reporter construct bearing a Nrf2 bind site upstream of the luciferase gene. In conclusion, the activation of Nrf2 decreased significantly during adipogenesis. The observed changes might lead to increased oxidative stress levels that could facilitate the differentiation process. These findings could shed new light on the pathogenesis of obesity, in which the adipose tissue and oxidative stress play prominent roles. PMID:21805027

  4. Nrf2 in health and disease: current and future clinical implications.

    PubMed

    Al-Sawaf, Othman; Clarner, Tim; Fragoulis, Athanassios; Kan, Yuet Wai; Pufe, Thomas; Streetz, Konrad; Wruck, Christoph Jan

    2015-12-01

    The transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) is a major regulator of oxidative stress defence in the human body. As Nrf2 regulates the expression of a large battery of cytoprotective genes, it plays a crucial role in the prevention of degenerative disease in multiple organs. Thus it has been the focus of research as a pharmacological target that could be used for prevention and treatment of chronic diseases such as multiple sclerosis, chronic kidney disease or cardiovascular diseases. The present review summarizes promising findings from basic research and shows which Nrf2-targeting therapies are currently being investigated in clinical trials and which agents have already entered clinical practice. PMID:26386022

  5. Enhanced muscle nutrient content and flesh quality, resulting from tryptophan, is associated with anti-oxidative damage referred to the Nrf2 and TOR signalling factors in young grass carp (Ctenopharyngodon idella): Avoid tryptophan deficiency or excess.

    PubMed

    Jiang, Wei-Dan; Wen, Hai-Lang; Liu, Yang; Jiang, Jun; Wu, Pei; Zhao, Juan; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu; Feng, Lin

    2016-05-15

    Flesh quality, muscle antioxidant status and related signalling molecule expressions were investigated in young grass carp fed six levels of tryptophan (Trp) for 8 weeks. The results indicated that fish fed 0.7 (deficiency) and 6.1g Trp g/kg (excess) diets exhibited lower muscle water-holding capacity, tenderness, cathepsin activity, protein levels, lipids and collagen contents. Optimal Trp reversed these negative effects, which were related to enhanced glutathione (GSH) content and glutathione peroxidase (GPx) activities regulated at gene transcription levels, rather than to superoxide dismutase (SOD) or catalase (CAT). The expression of signalling molecules [Kelch-like ECH-associated protein 1, target of rapamycin (TOR) and ribosomal S6 protein kinase 1] involved in the NF-E2-related factor 2 (Nrf2) pathway revealed a potential method of Trp-enhanced antioxidant defence. Collectively, the present study indicated that appropriate Trp levels improved flesh quality partly related to the enhancement of antioxidant ability through Nrf2 and TOR signalling. PMID:26775963

  6. Role of the Keap1/Nrf2 pathway in neurodegenerative diseases.

    PubMed

    Yamazaki, Hiromi; Tanji, Kunikazu; Wakabayashi, Koichi; Matsuura, Shin; Itoh, Ken

    2015-05-01

    As the elderly population increases, a growing number of individuals suffer from age-associated neurodegenerative diseases, such as Alzheimer's disease (AD) and Parkinson's disease (PD). Oxidative stress is considered to play a crucial role in the pathogenesis of age-related diseases. The transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) is activated by oxidative stress and regulates the expression of a variety of antioxidant enzymes and proteins that exert cytoprotective effects against oxidative stress. Numerous studies have addressed the role of Nrf2 in age-related diseases, including neurodegenerative diseases, using animal or in vitro cell culture models. Here, we introduce the role of oxidative stress in the pathogenesis of neurodegenerative diseases and critically examine the recent findings concerning the role for Nrf2 in the amelioration of AD and PD. Nrf2 not only regulates antioxidant proteins but also regulates the genes associated with autophagy and nerve growth factor signaling. Current research unequivocally demonstrates that the activation of the Nrf2 pathway is a promising novel strategy for the prevention and modification of neurodegenerative diseases. PMID:25707882

  7. Suppression of nuclear factor erythroid 2-related factor 2 via extracellular signal-regulated kinase contributes to bleomycin-induced oxidative stress and fibrogenesis.

    PubMed

    Liu, Rui; Chen, Hongli; Bai, Hua; Zhang, Wei; Wang, Xin; Qin, Xujun; Zhang, Xiaodi; Li, Wenli; Liang, Xin; Hai, Chunxu

    2013-06-20

    Pulmonary fibrosis is a serious and irreversible lung injury with obscure etiologic mechanisms and no effective treatment to date. This study explored a crucial link between oxidative stress and pulmonary fibrogenesis, focusing on nuclear factor erythroid 2-related factor 2 (Nrf2), a core transcription factor in antioxidative regulation systems. Treatment of C57 BL/6 mice with bleomycin increased fibroblast viability and collagen production and significantly downregulated Nrf2. In addition, prominent oxidative stress was indicated by changes in superoxide dismutase, catalase activity, and glutathione and thiobarbituric acid-reactive substance levels. In a cell-based model, bleomycin suppressed Nrf2 activation via extracellular signal-related kinase phosphorylation, enhancing intracellular reactive oxygen species in lung fibroblasts and stimulating abnormal cell proliferation and collagen secretion. To confirm this novel mechanism of bleomycin-induced fibrogenesis, we attempted to upregulate Nrf2 and related antioxidant proteins in bleomycin-treated fibroblasts using a putative Nrf2 activator, caffeic acid phenethyl ester, and the results showed that bleomycin-induced fibroblast proliferation and collagen content were attenuated through improved redox balance. Collectively, these results disclose a potential regulatory mechanism in pulmonary fibrosis that will aid the development of new therapies. PMID:23570914

  8. Modulation of mitochondrial dysfunction in neurodegenerative diseases via activation of nuclear factor erythroid-2-related factor 2 by food-derived compounds.

    PubMed

    Denzer, Isabel; Münch, Gerald; Friedland, Kristina

    2016-01-01

    Oxidative stress and mitochondrial dysfunction are early events in the pathogenesis of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and amyotrophic lateral sclerosis (ALS). Mitochondria are important key players in cellular function based on mitochondrial energy production and their major role in cell physiology. Since neurons are highly depending on mitochondrial energy production due to their high energy demand and their reduced glycolytic capacity mitochondrial dysfunction has fatal consequences for neuronal function and survival. The transcription factor nuclear factor erythroid-2-related factor 2 (Nrf2) is the major regulator of cellular response to oxidative stress. Activation of Nrf2 induces the transcriptional regulation of antioxidant response element (ARE)-dependent expression of a battery of cytoprotective and antioxidant enzymes and proteins. Moreover, activation of Nrf2 protects mitochondria from dysfunction and promotes mitochondrial biogenesis. Therefore, the Nrf2/ARE pathway has become an attractive target for the prevention and treatment of oxidative stress-related neurodegenerative diseases. Small food-derived inducers of the Nrf2/ARE pathway including l-sulforaphane from broccoli and isoliquiritigenin from licorice displayed promising protection of mitochondrial function in models of oxidative stress and neurodegenerative diseases and represent a novel approach to prevent and treat aging-associated neurodegenerative diseases. PMID:26626189

  9. Potential drugs which activate nuclear factor E2-related factor 2 signaling to prevent diabetic cardiovascular complications: A focus on fumaric acid esters.

    PubMed

    Zhou, Shanshan; Jin, Jingpeng; Bai, Tao; Sachleben, Leroy R; Cai, Lu; Zheng, Yang

    2015-08-01

    Diabetes and its cardiovascular complications have been a major public health issue. These complications are mainly attributable to a severe imbalance between free radical and reactive oxygen species production and the antioxidant defense systems. Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that controls the basal and inducible expression of a battery of antioxidant enzyme genes and other cyto-protective phase II detoxifying enzymes. As a result, Nrf2 has gained great attention as a promising drug target for preventing diabetic cardiovascular complications. And while animal studies have shown that several Nrf2 activators manifest a potential to efficiently prevent the diabetic complications, their use in humans has not been approved due to the lack of substantial evidence regarding safety and efficacy of the Nrf2 activation. We provide here a brief review of a few clinically-used drugs that can up-regulate Nrf2 with the potential of extending their usage to diabetic patients for the prevention of cardiovascular complications and conclude with a closer inspection of dimethyl fumarate and its mimic members. PMID:26044512

  10. Immunohistochemical expression of nuclear factor erythroid-2-related factor 2 and heme oxygenase 1 in normal bovine lung and bovine lung infected with Mannheimia haemolytica

    PubMed Central

    Moussa, Amira Talaat; Singh, Baljit; Al-Dissi, Ahmad N.

    2015-01-01

    Mannheimia haemolytica is an important cause of pneumonia in feedlot cattle. Nuclear factor erythroid-2-related factor 2 (Nrf2) is a redox-sensitive transcription factor responsible for the induction of antioxidant enzymes, such as heme oxygenase 1 (HO-1), within the lung. The expression of Nrf2 and HO-1 was immunohistochemically evaluated in 4 calves 24 h after experimental infection with M. haemolytica. Calves receiving normal saline served as controls. In the infected lungs, cytoplasmic Nrf2 expression was high in macrophages and bronchioles and low in alveolar epithelium, whereas nuclear expression was high in endothelial cells, macrophages, and bronchioles and lowest in alveolar epithelium. Normal lung samples displayed only faint Nrf2 cytoplasmic staining within bronchiolar epithelium. Expression of HO-1 was detected within the cytoplasm of macrophages and bronchiolar epithelial cells in all infected lung samples, whereas normal lungs displayed only weak cytoplasmic staining in bronchiolar epithelial cells. These findings suggest that bronchiolar epithelial cells and macrophages up-regulate Nrf2 expression early in the course of infection, which results in increased expression of HO-1 within these cells. PMID:25852222

  11. Role of the Nrf2-heme oxygenase-1 pathway in silver nanoparticle-mediated cytotoxicity

    SciTech Connect

    Kang, Su Jin; Ryoo, In-geun; Lee, Young Joon; Kwak, Mi-Kyoung

    2012-01-01

    Silver nanoparticles (nano-Ag) have been widely used in various commercial products including textiles, electronic appliances and biomedical products. However, there remains insufficient information on the potential risk of nano-Ag to human health and environment. In the current study, we have investigated the role of NF-E2-related factor 2 (Nrf2) transcription factor in nano-Ag-induced cytotoxicity. When Nrf2 expression was blocked using interring RNA expression in ovarian carcinoma cell line, nano-Ag treatment showed a substantial decrease in cell viability with concomitant increases in apoptosis and DNA damage compared to the control cells. Target gene analysis revealed that the expression of heme oxygenase-1 (HO-1) was highly elevated by nano-Ag in nonspecific shRNA expressing cells, while Nrf2 knockdown cells (NRF2i) did not increase HO-1 expression. The role of HO-1 in cytoprotection against nano-Ag was reinforced by results using pharmacological inducer of HO-1: cobalt protoporphyrin-mediated HO-1 activation in the NRF2i cells prevented nano-Ag-mediated cell death. Similarly, pharmacological or genetic inhibition of HO-1 in nonspecific control cells exacerbated nano-Ag toxicity. As the upstream signaling mechanism, nano-Ag required the phosphoinositide 3-kinase (PI3K) and p38MAPK signaling cascades for HO-1 induction. The treatment with either PI3K inhibitor or p38MAPK inhibitor suppressed HO-1 induction and intensified nano-Ag-induced cell death. Taken together, these results suggest that Nrf2-dependent HO-1 up-regulation plays a protective role in nano-Ag-induced DNA damage and consequent cell death. In addition, nano-Ag-mediated HO-1 induction is associated with the PI3K and p38MAPK signaling pathways. -- Highlights: ► Role of Nrf2 signaling in silver nanoparticle toxicity. ► Silver nanoparticle toxicity is increased by Nrf2 blockade. ► Nrf2-dependent HO-1 induction protects cells from silver nanoparticle toxicity. ► PI3K and p38MAPK cascades are

  12. Inorganic Arsenic Induces NRF2-Regulated Antioxidant Defenses in Both Cerebral Cortex and Hippocampus in Vivo.

    PubMed

    Zhang, Yang; Duan, Xiaoxu; Li, Jinlong; Zhao, Shuo; Li, Wei; Zhao, Lu; Li, Wei; Nie, Huifang; Sun, Guifang; Li, Bing

    2016-08-01

    Inorganic arsenic is reported to induce the reactive oxygen species-mediated oxidative stress, which is supposed to be one of the main mechanisms of arsenic-related neurological diseases. Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of antioxidant defense systems, up-regulates the expression of target genes to fight against oxidative damages caused by harmful substances, including metals. In the present study, mice were used as a model to investigate the oxidative stress levels and the expressions of NRF2-regulated antioxidant substances in both cerebral cortex and hippocampus with 5, 10 and 20 mg/kg NaAsO2 exposure intra-gastrically. Our results showed that acute NaAsO2 treatment resulted in decreased total anti-oxidative capacity (T-AOC) and increased maleic dialdehyde production in the nervous system. We also detected rapidly elevation of NRF2 protein levels by enhancement of Nrf2 transcription, especially at 20 mg/kg NaAsO2 exposure group. In the meantime, mRNA and protein levels of Nrf2 encoding antioxidant enzymes heme oxygenase-1 (HO-1), NAD(P)H: quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) were consistently elevated time- and dose-dependently both in the cerebral cortex and hippocampus. Taken together, the presence study demonstrated the activation of NRF2 pathway, an early antioxidant defensive response, in both cerebral cortex and hippocampus upon inorganic arsenic (iAs) exposure in vivo. A better knowledge on the roles of NRF2 pathway in maintaining cellular redox homeostasis would be helpful for the strategies on improvement of neurotoxicity related to this metalloid. PMID:27165637

  13. Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo

    SciTech Connect

    Chian, Song; Thapa, Ruby; Chi, Zhexu; Wang, Xiu Jun; Tang, Xiuwen

    2014-05-16

    Highlights: • Luteolin inhibits the Nrf2 pathway in mouse liver and in xenografted tumors. • Luteolin markedly inhibits the growth of xenograft tumors. • Luteolin enhances the anti-cancer effect of cisplatin in mice in vivo. • Luteolin could serve as an adjuvant in the chemotherapy of NSCLC. - Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) is over-expressed in many types of tumor, promotes tumor growth, and confers resistance to anticancer therapy. Hence, Nrf2 is regarded as a novel therapeutic target in cancer. Previously, we reported that luteolin is a strong inhibitor of Nrf2 in vitro. Here, we showed that luteolin reduced the constitutive expression of NAD(P)H quinone oxidoreductase 1 in mouse liver in a time- and dose-dependent manner. Further, luteolin inhibited the expression of antioxidant enzymes and glutathione transferases, decreasing the reduced glutathione in the liver of wild-type mice under both constitutive and butylated hydroxyanisole-induced conditions. In contrast, such distinct responses were not detected in Nrf2{sup −/−} mice. In addition, oral administration of luteolin, either alone or combined with intraperitoneal injection of the cytotoxic drug cisplatin, greatly inhibited the growth of xenograft tumors from non-small-cell lung cancer (NSCLC) cell line A549 cells grown subcutaneously in athymic nude mice. Cell proliferation, the expression of Nrf2, and antioxidant enzymes were all reduced in tumor xenograft tissues. Furthermore, luteolin enhanced the anti-cancer effect of cisplatin. Together, our findings demonstrated that luteolin inhibits the Nrf2 pathway in vivo and can serve as an adjuvant in the chemotherapy of NSCLC.

  14. Accelerated ovarian failure induced by 4-vinyl cyclohexene diepoxide in Nrf2 null mice.

    PubMed

    Hu, Xiaoming; Roberts, Jenny R; Apopa, Patrick L; Kan, Yuet Wai; Ma, Qiang

    2006-02-01

    Genetic and biochemical analyses have uncovered an essential role for nuclear factor erythroid 2-related factor 2 (Nrf2) in regulating phase II xenobiotic metabolism and antioxidant response. Here we show that Nrf2 protects against the ovarian toxicity of 4-vinylcyclohexene diepoxide (VCD) in mice. Nrf2-/- female mice exposed to VCD exhibit an age-dependent decline in reproduction leading to secondary infertility accompanied by hypergonadotropic hypogonadism after 30 weeks of age. VCD is shown to selectively destroy small ovarian follicles, resulting in early depletion of functional follicles. Treatment with VCD induces apoptotic death in cultured cells and in ovarian follicles, suggesting apoptosis as a mechanism of follicle loss. Loss of Nrf2 function blocks the basal and inducible expression of microsomal epoxide hydrolase, a key enzyme in the detoxification of VCD, and increases the oxidative stress in cells that is further exacerbated by VCD. Foxo3a, a repressor in the early stages of follicle activation, displays reduced expression in Nrf2-/- ovaries, causing accelerated growth of follicles in the absence of exposure to exogenous chemicals. Furthermore, Foxo3a is degraded through the 26S proteasome pathway in untreated cells and is induced by VCD via both Nrf2-dependent transcription and protein stabilization. This study demonstrates that Nrf2 serves as an essential sensor and regulator of chemical homeostasis in ovarian cells, protecting the cells from toxic chemicals by controlling metabolic detoxification, reactive oxygen species defense, and Foxo3a expression. In addition, these findings raise the possibility that exposure to environmental or occupational ovotoxicants plays a role in the premature ovarian failure commonly associated with infertility and premature aging in women. PMID:16428448

  15. Nrf2 as molecular target for polyphenols: A novel therapeutic strategy in diabetic retinopathy.

    PubMed

    Nabavi, Seyed Fazel; Barber, Alistair J; Spagnuolo, Carmela; Russo, Gian Luigi; Daglia, Maria; Nabavi, Seyed Mohammad; Sobarzo-Sánchez, Eduardo

    2016-10-01

    Diabetic retinopathy is a microvascular complication of diabetes that is considered one of the leading causes of blindness among adults. More than 4.4 million people suffer from this disorder throughout the world. Growing evidence suggests that oxidative stress plays a crucial role in the pathophysiology of diabetic retinopathy. Nuclear factor erythroid 2-related factor 2 (Nrf2), a redox sensitive transcription factor, plays an essential protective role in regulating the physiological response to oxidative and electrophilic stress via regulation of multiple genes encoding antioxidant proteins and phase II detoxifying enzymes. Many studies suggest that dozens of natural compounds, including polyphenols, can supress oxidative stress and inflammation through targeting Nrf2 and consequently activating the antioxidant response element-related cytoprotective genes. Therefore, Nrf2 may provide a new therapeutic target for treatment of diabetic retinopathy. In the present article, we will focus on the role of Nrf2 in diabetic retinopathy and the ability of polyphenols to target Nrf2 as a therapeutic strategy. PMID:26926494

  16. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician's Expectation Be Matched by the Reality?

    PubMed Central

    Houghton, Christine A.; Fassett, Robert G.; Coombes, Jeff S.

    2016-01-01

    The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements. PMID:26881038

  17. Recent Updates on Acetaminophen Hepatotoxicity: The Role of Nrf2 in Hepatoprotection

    PubMed Central

    Gum, Sang Il

    2013-01-01

    Acetaminophen (APAP) known as paracetamol is the main ingredient in Tylenol, which has analgesic and anti-pyretic properties. Inappropriate use of APAP causes major morbidity and mortality secondary to hepatic failure. Overdose of APAP depletes the hepatic glutathione (GSH) rapidly, and the metabolic intermediate leads to hepatocellular death. This article reviews the mechanisms of hepatotoxicity and provides an overview of current research studies. Pharmacokinetics including metabolism (activation and detoxification), subsequent transport (efflux)-facilitating excretion, and some other aspects related to toxicity are discussed. Nuclear factor erythroid 2-related factor 2 (Nrf2)-regulated gene battery plays a critical role in the multiple steps associated with the mitigation of APAP toxicity. The role of Nrf2 as a protective target is described, and potential natural products inhibiting APAP toxicity are outlined. This review provides an update on the mechanism of APAP toxicity and highlights the beneficial role of Nrf2 and specific natural products in hepatoprotection. PMID:24386516

  18. Sofalcone, a gastric mucosa protective agent, increases vascular endothelial growth factor via the Nrf2-heme-oxygenase-1 dependent pathway in gastric epithelial cells

    SciTech Connect

    Shibuya, Akiko; Onda, Kenji; Kawahara, Hirofumi; Uchiyama, Yuka; Nakayama, Hiroko; Omi, Takamasa; Nagaoka, Masayoshi; Matsui, Hirofumi; Hirano, Toshihiko

    2010-07-30

    Research highlights: {yields} Sofalcone increases HO-1 in gastric epithelial cells. {yields} The induction of HO-1 by sofalcone treatment follows the activation of Nrf2. {yields} The production of VEGF by sofalcone treatment is mediated by HO-1 induction. -- Abstract: Sofalcone, 2'-carboxymethoxy-4,4-bis(3-methyl-2-butenyloxy)chalcone, is an anti-ulcer agent that is classified as a gastric mucosa protective agent. Recent studies indicate heat shock proteins such as HSP32, also known as heme-oxygenase-1(HO-1), play important roles in protecting gastrointestinal tissues from several stresses. We have previously reported that sofalcone increases the expression of HO-1 in adipocytes and pre-adipocytes, although the effect of sofalcone on HO-1 induction in gastrointestinal tissues is not clear. In the current study, we investigated the effects of sofalcone on the expression of HO-1 and its functional role in rat gastric epithelial (RGM-1) cells. We found that sofalcone increased HO-1 expression in RGM-1 cells in both time- and concentration-dependent manners. The HO-1 induction was associated with the nuclear translocation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) in RGM-1 cells. We also observed that sofalcone increased vascular endothelial growth factor (VEGF) production in the culture medium. Treatment of RGM-1 cells with an HO-1 inhibitor (tin-protoporphyrin), or HO-1 siRNA inhibited sofalcone-induced VEGF production, suggesting that the effect of sofalcone on VEGF expression is mediated by the HO-1 pathway. These results suggest that the gastroprotective effects of sofalcone are partly exerted via Nrf2-HO-1 activation followed by VEGF production.

  19. Nrf2: a modulator of Parkinson's disease?

    PubMed

    Todorovic, Michael; Wood, Stephen A; Mellick, George D

    2016-06-01

    Parkinson's disease (PD) is a complex multifactorial disorder that has been associated with the processes of oxidative stress. In the absence of curative therapies, modification of the neurodegenerative process-including the manipulation of endogenous antioxidant pathways-is the focus of intensive research. Recently, genetic and pharmacological accretion of the transcription factor, and phase II antioxidant 'master regulator' Nrf2, has shown to demonstrably mitigate the toxic neuronal effects of parkinsonian agents such as MPP(+), rotenone, and hydrogen peroxide in vitro and in vivo. Furthermore, baseline genetic variability in Nrf2-dependant pathways may promote neuronal susceptibility to exogenous agents and correlate with PD onset within certain populations. While contemporary evidence directly implicating Nrf2 in the pathogenesis of PD is not conclusive and likely contingent upon the evaluation of complex interacting factors-including genetic variation and a history of environmental exposures-it remains a promising target for therapeutic benefit in the modulation of oxidative stress. PMID:27145762

  20. Protective role of nuclear factor erythroid 2-related factor 2 in the hemorrhagic shock-induced inflammatory response

    PubMed Central

    ZHAO, HAIGE; HAO, SIJING; XU, HONGFEI; MA, LIANG; ZHANG, ZHENG; NI, YIMING; YU, LUYANG

    2016-01-01

    Hemorrhagic shock (HS) following trauma or major surgery significantly contributes to mortality. However, the mechanisms through which HS activates the inflammatory response are not yet fully understood. Nuclear factor-erythroid 2 (NF-E2) p45-related factor-2 (Nrf2), a bZIP transcription factor, is a master regulator of robust cytoprotective defenses. The present study investigated the role of Nrf2 in the pathophysiology of HS. Nrf2 expression in peripheral leukocytes obtained from patients with surgery-associated hemorrhage subjected to resuscitation treatment (termed HS patients) or healthy donors was examined by RT-qPCR. A marked increase in Nrf2 expression was detected in the leukocytes obtained from the HS patients, which indicates a correlation between Nrf2 expression and the development of HS. Wild-type (WT; Nrf2+/+) and Nrf2-deficient [Nrf2−/− or Nrf2-knockout (KO)] mice were subjected to surgery to induce HS. Systemic inflammation was significantly elevated in the Nrf2-KO mice compared with the WT mice following HS, as assessed by an increase in serum cytokine levels [interleukin (IL)-6, tumor necrosis factor (TNF)-α and IL-1β], as well as high-mobility group box 1 protein (HMGB1) expression. The Nrf2-KO mice exhibited more severe lung and liver injury following HS as evidenced by increased tissue damage, increased myeloperoxidase (MPO) activity and the increased production of pro-inflammatory cytokines. Additionally, Nrf2 deficiency augmented cytokine production induced by the exposure of peritoneal mouse macrophages to lipopolysaccha-ride (LPS) following HS. Taken together, these results suggest that Nrf2 is a critical host factor which limits immune dysregulation and organ injury following HS. PMID:26935388

  1. Protective role of nuclear factor erythroid 2-related factor 2 in the hemorrhagic shock-induced inflammatory response.

    PubMed

    Zhao, Haige; Hao, Sijing; Xu, Hongfei; Ma, Liang; Zhang, Zheng; Ni, Yiming; Yu, Luyang

    2016-04-01

    Hemorrhagic shock (HS) following trauma or major surgery significantly contributes to mortality. However, the mechanisms through which HS activates the inflammatory response are not yet fully understood. Nuclear factor-erythroid 2 (NF-E2) p45-related factor-2 (Nrf2), a bZIP transcription factor, is a master regulator of robust cytoprotective defenses. The present study investigated the role of Nrf2 in the pathophysiology of HS. Nrf2 expression in peripheral leukocytes obtained from patients with surgery-associated hemorrhage subjected to resuscitation treatment (termed HS patients) or healthy donors was examined by RT-qPCR. A marked increase in Nrf2 expression was detected in the leukocytes obtained from the HS patients, which indicates a correlation between Nrf2 expression and the development of HS. Wild-type (WT; Nrf2+/+) and Nrf2-deficient [Nrf2-/- or Nrf2‑knockout (KO)] mice were subjected to surgery to induce HS. Systemic inflammation was significantly elevated in the Nrf2-KO mice compared with the WT mice following HS, as assessed by an increase in serum cytokine levels [interleukin (IL)-6, tumor necrosis factor (TNF)-α and IL-1β], as well as high-mobility group box 1 protein (HMGB1) expression. The Nrf2-KO mice exhibited more severe lung and liver injury following HS as evidenced by increased tissue damage, increased myeloperoxidase (MPO) activity and the increased production of pro-inflammatory cytokines. Additionally, Nrf2 deficiency augmented cytokine production induced by the exposure of peritoneal mouse macrophages to lipopolysaccharide (LPS) following HS. Taken together, these results suggest that Nrf2 is a critical host factor which limits immune dysregulation and organ injury following HS. PMID:26935388

  2. Nrf2 activation in the treatment of neurodegenerative diseases: a focus on its role in mitochondrial bioenergetics and function.

    PubMed

    Esteras, Noemí; Dinkova-Kostova, Albena T; Abramov, Andrey Y

    2016-05-01

    The nuclear factor erythroid-derived 2 (NF-E2)-related factor 2 (Nrf2) is a transcription factor well-known for its function in controlling the basal and inducible expression of a variety of antioxidant and detoxifying enzymes. As part of its cytoprotective activity, increasing evidence supports its role in metabolism and mitochondrial bioenergetics and function. Neurodegenerative diseases are excellent candidates for Nrf2-targeted treatments. Most neurodegenerative conditions such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, frontotemporal dementia and Friedreich's ataxia are characterized by oxidative stress, misfolded protein aggregates, and chronic inflammation, the common targets of Nrf2 therapeutic strategies. Together with them, mitochondrial dysfunction is implicated in the pathogenesis of most neurodegenerative disorders. The recently recognized ability of Nrf2 to regulate intermediary metabolism and mitochondrial function makes Nrf2 activation an attractive and comprehensive strategy for the treatment of neurodegenerative disorders. This review aims to focus on the potential therapeutic role of Nrf2 activation in neurodegeneration, with special emphasis on mitochondrial bioenergetics and function, metabolism and the role of transporters, all of which collectively contribute to the cytoprotective activity of this transcription factor. PMID:26812787

  3. Identification of Chromomoric Acid C-I as an Nrf2 Activator in Chromolaena odorata

    PubMed Central

    2014-01-01

    Activation of nuclear factor-erythroid 2-related factor 2 (Nrf2) contributes to several beneficial bioactivities of natural products, including induction of an increased cellular stress resistance and prevention or resolution of inflammation. In this study, the potential of a crude leaf extract of Chromolaena odorata, traditionally used against inflammation and skin lesions, was examined for Nrf2 activation. Guided by an Nrf2-dependent luciferase reporter gene assay, the phytoprostane chromomoric acid C-I (1) was identified as a potent Nrf2 activator from C. odorata with a CD (concentration doubling the response of vehicle-treated cells) of 5.2 μM. When tested at 1–10 μM, 1 was able to induce the endogenous Nrf2 target gene heme oxygenase 1 (HO-1) in fibroblasts. Between 2 and 5 μM, compound 1 induced HO-1 in vascular smooth muscle cells (VSMC) and inhibited their proliferation in a HO-1-dependent manner, without eliciting signs of cytotoxicity. PMID:24476568

  4. Identification of chromomoric acid C-I as an Nrf2 activator in Chromolaena odorata.

    PubMed

    Heiss, Elke H; Tran, Thi Van Anh; Zimmermann, Kristin; Schwaiger, Stefan; Vouk, Corina; Mayerhofer, Barbara; Malainer, Clemens; Atanasov, Atanas G; Stuppner, Hermann; Dirsch, Verena M

    2014-03-28

    Activation of nuclear factor-erythroid 2-related factor 2 (Nrf2) contributes to several beneficial bioactivities of natural products, including induction of an increased cellular stress resistance and prevention or resolution of inflammation. In this study, the potential of a crude leaf extract of Chromolaena odorata, traditionally used against inflammation and skin lesions, was examined for Nrf2 activation. Guided by an Nrf2-dependent luciferase reporter gene assay, the phytoprostane chromomoric acid C-I (1) was identified as a potent Nrf2 activator from C. odorata with a CD (concentration doubling the response of vehicle-treated cells) of 5.2 μM. When tested at 1-10 μM, 1 was able to induce the endogenous Nrf2 target gene heme oxygenase 1 (HO-1) in fibroblasts. Between 2 and 5 μM, compound 1 induced HO-1 in vascular smooth muscle cells (VSMC) and inhibited their proliferation in a HO-1-dependent manner, without eliciting signs of cytotoxicity. PMID:24476568

  5. Phytoestrogens modulate hepcidin expression by Nrf2: Implications for dietary control of iron absorption

    PubMed Central

    Bayele, Henry K.; Balesaria, Sara; Srai, Surjit K.S.

    2015-01-01

    Hepcidin is a liver-derived antimicrobial peptide that regulates iron absorption and is also an integral part of the acute phase response. In a previous report, we found evidence that this peptide could also be induced by toxic heavy metals and xenobiotics, thus broadening its teleological role as a defensin. However it remained unclear how its sensing of disparate biotic and abiotic stressors might be integrated at the transcriptional level. We hypothesized that its function in cytoprotection may be regulated by NFE2-related factor 2 (Nrf2), the master transcriptional controller of cellular stress defenses. In this report, we show that hepcidin regulation is inextricably linked to the acute stress response through Nrf2 signaling. Nrf2 regulates hepcidin expression from a prototypical antioxidant response element in its promoter, and by synergizing with other basic leucine-zipper transcription factors. We also show that polyphenolic small molecules or phytoestrogens commonly found in fruits and vegetables including the red wine constituent resveratrol can induce hepcidin expression in vitro and post-prandially, with concomitant reductions in circulating iron levels and transferrin saturation by one such polyphenol quercetin. Furthermore, these molecules derepress hepcidin promoter activity when its transcription by Nrf2 is repressed by Keap1. Taken together, the data show that hepcidin is a prototypical antioxidant response or cytoprotective gene within the Nrf2 transcriptional circuitry. The ability of phytoestrogens to modulate hepcidin expression in vivo suggests a novel mechanism by which diet may impact iron homeostasis. PMID:26546695

  6. Nrf2 Protects Against TWEAK-mediated Skeletal Muscle Wasting

    NASA Astrophysics Data System (ADS)

    Al-Sawaf, Othman; Fragoulis, Athanassios; Rosen, Christian; Kan, Yuet Wai; Sönmez, Tolga Taha; Pufe, Thomas; Wruck, Christoph Jan

    2014-01-01

    Skeletal muscle (SM) regeneration after injury is impaired by excessive inflammation. Particularly, the inflammatory cytokine tumour necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) is a potent inducer of skeletal muscle wasting and fibrosis. In this study we investigated the role of Nrf2, a major regulator of oxidative stress defence, in SM ischemia/reperfusion (I/R) injury and TWEAK induced atrophy. We explored the time-dependent expression of TWEAK after I/R in SM of Nrf2-wildtype (WT) and knockout (KO) mice. Nrf2-KO mice expressed significant higher levels of TWEAK as compared to WT mice. Consequently, Nrf2-KO mice present an insufficient regeneration as compared to Nrf2-WT mice. Moreover, TWEAK stimulation activates Nrf2 in the mouse myoblast cell line C2C12. This Nrf2 activation inhibits TWEAK induced atrophy in C2C12 differentiated myotubes. In summary, we show that Nrf2 protects SM from TWEAK-induced cell death in vitro and that Nrf2-deficient mice therefore have poorer muscle regeneration.

  7. Targeting Nrf2-Mediated Gene Transcription by Extremely Potent Synthetic Triterpenoids Attenuate Dopaminergic Neurotoxicity in the MPTP Mouse Model of Parkinson's Disease

    PubMed Central

    Kaidery, Navneet Ammal; Banerjee, Rebecca; Yang, Lichuan; Smirnova, Natalya A.; Hushpulian, Dmitry M.; Liby, Karen T.; Williams, Charlotte R.; Yamamoto, Masayuki; Kensler, Thomas W.; Ratan, Rajiv R.; Sporn, Michael B.; Beal, M. Flint; Gazaryan, Irina G.

