Science.gov

Sample records for 23s rrna mutations

  1. 23S rRNA gene mutations contributing to macrolide resistance in Campylobacter jejuni and Campylobacter coli

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Operon specific 23S rRNA mutations affecting minimum inhibitory concentrations (MICs) of macrolides (erythromycin [ERY], azithromycin [AZM], tylosin [TYL]) and a lincosamide (clindamycin [CLI]) were examined in a collection of Campylobacter jejuni and C. coli isolates. The three copies of the Campy...

  2. Two Cases of Mycoplasma pneumoniae Pneumonia with A2063G Mutation in the 23S rRNA Gene in Siblings

    PubMed Central

    Hong, Joo Hee; Chun, Jin Kyong; Oh, Ki Jin; Kim, Juwon; Yoon, Kap Jun

    2013-01-01

    We describe 2 cases of pneumonia caused by the same macrolide-resistant Mycoplasma pneumoniae in siblings. M. pneumoniae was identified using real-time PCR. Direct sequence analysis of the 23S rRNA gene revealed a point mutation in V domain (A2063G) of the 23S rRNA gene. PMID:23301225

  3. Rapid Detection of Mutations in the 23S rRNA Gene of Helicobacter pylori That Confers Resistance to Clarithromycin Treatment to the Bacterium

    PubMed Central

    Matsumura, Masayuki; Hikiba, Yoko; Ogura, Keiji; Togo, Goichi; Tsukuda, Izumi; Ushikawa, Kenji; Shiratori, Yasushi; Omata, Masao

    2001-01-01

    We developed a new method capable of detecting point mutations in the 23S rRNA gene of Helicobacter pylori using a LightCycler. Our method can detect a mutation in this gene in less than 1 h and can process many samples at once, thereby contributing to the selection of patients suitable for clarithromycin-based therapy. PMID:11158129

  4. Rapid assay of A2058T-mutated 23S rRNA allelic profiles associated with high-level macrolide resistance in Moraxella catarrhalis.

    PubMed

    Saito, Ryoichi; Kasai, Ayako; Ogihara, Shinji; Yamada, Kageto; Tao, Kazuyuki

    2015-09-01

    We report on a restriction fragment-length polymorphism (HpyCH4III) assay for profile analysis of 23S rRNA gene A2058T-mutated alleles associated with high-level macrolide resistance in Moraxella catarrhalis. Our assay results were supported by DNA sequencing analysis, allowed for simultaneous testing of many strains, and produced results from pure-cultured colonies within 4 h.

  5. High-level azithromycin resistance occurs in Neisseria gonorrhoeae as a result of a single point mutation in the 23S rRNA genes.

    PubMed

    Chisholm, Stephanie A; Dave, Jayshree; Ison, Catherine A

    2010-09-01

    High-level azithromycin resistance (AZM-HR), defined as a MIC of > or = 256 mg/liter, emerged in Neisseria gonorrhoeae in the United Kingdom in 2004. To determine the mechanism of this novel phenotype, isolates from the United Kingdom that were AZM-HR (n, 19), moderately AZM resistant (MICs, 2 to 8 mg/liter) (n, 26), or sensitive (MICs, 0.12 to 0.25 mg/liter) (n, 4) were screened for methylase (erm) genes and for mutations in the mtrR promoter region, associated with efflux pump upregulation. All AZM-resistant isolates and 12 sensitive isolates were screened for mutations in domain V of each 23S rRNA allele. All AZM-HR isolates contained the A2059G mutation (Escherichia coli numbering) in three (3 isolates) or four (16 isolates) 23S rRNA alleles. Most (22/26) moderately AZM resistant isolates contained the C2611T mutation in at least 3/4 alleles. The remainder contained four wild-type alleles, as did 8/12 sensitive isolates, while one allele was mutated in the remaining four sensitive isolates. Serial passage of AZM-sensitive colonies on an erythromycin-containing medium selected AZM-HR if the parent strain already contained mutation A2059G in one 23S rRNA allele. The resultant AZM-HR strains contained four mutated alleles. Eight isolates (five moderately AZM resistant and three AZM-HR) contained mutations in the mtrR promoter. No methylase genes were detected. This is the first evidence that AZM-HR in gonococci may result from a single point mutation (A2059G) in the peptidyltransferase loop in domain V of the 23S rRNA gene. Mutation of a single allele is insufficient to confer AZM-HR, but AZM-HR can develop under selection pressure. The description of a novel resistance mechanism will aid in screening for the AZM-HR phenotype. PMID:20585125

  6. Low prevalence of clarithromycin-resistant Helicobacter pylori isolates with A2143G point mutation in the 23S rRNA gene in North India.

    PubMed

    Gehlot, Valentina; Mahant, Shweta; Mukhopadhyay, Asish Kumar; Das, Kunal; Alam, Jawed; Ghosh, Prachetash; Das, Rajashree

    2016-09-01

    Resistance of Helicobacter pylori to clarithromycin is associated with a single base substitution in the 23S rRNA gene. In this study, clarithromycin-resistant H. pylori isolates were analysed for the presence of 23S rRNA gene mutations. H. pylori were isolated from 68 patients suffering from various gastroduodenal diseases in North India. Minimum inhibitory concentrations (MICs) were determined by the agar dilution method, and point mutations in clarithromycin-resistant strains were identified by PCR-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing. Clarithromycin resistance was observed in 11.8% (8/68) of the H. pylori isolates in North India. The A2143G point mutation in the 23S rRNA gene was found in 87.5% (7/8) of the clarithromycin-resistant strains, and the A2142G mutation in association with the T2182C mutation was found in 12.5% (1/8). In conclusion, the continued high prevalence of clarithromycin-sensitive H. pylori strains (88.2%) observed in this study allows the use of the triple-therapy regimen for the treatment of H. pylori infection in this region. Surveillance studies need to be conducted at regular intervals for clarithromycin resistance in the population. To our knowledge, this is the first study in India to report that point mutations at position A2143G and at A2142G in association with T2182C are associated with clarithromycin resistance, confirming reports from other parts of the world. PMID:27530837

  7. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    PubMed

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis.

  8. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    PubMed

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis. PMID:26038763

  9. Linezolid-resistant Staphylococcus haemolyticus and Staphylococcus hominis: single and double mutations at the domain V of 23S rRNA among isolates from a Rio de Janeiro hospital.

    PubMed

    Chamon, Raiane Cardoso; Iorio, Natalia Lopes Pontes; Cavalcante, Fernanda Sampaio; Teodoro, Cristiane R S; de Oliveira, Ana Paula Chaves; Maia, Fernanda; dos Santos, Kátia Regina Netto

    2014-12-01

    In this work, the molecular and phenotypic antimicrobial resistance and clonal diversity of 10 linezolid-resistant Staphylococcus spp. isolates were investigated. The 7 Staphylococcus haemolyticus isolates presented Staphylococcal cassete chromosome mec (SCCmec) V and belonged to the same pulsed-field gel electrophoresis pulsotype. Their MICs for oxacillin, vancomycin, and linezolid were ≥ 256 μg/mL, 1-4 μg/mL, and 8-16 μg/mL, respectively. The 3 S. hominis presented MIC values 32 to >256 μg/mL, 2-4 μg/mL, and 12-24 μg/mL, and all carried the nontypeable SCCmec (ccr1 + mecA class) and belonged to 2 different genotypes. The cfr gene was not found, but the mutation G2603T was detected in S. haemolyticus and C2190T and G2603T in Staphylococcus hominis in 23S rRNA. This study demonstrates the spread of a linezolid-resistant S. haemolyticus genotype and, for the first time, describes the mutation C2190T among S. hominis isolates with a double mutation in Brazil.

  10. A Novel SimpleProbe PCR Assay for Detection of Mutations in the 23S rRNA Gene Associated with Macrolide Resistance in Mycoplasma genitalium in Clinical Samples

    PubMed Central

    Lysvand, Hilde; Pukstad, Brita; Nordbø, Svein Arne

    2016-01-01

    Macrolide-resistant strains of Mycoplasma genitalium are an increasing problem throughout the world, and the implementation of a rapid and sensitive assay for mutation detection to guide treatment is needed. Macrolide-resistant strains have been shown to contain base substitutions in positions 2058 and 2059 (Escherichia coli numbering) in region V of the 23S rRNA gene. In this study, we present a SimpleProbe PCR followed by melting curve analysis to differentiate between macrolide-resistant mutants and wild types. The assay was performed on 159 Mycoplasma genitalium-positive samples, and the results were compared with DNA sequencing. We also looked at the prevalence of macrolide-resistant strains in a Norwegian population. Of 139 samples characterized successfully by sequencing, 54 (39%) were wild types and 85 (61%) were mutants, consisting of 59 (42%) A2059G, 24 (17%) A2058G, 1 (1%) A2058T, and 1 (1%) A2059C mutation. The melting curve analysis correctly differentiated between wild-type and mutant strains in all cases, but it could not identify the different mutant types. The SimpleProbe PCR proved to be a simple, rapid, and reliable method for the detection of macrolide-resistant isolates of Mycoplasma genitalium in a clinical setting. PMID:27487958

  11. New Site of Modification of 23S rRNA Associated with Clarithromycin Resistance of Helicobacter pylori Clinical Isolates

    PubMed Central

    Fontana, Carla; Favaro, Marco; Minelli, Silvia; Criscuolo, Anna Angela; Pietroiusti, Antonio; Galante, Alberto; Favalli, Cartesio

    2002-01-01

    Resistance of Helicobacter pylori to clarithromycin occurs with a prevalence ranging from 0 to 15%. This has an important clinical impact on dual and triple therapies, in which clarithromycin seems to be the better choice to achieve H. pylori eradication. In order to evaluate the possibility of new mechanisms of clarithromycin resistance, a PCR assay that amplified a portion of 23S rRNA from H. pylori isolates was used. Gastric tissue biopsy specimens from 230 consecutive patients were cultured for H. pylori isolation. Eighty-six gastric biopsy specimens yielded H. pylori-positive results, and among these 12 isolates were clarithromycin resistant. The latter were studied to detect mutations in the 23S rRNA gene. Sequence analysis of the 1,143-bp PCR product (portion of the 23S rRNA gene) did not reveal mutation such as that described at position 2142 to 2143. On the contrary, our findings show, for seven isolates, a T-to-C transition at position 2717. This mutation conferred a low level of resistance, equivalent to the MIC for the isolates, selected using the E-test as well as using the agar dilution method: 1 μg/ml. Moreover, T2717C transition is located in a highly conserved region of the 23S RNA associated with functional sites: domain VI. This fact has a strong effect on the secondary structure of the 23S RNA and on its interaction with macrolide. Mutation at position 2717 also generated an HhaI restriction site; therefore, restriction analysis of the PCR product also permits a rapid detection of resistant isolates. PMID:12435674

  12. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.

    PubMed

    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver

    2011-09-01

    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  13. Methylation of 23S rRNA Nucleotide G748 by RlmAII Methyltransferase Renders Streptococcus pneumoniae Telithromycin Susceptible

    PubMed Central

    Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-01-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046

  14. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  15. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  16. Lactobacillus species identification by amplified ribosomal 16S-23S rRNA restriction fragment length polymorphism analysis.

    PubMed

    Sandes, S H C; Alvin, L B; Silva, B C; Zanirati, D F; Jung, L R C; Nicoli, J R; Neumann, E; Nunes, A C

    2014-12-01

    Lactic acid bacteria strains are commonly used for animal and human consumption due to their probiotic properties. One of the major genera used is Lactobacillus, a highly diverse genus comprised of several closely related species. The selection of new strains for probiotic use, especially strains of Lactobacillus, is the focus of several research groups. Accurate identification to species level is fundamental for research on new strains, as well as for safety assessment and quality assurance. The 16S-23S internal transcribed spacer (ITS-1) is a deeply homologous region among prokaryotes that is commonly used for identification to the species level because it is able to acquire and accumulate mutations without compromising general bacterial metabolism. In the present study, 16S-23S ITS regions of 45 Lactobacillus species (48 strains) were amplified and subjected to independent enzymatic digestions, using 12 restriction enzymes that recognise six-base sequences. Twenty-nine species showed unique restriction patterns, and could therefore be precisely identified solely by this assay (64%). This approach proved to be reproducible, allowing us to establish simplified restriction patterns for each evaluated species. The restriction patterns of each species were similar among homologous strains, and to a large extent reflected phylogenetic relationships based on 16S rRNA sequences, demonstrating the promising nature of this region for evolutionary studies.

  17. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    PubMed

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  18. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.

    PubMed

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B

    2016-04-01

    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value <0.0001). dPCR quantification was also consistent with quantitative PCR (qPCR) measurements as well as cell counts for BioBall reference standard and 24 environmental water samples. qPCR and dPCR quantification of enterococci in the 24 environmental samples were significantly correlated (linear regression slope =1.08, R(2) of 0.96, and p value <0.0001); the group mean of the qPCR measurements was 0.19 log units higher than that of the dPCR measurements. At environmentally relevant concentrations, dPCR quantification was more precise (i.e., had narrower 95% confidence intervals than qPCR quantification). We observed that humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  19. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    PubMed

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  20. Case of Localized Recombination in 23S rRNA Genes from Divergent Bradyrhizobium Lineages Associated with Neotropical Legumes

    PubMed Central

    Parker, Matthew A.

    2001-01-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5′ portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5′ 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii. PMID:11319084

  1. Case of localized recombination in 23S rRNA genes from divergent bradyrhizobium lineages associated with neotropical legumes.

    PubMed

    Parker, M A

    2001-05-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5' portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5' 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii.

  2. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    PubMed

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  3. Essential role of conserved DUF177A protein in plastid 23S rRNA accumulation and plant embryogenesis

    PubMed Central

    Yang, Jiani; Suzuki, Masaharu; McCarty, Donald R.

    2016-01-01

    DUF177 proteins are nearly universally conserved in bacteria and plants except the Chlorophyceae algae. Thus far, duf177 mutants in bacteria have not established a function. In contrast, duf177a mutants have embryo lethal phenotypes in maize and Arabidopsis. In maize inbred W22, duf177a mutant embryos arrest at an early transition stage, whereas the block is suppressed in the B73 inbred background, conditioning an albino seedling phenotype. Background-dependent embryo lethal phenotypes are characteristic of maize plastid gene expression mutants. Consistent with the plastid gene expression hypothesis, quantitative real-time PCR revealed a significant reduction of 23S rRNA in an Escherichia coli duf177 knockout. Plastid 23S rRNA contents of duf177a mutant tissues were also markedly reduced compared with the wild-type, whereas plastid 16S, 5S, and 4.5S rRNA contents were less affected, indicating that DUF177 is specifically required for accumulation of prokaryote-type 23S rRNA. An AtDUF177A–green fluorescent protein (GFP) transgene controlled by the native AtDUF177A promoter fully complemented the Arabidopsis atduf177a mutant. Transient expression of AtDUF177A–GFP in Nicotiana benthamiana leaves showed that the protein was localized in chloroplasts. The essential role of DUF177A in chloroplast–ribosome formation is reminiscent of IOJAP, another highly conserved ribosome-associated protein, suggesting that key mechanisms controlling ribosome formation in plastids evolved from non-essential pathways for regulation of the prokaryotic ribosome. PMID:27574185

  4. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis

    PubMed Central

    Yang, Leiyun; Yang, Fen; Wang, Yi; Zhu, Jian-Kang; Hua, Jian

    2016-01-01

    Plants have varying abilities to tolerate chilling (low but not freezing temperatures), and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance. PMID:27138552

  5. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis.

    PubMed

    Wang, Shuai; Bai, Ge; Wang, Shu; Yang, Leiyun; Yang, Fen; Wang, Yi; Zhu, Jian-Kang; Hua, Jian

    2016-05-01

    Plants have varying abilities to tolerate chilling (low but not freezing temperatures), and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance. PMID:27138552

  6. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  7. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    PubMed

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  8. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    PubMed

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence. PMID:26904019

  9. 16S–23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    PubMed Central

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S–23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S–23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2–57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes), ITSAla(TGC), ITSAla(TGC)+Ile(GAT), ITSIle(GAT)+Ala(TGC), and ITS Ile(GAT)+Pseudo. All of the identified tRNAAla(TGC) molecules consisted of 73 bases, and all of the tRNAIle(GAT) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S–23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence. PMID:26904019

  10. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    PubMed

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  11. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly.

    PubMed

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-08-25

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2'-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2'-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  12. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly

    PubMed Central

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-01-01

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2′-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2′-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  13. Methylation sites in Escherichia coli ribosomal RNA: localization and identification of four new sites of methylation in 23S rRNA.

    PubMed

    Smith, J E; Cooperman, B S; Mitchell, P

    1992-11-10

    Four previously undetermined sites of methylation are mapped in Escherichia coli 23S rRNA employing a novel combination of methods. First, using a double-isotope approach, the total number of methyl groups in 23S rRNA was determined to be 14.9 +/- 1.6. Second, hybridization of methyl-labeled rRNA to complementary DNA restriction fragments and PAGE analysis were used to purify RNA-DNA heteroduplexes and to quantify methyl groups within specific 23S rRNA fragments. Third, the methylated nucleosides in these fragments were identified and quantified using HPLC, confirming the presence of 14 methylation sites in 23S rRNA, four more than had been previously identified. In contrast, a similar set of analyses conducted on 16S rRNA gave evidence for 10 sites of methylation, at all approximate locations consistent with published 16S methylated nucleoside identities and locations. Selected regions of the 23S rRNA molecule containing previously unidentified methylated nucleosides were released by site-directed cleavage with ribonuclease H and isolated by PAGE. Sites of methylation within the RNA fragments were determined by classical oligonucleotide analyses. The four newly identified methylation sites in 23S rRNA are m2G-1835, m5C-1962, m6A-2503, and m2G at one of positions 2445-2447. Together with previously described sites of modification, these new sites form a group that is clustered in a current model for the three-dimensional organization of the 23S rRNA in the 50S ribosomal subunit, at a locus congruent with nucleotides previously implicated in ribosomal function. PMID:1384701

  14. Gram-positive bacteria with a high DNA G+C content are characterized by a common insertion within their 23S rRNA genes.

    PubMed

    Roller, C; Ludwig, W; Schleifer, K H

    1992-06-01

    An insertion of about 100 bases within the central part of the 23S rRNA genes was found to be a phylogenetic marker for the bacterial line of descent of Gram-positive bacteria with a high DNA G + C content. The insertion was present in 23S rRNA genes of 64 strains representing the major phylogenetic groups of Gram-positive bacteria with a high DNA G+C content, whereas it was not found in 23S rRNA genes of 55 (eu)bacteria representing Gram-positive bacteria with a low DNA G + C content and all other known (eu)bacterial phyla. The presence of the insertion could be easily demonstrated by comparative gel electrophoretic analysis of in vitro-amplified 23S rDNA fragments, which contained the insertion. The nucleotide sequences of the amplified fragments were determined and sequence similarities of at least 44% were found. The overall similarity values are lower than those of 16S and 23S rRNA sequences of the particular organism. Northern hybridization experiments indicated the presence of the insertion within the mature 23S rRNA of Corynebacterium glutamicum.

  15. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    PubMed Central

    2010-01-01

    Background Francisella (F.) tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR) have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH) assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples. PMID:20205957

  16. Analysis of 16S-23S rRNA Intergenic Spacer Regions of Vibrio cholerae and Vibrio mimicus

    PubMed Central

    Chun, Jongsik; Huq, Anwarul; Colwell, Rita R.

    1999-01-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3′ end of the 16S and the 5′ end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae. PMID:10224020

  17. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    PubMed

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  18. Pyrosequencing of plastid 23S rRNA genes reveals diverse and dynamic cyanobacterial and algal populations in two eutrophic lakes.