    2013-01-01

    Abstract Although the etiology of Parkinson's disease (PD) remains unclear, ample empirical evidence suggests that oxidative stress is a major player in the development of PD and in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) neurotoxicity. Nuclear factor E2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that upregulates a battery of antioxidant response element (ARE)-driven antioxidative and cytoprotective genes that defend against oxidative stress. Aims: We evaluated whether the strategy of activation of Nrf2 and its downstream network of cytoprotective genes with small molecule synthetic triterpenoids (TP) attenuate MPTP-induced PD in mice. Results: We show that synthetic TP are thus far the most potent and direct activators of the Nrf2 pathway using a novel Neh2-luciferase reporter. They upregulate several cytoprotective genes, including those involved in glutathione biosynthesis in vitro. Oral administration of TP that were structurally modified to penetrate the brain-induced messenger RNA and protein levels for a battery of Nrf2-dependent cytoprotective genes reduced MPTP-induced oxidative stress and inflammation, and ameliorated dopaminergic neurotoxicity in mice. The neuroprotective effect of these TP against MPTP neurotoxicity was dependent on Nrf2, since treatment with TP in Nrf2 knockout mice failed to block against MPTP neurotoxicity and induce Nrf2-dependent cytoprotective genes. Innovation: Extremely potent synthetic TP that are direct activators of the Nrf2 pathway block dopaminergic neurodegeneration in the MPTP mouse model of PD. Conclusion: Our results indicate that activation of Nrf2/antioxidant response element (ARE) signaling by synthetic TP is directly associated with their neuroprotective effects against MPTP neurotoxicity and suggest that targeting the Nrf2/ARE pathway is a promising approach for therapeutic intervention in PD. Antioxid. Redox Signal. 18, 139–157. PMID:22746536

  8. Tert-butylhydroquinone ameliorates doxorubicin-induced cardiotoxicity by activating Nrf2 and inducing the expression of its target genes

    PubMed Central

    Wang, Lin-Feng; Su, Su-Wen; Wang, Lei; Zhang, Guo-Qiang; Zhang, Rong; Niu, Yu-Jie; Guo, Yan-Su; Li, Chun-Yan; Jiang, Wen-Bo; Liu, Yi; Guo, Hui-Cai

    2015-01-01

    Oxidative stress plays an important role in doxorubicin (DOX)-induced cardiotoxicity. Nuclear factor E2-related factor-2 (Nrf2) is a transcription factor that orchestrates the antioxidant and cytoprotective responses to oxidative stress. In the present study, we tested whether tert-butylhydroquinone (tBHQ) could protect against DOX-induced cardiotoxicity in vivo and, if so, whether the protection was associated with the up-regulation of the Nrf2 pathway. The results showed that treatment with tBHQ significantly decreased the DOX-induced cardiac injury in wild-type mice. Moreover, tBHQ ameliorated the DOX-induced oxidative stress and apoptosis. Further studies suggested that tBHQ increased the nuclear accumulation of Nrf2 and the Nrf2-regulated gene expression, including heme oxygenase-1 (HO-1) and NAD(P)H:quinone oxido-reductase-1 (NQO-1) expression. Knocking out Nrf2 in mice abolished the protective effect of tBHQ on the DOX-induced cardiotoxicity. These results indicate that tBHQ has a beneficial effect on DOX-induced cardiotoxicity, and this effect was associated with the enhanced expression of Nrf2 and its downstream antioxidant genes, HO-1 and NQO-1. PMID:26692920

  9. Nrf2 signalling and autophagy are involved in diabetes mellitus-induced defects in the development of mouse placenta

    PubMed Central

    Han, Sha-sha; Jin, Ya; Li, He; Wu, Xia; Ma, Zheng-lai; cheng, Xin; Tang, Xiuwen

    2016-01-01

    It is widely accepted that diabetes mellitus impairs placental development, but the mechanism by which the disease operates to impair development remains controversial. In this study, we demonstrated that pregestational diabetes mellitus (PGDM)-induced defects in placental development in mice are mainly characterized by the changes of morphological structure of placenta. The alteration of differentiation-related gene expressions in trophoblast cells rather than cell proliferation/apoptosis is responsible for the phenotypes found in mouse placenta. Meanwhile, excess reactive oxygen species (ROS) production and activated nuclear factor erythroid2-related factor 2 (Nrf2) signalling were observed in the placenta of mice suffering from PGDM. Using BeWo cells, we also demonstrated that excess ROS was produced and Nrf2 signalling molecules were activated in settings characterized by a high concentration of glucose. More interestingly, differentiation-related gene expressions in trophoblast cells were altered when endogenous Nrf2 expression is manipulated by transfecting Nrf2-wt or Nrf2-shRNA. In addition, PGDM interferes with autophagy in both mouse placenta and BeWo cells, implying that autophagy is also involved, directly or indirectly, in PGDM-induced placental phenotypes. Therefore, we revealed that dysfunctional oxidative stress-activated Nrf2 signalling and autophagy are probably responsible for PGDM-induced defects in the placental development of mice. The mechanism was through the interference with differentiation-related gene expression in trophoblast cells. PMID:27383629

  10. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    SciTech Connect

    Lo, Raymond; Matthews, Jason

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  11. Antisense Oligonucleotide Against GSK-3β in Brain of SAMP8 Mice Improves Learning and Memory and Decreases Oxidative Stress: Involvement of Transcription Factor Nrf2 and Implications for Alzheimer Disease

    PubMed Central

    Farr, Susan A.; Ripley, Jessica L.; Sultana, Rukhsana; Zhang, Zhaoshu; Niehoff, Michael L.; Platt, Thomas L.; Murphy, M. Paul; Morley, John E.; Kumar, Vijaya; Butterfield, D. Allan

    2014-01-01

    Glycogen synthase kinase (GSK) -3β is a multifunctional protein that has been implicated in the pathological characteristics of Alzheimer’s disease (AD), including the heightened levels of neurofibrillary tangles, amyloid-beta (Aβ) and neurodegeneration. In this study we used 12 month old SAMP8 mice, an AD model, to examine the effects GSK-3β may cause regarding the cognitive impairment and oxidative stress associated with AD. To suppress the level of GSK-3β, SAMP8 mice were treated with an antisense oligonucleotide (GAO) directed at this kinase. We measured a decreased level of GSK-3β in the cortex of the mice, indicating the success of the antisense treatment. Learning and memory assessments of the SAMP8 mice were tested post-antisense treatment using an aversive T-maze and object recognition test, both of which observably improved. In cortex samples of the SAMP8 mice, decreased levels of protein carbonyl and protein-bound HNE were measured indicating decreased oxidative stress. Nuclear factor erythroid -2-related factor 2 (Nrf2) is a transcription factor known to increase the level of many antioxidants, including glutathione-S transferase (GST), and is negatively regulated by the activity of GSK-3β. Our results indicated the increased nuclear localization of Nrf2 and level of GST, suggesting the increased activity of the transcription factor as a result of GSK-3β suppression, consistent with the decreased oxidative stress observed. Consistent with the improved learning and memory, and consistent with GSK-3b being a tau kinase, we observed decreased tau phosphorylation in brain of GAO-treated SAMP8 mice compared to that of RAO-treated SAMP8 mice. Lastly, we examined the ability of GAO to cross the blood-brain barrier and determined it to be possible. The results presented in this study demonstrate that reducing GSK-3 with a phosphorothionated antisense against GSK-3 improves learning and memory, reduces oxidative stress, possibly coincident with

  12. Schisandrol B protects against acetaminophen-induced acute hepatotoxicity in mice via activation of the NRF2/ARE signaling pathway

    PubMed Central

    Jiang, Yi-ming; Wang, Ying; Tan, Hua-sen; Yu, Tao; Fan, Xiao-mei; Chen, Pan; Zeng, Hang; Huang, Min; Bi, Hui-chang

    2016-01-01

    Aim: The nuclear factor erythroid 2-related factor 2 (NRF2) acts through the antioxidant response element (ARE) to regulate the expression of many detoxifying and antioxidant genes responsible for cytoprotective processes. We previously reported that Schisandrol B (SolB) isolated from Schisandra sphenanthera produced a protective effect against acetaminophen (APAP)-induced liver injury. In this study we investigated whether the NRF2/ARE signaling pathway was involved in this hepato-protective effect. Methods: Male C57BL/6 mice were treated with SolB (200 mg·kg−1·d−1, ig) for 3 d before injection of APAP (400 mg/kg, ip). Serum and liver tissue samples were collected 6 h later. The mRNA and protein expression were measured using qRT-PCR and Western blot assay, respectively. The activation of NRF2 was examined in HepG2 cells using luciferase reporter gene assay. Results: SolB pretreatment significantly alleviated the hepatic injury (large patchy necrosis and hyperemia of the hepatic sinus), the increase of serum AST, ALT levels and hepatic MDA contents, and the decrease of liver and mitochondrial glutathione levels in APAP-treated mice. Furthermore, SolB pretreatment significantly increased nuclear accumulation of NRF2 and increased hepatic expression of NRF2 downstream proteins, including GCLC, GSR, NQO1, GSTs, MRP2, MRP3 and MRP4 in APAP-treated mice. Moreover, treatment with SolB (2.5–20 μmol/L) dose-dependently increased the activity of NRF2 reporter gene in HepG2 cells. Conclusion: SolB exhibits a remarkable protective effect against APAP-induced hepatotoxicity, partially via activation of the NRF2/ARE pathway and regulation of NRF2 target genes, which induce detoxification and increase antioxidant capacity. PMID:26806302

  13. Protocatechuic acid induces antioxidant/detoxifying enzyme expression through JNK-mediated Nrf2 activation in murine macrophages.

    PubMed

    Varì, Rosaria; D'Archivio, Massimo; Filesi, Carmelina; Carotenuto, Simona; Scazzocchio, Beatrice; Santangelo, Carmela; Giovannini, Claudio; Masella, Roberta

    2011-05-01

    Protocatechuic acid (PCA) is a main metabolite of anthocyanins, whose daily intake is much higher than that of other polyphenols. PCA has biological effects, e.g., it induces the antioxidant/detoxifying enzyme gene expression. This study was aimed at defining the molecular mechanism responsible for PCA-induced over-expression of glutathione (GSH) peroxidase (GPx) and GSH reductase (GR) in J774 A.1 macrophages. New evidence is provided that PCA increases GPx and GR expression by inducing C-JUN NH(2)-terminal kinase (JNK)-mediated phosphorylation of Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2). RNA and proteins were extracted from cells treated with PCA (25 μM) for different time points. Quantitative real-time polymerase chain reaction and immunoblotting analyses showed a rapid increase in mRNA (>60%) and protein (>50%) for both the enzymes. This was preceded by the up-regulation of Nrf2, in terms of mRNA and protein, and by its significant activation as assessed by increased Nrf2 phosphorylation and nuclear translocation (+60%). By using specific kinase inhibitors and detecting the activated form, we showed that JNK was the main upstream kinase responsible for Nrf2 activation. Convincing evidence is provided of a causal link between PCA-induced Nrf2 activation and increased enzyme expression. By silencing Nrf2 and using a JNK inhibitor, enzyme enhancement was counteracted. Finally, with the ChIP assay, we demonstrated that PCA-activated Nrf2 specifically bound ARE sequences in enzyme gene promoters. Our study demonstrates for the first time that PCA improves the macrophage endogenous antioxidant potential by a mechanism in which JNK-mediated Nrf2 activation plays an essential role. This knowledge could contribute to novel diet-based approaches aimed at counteracting oxidative injury by reinforcing endogenous defences. PMID:20621462

  14. Chemoprevention of dietary digitoflavone on colitis-associated colon tumorigenesis through inducing Nrf2 signaling pathway and inhibition of inflammation

    PubMed Central

    2014-01-01

    Background Nuclear factor-erythroid 2-related factor 2 (Nrf2) has emerged as a novel target for the prevention of colorectal cancer (CRC). Many chemopreventive compounds associated with Nrf2 activation are effective in preclinical systems and many on-going clinical trials are showing promising findings. In present study we evaluated the cytoprotective effect and chemopreventive properties of dietary digitoflavone. Method A cell based Antioxidant Response Element (ARE)-driven luciferase reporter system was applied to screen potential Nrf2 activators. Activation of Nrf2 by digitoflavone was confirmed through mRNA, protein and GSH level assay in Caco-2 cell line. The cytoprotective effect of digitoflavone was evaluated in H2O2-induced oxidative stress model and further signaling pathways analysis was used to determine the target of digitoflavone induced Nrf2 activation. An AOM-DSS induced colorectal cancer model was used to assess the chemopreventive effect of digitoflavone. Result Micromolarity (10 μM) level of digitoflavone increased Nrf2 expressing, nuclear translocation and expression of downstream phase II antioxidant enzymes. Furthermore, digitoflavone decreased H2O2-induced oxidative stress and cell death via p38 MAPK-Nrf2/ARE pathway. In vivo study, 50 mg/kg digitoflavone significantly reduced AOM-DSS induced tumor incidence, number and size. Conclusion These observations suggest that digitoflavone is a novel Nrf2 pathway activator, and protects against oxidative stress-induced cell injury. The results of the present study add further evidence of the molecular mechanisms that allow digitoflavone to exert protective effects and reaffirm its potential role as a chemopreventive agent in colorectal carcinogenesis. PMID:24602443

  15. Keap1 Cysteine 288 as a Potential Target for Diallyl Trisulfide-Induced Nrf2 Activation

    PubMed Central

    Kim, Sanghyun; Lee, Hee-Geum; Park, Sin-Aye; Kundu, Joydeb Kumar; Keum, Young-Sam; Cha, Young-Nam; Na, Hye-Kyung; Surh, Young-Joon

    2014-01-01

    Diallyl sulfide, diallyl disulfide, and daillyl trisulfide (DATS) are major volatile components of garlic oil. In this study, we assessed their relative potency in inducing antioxidant enzyme expression. Among the three organosulfur compounds, DATS was found to be most potent in inducing heme oxygenase-1 (HO-1) and NAD(P)H:quinone oxidoreductase-1 (NQO1) in human gastric epithelial (AGS) cells. Furthermore, DATS administration by gavage increased the expression of HO-1 and NQO1 in C57BL/6 mouse stomach. Treatment with DATS increased the accumulation of nuclear factor-erythroid-2-related factor-2 (Nrf2) in the nucleus of cultured AGS cells and in mouse stomach in vivo. The DATS-induced expression of HO-1 and NQO1 was abrogated in the cells transiently transfected with Nrf2-siRNA or in the embryonic fibroblasts from Nrf2-null mice, indicating that Nrf2 is a key mediator of the cytoprotective effects of DATS. Pretreatment of AGS cells with N-acetylcysteine or dithiothreitol attenuated DATS-induced nuclear localization of Nrf2 and the expression of HO-1 and NQO1. Cysteine-151, -273 and -288 of Kelch-like ECH-associated protein-1 (Keap1), a cytosolic repressor of Nrf2, have been considered to act as a redox sensor and play a role in Nrf2 activation. To determine whether DATS could inactivate Keap1 through thiol modification, we established cell lines constitutively expressing wild type-Keap1 or three different mutant constructs in which cysteine-151, -273, or -288 of Keap1 was replaced with serine by retroviral gene transfer. DATS failed to activate Nrf2, and to induce expression of HO-1 and NQO1 only in Keap1-C288S mutant cells. LC-ESI-MS/MS analysis of recombinant Keap1 treated with DATS revealed that the peptide fragment containing Cys288 gained a molecular mass of 72.1 Da equivalent to the molecular weight of mono-allyl mono-sulfide. Taken together, these findings suggest that DATS may directly interact with the Cys288 residue of Keap1, which partly accounts for its

  16. Neuroprotective effects of salidroside on focal cerebral ischemia/reperfusion injury involve the nuclear erythroid 2-related factor 2 pathway

    PubMed Central

    Han, Jing; Xiao, Qing; Lin, Yan-hua; Zheng, Zhen-zhu; He, Zhao-dong; Hu, Juan; Chen, Li-dian

    2015-01-01

    Salidroside, the main active ingredient extracted from Rhodiola crenulata, has been shown to be neuroprotective in ischemic cerebral injury, but the underlying mechanism for this neuroprotection is poorly understood. In the current study, the neuroprotective effect of salidroside on cerebral ischemia-induced oxidative stress and the role of the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway was investigated in a rat model of middle cerebral artery occlusion. Salidroside (30 mg/kg) reduced infarct size, improved neurological function and histological changes, increased activity of superoxide dismutase and glutathione-S-transferase, and reduced malon-dialdehyde levels after cerebral ischemia and reperfusion. Furthermore, salidroside apparently increased Nrf2 and heme oxygenase-1 expression. These results suggest that salidroside exerts its neuroprotective effect against cerebral ischemia through anti-oxidant mechanisms and that activation of the Nrf2 pathway is involved. The Nrf2/antioxidant response element pathway may become a new therapeutic target for the treatment of ischemic stroke. PMID:26889188

  17. Protective Effect of Nuclear Factor E2-Related Factor 2 on Inflammatory Cytokine Response to Brominated Diphenyl Ether-47 in the HTR-8/SVneo Human First Trimester Extravillous Trophoblast Cell Line

    PubMed Central

    Park, Hae-Ryung; Loch-Caruso, Rita

    2014-01-01

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. PMID:25305463

  18. Neuroprotection by acetyl-11-keto-β-Boswellic acid, in ischemic brain injury involves the Nrf2/HO-1 defense pathway.

    PubMed

    Ding, Yi; Chen, MinChun; Wang, Min; Wang, MingMing; Zhang, Tiejun; Park, Jongsun; Zhu, YanRong; Guo, Chao; Jia, YanYan; Li, YuWen; Wen, AiDong

    2014-01-01

    Stroke is a complex disease involved oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway has been considered a potential target for neuroprotection in stroke. Acetyl-11-Keto-β-Boswellic Acid (AKBA) is an active triterpenoid compound from the extract of Boswellia serrate. The present study was to determine whether AKBA, a novel Nrf2 activator, can protect against cerebral ischemic injury. The stroke model was produced in Sprague-Dawley rats via middle cerebral artery occlusion. To model ischemia-like conditions in vitro, primary cultured cortical neurons were exposed to transient oxygen and glucose deprivation (OGD). Treatment of AKBA significantly reduced infarct volumes and apoptotic cells, and also increased neurologic scores by elevating the Nrf2 and HO-1 expression in brain tissues in middle cerebral artery occlusion (MCAO) rats at 48 hours post reperfusion. In primary cultured neurons, AKBA increased the Nrf2 and HO-1 expression, which provided protection against OGD-induced oxidative insult. Additionally, AKBA treatment increased Nrf2 binding activity to antioxidant-response elements (ARE). The protective effect of AKBA was attenuated by knockdown of Nrf2 or HO-1. In conclusion, these findings provide evidence that AKBA protects neurons against ischemic injury, and this neuroprotective effect involves the Nrf2/HO-1 pathway. PMID:25384416

  19. S[+] Apomorphine is a CNS penetrating activator of the Nrf2-ARE pathway with activity in mouse and patient fibroblast models of amyotrophic lateral sclerosis☆

    PubMed Central

    Mead, Richard J.; Higginbottom, Adrian; Allen, Scott P.; Kirby, Janine; Bennett, Ellen; Barber, Siân C.; Heath, Paul R.; Coluccia, Antonio; Patel, Neelam; Gardner, Iain; Brancale, Andrea; Grierson, Andrew J.; Shaw, Pamela J.

    2013-01-01

    Compelling evidence indicates that oxidative stress contributes to motor neuron injury in amyotrophic lateral sclerosis (ALS), but antioxidant therapies have not yet achieved therapeutic benefit in the clinic. The nuclear erythroid 2-related-factor 2 (Nrf2) transcription factor is a key regulator of an important neuroprotective response by driving the expression of multiple cytoprotective genes via its interaction with the antioxidant response element (ARE). Dysregulation of the Nrf2-ARE system has been identified in ALS models and human disease. Taking the Nrf2-ARE pathway as an attractive therapeutic target for neuroprotection in ALS, we aimed to identify CNS penetrating, small molecule activators of Nrf2-mediated transcription in a library of 2000 drugs and natural products. Compounds were screened extensively for Nrf2 activation, and antioxidant and neuroprotective properties in vitro. S[+]-Apomorphine, a receptor-inactive enantiomer of the clinically approved dopamine-receptor agonist (R[–]-apomorphine), was identified as a nontoxic Nrf2 activating molecule. In vivo S[+]-apomorphine demonstrated CNS penetrance, Nrf2 induction, and significant attenuation of motor dysfunction in the SOD1G93A transgenic mouse model of ALS. S[+]-apomorphine also reduced pathological oxidative stress and improved survival following an oxidative insult in fibroblasts from ALS patients. This molecule emerges as a promising candidate for evaluation as a potential neuroprotective agent in ALS patients in the clinic. PMID:23608463

  20. Nrf2 links epidermal barrier function with antioxidant defense.

    PubMed

    Schäfer, Matthias; Farwanah, Hany; Willrodt, Ann-Helen; Huebner, Aaron J; Sandhoff, Konrad; Roop, Dennis; Hohl, Daniel; Bloch, Wilhelm; Werner, Sabine

    2012-05-01

    The skin provides an efficient permeability barrier and protects from microbial invasion and oxidative stress. Here, we show that these essential functions are linked through the Nrf2 transcription factor. To test the hypothesis that activation of Nrf2 provides skin protection under stress conditions, we determined the consequences of pharmacological or genetic activation of Nrf2 in keratinocytes. Surprisingly, mice with enhanced Nrf2 activity in keratinocytes developed epidermal thickening, hyperkeratosis and inflammation resembling lamellar ichthyosis. This resulted from upregulation of the cornified envelope proteins small proline-rich proteins (Sprr) 2d and 2h and of secretory leukocyte peptidase inhibitor (Slpi), which we identified as novel Nrf2 targets in keratinocytes. Since Sprrs are potent scavengers of reactive oxygen species and since Slpi has antimicrobial activities, their upregulation contributes to Nrf2's protective function. However, it also caused corneocyte fragility and impaired desquamation, followed by alterations in the epidermal lipid barrier, inflammation and overexpression of mitogens that induced keratinocyte hyperproliferation. These results identify an unexpected role of Nrf2 in epidermal barrier function, which needs to be considered for pharmacological use of Nrf2 activators. PMID:22383093

  1. Aged garlic extract enhances heme oxygenase-1 and glutamate-cysteine ligase modifier subunit expression via the nuclear factor erythroid 2-related factor 2-antioxidant response element signaling pathway in human endothelial cells.

    PubMed

    Hiramatsu, Kei; Tsuneyoshi, Tadamitsu; Ogawa, Takahiro; Morihara, Naoaki

    2016-02-01

    The nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway defends cells against oxidative stress and regulates the cellular redox balance. Activation of this pathway induces a variety of antioxidant enzymes, resulting in the protection of our bodies against oxidative damage. It has been reported that aged garlic extract (AGE), a garlic preparation that is rich in water-soluble cysteinyl moieties, reduces oxidative stress and helps to ameliorate of cardiovascular, renal and hepatic diseases. We hypothesized that AGE enhances the expression of antioxidant enzymes via the Nrf2-ARE pathway in human umbilical vein endothelial cells in culture. Gene expression of antioxidant enzymes was measured using real-time polymerase chain reaction. Nuclear accumulation of Nrf2 and antioxidant enzymes expression were evaluated using western blotting analyses. We found that AGE promoted the accumulation of Nrf2 into the nucleus in a time- and dose-dependent manner and increased the gene expression and polypeptide level of heme oxygenase-1 (HO-1) and glutamate-cysteine ligase modifier subunit (GCLM). Moreover, the effect of AGE in elevating the gene expression of HO-1 and GCLM was found to be mediated via Nrf2 activation in human umbilical vein endothelial cells. Taken together, these observations suggest that AGE induces the expression of HO-1 and GCLM, which are antioxidant enzymes, via activation of the Nrf2-ARE signaling pathway. PMID:26507778

  2. Dipeptidyl peptidase-4 inhibition by gemigliptin prevents abnormal vascular remodeling via NF-E2-related factor 2 activation.

    PubMed

    Choi, Seung Hee; Park, Sungmi; Oh, Chang Joo; Leem, Jaechan; Park, Keun-Gyu; Lee, In-Kyu

    2015-10-01

    Dipeptidyl peptidase-4 (DPP-4) inhibitors exert a potent anti-hyperglycemic effect and reduce cardiovascular risk in type 2 diabetic patients. Several studies have shown that DPP-4 inhibitors including sitagliptin have beneficial effects in atherosclerosis and cardiac infarction involving reactive oxygen species. Here, we show that gemigliptin can directly attenuate the abnormal proliferation and migration of vascular smooth muscle cells (VSMCs) via enhanced NF-E2-related factor 2 (Nrf2) activity. Gemigliptin dramatically prevented ligation injury-induced neointimal hyperplasia in mouse carotid arteries. Likewise, the proliferation of primary VSMCs was significantly attenuated by gemigliptin in a dose-dependent manner consistent with a decrease in phospho-Rb, resulting in G1 cell cycle arrest. We found that gemigliptin enhanced Nrf2 activity not only by mRNA expression, but also by increasing Keap1 proteosomal degradation by p62, leading to the induction of Nrf2 target genes such as HO-1 and NQO1. The anti-proliferative role of gemigliptin disappeared with DPP-4 siRNA knockdown, indicating that the endogenous DPP-4 in VSMCs contributed to the effect of gemigliptin. In addition, gemigliptin diminished TNF-α-mediated cell adhesion molecules such as MCP-1 and VCAM-1 and reduced MMP2 activity in VSMCs. Taken together, our data indicate that gemigliptin exerts a preventative effect on the proliferation and migration of VSMCs via Nrf2. PMID:26187356

  3. Cystamine Protects from 3-Nitropropionic Acid Lesioning via Induction of NF-E2 Related Factor 2 Mediated Transcription

    PubMed Central

    Calkins, Marcus J.; Townsend, Jessica A.; Johnson, Delinda A.; Johnson, Jeffrey A.

    2010-01-01

    Systemic administration of cystamine is known to protect from both chemical and genetic models of neurotoxicity. Despite positive effects in laboratory models, cystamine has not been successfully translated to clinical application for neurodegenerative disease. Furthermore, the long held assumption that cystamine protects through tissue-transglutaminase inhibition has recently been challenged. The studies described here examine other potential mechanisms of cystamine-mediated protection in an attempt to reveal molecular targets for neurodegenerative therapy. Based on previously described effects of cystamine, we examined the potential for activation of NF-E2 related factor 2 (Nrf2) mediated signaling through the antioxidant response element (ARE). We found that cystamine activates Nrf2/ARE both in cell culture and in brain tissue and then probed the mechanism of activation in cell culture. In live animals, we show that neuroprotection from 3-nitropropionic acid (3NP) toxicity is Nrf2-dependent. Therefore, these findings provide strong evidence that Nrf2 signaling may be an effective target for prevention of neurodegeneration. PMID:20406637

  4. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line

    SciTech Connect

    Park, Hae-Ryung Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential

  5. Nrf2/Keap1 system regulates vascular smooth muscle cell apoptosis for vascular homeostasis: role in neointimal formation after vascular injury

    PubMed Central

    Ashino, Takashi; Yamamoto, Masayuki; Numazawa, Satoshi

    2016-01-01

    Abnormal increases in vascular smooth muscle cells (VSMCs) in the intimal region after a vascular injury is a key event in developing neointimal hyperplasia. To maintain vascular function, proliferation and apoptosis of VSMCs is tightly controlled during vascular remodeling. NF-E2-related factor 2 (Nrf2)/Kelch-like ECH-associated protein 1 (Keap1) system, a key component of the oxidative stress response that acts in maintaining homeostasis, plays an important role in neointimal hyperplasia after a vascular injury; however, the role of Nrf2/Keap1 in VSMC apoptosis has not been clarified. Here we report that 14 days after arterial injury in mice, TUNEL-positive VSMCs are detected in both the neointimal and medial layers. These layers contain cells expressing high levels of Nrf2 but low Keap1 expression. In VSMCs, Keap1 depletion induces features of apoptosis, such as positive TUNEL staining and annexin V binding. These changes are associated with an increased expression of nuclear Nrf2. Simultaneous Nrf2 depletion inhibits Keap1 depletion-induced apoptosis. At 14 days after the vascular injury, Nrf2-deficient mice demonstrated fewer TUNEL-positive cells and increased neointimal formation in the neointimal and medial areas. The results suggest that the Nrf2/Keap1 system regulates VSMC apoptosis during neointimal formation, thereby inhibiting neointimal hyperplasia after a vascular injury. PMID:27198574

  6. Thyroid hormone-induced cytosol-to-nuclear translocation of rat liver Nrf2 is dependent on Kupffer cell functioning.

    PubMed

    Videla, Luis A; Cornejo, Pamela; Romanque, Pamela; Santibáñez, Catherine; Castillo, Iván; Vargas, Romina

    2012-01-01

    L-3,3',5-triiodothyronine (T(3)) administration upregulates nuclear factor-E2-related factor 2 (Nrf2) in rat liver, which is redox-sensitive transcription factor mediating cytoprotection. In this work, we studied the role of Kupffer cell respiratory burst activity, a process related to reactive oxygen species generation and liver homeostasis, in Nrf2 activation using the macrophage inactivator gadolinium chloride (GdCl(3); 10 mg/kg i.v. 72 h before T(3) [0.1 mg/kg i.p.]) or NADPH oxidase inhibitor apocynin (1.5 mmol/L added to the drinking water for 7 days before T(3)), and determinations were performed 2 h after T(3). T(3) increased nuclear/cytosolic Nrf2 content ratio and levels of heme oxygenase 1 (HO-1), catalytic subunit of glutamate cysteine ligase, and thioredoxin (Western blot) over control values, proteins whose gene transcription is induced by Nrf2. These changes were suppressed by GdCl(3) treatment prior to T(3), an agent-eliciting Kupffer-cell depletion, inhibition of colloidal carbon phagocytosis, and the associated respiratory burst activity, with enhancement in nuclear inhibitor of Nrf2 kelch-like ECH-associated protein 1 (Keap1)/Nrf2 content ratios suggesting Nrf2 degradation. Under these conditions, T(3)-induced tumor necrosis factor-α (TNF-α) response was eliminated by previous GdCl(3) administration. Similar to GdCl(3), apocynin given before T(3) significantly reduced liver Nrf2 activation and HO-1 expression, a NADPH oxidase inhibitor eliciting abolishment of colloidal carbon-induced respiratory burst activity without altering carbon phagocytosis. It is concluded that Kupffer cell functioning is essential for upregulation of liver Nrf2-signaling pathway by T(3). This contention is supported by suppression of the respiratory burst activity of Kupffer cells and the associated reactive oxygen species production by GdCl(3) or apocynin given prior to T(3), thus hindering Nrf2 activation. PMID:22649286

  7. Nuclear Factor Erythroid 2-Related Factor 2 Drives Podocyte-Specific Expression of Peroxisome Proliferator-Activated Receptor γ Essential for Resistance to Crescentic GN.

    PubMed

    Henique, Carole; Bollee, Guillaume; Lenoir, Olivia; Dhaun, Neeraj; Camus, Marine; Chipont, Anna; Flosseau, Kathleen; Mandet, Chantal; Yamamoto, Masayuki; Karras, Alexandre; Thervet, Eric; Bruneval, Patrick; Nochy, Dominique; Mesnard, Laurent; Tharaux, Pierre-Louis

    2016-01-01

    Necrotizing and crescentic rapidly progressive GN (RPGN) is a life-threatening syndrome characterized by a rapid loss of renal function. Evidence suggests that podocyte expression of the transcription factor peroxisome proliferator-activated receptor γ (PPARγ) may prevent podocyte injury, but the function of glomerular PPARγ in acute, severe inflammatory GN is unknown. Here, we observed marked loss of PPARγ abundance and transcriptional activity in glomerular podocytes in experimental RPGN. Blunted expression of PPARγ in podocyte nuclei was also found in kidneys from patients diagnosed with crescentic GN. Podocyte-specific Pparγ gene targeting accentuated glomerular damage, with increased urinary loss of albumin and severe kidney failure. Furthermore, a PPARγ gain-of-function approach achieved by systemic administration of thiazolidinedione (TZD) failed to prevent severe RPGN in mice with podocyte-specific Pparγ gene deficiency. In nuclear factor erythroid 2-related factor 2 (NRF2)-deficient mice, loss of podocyte PPARγ was observed at baseline. NRF2 deficiency markedly aggravated the course of RPGN, an effect that was partially prevented by TZD administration. Furthermore, delayed administration of TZD, initiated after the onset of RPGN, still alleviated the severity of experimental RPGN. These findings establish a requirement for the NRF2-PPARγ cascade in podocytes, and we suggest that these transcription factors have a role in augmenting the tolerance of glomeruli to severe immune-complex mediated injury. The NRF2-PPARγ pathway may be a therapeutic target for RPGN. PMID:25999406

  8. Dimethylfumarate attenuates restenosis after acute vascular injury by cell-specific and Nrf2-dependent mechanisms

    PubMed Central

    Oh, Chang Joo; Park, Sungmi; Kim, Joon-Young; Kim, Han-Jong; Jeoung, Nam Ho; Choi, Young-Keun; Go, Younghoon; Park, Keun-Gyu; Lee, In-Kyu

    2014-01-01

    Excessive proliferation of vascular smooth muscle cells (VSMCs) and incomplete re-endothelialization is a major clinical problem limiting the long-term efficacy of percutaneous coronary angioplasty. We tested if dimethylfumarate (DMF), an anti-psoriasis drug, could inhibit abnormal vascular remodeling via NF−E2-related factor 2 (Nrf2)-NAD(P)H quinone oxidoreductase 1 (NQO1) activity. DMF significantly attenuated neointimal hyperplasia induced by balloon injury in rat carotid arteries via suppression of the G1 to S phase transition resulting from induction of p21 protein in VSMCs. Initially, DMF increased p21 protein stability through an enhancement in Nrf2 activity without an increase in p21 mRNA. Later on, DMF stimulated p21 mRNA expression through a process dependent on p53 activity. However, heme oxygenase-1 (HO-1) or NQO1 activity, well-known target genes induced by Nrf2, were dispensable for the DMF induction of p21 protein and the effect on the VSMC proliferation. Likewise, DMF protected endothelial cells from TNF-α-induced apoptosis and the dysfunction characterized by decreased eNOS expression. With knock-down of Nrf2 or NQO1, DMF failed to prevent TNF-α-induced cell apoptosis and decreased eNOS expression. Also, CD31 expression, an endothelial specific marker, was restored in vivo by DMF. In conclusion, DMF prevented abnormal proliferation in VSMCs by G1 cell cycle arrest via p21 upregulation driven by Nrf2 and p53 activity, and had a beneficial effect on TNF-α-induced apoptosis and dysfunction in endothelial cells through Nrf2–NQO1 activity suggesting that DMF might be a therapeutic drug for patients with vascular disease. PMID:25009787

  9. HIV-Tat Induces the Nrf2/ARE Pathway through NMDA Receptor-Elicited Spermine Oxidase Activation in Human Neuroblastoma Cells

    PubMed Central

    Mastrantonio, Roberta; Cervelli, Manuela; Pietropaoli, Stefano; Mariottini, Paolo; Colasanti, Marco; Persichini, Tiziana

    2016-01-01

    Previously, we reported that HIV-Tat elicits spermine oxidase (SMO) activity upregulation through NMDA receptor (NMDAR) stimulation in human SH-SY5Y neuroblastoma cells, thus increasing ROS generation, which in turn leads to GSH depletion, oxidative stress, and reduced cell viability. In several cell types, ROS can trigger an antioxidant cell response through the transcriptional induction of oxidative stress-responsive genes regulated by the nuclear factor erythroid 2-related factor 2 (Nrf2). Here, we demonstrate that Tat induces both antioxidant gene expression and Nrf2 activation in SH-SY5Y cells, mediated by SMO activity. Furthermore, NMDAR is involved in Tat-induced Nrf2 activation. These findings suggest that the NMDAR/SMO/Nrf2 pathway is an important target for protection against HIV-associated neurocognitive disorders. PMID:26895301

  10. l-carnitine protects human hepatocytes from oxidative stress-induced toxicity through Akt-mediated activation of Nrf2 signaling pathway.

    PubMed

    Li, Jinlian; Zhang, Yanli; Luan, Haiyun; Chen, Xuehong; Han, Yantao; Wang, Chunbo

    2016-05-01

    In our previous study, l-carnitine was shown to have cytoprotective effect against hydrogen peroxide (H2O2)-induced injury in human normal HL7702 hepatocytes. The aim of this study was to investigate whether the protective effect of l-carnitine was associated with the nuclear factor erythroid 2 (NFE2)-related factor 2 (Nrf2) pathway. Our results showed that pretreatment with l-carnitine augmented Nrf2 nuclear translocation, DNA binding activity and heme oxygenase-1 (HO-1) expression in H2O2-treated HL7702 cells, although l-carnitine treatment alone had no effect on them. Analysis using Nrf2 siRNA demonstrated that Nrf2 activation was involved in l-carnitine-induced HO-1 expression. In addition, l-carnitine-mediated protection against H2O2 toxicity was abrogated by Nrf2 siRNA, indicating the important role of Nrf2 in l-carnitine-induced cytoprotection. Further experiments revealed that l-carnitine pretreatment enhanced the phosphorylation of Akt in H2O2-treated cells. Blocking Akt pathway with inhibitor partly abrogated the protective effect of l-carnitine. Moreover, our finding demonstrated that the induction of Nrf2 translocation and HO-1 expression by l-carnitine directly correlated with the Akt pathway because Akt inhibitor showed inhibitory effects on the Nrf2 translocation and HO-1 expression. Altogether, these results demonstrate that l-carnitine protects HL7702 cells against H2O2-induced cell damage through Akt-mediated activation of Nrf2 signaling pathway. PMID:26889770

  11. Coordinated regulation of Nrf2 and histone H3 serine 10 phosphorylation in arsenite-activated transcription of the human heme oxygenase-1 gene.

    PubMed

    Ray, Paul D; Huang, Bo-Wen; Tsuji, Yoshiaki

    2015-10-01

    Expression of the antioxidant gene heme oxygenase-1 (HO-1) is primarily induced through NF-E2-related factor 2 (Nrf2)-mediated activation of the antioxidant response element (ARE). Gene transcription is coordinately regulated by transcription factor activity at enhancer elements and epigenetic alterations such as the posttranslational modification of histone proteins. However, the role of histone modifications in the Nrf2-ARE axis remains largely uncharacterized. The environmental contaminant arsenite is a potent inducer of both HO-1 expression and phosphorylation of histone H3 serine 10 (H3S10); therefore, we investigated the relationships between Nrf2 and H3S10 phosphorylation in arsenite-induced, ARE-dependent, transcriptional activation of the human HO-1 gene. Arsenite increased phosphorylation of H3S10 both globally and at the HO-1 promoter concomitantly with HO-1 transcription in human HaCaT keratinocytes. Conversely, arsenite-induced H3S10 phosphorylation and HO-1 expression were blocked by N-acetylcysteine (NAC), the c-Jun N-terminal kinase (JNK) inhibitor SP600125, and JNK knockdown (siJNK). Interestingly, ablation of arsenite-induced H3S10 phosphorylation by SP600125 or siJNK did not inhibit Nrf2 nuclear accumulation nor ARE binding, despite inhibiting HO-1 expression. In response to arsenite, binding of Nrf2 to the HO-1 ARE preceded phosphorylation of H3S10 at the HO-1 ARE. Furthermore, arsenite-mediated occupancy of phosphorylated H3S10 at the HO-1 ARE was decreased in Nrf2-deficient mouse embryonic fibroblasts. These results suggest the involvement of H3S10 phosphorylation in the Nrf2-ARE axis by proposing that Nrf2 may influence H3S10 phosphorylation at the HO-1 ARE and additional promoter regions. Our data highlights the complex interplay between Nrf2 and H3S10 phosphorylation in arsenite-activated HO-1 transcription. PMID:26291278

  12. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism.

    PubMed

    Loboda, Agnieszka; Damulewicz, Milena; Pyza, Elzbieta; Jozkowicz, Alicja; Dulak, Jozef

    2016-09-01

    The multifunctional regulator nuclear factor erythroid 2-related factor (Nrf2) is considered not only as a cytoprotective factor regulating the expression of genes coding for anti-oxidant, anti-inflammatory and detoxifying proteins, but it is also a powerful modulator of species longevity. The vertebrate Nrf2 belongs to Cap 'n' Collar (Cnc) bZIP family of transcription factors and shares a high homology with SKN-1 from Caenorhabditis elegans or CncC found in Drosophila melanogaster. The major characteristics of Nrf2 are to some extent mimicked by Nrf2-dependent genes and their proteins including heme oxygenase-1 (HO-1), which besides removing toxic heme, produces biliverdin, iron ions and carbon monoxide. HO-1 and their products exert beneficial effects through the protection against oxidative injury, regulation of apoptosis, modulation of inflammation as well as contribution to angiogenesis. On the other hand, the disturbances in the proper HO-1 level are associated with the pathogenesis of some age-dependent disorders, including neurodegeneration, cancer or macular degeneration. This review summarizes our knowledge about Nrf2 and HO-1 across different phyla suggesting their conservative role as stress-protective and anti-aging factors. PMID:27100828

  13. Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients

    PubMed Central

    Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

    2016-01-01

    The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of NAD(P)H:quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients. PMID:27274779

  14. Prolonged metformin treatment leads to reduced transcription of Nrf2 and neurotrophic factors without cognitive impairment in older C57BL/6J mice.