    PubMed

    Steven, Blaire; McCann, Sage; Ward, Naomi L

    2012-12-01

    Pyrosequencing of plastid 23S rRNA genes was performed to determine the usefulness of this methodology for describing spatial and temporal patterns of algal diversity in two eutrophic lakes. The majority of the sequences were identified as known cyanobacteria or eukaryotic algae (> 70% of sequence reads), indicating this approach can specifically recover algal sequences from complex communities. Furthermore, estimated coverage of the data sets indicated that the majority of the 23S rRNA genetic diversity was recovered in these surveys. Communities from algal mats could be clearly distinguished from algae in the water column, and the communities could be readily differentiated between the two lakes, suggesting that the plastid 23S rRNA sequencing was able to distinguish niche and biogeographic partitioning of algal communities. Within the sequence data sets, the ratio of cyanobacteria to eukaryotic algae fluctuated over the course of sampling, with cyanobacteria 23S rRNA sequences being more abundant in later samples. In addition, the eukaryotic algae communities showed large shifts in composition over the course of sampling. Taken together, these data demonstrate the usefulness of targeted plastid 23S rRNA sequencing for describing the structure and dynamics of complex algal communities.

  19. SrmB, a DEAD-box helicase involved in Escherichia coli ribosome assembly, is specifically targeted to 23S rRNA in vivo

    PubMed Central

    Trubetskoy, Dmitrii; Proux, Florence; Allemand, Frédéric; Dreyfus, Marc; Iost, Isabelle

    2009-01-01

    DEAD-box proteins play specific roles in remodeling RNA or ribonucleoprotein complexes. Yet, in vitro, they generally behave as nonspecific RNA-dependent ATPases, raising the question of what determines their specificity in vivo. SrmB, one of the five Escherichia coli DEAD-box proteins, participates in the assembly of the large ribosomal subunit. Moreover, when overexpressed, it compensates for a mutation in L24, the ribosomal protein (r-protein) thought to initiate assembly. Here, using the tandem affinity purification (TAP) procedure, we show that SrmB forms a complex with r-proteins L4, L24 and a region near the 5′-end of 23S rRNA that binds these proteins. In vitro reconstitution experiments show that the stability of this complex reflects cooperative interactions of SrmB with L4, L24 and rRNA. These observations are consistent with an early role of SrmB in assembly and explain the genetic link between SrmB and L24. Besides its catalytic core, SrmB possesses a nonconserved C-terminal extension that, we show, is not essential for SrmB function and specificity. In this regard, SrmB differs from DbpA, another DEAD-box protein involved in ribosome assembly. PMID:19734346

  20. SrmB, a DEAD-box helicase involved in Escherichia coli ribosome assembly, is specifically targeted to 23S rRNA in vivo.

    PubMed

    Trubetskoy, Dmitrii; Proux, Florence; Allemand, Frédéric; Dreyfus, Marc; Iost, Isabelle

    2009-10-01

    DEAD-box proteins play specific roles in remodeling RNA or ribonucleoprotein complexes. Yet, in vitro, they generally behave as nonspecific RNA-dependent ATPases, raising the question of what determines their specificity in vivo. SrmB, one of the five Escherichia coli DEAD-box proteins, participates in the assembly of the large ribosomal subunit. Moreover, when overexpressed, it compensates for a mutation in L24, the ribosomal protein (r-protein) thought to initiate assembly. Here, using the tandem affinity purification (TAP) procedure, we show that SrmB forms a complex with r-proteins L4, L24 and a region near the 5'-end of 23S rRNA that binds these proteins. In vitro reconstitution experiments show that the stability of this complex reflects cooperative interactions of SrmB with L4, L24 and rRNA. These observations are consistent with an early role of SrmB in assembly and explain the genetic link between SrmB and L24. Besides its catalytic core, SrmB possesses a nonconserved C-terminal extension that, we show, is not essential for SrmB function and specificity. In this regard, SrmB differs from DbpA, another DEAD-box protein involved in ribosome assembly.

  1. PCR-based method for targeting 16S-23S rRNA intergenic spacer regions among Vibrio species

    PubMed Central

    2010-01-01

    Background The genus Vibrio is a diverse group of Gram-negative bacteria comprised of 74 species. Furthermore, the genus has and is expected to continue expanding with the addition of several new species annually. Consequently, it is of paramount importance to have a method which is able to reliably and efficiently differentiate the numerous Vibrio species. Results In this study, a novel and rapid polymerase chain reaction (PCR)-based intergenic spacer (IGS)-typing system for vibrios was developed that is based on the well-known IGS regions located between the 16S and 23S rRNA genes on the bacterial chromosome. The system was optimized to resolve heteroduplex formation as well as to take advantage of capillary gel electrophoresis technology such that reproducible analyses could be achieved in a rapid manner. System validation was achieved through testing of 69 archetypal Vibrio strains, representing 48 Vibrio species, from which an 'IGS-type' profile database was generated. These data, presented here in several cluster analyses, demonstrated successful differentiation of the 69 type strains showing that this PCR-based fingerprinting method easily discriminates bacterial strains at the species level among Vibrio. Furthermore, testing 36 strains each of V. parahaemolyticus and V. vulnificus, important food borne pathogens, isolated from a variety of geographical locations with the IGS-typing method demonstrated distinct IGS-typing patterns indicative of subspecies divergence in both populations making this technique equally useful for intraspecies differentiation, as well. Conclusion This rapid, reliable and efficient IGS-typing system, especially in combination with 16S rRNA gene sequencing, has the capacity to not only discern and identify vibrios at the species level but, in some cases, at the sub-species level, as well. This procedure is particularly well-suited for preliminary species identification and, lends itself nicely to epidemiological investigations

  2. Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

    PubMed Central

    Takaiwa, F; Sugiura, M

    1982-01-01

    The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which contain intervening sequences of 707 bp and 710 bp, respectively. Strong homology between the two intervening sequences is observed. These spacer tRNAs are synthesized as part of an 8.2 kb precursor molecule containing 16S and 23S rRNA sequences. Images PMID:6281739

  3. Atypical processing in domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004(T) at a position homologous to an rRNA fragmentation site in protozoa.

    PubMed

    Klein, Franziska; Samorski, Regina; Klug, Gabriele; Evguenieva-Hackenberg, Elena

    2002-06-01

    For still unknown reasons, the 23S rRNA of many alpha-Proteobacteria shows a unique fragmentation pattern compared to other bacteria. The 23S rRNA processing involves RNase III and additional, yet unidentified enzymes. The alpha-proteobacterium Rhizobium leguminosarum ATCC 10004(T) possesses two fragmentation sites in its 23S rRNA. The first one harbors an intervening sequence in helix 9 which is cleaved by RNase III. We demonstrate that the mature 5' end of the resulting 2.6-kb rRNA fragment is generated by additional removal of helix 10. A fraction of the 2.6-kb rRNA is further processed in domain III, giving rise to two 1.3-kb rRNA fragments. We mapped the domain III fragmentation site and found it to be at a position which has only been reported for trypanosomatid protozoa. This fragmentation site is also unique in that it lacks an intervening sequence. We found that the simultaneous occurrence of 2.6-kb and 1.3-kb rRNA fragments is not due to interoperonal sequence differences but rather reflects slow processing. The different characteristics of the two fragmentation sites in the 23S rRNA suggest that they are processed by different mechanisms. Interestingly, the amount of 2.6-kb rRNA varies during culture growth. We observed a transient increase in the relative amount of 2.6-kb rRNA fragments during the first hours after inoculation, which points to changes in the ratio of rRNA synthesis rate to domain III processing rate during the growth of a culture.

  4. Differentiation of non-pylori Helicobacter species based on PCR-restriction fragment length polymorphism of the 23S rRNA gene.

    PubMed

    Yadegar, Abbas; Alebouyeh, Masoud; Lawson, Andy J; Mirzaei, Tabassom; Nazemalhosseini Mojarad, Ehsan; Zali, Mohammad Reza

    2014-06-01

    Phenotypic identification of non-pylori Helicobacter species has always been problematic and time-consuming in comparison with many other bacteria. We developed a rapid two-step identification assay based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 23S rRNA gene for differentiating between non-pylori Helicobacter species. A new genus-specific primer pair based on all available complete and partial 23S rRNA sequences of Helicobacter species was designed. In silico restriction analysis of variable regions of the 23S rRNA gene suggested SmaI and HindIII endonucleases would provide a good level of differentiation. Analysis of the obtained 23S rRNA RFLP patterns divided all Helicobacter study strains into three species groups (groups A-C) and 12 unique restriction patterns. Wolinella succinogenes also gave a unique pattern. Our proposed PCR-RFLP method was found to be as a valuable tool for routine identification of non-pylori Helicobacter species from human or animal samples.

  5. The sequence of Methanospirillum hungatei 23S rRNA confirms the specific relationship between the extreme halophiles and the Methanomicrobiales

    NASA Technical Reports Server (NTRS)

    Burggraf, S.; Ching, A.; Stetter, K. O.; Woese, C. R.

    1991-01-01

    We have determined the sequence of the 23S rRNA from the methanogenic archaeon Methanospirillum hungatei. This is the first such sequence from a member of the Methanomicrobiales. Moreover, it brings additional evidence to bear on the possible specific relationship between this particular group of methanogens and the extreme halophiles. Such evidence is critical in that several new (and relatively untested) methods of phylogenetic inference have lead to the controversial conclusion that the extreme halophiles are either not related to the archaea, or are only peripherally so. Analysis of the Methanospirillum hungatei 23S rRNA sequence shows the Methanomicrobiales are indeed a sister group of the extreme halophiles, further strengthening the conclusions reached from analysis of 16S rRNA sequences.

  6. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

    2007-12-04

    The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  7. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    PubMed

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis. PMID:27546720

  8. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    PubMed

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  9. Domain I of 23S rRNA competes with a paused transcription complex for ribosomal protein L4 of Escherichia coli.

    PubMed Central

    Zengel, J M; Lindahl, L

    1993-01-01

    Ribosomal protein L4 of Escherichia coli regulates expression of its own eleven gene S10 operon both by inhibiting translation and by stimulating premature termination of transcription. Both regulatory processes presumably involve L4 recognition of the S10 leader RNA. To help define L4's regulatory target, we have investigated the protein's cognate target on 23S rRNA. Binding of L4 to various fragments of the 23S rRNA was monitored by determining their ability to sequester L4 in an in vitro transcription system and thereby eliminate the protein's effect on transcription. Using this approach we identified a region of about 110 bases within domain I of 23S rRNA which binds L4. A two base deletion within this region, close to the base to which L4 has been cross-linked in intact 50S subunits, eliminates L4 binding. These results also confirm the prediction of the autogenous control model, that L4 bound to its target on rRNA is not active in regulating transcription of the S10 operon. Images PMID:7685080

  10. Mycobacterial toxin MazF-mt6 inhibits translation through cleavage of 23S rRNA at the ribosomal A site.

    PubMed

    Schifano, Jason M; Edifor, Regina; Sharp, Jared D; Ouyang, Ming; Konkimalla, Arvind; Husson, Robert N; Woychik, Nancy A

    2013-05-21

    The Mycobacterium tuberculosis genome contains an unusually high number of toxin-antitoxin modules, some of which have been suggested to play a role in the establishment and maintenance of latent tuberculosis. Nine of these toxin-antitoxin loci belong to the mazEF family, encoding the intracellular toxin MazF and its antitoxin inhibitor MazE. Nearly every MazF ortholog recognizes a unique three- or five-base RNA sequence and cleaves mRNA. As a result, these toxins selectively target a subset of the transcriptome for degradation and are known as "mRNA interferases." Here we demonstrate that a MazF family member from M. tuberculosis, MazF-mt6, has an additional role--inhibiting translation through targeted cleavage of 23S rRNA in the evolutionarily conserved helix/loop 70. We first determined that MazF-mt6 cleaves mRNA at (5')UU↓CCU(3') sequences. We then discovered that MazF-mt6 also cleaves M. tuberculosis 23S rRNA at a single UUCCU in the ribosomal A site that contacts tRNA and ribosome recycling factor. To gain further mechanistic insight, we demonstrated that MazF-mt6-mediated cleavage of rRNA can inhibit protein synthesis in the absence of mRNA cleavage. Finally, consistent with the position of 23S rRNA cleavage, MazF-mt6 destabilized 50S-30S ribosomal subunit association. Collectively, these results show that MazF toxins do not universally act as mRNA interferases, because MazF-mt6 inhibits protein synthesis by cleaving 23S rRNA in the ribosome active center. PMID:23650345

  11. Magnesium ions mediate contacts between phosphoryl oxygens at positions 2122 and 2176 of the 23S rRNA and ribosomal protein L1.

    PubMed Central

    Drygin, D; Zimmermann, R A

    2000-01-01

    The complex of ribosomal protein L1 with 23S rRNA from Escherichia coli is of great interest because of the unique structural and functional aspects of this ribonucleoprotein domain. We have minimized the binding site for protein L1 on the 23S rRNA to nt 2120-2129, 2159-2162, and 2167-2178. This RNA fragment consists of two helices as well as an interconnecting loop of unknown structure. RNA molecules corresponding to the minimized L1 binding site, in which G, A, U, or C were individually replaced by their deoxyribo- (dN) or alpha-thio- (rNaS) analogs have been synthesized by T7 transcription in vitro and analyzed for their ability to bind protein L1. It has been demonstrated that the substitution of rNaS at position 2122 or 2176 decreases the affinity of the RNA for the protein in the presence of magnesium five- to tenfold, whereas the same changes have little effect on binding in the presence of manganese. This suggests that Rp oxygens in the phosphates preceding positions 2122 and 2176 are coordinated with Mg2+ and may participate in L1-23S rRNA interaction via magnesium bridges. We have also shown that this interaction is impaired by the presence of dC at position 2122 coupled with the presence of deoxyribonucleotide(s) at other positions in the RNA. This study demonstrates that the ribose-phosphate backbone of the helix encompassing nt 2120-2124/2174-2178 is intimately involved in the interaction of protein L1 with the 23S rRNA. In particular, we suggest that this helix is positioned in the cleft between the two domains of protein L1. PMID:11142372

  12. Evaluation of the 23S rRNA gene as target for qPCR based quantification of Frankia in soils.

    PubMed

    Samant, Suvidha; Amann, Rudolf I; Hahn, Dittmar

    2014-05-01

    The 23S rRNA gene was evaluated as target for the development of Sybr Green-based quantitative PCR (qPCR) for the analysis of nitrogen-fixing members of the genus Frankia or subgroups of these in soil. A qPCR with a primer combination targeting all nitrogen-fixing frankiae (clusters 1, 2 and 3) resulted in numbers similar to those obtained with a previously developed qPCR using nifH gene sequences, both with respect to introduced and indigenous Frankia populations. Primer combinations more specifically targeting three subgroups of the Alnus host infection group (cluster 1) or members of the Elaeagnus host infection group (cluster 3) were specific for introduced strains of the target group, with numbers corresponding to those obtained by quantification of nitrogen-fixing frankiae with both the 23S rRNA and nifH genes as target. Method verification on indigenous Frankia populations in soils, i.e. in depth profiles from four sites at an Alnus glutinosa stand, revealed declining numbers in the depth profiles, with similar abundance of all nitrogen-fixing frankiae independent of 23S rRNA or nifH gene targets, and corresponding numbers of one group of frankiae of the Alnus host infection only, with no detections of frankiae representing the Elaeagnus, Casuarina, or a second subgroup of the Alnus host infection groups. PMID:24315016

  13. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed Central

    Stelzl, U; Nierhaus, K H

    2001-01-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied. PMID:11345438

  14. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed

    Stelzl, U; Nierhaus, K H

    2001-04-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied.

  15. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  16. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    SciTech Connect

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D.

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  17. Discrimination of Bacillus anthracis and Closely Related Microorganisms by Analysis of 16S and 23S rRNA with Oligonucleotide Microarray

    PubMed Central

    Bavykin, Sergei G.; Mikhailovich, Vladimir M.; Zakharyev, Vladimir M.; Lysov, Yuri p.; Kelly, John J.; Alferov, Oleg S.; Gavin, Igor M.; Kukhtin, Alexander V.; Jackman, Joany; Stahl, David A.; Chandler, Darrell; Mirzabekov, Andrei D.

    2009-01-01

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 minutes. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead

  18. Macrolide Resistance in Treponema pallidum Correlates With 23S rDNA Mutations in Recently Isolated Clinical Strains

    PubMed Central

    Molini, Barbara J.; Tantalo, Lauren C.; Sahi, Sharon K.; Rodriguez, Veronica I.; Brandt, Stephanie L.; Fernandez, Mark C.; Godornes, Charmie B.; Marra, Christina M.; Lukehart, Sheila A.

    2016-01-01

    Background High rates of 23S rDNA mutations implicated in macrolide resistance have been identified in Treponema pallidum samples from syphilis patients in many countries. Nonetheless, some clinicians have been reluctant to abandon azithromycin as a treatment for syphilis, citing the lack of a causal association between these mutations and clinical evidence of drug resistance. Although azithromycin resistance has been demonstrated in vivo for the historical Street 14 strain, no recent T. pallidum isolates have been tested. We used the well-established rabbit model of syphilis to determine the in vivo efficacy of azithromycin against 23S rDNA mutant strains collected in 2004 to 2005 from patients with syphilis in Seattle, Wash. Methods Groups of 9 rabbits were each infected with a strain containing 23S rDNA mutation A2058G (strains UW074B, UW189B, UW391B) or A2059G (strains UW228B, UW254B, and UW330B), or with 1 wild type strain (Chicago, Bal 3, and Mexico A). After documentation of infection, 3 animals per strain were treated with azithromycin, 3 were treated with benzathine penicillin G, and 3 served as untreated control groups. Treatment efficacy was documented by darkfield microscopic evidence of T. pallidum, serological response, and rabbit infectivity test. Results Azithromycin uniformly failed to cure rabbits infected with strains harboring either 23S rDNA mutation, although benzathine penicillin G was effective. Infections caused by wild type strains were successfully treated by either azithromycin or benzathine penicillin G. Conclusions A macrolide resistant phenotype was demonstrated for all strains harboring a 23S rDNA mutation, demonstrating that either A2058G or A2059G mutation confers in vivo drug resistance. PMID:27513385

  19. Identification of Lactobacillus Isolates from the Gastrointestinal Tract, Silage, and Yoghurt by 16S-23S rRNA Gene Intergenic Spacer Region Sequence Comparisons

    PubMed Central

    Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Ng, J.; Munro, K.; Alatossava, T.

    1999-01-01

    Lactobacillus isolates were identified by PCR amplification and sequencing of the region between the 16S and 23S rRNA genes (spacer region). The sequences obtained from the isolates were compared to those of reference strains held in GenBank. A similarity of 97.5% or greater was considered to provide identification. To check the reliability of the method, the V2-V3 region of the 16S rRNA gene was amplified and sequenced in the case of isolates whose spacer region sequences were less than 99% similar to that of a reference strain. Confirmation of identity was obtained in all instances. Spacer region sequencing provided rapid and accurate identification of Lactobacillus isolates obtained from gastrointestinal, yoghurt, and silage samples. It had an advantage over 16S V2-V3 sequence comparisons because it distinguished between isolates of Lactobacillus casei and Lactobacillus rhamnosus. PMID:10473450

  20. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  1. Variations in the 16S-23S rRNA internal transcribed spacer of fibrolytic Butyrivibrio isolates from the reindeer rumen.

    PubMed

    Præsteng, Kirsti E; Mackie, Roderick I; Cann, Isaac K O; Mathiesen, Svein D; Sundset, Monica A

    2011-07-01

    Strains of Butyrivibrio are principal cellulytic bacteria in the rumen of the High Arctic Svalbard reindeer ( Rangifer tarandus platyrhynchus ). According to phylogenetic analysis based on 16S rRNA gene sequencing, Butyrivibrio can be divided into three subgroups within the Clostridia class of the phylum Firmicutes, but the current phenotypic and genotypic differentiation within the family Lachnospiraceae is insufficient. This current study describes the sequence diversity of the 16S-23S rRNA intergenic transcribed spacer (ITS) region of Butyrivibrio isolates from reindeer. A total of 17 different ITS sequences with sizes between 449 and 784 nt were obtained. Genes encoding tRNA(Ile) and tRNA(Ala) were identified in four of the sequences. Phylogenetic neighbor-joining trees were constructed based on the ITS sequence and compared with a phylogenetic neighbor-joining tree based on 16S rRNA gene sequences previously obtained for the same isolates. These comparisons indicated a better differentiation between strains in the ITS sequence than the 16S rRNA gene based tree. Through this study, a better means for identifying and tracking fibrolytic and potentially probiotic Butyrivibrio strains in reindeer and other ruminants has been provided.

  2. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.

    PubMed

    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara

    2003-09-01

    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing.

  3. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    PubMed

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods.

  4. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  5. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    PubMed

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods. PMID:23269456

  6. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.

    PubMed

    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara

    2003-09-01

    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing. PMID:12957895

  7. Use of denaturing gradient gel electrophoresis to detect mutation in VS2 of the 16S-23S rDNA spacer amplified from Staphylococcus aureus isolates.

    PubMed

    Gürtler, V; Barrie, H D; Mayall, B C

    2001-06-01

    To develop a double gradient denaturing gradient gel electrophoresis (DG-DGGE) based typing method that rapidly and accurately types clinical isolates of Staphylococcus aureus, the VS2 region of the 16S-23S rRNA spacer region (ISR) was chosen because of its potential high variation. The VS2 region was amplified with a 40-mer GC-clamp attached to the 5'-end of the reverse primer. The 145 bp PCR product was then separated by DG-DGGE using denaturant concentrations of 25-40% and polyacrylamide concentrations of 6-12%. Of the five mutations identified in 336 S. aureus isolates, one mutation was found to be highly specific for 161/171 (94%) of methicillin-resistant S. aureus (MRSA) isolates from different geographic locations and isolation times. This same mutation was found in 15/160 (9%) of penicillin- or methicillin-sensitive S. aureus isolates. In some isolates two mutations occured together in the one genome suggesting some S. aureus isolates have two copies of VS2. In these 336 isolates nine genotypes with different combinations of the five mutations were identified. In 18 coagulase-negative staphylococci (CNS), the MRSA-specific mutation was found along with two other mutations in all isolates demonstrating consistent differences in the presence of these mutations between CNS and S. aureus. The marked differences in VS2 sequences found between MRSA, methicillin- or penicillin-sensitive S. aureus (SSA), and CNS by DGGE in the present study may be useful in evolutionary studies and in the development of a specific assay for MRSA from clinical specimens.

  8. AtPPR2, an Arabidopsis pentatricopeptide repeat protein, binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis

    PubMed Central

    Lu, Yuqing; Li, Cong; Wang, Hai; Chen, Hao; Berg, Howard; Xia, Yiji

    2011-01-01

    SUMMARY Pentatricopeptide repeat (PPR) proteins are mainly involved in regulating post-transcriptional processes in mitochondria and plastids, including chloroplasts. Mutations in the Arabidopsis PPR2 gene have previously been found to cause defects in seed development and reduced transmission through male and female gametophytes. However, the exact function of AtPPR2 has not been defined. We found that a loss-of-function mutation of AtPPR2 leads to arrest of the first mitotic division during both male and female gametogenesis. In addition, the Atppr2 mutation causes delayed embryogenesis, leading to embryonic lethality. Mutation in emb2750, which appears to be a weak mutant allele of the AtPPR2 locus, also results in defective seeds. However, a majority of emb2750 seeds were able to germinate, but their cotyledons were albino and often deformed, and growth of the emb2750 seedlings were arrested after germination. AtPPR2 is mainly expressed in plant parts that undergo cell division, and AtPPR2 protein was localized to chloroplasts. RNA immunoprecipitation and protein gel mobility shift assays showed that AtPPR2 binds to plastid 23S rRNA. Our study adds to a growing body of evidence that plastids and/or chloroplasts play a key role in cell division. AtPPR2 may modulate the translational process to fine-tune plastid function, thereby regulating cell division. PMID:21435048

  9. Escherichia coli and Enterococcus spp. in rainwater tank samples: comparison of culture-based methods and 23S rRNA gene quantitative PCR assays.

    PubMed

    Ahmed, W; Richardson, K; Sidhu, J P S; Toze, S

    2012-10-16

    In this study, culture-based methods and quantitative PCR (qPCR) assays were compared with each other for the measurement of Escherichia coli and Enterococcus spp. in water samples collected from rainwater tanks in Southeast Queensland, Australia. Among the 50 rainwater tank samples tested, 26 (52%) and 46 (92%) samples yielded E. coli numbers as measured by EPA Method 1603 and E. coli 23S rRNA gene qPCR assay, respectively. Similarly, 49 (98%) and 47 (94%) samples yielded Enterococcus spp. numbers as measured by EPA Method 1600 and Enterococcus spp. 23S rRNA gene qPCR assay, respectively. The mean E. coli (2.49 ± 0.85) log(10) and Enterococcus spp. (2.72 ± 0.32) log(10) numbers as measured by qPCR assays were significantly (P < 0001) different than E. coli (0.91 ± 0.80) log(10) and Enterococcus spp. (1.86 ± 0.60) log(10) numbers as measured by culture-based method. Weak but significant correlations were observed between both EPA Method 1603 and the E. coli qPCR assay (r = 0.47, P = 0.0009), and EPA Method 1600 and the Enterococcus spp. qPCR assay (r = 0.42, P = 0.002). Good qualitative agreement was found between the culture-based method and the Enterococcus spp. qPCR assay in terms of detecting fecal pollution in water samples from the studied rainwater tanks. More research studies, however, are needed to shed some light on the discrepancies associated with the culture-based methods and qPCR assays for measuring fecal indicator bacteria.

  10. Resistance to macrolides, lincosamides and streptogramin type B antibiotics due to a mutation in an rRNA operon of Streptomyces ambofaciens.

    PubMed Central

    Pernodet, J L; Boccard, F; Alegre, M T; Blondelet-Rouault, M H; Guérineau, M

    1988-01-01

    Streptomyces ambofaciens produces spiramycin, a macrolide antibiotic and expresses an inducible resistance to macrolides, lincosamides and streptogramin B antibiotics (MLS). From a mutant of S.ambofaciens exhibiting a constitutive MLS resistance phenotype a resistance determinant was cloned on a low copy number vector (pIJ61) through its expression in Streptomyces lividans. Further characterization has shown that this determinant corresponded to a mutant rRNA operon with a mutation in the 23S rRNA gene. In different organisms, mutations leading to MLS resistance have been located at a position corresponding to the adenine 2058 of Escherichia coli 23S rRNA. In the 23S rRNA from S.ambofaciens a similar position for the mutation has been postulated and DNA sequencing of this region has shown an adenine to guanine transition at a position corresponding to 2058. S.ambofaciens possesses four rRNA operons which we have cloned. In Streptomyces, contrary to other bacteria, a mutation in one among several rRNA operons confers a selectable MLS resistance phenotype. Possible reasons for this difference are discussed. Images PMID:2834204

  11. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA.

    PubMed

    Sunita, S; Zhenxing, H; Swaathi, J; Cygler, Miroslaw; Matte, Allan; Sivaraman, J

    2006-06-16

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine (Psi) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E.coli RluF at 2.6A resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of Psi-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  12. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends.

  13. Phylogeny of bradyrhizobia from Chinese cowpea miscellany inferred from 16S rRNA, atpD, glnII, and 16S-23S intergenic spacer sequences.

    PubMed

    Zhang, Sufang; Xie, Fuli; Yang, Jiangke; Li, Youguo

    2011-04-01

    The cowpea (Vigna unguiculata L.), peanut (Arachis hypogaea L.), and mung bean (Vigna radiata L.) belong to a group of plants known as the "cowpea miscellany" plants, which are widely cultivated throughout the tropic and subtropical zones of Africa and Asia. However, the phylogeny of the rhizobial strains that nodulate these plants is poorly understood. Previous studies have isolated a diversity of rhizobial strains from cowpea miscellany hosts and have suggested that, phylogenetically, they are from different species. In this work, the phylogeny of 42 slow-growing rhizobial strains, isolated from root nodules of cowpea, peanut, and mung bean from different geographical regions of China, was investigated using sequences from the 16S rRNA, atpD and glnII genes, and the 16S-23S rRNA intergenic spacer. The indigenous rhizobial strains from the cowpea miscellany could all be placed in the genus Bradyrhizobium , and Bradyrhizobium liaoningense and Bradyrhizobium yuanmingense were the main species. Phylogenies derived from housekeeping genes were consistent with phylogenies generated from the ribosomal gene. Mung bean rhizobia clustered only into B. liaoningense and B. yuanmingense and were phylogenetically less diverse than cowpea and peanut rhizobia. Geographical origin was significantly reflected in the phylogeny of mung bean rhizobia. Most cowpea rhizobia were more closely related to the 3 major groups B. liaoningense, B. yuanmingense, and Bradyrhizobium elkanii than to the minor groups Bradyrhizobium japonicum or Bradyrhizobium canariense . However, most peanut rhizobia were more closely related to the 2 major groups B. liaoningense and B. yuanmingense than to the minor group B. elkanii.

  14. Genotypic Characterization of Bradyrhizobium Strains Nodulating Small Senegalese Legumes by 16S-23S rRNA Intergenic Gene Spacers and Amplified Fragment Length Polymorphism Fingerprint Analyses

    PubMed Central

    Doignon-Bourcier, Florence; Willems, Anne; Coopman, Renata; Laguerre, Gisele; Gillis, Monique; de Lajudie, Philippe

    2000-01-01

    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations. PMID:10966419

  15. Genotypic characterization of Bradyrhizobium strains nodulating small Senegalese legumes by 16S-23S rRNA intergenic gene spacers and amplified fragment length polymorphism fingerprint analyses.

    PubMed

    Doignon-Bourcier, F; Willems, A; Coopman, R; Laguerre, G; Gillis, M; de Lajudie, P

    2000-09-01

    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations.

  16. Development of a 16S-23S rRNA intergenic spacer-based quantitative PCR assay for improved detection and enumeration of Lactococcus garvieae.

    PubMed

    Thanh, Hien Dang; Park, Hee Kuk; Kim, Wonyong; Shin, Hyoung-Shik

    2013-02-01

    Lactococcus garvieae is an important foodborne pathogen causing lactococcosis associated with hemorrhagic septicemia in fish worldwide. A real-time quantitative polymerase chain reaction (qPCR) protocol targeting the 16S-23S rRNA intergenic spacer (ITS) region was developed for the detection and enum-eration of L. garvieae. The specificity was evaluated using genomic DNAs extracted from 66 cocci strains. Fourteen L. garvieae strains tested were positive, whereas 52 other strains including Lactococcus lactis ssp. lactis, Lactococcus lactis ssp. hordniae and Lactococcus lactis ssp. cremoris did not show a specific signal. The minimal limit of detection was 2.63 fg of purified genomic DNA, equivalent to 1 genome of L. garvieae. The optimized protocol was applied for the survey of L. garvieae in naturally contaminated fish samples. Our results suggest that the qPCR protocol using ITS is a sensitive and efficient tool for the rapid detection and enumeration of L. garvieae in fish and fish-containing foods.

  17. Identification of virulence factors in 16S-23S rRNA intergenic spacer genotyped Staphylococcus aureus isolated from water buffaloes and small ruminants.

    PubMed

    Cremonesi, P; Zottola, T; Locatelli, C; Pollera, C; Castiglioni, B; Scaccabarozzi, L; Moroni, P

    2013-01-01

    Staphylococcus aureus is an important human and animal pathogen, and is regarded as an important cause of intramammary infection (IMI) in ruminants. Staphylococcus aureus genetic variability and virulence factors have been well studied in veterinary medicine, especially in cows as support for control and management of IMI. The aim of the present study was to genotype 71 Staph. aureus isolates from the bulk tank and foremilk of water buffaloes (n=40) and from udder tissue (n=7) and foremilk (n=24) from small ruminants. The method used was previously applied to bovine Staph. aureus and is based on the amplification of the 16S-23S rRNA intergenic spacer region. The technique applied was able to identify different Staph. aureus genotypes isolated from dairy species other than the bovine species, and cluster the genotypes according to species and herds. Virulence gene distribution was consistent with genotype differentiation. The isolates were also characterized through determination of the presence of 19 virulence-associated genes by specific PCR. Enterotoxins A, C, D, G, I, J, and L were associated with Staph. aureus isolates from buffaloes, whereas enterotoxins C and L were linked to small ruminants. Genes coding for methicillin resistance, Panton-Valentine leukocidin, exfoliative toxins A and B, and enterotoxins B, E, and H were undetected. These findings indicate that RNA template-specific PCR is a valid technique for typing Staph. aureus from buffaloes and small ruminants and is a useful tool for understanding udder infection epidemiology.

  18. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    NASA Astrophysics Data System (ADS)

    Okamura, K.; Hisada, T.; Takata, K.; Hiraishi, A.

    2013-04-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  19. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  20. Identification of Carnobacterium species by restriction fragment length polymorphism of the 16S-23S rRNA gene intergenic spacer region and species-specific PCR.

    PubMed

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-08-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in order to obtain restriction profiles for all of the species. Three PCR amplicons, which were designated small ISR (S-ISR), medium ISR (M-ISR), and large ISR (L-ISR), were obtained for all Carnobacterium species. The L-ISR sequence revealed the presence of two tRNA genes, tRNA(Ala) and tRNA(Ile), which were separated by a spacer region that varied from 24 to 38 bp long. This region was variable among the species, allowing the design of species-specific primers. These primers were tested and proved to be species specific. The identification method based on the 16S-23S rDNA ISR, using PCR-RFLP and specific primers, is very suitable for the rapid low-cost identification and discrimination of all of the Carnobacterium species from other phylogenetically related lactic acid bacteria.

  1. Bacteria evade immune recognition via TLR13 and binding of their 23S rRNA by MLS antibiotics by the same mechanisms

    PubMed Central

    Hochrein, Hubertus; Kirschning, Carsten J.

    2013-01-01

    The immune system recognizes pathogens and other danger by means of pattern recognition receptors. Recently, we have demonstrated that the orphan Toll-like receptor 13 (TLR13) senses a defined sequence of the bacterial rRNA and that bacteria use specific mechanisms to evade macrolide lincosamide streptogramin (MLS) antibiotics detection via TLR13. PMID:23802068

  2. Cyanobacterial Ecotypes in Different Optical Microenvironments of a 68°C Hot Spring Mat Community Revealed by 16S-23S rRNA Internal Transcribed Spacer Region Variation†

    PubMed Central

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea; Ward, David M.

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynthesis demonstrated the existence of physiologically distinct Synechococcus populations at different depths along a light gradient quantified by scalar irradiance microprobes. Molecular methods were used to evaluate whether physiologically distinct populations could be correlated with genetically distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S rRNA genes suggested the existence of closely related but genetically distinct populations corresponding to different functional populations occurring at different depths. PMID:12732563

  3. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    SciTech Connect

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  4. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.

    PubMed

    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  5. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    NASA Astrophysics Data System (ADS)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  6. Sequence specific detection of bacterial 23S ribosomal RNA by TLR13

    PubMed Central

    Li, Xiao-Dong; Chen, Zhijian J

    2012-01-01

    Toll-like receptors (TLRs) detect microbial infections and trigger innate immune responses. Among vertebrate TLRs, the role of TLR13 and its ligand are unknown. Here we show that TLR13 detects the 23S ribosomal RNA of both gram-positive and gram-negative bacteria. A sequence containing 13 nucleotides near the active site of 23S rRNA ribozyme, which catalyzes peptide bond synthesis, was both necessary and sufficient to trigger TLR13-dependent interleukin-1β production. Single point mutations within this sequence destroyed the ability of the 23S rRNA to stimulate the TLR13 pathway. Knockout of TLR13 in mice abolished the induction of interleukin-1β and other cytokines by the 23S rRNA sequence. Thus, TLR13 detects bacterial RNA with exquisite sequence specificity. DOI: http://dx.doi.org/10.7554/eLife.00102.001 PMID:23110254

  7. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant.

    PubMed Central

    Douthwaite, S; Prince, J B; Noller, H F

    1985-01-01

    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of 23S rRNA by replacement of restriction fragments in the wild-type plasmid by corresponding fragments from the mutant plasmid. DNA sequencing showed that positions 1219-1230 of the 23S rRNA gene are deleted in the mutant. Since all previously characterized rRNA mutations conferring resistance to erythromycin show changes exclusively in domain V, our present findings provide direct evidence for functional interaction between domains II and V of 23S rRNA. Images PMID:3909142

  8. Emergence of methicillin-resistant coagulase-negative staphylococci resistant to linezolid with rRNA gene C2190T and G2603T mutations.

    PubMed

    Cidral, Thiago André; Carvalho, Maria Cícera; Figueiredo, Agnes Marie Sá; de Melo, Maria Celeste Nunes

    2015-10-01

    The aim of this article were to determinate the mechanism of linezolid resistance in coagulase-negative methicillin-resistant staphylococci from hospitals in the northeast of Brazil. We identified the isolates using VITEK(®) 2 and MALDI-TOF. Susceptibility to antibiotics was measured by the disk-diffusion method and by Etest(®) . Extraction of the whole genome DNA was performed, followed by screening of all the strains for the presence of mecA and cfr genes. The domain V region of 23S rRNA gene was sequenced and then aligned with a linezolid-susceptible reference strain. Pulsed-field gel electrophoresis (PFGE) macro-restriction analysis was performed. Three linezolid-resistant Staphylococcus hominis and two linezolid-resistant Staphylococcus epidermidis strains were analyzed. The isolates showed two point mutations in the V region of the 23S rRNA gene (C2190T and G2603T). We did not detect the cfr gene in any isolate by PCR. The S. hominis showed the same pulsotype, while the S. epidermidis did not present any genetic relation to each other. In conclusion, this study revealed three S. hominis and two S. epidermidis strains with resistance to linezolid due to a double mutation (C2190T and G2603T) in the domain V of the 23S rRNA gene. For the first time, the mutation of C2190T in S. epidermidis is described. This study also revealed the clonal spread of a S. hominis pulsotype between three public hospitals in the city of Natal, Brazil. These findings highlight the importance of continued vigilance of linezolid resistance in staphylococci.

  9. Thermotoga maritima ribonuclease III. Characterization of thermostable biochemical behavior and analysis of conserved base pairs that function as reactivity epitopes for the Thermotoga 23S rRNA precursor.

    PubMed

    Nathania, Lilian; Nicholson, Allen W

    2010-08-24

    The cleavage of double-stranded (ds) RNA by ribonuclease III is a conserved early step in bacterial rRNA maturation. Studies on the mechanism of dsRNA cleavage by RNase III have focused mainly on the enzymes from mesophiles such as Escherichia coli. In contrast, neither the catalytic properties of extremophile RNases III nor the structures and reactivities of their cognate substrates have been described. The biochemical behavior of RNase III of the hyperthermophilic bacterium Thermotoga maritima was analyzed using purified recombinant enzyme. T. maritima (Tm) RNase III catalytic activity exhibits a broad optimal temperature range of approximately 40-70 degrees C, with significant activity at 95 degrees C. Tm-RNase III cleavage of substrate is optimally supported by Mg(2+) at >or=1 mM concentrations. Mn(2+), Co(2+), and Ni(2+) also support activity but with reduced efficiencies. The enzyme functions optimally at pH 8 and approximately 50-80 mM salt concentrations. Small RNA hairpins that incorporate the 16S and 23S pre-rRNA stem sequences are efficiently cleaved by Tm-RNase III at sites that are consistent with production in vivo of the immediate precursors to the mature rRNAs. Analysis of pre-23S substrate variants reveals a dependence of reactivity on the base-pair (bp) sequence in the proximal box (pb), a site of protein contact that functions as a positive recognition determinant for Escherichia coli (Ec) RNase III substrates. The dependence of reactivity on the pb sequence is similar to that observed with Ec-RNase III substrates. In fact, Tm-RNase III cleaves an Ec-RNase III substrate with identical specificity and is inhibited by antideterminant bp that also inhibit Ec-RNase III. These results indicate the conservation, across a broad phylogenetic distance, of positive and negative determinants of reactivity of bacterial RNase III substrates.

  10. Touchdown Enzyme Time Release-PCR for Detection and Identification of Chlamydia trachomatis, C. pneumoniae, and C. psittaci Using the 16S and 16S-23S Spacer rRNA Genes

    PubMed Central

    Madico, Guillermo; Quinn, Thomas C.; Boman, Jens; Gaydos, Charlotte A.