    PubMed

    Allard, Joanne S; Perez, Evelyn J; Fukui, Koji; Carpenter, Priscilla; Ingram, Donald K; de Cabo, Rafael

    2016-03-15

    Long-term use of anti-diabetic agents has become commonplace as rates of obesity, metabolic syndrome and diabetes continue to escalate. Metformin, a commonly used anti-diabetic drug, has been shown to have many beneficial effects outside of its therapeutic regulation of glucose metabolism and insulin sensitivity. Studies on metformin's effects on the central nervous system are limited and predominantly consist of in vitro studies and a few in vivo studies with short-term treatment in relatively young animals; some provide support for metformin as a neuroprotective agent while others show evidence that metformin may be deleterious to neuronal survival. In this study, we examined the effect of long-term metformin treatment on brain neurotrophins and cognition in aged male C57Bl/6 mice. Mice were fed control (C), high-fat (HF) or a high-fat diet supplemented with metformin (HFM) for 6 months. Metformin decreased body fat composition and attenuated declines in motor function induced by a HF diet. Performance in the Morris water maze test of hippocampal based memory function, showed that metformin prevented impairment of spatial reference memory associated with the HF diet. Quantitative RT-PCR on brain homogenates revealed decreased transcription of BDNF, NGF and NTF3; however protein levels were not altered. Metformin treatment also decreased expression of the antioxidant pathway regulator, Nrf2. The decrease in transcription of neurotrophic factors and Nrf2 with chronic metformin intake, cautions of the possibility that extended metformin use may alter brain biochemistry in a manner that creates a vulnerable brain environment and warrants further investigation. PMID:26698400

  15. Network Inference Algorithms Elucidate Nrf2 Regulation of Mouse Lung Oxidative Stress

    PubMed Central

    Singhal, Mudita; Malhotra, Deepti; Biswal, Shyam

    2008-01-01

    A variety of cardiovascular, neurological, and neoplastic conditions have been associated with oxidative stress, i.e., conditions under which levels of reactive oxygen species (ROS) are elevated over significant periods. Nuclear factor erythroid 2-related factor (Nrf2) regulates the transcription of several gene products involved in the protective response to oxidative stress. The transcriptional regulatory and signaling relationships linking gene products involved in the response to oxidative stress are, currently, only partially resolved. Microarray data constitute RNA abundance measures representing gene expression patterns. In some cases, these patterns can identify the molecular interactions of gene products. They can be, in effect, proxies for protein–protein and protein–DNA interactions. Traditional techniques used for clustering coregulated genes on high-throughput gene arrays are rarely capable of distinguishing between direct transcriptional regulatory interactions and indirect ones. In this study, newly developed information-theoretic algorithms that employ the concept of mutual information were used: the Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNE), and Context Likelihood of Relatedness (CLR). These algorithms captured dependencies in the gene expression profiles of the mouse lung, allowing the regulatory effect of Nrf2 in response to oxidative stress to be determined more precisely. In addition, a characterization of promoter sequences of Nrf2 regulatory targets was conducted using a Support Vector Machine classification algorithm to corroborate ARACNE and CLR predictions. Inferred networks were analyzed, compared, and integrated using the Collective Analysis of Biological Interaction Networks (CABIN) plug-in of Cytoscape. Using the two network inference algorithms and one machine learning algorithm, a number of both previously known and novel targets of Nrf2 transcriptional activation were identified. Genes predicted as

  16. Nrf2 reduces levels of phosphorylated tau protein by inducing autophagy adaptor protein NDP52

    NASA Astrophysics Data System (ADS)

    Jo, Chulman; Gundemir, Soner; Pritchard, Susanne; Jin, Youngnam N.; Rahman, Irfan; Johnson, Gail V. W.

    2014-03-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a pivotal transcription factor in the defence against oxidative stress. Here we provide evidence that activation of the Nrf2 pathway reduces the levels of phosphorylated tau by induction of an autophagy adaptor protein NDP52 (also known as CALCOCO2) in neurons. The expression of NDP52, which we show has three antioxidant response elements (AREs) in its promoter region, is strongly induced by Nrf2, and its overexpression facilitates clearance of phosphorylated tau in the presence of an autophagy stimulator. In Nrf2-knockout mice, phosphorylated and sarkosyl-insoluble tau accumulates in the brains concurrent with decreased levels of NDP52. Moreover, NDP52 associates with phosphorylated tau from brain cortical samples of Alzheimer disease cases, and the amount of phosphorylated tau in sarkosyl-insoluble fractions is inversely proportional to that of NDP52. These results suggest that NDP52 plays a key role in autophagy-mediated degradation of phosphorylated tau in vivo.

  17. Value of monitoring Nrf2 activity for the detection of chemical and oxidative stress

    PubMed Central

    Mutter, Fiona E.; Park, B. Kevin; Copple, Ian M.

    2015-01-01

    Beyond specific limits of exposure, chemical entities can provoke deleterious effects in mammalian cells via direct interaction with critical macromolecules or by stimulating the accumulation of reactive oxygen species (ROS). In particular, these chemical and oxidative stresses can underpin adverse reactions to therapeutic drugs, which pose an unnecessary burden in the clinic and pharmaceutical industry. Novel pre-clinical testing strategies are required to identify, at an earlier stage in the development pathway, chemicals and drugs that are likely to provoke toxicity in humans. Mammalian cells can adapt to chemical and oxidative stress via the action of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2), which up-regulates the expression of numerous cell defence genes and has been shown to protect against a variety of chemical toxicities. Here, we provide a brief overview of the Nrf2 pathway and summarize novel experimental models that can be used to monitor changes in Nrf2 pathway activity and thus understand the functional consequences of such perturbations in the context of chemical and drug toxicity. We also provide an outlook on the potential value of monitoring Nrf2 activity for improving the pre-clinical identification of chemicals and drugs with toxic liability in humans. PMID:26551708

  18. Kaposi's Sarcoma-Associated Herpesvirus Induces Nrf2 Activation in Latently Infected Endothelial Cells through SQSTM1 Phosphorylation and Interaction with Polyubiquitinated Keap1

    PubMed Central

    Gjyshi, Olsi; Flaherty, Stephanie; Veettil, Mohanan Valiya; Johnson, Karen E.; Chandran, Bala

    2014-01-01

    ABSTRACT Nuclear factor erythroid 2-related factor 2 (Nrf2), the cellular master regulator of the antioxidant response, dissociates from its inhibitor Keap1 when activated by stress signals and participates in the pathogenesis of viral infections and tumorigenesis. Early during de novo infection of endothelial cells, KSHV induces Nrf2 through an intricate mechanism involving reactive oxygen species (ROS) and prostaglandin E2 (PGE2). When we investigated the Nrf2 activity during latent KSHV infection, we observed increased nuclear serine-40-phosphorylated Nrf2 in human KS lesions compared to that in healthy tissues. Using KSHV long-term-infected endothelial cells (LTC) as a cellular model for KS, we demonstrated that KSHV infection induces Nrf2 constitutively by extending its half-life, increasing its phosphorylation by protein kinase Cζ (PKCζ) via the infection-induced cyclooxygenase-2 (COX-2)/PGE2 axis and inducing its nuclear localization. Nrf2 knockdown in LTC decreased expression of antioxidant genes and genes involved in KS pathogenesis such as the NAD(P)H quinone oxidase 1 (NQO1), gamma glutamylcysteine synthase heavy unit (γGCSH), the cysteine transporter (xCT), interleukin 6 (IL-6), and vascular endothelial growth factor A (VEGF-A) genes. Nrf2 activation was independent of oxidative stress but dependent on the autophagic protein sequestosome-1 (SQSTM1; p62). SQSTM1 levels were elevated in LTC, a consequence of protein accumulation due to decreased autophagy and Nrf2-mediated transcriptional activation. SQSTM1 was phosphorylated on serine-351 and -403, while Keap1 was polyubiquitinated with lysine-63–ubiquitin chains, modifications known to increase their mutual affinity and interaction, leading to Keap1 degradation and Nrf2 activation. The latent KSHV protein Fas-associated death domain-like interleukin-1β-converting enzyme-inhibitory protein (vFLIP) increased SQSTM1 expression and activated Nrf2. Collectively, these results demonstrate that KSHV

  19. Mechanisms and functions of Nrf2 signaling in Drosophila.

    PubMed

    Pitoniak, Andrew; Bohmann, Dirk

    2015-11-01

    The Nrf2 transcription factor belongs to the Cap'n'collar family, named after the founding member of this group, the product of the Drosophila Cap'n'collar gene. The encoded protein, Cap'n'collar, abbreviated Cnc, offers a convenient and accessible model to study the structure, function, and biology of Nrf2 transcription factors at the organismic, tissular, cellular, and molecular levels, using the powerful genetic, genomic, and biochemical tools available in Drosophila. In this review we provide an account of the original identification of Cnc as a regulator of embryonic development. We then describe the discovery of Nrf2-like functions of Cnc and its role in acute stress signaling and aging. The establishment of Drosophila as a model organism in which the mechanisms and functions of Nrf2 signaling can be studied has led to several discoveries: the regulation of stem cell activity by an Nrf2-mediated redox mechanism, the interaction of Nrf2 with p62 and Myc in the control of tissue growth and the unfolded protein response, and more. Several of these more recent lines of investigation are highlighted. Model organisms such as the fly and the worm remain powerful experimental platforms that can help to unravel the many remaining puzzles regarding the role of Nrf2 and its relatives in controlling the physiology and maintaining the health of multicellular organisms. PMID:26117322

  20. Resveratrol Inhibits Paraquat-Induced Oxidative Stress and Fibrogenic Response by Activating the Nuclear Factor Erythroid 2-Related Factor 2 Pathway

    PubMed Central

    He, Xiaoqing; Wang, Liping; Szklarz, Grazyna; Bi, Yongyi; Ma, Qiang

    2015-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is an antioxidant-activated transcription factor that recently emerged as a critical regulator of cellular defense against oxidative and inflammatory lesions. Resveratrol (Res) is a natural phytoalexin that exhibits multiple therapeutic potentials, including antioxidative and anti-inflammatory effects in animals. Paraquat (PQ) is the second most widely used herbicide worldwide, but it selectively accumulates in human lungs to cause oxidative injury and fibrosis with high mortality. Here, we analyzed the molecular mechanism of the fibrogenic response to PQ and its inhibition by Res and Nrf2. PQ dose-dependently caused toxicity in normal human bronchial epithelial cells (BEAS-2B), resulting in mitochondrial damage, oxidative stress, and cell death. Res at 10 µM markedly inhibited PQ toxicity. PQ at 10 µM stimulated production of inflammatory and profibrogenic factors (tumor necrosis factor α, interleukin 6, and transforming growth factor β1) and induced the transformation of normal human lung fibroblasts (WI38-VA13) to myofibroblasts; both effects were inhibited by Res. Res strongly activated the Nrf2 signaling pathway and induced antioxidant response elementdependent cytoprotective genes. On the other hand, knockout or knockdown of Nrf2 markedly increased PQ-induced cytotoxicity, cytokine production, and myofibroblast transformation and abolished protection by Res. The findings demonstrate that Res attenuates PQ-induced reactive oxygen species production, inflammation, and fibrotic reactions by activating Nrf2 signaling. The study reveals a new pathway for molecular intervention against pulmonary oxidative injury and fibrosis. PMID:22493042

  1. Increased AD-like pathology in the APP/ PS1ΔE9 mouse model lacking Nrf2 through modulation of autophagy

    PubMed Central

    Joshi, Gururaj; Gan, Kok Ann; Johnson, Delinda A.; Johnson, Jeffrey A.

    2014-01-01

    The presence of senile plaques is one of the major pathological hallmarks of the Alzheimer’s disease (AD) brain. The plaques predominantly contain insoluble amyloid β-peptide; a cleavage product of the larger amyloid precursor protein (APP). Two enzymes named β and γ secretase generate the neurotoxic amyloid-β peptide from APP. Mature APP is also turnovered endogenously by autophagy, more specifically by the endosomal-lysosomal pathway. A defective lysosomal system is known to be pathogenic in AD. Modulation of NF-E2 related factor 2 (Nrf2) has been shown in several neurodegenerative disorders and Nrf2 has become a potential therapeutic target for various neurodegenerative disorders including AD, Parkinson’s disease, and amyotrophic lateral sclerosis. In the current study, we explored the effect of genetic ablation of Nrf2 on APP/Aβ processing and/or aggregation as well as changes in autophagic dysfunction in APP/PS1 mice. There was a significant increase in inflammatory response in APP/PS1 mice lacking Nrf2. This was accompanied by increased intracellular levels of APP, Aβ (1-42), and Aβ (1-40), without a change total full-length APP. There was a shift of APP and Aβ into the insoluble fraction, as well as increased poly-ubiquitin conjugated proteins in mice lacking Nrf2. APP/PS1-mediated autophagic dysfunction is also enhanced in Nrf2 deficient mice. Finally, neurons in the APP/PS1/Nrf2−/− mice had increased accumulation of multivesicular bodies, endosomes and lysosomes. These outcomes provide a better understanding of the role of Nrf2 in modulating autophagy in an AD mouse model and may help design better Nrf2 targeted therapeutics that could be efficacious in the treatment of AD. PMID:25316599

  2. Nitro-linoleic acid inhibits vascular smooth muscle cell proliferation via the Keap1/Nrf2 signaling pathway

    PubMed Central

    Villacorta, Luis; Zhang, Jifeng; Garcia-Barrio, Minerva T.; Chen, Xi-lin; Freeman, Bruce A.; Chen, Yuqing E.; Cui, Taixing

    2007-01-01

    Nitroalkenes, the nitration products of unsaturated fatty acids formed via NO-dependent oxidative reactions, have been demonstrated to exert strong biological actions in endothelial cells and monocytes/macrophages; however, little is known about their effects on vascular smooth muscle cells (VSMCs). The present study examined the role of nitro-linoleic acid (LNO2) in the regulation of VSMC proliferation. We observed that LNO2 inhibited VSMC proliferation in a dose-dependent manner. In addition, LNO2 induced growth arrest of VSMCs in the G1/S phase of the cell cycle with an upregulation of the cyclin-dependent kinase inhibitor p27kip1. Furthermore, LNO2 triggered nuclear factor-erythroid 2-related factor 2 (Nrf2) nuclear translocation and activation of the antioxidant-responsive element-driven transcriptional activity via impairing Kelch-like ECH-associating protein 1 (Keap1)-mediated negative control of Nrf2 activity in VSMCs. LNO2 upregulated the expression of Nrf2 protein levels, but not mRNA levels, in VSMCs. A forced activation of Nrf2 led to an upregulation of p27kip1 and growth inhibition of VSMCs. In contrast, knock down of Nrf2 using an Nrf2 siRNA approach reversed the LNO2-induced upregulation of p27kip1 and inhibition of cellular proliferation in VSMCs. These studies provide the first evidence that nitroalkene LNO2 inhibits VSMC proliferation through activation of the Keap1/Nrf2 signaling pathway, suggesting an important role of nitroalkenes in vascular biology. PMID:17468336

  3. miR-144 reverses chemoresistance of hepatocellular carcinoma cell lines by targeting Nrf2-dependent antioxidant pathway

    PubMed Central

    Zhou, Suna; Ye, Wenguang; Zhang, Yanjun; Yu, Dequan; Shao, Qiuju; Liang, Jun; Zhang, Mingxin

    2016-01-01

    Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide. Chemoresistance occurrence is a major cause of treatment failure in HCC. Currently, extensive research has revealed diverse mechanisms for chemoresistance, but the molecular mechanisms underlying the role of miRNAs in resistance to 5-FU are not confirmed in HCC cells. By quantitative real-time polymerase chain reaction (qRT-PCR) analysis, we found that miR-144 was significantly decreased in HCC cell lines. It has been further demonstrated that miR-144 were significantly down-regulated in Bel-7402/5-FU cells compared with parental Bel-7402 cells by qRT-PCR and western blot. The expression of Nrf2 was reversely correlated to that of miR-144 in HCC cells. Moreover, Enhancement of 5-FU-induced cytotoxicity and apoptosis are resulted from the transfection with miR-144 mimics in Bel-7402/5-FU cells. Mechanically, miR-144 promoted nuclear factor erythroid-2-related factor-2 (Nrf2) mRNA degradation by directly targeting the Nrf2 3’untranslated region (3’UTR). In addition, ectopic expression of miR-144 in Bel-7402/5-FU cells reduced the levels of Nrf2 and inhibited the transcription of Nrf2-dependent HO-1 gene, thus contributing to 5-FU sensibilization. Conversely, re-expression of Nrf2 partly attenuated the chemosensibilization of miR-144. Our study showed that miR-144 serves as a potential chemoresistance-reversal agent in hepatocellular carcinoma cells, which is at least partly due to the down-regulation of Nrf2-dependent antioxidant pathway. PMID:27508019

  4. Kaposi's Sarcoma-Associated Herpesvirus Induces Nrf2 during De Novo Infection of Endothelial Cells to Create a Microenvironment Conducive to Infection

    PubMed Central

    Gjyshi, Olsi; Bottero, Virginie; Veettil, Mohanan Valliya; Dutta, Sujoy; Singh, Vivek Vikram; Chikoti, Leela; Chandran, Bala

    2014-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiological agent of Kaposi's sarcoma (KS) and primary effusion B-cell lymphoma. KSHV induces reactive oxygen species (ROS) early during infection of human dermal microvascular endothelial (HMVEC-d) cells that are critical for virus entry. One of the downstream targets of ROS is nuclear factor E2-related factor 2 (Nrf2), a transcription factor with important anti-oxidative functions. Here, we show that KS skin lesions have high Nrf2 activity compared to healthy skin tissue. Within 30 minutes of de novo KSHV infection of HMVEC-d cells, we observed Nrf2 activation through ROS-mediated dissociation from its inhibitor Keap1, Ser-40 phosphorylation, and subsequent nuclear translocation. KSHV binding and consequent signaling through Src, PI3-K and PKC-ζ were also important for Nrf2 stability, phosphorylation and transcriptional activity. Although Nrf2 was dispensable for ROS homeostasis, it was essential for the induction of COX-2, VEGF-A, VEGF-D, Bcl-2, NQO1, GCS, HO1, TKT, TALDO and G6PD gene expression in KSHV-infected HMVEC-d cells. The COX-2 product PGE2 induced Nrf2 activity through paracrine and autocrine signaling, creating a feed-forward loop between COX-2 and Nrf2. vFLIP, a product of KSHV latent gene ORF71, induced Nrf2 and its target genes NQO1 and HO1. Activated Nrf2 colocalized with the KSHV genome as well as with the latency protein LANA-1. Nrf2 knockdown enhanced ORF73 expression while reducing ORF50 and other lytic gene expression without affecting KSHV entry or genome nuclear delivery. Collectively, these studies for the first time demonstrate that during de novo infection, KSHV induces Nrf2 through intricate mechanisms involving multiple signal molecules, which is important for its ability to manipulate host and viral genes, creating a microenvironment conducive to KSHV infection. Thus, Nrf2 is a potential attractive target to intervene in KSHV infection and the associated maladies. PMID:25340789

  5. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages.

    PubMed

    Gu, Da-Min; Lu, Pei-Hua; Zhang, Ke; Wang, Xiang; Sun, Min; Chen, Guo-Qian; Wang, Qiong

    2015-02-13

    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. PMID:25582778

  6. The Dual Role of Nrf2 in Nonalcoholic Fatty Liver Disease: Regulation of Antioxidant Defenses and Hepatic Lipid Metabolism.

    PubMed

    Chambel, Sílvia S; Santos-Gonçalves, Andreia; Duarte, Tiago L

    2015-01-01

    Nonalcoholic fatty liver disease (NAFLD) is a progressive liver disease with ever-growing incidence in the industrialized world. It starts with the simple accumulation of lipids in the hepatocyte and can progress to the more severe nonalcoholic steatohepatitis (NASH), which is associated with inflammation, fibrosis, and cirrhosis. There is increasing awareness that reactive oxygen species and electrophiles are implicated in the pathogenesis of NASH. Transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) is a positive regulator of the expression of a battery of genes involved in the protection against oxidative/electrophilic stress. In rodents, Nrf2 is also known to participate in hepatic fatty acid metabolism, as a negative regulator of genes that promote hepatosteatosis. We review relevant evidence in the literature that these two mechanisms may contribute to the protective role of Nrf2 in the development of hepatic steatosis and in the progression to steatohepatitis, particularly in young animals. We propose that age may be a key to explain contradictory findings in the literature. In summary, Nrf2 mediates the crosstalk between lipid metabolism and antioxidant defense mechanisms in experimental models of NAFLD, and the nutritional or pharmacological induction of Nrf2 represents a promising potential new strategy for its prevention and treatment. PMID:26120584

  7. Involvement of NRF2 Signaling in Doxorubicin Resistance of Cancer Stem Cell-Enriched Colonospheres

    PubMed Central

    Ryoo, In-geun; Kim, Geon; Choi, Bo-hyun; Lee, Sang-hwan; Kwak, Mi-Kyoung

    2016-01-01

    Cancer stem cells (CSCs) are a subset of tumor cells, which are characterized by resistance against chemotherapy and environmental stress, and are known to cause tumor relapse after therapy. A number of molecular mechanisms underlie the chemoresistance of CSCs, including high expression levels of drug efflux transporters. We investigated the role of the antioxidant transcription factor NF-E2-related factor 2 (NRF2) in chemoresistance development, using a CSC-enriched colonosphere system. HCT116 colonospheres were more resistant to doxorubicin-induced cell death and expressed higher levels of drug efflux transporters such as P-glycoprotein (Pgp) and breast cancer resistance protein (BCRP) compared to HCT116 monolayers. Notably, levels of NRF2 and expression of its target genes were substantially elevated in colonospheres, and these increases were linked to doxorubicin resistance. When NRF2 expression was silenced in colonospheres, Pgp and BCRP expression was downregulated, and doxorubicin resistance was diminished. Collectively, these results indicate that NRF2 activation contributes to chemoresistance acquisition in CSC-enriched colonospheres through the upregulation of drug efflux transporters. PMID:27582554

  8. Involvement of NRF2 Signaling in Doxorubicin Resistance of Cancer Stem Cell-Enriched Colonospheres.

    PubMed

    Ryoo, In-Geun; Kim, Geon; Choi, Bo-Hyun; Lee, Sang-Hwan; Kwak, Mi-Kyoung

    2016-09-01

    Cancer stem cells (CSCs) are a subset of tumor cells, which are characterized by resistance against chemotherapy and environmental stress, and are known to cause tumor relapse after therapy. A number of molecular mechanisms underlie the chemoresistance of CSCs, including high expression levels of drug efflux transporters. We investigated the role of the antioxidant transcription factor NF-E2-related factor 2 (NRF2) in chemoresistance development, using a CSC-enriched colonosphere system. HCT116 colonospheres were more resistant to doxorubicin-induced cell death and expressed higher levels of drug efflux transporters such as P-glycoprotein (Pgp) and breast cancer resistance protein (BCRP) compared to HCT116 monolayers. Notably, levels of NRF2 and expression of its target genes were substantially elevated in colonospheres, and these increases were linked to doxorubicin resistance. When NRF2 expression was silenced in colonospheres, Pgp and BCRP expression was downregulated, and doxorubicin resistance was diminished. Collectively, these results indicate that NRF2 activation contributes to chemoresistance acquisition in CSC-enriched colonospheres through the upregulation of drug efflux transporters. PMID:27582554

  9. Beyond antioxidant genes in the ancient NRF2 regulatory network

    PubMed Central

    Lacher, Sarah E.; Lee, Joslynn S.; Wang, Xuting; Campbell, Michelle R.; Bell, Douglas A.; Slattery, Matthew

    2016-01-01

    NRF2, a basic leucine zipper transcription factor encoded by the gene NFE2L2, is a master regulator of the transcriptional response to oxidative stress. NRF2 is structurally and functionally conserved from insects to humans, and it heterodimerizes with the small MAF transcription factors to bind a consensus DNA sequence (the antioxidant response element, or ARE) and regulate gene expression. We have used genome-wide chromatin immunoprecipitation (ChIP-seq) and gene expression data to identify direct NRF2 target genes in Drosophila and humans. These data have allowed us to construct the deeply conserved ancient NRF2 regulatory network – target genes that are conserved from Drosophila to human. The ancient network consists of canonical antioxidant genes, as well as genes related to proteasomal pathways, metabolism, and a number of less expected genes. We have also used enhancer reporter assays and electrophoretic mobility shift assays to confirm NRF2-mediated regulation of ARE (antioxidant response element) activity at a number of these novel target genes. Interestingly, the ancient network also highlights a prominent negative feedback loop; this, combined with the finding that and NRF2-mediated regulatory output is tightly linked to the quality of the ARE it is targeting, suggests that precise regulation of nuclear NRF2 concentration is necessary to achieve proper quantitative regulation of distinct gene sets. Together, these findings highlight the importance of balance in the NRF2-ARE pathway, and indicate that NRF2-mediated regulation of xenobiotic metabolism, glucose metabolism, and proteostasis have been central to this pathway since its inception. PMID:26163000

  10. Lipoicmethylenedioxyphenol Reduces Experimental Atherosclerosis through Activation of Nrf2 Signaling

    PubMed Central

    Ying, Zhekang; Chen, Minjie; Xie, Xiaoyun; Wang, Xiaoke; Kherada, Nisharahmed; Desikan, Rajagopal; Mihai, Georgeta; Burns, Patrick; Sun, Qinghua; Rajagopalan, Sanjay

    2016-01-01

    Objective Oxidative stress is implicated in the pathogenesis of atherosclerosis, and Nrf2 is the transcriptional factor central in cellular antioxidant responses. In the present study, we investigate the effect of a dihydrolipoic acid derivative lipoicmethylenedioxyphenol (LMDP) on the progression of atherosclerosis and test whether its effect on atherosclerosis is mediated by Nrf2. Methods and Results Both magnetic resonance imaging (MRI) scanning and en face analysis reveal that 14 weeks of treatment with LMDP markedly reduced atherosclerotic burden in a rabbit balloon vascular injury model. Myograph analyses show decreased aortic contractile response to phenylephrine and increased aortic response to acetylcholine and insulin in LMDP-treated animals, suggesting that LMDP inhibits atherosclerosis through improving vascular function. A role of Nrf2 signaling in mediating the amelioration of vascular function by LMDP was supported by increased Nrf2 translocation into nuclear and increased expression of Nrf2 target genes. Furthermore, chemotaxis analysis with Boydem chamber shows that leukocytes isolated from LMDP-treated rabbits had reduced chemotaxis, and knock-down of Nrf2 significantly reduced the effect of LMDP on the chemotaxis of mouse macrophages. Conclusion Our results support that LMDP has an anti-atherosclerotic effect likely through activation of Nrf2 signaling and subsequent inhibition of macrophage chemotaxis. PMID:26859892

  11. Genetic Polymorphisms of Transcription Factor NRF2 and of its Host Gene Sulfiredoxin (SRXN1) are Associated with Cerebrovascular Disease in a Finnish Cohort, the TAMRISK Study

    PubMed Central

    Kunnas, Tarja; Määttä, Kirsi; Nikkari, Seppo T

    2016-01-01

    Oxidative stress is involved in the pathophysiology of many cardiovascular disorders, such as hypertension and atherosclerosis. NRF2 is the primary transcriptional regulator of several antioxidant genes, including that of sulfiredoxin (SRXN1). The association of genotypes of NRF2 and SRXN1 with cardiovascular conditions was studied in a Finnish cohort of 336 subjects with diagnosed hypertension and 480 normotensive controls from the Tampere adult population cardiovascular risk study (TAMRISK). Samples were genotyped for four SNPs (rs1962142, rs2706110, rs6721961 and rs6706649) in the NRF2 gene region and four SNPs (rs6053666, rs6116929, rs2008022, rs6085283) in the SRXN1 gene region using Competitive Allele Specific PCR (KASP) technique. Cardiovascular diseases were followed up from 2005 to 2014 using the Finnish National Hospital Discharge Registry (HILMO). Four out of eight studied polymorphisms: rs6721961, rs1962142, rs2706110 of NRF2, and rs6053666 of SRXN1 were associated with cerebrovascular disease. NRF2 polymorphism rs6721961 showed association with hypertension. NRF2 and SRXN1 polymorphisms, previously thought to be associated with human disease, appear to be associated particularly with cerebrovascular disease. PMID:27226772

  12. The Keap1-Nrf2 pathway: Mechanisms of activation and dysregulation in cancer☆

    PubMed Central

    Kansanen, Emilia; Kuosmanen, Suvi M.; Leinonen, Hanna; Levonen, Anna-Liisa

    2013-01-01

    The Keap1-Nrf2 pathway is the major regulator of cytoprotective responses to oxidative and electrophilic stress. Although cell signaling pathways triggered by the transcription factor Nrf2 prevent cancer initiation and progression in normal and premalignant tissues, in fully malignant cells Nrf2 activity provides growth advantage by increasing cancer chemoresistance and enhancing tumor cell growth. In this graphical review, we provide an overview of the Keap1-Nrf2 pathway and its dysregulation in cancer cells. We also briefly summarize the consequences of constitutive Nrf2 activation in cancer cells and how this can be exploited in cancer gene therapy. PMID:24024136

  13. Expression of target genes of nuclear factor E2-related factor 2 in the liver of dairy cows in the transition period and at different stages of lactation.

    PubMed

    Gessner, D K; Schlegel, G; Keller, J; Schwarz, F J; Ringseis, R; Eder, K

    2013-02-01

    In the liver of dairy cows, the production of cytokines is enhanced during the periparturient phase, which in turn leads to inflammation and an impairment of hepatic function. Nuclear factor E2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that controls the transcription of genes encoding various antioxidative and cytoprotective proteins. In the present study, we investigated the hypothesis that Nrf2 is activated in the liver of dairy cows during the periparturient phase to protect the liver against the deleterious effects of cytokines and reactive oxygen species. Therefore, we determined relative mRNA abundances of TNF (encoding tumor necrosis factor-α), various acute phase proteins and several Nrf2 target genes in liver biopsy samples of 20 dairy cows at each time point from 3 wk antepartum to 1, 5, and 14 wk postpartum. We observed an increase in mRNA abundances of TNF and acute-phase proteins [serum amyloid A 3 (SAA3), haptoglobin (HP), and C-reactive protein (CRP)] from 3 wk antepartum to 1 wk postpartum, indicative of a proinflammatory condition. Messenger RNA abundances of various Nrf2 target genes with antioxidative or cytoprotective functions [glutathione peroxidase 3 (GPX3); microsomal glutathione S-transferase 3 (MGST3); superoxide dismutase (SOD1); catalase (CAT); metallothioneins 1A, 1E, and 2A (MT1A, MT1E, and MT2A, respectively); NAD(P)H dehydrogenase, quinone 1 (NQO1); heme oxygenase 2 (HMOX2); and UDP glucuronosyltransferase 1 family, polypeptide A1 (UGT1A1)] were also greatly increased from 3 wk antepartum to 1 wk postpartum. From 1 wk postpartum to later lactation, mRNA abundances of all the Nrf2-target genes considered declined but remained at levels that were higher than those in 3 wk antepartum. No correlations were found, however, between plasma concentrations of nonesterified fatty acids or β-hydroxybutyrate and mRNA abundances of Nrf2 target genes, indicating that a negative energy balance might not have been the main

  14. Taurine protects against As2O3-induced autophagy in pancreas of rat offsprings through Nrf2/Trx pathway.

    PubMed

    Bai, Jie; Yao, Xiaofeng; Jiang, Liping; Qiu, Tianming; Liu, Shuang; Qi, Baoxu; Zheng, Yue; Kong, Yuan; Yang, Guang; Chen, Min; Liu, Xiaofang; Sun, Xiance

    2016-04-01

    Arsenic was increasingly to blame as a risk factor for type 2 diabetes mellitus. In our previous study, we had found iAs stimulated autophagic flux and caused autophagic cell death through ROS pathway in INS-1 cells. Since NF-E2-related factor 2 (Nrf2) and the thioredoxin (Trx) system was a crucial line of defense against ROS, we investigated whether Nrf2/Trx pathway contributed to As2O3-stimulated autophagy and the role of taurine in this study. After treatment with 2 mg/kg BW-8 mg/kg BW As2O3 for 57 d, the expression of Nrf2 protein was decreased significantly in offsprings' pancreas. The expression of Trx gene was decreased significantly in pancreas subsequently. Finally, the generation of reactive oxygen species stimulated autophagy in arsenic-treated pancreas. Taurine could reverse arsenic-inhibited Nrf2 and Trx and inhibit autophagy. In short, inhibition of Nrf2/Trx pathway might play an important role in the pathogenesis of arsenic-related diabetes. Taurine could serve as nutrition supplementation against arsenic-related diabetes in high arsenic exposure area. PMID:26775255

  15. Sulforaphane mitigates muscle fibrosis in mdx mice via Nrf2-mediated inhibition of TGF-β/Smad signaling.

    PubMed

    Sun, Chengcao; Li, Shujun; Li, Dejia

    2016-02-15

    Sulforaphane (SFN), an activator of NF-E2-related factor 2 (Nrf2), has been found to have an antifibrotic effect on liver and lung. However, its effects on dystrophic muscle fibrosis remain unknown. This work was undertaken to evaluate the effects of SFN-mediated activation of Nrf2 on dystrophic muscle fibrosis. Male mdx mice (age 3 mo) were treated with SFN by gavage (2 mg/kg body wt per day) for 3 mo. Experimental results demonstrated that SFN remarkably attenuated skeletal and cardiac muscle fibrosis as indicated by reduced Sirius Red staining and immunostaining of the extracellular matrix. Moreover, SFN significantly inhibited the transforming growth factor-β (TGF-β)/Smad signaling pathway and suppressed profibrogenic gene and protein expressions such as those of α-smooth muscle actin (α-SMA), fibronectin, collagen I, plasminogen activator inhibitor-1 (PAI-1), and tissue inhibitor metalloproteinase-1 (TIMP-1) in an Nrf2-dependent manner. Furthermore, SFN significantly decreased the expression of inflammatory cytokines CD45, TNF-α, and IL-6 in mdx mice. In conclusion, these results show that SFN can attenuate dystrophic muscle fibrosis by Nrf2-mediated inhibition of the TGF-β/Smad signaling pathway, which indicates that Nrf2 may represent a new target for dystrophic muscle fibrosis. PMID:26494449

  16. A novel natural Nrf2 activator with PPARγ-agonist (monascin) attenuates the toxicity of methylglyoxal and hyperglycemia.