    2000-01-01

    Three touchdown enzyme time release (TETR)-PCR assays were used to amplify different DNA sequences in the variable regions of the 16S and 16S-23S spacer rRNA genes specific for Chlamydia trachomatis, Chlamydia pneumoniae, and Chlamydia psittaci as improved tests for sensitive diagnosis and rapid species differentiation. The TETR-PCR protocol used 60 cycles of amplification, which provided improved analytical sensitivity (0.004 to 0.063 inclusion-forming unit of Chlamydia species per PCR). The sensitivity of TETR-PCR with primer set CTR 70-CTR 71 was 96.7%, and the specificity was 99.6%, compared to those of the AMPLICOR PCR for the detection of C. trachomatis in vaginal swab samples. TETR-PCR for C. pneumoniae with primer set CPN 90-CPN 91 was 90% sensitive and 93.3% specific compared with a nested PCR with primer set CP1/2-CPC/D for clinical respiratory samples. TETR-PCR for C. psittaci with primer set CPS 100-CPS 101 showed substantial agreement with cell culturing (κ, 0.78) for animal tissue samples. Primer sets were then combined into a single multiplex TETR-PCR test. The respective 315-, 195-, and 111-bp DNA target products were precisely amplified when DNA from each of the respective Chlamydia species or combinations of them was used. Multiplex chlamydia TETR-PCR correctly identified one strain of each of the 15 serovars of C. trachomatis, 22 isolates of C. pneumoniae, and 20 isolates of C. psittaci. The primer sets were specific for each species. No target products were amplified when DNA from C. pecorum or a variety of other microorganisms was tested for specificity. TETR-PCR with primers selected for specific sequences in the 16S and 16S-23S spacer rRNA genes is a valuable test that could be used either with individual primers or in a multiplex assay for the identification and differentiation of Chlamydia species from culture isolates or for the detection of chlamydiae in clinical samples. PMID:10699002

  11. Species-level identification of isolates of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex by sequence analysis of the 16S-23S rRNA gene spacer region.

    PubMed

    Chang, Hsien Chang; Wei, Yu Fang; Dijkshoorn, Lenie; Vaneechoutte, Mario; Tang, Chung Tao; Chang, Tsung Chain

    2005-04-01

    The species Acinetobacter calcoaceticus, A. baumannii, genomic species 3, and genomic species 13TU included in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex are genetically highly related and difficult to distinguish phenotypically. Except for A. calcoaceticus, they are all important nosocomial species. In the present study, the usefulness of the 16S-23S rRNA gene intergenic spacer (ITS) sequence for the differentiation of (genomic) species in the A. calcoaceticus-A. baumannii complex was evaluated. The ITSs of 11 reference strains of the complex and 17 strains of other (genomic) species of Acinetobacter were sequenced. The ITS lengths (607 to 638 bp) and sequences were highly conserved for strains within the A. calcoaceticus-A. baumannii complex. Intraspecies ITS sequence similarities ranged from 0.99 to 1.0, whereas interspecies similarities varied from 0.86 to 0.92. By using these criteria, 79 clinical isolates identified as A. calcoaceticus (18 isolates) or A. baumannii (61 isolates) with the API 20 NE system (bioMerieux Vitek, Marcy l'Etoile, France) were identified as A. baumannii (46 isolates), genomic species 3 (19 isolates), and genomic species 13TU (11 isolates) by ITS sequencing. An identification rate of 96.2% (76 of 79 isolates) was obtained by using ITS sequence analysis for identification of isolates in the A. calcoaceticus-A. baumannii complex, and the accuracy of the method was confirmed for a subset of strains by amplified rRNA gene restriction analysis and genomic DNA analysis by AFLP analysis by using libraries of profiles of reference strains. In conclusion, ITS sequence-based identification is reliable and provides a promising tool for elucidation of the clinical significance of the different species of the A. calcoaceticus-A. baumannii complex.

  12. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    PubMed

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general.

  13. Evaluation of a fluorescence-labelled oligonucleotide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears.

    PubMed Central

    Nordentoft, S; Christensen, H; Wegener, H C

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all of the S. enterica subspecies and S. bongori, an 18-mer oligonucleotide probe was selected. The specificity of the probe was tested by in situ hybridization to bacterial cell smears of pure cultures. Forty-nine of 55 tested Salmonella serovars belonging to subspecies I, II, IIIb, IV, and VI hybridized with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin-fixed, paraffin-embedded tissue from experimentally infected mice or from animals with a history of clinical salmonellosis. In these tissue sections the probe hybridized specifically to Salmonella serovars, allowing for the detection of single bacterial cells. The development of a fluorescence-labelled specific oligonucleotide probe makes the FISH technique a promising tool for the rapid identification of S. enterica in bacterial smears, as well as for the detection of S. enterica in histological tissue sections. PMID:9316923

  14. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.

    PubMed

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H

    2013-12-27

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here.

  15. Crystal structure of the RluD pseudouridine synthase catalytic module, an enzyme that modifies 23S rRNA and is essential for normal cell growth of Escherichia coli.

    PubMed

    Sivaraman, J; Iannuzzi, Pietro; Cygler, Miroslaw; Matte, Allan

    2004-01-01

    Pseudouridine (5-beta-D-ribofuranosyluracil, Psi) is the most commonly found modified base in RNA. Conversion of uridine to Psi is performed enzymatically in both prokaryotes and eukaryotes by pseudouridine synthases (EC 4.2.1.70). The Escherichia coli Psi-synthase RluD modifies uridine to Psi at positions 1911, 1915 and 1917 within 23S rRNA. RluD also possesses a second function related to proper assembly of the 50S ribosomal subunit that is independent of Psi-synthesis. Here, we report the crystal structure of the catalytic module of RluD (residues 68-326; DeltaRluD) refined at 1.8A to a final R-factor of 21.8% (R(free)=24.3%). DeltaRluD is a monomeric enzyme having an overall mixed alpha/beta fold. The DeltaRluD molecule consists of two subdomains, a catalytic subdomain and C-terminal subdomain with the RNA-binding cleft formed by loops extending from the catalytic sub-domain. The catalytic sub-domain of DeltaRluD has a similar fold as in TruA, TruB and RsuA, with the location of the RNA-binding cleft, active-site and conserved, catalytic Asp residue superposing in all four structures. Superposition of the crystal structure of TruB bound to a T-stem loop with RluD reveals that similar RNA-protein interactions for the flipped-out uridine base would exist in both structures, implying that base-flipping is necessary for catalysis. This observation also implies that the specificity determinants for site-specific RNA-binding and recognition likely reside in parts of RluD beyond the active site.

  16. An MRPS12 mutation modifies aminoglycoside sensitivity caused by 12S rRNA mutations

    PubMed Central

    Emperador, Sonia; Pacheu-Grau, David; Bayona-Bafaluy, M. Pilar; Garrido-Pérez, Nuria; Martín-Navarro, Antonio; López-Pérez, Manuel J.; Montoya, Julio; Ruiz-Pesini, Eduardo

    2015-01-01

    Several homoplasmic pathologic mutations in mitochondrial DNA, such as those causing Leber hereditary optic neuropathy or non-syndromic hearing loss, show incomplete penetrance. Therefore, other elements must modify their pathogenicity. Discovery of these modifying factors is not an easy task because in multifactorial diseases conventional genetic approaches may not always be informative. Here, we have taken an evolutionary approach to unmask putative modifying factors for a particular homoplasmic pathologic mutation causing aminoglycoside-induced and non-syndromic hearing loss, the m.1494C>T transition in the mitochondrial DNA. The mutation is located in the decoding site of the mitochondrial ribosomal RNA. We first looked at mammalian species that had fixed the human pathologic mutation. These mutations are called compensated pathogenic deviations because an organism carrying one must also have another that suppresses the deleterious effect of the first. We found that species from the primate family Cercopithecidae (old world monkeys) harbor the m.1494T allele even if their auditory function is normal. In humans the m.1494T allele increases the susceptibility to aminoglycosides. However, in primary fibroblasts from a Cercopithecidae species, aminoglycosides do not impair cell growth, respiratory complex IV activity and quantity or the mitochondrial protein synthesis. Interestingly, this species also carries a fixed mutation in the mitochondrial ribosomal protein S12. We show that the expression of this variant in a human m.1494T cell line reduces its susceptibility to aminoglycosides. Because several mutations in this human protein have been described, they may possibly explain the absence of pathologic phenotype in some pedigree members with the most frequent pathologic mutations in mitochondrial ribosomal RNA. PMID:25642242

  17. Mitochondrial 12S rRNA A827G mutation is involved in the genetic susceptibility to aminoglycoside ototoxicity

    SciTech Connect

    Xing Guangqian; Chen Zhibin; Wei Qinjun; Tian Huiqin; Li Xiaolu; Zhou Aidong; Bu Xingkuan; Cao Xin . E-mail: caoxin@njmu.edu.cn

    2006-08-11

    We have analyzed the clinical and molecular characterization of a Chinese family with aminoglycoside-induced and non-syndromic hearing impairment. Clinical evaluations revealed that only those family members who had a history of exposure to aminoglycoside antibiotics subsequently developed hearing loss, suggesting mitochondrial genome involvement. Sequence analysis of the mitochondrial 12S rRNA and tRNA{sup Ser(UCN)} genes led to the identification of a homoplasmic A827G mutation in all maternal relatives, a mutation that was identified previously in a few sporadic patients and in another Chinese family with non-syndromic deafness. The pathogenicity of the A827G mutation is strongly supported by the occurrence of the same mutation in two independent families and several genetically unrelated subjects. The A827G mutation is located at the A-site of the mitochondrial 12S rRNA gene which is highly conserved in mammals. It is possible that the alteration of the tertiary or quaternary structure of this rRNA by the A827G mutation may lead to mitochondrial dysfunction, thereby playing a role in the pathogenesis of hearing loss and aminoglycoside hypersensitivity. However, incomplete penetrance of hearing impairment indicates that the A827G mutation itself is not sufficient to produce clinical phenotype but requires the involvement of modifier factors for the phenotypic expression. Indeed, aminoglycosides may contribute to the phenotypic manifestation of the A827G mutation in this family. In contrast with the congenital or early-onset hearing impairment in another Chinese family carrying the A827G mutation, three patients in this pedigree developed hearing loss only after use of aminoglycosides. This discrepancy likely reflects the difference of genetic backgrounds, either mitochondrial haplotypes or nuclear modifier genes, between two families.

  18. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  19. Mechanistic Study on the Nuclear Modifier Gene MSS1 Mutation Suppressing Neomycin Sensitivity of the Mitochondrial 15S rRNA C1477G Mutation in Saccharomyces cerevisiae

    PubMed Central

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations. PMID:24595024

  20. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    PubMed

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  1. Allele-specific PCR for detecting the deafness-associated mitochondrial 12S rRNA mutations.

    PubMed

    Ding, Yu; Xia, Bo-Hou; Liu, Qi; Li, Mei-Ya; Huang, Shui-Xian; Zhuo, Guang-Chao

    2016-10-10

    Mutations in mitochondrial 12S rRNA (MT-RNR1) are the important causes of sensorineural hearing loss. Of these mutations, the homoplasmic m.1555A>G or m.1494C>T mutation in the highly conserved A-site of MT-RNR1 gene has been found to be associated with both aminoglycoside-induced and non-syndromic hearing loss in many families worldwide. Since the m.1555A>G and m.1494C>T mutations are sensitive to ototoxic drugs, therefore, screening for the presence of these mutations is important for early diagnosis and prevention of deafness. For this purpose, we recently developed a novel allele-specific PCR (AS-PCR) which is able to simultaneously detect these mutations. To assess its accuracy, in this study, we employed this method to screen the frequency of m.1555A>G and m.1494C>T mutations in 200 deafness patients and 120 healthy subjects. Consequently, four m.1555A>G and four m.1494C>T mutations were identified; among these, only one patient with the m.1494C>T mutation had an obvious family history of hearing loss. Strikingly, clinical evaluation showed that this family exhibited a high penetrance of hearing loss. In particular, the penetrances of hearing loss were 80% with the aminoglycoside included and 20% when excluded. PCR-Sanger sequencing of the mitochondrial genomes confirmed the presence of the m.1494C>T mutation and identified a set of polymorphisms belonging to mitochondrial haplogroup A. However, the lack of functional variants in mitochondrial and nuclear modified genes (GJB2 and TRMU) in this family indicated that mitochondrial haplogroup and nuclear genes may not play important roles in the phenotypic expression of the m.1494C>T mutation. Thus, other modification factors, such as environmental factor, aminoglycosides or epigenetic modification may have contributed to the high penetrance of hearing loss in this family. Taken together, our data showed that this assay is an effective approach that could be used for detection the deafness-associated MT-RNR1

  2. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  3. Properties of small rRNA methyltransferase RsmD: Mutational and kinetic study

    PubMed Central

    Sergeeva, Olga V.; Prokhorova, Irina V.; Ordabaev, Yerdos; Tsvetkov, Philipp O.; Sergiev, Petr V.; Bogdanov, Alexey A.; Makarov, Alexander A.; Dontsova, Olga A.

    2012-01-01

    Ribosomal RNA modification is accomplished by a variety of enzymes acting on all stages of ribosome assembly. Among rRNA methyltransferases of Escherichia coli, RsmD deserves special attention. Despite its minimalistic domain architecture, it is able to recognize a single target nucleotide G966 of the 16S rRNA. RsmD acts late in the assembly process and is able to modify a completely assembled 30S subunit. Here, we show that it possesses superior binding properties toward the unmodified 30S subunit but is unable to bind a 30S subunit modified at G966. RsmD is unusual in its ability to withstand multiple amino acid substitutions of the active site. Such efficiency of RsmD may be useful to complete the modification of a 30S subunit ahead of the 30S subunit’s involvement in translation. PMID:22535590

  4. Genetic analysis of new 16S rRNA mutations conferring aminoglycoside resistance in Mycobacterium abscessus

    PubMed Central

    Nessar, Rachid; Reyrat, Jean Marc; Murray, Alan; Gicquel, Brigitte

    2011-01-01

    Objectives We studied the development and fitness cost of 2-deoxystreptamine aminoglycoside resistance of Mycobacterium abscessus. Methods Spontaneous 2-deoxystreptamine aminoglycoside-resistant mutants were selected and the frequency of their appearance was determined. The 3′ part of the rrs gene was sequenced to characterize mutations. Additionally, we determined the MICs of aminoglycoside drugs for the different mutants obtained. The dominance/recessivity traits of the different mutations were examined and we explored the potential cost conferred by the mutations selected in vitro on the fitness of these isolates compared with the wild-type strain. Results The in vitro mutation rate for 2-deoxystreptamine aminoglycoside resistance was ∼10−7 mutations/cell division. In addition to the known rrs A→G substitution at position 1408 (Escherichia coli numbering), which confers kanamycin resistance (KanR), three new substitutions in rrs were identified in M. abscessus KanR mutants, i.e. T→A at 1406, C→T at 1409 and G→T at 1491. Heterodiploids carrying genomic mutations T→A at 1406 and A→G at 1408 with the wild-type rrs gene carried by the pNBV1 vector showed a resistant phenotype. In contrast, heterodiploids carrying genomic mutations C→T at 1409 and G→T at 1491 with the wild-type rrs gene carried by the pNBV1 vector had a susceptible phenotype. No burden on fitness was observed for the different mutations. Conclusion Mutations in the rrs gene that confer high-level 2-deoxystreptamine aminoglycoside resistance on M. abscessus differ in their dominance/recessivity traits and have no biological cost under our experimental conditions. PMID:21652621

  5. Mutational analysis of the mitochondrial 12S rRNA and tRNA{sup Ser(UCN)} genes in Tunisian patients with nonsyndromic hearing loss

    SciTech Connect

    Mkaouar-Rebai, Emna . E-mail: emna_mkaouar@mail2world.com; Tlili, Abdelaziz; Masmoudi, Saber; Louhichi, Nacim; Charfeddine, Ilhem; Amor, Mohamed Ben; Lahmar, Imed; Driss, Nabil; Drira, Mohamed; Ayadi, Hammadi; Fakhfakh, Faiza

    2006-02-24

    We explored the mitochondrial 12S rRNA and the tRNA{sup Ser(UCN)} genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNA{sup Ser(UCN)} genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNA{sup Ser(UCN)} gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNA{sup Ser(UCN)} genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene.

  6. Mitochondrial tRNAArg T10454C variant may not influence the clinical expression of deafness associated 12S rRNA A1555G mutation.

    PubMed

    Luo, Zhiyi

    2016-01-01

    In this study, we examined the "pathogenic" role of the T10454C mutation in mitochondrial tRNA(Arg) gene in deafness expression as increasing reports provided an active role of this mutation in clinical manifestation of deafness associated 12S rRNA A1555G mutation. For this purpose, we reanalyzed the complete mitochondrial DNA (mtDNA) sequence data containing the T10454C mutation. Moreover, we analyzed the reported "polymorphisms" of mtDNA in the proband using the phylogentic approach. To our surprise, other mutations which occurred at protein-coding genes played more important roles in resulting mitochondrial dysfunctions by using the bioinformatic tool. In addition, evolutionary conservation analysis of the T10454C mutation indicated that this mutation was not conserved between different species. To our knowledge, this is the first report that the T10454C variant may not modulate the phenotypic expression of the deafness associated A1555G mutation.

  7. 16S rRNA Gene Mutations Associated with Decreased Susceptibility to Tetracycline in Mycoplasma bovis

    PubMed Central

    Amram, E.; Mikula, I.; Schnee, C.; Ayling, R. D.; Nicholas, R. A. J.; Rosales, R. S.; Harrus, S.

    2014-01-01

    Mycoplasma bovis isolates with decreased susceptibilities to tetracyclines are increasingly reported worldwide. The acquired molecular mechanisms associated with this phenomenon were investigated in 70 clinical isolates of M. bovis. Sequence analysis of the two 16S rRNA-encoding genes (rrs3 and rrs4 alleles) containing the primary binding pocket for tetracycline (Tet-1 site) was performed on isolates with tetracycline hydrochloride MICs of 0.125 to 16 μg/ml. Mutations at positions A965T, A967T/C (Escherichia coli numbering) of helix 31, U1199C of helix 34, and G1058A/C were identified. Decreased susceptibilities to tetracycline (MICs, ≥2 μg/ml) were associated with mutations present at two (A965 and A967) or three positions (A965, A967, and G1058) of the two rrs alleles. No tet(M), tet(O), or tet(L) determinants were found in the genome of any of the 70 M. bovis isolates. The data presented correlate (P < 0.0001) the mutations identified in the Tet-1 site of clinical isolates of M. bovis with decreased susceptibility to tetracycline. PMID:25403668

  8. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  9. Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

    2013-01-01

    The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

  10. Rapid emergence of resistance to linezolid and mutator phenotypes in Staphylococcus aureus isolates from an adult cystic fibrosis patient.

    PubMed

    Tazi, Asmaa; Chapron, Jeanne; Touak, Gerald; Longo, Magalie; Hubert, Dominique; Collobert, Gislène; Dusser, Daniel; Poyart, Claire; Morand, Philippe C

    2013-10-01

    Linezolid has emerged as an important therapeutic option for the treatment of Staphylococcus aureus in patients with cystic fibrosis. We report the rapid emergence, upon treatment with linezolid, of linezolid-resistant S. aureus clinical isolates through the accumulation of resistance-associated 23S rRNA mutations, together with acquisition of an altered mutator phenotype.