    PubMed

    Hsu, Wei-Hsuan; Lee, Bao-Hong; Chang, Yu-Ying; Hsu, Ya-Wen; Pan, Tzu-Ming

    2013-11-01

    Methylglyoxal (MG) is a toxic-glucose metabolite and a major precursor of advanced glycation endproducts (AGEs). MG has been reported to result in inflammation by activating receptor for AGEs (RAGE). We recently found that Monascus-fermented metabolite monascin acts as a novel natural peroxisome proliferator-activated receptor-γ (PPARγ) agonist that improves insulin sensitivity. We investigated the metabolic, biochemical, and molecular abnormalities characteristic of type 2 diabetes in MG-treated Wistar rats treated with oral administration of monascin or rosiglitazone. Monascin (a novel PPARγ agonist) activated nuclear factor-erythroid 2-related factor 2 (Nrf2) and down-regulated hyperinsulinmia in oral glucose tolerance test (OGTT). Monascin was able to elevate glyoxalase-1 expression via activation of hepatic Nrf2, hence, resulting in MG metabolism to d-lactic acid and protected from AGEs production in MG-treated rats. Rosiglitazone did not activate Nrf2 nor glyoxalase expression to lower serum and hepatic AGEs levels. Monascin acts as a novel natural Nrf2 activator with PPARγ-agonist activity were confirmed by Nrf2 and PPARγ reporter assays in Hep G2 cells. These findings suggest that monascin acts as an anti-diabetic and anti-oxidative stress agent to a greater degree than rosiglitazone and thus may have therapeutic potential for the prevention of diabetes. PMID:23954466

  17. Withaferin A induces heme oxygenase (HO-1) expression in endothelial cells via activation of the Keap1/Nrf2 pathway.

    PubMed

    Heyninck, Karen; Sabbe, Linde; Chirumamilla, Chandra Sekhar; Szarc Vel Szic, Katarzyna; Vander Veken, Pieter; Lemmens, Kristien J A; Lahtela-Kakkonen, Maija; Naulaerts, Stefan; Op de Beeck, Ken; Laukens, Kris; Van Camp, Guy; Weseler, Antje R; Bast, Aalt; Haenen, Guido R M M; Haegeman, Guy; Vanden Berghe, Wim

    2016-06-01

    Withaferin A (WA), a natural phytochemical derived from the plant Withania somnifera, is a well-studied bioactive compound exerting a broad spectrum of health promoting effects. To gain better insight in the potential therapeutic capacity of WA, we evaluated the transcriptional effects of WA on primary human umbilical vein endothelial cells (HUVECs) and an endothelial cell line (EA.hy926). RNA microarray analysis of WA treated HUVEC cells demonstrated increased expression of the antioxidant gene heme oxygenase (HO-1). Transcriptional regulation of this gene is strongly dependent on the transcription factor NF-E2-related factor 2 (Nrf2), which senses chemical changes in the cell and coordinates transcriptional responses to maintain chemical homeostasis via expression of antioxidant genes and cytoprotective Phase II detoxifying enzymes. Under normal conditions, Nrf2 is kept in the cytoplasm by Kelch-like ECH-associated protein 1 (Keap1), an adaptor protein controlling the half-life of Nrf2 via constant proteasomal degradation. In this study we demonstrate that WA time- and concentration-dependently induces HO-1 expression in endothelial cells via upregulation and increased nuclear translocation of Nrf2. According to the crucial negative regulatory role of Keap1 in Nrf2 expression levels, a direct interaction of WA with Keap1 could be demonstrated. In vitro and in silico evaluations suggest that specific cysteine residues in Keap1 might be involved in the interaction with WA. PMID:27045103

  18. Standardized Extract of Bacopa monniera Attenuates Okadaic Acid Induced Memory Dysfunction in Rats: Effect on Nrf2 Pathway

    PubMed Central

    Nagarajan, Rajasekar; Hanif, Kashif; Siddiqui, Hefazat Husain; Nath, Chandishwar

    2013-01-01

    The aim of the present study is to investigate the effect of standardized extract of Bacopa monnieri (memory enhancer) and Melatonin (an antioxidant) on nuclear factor erythroid 2 related factor 2 (Nrf2) pathway in Okadaic acid induced memory impaired rats. OKA (200 ng) was administered intracerebroventricularly (ICV) to induce memory impairment in rats. Bacopa monnieri (BM-40 and 80 mg/kg) and Melatonin (20 mg/kg) were administered 1 hr before OKA injection and continued daily up to day 13. Memory functions were assessed by Morris water maze test on days 13–15. Rats were sacrificed for biochemical estimations of oxidative stress, neuroinflammation, apoptosis, and molecular studies of Nrf2, HO1, and GCLC expressions in cerebral cortex and hippocampus brain regions. OKA caused a significant memory deficit with oxidative stress, neuroinflammation, and neuronal loss which was concomitant with attenuated expression of Nrf2, HO1, and GCLC. Treatment with BM and Melatonin significantly improved memory dysfunction in OKA rats as shown by decreased latency time and path length. The treatments also restored Nrf2, HO1, and GCLC expressions and decreased oxidative stress, neuroinflammation, and neuronal loss. Thus strengthening the endogenous defense through Nrf2 modulation plays a key role in the protective effect of BM and Melatonin in OKA induced memory impairment in rats. PMID:24078822

  19. Cerebroprotection of Flavanol (−)-Epicatechin after Traumatic Brain Injury via Nrf2-dependent and –independent Pathways

    PubMed Central

    Cheng, Tian; Wang, Wenzhu; Li, Qian; Han, Xiaoning; Xing, Jing; Qi, Cunfang; Lan, Xi; Wan, Jieru; Potts, Alexa; Guan, Fangxia; Wang, Jian

    2016-01-01

    Traumatic brain injury (TBI), which leads to disability, dysfunction, and even death, is a prominent health problem worldwide with no effective treatment. A brain-permeable flavonoid named (−)-epicatechin (EC) modulates redox/oxidative stress and has been shown to be beneficial for vascular and cognitive function in humans and for ischemic and hemorrhagic stroke in rodents. Here we examined whether EC is able to protect the brain against TBI-induced brain injury in mice and if so, whether it exerts neuroprotection by modulating the NF-E2-related factor (Nrf2) pathway. We used the controlled cortical impact model to mimic TBI. EC was administered orally at 3 h after TBI and then every 24 h for either 3 or 7 days. We evaluated lesion volume, brain edema, white matter injury, neurologic deficits, cognitive performance and emotion-like behaviors, neutrophil infiltration, reactive oxygen species (ROS), and a variety of injury-related protein markers. Nrf2 knockout mice were used to determine the role of the Nrf2 signaling pathway after EC treatment. In wild-type mice, EC significantly reduced lesion volume, edema, and cell death and improved neurologic function on days 3 and 28; cognitive performance and depression-like behaviors were also improved with EC administration. In addition, EC reduced white matter injury, heme oxygenase-1 expression, and ferric iron deposition after TBI. These changes were accompanied by attenuation of neutrophil infiltration and oxidative insults, reduced activity of matrix metalloproteinase 9, decreased Keap 1 expression, increased Nrf2 nuclear accumulation, and increased expression of superoxide dismutase 1 and quinone 1. However, EC did not significantly reduce lesion volume or improve neurologic deficits in Nrf2 knockout mice after TBI. Our results show that EC protects the TBI brain by activating the Nrf2 pathway, inhibiting heme oxygenase-1 protein expression, and reducing iron deposition. The latter two effects could represent an

  20. Nrf2, a Guardian of Healthspan and Gatekeeper of Species Longevity

    PubMed Central

    Lewis, Kaitlyn N.; Mele, James; Hayes, John D.; Buffenstein, Rochelle

    2010-01-01

    Although aging is a ubiquitous process that prevails in all organisms, the mechanisms governing both the rate of decline in functionality and the age of onset remain elusive. A profound constitutively upregulated cytoprotective response is commonly observed in naturally long-lived species and experimental models of extensions to lifespan (e.g., genetically-altered and/or experimentally manipulated organisms), as indicated by enhanced resistance to stress and upregulated downstream components of the cytoprotective nuclear factor erythroid 2-related factor 2 (Nrf2)-signaling pathway. The transcription factor Nrf2 is constitutively expressed in all tissues, although levels may vary among organs, with the key detoxification organs (kidney and liver) exhibiting highest levels. Nrf2 may be further induced by cellular stressors including endogenous reactive-oxygen species or exogenous electrophiles. The Nrf2-signaling pathway mediates multiple avenues of cytoprotection by activating the transcription of more than 200 genes that are crucial in the metabolism of drugs and toxins, protection against oxidative stress and inflammation, as well as playing an integral role in stability of proteins and in the removal of damaged proteins via proteasomal degradation or autophagy. Nrf2 interacts with other important cell regulators such as tumor suppressor protein 53 (p53) and nuclear factor-kappa beta (NF-κB) and through their combined interactions is the guardian of healthspan, protecting against many age-related diseases including cancer and neurodegeneration. We hypothesize that this signaling pathway plays a critical role in the determination of species longevity and that this pathway may indeed be the master regulator of the aging process. PMID:21031035

  1. Oxyresveratrol abrogates oxidative stress by activating ERK-Nrf2 pathway in the liver.

    PubMed

    Choi, Hee Yoon; Lee, Ju-Hee; Jegal, Kyung Hwan; Cho, Il Je; Kim, Young Woo; Kim, Sang Chan

    2016-02-01

    Oxyresveratrol is a polyphenolic phytoalexin produced by plants as an antioxidant. This study investigated the hepatoprotective effects of oxyresveratrol as well as its underlying mechanism of action. Here, we evaluated the protective effects of oxyresveratrol against tert-butyl hydroperoxide (tBHP)-induced severe oxidative stress in HepG2 cells as well as acute liver injury caused by carbon tetrachloride (CCl4) in mice. tBHP-induced reactive oxygen species production and cell death in hepatocytes were blocked by oxyresveratrol, as indicated by MTT, TUNEL, and FACS analyses. Moreover, pretreatment with oxyresveratrol increased nuclear translocation and transactivation of NF-E2-related factor 2 (Nrf2), as assessed by antioxidant response element reporter gene expression and immunofluorescence staining, and transactivated expression of both hemeoxygenase-1 and glutamate-cysteine ligase catalytic subunit. More importantly, oxyresveratrol induced phosphorylation of Nrf2 mediated through activation of extracellular signal-regulated kinase 1/2 (ERK1/2). Further, ERK inhibitors such as PD98059 and U0126 blocked phosphorylation of Nrf2 as well as the protective effect of oxyresveratrol in mitochondria. In mice, oral administration of oxyresveratrol significantly prevented hepatocyte degeneration, inflammatory cell infiltration, as well as elevation of plasma markers such as ALT and AST induced by CCl4 injection. In conclusion, this study confirmed that oxyresveratrol protected hepatocytes against oxidative stress and mitochondrial dysfunction, which might be associated with activation of Nrf2. PMID:26102008

  2. Carvedilol, a third-generation β-blocker prevents oxidative stress-induced neuronal death and activates Nrf2/ARE pathway in HT22 cells

    SciTech Connect

    Ouyang, Ying; Chen, Ziwei; Tan, Min; Liu, Anmin; Chen, Meihui; Liu, Jun; Pi, Rongbiao; Fang, Jianpei

    2013-11-29

    Highlights: •Carvedilol significantly prevented oxidative stress-induced cell death. •Carvedilol significantly decreased the production of ROS. •Carvedilol activated Nrf2/ARE pathway. •Carvedilol increased the protein levels of HO-1 and NQO-1. -- Abstract: Carvedilol, a nonselective β-adrenoreceptor blocker with pleiotropic activities has been shown to exert neuroprotective effect due to its antioxidant property. However, the neuroprotective mechanism of carvedilol is still not fully uncovered. Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. Here we investigated the effect of carvedilol on oxidative stress-induced cell death (glutamate 2 mM and H{sub 2}O{sub 2} 600 μM) and the activity of Nrf2/ARE pathway in HT22 hippocampal cells. Carvedilol significantly increased cell viability and decreased ROS in HT22 cells exposed to glutamate or H{sub 2}O{sub 2}. Furthermore, carvedilol activated the Nrf2/ARE pathway in a concentration-dependent manner, and increased the protein levels of heme oxygenase-1(HO-1) and NAD(P)H quinone oxidoreductase-1(NQO-1), two downstream factors of the Nrf2/ARE pathway. Collectively, our results indicate that carvedilol protects neuronal cell against glutamate- and H{sub 2}O{sub 2}-induced neurotoxicity possibly through activating the Nrf2/ARE signaling pathway.

  3. Sulforaphane Protects against Cardiovascular Disease via Nrf2 Activation

    PubMed Central

    Bai, Yang; Wang, Xiaolu; Zhao, Song; Ma, Chunye; Cui, Jiuwei; Zheng, Yang

    2015-01-01

    Cardiovascular disease (CVD) causes an unparalleled proportion of the global burden of disease and will remain the main cause of mortality for the near future. Oxidative stress plays a major role in the pathophysiology of cardiac disorders. Several studies have highlighted the cardinal role played by the overproduction of reactive oxygen or nitrogen species in the pathogenesis of ischemic myocardial damage and consequent cardiac dysfunction. Isothiocyanates (ITC) are sulfur-containing compounds that are broadly distributed among cruciferous vegetables. Sulforaphane (SFN) is an ITC shown to possess anticancer activities by both in vivo and epidemiological studies. Recent data have indicated that the beneficial effects of SFN in CVD are due to its antioxidant and anti-inflammatory properties. SFN activates NF-E2-related factor 2 (Nrf2), a basic leucine zipper transcription factor that serves as a defense mechanism against oxidative stress and electrophilic toxicants by inducing more than a hundred cytoprotective proteins, including antioxidants and phase II detoxifying enzymes. This review will summarize the evidence from clinical studies and animal experiments relating to the potential mechanisms by which SFN modulates Nrf2 activation and protects against CVD. PMID:26583056

  4. Mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after intracranial hemorrhage

    PubMed Central

    Yin, Xiao-ping; Chen, Zhi-ying; Zhou, Jun; Wu, Dan; Bao, Bing

    2015-01-01

    Background It has been found that nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2–ARE) signaling pathway plays a role in antioxidative response, anti-inflammatory response, and neuron-protection in intracerebral hemorrhage (ICH). The aim of this study is to explore mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after ICH. Methods There were a total of 90 rats with basal ganglia hemorrhage, which were randomly divided into the following four groups: ICH (Sprague–Dawley rats with autologous femoral arterial blood injection into the basal ganglia), sulforaphane (SFN) (SFN was intraperitoneally administered into rats), retinoic acid (RA) (RA was intraperitoneally administered into rats), and dimethyl sulfoxide (the rats were treated with dimethyl sulfoxide). We observed the neurological score of the rats in the different groups, and collected brain tissues for immunofluorescence, Western blot, and reverse transcription polymerase chain reaction to detect expression of Nrf2, heme oxygenase (HO-1), nuclear factor-κB (NF-κB), and tumor necrosis factor-α (TNF-α). Results The results indicated that neurological dysfunction of rats was significantly improved in the SFN group, and the expressions of Nrf2 and HO-1 in tissues surrounding the hemorrhage were increased. Also, the level of NF-κB and TNF-α were reduced compared to the ICH group. The RA group exhibited more severe neurological dysfunction and lower levels of Nrf2 and HO-1 than the SFN and ICH groups. Compared to the ICH group, the NF-κB and TNF-α expression in the RA groups was increased. In conclusion, RA inhibits Nrf2 dissociation and translocation into nucleus, thereby suppressing the anti-inflammatory effect of Nrf2–ARE signaling pathway. The activation of Nrf2–ARE signaling pathway by SFN can elevate expression of antioxidant enzyme HO-1, reduce perifocal inflammatory response after ICH, and thus may play a

  5. Broccoli sprout extract prevents diabetic cardiomyopathy via Nrf2 activation in db/db T2DM mice

    PubMed Central

    Xu, Zheng; Wang, Shudong; Ji, Honglei; Zhang, Zhiguo; Chen, Jing; Tan, Yi; Wintergerst, Kupper; Zheng, Yang; Sun, Jian; Cai, Lu

    2016-01-01

    To develop a clinic-relevant protocol for systemic up-regulation of NFE2-related factor 2 (Nrf2) to prevent diabetic cardiomyopathy (DCM), male db/db and age-matched wild-type (WT) mice were given sulforaphane (SFN, an Nrf2 activator) and its natural source, broccoli sprout extract (BSE) by gavage every other day for 3 months, with four groups: vehicle (0.1 ml/10 g), BSE-low dose (estimated SFN availability at 0.5 mg/kg), BSE-high dose (estimated SFN availability at 1.0 mg/kg), and SFN (0.5 mg/kg). Cardiac function and pathological changes (hypertrophy, fibrosis, inflammation and oxidative damage) were assessed by echocardiography and histopathological examination along with Western blot and real-time PCR, respectively. Both BSE and SFN significantly prevented diabetes-induced cardiac dysfunction, hypertrophy and fibrosis. Mechanistically, BSE, like SFN, significantly up-regulated Nrf2 transcriptional activity, evidenced by the increased Nrf2 nuclear accumulation and its downstream gene expression. This resulted in a significant prevention of cardiac oxidative damage and inflammation. For all these preventive effects, BSE at high dose provided a similar effect as did SFN. These results indicated that BSE at high dose prevents DCM in a manner congruent with SFN treatment. Therefore, it suggests that BSE could potentially be used as a natural and safe treatment against DCM via Nrf2 activation. PMID:27457280

  6. Broccoli sprout extract prevents diabetic cardiomyopathy via Nrf2 activation in db/db T2DM mice.

    PubMed

    Xu, Zheng; Wang, Shudong; Ji, Honglei; Zhang, Zhiguo; Chen, Jing; Tan, Yi; Wintergerst, Kupper; Zheng, Yang; Sun, Jian; Cai, Lu

    2016-01-01

    To develop a clinic-relevant protocol for systemic up-regulation of NFE2-related factor 2 (Nrf2) to prevent diabetic cardiomyopathy (DCM), male db/db and age-matched wild-type (WT) mice were given sulforaphane (SFN, an Nrf2 activator) and its natural source, broccoli sprout extract (BSE) by gavage every other day for 3 months, with four groups: vehicle (0.1 ml/10 g), BSE-low dose (estimated SFN availability at 0.5 mg/kg), BSE-high dose (estimated SFN availability at 1.0 mg/kg), and SFN (0.5 mg/kg). Cardiac function and pathological changes (hypertrophy, fibrosis, inflammation and oxidative damage) were assessed by echocardiography and histopathological examination along with Western blot and real-time PCR, respectively. Both BSE and SFN significantly prevented diabetes-induced cardiac dysfunction, hypertrophy and fibrosis. Mechanistically, BSE, like SFN, significantly up-regulated Nrf2 transcriptional activity, evidenced by the increased Nrf2 nuclear accumulation and its downstream gene expression. This resulted in a significant prevention of cardiac oxidative damage and inflammation. For all these preventive effects, BSE at high dose provided a similar effect as did SFN. These results indicated that BSE at high dose prevents DCM in a manner congruent with SFN treatment. Therefore, it suggests that BSE could potentially be used as a natural and safe treatment against DCM via Nrf2 activation. PMID:27457280

  7. The Crosstalk Between Nrf2 and AMPK Signal Pathways Is Important for the Anti-Inflammatory Effect of Berberine in LPS-Stimulated Macrophages and Endotoxin-Shocked Mice

    PubMed Central

    Mo, Chunfen; Wang, Ling; Zhang, Jie; Numazawa, Satoshi; Tang, Hong; Tang, Xiaoqiang; Han, XiaoJuan; Li, Junhong; Yang, Ming; Wang, Zhe; Wei, Dandan

    2014-01-01

    Abstract Aims: The response of AMP-activated protein kinase (AMPK) to oxidative stress has been recently reported but the downstream signals of this response are largely unknown. Meanwhile, the upstream events for the activation of nuclear factor erythroid-2-related factor-2 (Nrf2), a critical transcriptional activator for antioxidative responses, remain unclear. In the present study, we investigated the relationship between AMPK and Nrf2 signal pathways in lipopolysaccharide (LPS)-triggered inflammatory system, in which berberine (BBR), a known AMPK activator, was used for inflammation suppression. Results and Innovation: In inflammatory macrophages, BBR attenuated LPS-induced expression of inflammatory genes (inducible nitric oxide synthase [iNOS], cyclooxygenase-2 [COX2], interleukin [IL]-6), and the generation of nitric oxide and reactive oxygen species, but increased the transcription of Nrf2-targeted antioxidative genes (NADPH quinone oxidoreductase-1 [NQO-1], heme oxygenase-1 [HO-1]), as well as the nuclear localization and phosphorylation of Nrf2 protein. Importantly, we found BBR-induced activation of Nrf2 is AMPK-dependent, as either pharmacologically or genetically inactivating AMPK blocked the activation of Nrf2. Consistent with in vitro experiments, BBR down-regulated the expression of proinflammatory genes but upregulated those of Nrf2-targeted genes in lungs of LPS-injected mice, and these effects were attenuated in Nrf2-deficient mice. Moreover, the effect of BBR on survival time extension and plasma redox regulation in endotoxin-shocked mice was largely weakened when Nrf2-depleted. Conclusions: Our results demonstrate convergence between AMPK and Nrf2 pathways and this intersection is essential for anti-inflammatory effect of BBR in LPS-stimulated macrophages and endotoxin-shocked mice. Uncovering this intersection is significant for understanding the relationship between energy homeostasis and antioxidative responses and may be beneficial for

  8. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages

    SciTech Connect

    Gu, Da-min; Lu, Pei-Hua; Zhang, Ke; Wang, Xiang; Sun, Min; Chen, Guo-Qian; Wang, Qiong

    2015-02-13

    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. - Highlights: • Pre-treatment of astragaloside IV (AS-IV) protects murine cortical neurons from OGD/R. • AS-IV activates Nrf2-ARE signaling in murine cortical neurons. • Nrf2 is required for AS-IV-mediated anti-oxidant and neuroprotective activities. • AS-IV stimulates HB-EGF release to trans-activate EGFR in murine cortical neurons. • EGFR mediates AS-IV-induced Nrf2 activation and neuroprotection against OGD/R.

  9. Posttreatment with 11-Keto-β-Boswellic Acid Ameliorates Cerebral Ischemia-Reperfusion Injury: Nrf2/HO-1 Pathway as a Potential Mechanism.

    PubMed

    Ding, Yi; Chen, MinChun; Wang, MingMing; Li, YuWen; Wen, AiDong

    2015-12-01

    Oxidative stress is well known to play a pivotal role in cerebral ischemia-reperfusion injury. The nuclear factor erythroid-2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway has been considered a potential target for neuroprotection in stroke. 11-Keto-β-boswellic acid (KBA) is a triterpenoid compound from extracts of Boswellia serrata. The aim of the present study was to determine whether KBA, a novel Nrf2 activator, can protect against cerebral ischemic injury. Middle cerebral artery occlusion (MCAO) was operated on male Sprague-Dawley rats. KBA (25 mg/kg) applied 1 h after reperfusion significantly reduced infarct volumes and apoptotic cells as well as increased neurologic scores at 48 h after reperfusion. Meanwhile, posttreatment with KBA significantly decreased malondialdehyde (MDA) levels, restored the superoxide dismutase (SOD) activity, and increased the protein Nrf2 and HO-1 expression in brain tissues. In primary cultured astrocytes, KBA increased the Nrf2 and HO-1 expression, which provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. But knockdown of Nrf2 or HO-1 attenuated the protective effect of KBA. In conclusion, these findings provide evidence that the neuroprotection of KBA against oxidative stress-induced ischemic injury involves the Nrf2/HO-1 pathway. PMID:25452227

  10. Nrf2 activation ameliorates cytotoxic effects of arsenic trioxide in acute promyelocytic leukemia cells through increased glutathione levels and arsenic efflux from cells.

    PubMed

    Nishimoto, Shoichi; Suzuki, Toshihiro; Koike, Shin; Yuan, Bo; Takagi, Norio; Ogasawara, Yuki

    2016-08-15

    Carnosic acid (CA), a phenolic diterpene isolated from Rosmarinus officinalis, has been shown to activate nuclear transcription factor E2-related factor 2 (Nrf2), which plays a central role in cytoprotective responses to oxidative and electrophilic stress. Recently, the Nrf2-Kelch ECH associating protein 1 (Keap1) pathway has been associated with cancer drug resistance attributable to modulation of the expression and activation of antioxidant and detoxification enzymes. However, the exact mechanisms by which Nrf2 activation results in chemoresistance are insufficiently understood to date. This study investigated the mechanisms by which the cytotoxic effects of arsenic trioxide (ATO), an anticancer drug, were decreased in acute promyelocytic leukemia cells treated with CA, a typical activator of Nrf2 used to stimulate the Nrf2/Keap1 system. Our findings suggest that arsenic is non-enzymatically incorporated into NB4 cells and forms complexes that are dependent on intracellular glutathione (GSH) concentrations. In addition, the arsenic complexes are recognized as substrates by multidrug resistance proteins and subsequently excreted from the cells. Therefore, Nrf2-associated activation of the GSH biosynthetic pathway, followed by increased levels of intracellular GSH, are key mechanisms underlying accelerated arsenic efflux and attenuation of the cytotoxic effects of ATO. PMID:27317373

  11. Effects of Ginger Phenylpropanoids and Quercetin on Nrf2-ARE Pathway in Human BJ Fibroblasts and HaCaT Keratinocytes

    PubMed Central

    Schadich, Ermin; Hlaváč, Jan; Volná, Tereza; Varanasi, Lakshman; Hajdúch, Marián; Džubák, Petr

    2016-01-01

    Quercetin and phenylpropanoids are well known chemoprotective compounds identified in many plants. This study was aimed at determining their effects on activation of Nuclear factor erythroid 2-related factor 2 (Nrf2) antioxidant response element (Nrf2-ARE) signalling pathway and expression of its important downstream effector phase II detoxification enzyme glutathione-S-transferase P1 (GSTP1) in BJ foreskin fibroblasts and skin HaCaT keratinocytes. Cell lines and their corresponding Nrf2-ARE luciferase reporter cells were treated by ginger phenylpropanoids and quercetin for 10 h and the level of Nrf2 activity was subsequently determined. Both, ginger phenylpropanoids and quercetin, significantly increased the level of Nrf2 activity. Subsequent western blot analyses of proteins showed the increased expression level of glutathione-S-transferase P1 (GSTP1) in BJ cells but not in HaCaT cells. Such phenomenon of unresponsive downstream target expression in HaCaT cells was consistent with previous studies showing a constitutive expression of their GSTP1. Thus, while both ginger phenylpropanoids and quercetin have the property of increasing the level of Nrf2 both in HaCaT and in BJ cells, their effects on its downstream signalling were mediated only in BJ cells. PMID:26942188

  12. Induction of the pi class of glutathione S-transferase by carnosic acid in rat Clone 9 cells via the p38/Nrf2 pathway.

    PubMed

    Lin, Chia-Yuan; Wu, Chi-Rei; Chang, Shu-Wei; Wang, Yu-Jung; Wu, Jia-Jiuan; Tsai, Chia-Wen

    2015-06-01

    Induction of phase II enzymes is important in cancer chemoprevention. We compared the effect of rosemary diterpenes on the expression of the pi class of glutathione S-transferase (GSTP) in rat liver Clone 9 cells and the signaling pathways involved. Culturing cells with 1, 5, 10, or 20 μM carnosic acid (CA) or carnosol (CS) for 24 h in a dose-dependent manner increased the GSTP expression. CA was more potent than CS. The RNA level and the enzyme activity of GSTP were also enhanced by CA treatment. Treatment with 10 μM CA highly induced the reporter activity of the enhancer element GPEI. Furthermore, CA markedly increased the translocation of nuclear factor erythroid-2 related factor 2 (Nrf2) from the cytosol to the nucleus after 30 to 60 min. CA the stimulated the protein induction of p38, nuclear Nrf2, and GSTP was diminished in the presence of SB203580 (a p38 inhibitor). In addition, SB203580 pretreatment or silencing of Nrf2 by siRNA suppressed the CA-induced GPEI-DNA binding activity and GSTP protein expression. Knockdown of p38 or Nrf2 by siRNA abolished the activation of p38 and Nrf2 as well as the protein induction and enzyme activity of GSTP by CA. These results suggest that CA up-regulates the expression and enzyme activity of GSTP via the p38/Nrf2/GPEI pathway. PMID:25974399

  13. P450 3A-Catalyzed O-Dealkylation of Lapatinib Induces Mitochondrial Stress and Activates Nrf2.

    PubMed

    Eno, Marsha Rebecca; El-Gendy, Bahaa El-Dien M; Cameron, Michael D

    2016-05-16

    Lapatinib (LAP), an oral tyrosine kinase inhibitor for the treatment of metastatic breast cancer, has been associated with idiosyncractic hepatotoxicity. Recent investigations have implicated the importance of P450 3A4/5 enzymes in the formation of an electrophilic quinone imine (LAPQI) metabolite generated through further oxidation of O-dealkylated lapatinib (OD-LAP). In the current study, hepatic stress was observed via mitochondrial impairment. OD-LAP caused a time- and concentration-dependent decrease in oxygen consumption in HepG2 cells, whereas LAP did not alter the oxygen consumption rate. Interestingly, however, HepG2 cells transfected with human P450 3A4 did exhibit mitochondrial dysfunction via P450 3A4-mediated metabolism of LAP to OD-LAP. OD-LAP-induced mitochondrial toxicity was enhanced upon depletion of intracellular GSH levels, demonstrating that cellular GSH levels are important in the protection of mitochondrial function against LAPQI. Given the nature of LAPQI and the importance of GSH levels in LAP-induced mitochondrial stress, the activation of nuclear factor erythroid 2-related factor 2 (Nrf2) was evaluated, as this transcription factor induces the expression of NAD(P)H quinone oxidoreductase 1, glutathione S-transferase, UDP-glucuronosyltransferases, and glutathione synthetase, all of which might be expected to decrease the toxicity of LAP. Using a FRET-based target gene assay in HepG2 cells, OD-LAP was indeed found to activate Nrf2. Follow-up assays showed increased mRNA levels of Nrf2 target genes after a 4 h treatment with OD-LAP but not with LAP. LAP activation of Nrf2 was observed only when HepG2 cells were transduced with P450 3A4. The significance of Nrf2 protection was established in vivo in Nrf2-KO mice. Increased transaminase levels were found after a single LAP dose in both Nrf2-KO and control mice, indicating elevated hepatic necrosis, although transaminase levels reverted to baseline levels in the control mice upon repeat dosing

  14. Contribution of Nrf2 to Atherogenic Phenotype Switching of Coronary Arterial Smooth Muscle Cells Lacking CD38 Gene

    PubMed Central

    Xu, Ming; Li, Xiao-Xue; Wang, Lei; Wang, Mi; Zhang, Yang; Li, Pin-Lan

    2015-01-01

    Background/Aims Recent studies have indicated that CD38 gene deficiency results in dedifferentiation or transdifferentiation of arterial smooth muscle cells upon atherogenic stimulations. However, the molecular mechanisms mediating this vascular smooth muscle (SMC) phenotypic switching remain unknown. Methods & Results In the present study, we first characterized the phenotypic change in the primary cultures of coronary arterial myocytes (CAMs) from CD38−/− mice. It was shown that CD38 deficiency decreased the expression of contractile marker calponin, SM22α and α-SMA but increased the expression of SMC dedifferentiation marker, vimentin, which was accompanied by enhanced cell proliferation. This phenotypic change in CD38−/− CAMs was enhanced by 7-ketocholesterol (7-Ket), an atherogenic stimulus. We further found that the CD38 deficiency decreased the expression and activity of nuclear factor E2-related factor 2 (Nrf2), a basic leucine zipper (bZIP) transcription factor sensitive to redox regulation. Similar to CD38 deletion, Nrf2 gene silencing increased CAM dedifferentiation upon 7-Ket stimulation. In contrast, the overexpression of Nrf2 gene abolished 7-Ket-induced dedifferentiation in CD38−/− CAMs. Given the sensitivity of Nrf2 to oxidative stress, we determined the role of redox signaling in the regulation of Nrf2 expression and activity associated with CD38 effect in CAM phenotype changes. It was demonstrated that in CD38−/− CAMs, 7-Ket failed to stimulate the production of O2−., while in CD38+/+ CAMs 7-Ket induced marked O2−. production and enhancement of Nrf2 activity, which was substantially attenuated by NOX4 gene silencing. Finally, we demonstrated that 7-Ket-induced and NOX4-dependent O2−. production was inhibited by 8-Br-cADPR, an antagonist of cADPR or NED-19, an antagonist of NAADP as product of CD38 ADP-ribosylcyclase, which significantly inhibited the level of cytosolic Ca2+ and the activation of Nrf2 under 7-Ket. Conclusion

  15. Nrf2-dependent protection against acute sodium arsenite toxicity in zebrafish.

    PubMed

    Fuse, Yuji; Nguyen, Vu Thanh; Kobayashi, Makoto

    2016-08-15

    Transcription factor Nrf2 induces a number of detoxifying enzymes and antioxidant proteins to confer protection against the toxic effects of a diverse range of chemicals including inorganic arsenicals. Although a number of studies using cultured cells have demonstrated that Nrf2 has a cell-protective function against acute and high-dose arsenic toxicity, there is no clear in vivo evidence of this effect. In the present study, we genetically investigated the protective role of Nrf2 against acute sodium arsenite toxicity using the zebrafish Nrf2 mutant, nrf2a(fh318). After treatment with 1mM sodium arsenite, the survival of nrf2a(fh318) larvae was significantly shorter than that of wild-type siblings, suggesting that Nrf2 protected the zebrafish larvae against high-dose arsenite exposure. To understand the molecular basis of the Nrf2-dependent protection, we analyzed the gene expression profiles after arsenite exposure, and found that the genes involved in the antioxidative function (prdx1 and gclc), arsenic metabolism (gstp1) and xenobiotic elimination (abcc2) were induced in an Nrf2-dependent manner. Furthermore, pre-treatment with sulforaphane, a well-known Nrf2 activator improved the survival of zebrafish larvae after arsenic exposure. Based on these results, we concluded that Nrf2 plays a fundamental and conserved role in protection against acute sodium arsenite toxicity. PMID:27306194

  16. NRF2 and p53: Januses in cancer?

    PubMed Central

    Rotblat, Barak; Melino, Gerry; Knight, Richard A.

    2012-01-01

    The transcription factor nuclear factor (erythroid-derived 2)-like 2, also known as NFE2L2 or NRF2, is a master regulator of the anti-oxidative stress response and positively controls the expression of a battery of anti-oxidative stress response proteins and enzymes implicated in detoxification and glutathione generation. Although its detoxifying activity is important in cancer prevention, it has recently been shown that cancer cells also exploit its protective functions to thrive and resist chemotherapy. NRF2 was also shown to the pentose phosphate pathway and glutaminolysis, which promotes purine synthesis for supporting rapid proliferation and glutathione for providing anti-oxidative stress protection. Evidence obtained from cancer patients and cell lines suggest that NRF2 is highly active in a variety of human cancers and is associated with aggressiveness. p53 is a tumor suppressor that also promotes an anti-oxidative stress metabolic program and glutaminolysis. Here we will discuss the similarities between NRF2 and p53 and review evidence that p53 might be exploited by cancer cells to gain protection against oxidative stress, as is the case for NRF2. We discuss findings of co-regulation between these transcription factors and propose possible therapeutic strategies that can be used for treatment of cancers that harbor WT p53 and express high levels of NRF2. PMID:23174755

  17. NRF2 Regulates PINK1 Expression under Oxidative Stress Conditions

    PubMed Central

    Murata, Hitoshi; Takamatsu, Hitoshi; Liu, Sulai; Kataoka, Ken; Huh, Nam-ho; Sakaguchi, Masakiyo

    2015-01-01

    Mutations of the PTEN-induced putative kinase 1 (PINK1) gene are a cause of autosomal recessive forms of Parkinson’s disease. Recent studies have revealed that PINK1 is an essential factor for controlling mitochondrial quality, and that it protects cells from oxidative stresses. Although there has been considerable progress in the elucidation of various aspects of PINK1 protein regulation such as activation, stability and degradation, the transcriptional regulation of PINK1 mRNA under stress conditions remains unclear. In this study, we found that nuclear factor (erythroid-derived 2)-like 2 (NRF2), an antioxidant transcription factor, regulates PINK1 expression under oxidative stress conditions. Damaged mitochondria arising from stress conditions induced NRF2-dependent transcription of the PINK1 gene through production of reactive oxygen species (ROS). Either an ROS scavenger or forced expression of KEAP1, a potent inhibitory partner to NRF2, restricted PINK1 expression induced by activated NRF2. Transcriptionally up-regulated PINK1 diminished oxidative stress-associated cell death. The results indicate that PINK1 expression is positively regulated by NRF2 and that the NRF2-PINK1 signaling axis is deeply involved in cell survival. PMID:26555609

  18. Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation

    SciTech Connect

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han

    2015-09-25

    Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death.

  19. Nrf2 Deficiency Improves Glucose Tolerance in Mice Fed a High-Fat Diet

    PubMed Central

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-01-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. PMID:23017736

  20. The protective role of Nrf2-Gadd45b against antimony-induced oxidative stress and apoptosis in HEK293 cells.

    PubMed

    Jiang, Xingkang; An, Zesheng; Lu, Chao; Chen, Yue; Du, E; Qi, Shiyong; Yang, Kuo; Zhang, Zhihong; Xu, Yong

    2016-08-10

    Antimony (Sb) is one of the most prevalent heavy metals and frequently causes biological toxicity. However, the specific mechanisms by which Sb elicits its toxic effects remains to be fully elucidated. In this study, we found antimony trioxide (Sb2O3) caused a dose-dependent cytotoxicity against HEK293 cells, and Sb2O3-induced excessive reactive oxygen species (ROS) was closely correlated with increased cell apoptosis. Mechanistic investigation manifested that nuclear factor NF-E2-related factor 2 (Nrf2) expression and nuclear translocation were significantly induced under Sb2O3 treatment in HEK293 cells, and Nrf2 knockdown aggregated Sb2O3-induced cell apoptosis. Moreover, elevated Gadd45b expression actives the phosphorylation of MAPKs upon Sb2O3 exposure, whereas Gadd45b knockdown diminished Sb2O3-induced activation of MAPKs and promoted cell apoptosis. In the meantime, however, the antioxidant N-acetylcysteine (NAC) was found to ameliorate Nrf2 expression and nuclear translocation as well as Gadd45b expression and MAPKs activation by repressing Sb2O3-induced ROS production. More importantly, we found Gadd45b was transcriptionally enhanced by Nrf2 through binding to three canonical antioxidant response elements (AREs) within its promoter region. Either Sb2O3 or TBHQ (a selective Nrf2 activator) treatment, Gadd45b expression was significantly increased by luciferase assay. Nrf2 inhibition greatly diminished Gadd45b expression due to reduced binding of Nrf2 in Gadd45b promoter under Sb2O3 treatment. To summarize, this study demonstrated the Nrf2-Gadd45b signaling axis exhibited a protective role in Sb-induced cell apoptosis. PMID:27208483

  1. Interplay between the chalcone cardamonin and selenium in the biosynthesis of Nrf2-regulated antioxidant enzymes in intestinal Caco-2 cells.

    PubMed

    De Spirt, Silke; Eckers, Anna; Wehrend, Carina; Micoogullari, Mustafa; Sies, Helmut; Stahl, Wilhelm; Steinbrenner, Holger

    2016-02-01

    Selenoenzymes and nuclear factor erythroid 2-related factor 2 (Nrf2)-regulated phase II enzymes comprise key components of the cellular redox and antioxidant systems, which show multiple interrelations. Deficiency of the micronutrient selenium (Se) and impaired biosynthesis of selenoproteins have been reported to result in induction of Nrf2 target genes. Conversely, transcription of the selenoenzymes glutathione peroxidase 2 (GPx2) and thioredoxin reductase 1 (TrxR1) is up-regulated upon Nrf2 activation. Here, we have studied the interplay between Se and the secondary plant metabolite cardamonin, an Nrf2-activating chalcone, in the regulation of Nrf2-controlled antioxidant enzymes. Se-deficient and Se-repleted (sodium selenite-supplemented) human intestinal Caco-2 cells were exposed to cardamonin. Uptake of cardamonin by the Caco-2 cells was independent of their Se status. Cardamonin strongly induced gene expression of GPx2 and TrxR1. However, cardamonin treatment did not result in elevated GPx or TrxR activity and protein levels, possibly relating to a concomitant down-regulation of O-phosphoseryl-tRNA(Sec) kinase (PSTK), an enzyme involved in translation of selenoprotein mRNAs. On the other hand, induction of the Nrf2-regulated enzyme heme oxygenase 1 (HO-1) by cardamonin was diminished in Se-replete compared to Se-deficient cells. Our findings suggest that cardamonin interferes with the biosynthesis of Nrf2-regulated selenoenzymes, in contrast to the Nrf2-activating isothiocyanate compound sulforaphane, which has been shown earlier to synergize with Se-mediated cytoprotection. Conversely, the cellular Se status apparently affects the cardamonin-mediated induction of non-selenoprotein antioxidant enzymes such as HO-1. PMID:26698667

  2. Nuclear factor erythroid-2 related factor 2 overexpressed mesenchymal stem cells transplantation, improves renal function, decreases injuries markers and increases repair markers in glycerol-induced Acute kidney injury rats

    PubMed Central

    Zhaleh, Fateme; Amiri, Fatemeh; Mohammadzadeh-Vardin, Mohammad; Bahadori, Marzie; Harati, Mitra Dehghan; Roudkenar, Mehryar Habibi; Saki, Sasan

    2016-01-01

    Objective(s): Recently cell therapy is a promising therapeutic modality for many types of disease including acute kidney injury (AKI). Due to the unique biological properties, mesenchymal stem cells (MSCs) are attractive cells in this regard. This study aims to transplant MSCs equipped with nuclear factor E2-related factor 2 (Nrf2) in rat experimental models of acute kidney and evaluate regeneration potential of injured kidney especially expression of injury and repaired biomarkers. Materials and methods: Nrf2 was overexpressed in bone marrow-derived MSCs by pcDNA.3.1 plasmid. AKI was induced using glycerol in rat models. The regenerative potential of Nrf2-overexpressed MSCs was evaluated in AKI-Induced animal models using biochemical and histological methods after transplantation. Expression of repaired genes, AQP1 and CK-18, as well as injury markers, Kim-1 and Cystatin C, was also assayed in engrafted kidney sections. Results: Our results revealed that transplantation of Nrf2-overexpressed MSCs into AKI-induced rats decreased blood urea nitrogen and creatinine and ameliorated kidney regeneration throughout 14 days. Upregulation of repaired markers and downregulation of injury markers were considerable 14 days after transplantation. Conclusions: Overexpression of Nrf2 in MSCs suggests a new strategy to increase efficiency of MSC-based cell therapy in AKI. PMID:27114803

  3. Heme oxygenase 1 plays role of neuron-protection by regulating Nrf2-ARE signaling post intracerebral hemorrhage.

    PubMed

    Yin, Xiao-Ping; Wu, Dan; Zhou, Jun; Chen, Zhi-Ying; Bao, Bing; Xie, Liang

    2015-01-01

    The NF-E2 related factor 2 (Nrf2) could be activated in intracerebral hemorrhage (ICH), and trigger the expression of ARE regulated heme oxygenase 1 (HO-1) subsequently. This study aims to explore neuroprotection of HO-1 protein in regulating the Nrf2-ARE signaling pathway in ICH. In this study, the femoral artery injection method was used to establish the ICH model. The zinc porphyrin-9 (ZPP-IX) was used to inhibit the HO-1 expression in ICH rats. The ICH rats were randomly divided into 3 groups, ICH group, ZPP-IX (10 mg/kg) + ICH group and DMSO (10 mg/kg) + ICH group. Neurological scores were evaluated for the 3 groups. Double immunofluorescence staining method was employed to observe the co-expression of HO-1, Nrf2, NF-κB and TNF-α and CD11b in glia cells. Western blot and RT-PCR assay were used to detect the total Nrf2, binding Nrf2, HO-1, NF-κB and TNF-α expression. The results indicated that ZPP-IX could aggravate the neurological dyafunstions of ICH rats. The HO-1 level in ZPP-IX group was significantly decreased compared to the ICH group (P < 0.05). The binding-Nrf2 protein was significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The NF-κB and TNF-α level were significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The ZPP-IX significantly inhibited the HO-1 and Nrf2, and enhanced NF-κB and TNF-α co-expressing with the CD11b compared to the ICH group (P < 0.05). In conclusion, HO-1 protein regulates the Nrf2-ARE pathway in ICH model by inhibiting the Nrf2 entering nucleus and activating the NF-κB and TNF-α expression. PMID:26617723

  4. Heme oxygenase 1 plays role of neuron-protection by regulating Nrf2-ARE signaling post intracerebral hemorrhage

    PubMed Central

    Yin, Xiao-Ping; Wu, Dan; Zhou, Jun; Chen, Zhi-Ying; Bao, Bing; Xie, Liang

    2015-01-01

    The NF-E2 related factor 2 (Nrf2) could be activated in intracerebral hemorrhage (ICH), and trigger the expression of ARE regulated heme oxygenase 1 (HO-1) subsequently. This study aims to explore neuroprotection of HO-1 protein in regulating the Nrf2-ARE signaling pathway in ICH. In this study, the femoral artery injection method was used to establish the ICH model. The zinc porphyrin-9 (ZPP-IX) was used to inhibit the HO-1 expression in ICH rats. The ICH rats were randomly divided into 3 groups, ICH group, ZPP-IX (10 mg/kg) + ICH group and DMSO (10 mg/kg) + ICH group. Neurological scores were evaluated for the 3 groups. Double immunofluorescence staining method was employed to observe the co-expression of HO-1, Nrf2, NF-κB and TNF-α and CD11b in glia cells. Western blot and RT-PCR assay were used to detect the total Nrf2, binding Nrf2, HO-1, NF-κB and TNF-α expression. The results indicated that ZPP-IX could aggravate the neurological dyafunstions of ICH rats. The HO-1 level in ZPP-IX group was significantly decreased compared to the ICH group (P < 0.05). The binding-Nrf2 protein was significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The NF-κB and TNF-α level were significantly increased in ZPP-IX group compared to ICH group (P < 0.05). The ZPP-IX significantly inhibited the HO-1 and Nrf2, and enhanced NF-κB and TNF-α co-expressing with the CD11b compared to the ICH group (P < 0.05). In conclusion, HO-1 protein regulates the Nrf2-ARE pathway in ICH model by inhibiting the Nrf2 entering nucleus and activating the NF-κB and TNF-α expression. PMID:26617723

  5. A novel natural Nrf2 activator with PPARγ-agonist (monascin) attenuates the toxicity of methylglyoxal and hyperglycemia

    SciTech Connect

    Hsu, Wei-Hsuan; Lee, Bao-Hong; Chang, Yu-Ying; Hsu, Ya-Wen; Pan, Tzu-Ming

    2013-11-01

    Methylglyoxal (MG) is a toxic-glucose metabolite and a major precursor of advanced glycation endproducts (AGEs). MG has been reported to result in inflammation by activating receptor for AGEs (RAGE). We recently found that Monascus-fermented metabolite monascin acts as a novel natural peroxisome proliferator-activated receptor-γ (PPARγ) agonist that improves insulin sensitivity. We investigated the metabolic, biochemical, and molecular abnormalities characteristic of type 2 diabetes in MG-treated Wistar rats treated with oral administration of monascin or rosiglitazone. Monascin (a novel PPARγ agonist) activated nuclear factor-erythroid 2-related factor 2 (Nrf2) and down-regulated hyperinsulinmia in oral glucose tolerance test (OGTT). Monascin was able to elevate glyoxalase-1 expression via activation of hepatic Nrf2, hence, resulting in MG metabolism to D-lactic acid and protected from AGEs production in MG-treated rats. Rosiglitazone did not activate Nrf2 nor glyoxalase expression to lower serum and hepatic AGEs levels. Monascin acts as a novel natural Nrf2 activator with PPARγ-agonist activity were confirmed by Nrf2 and PPARγ reporter assays in Hep G2 cells. These findings suggest that monascin acts as an anti-diabetic and anti-oxidative stress agent to a greater degree than rosiglitazone and thus may have therapeutic potential for the prevention of diabetes. - Highlights: • Monascin acts as a PPARgamma agonist. • Monascin activates Nrf2 and AMPK. • Monascin promotes MG metabolism into D-lactic acid. • Monascin attenuates inflammation and diabetes in vivo.

  6. Epigenetic modifications of triterpenoid ursolic acid in activating Nrf2 and blocking cellular transformation of mouse epidermal cells.

    PubMed

    Kim, Hyuck; Ramirez, Christina N; Su, Zheng-Yuan; Kong, Ah-Ng Tony

    2016-07-01

    Ursolic acid (UA), a well-known natural triterpenoid found in abundance in blueberries, cranberries and apple peels, has been reported to possess many beneficial health effects. These effects include anticancer activity in various cancers, such as skin cancer. Skin cancer is the most common cancer in the world. Nuclear factor E2-related factor 2 (Nrf2) is a master regulator of antioxidative stress response with anticarcinogenic activity against UV- and chemical-induced tumor formation in the skin. Recent studies show that epigenetic modifications of Nrf2 play an important role in cancer prevention. However, the epigenetic impact of UA on Nrf2 signaling remains poorly understood in skin cancer. In this study, we investigated the epigenetic effects of UA on mouse epidermal JB6 P+ cells. UA inhibited cellular transformation by 12-O-tetradecanoylphorbol-13-acetate at a concentration at which the cytotoxicity was no more than 25%. Under this condition, UA induced the expression of the Nrf2-mediated detoxifying/antioxidant enzymes heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 and UDP-glucuronosyltransferase 1A1. DNA methylation analysis revealed that UA demethylated the first 15 CpG sites of the Nrf2 promoter region, which correlated with the reexpression of Nrf2. Furthermore, UA reduced the expression of epigenetic modifying enzymes, including the DNA methyltransferases DNMT1 and DNMT3a and the histone deacetylases (HDACs) HDAC1, HDAC2, HDAC3 and HDAC8 (Class I) and HDAC6 and HDAC7 (Class II), and HDAC activity. Taken together, these results suggest that the epigenetic effects of the triterpenoid UA could potentially contribute to its beneficial effects, including the prevention of skin cancer. PMID:27260468

  7. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    SciTech Connect

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-11-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  8. The emerging role of Nrf2 in mitochondrial function.

    PubMed

    Dinkova-Kostova, Albena T; Abramov, Andrey Y

    2015-11-01

    The transcription factor NF-E2 p45-related factor 2 (Nrf2; gene name NFE2L2) allows adaptation and survival under conditions of stress by regulating the gene expression of diverse networks of cytoprotective proteins, including antioxidant, anti-inflammatory, and detoxification enzymes as well as proteins that assist in the repair or removal of damaged macromolecules. Nrf2 has a crucial role in the maintenance of cellular redox homeostasis by regulating the biosynthesis, utilization, and regeneration of glutathione, thioredoxin, and NADPH and by controlling the production of reactive oxygen species by mitochondria and NADPH oxidase. Under homeostatic conditions, Nrf2 affects the mitochondrial membrane potential, fatty acid oxidation, availability of substrates (NADH and FADH2/succinate) for respiration, and ATP synthesis. Under conditions of stress or growth factor stimulation, activation of Nrf2 counteracts the increased reactive oxygen species production in mitochondria via transcriptional upregulation of uncoupling protein 3 and influences mitochondrial biogenesis by maintaining the levels of nuclear respiratory factor 1 and peroxisome proliferator-activated receptor γ coactivator 1α, as well as by promoting purine nucleotide biosynthesis. Pharmacological Nrf2 activators, such as the naturally occurring isothiocyanate sulforaphane, inhibit oxidant-mediated opening of the mitochondrial permeability transition pore and mitochondrial swelling. Curiously, a synthetic 1,4-diphenyl-1,2,3-triazole compound, originally designed as an Nrf2 activator, was found to promote mitophagy, thereby contributing to the overall mitochondrial homeostasis. Thus, Nrf2 is a prominent player in supporting the structural and functional integrity of the mitochondria, and this role is particularly crucial under conditions of stress. PMID:25975984

  9. The emerging role of Nrf2 in mitochondrial function

    PubMed Central

    Dinkova-Kostova, Albena T.; Abramov, Andrey Y.

    2015-01-01

    The transcription factor NF-E2 p45-related factor 2 (Nrf2; gene name NFE2L2) allows adaptation and survival under conditions of stress by regulating the gene expression of diverse networks of cytoprotective proteins, including antioxidant, anti-inflammatory, and detoxification enzymes as well as proteins that assist in the repair or removal of damaged macromolecules. Nrf2 has a crucial role in the maintenance of cellular redox homeostasis by regulating the biosynthesis, utilization, and regeneration of glutathione, thioredoxin, and NADPH and by controlling the production of reactive oxygen species by mitochondria and NADPH oxidase. Under homeostatic conditions, Nrf2 affects the mitochondrial membrane potential, fatty acid oxidation, availability of substrates (NADH and FADH2/succinate) for respiration, and ATP synthesis. Under conditions of stress or growth factor stimulation, activation of Nrf2 counteracts the increased reactive oxygen species production in mitochondria via transcriptional upregulation of uncoupling protein 3 and influences mitochondrial biogenesis by maintaining the levels of nuclear respiratory factor 1 and peroxisome proliferator-activated receptor γ coactivator 1α, as well as by promoting purine nucleotide biosynthesis. Pharmacological Nrf2 activators, such as the naturally occurring isothiocyanate sulforaphane, inhibit oxidant-mediated opening of the mitochondrial permeability transition pore and mitochondrial swelling. Curiously, a synthetic 1,4-diphenyl-1,2,3-triazole compound, originally designed as an Nrf2 activator, was found to promote mitophagy, thereby contributing to the overall mitochondrial homeostasis. Thus, Nrf2 is a prominent player in supporting the structural and functional integrity of the mitochondria, and this role is particularly crucial under conditions of stress. PMID:25975984

  10. Constitutive Activation of Nuclear Factor-E2-Related Factor 2 Induces Biotransformation Enzyme and Transporter Expression in Livers of Mice With Hepatocyte-Specific Deletion of Kelch-like ECH-associated protein 1

    PubMed Central

    Cheng, Qiuqiong; Taguchi, Keiko; Aleksunes, Lauren M.; Manautou, José E.; Cherrington, Nathan J.; Yamamoto, Masayuki; Slitt, Angela L.

    2013-01-01

    Chemicals that activate nuclear factor-E2-related factor-2 (Nrf2) often increase multidrug resistance-associated protein expression in liver. Hepatocyte-specific deletion of Kelch-like ECH-associated protein 1 (Keap1) activates Nrf2. Use of hepatocyte-specific Keap1 deletion represents a non-pharmacological method to determine whether constitutive Nrf2 activation upregulates liver transporter expression in vivo. The mRNA, protein expression and localization of several biotransformation and transporters was determined in livers of wild-type and hepatocyte-specific Keap1-null mice. Sulfotransferase 2a1/2, NADP(H):quinone oxidoreductase 1, Cytochrome P450 2b10, 3a11, and glutamate-cysteine ligase catalytic subunit expression was increased in livers of Keap1-null mice. Oatp1a1 expression was nearly abolished, as compared to that detected in livers of wild-type mice. By contrast, Mrp 1-5 mRNA and protein levels were increased in Keap1-null mouse livers, with Mrp4 expression being more than 15-fold higher than wild-types. In summary, Nrf2 has a significant role in affecting expression of Oatp and Mrp expression. PMID:21538727

  11. Vitamin E prevents NRF2-suppression by allergen in asthmatic alveolar macrophages in vivo

    PubMed Central

    Dworski, Ryszard; Han, Wei; Blackwell, Timothy S.; Hoskins, Aimee; Freeman, Michael L.

    2011-01-01

    Asthma is a chronic inflammatory airway disease associated with increased generation of reactive oxidant species and disturbed antioxidant defenses. NRF2 is the master transcription factor that regulates the expression of Phase II antioxidant and detoxifying enzymes. Disruption of NRF2 augments oxidative stress and inflammation in a mouse model of asthma suggesting a protective role of NRF2 in the lungs in vivo. Yet, little is known about the regulation and function of NRF2 in human asthmatics. Using segmental allergen challenge, a well established experimental model of IgE-mediated asthma exacerbation in human atopic asthmatics, we investigated the effect of a specific allergen and the modulatory role of vitamin E on NRF2 and a NRF2-target gene, superoxide dismutase, in alveolar macrophages recovered from the airways at 24h after allergen instillation in vivo. Allergen-provoked airway inflammation in sensitive asthmatics caused a profound inhibition of macrophage NRF2 activity and superoxide dismutase, rendering them incapable of responding to the NRF2 inducers. Prolonged treatment with high doses of the antioxidant vitamin E lessened this allergen-induced drop in alveolar macrophage NRF2. These results are the first to demonstrate that NRF2 expression in human asthmatics is compromised upon allergen challenge but can be rescued by vitamin E in vivo. PMID:21605660

  12. WNT-3A Regulates an Axin1/NRF2 Complex That Regulates Antioxidant Metabolism in Hepatocytes

    PubMed Central

    Rada, Patricia; Rojo, Ana I.; Offergeld, Anika; Feng, Gui Jie; Velasco-Martín, Juan P.; González-Sancho, José Manuel; Valverde, Ángela M.; Dale, Trevor; Regadera, Javier

    2015-01-01

    Abstract Aims: Nuclear factor (erythroid-derived 2)-like 2 (NRF2) is a master regulator of oxidant and xenobiotic metabolism, but it is unknown how it is regulated to provide basal expression of this defense system. Here, we studied the putative connection between NRF2 and the canonical WNT pathway, which modulates hepatocyte metabolism. Results: WNT-3A increased the levels of NRF2 and its transcriptional signature in mouse hepatocytes and HEK293T cells. The use of short interfering RNAs in hepatocytes and mouse embryonic fibroblasts which are deficient in the redox sensor Kelch-like ECH-associated protein 1 (KEAP1) indicated that WNT-3A activates NRF2 in a β-Catenin- and KEAP1-independent manner. WNT-3A stabilized NRF2 by preventing its GSK-3-dependent phosphorylation and subsequent SCF/β-TrCP-dependent ubiquitination and proteasomal degradation. Axin1 and NRF2 were physically associated in a protein complex that was regulated by WNT-3A, involving the central region of Axin1 and the Neh4/Neh5 domains of NRF2. Axin1 knockdown increased NRF2 protein levels, while Axin1 stabilization with Tankyrase inhibitors blocked WNT/NRF2 signaling. The relevance of this novel pathway was assessed in mice with a conditional deletion of Axin1 in the liver, which showed upregulation of the NRF2 signature in hepatocytes and disruption of liver zonation of antioxidant metabolism. Innovation: NRF2 takes part in a protein complex with Axin1 that is regulated by the canonical WNT pathway. This new WNT-NRF2 axis controls the antioxidant metabolism of hepatocytes. Conclusion: These results uncover the participation of NRF2 in a WNT-regulated signalosome that participates in basal maintenance of hepatic antioxidant metabolism. Antioxid. Redox Signal. 22, 555–571. PMID:25336178

  13. Poly(ADP-ribose) polymerase-1 modulates Nrf2-dependent transcription.

    PubMed

    Wu, Tongde; Wang, Xiao-Jun; Tian, Wang; Jaramillo, Melba C; Lau, Alexandria; Zhang, Donna D

    2014-02-01

    The basic leucine zipper transcription factor Nrf2 has emerged as a master regulator of intracellular redox homeostasis by controlling the expression of a battery of redox-balancing antioxidants and phase II detoxification enzymes. Under oxidative stress conditions, Nrf2 is induced at the protein level through redox-sensitive modifications on critical cysteine residues in Keap1, a component of an E3 ubiquitin ligase complex that targets Nrf2 for proteasomal degradation. Poly(ADP-ribose) polymerase-1 (PARP-1) is historically known to function in DNA damage detection and repair; however, recently PARP-1 has been shown to play an important role in other biochemical activities, such as DNA methylation and imprinting, insulator activity, chromosome organization, and transcriptional regulation. The exact role of PARP-1 in transcription modulation and the underlying mechanisms remain poorly defined. In this study, we report that PARP-1 forms complexes with the antioxidant response element (ARE) within the promoter region of Nrf2 target genes and upregulates the transcriptional activity of Nrf2. Interestingly, PARP-1 neither physically interacts with Nrf2 nor promotes the expression of Nrf2. In addition, PARP-1 does not target Nrf2 for poly(ADP-ribosyl)ation. Instead, PARP-1 interacts directly with small Maf proteins and the ARE of Nrf2 target genes, which augments ARE-specific DNA-binding of Nrf2 and enhances the transcription of Nrf2 target genes. Collectively, these results suggest that PARP-1 serves as a transcriptional coactivator, upregulating the transcriptional activity of Nrf2 by enhancing the interaction among Nrf2, MafG, and the ARE. PMID:24140708

  14. NRF2 Signaling Negatively Regulates Phorbol-12-Myristate-13-Acetate (PMA)-Induced Differentiation of Human Monocytic U937 Cells into Pro-Inflammatory Macrophages

    PubMed Central

    Choi, Hye-young; Choi, Bo-hyun; Kim, Sang-Tae; Heo, Tae-Hwe; Lee, Joo Young; Park, Pil-Hoon; Kwak, Mi-Kyoung

    2015-01-01

    Blood monocytes are recruited to injured tissue sites and differentiate into macrophages, which protect against pathogens and repair damaged tissues. Reactive oxygen species (ROS) are known to be an important contributor to monocytes’ differentiation and macrophages’ function. NF-E2-related factor 2 (NRF2), a transcription factor regulating cellular redox homeostasis, is known to be a critical modulator of inflammatory responses. We herein investigated the role of NRF2 in macrophage differentiation using the human monocytic U937 cell line and phorbol-12-myristate-13-acetate (PMA). In U937 cells with NRF2 silencing, PMA-stimulated cell adherence was significantly facilitated when compared to control U937 cells. Both transcript and protein levels for pro-inflammatory cytokines, including interleukine-1β (IL-1β), IL-6, and tumor necrosis factor-α (TNFα) were highly elevated in PMA-stimulated NRF2-silenced U937 compared to the control. In addition, PMA-inducible secretion of monocyte chemotactic protein 1 (MCP-1) was significantly high in NRF2-silenced U937. As an underlying mechanism, we showed that NRF2-knockdown U937 retained high levels of cellular ROS and endoplasmic reticulum (ER) stress markers expression; and subsequently, PMA-stimulated levels of Ca2+ and PKCα were greater in NRF2-knockdown U937 cells, which caused enhanced nuclear accumulation of nuclear factor-ҡB (NFҡB) p50 and extracellular signal-regulated kinase (ERK)-1/2 phosphorylation. Whereas the treatment of NRF2-silenced U937 cells with pharmacological inhibitors of NFҡB or ERK1/2 largely blocked PMA-induced IL-1β and IL-6 expression, indicating that these pathways are associated with cell differentiation. Taken together, our results suggest that the NRF2 system functions to suppress PMA-stimulated U937 cell differentiation into pro-inflammatory macrophages and provide evidence that the ROS-PKCα-ERK-NFҡB axis is involved in PMA-facilitated differentiation of NRF2-silenced U937 cells

  15. Nrf2 expression is increased in peripheral blood mononuclear cells derived from mild–moderate ex-smoker COPD patients with persistent oxidative stress

    PubMed Central

    Fratta Pasini, Anna Maria; Ferrari, Marcello; Stranieri, Chiara; Vallerio, Paola; Mozzini, Chiara; Garbin, Ulisse; Zambon, Giorgia; Cominacini, Luciano

    2016-01-01

    Inadequacy of antioxidant nuclear factor-E2-related factor 2 (Nrf2) and endoplasmic reticulum stress-mediated unfolded protein response has been implicated in severe chronic obstructive pulmonary disease (COPD) and cigarette smoking-induced emphysema. As evidence suggests that the ability to upregulate Nrf2 expression may influence the progression of COPD and no data exist up to now in ex-smokers with mild–moderate COPD, this study was first aimed to evaluate Nrf2 and unfolded protein response expression in peripheral blood mononuclear cells (PBMC) of mild–moderate ex-smokers with COPD compared to smoking habit-matched non-COPD subjects. Then, we tested whether oxidative stress persists after cigarette smoking cessation and whether the concentrations of oxidized phospholipids (oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine [oxPAPC]) in the PBMC of the same subjects may have a causative role in determining the upregulation of Nrf2. The expression (mRNA and protein) of Nrf2 and of its related gene heme oxygenase-1 was significantly increased in COPD group without differences in the unfolded protein response. Plasma malondialdehyde, the circulating marker of oxidative stress, and oxPAPC in PBMC were significantly higher in COPD than in non-COPD subjects. The fact that the expression of p47phox, a subunit of NADPH oxidase, was increased in PBMC of COPD patients and that it was directly correlated with oxPAPC may indicate that oxPAPC may be one of the determinants of oxidative stress-induced Nrf2 upregulation. Finally, we also demonstrated that lung function inversely correlated with plasma malondialdehyde and with Nrf2 and heme oxygenase-1 mRNA expression in all subjects. Our results indicate that mild–moderate ex-smokers with COPD may be able to counteract oxidative stress by increasing the expression of Nrf2/antioxidant-response elements. Because Nrf2 failure significantly contributes to the development of COPD

  16. Expression of xCT and activity of system xc(-) are regulated by NRF2 in human breast cancer cells in response to oxidative stress.

    PubMed

    Habib, Eric; Linher-Melville, Katja; Lin, Han-Xin; Singh, Gurmit

    2015-08-01

    Cancer cells adapt to high levels of oxidative stress in order to survive and proliferate by activating key transcription factors. One such master regulator, the redox sensitive transcription factor NF E2 Related Factor 2 (NRF2), controls the expression of cellular defense genes including those encoding intracellular redox-balancing proteins involved in glutathione (GSH) synthesis. Under basal conditions, Kelch-like ECH-associated protein 1 (KEAP1) targets NRF2 for ubiquitination. In response to oxidative stress, NRF2 dissociates from KEAP1, entering the nucleus and binding to the antioxidant response element (ARE) in the promoter of its target genes. Elevated reactive oxygen species (ROS) production may deplete GSH levels within cancer cells. System xc(-), an antiporter that exports glutamate while importing cystine to be converted into cysteine for GSH synthesis, is upregulated in cancer cells in response to oxidative stress. Here, we provided evidence that the expression of xCT, the light chain subunit of system xc(-), is regulated by NRF2 in representative human breast cancer cells. Hydrogen peroxide (H2O2) treatment increased nuclear translocation of NRF2, also increasing levels of xCT mRNA and protein and extracellular glutamate release. Overexpression of NRF2 up-regulated the activity of the xCT promoter, which contains a proximal ARE. In contrast, overexpression of KEAP1 repressed promoter activity and decreased xCT protein levels, while siRNA knockdown of KEAP1 up-regulated xCT protein levels and transporter activity. These results demonstrate the importance of the KEAP1/NRF2 pathway in balancing oxidative stress in breast cancer cells through system xc(-). We have previously shown that xCT is upregulated in various cancer cell lines under oxidative stress. In the current investigation, we focused on MCF-7 cells as a model for mechanistic studies. PMID:25827424

  17. Adenovirus-Mediated Over-Expression of Nrf2 Within Mesenchymal Stem Cells (MSCs) Protected Rats Against Acute Kidney Injury

    PubMed Central

    Mohammadzadeh-Vardin, Mohammad; Habibi Roudkenar, Mehryar; Jahanian-Najafabadi, Ali

    2015-01-01

    Purpose: Recent developments in the field of cell therapy have led to a renewed interest in treatment of acute kidney injury (AKI). However, the early death of transplanted mesenchymal stem cells (MSCs) in stressful microenvironment of a recipient tissue is a major problem with this kind of treatment. The objective of this study was to determine whether overexpression of a cytoprotective factor, nuclear factor erythroid-2 related factor 2 (Nrf2), in MSCs could protect rats against AKI. Methods: The Nrf2 was overexpressed in MSCs by recombinant adenoviruses, and the MSCs were implanted to rats suffering from cisplatin-induced AKI. Results: The obtained results showed that transplantation with the engineered MSCs ameliorates cisplatin-induced AKI. Morphologic features of the investigated kidneys showed that transplantation with the MSCs in which Nrf2 had been overexpressed significantly improved the complications of AKI. Conclusion: These findings suggested that the engineered MSCs might be a good candidate to be further evaluated in clinical trials. However, detailed studies must be performed to investigate the possible carcinogenic effect of Nrf2 overexpression. PMID:26236658

  18. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    PubMed

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  19. The Role of Nrf2-Mediated Pathway in Cardiac Remodeling and Heart Failure

    PubMed Central

    Sun, Wanqing; Zhang, Zhiguo; Zheng, Yang

    2014-01-01

    Heart failure (HF) is frequently the consequence of sustained, abnormal neurohormonal, and mechanical stress and remains a leading cause of death worldwide. The key pathophysiological process leading to HF is cardiac remodeling, a term referring to maladaptation to cardiac stress at the molecular, cellular, tissue, and organ levels. HF and many of the conditions that predispose one to HF are associated with oxidative stress. Increased generation of reactive oxygen species (ROS) in the heart can directly lead to increased necrosis and apoptosis of cardiomyocytes which subsequently induce cardiac remodeling and dysfunction. Nuclear factor-erythroid-2- (NF-E2-) related factor 2 (Nrf2) is a transcription factor that controls the basal and inducible expression of a battery of antioxidant genes and other cytoprotective phase II detoxifying enzymes that are ubiquitously expressed in the cardiovascular system. Emerging evidence has revealed that Nrf2 and its target genes are critical regulators of cardiovascular homeostasis via the suppression of oxidative stress, which is the key player in the development and progression of HF. The purpose of this review is to summarize evidence that activation of Nrf2 enhances endogenous antioxidant defenses and counteracts oxidative stress-associated cardiac remodeling and HF. PMID:25101151

  20. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    SciTech Connect

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun; Yang, Chung S.; Zhang, Jinsong

    2015-02-15

    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  1. Cinnamaldehyde inhibits the tumor necrosis factor-{alpha}-induced expression of cell adhesion molecules in endothelial cells by suppressing NF-{kappa}B activation: Effects upon I{kappa}B and Nrf2

    SciTech Connect

    Liao, B.-C.; Hsieh, C.-W.; Liu, Y.-C.; Tzeng, T.-T.; Sun, Y.-W.; Wung, B.-S.

    2008-06-01

    The production of adhesion molecules and subsequent attachment of leukocytes to endothelial cells (ECs) are critical early events in atherogenesis. These adhesion molecules thus play an important role in the development of this disease. Recent studies have highlighted the chemoprotective and anti-inflammatory effects of cinnamaldehyde, a Cinnamomum cassia Presl-specific diterpene. In our current study, we have examined the effects of both cinnamaldehyde and extracts of C. cassia on cytokine-induced monocyte/human endothelial cell interactions. We find that these compounds inhibit the adhesion of TNF{alpha}-induced monocytes to endothelial cells and suppress the expression of the cell adhesion molecules, VCAM-1 and ICAM-1, at the transcriptional level. Moreover, in TNF{alpha}-treated ECs, the principal downstream signal of VCAM-1 and ICAM-1, NF-{kappa}B, was also found to be abolished in a time-dependent manner. Interestingly, cinnamaldehyde exerts its anti-inflammatory effects by blocking the degradation of the inhibitory protein I{kappa}B-{alpha}, but only in short term pretreatments, whereas it does so via the induction of Nrf2-related genes, including heme-oxygenase-1 (HO-1), over long term pretreatments. Treating ECs with zinc protoporphyrin, a HO-1 inhibitor, partially blocks the anti-inflammatory effects of cinnamaldehyde. Elevated HO-1 protein levels were associated with the inhibition of TNF{alpha}-induced ICAM-1 expression. In addition to HO-1, we also found that cinnamaldehyde can upregulate Nrf2 in nuclear extracts, and can increase ARE-luciferase activity and upregulate thioredoxin reductase-1, another Nrf2-related gene. Moreover, cinnamaldehyde exposure rapidly reduces the cellular GSH levels in ECs over short term treatments but increases these levels after 9 h exposure. Hence, our present findings indicate that cinnamaldehyde suppresses TNF-induced singling pathways via two distinct mechanisms that are activated by different pretreatment periods.

  2. Increased cell migration and plasticity in Nrf2-deficient cancer cell lines.

    PubMed

    Rachakonda, G; Sekhar, K R; Jowhar, D; Samson, P C; Wikswo, J P; Beauchamp, R D; Datta, P K; Freeman, M L

    2010-06-24

    Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) expression is deregulated in many cancers. Genetic and biochemical approaches coupled with functional assays in cultured cells were used to explore the consequences of Nrf2 repression. Nrf2 suppression by Keap1-directed ubiquitylation or the expression of independent short hairpin RNA (shRNA)/siRNA sequences enhanced cellular levels of reactive oxygen species, Smad-dependent tumor cell motility and growth in soft agar. Loss of Nrf2 was accompanied by concomitant Smad linker region/C-terminus phosphorylation, induction of the E-cadherin transcriptional repressor Slug and suppression of the cell-cell adhesion protein E-cadherin. Ectopic expression of the wildtype but not dominant-negative Nrf2 suppressed the activity of a synthetic transforming growth factor-beta1-responsive CAGA-directed luciferase reporter. shRNA knock-down of Nrf2 enhanced the activity of the synthetic CAGA reporter, as well as the expression of the endogenous Smad target gene plasminogen activator inhibitor-1. Finally, we found that Nrf2/Smad3/Smad4 formed an immunoprecipitable nuclear complex. Thus, loss of Nrf2 increased R-Smad phosphorylation and R-Smad signaling, supporting the hypothesis that loss of Nrf2 in an oncogenic context-dependent manner can enhance cellular plasticity and motility, in part by using transforming growth factor-beta/Smad signaling. PMID:20440267

  3. Exercise, Nrf2 and Antioxidant Signaling in Cardiac Aging.

    PubMed

    Narasimhan, Madhusudhanan; Rajasekaran, Namakkal S

    2016-01-01

    Aging is represented by a progressive decline in cellular functions. The age-related deformities in cardiac behaviors are the loss of cardiac myocytes through apoptosis or programmed cell death. Oxidative stress (OS) and its deleterious consequence contribute to age-related mechanical remodeling, reduced regenerative capacity, and apoptosis in cardiac tissue. The pathogenesis of OS in the elderly can predispose the heart to other cardiac complications such as atherosclerosis, hypertension, ischemic heart disease, cardiac myopathy, and so on. At the molecular level, oxidant-induced activation of Nrf2 (Nuclear erythroid-2-p45-related factor-2), a transcription factor, regulates several genes containing AREs (Antioxidant Response Element) and bring the respective translates to counteract the reactive radicals and establish homeostasis. Myriad of Nrf2 gene knockout studies in various organs such as lung, liver, kidney, brain, etc. have shown that dysregulation of Nrf2 severely affects the oxidant/ROS sensitivity and predispose the system to several pathological changes with aberrant cellular lesions. On the other hand, its gain of function chemical interventions exhibited oxidant stress resistance and cytoprotection. However, thus far, only a few investigations have shown the potential role of Nrf2 and its non-pharmacological induction in cardiac aging. Therefore, here we review the involvement of Nrf2 signaling along with its responses and ramifications on the cascade of OS under acute exercise stress (AES), moderate exercise training (MET), and endurance exercise stress (EES) conditions in the aging heart. PMID:27378947

  4. Exercise, Nrf2 and Antioxidant Signaling in Cardiac Aging

    PubMed Central

    Narasimhan, Madhusudhanan; Rajasekaran, Namakkal S.

    2016-01-01

    Aging is represented by a progressive decline in cellular functions. The age-related deformities in cardiac behaviors are the loss of cardiac myocytes through apoptosis or programmed cell death. Oxidative stress (OS) and its deleterious consequence contribute to age-related mechanical remodeling, reduced regenerative capacity, and apoptosis in cardiac tissue. The pathogenesis of OS in the elderly can predispose the heart to other cardiac complications such as atherosclerosis, hypertension, ischemic heart disease, cardiac myopathy, and so on. At the molecular level, oxidant-induced activation of Nrf2 (Nuclear erythroid-2-p45-related factor-2), a transcription factor, regulates several genes containing AREs (Antioxidant Response Element) and bring the respective translates to counteract the reactive radicals and establish homeostasis. Myriad of Nrf2 gene knockout studies in various organs such as lung, liver, kidney, brain, etc. have shown that dysregulation of Nrf2 severely affects the oxidant/ROS sensitivity and predispose the system to several pathological changes with aberrant cellular lesions. On the other hand, its gain of function chemical interventions exhibited oxidant stress resistance and cytoprotection. However, thus far, only a few investigations have shown the potential role of Nrf2 and its non-pharmacological induction in cardiac aging. Therefore, here we review the involvement of Nrf2 signaling along with its responses and ramifications on the cascade of OS under acute exercise stress (AES), moderate exercise training (MET), and endurance exercise stress (EES) conditions in the aging heart. PMID:27378947

  5. Nrf2 activation in astrocytes contributes to spinal cord ischemic tolerance induced by hyperbaric oxygen preconditioning.