  11. Fitness cost due to mutations in the 16S rRNA associated with spectinomycin resistance in Chlamydia psittaci 6BC.

    PubMed

    Binet, Rachel; Maurelli, Anthony T

    2005-11-01

    The fitness cost of a resistance determinant is the primary parameter that determines its frequency in vivo. As a model for analysis of the impact of drug resistance mutations on the intracellular life cycle of Chlamydia spp., we studied the growth of four genetically defined spectinomycin-resistant (Spc(r)) clonal variants of Chlamydia psittaci 6BC isolated in the plaque assay. The development of each variant was monitored over 46 h postinfection in the absence of drug, either in pure culture or in 1:1 competition with the parent strain. Spc(r) mutations in the 16S rRNA gene at positions 1191 and 1193 were associated with a marked impairment of C.psittaci biological fitness, and the bacteria were severely out-competed by the wild-type parent. In contrast, mutations at position 1192 had minor effects on the bacterial life cycle, allowing the resistant isolates to compete more efficiently with the wild-type strain. Thus, mutations with a wide range of fitness costs can be selected in the plaque assay, providing a new strategy for prediction and monitoring of the emergence of antibiotic resistance in chlamydiae. So far, drug resistance has not been a serious threat for the treatment of chlamydial infections. Tetracycline is an effective antichlamydial drug that targets 16S rRNA. Attempts to isolate spontaneous tetracycline-resistant mutants of C. psittaci 6BC revealed a frequency <3 x 10(-9). We suggest that the rarity of genotypic antibiotic resistance among chlamydial clinical isolates reflects the deleterious effects of such mutations on the fitness of these obligate intracellular bacteria in the host.

  12. Prevalence of the A1555G (12S rRNA) and tRNASer(UCN) mitochondrial mutations in hearing-impaired Brazilian patients.

    PubMed

    Abreu-Silva, R S; Lezirovitz, K; Braga, M C C; Spinelli, M; Pirana, S; Della-Rosa, V A; Otto, P A; Mingroni-Netto, R C

    2006-02-01

    Mitochondrial mutations are responsible for at least 1% of the cases of hereditary deafness, but the contribution of each mutation has not yet been defined in African-derived or native American genetic backgrounds. A total of 203 unselected hearing-impaired patients were screened for the presence of the mitochondrial mutation A1555G in the 12S rRNA gene and mutations in the tRNASer(UCN) gene in order to assess their frequency in the ethnically admixed Brazilian population. We found four individuals with A1555G mutation (2%), which is a frequency similar to those reported for European-derived populations in unselected samples. On the other hand, complete sequencing of the tRNASer(UCN) did not reveal reported pathogenic substitutions, namely A7445G, 7472insC, T7510C, or T7511C. Instead, other rare substitutions were found such as T1291C, A7569G, and G7444A. To evaluate the significance of these findings, 110 "European-Brazilians" and 190 "African-Brazilians" unrelated hearing controls were screened. The T1291C, A7569G and G7444A substitutions were each found in about 1% (2/190) of individuals of African ancestry, suggesting that they are probably polymorphic. Our results indicate that screening for the A1555G mutation is recommended among all Brazilian deaf patients, while testing for mutations in the tRNASer(UCN) gene should be considered only when other frequent deafness-causing mutations have been excluded or in the presence of a maternal transmission pattern.

  13. Correspondence regarding Ballana et al., "Mitochondrial 12S rRNA gene mutations affect RNA secondary structure and lead to variable penetrance in hearing impairment".

    PubMed

    Abreu-Silva, R S; Batissoco, A C; Lezirovitz, K; Romanos, J; Rincon, D; Auricchio, M T B M; Otto, P A; Mingroni-Netto, R C

    2006-05-12

    Ballana et al. [E. Ballana, E. Morales, R. Rabionet, B. Montserrat, M. Ventayol, O. Bravo, P. Gasparini, X. Estivill, Mitochondrial 12S rRNA gene mutations affect RNA secondary structure and lead to variable penetrance in hearing impairment, Biochem. Biophys. Res. Commun. 341 (2006) 950-957] detected a T1291C mutation segregating in a Cuban pedigree with hearing impairment. They interpreted it as probably pathogenic, based on family history, RNA conformation prediction and its absence in a control group of 95 Spanish subjects. We screened a sample of 203 deaf subjects and 300 hearing controls (110 "European-Brazilians" and 190 "African-Brazilians") for the mitochondrial mutations A1555G and T1291C. Five deaf subjects had the T1291C substitution, three isolated cases and two familial cases. In the latter, deafness was paternally inherited or segregated with the A1555G mutation. This doesn't support the hypothesis of T1291C mutation being pathogenic. Two "African-Brazilian" controls also had the T1291C substitution. Six of the seven T1291C-carriers (five deaf and two controls) had mitochondrial DNA of African origin, belonging to macrohaplogroup L1/L2. Therefore, these data point to T1291C substitution as most probably an African non-pathogenic polymorphism.

  14. Extremely low penetrance of deafness associated with the mitochondrial 12S rRNA mutation in 16 Chinese families: Implication for early detection and prevention of deafness

    SciTech Connect

    Dai Pu; Liu Xin; Han Dongyi . E-mail: hdy301@263.net; Qian Yaping; Huang Deliang; Yuan Huijun; Li Weiming; Yu Fei; Zhang Ruining; Lin Hongyan; He Yong; Yu Youjun; Sun Quanzhu; Qin Huaiyi; Li Ronghua; Zhang Xin; Kang Dongyang; Cao Juyang; Young Wieyen . E-mail: ywy301@163.net; Guan Minxin |. E-mail: min-xin.guan@cchmc.org

    2006-02-03

    Mutations in mitochondrial DNA (mtDNA) have been found to be associated with sensorineural hearing loss. We report here the clinical, genetic, and molecular characterization of 16 Chinese pedigrees (a total of 246 matrilineal relatives) with aminoglycoside-induced impairment. Clinical evaluation revealed the variable phenotype of hearing impairment including audiometric configuration in these subjects, although these subjects share some common features: being bilateral and sensorineural hearing impairment. Strikingly, these Chinese pedigrees exhibited extremely low penetrance of hearing loss, ranging from 4% to 18%, with an average of 8%. In particular, nineteen of 246 matrilineal relatives in these pedigrees had aminoglycoside-induced hearing loss. Mutational analysis of the mtDNA in these pedigrees showed the presence of homoplasmic 12S rRNA A1555G mutation, which has been associated with hearing impairment in many families worldwide. The extremely low penetrance of hearing loss in these Chinese families carrying the A1555G mutation strongly supports the notion that the A1555G mutation itself is not sufficient to produce the clinical phenotype. Children carrying the A1555G mutation are susceptible to the exposure of aminoglycosides, thereby inducing or worsening hearing impairment, as in the case of these Chinese families. Using those genetic and molecular approaches, we are able to diagnose whether children carry the ototoxic mtDNA mutation. Therefore, these data have been providing valuable information and technology to predict which individuals are at risk for ototoxicity, to improve the safety of aminoglycoside therapy, and eventually to decrease the incidence of deafness.

  15. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  16. Identification of two Escherichia coli pseudouridine synthases that show multisite specificity for 23S RNA.

    PubMed

    Huang, L; Ku, J; Pookanjanatavip, M; Gu, X; Wang, D; Greene, P J; Santi, D V

    1998-11-10

    Several putative Escherichia coli pseudouridine (Psi) synthases have been identified by iterative searching of genomic databases for ORFs homologous to known Psi synthases [Gustafsson et al. (1996) Nucleic Acids Res. 24, 3756-3762]. Of these, yceC and yfiI were proposed to encode Psi synthases which modify 23S rRNA. In the present work, yceC and yfiI were cloned and overexpressed in E. coli, and the encoded enzymes, YceC and YfiI, were purified to homogeneity. Both proteins converted Urd residues of rRNA to Psi, thus confirming their identities as Psi synthases. However, in in vitro experiments both enzymes extensively modified Urd residues of both 23S rRNA and 16S rRNA. Gene-disruption of yceCresulted in the absence of Psi modification at positions U955, 2504, and 2580 of 23S RNA, thus identifying these sites as in vivo targets for YceC. Likewise, yfiI disruption resulted in the absence of Psi modification at positions U1911, 1917, and possibly 1915 of 23S RNA. Disruption of yceC did not affect the growth under the conditions tested, whereas yfiI-disrupted cells showed a dramatic decrease in growth rate. Since YceC and YfiI hypermodify RNA in vitro, factors in addition to ribonucleotide sequence must contribute to the in vivo specificity of these enzymes.

  17. The presence of highly disruptive 16S rRNA mutations in clinical samples indicates a wider role for mutations of the mitochondrial ribosome in human disease

    PubMed Central

    Elson, Joanna L.; Smith, Paul M.; Greaves, Laura C.; Lightowlers, Robert N.; Chrzanowska-Lightowlers, Zofia M.A.; Taylor, Robert W.; Vila-Sanjurjo, Antón

    2015-01-01

    Mitochondrial DNA mutations are well recognized as an important cause of disease, with over two hundred variants in the protein encoding and mt-tRNA genes associated with human disorders. In contrast, the two genes encoding the mitochondrial rRNAs (mt-rRNAs) have been studied in far less detail. This is because establishing the pathogenicity of mt-rRNA mutations is a major diagnostic challenge. Only two disease causing mutations have been identified at these loci, both mapping to the small subunit (SSU). On the large subunit (LSU), however, the evidence for the presence of pathogenic LSU mt-rRNA changes is particularly sparse. We have previously expanded the list of deleterious SSU mt-rRNA mutations by identifying highly disruptive base changes capable of blocking the activity of the mitoribosomal SSU. To do this, we used a new methodology named heterologous inferential analysis (HIA). The recent arrival of near-atomic-resolution structures of the human mitoribosomal LSU, has enhanced the power of our approach by permitting the analysis of the corresponding sites of mutation within their natural structural context. Here, we have used these tools to determine whether LSU mt-rRNA mutations found in the context of human disease and/or ageing could disrupt the function of the mitoribosomal LSU. Our results clearly show that, much like the for SSU mt-rRNA, LSU mt-rRNAs mutations capable of compromising the function of the mitoribosomal LSU are indeed present in clinical samples. Thus, our work constitutes an important contribution to an emerging view of the mitoribosome as an important element in human health. PMID:26349026

  18. Evaluation of PCR-generated chimeras, mutations, and heteroduplexes with 16S rRNA gene-based cloning.

    PubMed

    Qiu, X; Wu, L; Huang, H; McDonel, P E; Palumbo, A V; Tiedje, J M; Zhou, J

    2001-02-01

    To evaluate PCR-generated artifacts (i.e., chimeras, mutations, and heteroduplexes) with the 16S ribosomal DNA (rDNA)-based cloning approach, a model community of four species was constructed from alpha, beta, and gamma subdivisions of the division Proteobacteria as well as gram-positive bacterium, all of which could be distinguished by HhaI restriction digestion patterns. The overall PCR artifacts were significantly different among the three Taq DNA polymerases examined: 20% for Z-Taq, with the highest processitivity; 15% for LA-Taq, with the highest fidelity and intermediate processitivity; and 7% for the conventionally used DNA polymerase, AmpliTaq. In contrast to the theoretical prediction, the frequency of chimeras for both Z-Taq (8.7%) and LA-Taq (6.2%) was higher than that for AmpliTaq (2.5%). The frequencies of chimeras and of heteroduplexes for Z-Taq were almost three times higher than those of AmpliTaq. The total PCR artifacts increased as PCR cycles and template concentrations increased and decreased as elongation time increased. Generally the frequency of chimeras was lower than that of mutations but higher than that of heteroduplexes. The total PCR artifacts as well as the frequency of heteroduplexes increased as the species diversity increased. PCR artifacts were significantly reduced by using AmpliTaq and fewer PCR cycles (fewer than 20 cycles), and the heteroduplexes could be effectively removed from PCR products prior to cloning by polyacrylamide gel purification or T7 endonuclease I digestion. Based upon these results, an optimal approach is proposed to minimize PCR artifacts in 16S rDNA-based microbial community studies.

  19. Direct Detection of Helicobacter pylori Mutations Associated with Macrolide Resistance in Gastric Biopsy Material Taken from Human Immunodeficiency Virus-Infected Subjects

    PubMed Central

    Scarpellini, Paolo; Carrera, Paola; Cavallero, Annalisa; Cernuschi, Massimo; Mezzi, Gianni; Testoni, Pier Alberto; Zingale, Anna; Lazzarin, Adriano

    2002-01-01

    One hundred forty gastric biopsies were tested by microbiological methods and by amplifying a sequence of 23S rRNA and identifying mutations associated to clarithromycin resistance. Seventy-six specimens were positive for Helicobacter pylori. Mutational analysis revealed alterations in 18 (39.1%) of 46 and 2 (8.7%) of 23 samples from human immunodeficiency virus-seropositive and -seronegative persons, respectively. The results of the mutational analysis fully correlated with those of the susceptibility tests. PMID:12037095

  20. Reconstruction of ancestral 16S rRNA reveals mutation bias in the evolution of optimal growth temperature in the Thermotogae phylum.

    PubMed

    Green, Anna G; Swithers, Kristen S; Gogarten, Jan F; Gogarten, Johann Peter

    2013-11-01

    Optimal growth temperature is a complex trait involving many cellular components, and its physiology is not yet fully understood. Evolution of continuous characters, such as optimal growth temperature, is often modeled as a one-dimensional random walk, but such a model may be an oversimplification given the complex processes underlying the evolution of continuous characters. Recent articles have used ancestral sequence reconstruction to infer the optimal growth temperature of ancient organisms from the guanine and cytosine content of the stem regions of ribosomal RNA, allowing inferences about the evolution of optimal growth temperature. Here, we investigate the optimal growth temperature of the bacterial phylum Thermotogae. Ancestral sequence reconstruction using a nonhomogeneous model was used to reconstruct the stem guanine and cytosine content of 16S rRNA sequences. We compare this sequence reconstruction method with other ancestral character reconstruction methods, and show that sequence reconstruction generates smaller confidence intervals and different ancestral values than other reconstruction methods. Unbiased random walk simulation indicates that the lower temperature members of the Thermotogales have been under directional selection; however, when a simulation is performed that takes possible mutations into account, it is the high temperature lineages that are, in fact, under directional selection. We find that the evolution of Thermotogales optimal growth temperatures is best fit by a biased random walk model. These findings suggest that it may be easier to evolve from a high optimal growth temperature to a lower one than vice versa.

  1. Molecular and clinical characterisation of three Spanish families with maternally inherited non‐syndromic hearing loss caused by the 1494C→T mutation in the mitochondrial 12S rRNA gene

    PubMed Central

    Rodríguez‐Ballesteros, M; Olarte, M; Aguirre, L A; Galán, F; Galán, R; Vallejo, L A; Navas, C; Villamar, M; Moreno‐Pelayo, M A; Moreno, F; del Castillo, I

    2006-01-01

    Mutations in the 12S rRNA gene of the mitochondrial genome are responsible for maternally inherited non‐syndromic hearing loss (NSHL), and for increased susceptibility to the ototoxicity of aminoglycoside antibiotics. Among these mutations, 1555A→G is the most prevalent in all populations tested so far. Recently, the 1494C→T mutation was reported in two large Chinese pedigrees with maternally inherited NSHL. In this study, sequencing of the 12S rRNA gene in a Spanish family with maternally inherited NSHL showed the presence of the 1494C→T mutation. An additional screening of 1339 unrelated Spanish patients with NSHL allowed the authors to find two other families with the mutation. Audiological data were obtained from 17 confirmed 1494C→T carriers, which showed that the hearing loss was sensorineural, bilateral and symmetrical, with a remarkable variability in age of onset and severity. Three carriers were asymptomatic. Three affected carriers had a history of treatment with aminoglycoside antibiotics. The mitochondrial genome of one affected person from each of these three families was entirely sequenced, and it was established that they belong to different mitochondrial haplogroups (H, U5b, U6a). The study results further support the pathogenic role of 1494C→T on hearing, and show that this mutation can be found in different Caucasian mitochondrial DNA backgrounds. PMID:17085680

  2. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    SciTech Connect

    Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin . E-mail: min-xin.guan@chmcc.org

    2006-04-21

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations.

  3. Coexistence of mitochondrial 12S rRNA C1494T and CO1/tRNA{sup Ser(UCN)} G7444A mutations in two Han Chinese pedigrees with aminoglycoside-induced and non-syndromic hearing loss

    SciTech Connect

    Yuan Huijun; Chen Jing; Liu Xin; Cheng Jing; Wang Xinjian; Yang Li; Yang Shuzhi; Cao Juyang; Kang Dongyang; Dai Pu; Zha, Suoqiang; Han Dongyi Young Wieyen Guan Minxin

    2007-10-12

    Mutations in mitochondrial DNA are one of the important causes of hearing loss. We report here the clinical, genetic, and molecular characterization of two Han Chinese pedigrees with maternally transmitted aminoglycoside-induced and nonsyndromic bilateral hearing loss. Clinical evaluation revealed the wide range of severity, age-at-onset, and audiometric configuration of hearing impairment in matrilineal relatives in these families. The penetrances of hearing loss in these pedigrees were 20% and 18%, when aminoglycoside-induced deafness was included. When the effect of aminoglycosides was excluded, the penetrances of hearing loss in these seven pedigrees were 10% and 15%. Sequence analysis of the complete mitochondrial genomes in these pedigrees showed the presence of the deafness-associated 12S rRNA C1494T and CO1/tRNA{sup Ser(UCN)} G7444A mutations. Their distinct sets of mtDNA polymorphism belonged to Eastern Asian haplogroup C4a1, while other previously identified six Chinese mitochondrial genomes harboring the C1494T mutation belong to haplogroups D5a2, D, R, and F1, respectively. This suggested that the C1494T or G7444A mutation occurred sporadically and multiplied through evolution of the mitochondrial DNA (mtDNA). The absence of functionally significant mutations in tRNA and rRNAs or secondary LHON mutations in their mtDNA suggest that these mtDNA haplogroup-specific variants may not play an important role in the phenotypic expression of the 12S rRNA C1494T and CO1/tRNA{sup Ser(UCN)} G7444A mutations in those Chinese families. However, aminoglycosides and other nuclear modifier genes play a modifying role in the phenotypic manifestation of the C1494T mutation in these Chinese families.

  4. In situ probing of gram-positive bacteria with high DNA G + C content using 23S rRNA-targeted oligonucleotides.

    PubMed

    Roller, C; Wagner, M; Amann, R; Ludwig, W; Schleifer, K H

    1994-10-01

    23S-rRNA-targeted oligonucleotide probes were designed for the phylogenetic group 'Gram-positive bacteria with high G + C content of DNA' (GPBHGC). A sequence idiosyncrasy in two adjacent base pairs in the stem of helix 69 in domain IV of the 23S rRNA is present in all hitherto analysed strains of GPBHGC. An oligonucleotide probe targeted to this region hybridized only with strains of GPBHGC and was successfully used for in situ monitoring of these cells in activated sludge. Another unique feature of the 23S rRNA molecules of GPBHGC is a large insertion in domain III. Fluorescent oligonucleotides targeted to the highly variable regions of the rRNA within the insertions of Corynebacterium glutamicum DSM 20300, Aureobacterium testaceum DSM 20166 and Brevibacterium sp. DSM 20165 hybridized specifically to their target strains, whereas probing with oligonucleotides complementary to the rRNA-coding strand of the 23S rDNA and to the spacer between 16S and 23S rRNA of C. glutamicum did not result in detectable fluorescence. This confirmed that the large 23S insertions are indeed present in 23S rRNAs of GPBHGC and provide potential target sites for highly specific nucleic acid probes.

  5. The coexistence of mitochondrial ND6 T14484C and 12S rRNA A1555G mutations in a Chinese family with Leber's hereditary optic neuropathy and hearing loss

    SciTech Connect

    Wei Qiping; Zhou Xiangtian; Yang Li; Sun Yanhong; Zhou Jian; Li Guang; Jiang, Robert; Lu Fan; Qu Jia . E-mail: jqu@wzmc.net; Guan Minxin . E-mail: min-xin.guan@cchmc.org

    2007-06-15

    We report here the clinical, genetic and molecular characterization of one three-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON) and hearing loss. Four of 14 matrilineal relatives exhibited the moderate central vision loss at the average age of 12.5 years. Of these, one subject exhibited both LHON and mild hearing impairment. Sequence analysis of the complete mitochondrial genomes in the pedigree showed the presence of homoplasmic LHON-associated ND6 T14484C mutation, deafness-associated 12S rRNA A1555 mutation and 47 other variants belonging to Eastern Asian haplogroup H2. None of other mitochondrial variants was evolutionarily conserved and functional significance. Therefore, the coexistence of the A1555G mutation and T14484C mutations in this Chinese family indicate that the A1555G mutation may play a synergistic role in the phenotypic manifestation of LHON associated ND6 T14484C mutation. However, the incomplete penetrance of vision and hearing loss suggests the involvement of nuclear modifier genes and environmental factors in the phenotypic expression of these mtDNA mutations.