    PubMed

    Xu, Jiajun; Huang, Guoyang; Zhang, Kun; Sun, Jinchuan; Xu, Tao; Li, Runping; Tao, Hengyi; Xu, Weigang

    2014-08-01

    In this study, we investigated whether nuclear factor erythroid 2-related factor 2 (Nrf2) activation in astrocytes contributes to the neuroprotection induced by a single hyperbaric oxygen preconditioning (HBO-PC) against spinal cord ischemia/reperfusion (SCIR) injury. In vivo: At 24 h after a single HBO-PC at 2.5 atmospheres absolute for 90 min, the male ICR mice underwent SCIR injury by aortic cross-clamping surgery and observed for 48 h. HBO-PC significantly improved hindlimb motor function, reduced secondary spinal cord edema, ameliorated the reactivity of spinal motor-evoked potentials, and slowed down the process of apoptosis to exert neuroprotective effects against SCIR injury. At 12 h or 24 h after HBO-PC without aortic cross-clamping surgery, Western blot, enzyme-linked immunosorbent assay, realtime-polymerase chain reaction and double-immunofluorescence staining were used to detect the Nrf2 activity of spinal cord tissue, such as mRNA level, protein content, DNA binding activity, and the expression of downstream gene, such as glutamate-cysteine ligase, γ-glutamyltransferase, multidrug resistance protein 1, which are key proteins for intracellular glutathione synthesis and transit. The Nrf2 activity and downstream genes expression were all enhanced in normal spinal cord with HBO-PC. Glutathione content of spinal cord tissue with HBO-PC significantly increased at all time points after SCIR injury. Moreover, Nrf2 overexpression mainly occurs in astrocytes. In vitro: At 24 h after HBO-PC, the primary spinal astrocyte-neuron co-cultures from ICR mouse pups were subjected to oxygen-glucose deprivation (OGD) for 90 min to simulate the ischemia-reperfusion injury. HBO-PC significantly increased the survival rate of neurons and the glutathione content in culture medium, which was mainly released from asctrocytes. Moreover, the Nrf2 activity and downstream genes expression induced by HBO-PC were mainly enhanced in astrocytes, but not in neurons. In

  6. Protective Effect of Decursin Extracted from Angelica gigas in Male Infertility via Nrf2/HO-1 Signaling Pathway

    PubMed Central

    Bae, Woong Jin; Ha, U. Syn; Choi, Jin Bong; Kim, Kang Sup; Kim, Su Jin; Cho, Hyuk Jin; Hong, Sung Hoo; Lee, Ji Youl; Wang, Zhiping; Hwang, Sung Yeoun; Kim, Sae Woong

    2016-01-01

    Higher testicular temperature results in altered spermatogenesis due to heat-related oxidative stress. We examined the effects of decursin extracted from Angelica gigas Nakai on antioxidant activity in vitro and in a cryptorchidism-induced infertility rat model. TM3 Leydig cell viability was measured based on oxidative stress according to treatment. Either distilled water or AG 400 mg/kg of A. gigas extract was administered orally for 4 weeks after unilateral cryptorchidism was induced. After 1, 2, and 4 weeks, six rats from the control group and six rats from treatment group were sacrificed. Testicular weight, semen quality, antioxidant activities, nuclear factor erythroid 2-related factor 2 (Nrf2) protein, and mRNA expression of Nrf2-regulated genes were analyzed. Treatment with A. gigas extract (1) protected TM3 cells against oxidative stress in a dose-dependent manner, (2) improved the mean weight of the cryptorchid testis, (3) maintained sperm counts, motility, and spermatogenic cell density, (4) decreased levels of 8-hydroxy-2-deoxyguanosine (8-OHdG) and increased levels of superoxide dismutase (SOD), (5) significantly increased Nrf2 and heme oxygenase-1 (HO-1), and (6) significantly decreased apoptosis. This study suggests that decursin extracted from A. gigas is a supplemental agent that can reduce oxidative stress by Nrf2-mediated upregulation of HO-1 in rat experimentally induced unilateral cryptorchidism and may improve cryptorchidism-induced infertility. PMID:27034737

  7. SIRT6 safeguards human mesenchymal stem cells from oxidative stress by coactivating NRF2

    PubMed Central

    Pan, Huize; Guan, Di; Liu, Xiaomeng; Li, Jingyi; Wang, Lixia; Wu, Jun; Zhou, Junzhi; Zhang, Weizhou; Ren, Ruotong; Zhang, Weiqi; Li, Ying; Yang, Jiping; Hao, Ying; Yuan, Tingting; Yuan, Guohong; Wang, Hu; Ju, Zhenyu; Mao, Zhiyong; Li, Jian; Qu, Jing; Tang, Fuchou; Liu, Guang-Hui

    2016-01-01

    SIRT6 belongs to the mammalian homologs of Sir2 histone NAD+-dependent deacylase family. In rodents, SIRT6 deficiency leads to aging-associated degeneration of mesodermal tissues. It remains unknown whether human SIRT6 has a direct role in maintaining the homeostasis of mesodermal tissues. To this end, we generated SIRT6 knockout human mesenchymal stem cells (hMSCs) by targeted gene editing. SIRT6-deficient hMSCs exhibited accelerated functional decay, a feature distinct from typical premature cellular senescence. Rather than compromised chromosomal stability, SIRT6-null hMSCs were predominately characterized by dysregulated redox metabolism and increased sensitivity to the oxidative stress. In addition, we found SIRT6 in a protein complex with both nuclear factor erythroid 2-related factor 2 (NRF2) and RNA polymerase II, which was required for the transactivation of NRF2-regulated antioxidant genes, including heme oxygenase 1 (HO-1). Overexpression of HO-1 in SIRT6-null hMSCs rescued premature cellular attrition. Our study uncovers a novel function of SIRT6 in maintaining hMSC homeostasis by serving as a NRF2 coactivator, which represents a new layer of regulation of oxidative stress-associated stem cell decay. PMID:26768768

  8. Isoorientin induces Nrf2 pathway-driven antioxidant response through phosphatidylinositol 3-kinase signaling.

    PubMed

    Lim, Ju Hee; Park, Hae-Suk; Choi, Jung-Kap; Lee, Ik-Soo; Choi, Hyun Jin

    2007-12-01

    Because oxidative stress is involved in the pathogenesis of various chronic diseases and the aging process, antioxidants that can increase the intrinsic antioxidant potency are proposed as desirable therapeutic agents to counteract oxidative stress-related diseases. NF-E2-related factor-2 (Nrf2) is a transcription factor that regulates important antioxidant and phase II detoxification genes, and therefore, the molecule that regulates nuclear translocation of Nrf2 and the induction of antioxidative proteins is thought to be a promising candidate as a cytoprotective agent for oxidative stress. In the present study, we show that isoorientin (luteolin 6-C-beta-D-glucoside) obtained from the leaves of Sasa borealis upregulates and activates Nrf2, and has protective ability against oxidative damage caused by reactive oxygen intermediates in HepG2 cells. Isoorientin induces increase in the level of antioxidant enzyme proteins, especially NQO1, and the cytoprotective and antioxidative effects of isoorientin are PI3K/Akt pathway-dependent. Together with direct radical scavenging activity, the novel effect of isoorientin on the regulation of antioxidative gene expression provides attractive strategy to prevent diseases associated with oxidative stress and attenuate the progress of the diseases. PMID:18254247

  9. Redox Modulating NRF2: A Potential Mediator of Cancer Stem Cell Resistance

    PubMed Central

    Ryoo, In-geun; Lee, Sang-hwan; Kwak, Mi-Kyoung

    2016-01-01

    Tumors contain a distinct small subpopulation of cells that possess stem cell-like characteristics. These cells have been called cancer stem cells (CSCs) and are thought to be responsible for anticancer drug resistance and tumor relapse after therapy. Emerging evidence indicates that CSCs share many properties, such as self-renewal and quiescence, with normal stem cells. In particular, CSCs and normal stem cells retain low levels of reactive oxygen species (ROS), which can contribute to stem cell maintenance and resistance to stressful tumor environments. Current literatures demonstrate that the activation of ataxia telangiectasia mutated (ATM) and forkhead box O3 (FoxO3) is associated with the maintenance of low ROS levels in normal stem cells such as hematopoietic stem cells. However, the importance of ROS signaling in CSC biology remains poorly understood. Recent studies demonstrate that nuclear factor-erythroid 2-related factor 2 (NRF2), a master regulator of the cellular antioxidant defense system, is involved in the maintenance of quiescence, survival, and stress resistance of CSCs. Here, we review the recent findings on the roles of NRF2 in maintenance of the redox state and multidrug resistance in CSCs, focusing on how NRF2-mediated ROS modulation influences the growth and resistance of CSCs. PMID:26682001

  10. Andrographolide protects against cigarette smoke-induced oxidative lung injury via augmentation of Nrf2 activity

    PubMed Central

    Guan, SP; Tee, W; Ng, DSW; Chan, TK; Peh, HY; Ho, WE; Cheng, C; Mak, JC; Wong, WSF

    2013-01-01

    Background and Purpose Cigarette smoke is a major cause for chronic obstructive pulmonary disease (COPD). Andrographolide is an active biomolecule isolated from the plant Andrographis paniculata. Andrographolide has been shown to activate nuclear factor erythroid-2-related factor 2 (Nrf2), a redox-sensitive antioxidant transcription factor. As Nrf2 activity is reduced in COPD, we hypothesize that andrographolide may have therapeutic value for COPD. Experimental Approach Andrographolide was given i.p. to BALB/c mice daily 2 h before 4% cigarette smoke exposure for 1 h over five consecutive days. Bronchoalveolar lavage fluid and lungs were collected for analyses of cytokines, oxidative damage markers and antioxidant activities. BEAS-2B bronchial epithelial cells were exposed to cigarette smoke extract (CSE) and used to study the antioxidant mechanism of action of andrographolide. Key Results Andrographolide suppressed cigarette smoke-induced increases in lavage fluid cell counts; levels of IL-1β, MCP-1, IP-10 and KC; and levels of oxidative biomarkers 8-isoprostane, 8-OHdG and 3-nitrotyrosine in a dose-dependent manner. Andrographolide promoted inductions of glutathione peroxidase (GPx) and glutathione reductase (GR) activities in lungs from cigarette smoke-exposed mice. In BEAS-2B cells, andrographolide markedly increased nuclear Nrf2 accumulation, promoted binding to antioxidant response element (ARE) and total cellular glutathione level in response to CSE. Andrographolide up-regulated ARE-regulated gene targets including glutamate-cysteine ligase catalytic (GCLC) subunit, GCL modifier (GCLM) subunit, GPx, GR and heme oxygenase-1 in BEAS-2B cells in response to CSE. Conclusions Andrographolide possesses antioxidative properties against cigarette smoke-induced lung injury probably via augmentation of Nrf2 activity and may have therapeutic potential for treating COPD. PMID:23146110

  11. Sulforaphane attenuates hepatic fibrosis via NF-E2-related factor 2-mediated inhibition of transforming growth factor-β/Smad signaling.

    PubMed

    Oh, Chang Joo; Kim, Joon-Young; Min, Ae-Kyung; Park, Keun-Gyu; Harris, Robert A; Kim, Han-Jong; Lee, In-Kyu

    2012-02-01

    Sulforaphane (SFN) is a dietary isothiocyanate that exerts chemopreventive effects via NF-E2-related factor 2 (Nrf2)-mediated induction of antioxidant/phase II enzymes, such as heme oxygenase-1 (HO-1) and NAD(P)H quinone oxidoreductase 1 (NQO1). This work was undertaken to evaluate the effects of SFN on hepatic fibrosis and profibrotic transforming growth factor (TGF)-β/Smad signaling, which are closely associated with oxidative stress. SFN suppressed TGF-β-enhanced expression of α-smooth muscle actin (α-SMA), a marker of hepatic stellate cell (HSC) activation, and profibrogenic genes such as type I collagen, fibronectin, tissue inhibitor of matrix metalloproteinase (TIMP)-1, and plasminogen activator inhibitor (PAI)-1 in hTERT, an immortalized human HSC line. SFN inhibited TGF-β-stimulated activity of a PAI-1 promoter construct and (CAGA)(9) MLP-Luc, an artificial Smad3/4-specific reporter, in addition to reducing phosphorylation and nuclear translocation of Smad3. Nrf2 overexpression was sufficient to inhibit the TGF-β/Smad signaling and PAI-1 expression. Conversely, knockdown of Nrf2, but not inhibition of HO-1 or NQO1 activity, significantly abolished the inhibitory effect of SFN on (CAGA)(9) MLP-Luc activity. However, inhibition of NQO1 activity reversed repression of TGF-β-stimulated expression of type I collagen by SFN, suggesting the involvement of antioxidant activity of SFN in the suppression of Smad-independent fibrogenic gene expression. Finally, SFN treatment attenuated the development and progression of early stage hepatic fibrosis induced by bile duct ligation in mice, accompanied by reduced expression of type I collagen and α-SMA. Collectively, these results show that SFN elicits an antifibrotic effect on hepatic fibrosis through Nrf2-mediated inhibition of the TGF-β/Smad signaling and subsequent suppression of HSC activation and fibrogenic gene expression. PMID:22155056

  12. Nrf2 transcriptional derepression from Keap1 by dietary polyphenols.

    PubMed

    Bayele, Henry K; Debnam, Edward S; Srai, Kaila S

    2016-01-15

    The liver expresses batteries of cytoprotective genes that confer cellular resistance to oxidative stress and xenobiotic toxins, and protection against cancer and other stress-related diseases. These genes are mainly regulated by Nrf2, making this transcription factor a target for small molecule discovery to treat such diseases. In this report, we identified dietary polyphenolic antioxidants that not only activated these genes but also relieved Nrf2 repression by Keap1, a Cul3-dependent ubiquitin ligase adaptor protein that mediates its degradation. Analysis of postprandial liver RNA revealed a marked activation of both genes by all test polyphenols compared with controls. Nrf2 inhibition by RNA interference reduced polyphenol effects on its target gene expression. Our data suggest that polyphenols may induce cellular defense genes by derepressing Nrf2 inhibition by Keap1. We posit that this ability to derepress Nrf2 and reactivate its target genes may underlie the protection conferred by polyphenols against oxidative stress-related diseases. PMID:26655811

  13. Activation of NRF2 Signaling in HEK293 Cells by a First-In-Class Direct KEAP1-NRF2 Inhibitor

    PubMed Central

    Wen, Xia; Thorne, Gabriell; Hu, Longqin; Joy, Melanie S.; Aleksunes, Lauren M.

    2015-01-01

    Under basal conditions, the antioxidant transcription factor NRF2 is bound to the KEAP1 protein and targeted for proteasomal degradation in the cytoplasm. In response to cellular injury or chemical treatment, NRF2 dissociates from KEAP1 and activates the transcription of protective genes and defends against injury. LH601A is a first-in-class direct inhibitor of the KEAP1-NRF2 protein-protein interaction. The purpose of this study was to determine whether LH601A activates NRF2 signaling in human kidney cells. HEK293 cells were treated with LH601A or the indirect NRF2 activator, sulforaphane (SFN) for 6 or 16 h. SFN and LH601A up-regulated NRF2 target genes HO-1 (2- to 7-fold), TRX1 (2-fold) and NQO1 mRNAs (2-fold). Both compounds also elevated HO-1 and TRX1 protein expression. Since NRF2 activation can protect tissues from injury, LH601A, a direct inhibitor of the KEAP1-NRF2 interaction may be used to defend against kidney injury and/or diseases. PMID:25683455

  14. Mutant p53 confers chemoresistance in non-small cell lung cancer by upregulating Nrf2

    PubMed Central

    Wang, Yao-Chen; He, Tsung-Ying; Lee, Ming-Ching; Yeh, Sauh-Der; Chen, Chih-Yi; Lee, Huei

    2015-01-01

    Nrf2 is a key transcription factor for genes coding for antioxidants, detoxification enzymes, and multiple drug resistance and it also confers resistance to anticancer drugs. Here, we hypothesized that mutant p53 could upregulate Nrf2 expression at the transcriptional level, thereby conferring cisplatin resistance in non-small cell lung cancer (NSCLC). Luciferase reporter assays and real-time PCR analysis indicated that the Nrf2 promoter activity and its mRNA levels were markedly suppressed by wild-type p53, but not by mutant p53. Chromatin immunoprecipitation (ChIP) further confirmed that wild-type p53 binds at the p53 putative binding site to block Sp1 binding to the Nrf2 promoter and consequently to suppress the Nrf2 promoter activity. The MTT assay indicated that an increase in Nrf2 expression by mutant p53 is responsible for cisplatin resistance. Among the Nrf2 downstream genes, Bcl-2 and Bcl-xL contribute more strongly to Nrf2-mediated cisplatin resistance when compared with heme oxygenase 1 (HO-1). Cox regression analysis showed that patients with high-Nrf2, high-Bcl-2, high-Bcl-xL mRNA tumors were more commonly occurred unfavorable response to cisplatin-based chemotherapy than their counterparts. The prognostic significance of Nrf2 mRNA levels on OS and RFS was also observed in patients who have received cisplatin-based chemotherapy, particularly in p53-mutant patients. Collectively, mutant p53 may confer cisplatin resistance via upregulation of Nrf2 expression, and Nrf2 mRNA level may predict chemotherapeutic response and outcomes in NSCLC. PMID:26497680

  15. High levels of Nrf2 determine chemoresistance in type II endometrial cancer

    PubMed Central

    Jiang, Tao; Chen, Ning; Zhao, Fei; Wang, Xiao-Jun; Kong, Beihua; Zheng, Wenxin; Zhang, Donna D.

    2010-01-01

    Type II endometrial cancer, which mainly presents as serous and clear cell types, has proved to be the most malignant and recurrent carcinoma among various female genital malignancies. The transcription factor, Nrf2, was first described as having chemopreventive activity. Activation of the Nrf2-mediated cellular defense response protects cells against the toxic and carcinogenic effects of environmental insults by upregulating an array of genes that detoxify reactive oxygen species (ROS) and restore cellular redox homeostasis. However, the cancer-promoting role of Nrf2 has recently been revealed. Nrf2 is constitutively upregulated in several types of human cancer tissues and cancer cell lines. Furthermore, inhibition of Nrf2 expression sensitizes cancer cells to chemotherapeutic drugs. In this study, the constitutive level of Nrf2 was compared in different types of human endometrial tumors. It was found that Nrf2 was highly expressed in endometrial serous carcinoma (ESC), whereas complex hyperplasia (CH) and endometrial endometrioid carcinoma (EEC) had no or marginal expression of Nrf2. Likewise, the ESC derived SPEC-2 cell line had a higher level of Nrf2 expression and was more resistant to the toxic effects of cisplatin and paclitaxel than that of the Ishikawa cell line, which was generated from EEC. Silencing of Nrf2 rendered SPEC-2 cells more susceptible to chemotherapeutic drugs while it had a limited effect on Ishikawa cells. Inhibition of Nrf2 expression by overexpressing Keap1 sensitized SPEC-2 cells or SPEC-2-derived xenografts to chemotherapeutic treatments using both cell culture and SCID mouse models. Collectively, we provide a molecular basis for the use of Nrf2 inhibitors to increase the efficacy of chemotherapeutic drugs and to combat chemoresistance, the biggest obstacle in chemotherapy. PMID:20530669

  16. Carthami Flos suppresses neutrophilic lung inflammation in mice, for which nuclear factor-erythroid 2-related factor-1 is required.

    PubMed

    Kim, Jeehye; Woo, Juyoun; Lyu, Ji Hyo; Song, Hyuk-Hwan; Jeong, Han-Sol; Ha, Ki-Tae; Choi, Jun-Yong; Han, Chang Woo; Ahn, Kyung-Seop; Oh, Sei-Ryang; Sadikot, Ruxana T; Kim, Kyun Ha; Joo, Myungsoo

    2014-03-15

    Carthami Flos (CF) is used in traditional Asian medicine to treat blood stagnation and its associated diseases in patients. While the underlying mechanism for this effect remains unknown, CF has been reported to activate Nrf2, a transcription factor that is critical in protecting from various inflammatory lung diseases including acute lung injury (ALI). Here, we examined whether CF has a therapeutic effect on lung inflammation and assessed the impact of Nrf2 on the effect of CF using an ALI mouse model. Treatment of bone marrow derived macrophages with standardized aqueous extract of CF (AECF) activated Nrf2, resulting in the expression of Nrf2 dependent genes including GCLC, NQO-1 and HO-1. While intranasal LPS treatment of wild type mice resulted in neutrophilic infiltration and a concomitant expression of pro-inflammatory cytokine genes in the lung, the hallmarks of ALI, an intratracheal spraying of AECF to the lung 2h after LPS treatment suppressed the inflammatory response. By contrast, similar treatment in nrf2(-/-) mice with AECF failed to attenuate the inflammatory response. Thus, our results show that AECF attenuated neutrophilic lung inflammation in mice, which required Nrf2. Since AECF administration abrogates lung inflammation after LPS treatment, we propose CF as a potential therapeutics in the management of ALI. PMID:24252335

  17. Nrf2/antioxidant defense pathway is involved in the neuroprotective effects of Sirt1 against focal cerebral ischemia in rats after hyperbaric oxygen preconditioning.

    PubMed

    Xue, Fen; Huang, Jin-Wen; Ding, Pei-Yan; Zang, Hong-Gang; Kou, Zhi-Jian; Li, Ting; Fan, Juan; Peng, Zheng-Wu; Yan, Wen-Jun

    2016-08-01

    Sirtuin 1 (Sirt1) is a class III histone deacetylase involved in neuroprotection induced by hyperbaric oxygen preconditioning (HBO-PC) in animal models of ischemia. However, the underlying mechanisms remain to be illustrated. In the present study, rats exposed to middle cerebral artery occlusion (MCAO) were used to establish an ischemic stroke model. The infarct volume ratio, neurobehavioral score, and expressions of Sirt1, nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase 1 (HO-1), and superoxide dismutase 1 (SOD1) were evaluated at 7 days after reperfusion, and the level of malondialdehyde (MDA) was used to assess oxidative stress. HBO-PC increased the expression of Sirt1 and reduced infarct volume ratio and neurobehavioral deficit in MCAO rats. Meanwhile, HBO-PC also increased expression of Nrf2, HO-1, and SOD1 and decreased MDA content. Furthermore, either Sirt1 or Nrf2 knockdown by short interfering RNA (siRNA) inhibited the expression of Nrf2, HO-1, and SOD1 and eliminated the neuroprotective effects of HBO-PC. Taken together, the results suggest that the Nrf2/antioxidant defense pathway is involved in the long lasting neuroprotective effects of Sirt1 induced by HBO-PC against transient focal cerebral ischemia. PMID:27131779

  18. Berberine Hydrochloride Protects C2C12 Myoblast Cells Against Oxidative Stress-Induced Damage via Induction of Nrf-2-Mediated HO-1 Expression.

    PubMed

    Choi, Yung Hyun

    2016-09-01

    Preclinical Research The aim of the present study was to evaluate the effects of berberine hydrochloride (BBH), an isoquinoline alkaloid that can be isolated from a variety of herbs, on hydrogen peroxide (H2 O2 )-induced oxidative stress in C2C12 myoblasts and to investigate the molecular mechanisms involved in this process, especially the expression of the Nrf2/HO-1 pathway. BBH preconditioning attenuated H2 O2 -induced growth inhibition and DNA damage as well as apoptosis in C2C12 cells via suppression of the accumulation of intracellular reactive oxygen species (ROS). Treatment with BBHride alone effectively upregulated the expression of nuclear factor-erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) and elevated HO-1 activity. However, the protective effects of BBH against H2 O2 -induced ROS generation and cell growth reduction were abolished by an HO-1 inhibitor. Moreover, BBH-mediated induction and activation of HO-1 were reduced by genetic silencing of Nrf2 using small interfering RNA (siRNA). In addition, the effects of BBH against H2 O2 -induced ROS accumulation and growth inhibition were abrogated in C2C12 cells transfected with Nrf2 siRNA. Therefore, the present study demonstrated that BBH could protect C2C12 cells against oxidative stress-induced injury and this effect involved activation of the Nrf2/HO-1 pathway. Drug Dev Res, 2016. © 2016 Wiley Periodicals, Inc. PMID:27535021

  19. Ethanol Extract of Cirsium japonicum var. ussuriense Kitamura Exhibits the Activation of Nuclear Factor Erythroid 2-Related Factor 2-dependent Antioxidant Response Element and Protects Human Keratinocyte HaCaT Cells Against Oxidative DNA Damage

    PubMed Central

    Yoo, Ok-Kyung; Choi, Bu Young; Park, Jin-Oh; Lee, Ji-Won; Park, Byoung-Kwon; Joo, Chul Gue; Heo, Hyo-Jung; Keum, Young-Sam

    2016-01-01

    Keratinocytes are constantly exposed to extracellular insults, such as ultraviolet B, toxic chemicals and mechanical stress, all of which can facilitate the aging of keratinocytes via the generation of intracellular reactive oxygen species (ROS). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that plays a critical role in protecting keratinocytes against oxidants and xenobiotics by binding to the antioxidant response element (ARE), a cis-acting element existing in the promoter of most phase II cytoprotective genes. In the present study, we have attempted to find novel ethanol extract(s) of indigenous plants of Jeju island, Korea that can activate the Nrf2/ARE-dependent gene expression in human keratinocyte HaCaT cells. As a result, we identified that ethanol extract of Cirsium japonicum var. ussuriense Kitamura (ECJUK) elicited strong stimulatory effect on the ARE-dependent gene expression. Supporting this observation, we found that ECJUK induced the expression of Nrf2, hemoxygenase-1, and NAD(P)H:quinone oxidoreductase-1 and this event was correlated with Akt1 phosphorylation. We also found that ECJUK increased the intracellular reduced glutathione level and suppressed 12-O-tetradecanoylphorbol acetate-induced 8-hydroxyguanosine formation without affecting the overall viability. Collectively, our results provide evidence that ECJUK can protect against oxidative stress-mediated damages through the activation of Nrf2/ARE-dependent phase II cytoprotective gene expression. PMID:27051652

  20. Cytoplasmic localization of Nrf2 promotes colorectal cancer with more aggressive tumors via upregulation of PSMD4.

    PubMed

    Lin, Po-Lin; Chang, Jinghua Tsai; Wu, De-Wei; Huang, Chi-Chou; Lee, Huei

    2016-06-01

    Differences in subcellular localization of Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) have been associated with poor outcomes in human cancers. However, the prognostic value of subcellular localization of Nrf2 in colorectal cancer and the underlying mechanism in tumor invasion remain unknown. We enrolled tumors from colorectal patients to evaluate Nrf2, NQO1, and HO-1 expression by immunohistochemistry. NQO1 and HO-1 positive tumors showed nearly complete expression of Nrf2 in the nucleus and/or showed partial expression in the nucleus/cytoplasm (nNrf2); however, tumors negative for NQO1 and HO-1 showed almost complete expression of Nrf2 in the cytoplasm and/or partial expression in the nucleus/cytoplasm (cNrf2). Kaplan-Meier and Cox regression analysis indicated poorer overall survival in patients with cNrf2 tumors than with nNrf2 tumors. Cell models provided evidence that cNrf2, rather than nNrf2, was responsible for cell invasion and soft agar growth triggered by activation of the NF-κB/AKT/β-catenin cascade. Mechanistically, cNrf2 persistently increased PSMD4 expression by the HIF1α/β-catenin axis, whereas PSMD4 reciprocally enhanced Nrf2 nuclear export by increasing CRM1 expression through p53 degradation. The mechanistic action of the cell model was further confirmed with a nude mouse animal model in which xenograft tumors induced by cNrf2 were nearly completely suppressed by the proteasomal inhibitor carfilzomib or the β-catenin inhibitor XAV939. We therefore suggest that PSMD4 or β-catenin might be potential targets for suppressing tumor aggressiveness, and consequently, improving outcomes in patients whose tumors express cNrf2. PMID:27033953

  1. Nrf2--A regulator of keratinocyte redox signaling.

    PubMed

    Schäfer, Matthias; Werner, Sabine

    2015-11-01

    The skin is frequently exposed to environmental challenges, such as UV irradiation, toxic chemicals, and mechanical wounding. These insults cause an increase in the levels of reactive oxygen species, resulting in oxidative stress and concomitant inflammation, skin aging, and even cancer development. Therefore, an efficient antioxidant defense strategy is of major importance in this tissue. Since the Nrf2 transcription factor regulates a battery of genes involved in the defense against reactive oxygen species and in compound metabolism, it plays a key role in skin homeostasis, repair, and disease. In this review we summarize current knowledge on the expression and function of Nrf2 in normal skin and its role in the acute and chronic UV response as well as in the pathogenesis of epithelial skin cancer and of different inflammatory skin diseases. Finally, we discuss the potential of Nrf2-activating compounds for skin protection under stress conditions and for the treatment of major human skin disorders. PMID:25912479

  2. NRF2/Long Noncoding RNA ROR Signaling Regulates Mammary Stem Cell Expansion and Protects against Estrogen Genotoxicity*

    PubMed Central

    Zhang, Yongshu; Xia, Jixiang; Li, Qinglin; Yao, Yuan; Eades, Gabriel; Gernapudi, Ramkishore; Duru, Nadire; Kensler, Thomas W.; Zhou, Qun

    2014-01-01

    Long noncoding RNAs (lncRNAs) have emerged as key regulators of gene expression in embryonic stem cell (ESC) self-renewal and differentiation. In ESCs, lncRNAs are regulated at the genetic level via transcription factor binding to lncRNA gene promoters. Here we demonstrate that the key cytoprotective transcription factor NRF2 controls lncRNA expression in mammary stem cells. By profiling lncRNAs in wild-type and NRF2 knockdown mammary stem cells, we demonstrate that the lncRNA ROR, a regulator of embryonic stem cell pluripotency, is overexpressed upon NRF2 knockdown. We performed promoter analyses and examined predicted NRF2 binding elements in the ROR promoter using luciferase reporter constructs of a ROR promoter deletion series. Our studies revealed that NRF2 binds to two specific NRF2 response elements flanking the ROR promoter and that these two NRF2 response elements are equally important to suppress ROR transcription. In addition, we identified associated H3K27me3 chromatin modification and EZH2 binding at the ROR promoter that was dependent on NRF2 binding. We observed that NRF2 knockdown or ROR overexpression leads to increased stem cell self-renewal in mammary stem cells. Furthermore, we demonstrate Nrf2 regulation of the mammary stem cell population in vivo. These observations provide further evidence for the critical role of NRF2 in maintaining normal stem cell subpopulations in mammary epithelium. PMID:25231996

  3. NRF2/long noncoding RNA ROR signaling regulates mammary stem cell expansion and protects against estrogen genotoxicity.

    PubMed

    Zhang, Yongshu; Xia, Jixiang; Li, Qinglin; Yao, Yuan; Eades, Gabriel; Gernapudi, Ramkishore; Duru, Nadire; Kensler, Thomas W; Zhou, Qun

    2014-11-01

    Long noncoding RNAs (lncRNAs) have emerged as key regulators of gene expression in embryonic stem cell (ESC) self-renewal and differentiation. In ESCs, lncRNAs are regulated at the genetic level via transcription factor binding to lncRNA gene promoters. Here we demonstrate that the key cytoprotective transcription factor NRF2 controls lncRNA expression in mammary stem cells. By profiling lncRNAs in wild-type and NRF2 knockdown mammary stem cells, we demonstrate that the lncRNA ROR, a regulator of embryonic stem cell pluripotency, is overexpressed upon NRF2 knockdown. We performed promoter analyses and examined predicted NRF2 binding elements in the ROR promoter using luciferase reporter constructs of a ROR promoter deletion series. Our studies revealed that NRF2 binds to two specific NRF2 response elements flanking the ROR promoter and that these two NRF2 response elements are equally important to suppress ROR transcription. In addition, we identified associated H3K27me3 chromatin modification and EZH2 binding at the ROR promoter that was dependent on NRF2 binding. We observed that NRF2 knockdown or ROR overexpression leads to increased stem cell self-renewal in mammary stem cells. Furthermore, we demonstrate Nrf2 regulation of the mammary stem cell population in vivo. These observations provide further evidence for the critical role of NRF2 in maintaining normal stem cell subpopulations in mammary epithelium. PMID:25231996

  4. Cobalt induces heme oxygenase-1 expression by a hypoxia-inducible factor-independent mechanism in Chinese hamster ovary cells: regulation by Nrf2 and MafG transcription factors.

    PubMed

    Gong, P; Hu, B; Stewart, D; Ellerbe, M; Figueroa, Y G; Blank, V; Beckman, B S; Alam, J

    2001-07-20

    We have shown previously that activation of the heme oxygenase-1 (ho-1) gene by hypoxia in aortic smooth muscle cells is mediated by hypoxia-inducible factor-1 (HIF-1). In mutant (Ka13) Chinese hamster ovary cells lacking HIF activity, accumulation of ho-1 mRNA in response to hypoxia and the hypoxia-mimetic CoCl(2) was similar to that observed in wild type (K1) cells. These results support the existence of HIF-dependent and HIF-independent mechanisms for ho-1 gene activation by hypoxia and CoCl(2). In Ka13 cells, CoCl(2) stimulated expression of a luciferase reporter gene under the control of a 15-kilobase pair mouse ho-1 promoter (pHO15luc). Mutation analyses identified the cobalt-responsive sequences as the stress-response elements (StREs). In electrophoretic mobility shift assays, two specific StRE-protein complexes were observed using extracts from Ka13 cells. In response to cobalt, the level of the slower migrating complex X increased, whereas that of complex Y decreased, in a time-dependent manner. Members of the AP-1 superfamily of basic-leucine zipper factors bind to the StRE. Antibody supershift electrophoretic mobility shift assays did not detect Jun, Fos, or ATF/CREB proteins but identified Nrf2 and the small Maf protein, MafG, as components of complex X. Furthermore, dominant-negative mutants of Nrf2 and small Maf, but not of other bZIP factors, attenuated cobalt-mediated gene activation. Additional experiments demonstrated that induction by cobalt does not result from increased expression of MafG or regulated nuclear translocation of Nrf2 but is dependent on cellular oxidative stress. Unlike cobalt, hypoxia did not stimulate pHO15luc expression and did not increase StRE binding activity, indicating distinct mechanisms for ho-1 gene activation by cobalt and hypoxia in Chinese hamster ovary cells. PMID:11356853

  5. Zeaxanthin induces Nrf2-mediated phase II enzymes in protection of cell death.

    PubMed

    Zou, X; Gao, J; Zheng, Y; Wang, X; Chen, C; Cao, K; Xu, J; Li, Y; Lu, W; Liu, J; Feng, Z

    2014-01-01

    Zeaxanthin (Zea) is a major carotenoid pigment contained in human retina, and its daily supplementation associated with lower risk of age-related macular degeneration. Despite known property of Zea as an antioxidant, its underlying molecular mechanisms of action remain poorly understood. In this study, we aim to study the regulation mechanism of Zea on phase II detoxification enzymes. In normal human retinal pigment epithelium cells, Zea promoted the nuclear translocation of NF-E2-related factor 2 (Nrf2) and induced mRNA and protein expression of phase II enzymes, the induction was suppressed by specific knockdown of Nrf2. Zea also effectively protected against tert-butyl hydroperoxide-induced mitochondrial dysfunction and apoptosis. Glutathione (GSH) as the most important antioxidant was also induced by Zea through Nrf2 activation in a time- and dose-dependent manner, whereas the protective effects of Zea were decimated by inhibition of GSH synthesis. Finally, Zea activated the PI3K/Akt and MAPK/ERK pathway, whereas only PI3K/Akt activation correlated with phase II enzymes induction and Zea protection. In further in vivo analyses, Zea showed effects of inducing phase II enzymes and increased GSH content, which contributed to the reduced lipid and protein peroxidation in the retina as well as the liver, heart, and serum of the Sprague-Dawley rats. For the first time, Zea is presented as a phase II enzymes inducer instead of being an antioxidant. By activating Nrf2-mediated phase II enzymes, Zea could enhance anti-oxidative capacity and prevent cell death both in vivo and in vitro. PMID:24810054

  6. Nrf2 Knockout Attenuates the Anti-Inflammatory Effects of Phenethyl Isothiocyanate and Curcumin

    PubMed Central

    2015-01-01

    The role of phytochemicals in preventive and therapeutic medicine is a major area of scientific research. Several studies have illustrated the mechanistic roles of phytochemicals in Nrf2 transcriptional activation. The present study aims to examine the importance of the transcription factor Nrf2 by treating peritoneal macrophages from Nrf2+/+ and Nrf2–/– mice ex vivo with phenethyl isothiocyanate (PEITC) and curcumin (CUR). The peritoneal macrophages were pretreated with the drugs and challenged with lipopolysaccharides (LPSs) alone and in combination with PEITC or CUR to assess their anti-inflammatory and antioxidative effects based on gene and protein expression in the treated cells. LPS treatment resulted in an increase in the expression of inflammatory markers such as cycloxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) in both Nrf2+/+ and Nrf2–/– macrophages, detected by quantitative polymerase chain reaction (qPCR). Nrf2+/+ macrophages treated with PEITC and CUR exhibited a significant decrease in the expression of these anti-inflammatory genes along with an increase in the expression of hemeoxygenase-1 (HO-1), which is an antioxidative stress gene downstream of the Nrf2 transcription factor battery. Although there was no significant decrease in the expression of the anti-inflammatory genes or an increase in HO-1 expression in Nrf2–/– macrophages treated with either PEITC or CUR, there was a significant decrease in the protein expression of COX-2 and an increase in the expression of HO-1 in Nrf2+/+ macrophages treated with PEITC compared to that with CUR treatment. No significant changes were observed in the macrophages from knockout animals. Additionally, there was a significant decrease in LPS-induced IL-6 and TNF-α production following PEITC treatment compared with that following CUR in Nrf2+/+ macrophages, whereas no change was observed in the macrophages from knockout

  7. Ethanol Induction of CYP2A5: Role of CYP2E1-ROS-Nrf2 Pathway

    PubMed Central

    Lu, Yongke; Zhang, Xu Hannah

    2012-01-01

    Chronic ethanol consumption was previously shown to induce CYP2A5 in mice, and this induction of CYP2A5 by ethanol was CYP2E1 dependent. In this study, the mechanisms of CYP2E1-dependent ethanol induction of CYP2A5 were investigated. CYP2E1 was induced by chronic ethanol consumption to the same degree in wild-type (WT) mice and CYP2A5 knockout (Cyp2a5 –/–) mice, suggesting that unlike the CYP2E1-dependent ethanol induction of CYP2A5, ethanol induction of CYP2E1 is not CYP2A5 dependent. Microsomal ethanol oxidation was about 25% lower in Cyp2a5 –/– mice compared with that in WT mice, suggesting that CYP2A5 can oxidize ethanol although to a lesser extent than CYP2E1 does. CYP2A5 was induced by short-term ethanol consumption in human CYP2E1 transgenic knockin (Cyp2e1 –/– KI) mice but not in CYP2E1 knockout (Cyp2e1 –/–) mice. The redox-sensitive transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) was also induced by acute ethanol in Cyp2e1 –/– KI mice but not in Cyp2e1 –/– mice. Ethanol induction of CYP2A5 in Nrf2 knockout (Nrf2 –/–) mice was lower compared with that in WT mice, whereas CYP2E1 induction by ethanol was comparable in WT and Nrf2 –/– mice. Antioxidants (N-acetyl-cysteine and vitamin C), which blocked oxidative stress induced by chronic ethanol in WT mice and acute ethanol in Cyp2e1 –/– KI mice, also blunted the induction of CYP2A5 and Nrf2 by ethanol but not the induction of CYP2E1 by ethanol. These results suggest that oxidative stress induced by ethanol via induction of CYP2E1 upregulates Nrf2 activity, which in turn regulates ethanol induction of CYP2A5. Results obtained from primary hepatocytes, mice gavaged with binge ethanol or fed chronic ethanol, show that Nrf2-regulated ethanol induction of CYP2A5 protects against ethanol-induced steatosis. PMID:22552773

  8. Identification of novel NRF2-regulated genes by ChIP-Seq: influence on retinoid X receptor alpha

    PubMed Central

    Chorley, Brian N.; Campbell, Michelle R.; Wang, Xuting; Karaca, Mehmet; Sambandan, Deepa; Bangura, Fatu; Xue, Peng; Pi, Jingbo; Kleeberger, Steven R.; Bell, Douglas A.