  6. Clinical and molecular analysis of a four-generation Chinese family with aminoglycoside-induced and nonsyndromic hearing loss associated with the mitochondrial 12S rRNA C1494T mutation

    SciTech Connect

    Wang Qiuju; Li Qingzhong; Han Dongyi . E-mail: hdy301@263.net; Zhao Yali; Zhao Lidong; Qian Yaping; Yuan Hu; Li Ronghua; Zhai Suoqiang; Young Wieyen . E-mail: ywy301@263.net; Guan Minxin . E-mail: min-xin.guan@chmcc.org

    2006-02-10

    We report here the clinical, genetic, and molecular characterization of a four-generation Chinese family with aminoglycoside-induced and nonsyndromic hearing loss. Five of nine matrilineal relatives had aminoglycoside-induced hearing loss. These matrilineal relatives exhibited variable severity and audiometric configuration of hearing impairment, despite sharing some common features: being bilateral and having sensorineural hearing impairment. Sequence analysis of mitochondrial DNA (mtDNA) in the pedigree identified 16 variants and the homoplasmic 12S rRNA C1494T mutation, which was associated with hearing loss in the other large Chinese family. In fact, the occurrence of the C1494T mutation in these genetically unrelated pedigrees affected by hearing impairment strongly indicated that this mutation is involved in the pathogenesis of aminoglycoside-induced and nonsyndromic hearing loss. However, incomplete penetrance of hearing loss indicated that the C1494T mutation itself is not sufficient to produce a clinical phenotype but requires the involvement of modifier factors for the phenotypic expression. Those mtDNA variants, showing no evolutional conservation, may not have a potential modifying role in the pathogenesis of the C1494T mutation. However, nuclear background seems to contribute to the phenotypic variability of matrilineal relatives in this family. Furthermore, aminoglycosides modulate the expressivity and penetrance of deafness associated with the C1494T mutation in this family.

  7. Cloning, in vitro transcription, and biological activity of Escherichia coli 23S ribosomal RNA.

    PubMed

    Weitzmann, C J; Cunningham, P R; Ofengand, J

    1990-06-25

    The 23S rRNA gene was excised from the rrnB operon of pKK3535 and ligated into pUC19 behind the strong class III T7 promoter so that the correct 5' end of mature 23S RNA was produced upon transcription by T7 RNA polymerase. At the 3' end, generation of a restriction site for linearization required the addition of 2 adenosine residues to the mature 23S sequence. In vitro runoff transcripts were indistinguishable from natural 23S RNA in size on denaturing gels and in 5'-terminal sequence. The length and sequence of the 3' terminal T1 fragment was also as expected from the DNA sequence, except that an additional C, A, or U residue was added to 21%, 18%, or 5% of the molecules, respectively. Typical transcription reactions yielded 500-700 moles RNA per mole template. This transcript was used as a substrate for methyl transfer from S-adenosyl methionine catalyzed by Escherichia coli cell extracts. The majority (50-65%) of activity observed in a crude (S30) extract appeared in the post-ribosomal supernatant (S100). Activities catalyzing formation of m5C, m5U, m2G, and m6A residues in the synthetic transcript were observed. PMID:2194163

  8. MRPS18CP2 alleles and DEFA3 absence as putative chromosome 8p23.1 modifiers of hearing loss due to mtDNA mutation A1555G in the 12S rRNA gene

    PubMed Central

    Ballana, Ester; Mercader, Josep Maria; Fischel-Ghodsian, Nathan; Estivill, Xavier

    2007-01-01

    Background Mitochondrial DNA (mtDNA) mutations account for at least 5% of cases of postlingual, nonsyndromic hearing impairment. Among them, mutation A1555G is frequently found associated with aminoglycoside-induced and/or nonsyndromic hearing loss in families presenting with extremely variable clinical phenotypes. Biochemical and genetic data have suggested that nuclear background is the main factor involved in modulating the phenotypic expression of mutation A1555G. However, although a major nuclear modifying locus was located on chromosome 8p23.1 and regardless intensive screening of the region, the gene involved has not been identified. Methods With the aim to gain insights into the factors that determine the phenotypic expression of A1555G mutation, we have analysed in detail different genetic and genomic elements on 8p23.1 region (DEFA3 gene absence, CLDN23 gene and MRPS18CP2 pseudogene) in a group of 213 A1555G carriers. Results Family based association studies identified a positive association for a polymorphism on MRPS18CP2 and an overrepresentation of DEFA3 gene absence in the deaf group of A1555G carriers. Conclusion Although none of the factors analysed seem to have a major contribution to the phenotype, our findings provide further evidences of the involvement of 8p23.1 region as a modifying locus for A1555G 12S rRNA gene mutation. PMID:18154640

  9. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    PubMed

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  10. A second function for pseudouridine synthases: A point mutant of RluD unable to form pseudouridines 1911, 1915, and 1917 in Escherichia coli 23S ribosomal RNA restores normal growth to an RluD-minus strain.

    PubMed

    Gutgsell, N S; Del Campo, M; Raychaudhuri, S; Ofengand, J

    2001-07-01

    This laboratory previously showed that truncation of the gene for RluD, the Escherichia coli pseudouridine synthase responsible for synthesis of 23S rRNA pseudouridines 1911, 1915, and 1917, blocks pseudouridine formation and inhibits growth. We now show that RluD mutants at the essential aspartate 139 allow these two functions of RluD to be separated. In vitro, RluD with aspartate 139 replaced by threonine or asparagine is completely inactive. In vivo, the growth defect could be completely restored by transformation of an RluD-inactive strain with plasmids carrying genes for RluD with aspartate 139 replaced by threonine or asparagine. Pseudouridine sequencing of the 23S rRNA from these transformed strains demonstrated the lack of these pseudouridines. Pseudoreversion, which has previously been shown to restore growth without pseudouridine formation by mutation at a distant position on the chromosome, was not responsible because transformation with empty vector under identical conditions did not alter the growth rate.

  11. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    PubMed

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions.

  12. Epistasis analysis of 16S rRNA ram mutations helps define the conformational dynamics of the ribosome that influence decoding.

    PubMed

    Ying, Lanqing; Fredrick, Kurt

    2016-04-01

    The ribosome actively participates in decoding, with a tRNA-dependent rearrangement of the 30S A site playing a key role. Ribosomal ambiguity (ram) mutations have mapped not only to the A site but also to the h12/S4/S5 region and intersubunit bridge B8, implicating other conformational changes such as 30S shoulder rotation and B8 disruption in the mechanism of decoding. Recent crystallographic data have revealed that mutation G299A in helix h12 allosterically promotes B8 disruption, raising the question of whether G299A and/or other ram mutations act mainly via B8. Here, we compared the effects of each of several ram mutations in the absence and presence of mutation h8Δ2, which effectively takes out bridge B8. The data obtained suggest that a subset of mutations including G299A act in part via B8 but predominantly through another mechanism. We also found that G299A in h12 and G347U in h14 each stabilize tRNA in the A site. Collectively, these data support a model in which rearrangement of the 30S A site, inward shoulder rotation, and bridge B8 disruption are loosely coupled events, all of which promote progression along the productive pathway toward peptide bond formation.

  13. Mutation of EMG1 causing Bowen-Conradi syndrome results in reduced cell proliferation rates concomitant with G2/M arrest and 18S rRNA processing delay.

    PubMed

    Armistead, Joy; Hemming, Richard; Patel, Nehal; Triggs-Raine, Barbara

    2014-06-01

    Bowen-Conradi syndrome (BCS) is a lethal autosomal recessive disorder caused by a D86G substitution in the protein, Essential for Mitotic Growth 1 (EMG1). EMG1 is essential for 18S rRNA maturation and 40S ribosome biogenesis in yeast, but no studies of its role in ribosome biogenesis have been done in mammals. To assess the effect of the EMG1 mutation on cell growth and ribosomal biogenesis in humans, we employed BCS patient cells. The D86G substitution did not interfere with EMG1 nucleolar localization. In BCS patient lymphoblasts, cells accumulated in G2/M, resulting in reduced proliferation rates; however, patient fibroblasts showed normal proliferation. The rate of 18S rRNA processing was consistently delayed in patient cells, although this did not lead to a difference in the levels of 40S ribosomes, or a change in protein synthesis rates. These results demonstrate that as in yeast, EMG1 in mammals has a role in ribosome biogenesis. The obvious phenotype in lymphoblasts compared to fibroblasts suggests a greater need for EMG1 in rapidly dividing cells. Tissue-specific effects have been seen in other ribosomal biogenesis disorders, and it seems likely that the impact of EMG1 deficiency would be larger in the rapidly proliferating cells of the developing embryo.

  14. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates

    PubMed Central

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-01-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  15. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates.

    PubMed

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Chujo, Takeshi; Ishigami, Yuma; Chemla, Yonatan; Blumberg, Amit; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-09-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  16. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA.

    PubMed

    Mundus, Julie; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2499 reported. Using homology search, we identified the open reading frame DR_0049 as the primary candidate gene for the methyltransferase that modifies cytidine 2499. Mass spectrometric analysis demonstrated that recombinantly expressed DR0049 protein methylates E. coli cytidine 2499 both in vitro and in vivo. We also inactivated the DR_0049 gene in D. radiodurans through insertion of a chloramphenicol resistance cassette. This resulted in complete absence of the cytidine 2499 methylation, which all together demonstrates that DR_0049 encodes the methyltransferase producing m(5)C2499 in D. radiodurans 23S rRNA. Growth experiments disclosed that inactivation of DR_0049 is associated with a severe growth defect, but available ribosome structures show that cytidine 2499 is positioned very similar in D. radiodurans harbouring the modification and E. coli without the modification. Hence there is no obvious structure-based explanation for the requirement for the C2499 posttranscriptional modification in D. radiodurans.

  17. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  18. Measurement of the helium 23S metastable atom density by observation of the change in the 23S-23P emission line shape due to radiation reabsorption

    NASA Astrophysics Data System (ADS)

    Shikama, T.; Ogane, S.; Iida, Y.; Hasuo, M.

    2016-01-01

    In helium discharge plasmas, the relative emission intensities of the fine-structure transitions belonging to the HeI 23S-23P transition can be affected by radiation reabsorption. Since the magnitude of the reabsorption depends on the density and temperature of the 23S metastable atoms, their density can be determined by measuring the 23S-23P emission line shape using a high wavelength-resolution spectrometer. In this study, the applicable conditions of the method in terms of the opacity and line broadening are revealed, and possible causes of errors in the measurement, i.e. spatial distributions of the density and temperature and the effects of external magnetic and electric fields, are investigated. The effect of reabsorption under an external magnetic field is experimentally confirmed using a glow discharge plasma installed in a superconducting magnet.

  19. Restriction Profiling of 23S Microheterogenic Ribosomal Repeats for Detection and Characterizing of E. coli and Their Clonal, Pathogenic, and Phylogroups

    PubMed Central

    Jayasree Rajagopalan Nair, Parvathi

    2015-01-01

    Correlating ribosomal microheterogenicity with unique restriction profiles can prove to be an efficacious and cost-effective approach compared with sequencing for microbial identification. An attempt to peruse restriction profiling of 23S ribosomal assemblage was ventured; digestion patterns with Bfa I discriminated E. coli from its colony morphovars, while Hae III profiles assisted in establishing distinct clonal groups. Among the gene pool of 399 ribosomal sequences extrapolated from 57 E. coli genomes, varying degree of predominance (I > III > IV > II) of Hae III pattern was observed. This was also corroborated in samples collected from clinical, commensal, and environmental origin. K-12 and its descendants showed type I pattern whereas E. coli-B and its descendants exhibited type IV, both of these patterns being exclusively present in E. coli. A near-possible association between phylogroups and Hae III profiles with presumable correlation between the clonal groups and different pathovars was established. The generic nature, conservation, and barcode gap of 23S rRNA gene make it an ideal choice and substitute to 16S rRNA gene, the most preferred region for molecular diagnostics in bacteria. PMID:26885397

  20. Restriction Profiling of 23S Microheterogenic Ribosomal Repeats for Detection and Characterizing of E. coli and Their Clonal, Pathogenic, and Phylogroups.

    PubMed

    Jayasree Rajagopalan Nair, Parvathi; Singh, Sunita

    2015-01-01

    Correlating ribosomal microheterogenicity with unique restriction profiles can prove to be an efficacious and cost-effective approach compared with sequencing for microbial identification. An attempt to peruse restriction profiling of 23S ribosomal assemblage was ventured; digestion patterns with Bfa I discriminated E. coli from its colony morphovars, while Hae III profiles assisted in establishing distinct clonal groups. Among the gene pool of 399 ribosomal sequences extrapolated from 57 E. coli genomes, varying degree of predominance (I > III > IV > II) of Hae III pattern was observed. This was also corroborated in samples collected from clinical, commensal, and environmental origin. K-12 and its descendants showed type I pattern whereas E. coli-B and its descendants exhibited type IV, both of these patterns being exclusively present in E. coli. A near-possible association between phylogroups and Hae III profiles with presumable correlation between the clonal groups and different pathovars was established. The generic nature, conservation, and barcode gap of 23S rRNA gene make it an ideal choice and substitute to 16S rRNA gene, the most preferred region for molecular diagnostics in bacteria. PMID:26885397

  1. Functional analysis of the residues C770 and G771 of E. coli 16S rRNA implicated in forming the intersubunit bridge B2c of the ribosome.

    PubMed

    Kim, Hong-Man; Yeom, Ji-Hyun; Ha, Hye-Jung; Kim, Jong-Myung; Lee, Kangseok

    2007-07-01

    Structural analyses have shown that nucleotides at the positions 770 and 771 of Escherichia coli 16S rRNA are implicated in forming one of highly conserved intersubunit bridges of the ribosome, B2c. To examine a functional role of these residues, base substitutions were introduced at these positions and mutant ribosomes were analyzed for their protein synthesis ability using a specialized ribosome system. The results showed requirement of a pyrimidine at the position 770 for ribosome function regardless of the nucleotide identity at the position 771. Sucrose gradient profiles of ribosomes revealed that the loss of protein-synthesis ability of mutant ribosome bearing a base substitution from C to G at the position 770 stems from its inability to form 70S ribosomes. These findings indicate involvement of nucleotide at the position 770, not 771, in ribosomal subunit association and provide a useful rRNA mutation that can be used as a target to investigate the physical interaction between 16S and 23S rRNA.

  2. Synthesis of 22S,23S-brassinosteroids based on stigmasterol

    SciTech Connect

    Akhrem, A.A.; Lakhvich, F.A.; Khripach, V.A.; Kovganko, N.V.; Zhabinskii, V.N.

    1987-09-10

    The analogs of 29C-brassinosteroids based on stigmasterol, i.e., 22S,23S-homo-castasterone and 22S,23S-homobrassinolide, were synthesized. Electrophilic additions at the ..delta../sup 22/-bond, hydroxylation with osmium tetroxide, and epoxidation followed by conversion of the epoxide into the diol were used for the construction of the 22S,23S-diol grouping. The PMR spectra of 5% solutions in deuterochloroform were obtained on JNM-PS-100 and WM-360 instruments at 100 and 360 MHz respectively with TMS as internal standard.

  3. Organization, structure, and variability of the rRNA operon of the Whipple's disease bacterium (Tropheryma whippelii).

    PubMed

    Maiwald, M; von Herbay, A; Lepp, P W; Relman, D A

    2000-06-01

    Whipple's disease is a systemic disorder associated with a cultivation-resistant, poorly characterized actinomycete, Tropheryma whippelii. We determined a nearly complete rRNA operon sequence of T. whippelii from specimens from 3 patients with Whipple's disease, as well as partial operon sequences from 43 patients. Variability was observed in the 16S-23S rRNA spacer sequences, leading to the description of five distinct sequence types. One specimen contained two spacer sequence types, raising the possibility of a double infection. Secondary structure models for the primary rRNA transcript and mature rRNAs revealed rare or unique features.

  4. Detection of new mutations conferring resistance to linezolid in glycopeptide-intermediate susceptibility Staphylococcus hominis subspecies hominis circulating in an intensive care unit.

    PubMed

    Sorlozano, A; Gutierrez, J; Martinez, T; Yuste, M E; Perez-Lopez, J A; Vindel, A; Guillen, J; Boquete, T

    2010-01-01

    Glycopeptides and linezolid are the most widely used antibiotics to treat infections by methicillin-resistant Staphylococcus spp. We report the presence of various isolates of methicillin-resistant S. hominis subsp. hominis with resistance to linezolid and reduced susceptibility to glycopeptides. We studied ten blood culture isolates of S. hominis subsp. hominis from nine patients admitted to our hospital. Etest was used to study susceptibility to antibiotics commonly prescribed against staphylococci. Domain V region of the 23S rRNA gene was amplified and sequenced to detect possible mutations that confer resistance to linezolid. Pulsed-field gel electrophoresis (PFGE) was used for the clonality study of isolates. All isolates were resistant to oxacillin, gentamicin, levofloxacin, cotrimoxazole, and linezolid, and susceptible to tigecycline and daptomycin. Nine of the isolates were resistant to erythromycin and clindamycin, and showed heterogeneous resistance to glycopeptides. C2190T, G2603T, and G2474T mutations were detected in domain V of the 23S rRNA gene. PFGE showed the presence of two different clones. This report alerts to the possible appearance of clinical strains of methicillin-resistant staphylococci with intermediate resistance to glycopeptides, resistance to linezolid, and multiple resistance to other second-line antibiotics.

  5. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.

    PubMed

    Stelzl, U; Spahn, C M; Nierhaus, K H

    2000-04-25

    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  6. Identification of aquatic Burkholderia (Pseudomonas) cepacia by hybridization with species-specific rRNA gene probes

    SciTech Connect

    Leff, L.G.; Kernan, R.M.; McArthur, J.V.

    1995-04-01

    Burkholderia (Pseudomonas) cepacia is a common environmental bacterium which can be pathogenic for plants and humans. In this study, four strategies were used to identify aquatic isolates: API test strips, hybridization with species-specific DNA probes for the 16S and 23S rRNA genes, fatty acid methyl ester (FAME) profiles, and growth on selective medium (TB-T agar [C. Hagedorn, W.D. Gould, T.R. Bardinelli, and D.R. Gustarson, Appl. Environ. Microbiol. 53:2265-2268, 1987]). Only 59% of the isolates identified as B. cepacia with the API test strips were confirmed as B. cepacia by using fatty acids profiles. The 23S rRNA probe generated a few false-positive results but dramatically underestimated the number of B. cepacia isolates (i.e., 40% of the colonies that did not hybridize to the probe were B. cepacia, as determined by FAME). The 16S rRNA probe generated more false-positive results than the 23S rRNA probe but was effective in identifying the majority of the B. cepacia isolates. The selective medium was only partially successful in recovering B. cepacia. Use of the B. cepacia-specific 16S rRNA probe was the most efficient and accurate way of identifying B. cepacia. 13 refs., 1 fig., 2 tabs.