    2012-01-01

    Cellular oxidative and electrophilic stress triggers a protective response in mammals regulated by NRF2 (nuclear factor (erythroid-derived) 2-like; NFE2L2) binding to deoxyribonucleic acid-regulatory sequences near stress-responsive genes. Studies using Nrf2-deficient mice suggest that hundreds of genes may be regulated by NRF2. To identify human NRF2-regulated genes, we conducted chromatin immunoprecipitation (ChIP)-sequencing experiments in lymphoid cells treated with the dietary isothiocyanate, sulforaphane (SFN) and carried out follow-up biological experiments on candidates. We found 242 high confidence, NRF2-bound genomic regions and 96% of these regions contained NRF2-regulatory sequence motifs. The majority of binding sites were near potential novel members of the NRF2 pathway. Validation of selected candidate genes using parallel ChIP techniques and in NRF2-silenced cell lines indicated that the expression of about two-thirds of the candidates are likely to be directly NRF2-dependent including retinoid X receptor alpha (RXRA). NRF2 regulation of RXRA has implications for response to retinoid treatments and adipogenesis. In mouse, 3T3-L1 cells’ SFN treatment affected Rxra expression early in adipogenesis, and knockdown of Nrf2-delayed Rxra expression, both leading to impaired adipogenesis. PMID:22581777

  9. Protective Effect of Thymoquinone against Cyclophosphamide-Induced Hemorrhagic Cystitis through Inhibiting DNA Damage and Upregulation of Nrf2 Expression.

    PubMed

    Gore, Prashant R; Prajapati, Chaitali P; Mahajan, Umesh B; Goyal, Sameer N; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R

    2016-01-01

    Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues. PMID:27489498

  10. Omega-3 fatty acids protect the brain against ischemic injury by activating Nrf2 and upregulating heme oxygenase 1.

    PubMed

    Zhang, Meijuan; Wang, Suping; Mao, Leilei; Leak, Rehana K; Shi, Yejie; Zhang, Wenting; Hu, Xiaoming; Sun, Baoliang; Cao, Guodong; Gao, Yanqin; Xu, Yun; Chen, Jun; Zhang, Feng

    2014-01-29

    Ischemic stroke is a debilitating clinical disorder that affects millions of people, yet lacks effective neuroprotective treatments. Fish oil is known to exert beneficial effects against cerebral ischemia. However, the underlying protective mechanisms are not fully understood. The present study tests the hypothesis that omega-3 polyunsaturated fatty acids (n-3 PUFAs) attenuate ischemic neuronal injury by activating nuclear factor E2-related factor 2 (Nrf2) and upregulating heme oxygenase-1 (HO-1) in both in vitro and in vivo models. We observed that pretreatment of rat primary neurons with docosahexaenoic acid (DHA) significantly reduced neuronal death following oxygen-glucose deprivation. This protection was associated with increased Nrf2 activation and HO-1 upregulation. Inhibition of HO-1 activity with tin protoporphyrin IX attenuated the protective effects of DHA. Further studies showed that 4-hydroxy-2E-hexenal (4-HHE), an end-product of peroxidation of n-3 PUFAs, was a more potent Nrf2 inducer than 4-hydroxy-2E-nonenal derived from n-6 PUFAs. In an in vivo setting, transgenic mice overexpressing fatty acid metabolism-1, an enzyme that converts n-6 PUFAs to n-3 PUFAs, were remarkably resistant to focal cerebral ischemia compared with their wild-type littermates. Regular mice fed with a fish oil-enhanced diet also demonstrated significant resistance to ischemia compared with mice fed with a regular diet. As expected, the protection was associated with HO-1 upregulation, Nrf2 activation, and 4-HHE generation. Together, our data demonstrate that n-3 PUFAs are highly effective in protecting the brain, and that the protective mechanisms involve Nrf2 activation and HO-1 upregulation by 4-HHE. Further investigation of n-3 PUFA neuroprotective mechanisms may accelerate the development of stroke therapies. PMID:24478369

  11. Protective Effect of Thymoquinone against Cyclophosphamide-Induced Hemorrhagic Cystitis through Inhibiting DNA Damage and Upregulation of Nrf2 Expression

    PubMed Central

    Gore, Prashant R.; Prajapati, Chaitali P.; Mahajan, Umesh B.; Goyal, Sameer N.; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R.

    2016-01-01

    Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues. PMID:27489498

  12. Reduction of DNA damage induced by titanium dioxide nanoparticles through Nrf2 in vitro and in vivo.

    PubMed

    Shi, Zhiqin; Niu, Yujie; Wang, Qian; Shi, Lei; Guo, Huicai; Liu, Yi; Zhu, Yue; Liu, Shufeng; Liu, Chao; Chen, Xin; Zhang, Rong

    2015-11-15

    Titanium dioxide nanoparticles (Nano-TiO2) are widely used to additives in cosmetics, pharmaceutical, paints and foods. Recent studies have demonstrated that Nano-TiO2 induces DNA damage and increased the risk of cancer and the mechanism might relate with oxidative stress. The aim of this study was to evaluate the effects of Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), an anti-oxidative mediator, on DNA damage induced by Nano-TiO2. Wildtype, Nrf2 knockout (Nrf2(-/-)) and tert-butylhydroquinone (tBHQ) pre-treated HepG2 cells and mice were treated with Nano-TiO2. And then the oxidative stress and DNA damage were evaluated. Our data showed that DNA damage, reactive oxygen species (ROS) generation and MDA content in Nano-TiO2 exposed cells were significantly increased than those of control in dose dependent manners. Nrf2/ARE droved the downstream genes including NAD(P)H dehydrogenase [quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC) expression were significantly higher in wildtype HepG2 cells after Nano-TiO2 treatment. After treatment with Nano-TiO2, the DNA damages were significantly increased in Nrf(-/-) cells and mice whereas significantly decreased in tBHQ pre-treatment cells and mice, compared with the wildtype HepG2 cells and mice, respectively. Our results indicated that the acquired of Nrf2 leads to a decreased susceptibility to DNA damages induction by Nano-TiO2 and decreasing of risk of cancer which would provide a strategy for a more efficacious sensitization of against of Nano-TiO2 toxication. PMID:26091733

  13. Ethanol Extract of Ganoderma lucidum Augments Cellular Anti-oxidant Defense through Activation of Nrf2/HO-1

    PubMed Central

    Lee, Yoo-hwan; Kim, Jung-hee; Song, Choon-ho; Jang, Kyung-jeon; kim, Cheol-hong; Kang, Ji- Sook; Choi, Yung-hyun

    2016-01-01

    Objectives: The mushroom Ganoderma lucidum has been widely used as a traditional herbal medicine for many years. Although several studies have focused on the anti-oxidative activity of this mushroom, the molecular mechanisms underlying its activity have not yet been clearly established. The present study investigated the cytoprotective effect of ethanol extract of Ganoderma lucidum (EGL) against oxidative stress (hydrogen peroxide, H2O2) and elucidated the underlying mechanisms in a C2C12 myoblast cell line. Methods: Oxidative stress markers were determined by using the comet assay to measure reactive oxygen species (ROS) generation and deoxyribonucleic acid (DNA) damage. Cell viability and Western blotting analyses were employed to evaluate the cellular response to EGL and H2O2 in C2C12 cells. Transfection with nuclear factor erythroid 2-related factor 2 (Nrf2)-specific small interfering ribonucleic acid (siRNA) was conducted to understand the relationship between Nrf2 expression and H2O2-induced growth inhibition. Results: The results showed that EGL effectively inhibited H2O2-induced growth and the generation of ROS. EGL markedly suppressed H2O2-induced comet-like DNA formation and phosphorylation of histone H2AX at serine 139 (p-γH2AX), a widely used marker of DNA damage, suggesting that EGL prevented H2O2-induced DNA damage. Furthermore, the EGL treatment effectively induced the expression of Nrf2, as well as heme oxygenase-1 (HO-1), with parallel phosphorylation and nuclear translocation of Nrf2 in the C2C12 myoblasts. However, zinc protoporphyrin IX, a HO-1 inhibitor, significantly abolished the protective effects of EGL against H2O2-induced accumulation of ROS and reduced cell growth. Notably, transient transfection with Nrf2-specific siRNA attenuated the cytoprotective effects and HO-1 induction by EGL, indicating that EGL induced the expression of HO-1 in an Nrf2-dependent manner. Conclusion: Collectively, these results demonstrate that EGL augments the

  14. CYP2E1 impairs GLUT4 gene expression and function: NRF2 as a possible mediator.

    PubMed

    Armoni, M; Harel, C; Ramdas, M; Karnieli, E

    2014-06-01

    Impaired GLUT4 function/expression in insulin target tissues is well-documented in diabetes and obesity. Cytochrome P450 isoform 2E1 (CYP2E1) induces oxidative stress, leading to impaired insulin action. CYP2E1 knockout mice are protected against high fat diet-induced insulin resistance and obesity; however the molecular mechanisms are still unclear. We examined whether CYP2E1 impairs GLUT4 gene expression and function in adipose and muscle cells. CYP2E1 overexpression in skeletal muscle-derived L6 cells inhibited insulin-stimulated Glut4 translocation and 2-deoxyglucose uptake, with the latter inhibition being blocked by vitamin E. CYP2E1 overexpression in L6 and primary rat adipose (PRA) cells suppressed GLUT4 gene expression at promoter and mRNA levels, whereas CYP2E1 silencing had opposite effects. In PRA, CYP2E1-induced suppression of GLUT4 expression was blocked by chlormethiazole (CYP2E1-specific inhibitor) and the antioxidants vitamin E and N-acetyl-l-cysteine. CYP2E1 effect was mediated by the transcription factor NF-E2-related factor 2 (NRF2), as evident from its complete reversal by a coexpressed dominant-negative, but not wild-type NRF2. GLUT4 transcription was suppressed by NRF2 overexpression, and enhanced by NRF2 silencing. Promoter and ChIP analysis showed a direct and specific binding of NRF2 to a 58-326 GLUT4 promoter region that was required to maintain CYP2E1 suppression; this binding was enhanced by CYP2E1 overexpression. We suggest a mechanism for CYP2E1 action that involves: a) suppression of GLUT4 gene expression that is mediated by NRF2; b) impairment of insulin-stimulated Glut4 translocation and function. CYP2E1 and NRF2 are introduced as negative regulators of GLUT4 expression and function in insulin-sensitive cells. PMID:24500986

  15. Supplementation of a grape seed and grape marc meal extract decreases activities of the oxidative stress-responsive transcription factors NF-κB and Nrf2 in the duodenal mucosa of pigs

    PubMed Central

    2013-01-01

    Background In pigs, enteric infections and the development of gut disorders such as diarrhoea are commonly observed, particularly after weaning. The present study investigated the hypothesis that feeding a grape seed and grape marc extract (GSGME) as a dietary supplement has the potential to suppress the inflammatory process in the small intestine of pigs by modulating the activities of NF-κB and Nrf2 due to its high content of flavonoids. Methods Twenty-four crossbred, 6 weeks old pigs were randomly assigned to 2 groups of 12 animals each and fed nutritionally adequate diets without or with 1% GSGME for 4 weeks. Results Pigs administered GSGME had a lower transactivation of NF-κB and Nrf2 and a lower expression of various target genes of these transcription factors in the duodenal mucosa than control pigs (P < 0.05). Concentrations of α-tocopherol and thiobarbituric acid reactive substances (TBARS) in liver and plasma and total antioxidant capacity of plasma and relative mRNA abundances of NF-κB and Nrf2 target genes in the liver did not differ between the two groups. However, the ratio of villus height:crypt depth and the gain:feed ratio was higher in the pigs fed GSGME than in control pigs (P < 0.05). Conclusions This study shows that dietary supplementation of a polyphenol rich GSGME suppresses the activity of NF-κB in the duodenal mucosa of pigs and thus might provide a useful dietary strategy to inhibit inflammation in the gut frequently occurring in pigs. Feeding GSGME did not influence vitamin E status and the antioxidant system of the pigs but improved the gain:feed ratio. In overall, the study suggests that polyphenol-rich plant extracts such GSGME could be useful feed supplements in pig nutrition, in order to maintain animal health and improve performance. PMID:23453040

  16. Frataxin Deficiency Leads to Defects in Expression of Antioxidants and Nrf2 Expression in Dorsal Root Ganglia of the Friedreich's Ataxia YG8R Mouse Model

    PubMed Central

    Shan, Yuxi; Schoenfeld, Robert A.; Hayashi, Genki; Napoli, Eleonora; Akiyama, Tasuku; Iodi Carstens, Mirela; Carstens, Earl E.; Pook, Mark A.

    2013-01-01

    Abstract Aims: Oxidative stress is thought to be involved in Friedreich's ataxia (FRDA), yet it has not been demonstrated in the target neurons that are first to degenerate. Using the YG8R mouse model of FRDA, microarray and neuritic growth experiments were carried out in the dorsal root ganglion (DRG), the primary site of neurodegeneration in this disease. Results: YG8R hemizygous mice exhibited defects in movement, and DRG neurites had growth defects. Microarray of DRG tissue identified decreased transcripts encoding the antioxidants, including peroxiredoxins, glutaredoxins, and glutathione S-transferase, and these were confirmed by immunoblots and quantitative real-time PCR. Because the decreased gene transcripts are the known targets of the antioxidant transcription factor nuclear factor-E2-related factor-2 (Nrf2), Nrf2 expression was measured; it was significantly decreased at the transcript and protein level in both the DRG and the cerebella of the YG8R hemizygous mouse; further, frataxin expression was significantly correlated with Nrf2 expression. Functionally, in YG8R hemizygous DRG, the total glutathione levels were reduced and explanted cells were more sensitive to the thioredoxin reductase (TxnRD) inhibitor auranofin, a thiol oxidant. In cell models of FRDA, including Schwann and the DRG, frataxin deficiency caused a decreased expression of the Nrf2 protein level in the nucleus, but not a defect in its translocation from the cytosol. Further, frataxin-deficient cells had decreased enzyme activity and expression of TxnRD, which is regulated by Nrf2, and were sensitive the TxnRD inhibitor auranofin. Innovation and Conclusion: These results support a mechanistic hypothesis in which frataxin deficiency decreases Nrf2 expression in vivo, causing the sensitivity to oxidative stress in target tissues the DRG and the cerebella, which contributes to the process of neurodegeneration. Antioxid. Redox Signal. 19, 1481–1493. PMID:23350650

  17. Salvianolic acid A protects RPE cells against oxidative stress through activation of Nrf2/HO-1 signaling.

    PubMed

    Zhang, Hui; Liu, Yuan-yuan; Jiang, Qin; Li, Ke-ran; Zhao, Yu-xia; Cao, Cong; Yao, Jin

    2014-04-01

    Reactive oxygen species (ROS) impair the physiological functions of retinal pigment epithelial (RPE) cells, which is known as one major cause of age-related macular degeneration. Salvianolic acid A (Sal A) is the main effective aqueous extract of Salvia miltiorrhiza. The aim of this study was to test the potential role of Sal A against oxidative stress in cultured RPE cells and to investigate the underlying mechanistic signaling pathways. We observed that Sal A significantly inhibited hydrogen peroxide (H2O2)-induced primary and transformed RPE cell death and apoptosis. H2O2-stimulated mitogen-activated protein kinase activation, ROS production, and subsequent proapoptotic AMP-activated protein kinase activation were largely inhibited by Sal A. Further, Sal A stimulation resulted in a fast and dramatic activation of Akt/mammalian target of rapamycin complex 1 (mTORC1) signaling, followed by phosphorylation, accumulation, and nuclear translocation of the NF-E2-related factor 2 (Nrf2), along with increased expression of the antioxidant-response element-dependent gene heme oxygenase-1 (HO-1). Both Nrf2 and HO-1 were required for Sal A-mediated cytoprotective effect, as Nrf2/HO-1 inhibition abolished Sal A-induced beneficial effects against H2O2. Meanwhile, the PI3K/Akt/mTORC1 chemical inhibitors not only suppressed Sal A-induced Nrf2/HO-1 activation, but also eliminated its cytoprotective effect in RPE cells. These observations suggest that Sal A activates the Nrf2/HO-1 axis in RPE cells and protects against oxidative stress via activation of Akt/mTORC1 signaling. PMID:24486344

  18. Dysfunctional KEAP1–NRF2 Interaction in Non-Small-Cell Lung Cancer

    PubMed Central

    Singh, Anju; Misra, Vikas; Thimmulappa, Rajesh K; Lee, Hannah; Ames, Stephen; Hoque, Mohammad O; Herman, James G; Baylin, Stephen B; Sidransky, David; Gabrielson, Edward; Brock, Malcolm V; Biswal, Shyam

    2006-01-01

    Background Nuclear factor erythroid-2 related factor 2 (NRF2) is a redox-sensitive transcription factor that positively regulates the expression of genes encoding antioxidants, xenobiotic detoxification enzymes, and drug efflux pumps, and confers cytoprotection against oxidative stress and xenobiotics in normal cells. Kelch-like ECH-associated protein 1 (KEAP1) negatively regulates NRF2 activity by targeting it to proteasomal degradation. Increased expression of cellular antioxidants and xenobiotic detoxification enzymes has been implicated in resistance of tumor cells against chemotherapeutic drugs. Methods and Findings Here we report a systematic analysis of the KEAP1 genomic locus in lung cancer patients and cell lines that revealed deletion, insertion, and missense mutations in functionally important domains of KEAP1 and a very high percentage of loss of heterozygosity at 19p13.2, suggesting that biallelic inactivation of KEAP1 in lung cancer is a common event. Sequencing of KEAP1 in 12 cell lines and 54 non-small-cell lung cancer (NSCLC) samples revealed somatic mutations in KEAP1 in a total of six cell lines and ten tumors at a frequency of 50% and 19%, respectively. All the mutations were within highly conserved amino acid residues located in the Kelch or intervening region domain of the KEAP1 protein, suggesting that these mutations would likely abolish KEAP1 repressor activity. Evaluation of loss of heterozygosity at 19p13.2 revealed allelic losses in 61% of the NSCLC cell lines and 41% of the tumor samples. Decreased KEAP1 activity in cancer cells induced greater nuclear accumulation of NRF2, causing enhanced transcriptional induction of antioxidants, xenobiotic metabolism enzymes, and drug efflux pumps. Conclusions This is the first study to our knowledge to demonstrate that biallelic inactivation of KEAP1 is a frequent genetic alteration in NSCLC. Loss of KEAP1 function leading to constitutive activation of NRF2-mediated gene expression in cancer

  19. Regulatory Role of KEAP1 and NRF2 in PPARγ Expression and Chemoresistance in Human Non-small Cell Lung Carcinoma Cells

    PubMed Central

    Zhan, Lijuan; Zhang, Hao; Zhang, Qiang; Woods, Courtney G.; Chen, Yanyan; Xue, Peng; Dong, Jian; Tokar, Erik J.; Xu, Yuanyuan; Hou, Yongyong; Fu, Jingqi; Yarborough, Kathy; Wang, Aiping; Qu, Weidong; Waalkes, Michael P.; Andersen, Melvin E.; Pi, Jingbo

    2012-01-01

    The nuclear factor-E2-related factor 2 (NRF2) serves as a master regulator in cellular defense against oxidative stress and chemical detoxification. However, persistent activation of NRF2 resulting from mutations of NRF2 and/or downregulation or mutations of its suppressor Kelch-like ECH-associated protein 1 (KEAP1) are associated with tumorigenicity and chemoresistance of non-small-cell lung carcinomas (NSCLCs). Thus, inhibiting NRF2-mediated adaptive antioxidant response is widely considered a promising strategy to prevent tumor growth and reverse chemoresistance in NSCLCs. Unexpectedly, stable knockdown of KEAP1 by lentiviral shRNA sensitized three independent NSCLC cell lines (A549, HTB-178 and HTB-182) to multiple chemotherapeutic agents, including arsenic trioxide (As2O3), etoposide and doxorubicin, despite moderately increased NRF2 levels. In lung adenocarcinoma epithelial A549 cells, silencing of KEAP1 augmented the expression of peroxisome proliferator-activated receptor γ (PPARγ) and genes associated with cell differentiation, including E-Cadherin and Gelsolin. In addition, KEAP1-knockdown A549 cells displayed attenuated expression of proto-oncogene Cyclin D1 and markers for cancer stem cells (CSCs), and reduced non-adherent sphere formation. Moreover, deficiency of KEAP1 led to elevated induction of PPARγ in response to As2O3. Pretreatment of A549 cells with PPARγ agonists activated PPARγ and augmented the cytotoxicity of As2O3. A mathematical model was formulated to advance a hypothesis that differential regulation of PPARγ and detoxification enzymes by KEAP1 and NRF2 may underpin the observed landscape changes in chemo-sensitivity. Collectively, suppression of KEAP1 expression in human NSCLC cells resulted in sensitization to chemotherapeutic agents, which may be attributed to activation of PPARγ and subsequent alterations in cell differentiation and CSC abundance. PMID:22684020

  20. Oxidised LDL up-regulate CD36 expression by the Nrf2 pathway in 3T3-L1 preadipocytes.

    PubMed

    D'Archivio, Massimo; Scazzocchio, Beatrice; Filesi, Carmela; Varì, Rosaria; Maggiorella, Maria Teresa; Sernicola, Leonardo; Santangelo, Carmela; Giovannini, Claudio; Masella, Roberta

    2008-06-25

    The effect of oxLDL on CD36 expression has been assessed in preadipocytes induced to differentiate. Novel evidence is provided that oxLDL induce a peroxisome proliferator-activated receptor gamma-independent CD36 overexpression, by up-regulating nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2). The nuclear translocation of Nrf2 appeared to depend on PKC pathway activation. In adipocytes, the CD36 up-regulation may indicate a compensation mechanism to meet the demand of excess oxLDL and oxidised lipids in blood, reducing the risk of atherogenesis. Besides strengthening the hypothesis that oxLDL can contribute to the onset of insulin-resistance, data herein presented highlight the significance of oxLDL-induced CD36 overexpression within the cellular defence response. PMID:18514070

  1. Role of Nrf2 in Oxidative Stress and Toxicity

    PubMed Central

    Ma, Qiang

    2015-01-01

    Organismal life encounters reactive oxidants from internal metabolism and environmental toxicant exposure. Reactive oxygen and nitrogen species cause oxidative stress and are traditionally viewed as being harmful. On the other hand, controlled production of oxidants in normal cells serves useful purposes to regulate signaling pathways. Reactive oxidants are counterbalanced by complex antioxidant defense systems regulated by a web of pathways to ensure that the response to oxidants is adequate for the body’s needs. A recurrent theme in oxidant signaling and antioxidant defense is reactive cysteine thiol–based redox signaling. The nuclear factor erythroid 2–related factor 2 (Nrf2) is an emerging regulator of cellular resistance to oxidants. Nrf2 controls the basal and induced expression of an array of antioxidant response element–dependent genes to regulate the physiological and pathophysiological outcomes of oxidant exposure. This review discusses the impact of Nrf2 on oxidative stress and toxicity and how Nrf2 senses oxidants and regulates antioxidant defense. PMID:23294312

  2. Nrf2 protects against As(III)-induced damage in mouse liver and bladder

    PubMed Central

    Jiang, Tao; Huang, Zheping; Chan, Jefferson Y.; Zhang, Donna D.

    2009-01-01

    Arsenic compounds are classified as toxicants and human carcinogens. Environmental exposure to arsenic imposes a big health issue worldwide. Arsenic elicits its toxic efforts through many mechanisms, including generation of reactive oxygen species (ROS). Nrf2 is the primary transcription factor that controls expression of a main cellular antioxidant response, which is required for neutralizing ROS and thus defending cells from exogenous insults. Previously, we demonstrated a protective role of Nrf2 against arsenic-induced toxicity using a cell culture model. In this report, we present evidence that Nrf2 protects against liver and bladder injury in response to six-weeks of arsenic exposure in a mouse model. Nrf2−/− mice displayed more severe pathological changes in the liver and bladder, compared to Nrf2+/+ mice. Furthermore, Nrf2−/− mice were more sensitive to arsenic-induced DNA hypomethylation, oxidative DNA damage, and apoptotic cell death. These results indicate a protective role of Nrf2 against arsenic toxicity in vivo. Hence, this work demonstrates the feasibility of using dietary compounds that target activation of the Nrf2 signaling pathway to alleviate arsenic-induced damage. PMID:19538980

  3. Nrf2-mediated haeme oxygenase-1 up-regulation induced by cobalt protoporphyrin has antinociceptive effects against inflammatory pain in the formalin test in mice.

    PubMed

    Rosa, Angelo O; Egea, Javier; Lorrio, Silvia; Rojo, Ana I; Cuadrado, Antonio; López, Manuela G

    2008-07-15

    This study investigated the effect of haeme oxygenase-1 (HO-1) in nociception induced by formalin injection in the mice hind paw. Intraperitoneal (i.p.) administration of cobalt protoporphyrin (CoPP, an HO-1 inducer, 5mg/kg) 24h before the test, inhibited the nociceptive response during the second phase, but not during the first phase of the formalin test. The effect of CoPP was prevented by treatment with tin protoporphyrin (SnPP, an inhibitor of HO-1 activity) administered either by i.p. (25mg/kg, 30 min before the test) or intraplantar (400 nmol/paw, 5 min before the test) routes. Human embryonic kidney (HEK) 293T cells treated with 10 microM CoPP expressed 20-fold higher HO-1 levels when compared to controls; this effect was suppressed by transfection with the dominant negative for the nuclear factor-erythroid 2-related factor 2 (Nrf2). Western blot analysis also revealed that CoPP treatment induced a similar 20-fold increase in HO-1 expression in the paw; this effect was attenuated in knockout mice for Nrf2. CoPP treatment of wild-type, but not in Nrf2 knockout mice, resulted in a striking increase of HO-1 stained cells surrounding the muscular tissues of the hind limbs. HO-1 positive cells were scarce in wild-type and in Nrf2 knockout untreated mice. CoPP-induced HO-1 expression in Nrf2 knockout mice was lost and correlated with the loss of antinociceptive effects. In conclusion, Nrf2-mediated HO-1 expression induced an antinociceptive effect at peripheral sites. These results suggest that HO-1 modulates the inflammatory pain pathways. Hence, the development of drugs that could raise peripheral HO-1 could be relevant in inflammatory pain treatment. PMID:17964723

  4. Lipoxin A4-Induced Heme Oxygenase-1 Protects Cardiomyocytes against Hypoxia/Reoxygenation Injury via p38 MAPK Activation and Nrf2/ARE Complex

    PubMed Central

    Chen, Xiao-Qing; Wu, Sheng-Hua; Zhou, Yu; Tang, Yan-Rong

    2013-01-01

    Objective To investigate whether lipoxin A4 (LXA4) increases expression of heme oxygenase-1(HO-1) in cardiomyocytes, whether LXA4-induced HO-1 protects cardiomyocytes against hypoxia/reoxygenation (H/R) injury, and what are the mechanisms involved in the LXA4-induced HO-1 induction. Methods Rat cardiomyocytes were exposed to H/R injury with or without preincubation with LXA4 or HO-1 inhibitor ZnPP-IX or various signal molecule inhibitors. Expressions of HO-1 protein and mRNA were analyzed by using Western blot and RT-PCR respectively. Activity of nuclear factor E2-related factor 2 (Nrf2) binding to the HO-1 E1 enhancer was assessed by chromatin immunoprecipitation. Nrf2 binding to the HO-1 antioxidant responsive element (ARE) were measured by using electrophoretic mobility shift assay. Results Pretreatment of the cells undergoing H/R lesion with LXA4 significantly reduced the lactate dehydrogenase and creatine kinase productions, increased the cell viability, and increased the expressions of HO-1 protein and mRNA and HO-1 promoter activity. HO-1 inhibition abolished the protective role of LXA4 on the cells undergoing H/R lesion. LXA4 increased p38 mitogen-activated protein kinase (p38 MAPK) activation, nuclear translocation of Nrf2, Nrf2 binding to the HO-1 ARE and E1 enhancer in cardiomyocytes with or without H/R exposure. Conclusion The protection role of LXA4 against H/R injury of cardiomyocytes is related to upregulation of HO-1, via activation of p38 MAPK pathway and nuclear translocation of Nrf2 and Nrf2 binding to the HO-1 ARE and E1 enhancer, but not via activation of phosphatidyinositol-3-kinase or extracellular signal-regulated kinase pathway. PMID:23826208

  5. Liver-specific knockdown of IGF-1 decreases vascular oxidative stress resistance by impairing the Nrf2-dependent antioxidant response: a novel model of vascular aging.

    PubMed

    Bailey-Downs, Lora C; Mitschelen, Matthew; Sosnowska, Danuta; Toth, Peter; Pinto, John T; Ballabh, Praveen; Valcarcel-Ares, M Noa; Farley, Julie; Koller, Akos; Henthorn, Jim C; Bass, Caroline; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

    2012-04-01

    Recent studies demonstrate that age-related dysfunction of NF-E2-related factor-2 (Nrf2)-driven pathways impairs cellular redox homeostasis, exacerbating age-related cellular oxidative stress and increasing sensitivity of aged vessels to oxidative stress-induced cellular damage. Circulating levels of insulin-like growth factor (IGF)-1 decline during aging, which significantly increases the risk for cardiovascular diseases in humans. To test the hypothesis that adult-onset IGF-1 deficiency impairs Nrf2-driven pathways in the vasculature, we utilized a novel mouse model with a liver-specific adeno-associated viral knockdown of the Igf1 gene using Cre-lox technology (Igf1(f/f) + MUP-iCre-AAV8), which exhibits a significant decrease in circulating IGF-1 levels (~50%). In the aortas of IGF-1-deficient mice, there was a trend for decreased expression of Nrf2 and the Nrf2 target genes GCLC, NQO1 and HMOX1. In cultured aorta segments of IGF-1-deficient mice treated with oxidative stressors (high glucose, oxidized low-density lipoprotein, and H(2)O(2)), induction of Nrf2-driven genes was significantly attenuated as compared with control vessels, which was associated with an exacerbation of endothelial dysfunction, increased oxidative stress, and apoptosis, mimicking the aging phenotype. In conclusion, endocrine IGF-1 deficiency is associated with dysregulation of Nrf2-dependent antioxidant responses in the vasculature, which likely promotes an adverse vascular phenotype under pathophysiological conditions associated with oxidative stress (eg, diabetes mellitus, hypertension) and results in accelerated vascular impairments in aging. PMID:22021391

  6. Developmental Expression of the Nfe2-Related Factor (Nrf) Transcription Factor Family in the Zebrafish, Danio rerio

    PubMed Central

    Williams, Larissa M.; Timme-Laragy, Alicia R.; Goldstone, Jared V.; McArthur, Andrew G.; Stegeman, John J.; Smolowitz, Roxanna M.; Hahn, Mark E.

    2013-01-01

    Transcription factors in the CNC-bZIP family (NFE2, NRF1, NRF2 and NRF3) regulate genes with a wide range of functions in response to both physiological and exogenous signals, including those indicating changes in cellular redox status. Given their role in helping to maintain cellular homeostasis, it is imperative to understand the expression, regulation, and function of CNC-bZIP genes during embryonic development. We explored the expression and function of six nrf genes (nfe2, nrf1a, nrf1b, nrf2a, nrf2b, and nrf3) using zebrafish embryos as a model system. Analysis by microarray and quantitative RT-PCR showed that genes in the nrf family were expressed throughout development from oocytes to larvae. The spatial expression of nrf3 suggested a role in regulating the development of the brain, brachia and pectoral fins. Knock-down by morpholino anti-sense oligonucleotides suggested that none of the genes were necessary for embryonic viability, but nfe2 was required for proper cellular organization in the pneumatic duct and subsequent swim bladder function, as well as for proper formation of the otic vesicles. nrf genes were induced by the oxidant tert-butylhydroperoxide, and some of this response was regulated through family members Nrf2a and Nrf2b. Our results provide a foundation for understanding the role of nrf genes in normal development and in regulating the response to oxidative stress in vertebrate embryos. PMID:24298298

  7. Sustained NRF2 activation in hereditary leiomyomatosis and renal cell cancer (HLRCC) and in hereditary tyrosinemia type 1 (HT1).

    PubMed

    Sandhu, Ivraj Singh; Maksim, Nicholas James; Amouzougan, Eva Alice; Gallion, Bryce Wilson; Raviele, Anthony L J; Ooi, Aikseng

    2015-08-01

    The nuclear erythroid 2-like 2 transcription factor (NRF2), is a major regulator of cellular redox balance. Although NRF2 activation is generally regarded as beneficial to human health, recent studies have identified that sustained NRF2 activation is over-represented in many cancers. This raises the question regarding the role of NRF2 activation in the development and progression of those cancers. This review focuses on the mechanisms and the effects of NRF2 activation in two hereditary cancer predisposition syndromes: hereditary leiomyomatosis and renal cell cancer (HLRCC) and hereditary tyrosinemia type 1 (HT1). Because the cancer initiating mutations in these hereditary syndromes are well defined, they offer a unique opportunity to explore the roles of NRF2 activation in the early stages of carcinogenesis. Over the years, a variety of approaches have been utilized to study the biology of HLRCC and HT1. In HLRCC, in vitro studies have demonstrated the importance of NRF2 activation in sustaining cancer cell proliferation. In the mouse model of HT1 however, NRF2 activation seems to protect cells from malignant transformation. In both HT1 and HLRCC, NRF2 activation promotes the clearance of electrophilic metabolites, enabling cells to survive cancer-initiating mutations. Biological insights gained from the hereditary syndromes' studies may shed light on to the roles of NRF2 activation in sporadic tumours. PMID:26551707

  8. Dietary myo-inositol modulates immunity through antioxidant activity and the Nrf2 and E2F4/cyclin signalling factors in the head kidney and spleen following infection of juvenile fish with Aeromonas hydrophila.

    PubMed

    Jiang, Wei-Dan; Hu, Kai; Liu, Yang; Jiang, Jun; Wu, Pei; Zhao, Juan; Zhang, Yong-An; Zhou, Xiao-Qiu; Feng, Lin

    2016-02-01

    This study was conducted to investigate the effects of the dietary vitamin myo-inositol (MI), on the immunity and structural integrity of the head kidney and spleen following infection of fish with the major freshwater pathogen bacterial Aeromonas hydrophila. The results demonstrated for the first time that MI deficiency depressed the lysozyme and acid phosphatase (ACP) activities and the complement 3 (C3) and C4 contents in the head kidney and spleen compared with the optimal MI levels, indicating that MI deficiency decreased the immunity of these important fish immune organs. The depression in immunity due to MI deficiency was partially related to oxidative damage [indicated by increases in the malondialdehyde (MDA) and protein carbonyl (PC) contents] that was in turn partially due to the decreased glutathione (GSH) content and the disturbances in antioxidant enzyme activities [total superoxide dismutase (T-SOD), CuZnSOD, MnSOD, catalase (CAT), glutathione peroxidase (GPx) and glutathione reductase (GR)]. MI deficiency inhibited the antioxidant-related gene transcription [CuZnSOD, MnSOD, CAT, GPx1a, GR and NF-E2-related factor 2 (Nrf2)] in the head kidney and spleen following infection of the fish with A. hydrophila. The oxidative damage due to MI deficiency also resulted in the inhibition of proliferation-associated signalling (cyclin D1, cyclin A, cyclin E and E2F4). Thus, MI deficiency partially inhibited damage repair. Excessive MI exhibited negative effects that were similar to MI deficiency, whereas the optimal MI content reversed those indicators. These observations indicated that an MI deficiency or excess could cause depression of the immune system that might be partially related to oxidative damage, antioxidant disturbances, and the inhibition of the proliferation-associated signalling in the head kidney and spleen following infection of fish with A. hydrophila. Finally, the optimal MI levels were 660.7 (based on ACP) and 736.8 mg kg(-1) diet (based

  9. Effects of that ATRA inhibits Nrf2-ARE pathway on glial cells activation after intracerebral hemorrhage

    PubMed Central

    Yin, Xiao-Ping; Zhou, Jun; Wu, Dan; Chen, Zhi-Ying; Bao, Bing

    2015-01-01

    Previous studies indicate that the Nrf2-ARE signaling pathway plays a neruo-protective role in glia cell, however, the mechanism was also elusive. This study aims to explore the inhibitive function of all-trans-retinoic (ATRA) on Nrf2-ARE pathway in intracerebral hemorrhage (ICH), and investigate the mechanism. In this study, the femoral artery injection method was employed to establish ICH model. The model rats were randomly divided into four groups, including Sham group, ICH group, ATRA group and DMSO group. The neurological scores were evaluated for the four groups at different time points. Hematoxylin-Eosin staining was used to stain the CD11b positive glia cells. Double immunofluorescence staining method was utilized to observe the co-expression of HO-1, NF-κB, Nrf2 and TNF-α and CD11b marker in glia cells. Western blot assay was used to detect the Nrf2 protein (total and binding Nrf2), HO-1, NF-κB and TNF-α proteins in every group. The results indicated that neurologiclal scores were significantly decreased in ATRA group compared to ICH gorup (P < 0.05). The glia cells were significantly activated and accumulated in ICH rats. ATRA significantly decreased co-expression of Nrf2, HO-1 and CD11b, and increased co-expression of NF-κB, TNF-α and CD11b of glia cells. ATRA significantly decreased total Nrf2 expression and increased binding Nrf2 expression in ATRA group compared to ICH group (P < 0.05). ATRA decreased anti-oxygen protein Nrf2 and HO-1, and increases inflammatory factors NF-κB and TNF-α. In conclusion, the application of ATRA could inhibit the neuro-protective function effectively by blocking the Nrf2-ARE pathway in glia cells. PMID:26617752

  10. Nrf2-deficiency creates a responsive microenvironment for metastasis to the lung.

    PubMed

    Satoh, Hironori; Moriguchi, Takashi; Taguchi, Keiko; Takai, Jun; Maher, Jonathan M; Suzuki, Takafumi; Winnard, Paul T; Raman, Venu; Ebina, Masahito; Nukiwa, Toshihiro; Yamamoto, Masayuki

    2010-10-01

    The Nrf2 transcription factor is crucial for regulating the cellular defense against various carcinogens. However, relationship between host Nrf2 and cancer metastasis remains unexplored. To address this issue, we examined susceptibility of Nrf2-deficient mice to pulmonary cancer metastasis following implantation of the mouse Lewis lung carcinoma (3LL) cell line. Nrf2-deficient mice reproducibly exhibited a higher number of pulmonary metastatic nodules than wild-type mice did. The lung and bone marrow (BM) of cancer-bearing Nrf2-deficient mice contained increased numbers of inflammatory cells, including myeloid-derived suppressor cells (MDSCs), a potent population of immunosuppressive cells. MDSCs can attenuate CD8(+) T-cell immunity through modification of the T-cell receptor complex exploiting reactive oxygen species (ROS). MDSCs of Nrf2-deficient mice retained elevated levels of ROS relative to wild-type mice. BM transplantation experiments revealed functional disturbance in the hematopoietic and immune systems of Nrf2-deficient mice. Wild-type recipient mice with Nrf2-deficient BM cells showed increased levels of lung metastasis after cancer cell inoculation. These mice exhibited high-level accumulation of ROS in MDSCs, which showed very good coincidence to the decrease of splenic CD8(+) T-cells. In contrast, Keap1-knockdown mutant mice harboring high-level Nrf2 expression displayed increased resistance against the cancer cell metastasis to the lung, accompanied by a decrease in ROS in the MDSCs fraction. Our results thus reveal a novel function for Nrf2 in the prevention of cancer metastasis, presumably by its ability to preserve the redox balance in the hematopoietic and immune systems. PMID:20513672

  11. CDDO-Im protects from acetaminophen hepatotoxicity through induction of Nrf2-dependent genes

    SciTech Connect

    Reisman, Scott A.; Buckley, David B.; Tanaka, Yuji; Klaassen, Curtis D.