  7. Mutations in the Bacterial Ribosomal Protein L3 and Their Association with Antibiotic Resistance

    PubMed Central

    Klitgaard, Rasmus N.; Ntokou, Eleni; Nørgaard, Katrine; Biltoft, Daniel; Hansen, Lykke H.; Trædholm, Nicolai M.; Kongsted, Jacob

    2015-01-01

    Different groups of antibiotics bind to the peptidyl transferase center (PTC) in the large subunit of the bacterial ribosome. Resistance to these groups of antibiotics has often been linked with mutations or methylations of the 23S rRNA. In recent years, there has been a rise in the number of studies where mutations have been found in the ribosomal protein L3 in bacterial strains resistant to PTC-targeting antibiotics but there is often no evidence that these mutations actually confer antibiotic resistance. In this study, a plasmid exchange system was used to replace plasmid-carried wild-type genes with mutated L3 genes in a chromosomal L3 deletion strain. In this way, the essential L3 gene is available for the bacteria while allowing replacement of the wild type with mutated L3 genes. This enables investigation of the effect of single mutations in Escherichia coli without a wild-type L3 background. Ten plasmid-carried mutated L3 genes were constructed, and their effect on growth and antibiotic susceptibility was investigated. Additionally, computational modeling of the impact of L3 mutations in E. coli was used to assess changes in 50S structure and antibiotic binding. All mutations are placed in the loops of L3 near the PTC. Growth data show that 9 of the 10 mutations were well accepted in E. coli, although some of them came with a fitness cost. Only one of the mutants exhibited reduced susceptibility to linezolid, while five exhibited reduced susceptibility to tiamulin. PMID:25845869

  8. Quantitative Analysis of rRNA Modifications Using Stable Isotope Labeling and Mass Spectrometry

    PubMed Central

    2015-01-01

    Post-transcriptional RNA modifications that are introduced during the multistep ribosome biogenesis process are essential for protein synthesis. The current lack of a comprehensive method for a fast quantitative analysis of rRNA modifications significantly limits our understanding of how individual modification steps are coordinated during biogenesis inside the cell. Here, an LC-MS approach has been developed and successfully applied for quantitative monitoring of 29 out of 36 modified residues in the 16S and 23S rRNA from Escherichia coli. An isotope labeling strategy is described for efficient identification of ribose and base methylations, and a novel metabolic labeling approach is presented to allow identification of MS-silent pseudouridine modifications. The method was used to measure relative abundances of modified residues in incomplete ribosomal subunits compared to a mature 15N-labeled rRNA standard, and a number of modifications in both 16S and 23S rRNA were present in substoichiometric amounts in the preribosomal particles. The RNA modification levels correlate well with previously obtained profiles for the ribosomal proteins, suggesting that RNA is modified in a schedule comparable to the association of the ribosomal proteins. Importantly, this study establishes an efficient workflow for a global monitoring of ribosomal modifications that will contribute to a better understanding of mechanisms of RNA modifications and their impact on intracellular processes in the future. PMID:24422502

  9. Comparison of sequence differences in a variable 23S rRNA domain among sets of cryptic species of ciliated protozoa.

    PubMed

    Nanney, D L; Park, C; Preparata, R; Simon, E M

    1998-01-01

    Studies were undertaken to discover the relative molecular distances separating some familiar forms of ciliated protozoa, and the genetic species they include. Sequences of 190 bases of the D2 domain of the large ribosomal nucleic acid molecule were obtained by polymerase chain reaction from protists of three distinctive groups of ciliated protozoa-Colpoda, Paramecium and Tetrahymena. Evolutionary trees were constructed for each set of sequences using the PHYLOGEN 1.0 string programs. All three groups of ciliates manifested large molecular diversity among strains difficult or impossible to distinguish morphologically. The largest single evolutionary distance within a group was the 75 differences separating Tetrahymena paravorax from the other tetrahymenids. The largest mean distance for a group was the 21.2 for the colpodids. In all the protist groups the large molecular diversity is obscured by morphological conservatism associated with constraints of ancient designs. The molecular diversity within morphotypes argues for long evolutionary coexistence of species differentiated from each other in significant physiological, ecological, or nutritional ways.

  10. Mutations Outside the Anisomycin-Binding Site Can Make Ribosomes Drug-Resistant

    SciTech Connect

    Blaha,G.; Gurel, G.; Schroeder, S.; Moore, P.; Steitz, T.

    2008-01-01

    Eleven mutations that make Haloarcula marismortui resistant to anisomycin, an antibiotic that competes with the amino acid side chains of aminoacyl tRNAs for binding to the A-site cleft of the large ribosomal unit, have been identified in 23S rRNA. The correlation observed between the sensitivity of H. marismortui to anisomycin and the affinity of its large ribosomal subunits for the drug indicates that its response to anisomycin is determined primarily by the binding of the drug to its large ribosomal subunit. The structures of large ribosomal subunits containing resistance mutations show that these mutations can be divided into two classes: (1) those that interfere with specific drug-ribosome interactions and (2) those that stabilize the apo conformation of the A-site cleft of the ribosome relative to its drug-bound conformation. The conformational effects of some mutations of the second kind propagate through the ribosome for considerable distances and are reversed when A-site substrates bind to the ribosome.

  11. High rate of A2142G point mutation associated with clarithromycin resistance among Iranian Helicobacter pylori clinical isolates.

    PubMed

    Khashei, Reza; Dara, Mahintaj; Bazargani, Abdollah; Bagheri Lankarani, Kamran; Taghavi, Alireza; Moeini, Maryam; Dehghani, Behzad; Sohrabi, Maryam

    2016-09-01

    This study aimed to investigate the clarithromycin resistance and its associated molecular mechanisms among Helicobacter pylori isolates from dyspeptic patients in Shiraz, Iran. From January to May 2014, 100 H. pylori strains were isolated from patients with gastroduodenal disorders. The resistance to clarithromycin was quantitatively evaluated, using Epsilometer (E-test) method. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was performed on all the isolates to detect A2143G and A2142G mutations in 23S rRNA gene. The H. pylori isolation rate was found to be 31.4%. E-test showed that 20% of isolates were resistant to clarithromycin (MIC ≥ 1 mg/L). MIC of clarithromycin ranged between 0.016 and 24 mg/L. Findings of PCR-RFLP showed that the A2142G was the most (90%) frequently point mutation, followed by the A2143G (10%). No statistically significant difference was found between H. pylori clarithromycin resistance point mutations and patients' gender or age. To the best of our knowledge, this is the first report of high frequency of A2142G point mutation in Iran and probably in other regions of the world. Considering the increasing trend of H. pylori resistance to clarithromycin due to these mutations, it is crucial to investigate the new therapeutic approaches against H. pylori infection. PMID:27357065

  12. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  13. Initiation factor IF 2 binds to the alpha-sarcin loop and helix 89 of Escherichia coli 23S ribosomal RNA.

    PubMed Central

    La Teana, A; Gualerzi, C O; Dahlberg, A E

    2001-01-01

    During initiation of protein synthesis in bacteria, translation initiation factor IF2 is responsible for the recognition of the initiator tRNA (fMet-tRNA). To perform this function, IF2 binds to the ribosome interacting with both 30S and 50S ribosomal subunits. Here we report the topographical localization of translation initiation factor IF2 on the 70S ribosome determined by base-specific chemical probing. Our results indicate that IF2 specifically protects from chemical modification two sites in domain V of 23S rRNA, namely A2476 and A2478, and residues around position 2660 in domain VI, the so-called sarcin-ricin loop. These footprints are generated by IF2 regardless of the presence of fMet-tRNA, GTP, mRNA, and IF1. IF2 causes no specific protection of 16S rRNA. We observe a decreased reactivity of residues A1418 and A1483, which is an indication that the initiation factor has a tightening effect on the association of ribosomal subunits. This result, confirmed by sucrose density gradient analysis, seems to be a universally conserved property of IF2. PMID:11497435

  14. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  15. Determination of the nucleotide sequence of the 23S ribosomal RNA and flanking spacers of an Enterococcus faecium strain, reveals insertion-deletion events in the ribosomal spacer 1 of enterococci.

    PubMed

    Naimi, A; Beck, G; Monique, M; Lefèbvre, G; Branlanti, C

    1999-02-01

    The usefulness of 16S-23S (ITS1) and 23S-5S (ITS2) ribosomal spacer nucleotide sequence determination, as a complementary approach to the biochemical tests traditionally used for enterococcal species identification, is shown by its application to the identification of a strain, E27, isolated from a natural bacteria mixture used for cheese production. Using combined approaches we showed, unambiguously, that strain E27 belongs to the Enterococcus faecium species. However, its ITS1 region has an interesting peculiarity. In our previous study of ITS1s from various enterococcal species (NAIMI et al., 1997, Microbiology 143, 823-834), the ITS1s of the two E. faecium strains studied, were found to contain an additional 115-nt long stem-loop structure as compared to the ITS1s of other enterococci, only one out of the 3 ITS1s of E. hirae ATCC 9790, was found to contain a similar 107-nt long stem-loop structure. The ITS1 of strain E27 is 100% identical to that of E. faecium ATCC 19434T, except that the 115-nt additional fragment is absent. This strongly suggests the existence of lateral DNA transfer or DNA recombination events at a hot spot position of the ITS1s from E. faecium and E. hirae. Small and large ITS1 nucleotide sequence determination for strain E27 generalized the notion of two kinds of ITSs in enterococci: one with a tRNA(Ala) gene, one without tRNA gene. To complete strain E27 characterization, its 23S rRNA sequence was established. This is the first complete 23S rRNA nucleotide sequence determined for an enterococcal species.

  16. Regarding the Charmed-Strange Member of the 23S1 Meson State

    PubMed Central

    Feng, Xue-Chao; Chen, Jing

    2013-01-01

    By employing the mass relations derived from the mass matrix and Regge trajectory, we investigate the masses of charmed and charmed-strange members of the 23S1 meson. The masses are compared with the values predicted by other theoretical approaches and experimental data. The results may be useful for the discovery of the unobserved meson and the determination of the quantum number of the newly discovered states. PMID:24250272

  17. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  18. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.

    PubMed

    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C

    2002-05-01

    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  19. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    PubMed

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  20. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  1. Peptide inhibitors of peptidyltransferase alter the conformation of domains IV and V of large subunit rRNA: a model for nascent peptide control of translation.

    PubMed Central

    Harrod, R; Lovett, P S

    1995-01-01

    Peptides of 5 and 8 residues encoded by the leaders of attenuation regulated chloramphenicol-resistance genes inhibit the peptidyltransferase of microorganisms from the three kingdoms. Therefore, the ribosomal target for the peptides is likely to be a conserved structure and/or sequence. The inhibitor peptides "footprint" to nucleotides of domain V in large subunit rRNA when peptide-ribosome complexes are probed with dimethyl sulfate. Accordingly, rRNA was examined as a candidate for the site of peptide binding. Inhibitor peptides MVKTD and MSTSKNAD were mixed with rRNA phenol-extracted from Escherichia coli ribosomes. The conformation of the RNA was then probed by limited digestion with nucleases that cleave at single-stranded (T1 endonuclease) and double-stranded (V1 endonuclease) sites. Both peptides selectively altered the susceptibility of domains IV and V of 23S rRNA to digestion by T1 endonuclease. Peptide effects on cleavage by V1 nuclease were observed only in domain V. The T1 nuclease susceptibility of domain V of in vitro-transcribed 23S rRNA was also altered by the peptides, demonstrating that peptide binding to the rRNA is independent of ribosomal protein. We propose the peptides MVKTD and MSTSKNAD perturb peptidyltransferase center catalytic activities by altering the conformation of domains IV and V of 23S rRNA. These findings provide a general mechanism through which nascent peptides may cis-regulate the catalytic activities of translating ribosomes. Images Fig. 1 Fig. 2 Fig. 4 PMID:7567991

  2. Mutational analysis of basic residues in the N-terminus of the rRNA:m6A methyltransferase ErmC'.

    PubMed

    Maravić, G; Bujnicki, J M; Flögel, M

    2004-01-01

    Erm methyltransferases mediate the resistance to the macrolide-lincosamide-streptogramin B antibiotics via dimethylation of a specific adenine residue in 23S rRNA. The role of positively charged N-terminal residues of the ErmC' methyltransferase in RNA binding and/or catalysis was determined. Mutational analysis of amino acids K4 and K7 was performed and the mutants were characterized in in vivo and in vitro experiments. The K4 and K7 residues were suggested not to be essential for the enzyme activity but to provide a considerable support for the catalytic step of the reaction, probably by maintaining the optimum conformation of the transition state through interactions with the phosphate backbone of RNA. PMID:15114858

  3. Mutational analysis of basic residues in the N-terminus of the rRNA:m6A methyltransferase ErmC'.

    PubMed

    Maravić, G; Bujnicki, J M; Flögel, M

    2004-01-01

    Erm methyltransferases mediate the resistance to the macrolide-lincosamide-streptogramin B antibiotics via dimethylation of a specific adenine residue in 23S rRNA. The role of positively charged N-terminal residues of the ErmC' methyltransferase in RNA binding and/or catalysis was determined. Mutational analysis of amino acids K4 and K7 was performed and the mutants were characterized in in vivo and in vitro experiments. The K4 and K7 residues were suggested not to be essential for the enzyme activity but to provide a considerable support for the catalytic step of the reaction, probably by maintaining the optimum conformation of the transition state through interactions with the phosphate backbone of RNA.

  4. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  5. Inter- and intraspecific genomic variability of the 16S-23S intergenic spacer regions (ISR) in representatives of Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans.

    PubMed

    Ni, Yong-Qing; Yang, Yuan; Bao, Jing-Ting; He, Kai-Yu; Li, Hong-Yu

    2007-05-01

    The complete sequences of 32 intergenic spacer regions (ISR) from Acidithiobacillus strains, including 29 field strains isolated from coal, copper, molybdenum mine wastes or sediment of different geoclimatic regions in China, reference strain ATCC19859 and the type strains of the two species were determined. These data, together with other sequences available in the GenBank database, were used to carry out the first detailed assessment of the inter- and intraspecific genomic variability of the ISR sequences and to infer phylogenetic relationships within the genus. The total length of the 16S-23S rRNA intergenic spacer regions of the Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans strains ranged from 451 to 490 bp, and from 434 to 456 bp, respectively. The degree of intrageneric ISR sequence similarity was higher than the degree of intergeneric similarity, and the overall similarity values of the ISRs varied from 60.49% to 84.71% between representatives of different species of the genus Acidithiobacillus. Sequences from the spacer of the A. thiooxidans and A. ferrooxidans strains ranged from 86.71% to 99.56% and 92.36% to 100% similarity, respectively. All Acidithiobacillus strains were separated into three phylogenetic major clusters and seven phylogenetic groups. ISR may be a potential target for the development of in situ hybridization probe aimed at accurately detecting acidithiobacilli in the various acidic environments.

  6. DNA sequence heterogeneity in the three copies of the long 16S-23S rDNA spacer of Enterococcus faecalis isolates.

    PubMed

    Gürtler, V; Rao, Y; Pearson, S R; Bates, S M; Mayall, B C

    1999-07-01

    The possibility of intragenic heterogeneity between copies of the long intergenic (16S-23S rDNA) spacer region (LISR) was investigated by specific amplification of this region from 21 Enterococcus faecalis isolates. Three copies of the LISR (rrnA, B and C) were demonstrated by hybridization of the LISR to genomic DNA cleaved with I-Ceul and SmaI. When the LISR amplicon was digested with Tsp509I, two known nucleotide substitutions were detected, one 4 nt upstream from the 5' end of the tRNA(ala) gene (allele rrnB has the Tsp509I site and rrnA and C do not) and the other 22 nt downstream from the 3' end of the tRNA(ala) gene (rrnC has the Tsp509I site). Sequence differences at these sites were detected at the allelic level (alleles rrnA, B and C) and different combinations of these alleles were designated Tsp Types. Using densitometry to analyse bands from electrophoresis gels, the intra-isolate ratios of the separate alleles (rrnA:rrnB:rrnC) were determined in each Tsp Type: I (0:3:0), II (1:2:0), III (2:0:1), IV (3:0:0), V (2:1:0) and VI (1:1:1). Sequence variation between the three copies of the LISR was confirmed by the detection of at least five other intra-isolate nucleotide substitutions using heteroduplex analysis by conformation-sensitive gel electrophoresis (CSGE) that were not detected by Tsp509I cleavage. Perpendicular denaturing gradient gel electrophoresis was capable of resolving homoduplexes; six to seven out of a possible nine curves were obtained in some isolates. In the isolate where seven curves were obtained one or more further nucleotide substitutions, not detected by Tsp509I cleavage or CSGE, were detected. On the basis of LISR sequence heterogeneity, isolates were categorized into homogeneous (only one allele sequence present) and heterogeneous (two or three allele sequences present). The transition between homogeneous and heterogeneous LISRs may be useful in studying evolutionary mechanisms between E. faecalis isolates.

  7. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  8. The weak measurement process and the weak value of spin for metastable helium 23S1

    NASA Astrophysics Data System (ADS)

    Monachello, Vincenzo; Barker, Peter; Flack, Robert; Hiley, Basil

    2016-05-01

    An experiment is being designed and constructed in order to measure the weak value of spin for an atomic system. The principle of the ``weak measurement'' process was first proposed by Aharonov, Albert and Vaidman, and describes a scenario in which a system is weakly coupled to a pointer between well-defined pre- and post-selected states. This experiment will utilise a pulsed supersonic beam of spin-1 metastable Helium (He*) atoms in the 23S1 state. The spin of the pre-selected He* atoms will be weakly coupled to its centre-of-mass. During its flight, the atomic beam will be prepared in a desired quantum state and travel through two inhomogeneous magnets (weak and strong) which both comprise the ``weak measurement'' process. The deviation of the post-selected ms = + 1 state as measured using a micro-channel plate, phosphor screen and CCD camera setup will allow for the determination of the weak value of spin. This poster will report on the methods used and the experimental realisation.

  9. Spin-dependent, optogalvanic effects of laser-pumped He(2/3/S1) atoms

    NASA Astrophysics Data System (ADS)

    Schearer, L. D.; Tin, Pedetha

    1989-10-01

    Spin-dependent optogalvanic effects of laser-pumped He(2/3/S1) atoms are demonstrated. As helium atoms are excited with an IR tunable laser, changes in the conductivity of helium radio-frequency discharge are observed. With approximately 1 mW/sq cm of tunable laser power near 1.083 microns, the intensity-modulated optogalvanic effect signals are obtained as the laser is tuned through the D0(2/3/S1-2/3/P0), D1(2/3/S1-2/3/P1), and D2(2/3/S1-2/3/P2) transitions at 1.082908, 1.083025, and 1.083034 microns, respectively. If the laser emission is now circularly polarized and directed onto the helium discharge cell with the applied field parallel to the pump axis, some of the metastable atoms are oriented with their electronic spins along the field direction, modulating the coil current. One of the important applications of spin-polarized ensembles of metastable 4He is in extremely sensitive magnetic-field measuring devices.

  10. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.

    PubMed

    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik

    2015-11-01

    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from http://microbiology.se/software/metaxa2/. PMID:25732605

  11. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  12. RRNA and dnaK relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legume trees in Costa Rica.

    PubMed

    Parker, Matthew A

    2004-05-01

    Enzyme electrophoresis and sequencing of rRNA and dnaK genes revealed high genetic diversity among root nodule bacteria from the Costa Rican trees Andira inermis, Dalbergia retusa, Platymiscium pinnatum (Papilionoideae tribe Dalbergieae) and Lonchocarpus atropurpureus (Papilionoideae tribe Millettieae). A total of 21 distinct multilocus genotypes [ETs (electrophoretic types)] was found among the 36 isolates analyzed, and no ETs were shared in common by isolates from different legume hosts. However, three of the ETs from D. retusa were identical to Bradyrhizobium sp. isolates detected in prior studies of several other legume genera in both Costa Rica and Panama. Nearly full-length 16S rRNA sequences and partial 23S rRNA sequences confirmed that two isolates from D. retusa were highly similar or identical to Bradyrhizobium strains isolated from the legumes Erythrina and Clitoria (Papilionoideae tribe Phaseoleae) in Panama. rRNA sequences for five isolates from L. atropurpureus, P. pinnatum and A. inermis were not closely related to any currently known strains from Central America or elsewhere, but had affinities to the reference strains Bradyrhizobium japonicum USDA 110 (three isolates) or to B. elkanii USDA 76 (two isolates). A phylogenetic tree for 21 Bradyrhizobium strains based on 603 bp of the dnaK gene showed several significant conflicts with the rRNA tree, suggesting that genealogical relationships may have been altered by lateral gene transfer events. PMID:15214639

  13. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  14. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  15. Rapid Identification and Differentiation of the Soft Rot Erwinias by 16S-23S Intergenic Transcribed Spacer-PCR and Restriction Fragment Length Polymorphism Analyses

    PubMed Central

    Toth, I. K.; Avrova, A. O.; Hyman, L. J.