    2009-04-01

    CDDO-Im is a synthetic triterpenoid recently shown to induce cytoprotective genes through the Nrf2-Keap1 pathway, an important mechanism for the induction of cytoprotective genes in response to oxidative stress. Upon oxidative or electrophilic insult, the transcription factor Nrf2 translocates to the nucleus, heterodimerizes with small Maf proteins, and binds to antioxidant response elements (AREs) in the upstream promoter regions of various cytoprotective genes. To further elucidate the hepatoprotective effects of CDDO-Im, wild-type and Nrf2-null mice were pretreated with CDDO-Im (1 mg/kg, i.p.) or vehicle (DMSO), and then administered acetaminophen (500 mg/kg, i.p.). Pretreatment of wild-type mice with CDDO-Im reduced liver injury caused by acetaminophen. In contrast, hepatoprotection by CDDO-Im was not observed in Nrf2-null mice. CDDO-Im increased Nrf2 protein expression and Nrf2-ARE binding in wild-type, but not Nrf2-null mice. Furthermore, CDDO-Im increased the mRNA expression of the Nrf2 target genes NAD(P)H: quinone oxidoreductase-1 (Nqo1); glutamate-cysteine ligase, catalytic subunit (Gclc); and heme-oxygenase-1 (Ho-1), in both a dose- and time-dependent manner. Conversely, CDDO-Im did not induce Nqo1, Gclc, and Ho-1 mRNA expression in Nrf2-null mice. Collectively, the present study shows that CDDO-Im pretreatment induces Nrf2-dependent cytoprotective genes and protects the liver from acetaminophen-induced hepatic injury.

  12. Impact of Nrf2 on UVB-induced skin inflammation/photoprotection and photoprotective effect of sulforaphane.

    PubMed

    Saw, Constance L; Huang, Mou-Tuan; Liu, Yue; Khor, Tin Oo; Conney, Allan H; Kong, Ah-Ng

    2011-06-01

    Ultraviolet (UV) of sunlight is a complete carcinogen that can burn skin, enhance inflammation, and drive skin carcinogenesis. Previously, we have shown that sulforaphane (SFN) inhibited chemically induced skin carcinogenesis via nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and others have shown that broccoli sprout extracts containing high SFN protected against UV-induced skin carcinogenesis in SKH-1 hairless mice. A recent study showed that there was no difference between Nrf2 knockout (Nrf2 KO) and Nrf2 wild-type (WT) BALB/C mice after exposing to high dose of UVB. Since Nrf2 plays critical roles in the anti-oxidative stress/anti-inflammatory responses, it is relevant to assess the role of Nrf2 for photoprotection against UV. In this context, the role of Nrf2 in UVB-induced skin inflammation in Nrf2 WT and Nrf2 KO C57BL/6 mice was studied. A single dose of UVB (300 mJ/cm(2)) resulted in skin inflammation in both WT and Nrf2 KO (-/-) mice (KO mice) at 8 h and 8 d following UVB irradiation. In the WT mice inflammation returned to the basal level to a greater extent when compared to the KO mice. SFN treatment of Nrf2 WT but not Nrf2 KO mice restored the number of sunburn cells back to their basal level by 8 d after UVB irradiation. Additionally, UVB-induced short-term inflammatory biomarkers (interleukin-1β and interleukin-6) were increased in the KO mice and UVB-induced apoptotic cells in the KO mice were significantly higher as compared to that in the WT. Taken together, our results show that functional Nrf2 confers a protective effect against UVB-induced inflammation, sunburn reaction, and SFN-mediated photoprotective effects in the skin. PMID:21557329

  13. Low dose of oleanolic acid protects against lithocholic acid-induced cholestasis in mice: potential involvement of nuclear factor-E2-related factor 2-mediated upregulation of multidrug resistance-associated proteins.

    PubMed

    Chen, Pan; Zeng, Hang; Wang, Yongtao; Fan, Xiaomei; Xu, Chenshu; Deng, Rongrong; Zhou, Xunian; Bi, Huichang; Huang, Min

    2014-05-01

    Oleanolic acid (OA) is a natural triterpenoid and has been demonstrated to protect against varieties of hepatotoxicants. Recently, however, OA at high doses was reported to produce apparent cholestasis in mice. In this study, we characterized the protective effect of OA at low doses against lithocholic acid (LCA)-induced cholestasis in mice and explored further mechanisms. OA cotreatment (5, 10, and 20 mg/kg, i.p.) significantly improved mouse survival rate, attenuated liver necrosis, and decreased serum alanine aminotransferase, aspartate aminotransferase, and alkaline phosphatase; more importantly, serum total bile acids and bilirubin, as well as hepatic total bile acids were also remarkably reduced. Gene and protein expression analysis showed that hepatic expression of multidrug resistance-associated protein 2 (Mrp2), Mrp3, and Mrp4 was significantly increased by OA cotreatment, whereas other bile acid metabolism- and transport-related genes, including Na+/taurocholate cotransporter, organic anion transporter 1b2, bile salt export pump, multidrug resistance protein 3, Cyp3a11, Cyp2b10, Sulfotransferase 2a1 (Sult2a1), and UDP-glucuronosyltransferase 1a1 (Ugt1a1), were only slightly changed. OA also caused increased nuclear factor-E2-related factor (Nrf2) mRNA expression and nuclear protein accumulation, whereas nuclear receptors farnesoid X receptor (FXR), pregnane X receptor (PXR), and constitutive androstane receptor were not significantly influenced by OA. Luciferase (Luc) assays performed in HepG2 cells illustrated that OA was a strong Nrf2 agonist with moderate PXR and weak FXR agonism. Finally, in mouse primary cultured hepatocytes, OA dose- and time-dependently induced expression of Mrp2, Mrp3, and Mrp4; however, this upregulation was abrogated when Nrf2 was silenced. In conclusion, OA produces a protective effect against LCA-induced hepatotoxicity and cholestasis, possibly due to Nrf2-mediated upregulation of Mrp2, Mrp3, and Mrp4. PMID:24510383

  14. Acetyl-l-carnitine (ALCAR) prevents hypobaric hypoxia-induced spatial memory impairment through extracellular related kinase-mediated nuclear factor erythroid 2-related factor 2 phosphorylation.

    PubMed

    Barhwal, K; Hota, S K; Jain, V; Prasad, D; Singh, S B; Ilavazhagan, G

    2009-06-30

    Exposure to hypobaric hypoxia, a condition involving decreased availability of oxygen is known to be associated with oxidative stress, neurodegeneration and memory impairment. The multifactorial response of the brain and the complex signaling pathways involved therewith limits the therapeutic efficacy of several antioxidants in ameliorating hypobaric hypoxia-induced memory impairment. The present study was therefore aimed at investigating the potential of acetyl-l-carnitine (ALCAR), a known antioxidant that has been reported to augment neurotrophin-mediated survival mechanisms, in ameliorating hypoxia-induced neurodegeneration and memory impairment. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key transcription factor involved in the cellular defense mechanism against oxidative stress related to brain injury and neurological disorders. The study was designed to understand the mechanisms involving Nrf2 stabilization following exposure to hypobaric hypoxia. The results displayed reference memory impairment in Sprague-Dawley rats exposed to hypobaric hypoxia (7620 m) for 14 consecutive days which however improved on administration of ALCAR during hypoxic exposure. The study also revealed Nrf2 regulated augmented antioxidant response on administration of ALCAR which was through a novel tyrosine kinase A (TrkA) receptor-mediated mechanism. A decrease in free radical generation, lipid peroxidation and protein oxidation was also observed along with a concomitant increase in thioredoxin and reduced glutathione levels on administration of ALCAR during exposure to hypobaric hypoxia. The present study therefore reveals the therapeutic potential of ALCAR under conditions of hypobaric hypoxia and elucidates a novel mechanism of action of the drug. PMID:19318118

  15. The Microglial α7-Acetylcholine Nicotinic Receptor Is a Key Element in Promoting Neuroprotection by Inducing Heme Oxygenase-1 via Nuclear Factor Erythroid-2-Related Factor 2

    PubMed Central

    Parada, Esther; Egea, Javier; Buendia, Izaskun; Negredo, Pilar; Cunha, Ana C.; Cardoso, Silvia; Soares, Miguel P.

    2013-01-01

    Abstract Aims: We asked whether the neuroprotective effect of cholinergic microglial stimulation during an ischemic event acts via a mechanism involving the activation of nuclear factor erythroid-2-related factor 2 (Nrf2) and/or the expression of its target cytoprotective gene, heme oxygenase-1 (HO-1). Specifically, the protective effect of the pharmacologic alpha-7 nicotinic acetylcholine receptor (α7 nAChR) agonist PNU282987 was analyzed in organotypic hippocampal cultures (OHCs) subjected to oxygen and glucose deprivation (OGD) in vitro as well as in photothrombotic stroke in vivo. Results: OHCs exposed to OGD followed by reoxygenation elicited cell death, measured by propidium iodide and 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide staining. Activation of α7 nAChR by PNU282987, after OGD, reduced cell death, reactive oxygen species production, and tumor necrosis factor release. This was associated with induction of HO-1 expression, an effect reversed by α-bungarotoxin and by tin–protoporphyrin IX. The protective effect of PNU282987 was lost in microglial-depleted OHCs as well as in OHCs from Nrf2-deficient-versus-wild-type mice, an effect associated with suppression of HO-1 expression in microglia. Administration of PNU282987 1 h after induction of photothrombotic stroke in vivo reduced the infarct size and improved motor skills in Hmox1lox/lox mice that express normal levels of HO-1, but not in LysMCreHmox1Δ/Δ in which HO-1 expression is inhibited in myeloid cells, including the microglia. Innovation: This study suggests the participation of the microglial α7 nAChR in the brain cholinergic anti-inflammatory pathway. Conclusion: Activation of the α7 nAChR/Nrf2/HO-1 axis in microglia regulates neuroinflammation and oxidative stress, affording neuroprotection under brain ischemic conditions. Antioxid. Redox Signal. 19, 1135–1148. PMID:23311871

  16. Pterostilbene-mediated Nrf2 activation: Mechanistic insights on Keap1:Nrf2 interface.

    PubMed

    Bhakkiyalakshmi, Elango; Dineshkumar, Kesavan; Karthik, Suresh; Sireesh, Dornadula; Hopper, Waheeta; Paulmurugan, Ramasamy; Ramkumar, Kunka Mohanram

    2016-08-15

    The discovery of Keap1-Nrf2 protein-protein interaction (PPI) inhibitors has become a promising strategy to develop novel lead molecules against variety of stress. Hence, Keap1-Nrf2 system plays an important role in oxidative/electrophilic stress associated disorders. Our earlier studies identified pterostilbene (PTS), a natural analogue of resveratrol, as a potent Nrf2 activator and Keap1-Nrf2 PPI inhibitor as assessed by luciferase complementation assay. In this study, we further identified the potential of PTS in Nrf2 activation and ARE-driven downstream target genes expression by nuclear translocation experiments and ARE-luciferase reporter assay, respectively. Further, the luciferase complementation assay identified that PTS inhibits Keap1-Nrf2 PPI in both dose and time-dependent manner. Computational studies using molecular docking and dynamic simulation revealed that PTS directly interacts with the basic amino acids of kelch domain of Keap1 and perturb Keap1-Nrf2 interaction pattern. This manuscript not only shows the binding determinants of Keap1-Nrf2 proteins but also provides mechanistic insights on Nrf2 activation potential of PTS. PMID:27312421

  17. Cardioprotection from emulsified isoflurane postconditioning is lost in rats with streptozotocin-induced diabetes due to the impairment of Brg1/Nrf2/STAT3 signalling.

    PubMed

    Wang, Yan; Li, Haobo; Huang, Huansen; Liu, Shiming; Mao, Xiaowen; Wang, Sheng; Wong, Stanley Sau-Ching; Xia, Zhengyuan; Irwin, Michael G

    2016-05-01

    Isoflurane postconditioning (IsoPostC) attenuates myocardial ischaemia/reperfusion injury (IRI). Signal transducer and activator of transcription-3 (STAT3) is critical in ischaemic postconditioning cardioprotection, which can be regulated by the Brahma-related gene (Brg1) and nuclear factor-erythroid 2-related factor 2 (Nrf2), although they are both reduced in diabetic hearts. We hypothesized that reduced Brg1/Nrf2 and STAT3 activation may jeopardize IsoPostC-mediated cardioprotection in diabetic hearts. In the present study, Langendorff-perfused, non-diabetic (control) and 8-week-old streptozotocin-induced Type 1 diabetic rat hearts were subjected to 30 min of global ischaemia and 120 min of reperfusion without or with IsoPostC, which was achieved by administering emulsified isoflurane (2.0%, v/v) in Krebs-Henseleit (KH) solution immediately at the onset of reperfusion for 10 min and switching to KH solution perfusion alone thereafter. Cultured H9C2 cells were exposed to normal glucose (NG, 5.5 mM) or high glucose (HG, 30 mM) and subjected to hypoxia/reoxygenation (HR) in the presence or absence of IsoPostC. Diabetic rats displayed larger post-ischaemic myocardial infarction and more severe haemodynamic dysfunction, associated with increased myocardial oxidative stress and reduced cardiac Brg1, Nrf2 and STAT3 phosphorylation/activation (p-STAT3), compared with controls. These changes were reversed/prevented by IsoPostC in control but not in diabetic rats. In H9C2 cells exposed to NG but not HG, IsoPostC significantly attenuated HR-induced cellular injury and superoxide anion production with increased Brg1, Nrf2 and p-STAT3. These beneficial effects of IsoPostC were abolished by Brg1, Nrf2 or STAT3 gene knockdown. Brg1 or Nrf2 gene knockdown abolished IsoPostC-induced STAT3 activation. N-acetylcysteine restored Brg1, Nrf2 and p-STAT3, and IsoPostC-induced protection in H9C2 cells exposed to HG and HR. In conclusion, IsoPostC confers cardioprotection through

  18. Role of Nrf2/ARE Pathway in Protective Effect of Electroacupuncture against Endotoxic Shock-Induced Acute Lung Injury in Rabbits

    PubMed Central

    Yu, Jian-bo; Shi, Jia; Gong, Li-rong; Dong, Shu-an; Xu, Yan; Zhang, Yuan; Cao, Xin-shun; Wu, Li-li

    2014-01-01

    NF-E2 related factor 2 (Nrf2) is a major transcription factor and acts as a key regulator of antioxidant genes to exogenous stimulations. The aim of current study was to determine whether Nrf2/ARE pathway is involved in the protective effect of electroacupuncture on the injured lung in a rabbit model of endotoxic shock. A dose of lipopolysaccharide (LPS) 5 mg/kg was administered intravenously to replicate the model of acute lung injury induced by endotoxic shock. Electroacupuncture pretreatment was handled bilaterally at Zusanli and Feishu acupoints for five consecutive days while sham electroacupuncture punctured at non-acupoints. Fourty anesthetized New England male rabbits were randomized into normal control group (group C), LPS group (group L), electroacupuncture + LPS group (group EL) and sham electroacupuncture + LPS (group SEL). At 6 h after LPS administration, the animals were sacrificed and the blood samples were collected for biochemical measurements. The lungs were removed for calculation of wet-to-dry weight ratios (W/D), histopathologic examination, determination of heme oxygenase (HO)-1 protein and mRNA, Nrf2 total and nucleoprotein, as well as Nrf2 mRNA expression, and evaluation of the intracellular distribution of Nrf2 nucleoprotein. LPS caused extensive morphologic lung damage, which was lessened by electroacupuncture treatment. Besides, lung W/D ratios were significantly decreased, the level of malondialdehyde was inhibited, plasma levels of TNF-α and interleukin-6 were decreased, while the activities of superoxide dismutase, glutathione peroxidase and catalase were enhanced in the electroacupucnture treated animals. In addition, electroacupuncture stimulation distinctly increased the expressions of HO-1 and Nrf2 protein including Nrf2 total protein and nucleoprotein as well as mRNA in lung tissue, while these effects were blunted in the sham electroacupuncture group. We concluded that electroacupuncture treatment at ST36 and BL13 effectively

  19. Activation of Nrf2 in keratinocytes causes chloracne (MADISH)-like skin disease in mice.

    PubMed

    Schäfer, Matthias; Willrodt, Ann-Helen; Kurinna, Svitlana; Link, Andrea S; Farwanah, Hany; Geusau, Alexandra; Gruber, Florian; Sorg, Olivier; Huebner, Aaron J; Roop, Dennis R; Sandhoff, Konrad; Saurat, Jean-Hilaire; Tschachler, Erwin; Schneider, Marlon R; Langbein, Lutz; Bloch, Wilhelm; Beer, Hans-Dietmar; Werner, Sabine

    2014-04-01

    The transcription factor Nrf2 is a key regulator of the cellular stress response, and pharmacological Nrf2 activation is a promising strategy for skin protection and cancer prevention. We show here that prolonged Nrf2 activation in keratinocytes causes sebaceous gland enlargement and seborrhea in mice due to upregulation of the growth factor epigen, which we identified as a novel Nrf2 target. This was accompanied by thickening and hyperkeratosis of hair follicle infundibula. These abnormalities caused dilatation of infundibula, hair loss, and cyst development upon aging. Upregulation of epigen, secretory leukocyte peptidase inhibitor (Slpi), and small proline-rich protein 2d (Sprr2d) in hair follicles was identified as the likely cause of infundibular acanthosis, hyperkeratosis, and cyst formation. These alterations were highly reminiscent to the phenotype of chloracne/"metabolizing acquired dioxin-induced skin hamartomas" (MADISH) patients. Indeed, SLPI, SPRR2, and epigen were strongly expressed in cysts of MADISH patients and upregulated by dioxin in human keratinocytes in an NRF2-dependent manner. These results identify novel Nrf2 activities in the pilosebaceous unit and point to a role of NRF2 in MADISH pathogenesis. PMID:24503019

  20. Chemical and biological mechanisms of phytochemical activation of Nrf2 and importance in disease prevention

    PubMed Central

    Eggler, Aimee L.; Savinov, Sergey N.

    2016-01-01

    Plants are an incredibly rich source of compounds that activate the Nrf2 transcription factor, leading to upregulation of a battery of cytoprotective genes. This perspective surveys established and proposed molecular mechanisms of Nrf2 activation by phytochemicals with a special emphasis on a common chemical property of Nrf2 activators: the ability as “soft” electrophiles to modify cellular thiols, either directly or as oxidized biotransformants. In addition, the role of reactive oxygen/nitrogen species as secondary messengers in Nrf2 activation is discussed. While the uniquely reactive C151 of Keap1, an Nrf2 repressor protein, is highlighted as a key target of cytoprotective phytochemicals, also reviewed are other stress-responsive proteins, including kinases, which play non-redundant roles in the activation of Nrf2 by plant-derived agents. Finally, the perspective presents two key factors accounting for the enhanced therapeutic windows of effective phytochemical activators of the Keap1–Nrf2 axis: enhanced selectivity toward sensor cysteines and reversibility of addition to thiolate molecules. PMID:26855455

  1. Targeting nrf2-mediated gene transcription by triterpenoids and their derivatives.

    PubMed

    Loboda, Agnieszka; Rojczyk-Golebiewska, Ewa; Bednarczyk-Cwynar, Barbara; Lucjusz, Zaprutko; Jozkowicz, Alicja; Dulak, Jozef

    2012-11-01

    Chemoprevention represents a strategy designed to protect cells or tissues against various carcinogens and carcinogenic metabolites derived from exogenous or endogenous sources. Recent studies indicate that plant-derived triterpenoids, like oleanolic acid, may exert cytoprotective functions via regulation of the activity of different transcription factors. The chemopreventive effects may be mediated through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) transcription factor. Activation of Nrf2 by triterpenoids induces the expression of phase 2 detoxifying and antioxidant enzymes such as NAD(P)H quinone oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1) - proteins which can protect cells or tissues against various toxic metabolites. On the other hand, inhibition of other transcription factors, like NF-κB leads to the decrease in the pro-inflammatory gene expression. Moreover, the modulation of microRNAs activity may constitute a new mechanism responsible for valuable effects of triterpenoids. Recently, based on the structure of naturally occurring triterpenoids and with involvement of bioinformatics and computational chemistry, many synthetic analogs with improved biological properties have been obtained. Data from in vitro and in vivo experiments strongly suggest synthetic derivatives as promising candidates in the chemopreventive and chemotherapeutic strategies. PMID:24009841

  2. Targeting Nrf2-Mediated Gene Transcription by Triterpenoids and Their Derivatives

    PubMed Central

    Loboda, Agnieszka; Rojczyk-Golebiewska, Ewa; Bednarczyk-Cwynar, Barbara; Lucjusz, Zaprutko; Jozkowicz, Alicja; Dulak, Jozef

    2012-01-01

    Chemoprevention represents a strategy designed to protect cells or tissues against various carcinogens and carcinogenic metabolites derived from exogenous or endogenous sources. Recent studies indicate that plant-derived triterpenoids, like oleanolic acid, may exert cytoprotective functions via regulation of the activity of different transcription factors. The chemopreventive effects may be mediated through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) transcription factor. Activation of Nrf2 by triterpenoids induces the expression of phase 2 detoxifying and antioxidant enzymes such as NAD(P)H quinone oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1) - proteins which can protect cells or tissues against various toxic metabolites. On the other hand, inhibition of other transcription factors, like NF-κB leads to the decrease in the pro-inflammatory gene expression. Moreover, the modulation of microRNAs activity may constitute a new mechanism responsible for valuable effects of triterpenoids. Recently, based on the structure of naturally occurring triterpenoids and with involvement of bioinformatics and computational chemistry, many synthetic analogs with improved biological properties have been obtained. Data from in vitro and in vivo experiments strongly suggest synthetic derivatives as promising candidates in the chemopreventive and chemotherapeutic strategies. PMID:24009841

  3. Delayed treatment with oleanolic acid attenuates tubulointerstitial fibrosis in chronic cyclosporine nephropathy through Nrf2/HO-1 signaling

    PubMed Central

    2014-01-01

    Background Nuclear factor erythroid-2-related factor-2 (Nrf2) is known to protect against tissue injury by orchestrating antioxidant and detoxification responses to oxidative stress. This study investigated whether upregulation of Nrf2-dependent signaling by oleanolic acid (OA), which is known to activate Nrf2, could attenuate renal inflammation and fibrosis in cyclosporine (CsA)-induced kidney injury. Methods Male ICR mice were divided into four treatment groups: Vehicle (VH, n = 6), VH + OA (n = 6), CsA (n = 8), and CsA + OA (n = 8). For the OA-treated groups, OA (25 mg/kg/day) was administered by intraperitoneal injection for the final week of the 4-week experimental period. Renal function, morphologies and signaling were evaluated at the end of the study. Results Treatment with CsA resulted in decreased kidney function and urine osmolality and increased urine volume and urinary albumin levels. The CsA-induced changes were improved by OA treatment. Specifically, administration of OA decreased tubulointerstitial fibrosis and inflammation scores that were increased in CsA-treated mice. Furthermore, OA treatment decreased urinary 8-hydroxy-2′-deoxyguanosine (8-OHdG) and 8-epi-prostaglandin F2α (8-iso-PGF2α) levels. The beneficial effects of OA were attributed to an increased ratio of nuclear/total Nrf2 and subsequently enhanced expression of heme oxygenase (HO)-1, as well as a stable level of Kelch-like ECH-associated protein 1 (Keap1) expression, indicating that OA enhanced nuclear translocation of Nrf2. Increased apoptotic cell death and a high ratio of B cell leukaemia/lymphoma 2 (Bcl-2)-associated X protein (Bax) to Bcl-2 in CsA-treated mice were also significantly ameliorated by OA treatment. Conclusion Our results suggest that OA activates Nrf2/HO-1 signaling in chronic CsA nephropathy, which may have beneficial effects on inflammation and oxidative stress. PMID:24559268

  4. The NRF2 knockout rat: a new animal model to study endothelial dysfunction, oxidant stress, and microvascular rarefaction.

    PubMed

    Priestley, Jessica R C; Kautenburg, Katie E; Casati, Marc C; Endres, Bradley T; Geurts, Aron M; Lombard, Julian H

    2016-02-15

    Nuclear factor (erythroid-derived 2)-like-2 (NRF2) is a master antioxidant and cell protective transcription factor that upregulates antioxidant defenses. In this study we developed a strain of Nrf2 null mutant rats to evaluate the role of reduced NRF2-regulated antioxidant defenses in contributing to endothelial dysfunction and impaired angiogenic responses during salt-induced ANG II suppression. Nrf2(-/-) mutant rats were developed using transcription activator-like effector nuclease technology in the Sprague-Dawley genetic background, and exhibited a 41-bp deletion that included the start codon for Nrf2 and an absence of immunohistochemically detectable NRF2 protein. Expression of mRNA for the NRF2-regulated indicator enzymes heme oxygenase-1, catalase, superoxide dismutase 1, superoxide dismutase 2, and glutathione reductase was significantly lower in livers of Nrf2(-/-) mutant rats fed high salt (HS; 4% NaCl) for 2 wk compared with wild-type controls. Endothelium-dependent dilation to acetylcholine was similar in isolated middle cerebral arteries (MCA) of Nrf2(-/-) mutant rats and wild-type littermates fed low-salt (0.4% NaCl) diet, and was eliminated by short-term (3 days) HS diet in both strains. Low-dose ANG II infusion (100 ng/kg sc) reversed salt-induced endothelial dysfunction in MCA and prevented microvessel rarefaction in wild-type rats fed HS diet, but not in Nrf2(-/-) mutant rats. The results of this study indicate that suppression of NRF2 antioxidant defenses plays an essential role in the development of salt-induced oxidant stress, endothelial dysfunction, and microvessel rarefaction in normotensive rats and emphasize the potential therapeutic benefits of directly upregulating NRF2-mediated antioxidant defenses to ameliorate vascular oxidant stress in humans. PMID:26637559

  5. The Cytoprotective Effect of Hyperoside against Oxidative Stress Is Mediated by the Nrf2-ARE Signaling Pathway through GSK-3β Inactivation

    PubMed Central

    Xing, Hai-Yan; Cai, Yong-Qing; Wang, Xian-Feng; Wang, Lin-Li; Li, Pan; Wang, Guan-Ying; Chen, Jian-Hong

    2015-01-01

    Glycogen synthase kinase-3β (GSK-3β) acts as a negative regulator of NF-E2 related factor 2 (Nrf2) by inducing Nrf2 degradation and nuclear export. Our previous study demonstrated that the flavonoid hyperoside elicits cytoprotection against oxidative stress by activating the Keap1-Nrf2-ARE signaling pathway, thus increasing the expression of antioxidant enzymes, such as heme oxygenase-1 (HO-1), superoxide dismutase (SOD) and catalase. However, the role of GSK-3β in hyperoside-mediated Nrf2 activation is unclear. Here, we demonstrate that in a normal human hepatocyte cell line, (L02), hyperoside is capable of inducing the phosphorylation of GSK-3β at Ser9 without affecting the protein levels of GSK-3β and its phosphorylation at Thr390. Lithium chloride (LiCl) and short interfering RNA (siRNA)-mediated inhibition of GSK-3β significantly enhanced the ability of hyperoside to protect L02 liver cells from H2O2-induced oxidative damage, leading to increased cell survival shown by the maintenance of cell membrane integrity and elevated levels of glutathione (GSH), one of the endogenous antioxidant biomarkers. Further study showed that LiCl and siRNA-mediated inhibition of GSK-3β increased hyperoside-induced HO-1 expression, and the effect was dependent upon enhanced Nrf2 nuclear translocation and gene expression. These activities were followed by ARE-mediated transcriptional activation in the presence of hyperoside, which was abolished by the transfection of the cells with Nrf2 siRNA. Furthermore, the siRNA-mediated inhibition of Keap1 also enhanced hyperoside-induced Nrf2 nuclear accumulation and HO-1 expression, which was relatively smaller than the effects obtained from GSK-3β siRNA administration. Moreover, Keap1 siRNA administration alone had no significant effect on the phosphorylation and protein expression of GSK-3β. Collectively, our data provide evidence that hyperoside attenuates H2O2 -induced L02 cell damage by activating the Nrf2-ARE signaling

  6. Role of Hydroxytyrosol-dependent Regulation of HO-1 Expression in Promoting Wound Healing of Vascular Endothelial Cells via Nrf2 De Novo Synthesis and Stabilization.

    PubMed

    Zrelli, Houda; Kusunoki, Miki; Miyazaki, Hitoshi

    2015-07-01

    Hydroxytyrosol (HT), an olive plant (Olea europaea L.) polyphenol, has proven atheroprotective effects. We previously demonstrated that heme oxygenase-1 (HO-1) is involved in the HT dependent prevention of dysfunction induced by oxidative stress in vascular endothelial cells (VECs). Here, we further investigated the signaling pathway of HT-dependent HO-1 expression in VECs. HT dose- and time-dependently increased HO-1 mRNA and protein levels through the PI3K/Akt and ERK1/2 pathways. Cycloheximide and actinomycin D inhibited both increases, suggesting that HT-triggered HO-1 induction is transcriptionally regulated and that de novo protein synthesis is necessary for this HT effect. HT stimulated nuclear accumulation of nuclear factor E2-related factor 2 (Nrf2). This Nrf2 accumulation was blocked by actinomycin D and cycloheximide whereas HT in combination with the 26S proteasome inhibitor MG132 enhanced the accumulation. HT also extended the half-life of Nrf2 proteins by decelerating its turnover. Moreover, HO-1 inhibitor, ZnppIX and CO scavenger, hemoglobin impaired HT-dependent wound healing while CORM-2, a CO generator, accelerated wound closure. Together, these data demonstrate that HT upregulates HO-1 expression by stimulating the nuclear accumulation and stabilization of Nrf2, leading to the wound repair of VECs crucial in the prevention of atherosclerosis. PMID:25870947

  7. Nrf2-Mediated HO-1 Induction Coupled with the ERK Signaling Pathway Contributes to Indirect Antioxidant Capacity of Caffeic Acid Phenethyl Ester in HepG2 Cells

    PubMed Central

    Kim, Jin-Kyoung; Jang, Hae-Dong

    2014-01-01

    The objective of this study is to investigate the contributing effect of the nuclear transcription factor-erythroid 2-related factor 2 (Nrf2)-mediated signaling pathway on the indirect antioxidant capacity of caffeic acid phenethyl ester (CAPE) against oxidative stress in HepG2 cells. The result of an antioxidant response element (ARE)-luciferase assay showed that CAPE stimulated ARE promoter activity resulting in increased transcriptional and translational activities of heme oxygenase-1 (HO-1). In addition, CAPE treatment enhanced Nrf2 accumulation in the nucleus and the post-translational phosphorylation level of extracellular signal-regulated kinase (ERK) among several protein kinases tested. Treatment with ERK inhibitor U126 completely suppressed CAPE-induced ERK phosphorylation and HO-1 expression, but it only partly inhibited CAPE-induced Nrf2 accumulation and ARE promoter. Using the 2',7'-dichlorofluorescein-diacetate (DCFH-DA) method, the cellular antioxidant capacity of CAPE against 2,2'-azobis (2-amidinopropane) dihydrochloride (AAPH)- or H2O2-induced oxidative stress also was shown to be partially suppressed by the ERK inhibitor. From the overall results it is proposed that the indirect antioxidant activity of CAPE against oxidative stress in HepG2 cells is partially attributed to induction of HO-1, which is regulated by Kelch-like erythroid-cell-derived protein with CNC homology (ECH)-associated protein 1 (Keap1)-independent Nrf2 activation relying on post-translational phosphorylation of ERK. PMID:25007817

  8. S-Propargyl-cysteine Exerts a Novel Protective Effect on Methionine and Choline Deficient Diet-Induced Fatty Liver via Akt/Nrf2/HO-1 Pathway

    PubMed Central

    Li, Wenwen; Ma, Fenfen; Zhang, Laiyin; Huang, Yong; Li, Xinghui; Zhang, Aijie; Hou, Cuilan; Zhu, Yichun; Zhu, YiZhun

    2016-01-01

    This study investigated the antioxidative effect of S-propargyl-cysteine (SPRC) on nonalcoholic fatty liver (NAFLD) by treating mice fed a methionine and choline deficient (MCD) diet with SPRC for four weeks. We found that SPRC significantly reduced hepatic reactive oxygen species (ROS) and methane dicarboxylic aldehyde (MDA) levels. Moreover, SPRC also increased the superoxide dismutase (SOD) activity. By Western blot, we found that this protective effect of SPRC was importantly attributed to the regulated hepatic antioxidant-related proteins, including protein kinase B (Akt), heme oxygenase-1 (HO-1), nuclear factor erythroid 2-related factor 2 (Nrf2), and cystathionine γ-lyase (CSE, an enzyme that synthesizes hydrogen sulfide). Next, we examined the detailed molecular mechanism of the SPRC protective effect using oleic acid- (OA-) induced HepG2 cells. The results showed that SPRC significantly decreased intracellular ROS and MDA levels in OA-induced HepG2 cells by upregulating the phosphorylation of Akt, the expression of HO-1 and CSE, and the translocation of Nrf2. SPRC-induced HO-1 expression and Nrf2 translocation were abolished by the phosphoinositide 3-kinase (PI3K) inhibitor LY294002. Moreover, the antioxidative effect of SPRC was abolished by CSE inhibitor DL-propargylglycine (PAG) and HO-1 siRNA. Therefore, these results proved that SPRC produced an antioxidative effect on NAFLD through the PI3K/Akt/Nrf2/HO-1 signaling pathway. PMID:27313828

  9. MicroRNA-153/Nrf-2/GPx1 pathway regulates radiosensitivity and stemness of glioma stem cells via reactive oxygen species

    PubMed Central

    Yang, Wei; Shen, Yueming; Wei, Jing; Liu, Fenju

    2015-01-01

    Glioma stem cells (GSCs) exhibit stem cell properties and high resistance to radiotherapy. The main aim of our study was to determine the roles of ROS in radioresistance and stemness of GSCs. We found that microRNA (miR)-153 was down-regulated and its target gene nuclear factor-erythroid 2-related factor-2 (Nrf-2) was up-regulated in GSCs compared with that of non-GSCs glioma cells. The enhanced Nrf-2 expression increased glutathione peroxidase 1 (GPx1) transcription and decreased ROS level leading to radioresistance of GSCs. MiR-153 overexpression resulted in increased ROS production and radiosensitization of GSCs. Moreover, miR-153 overexpression led to decreased neurosphere formation capacity and stem cell marker expression, and induced differentiation through ROS-mediated activation of p38 MAPK in GSCs. Nrf-2 overexpression rescued the decreased stemness and radioresistance resulting from miR-153 overexpression in GSCs. In addition, miR-153 overexpression reduced tumorigenic capacity of GSCs and increased survival in mice bearing human GSCs. These findings demonstrated that miR-153 overexpression decreased radioresistance and stemness of GSCs through targeting Nrf-2/GPx1/ROS pathway. PMID:26124081

  10. S-Propargyl-cysteine Exerts a Novel Protective Effect on Methionine and Choline Deficient Diet-Induced Fatty Liver via Akt/Nrf2/HO-1 Pathway.

    PubMed

    Li, Wenwen; Ma, Fenfen; Zhang, Laiyin; Huang, Yong; Li, Xinghui; Zhang, Aijie; Hou, Cuilan; Zhu, Yichun; Zhu, YiZhun

    2016-01-01

    This study investigated the antioxidative effect of S-propargyl-cysteine (SPRC) on nonalcoholic fatty liver (NAFLD) by treating mice fed a methionine and choline deficient (MCD) diet with SPRC for four weeks. We found that SPRC significantly reduced hepatic reactive oxygen species (ROS) and methane dicarboxylic aldehyde (MDA) levels. Moreover, SPRC also increased the superoxide dismutase (SOD) activity. By Western blot, we found that this protective effect of SPRC was importantly attributed to the regulated hepatic antioxidant-related proteins, including protein kinase B (Akt), heme oxygenase-1 (HO-1), nuclear factor erythroid 2-related factor 2 (Nrf2), and cystathionine γ-lyase (CSE, an enzyme that synthesizes hydrogen sulfide). Next, we examined the detailed molecular mechanism of the SPRC protective effect using oleic acid- (OA-) induced HepG2 cells. The results showed that SPRC significantly decreased intracellular ROS and MDA levels in OA-induced HepG2 cells by upregulating the phosphorylation of Akt,