    2001-01-01

    Current identification methods for the soft rot erwinias are both imprecise and time-consuming. We have used the 16S-23S rRNA intergenic transcribed spacer (ITS) to aid in their identification. Analysis by ITS-PCR and ITS-restriction fragment length polymorphism was found to be a simple, precise, and rapid method compared to current molecular and phenotypic techniques. The ITS was amplified from Erwinia and other genera using universal PCR primers. After PCR, the banding patterns generated allowed the soft rot erwinias to be differentiated from all other Erwinia and non-Erwinia species and placed into one of three groups (I to III). Group I comprised all Erwinia carotovora subsp. atroseptica and subsp. betavasculorum isolates. Group II comprised all E. carotovora subsp. carotovora, subsp. odorifera, and subsp. wasabiae and E. cacticida isolates, and group III comprised all E. chrysanthemi isolates. To increase the level of discrimination further, the ITS-PCR products were digested with one of two restriction enzymes. Digestion with CfoI identified E. carotovora subsp. atroseptica and subsp. betavasculorum (group I) and E. chrysanthemi (group III) isolates, while digestion with RsaI identified E. carotovora subsp. wasabiae, subsp. carotovora, and subsp. odorifera/carotovora and E. cacticida isolates (group II). In the latter case, it was necessary to distinguish E. carotovora subsp. odorifera and subsp. carotovora using the α-methyl glucoside test. Sixty suspected soft rot erwinia isolates from Australia were identified as E. carotovora subsp. atroseptica, E. chrysanthemi, E. carotovora subsp. carotovora, and non-soft rot species. Ten “atypical” E. carotovora subsp. atroseptica isolates were identified as E. carotovora subsp. atroseptica, subsp. carotovora, and subsp. betavasculorum and non-soft rot species, and two “atypical” E. carotovora subsp. carotovora isolates were identified as E. carotovora subsp. carotovora and subsp. atroseptica. PMID:11526007

  16. Bead Array Direct rRNA Capture Assay (rCapA) for Amplification Free Speciation of Mycobacterium Cultures

    PubMed Central

    de Ronde, Hans; González Alonso, Paula; van Soolingen, Dick; Klatser, Paul R.; Anthony, Richard M.

    2012-01-01

    Mycobacterium cultures, from patients suspected of tuberculosis or nontuberculous mycobacteria (NTM) infection, need to be identified. It is most critical to identify cultures belonging to the Mycobacterium tuberculosis complex, but also important to recognize clinically irrelevant or important NTM to allow appropriate patient management. Identification of M. tuberculosis can be achieved by a simple and cheap lateral flow assay, but identification of other Mycobacterium spp. generally requires more complex molecular methods. Here we demonstrate that a paramagnetic liquid bead array method can be used to capture mycobacterial rRNA in crude lysates of positive cultures and use a robust reader to identify the species in a direct and sensitive manner. We developed an array composed of paramagnetic beads coupled to oligonucleotides to capture 16 rRNA from eight specific Mycobacterium species and a single secondary biotinilated reporter probe to allow the captured rRNA to be detected. A ninth less specific bead and its associated reporter probe, designed to capture 23S rRNA from mycobacteria and related genera, is included as an internal control to confirm the presence of bacterial rRNA from a GC rich Gram variable genera. Using this rRNA capture assay (rCapA) with the array developed we were already able to confirm the presence of members of the M. tuberculosis complex and to discriminate a range of NTM species. This approach is not based on DNA amplification and therefore does not require precautions to avoid amplicon contamination. Moreover, the new generation of stable and cost effective liquid bead readers provides the necessary multiplexing potential to develop a robust and highly discriminatory assay. PMID:22396779

  17. Mycoplasma genitalium infection: current treatment options, therapeutic failure, and resistance-associated mutations

    PubMed Central

    Couldwell, Deborah L; Lewis, David A

    2015-01-01

    Mycoplasma genitalium is an important cause of non-gonococcal urethritis, cervicitis, and related upper genital tract infections. The efficacy of doxycycline, used extensively to treat non-gonococcal urethritis in the past, is relatively poor for M. genitalium infection; azithromycin has been the preferred treatment for several years. Research on the efficacy of azithromycin has primarily focused on the 1 g single-dose regimen, but some studies have also evaluated higher doses and longer courses, particularly the extended 1.5 g regimen. This extended regimen is thought to be more efficacious than the 1 g single-dose regimen, although the regimens have not been directly compared in clinical trials. Azithromycin treatment failure was first reported in Australia and has subsequently been documented in several continents. Recent reports indicate an upward trend in the prevalence of macrolide-resistant M. genitalium infections (transmitted resistance), and cases of induced resistance following azithromycin therapy have also been documented. Emergence of antimicrobial-resistant M. genitalium, driven by suboptimal macrolide dosage, now threatens the continued provision of effective and convenient treatments. Advances in techniques to detect resistance mutations in DNA extracts have facilitated correlation of clinical outcomes with genotypic resistance. A strong and consistent association exists between presence of 23S rRNA gene mutations and azithromycin treatment failure. Fluoroquinolones such as moxifloxacin, gatifloxacin, and sitafloxacin remain highly active against most macrolide-resistant M. genitalium. However, the first clinical cases of moxifloxacin treatment failure, due to bacteria with coexistent macrolide-associated and fluoroquinolone-associated resistance mutations, were recently published by Australian investigators. Pristinamycin and solithromycin may be of clinical benefit for such multidrug-resistant infections. Further clinical studies are required to

  18. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  19. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  20. RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing

    PubMed Central

    Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander

    2002-01-01

    The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103

  1. Random mutagenesis of yeast 25S rRNA identify bases critical for 60S subunit structural integrity and function

    PubMed Central

    Nemoto, Naoki; Udagawa, Tsuyoshi; Chowdhury, Wasimul; Kitabatake, Makoto; Shin, Byung-shik; Hiraishi, Hiroyuki; Wang, Suzhi; Singh, Chingakham Ranjit; Brown, Susan J.; Ohno, Mutsuhito; Asano, Katsura

    2013-01-01

    In yeast Saccharomyces cerevisiae, 25S rRNA makes up the major mass and shape of the 60S ribosomal subunit. During translation initiation, the 60S subunit joins the 40S initiation complex, producing the 80S initiation complex. During elongation, the 60S subunit binds the CCA-ends of aminoacyl- and peptidyl-tRNAs at the A-loop and P-loop, respectively, transferring the peptide onto the α-amino group of the aminoacyl-tRNA. To study the role of 25S rRNA in translation in vivo, we randomly mutated 25S rRNA and isolated and characterized seven point mutations that affected yeast cell growth and polysome profiles. Four of these mutations, G651A, A1435U, A1446G and A1587G, change a base involved in base triples crucial for structural integrity. Three other mutations change bases near the ribosomal surface: C2879U and U2408C alter the A-loop and P-loop, respectively, and G1735A maps near a Eukarya-specific bridge to the 40S subunit. By polysome profiling in mmslΔ mutants defective in nonfunctional 25S rRNA decay, we show that some of these mutations are defective in both the initiation and elongation phases of translation. Of the mutants characterized, C2879U displays the strongest defect in translation initiation. The ribosome transit-time assay directly shows that this mutation is also defective in peptide elongation/termination. Thus, our genetic analysis not only identifies bases critical for structural integrity of the 60S subunit, but also suggests a role for bases near the peptidyl transferase center in translation initiation. PMID:26824023

  2. Occurrence of 20S RNA and 23S RNA replicons in industrial yeast strains and their variation under nutritional stress conditions.

    PubMed

    López, Victoria; Gil, Rosario; Vicente Carbonell, José; Navarro, Alfonso

    2002-04-01

    We have characterized industrial yeast strains used in the brewing, baking, and winemaking industries for the presence or absence of cytoplasmic single-stranded 20S and 23S RNAs. Furthermore, the variation of intracellular concentrations of these replicons in brewing and laboratory strains under nutritional stress conditions was determined. Our results show a correlation between the relative abundance of these replicons and exposure of yeast to nutritionally stressful conditions, indicating that these RNAs could be employed as molecular probes to evaluate the exposure of 20S(+) and/or 23S(+) yeast strains to stress situations during industrial manipulation. During this study, several 20S(-)23S(+) Saccharomyces cerevisiae strains were isolated and identified. This is the first time that a yeast strain containing only 23S RNA has been reported, demonstrating that 20S RNA is not required for 23S RNA replication. PMID:11921103

  3. Occurrence of 20S RNA and 23S RNA replicons in industrial yeast strains and their variation under nutritional stress conditions.

    PubMed

    López, Victoria; Gil, Rosario; Vicente Carbonell, José; Navarro, Alfonso

    2002-04-01

    We have characterized industrial yeast strains used in the brewing, baking, and winemaking industries for the presence or absence of cytoplasmic single-stranded 20S and 23S RNAs. Furthermore, the variation of intracellular concentrations of these replicons in brewing and laboratory strains under nutritional stress conditions was determined. Our results show a correlation between the relative abundance of these replicons and exposure of yeast to nutritionally stressful conditions, indicating that these RNAs could be employed as molecular probes to evaluate the exposure of 20S(+) and/or 23S(+) yeast strains to stress situations during industrial manipulation. During this study, several 20S(-)23S(+) Saccharomyces cerevisiae strains were isolated and identified. This is the first time that a yeast strain containing only 23S RNA has been reported, demonstrating that 20S RNA is not required for 23S RNA replication.

  4. Mitochondrial 12S rRNA variants in 1642 Han Chinese pediatric subjects with aminoglycoside-induced and nonsyndromic hearing loss

    PubMed Central

    Lu, Jianxin; Li, Zhiyuan; Zhu, Yi; Yang, Aifen; Li, Ronghua; Zheng, Jing; Cai, Qin; Peng, Guanghua; Zheng, Wuwei; Tang, Xiaowen; Chen, Bobei; Chen, Jianfu; Liao, Zhisu; Yang, Li; Li, Yongyan; You, Junyan; Ding, Yu; Yu, Hong; Wang, Jindan; Sun, Dongmei; Zhao, Jianyue; Xue, Ling; Wang, Jieying; Guan, Min-Xin

    2010-01-01

    In this report, we investigated the frequency and spectrum of mitochondrial 12S rRNA variants in a large cohort of 1642 Han Chinese pediatric subjects with aminoglycoside-induced and nonsyndromic hearing loss. Mutational analysis of 12S rRNA gene in these subjects identified 68 (54 known and 14 novel) variants. The frequencies of known 1555A>G and 1494C>T mutations were 3.96% and 0.18%, respectively, in this cohort with nonsyndromic and aminoglycoside-induced hearing loss. Prevalence of other putative deafness-associated mutation at positions 1095 and 961 were 0.61% and 1.7% in this cohort, respectively. Furthermore, the 745A>G, 792C>T, 801A>G, 839A>G, 856A>G, 1027A>G, 1192C>T, 1192C>A, 1310C>T, 1331A>G, 1374A>G and 1452T>C variants conferred increased sensitivity to ototoxic drugs or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants appeared to be polymorphisms. Moreover, 65 Chinese subjects carrying the 1555A>G mutation exhibited bilateral and sensorineural hearing loss. A wide range of severity, age-of-onset and audiometric configuration was observed among these subjects. In particular, the sloping and flat shaped patterns were the common audiograms in individuals carrying the 1555A>G mutation. The phenotypic variability in subjects carrying these 12S rRNA mutations indicated the involvement of nuclear modifier genes, mitochondrial haplotypes, epigenetic and environmental factors in the phenotypic manifestation of these mutations. Therefore, our data demonstrated that mitochondrial 12S rRNA is the hot spot for mutations associated with aminoglycoside ototoxicity. PMID:20100600

  5. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes.

    PubMed

    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott

    2014-08-01

    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  6. Calculation and Comparative Analysis of the IR Spectra of Homobrassinolide and (22S,23S)-Homobrassinolide

    NASA Astrophysics Data System (ADS)

    Andrianov, V. M.; Korolevich, M. V.

    2015-09-01

    Normal vibrational frequencies and absolute IR band intensities of the biologically active steroid phytohormones homobrassinolide and (22S,23S)-homobrassinolide were calculated in the framework of an original approach that combined classical analysis of normal modes using molecular mechanics with quantum-chemical estimation of the absolute intensities. IR absorption bands were interpreted based on a comparison of the experimental and theoretical absorption spectra. The impact of structural differences in the side chains of these molecules on the formation of their IR spectra in the region 1500-950 cm -1 was estimated.

  7. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes1

    PubMed Central

    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott

    2014-01-01

    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  8. Simulation of the structures and calculation of IR Spectra of (22 s,23 s)-Homobrassinolide conformers

    NASA Astrophysics Data System (ADS)

    Andrianov, V. M.; Korolevich, M. V.

    2012-07-01

    Frequencies and intensities of normal vibrations of (22 S,23 S)-homobrassinolide, a biologically active representative of steroidal phytohormones, were calculated within the framework of an original approach that combined a classical analysis of normal vibrations by a molecular mechanics method with a quantum-chemical estimation of absolute intensities. Two molecular structures with different side-chain conformations were considered. The molecular IR absorption bands in the range 1500-900 cm-1 were interpreted for the first time and the influence of the side-chain conformation on the IR spectrum was analyzed based on a comparison of the experimental and calculated spectra.

  9. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  10. Characterisation of clinical meticillin-resistant Staphylococcus epidermidis demonstrating high levels of linezolid resistance (>256 μg/ml) resulting from transmissible and mutational mechanisms.

    PubMed

    Gabriel, Emma M; Fitzgibbon, Siobhan; Clair, James; Coffey, Aidan; O'Mahony, Jim M

    2015-07-01

    Staphylococcus epidermidis (S. epidermidis), one of the leading etiological agents of nosocomial infections poses a significant economic burden globally. Introduced in 2000, linezolid (LZD) has become an important antibiotic, used in nearly seventy countries worldwide to treat infections caused by Gram-positive pathogens such as meticillin-resistant Staphylococcus and Streptococcus species along with vancomycin-resistant enterococci. Resistance to LZD in clinical settings remains rare. Here, we report the emergence of meticillin resistant S. epidermidis (MRSE) clinical isolates from two voluntary general acute hospitals exhibiting higher than typically reported levels of LZD resistance (MIC>256 μg/ml). The MRSE ST-2 clone isolated from eight patients (2010-2011) not only possessed resistance-conferring mutations such as G2576T in domain V of 23S rRNA gene (as determined by HRM-PCR analysis) and R172C substitution in the ribosomal protein L3, but also carried the cfr gene (the only known transmissible mechanism of LZD resistance). All isolates possessed several key biofilm-associated genes (such as icaA, icaD, aap and atlE) and resistance to multiple clinically significant antibiotics was recorded. This study reports the earliest incidence (2010) of clinical MRSE in the Republic of Ireland demonstrating multiple LZD resistance mechanisms both mutational and potentially transmissible, and characterises this emerging resistance from a molecular perspective.

  11. Do mutator mutations fuel tumorigenesis?

    PubMed

    Fox, Edward J; Prindle, Marc J; Loeb, Lawrence A

    2013-12-01

    The mutator phenotype hypothesis proposes that the mutation rate of normal cells is insufficient to account for the large number of mutations found in human cancers. Consequently, human tumors exhibit an elevated mutation rate that increases the likelihood of a tumor acquiring advantageous mutations. The hypothesis predicts that tumors are composed of cells harboring hundreds of thousands of mutations, as opposed to a small number of specific driver mutations, and that malignant cells within a tumor therefore constitute a highly heterogeneous population. As a result, drugs targeting specific mutated driver genes or even pathways of mutated driver genes will have only limited anticancer potential. In addition, because the tumor is composed of such a diverse cell population, tumor cells harboring drug-resistant mutations will exist prior to the administration of any chemotherapeutic agent. We present recent evidence in support of the mutator phenotype hypothesis, major arguments against this concept, and discuss the clinical consequences of tumor evolution fueled by an elevated mutation rate. We also consider the therapeutic possibility of altering the rate of mutation accumulation. Most significantly, we contend that there is a need to fundamentally reconsider current approaches to personalized cancer therapy. We propose that targeting cellular pathways that alter the rate of mutation accumulation in tumors will ultimately prove more effective than attempting to identify and target mutant driver genes or driver pathways.

  12. Comparison of Solution Conformations and Stabilities of Modified Helix 69 rRNA Analogues from Bacteria and Human†

    PubMed Central

    Sumita, Minako; Jiang, Jun; SantaLucia, John; Chow, Christine S.

    2012-01-01

    The helix 69 (H69) region of the large subunit (28S) rRNA of H. sapiens contains five pseudouridine (Ψ) residues out of 19 total nucleotides, three of which are highly conserved. In this study, the effects of this abundant modified nucleotide on the structure and stability of H69 were compared with those of uridine in double-stranded (stem) regions. These results were compared with previous hairpin (stem plus single-stranded loop) studies in order to understand the contributions of the loop sequences to H69 structure and stability. The role of a loop nucleotide substitution from an A in bacteria (position 1918 in E. coli 23S rRNA) to a G in eukaryotes (position 3734 in H. sapiens 28S rRNA) was examined. Thermodynamic parameters for the duplex RNAs were obtained through UV melting studies, and differences in the modified and unmodified RNA structures were examined by circular dichroism spectroscopy. The overall folded structure of human H69 appears to be similar to the bacterial RNA, consistent with the idea that ribosome structure and function are highly conserved; however, our results reveal subtle differences in structure and stability between the bacterial and human H69 RNAs in both the stem and loop regions. These findings may be significant with respect to H69 as a potential drug target site. PMID:21858779

  13. The Cfr rRNA Methyltransferase Confers Resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A Antibiotics

    PubMed Central

    Long, Katherine S.; Poehlsgaard, Jacob; Kehrenberg, Corinna; Schwarz, Stefan; Vester, Birte

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and recently shown to encode a methyltransferase that modifies 23S rRNA at A2503. Antimicrobial susceptibility testing shows that S. aureus and E. coli strains expressing the cfr gene exhibit elevated MICs to a number of chemically unrelated drugs. The phenotype is named PhLOPSA for resistance to the following drug classes: Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics. Each of these five drug classes contains important antimicrobial agents that are currently used in human and/or veterinary medicine. We find that binding of the PhLOPSA drugs, which bind to overlapping sites at the peptidyl transferase center that abut nucleotide A2503, is perturbed upon Cfr-mediated methylation. Decreased drug binding to Cfr-methylated ribosomes has been confirmed by footprinting analysis. No other rRNA methyltransferase is known to confer resistance to five chemically distinct classes of antimicrobials. In addition, the findings described in this study represent the first report of a gene conferring transferable resistance to pleuromutilins and oxazolidinones. PMID:16801432

  14. Further involvement of the mitochondrial 12S rRNA gene in aminoglycoside-induced deafness: A novel type of heteroplasmy

    SciTech Connect

    Bacino, C.; Prezant, T.R.; Bu, X.

    1994-09-01

    Aminoglycoside-induced deafness has been linked recently to a predisposing mutation in the 3{prime} end of the small ribosomal RNA (rRNA) gene of human mitochondria (1555 A{yields}G) that makes the mitochondrial rRNA structurally more similar to its bacterial counterpart. This mutation was found in Chinese families in which the susceptibility to develop ototoxic deafness was inherited through the maternal lineage. However, the 1555 A{yields}G mutation was rarely found in sporadic patients in China, where aminoglycosides are commonly used. To further characterize the mutations predisposing to aminoglycoside ototoxicity, we analyzed the 12S rRNA gene in 35 sporadic patients without the 1555 mutation. Using single stranded conformational polymorphism (SSCP) analysis, heteroduplex (HD) analysis, sequencing, and allele-specific oligonucleotide hybridization, we found that 3 of 35 sporadic patients had unique sequence changes in the 12S rRNA gene. Two of these changes were homoplasmic. One of the patients displayed a novel type of heteroplasmy, which we term multiplasmy, with one base deletion at nt 961 and different populations of mitochondrial DNA with varying numbers of inserted cytosines at that site.

  15. Insertions or Deletions (Indels) in the rrn 16S-23S rRNA Gene Internal Transcribed Spacer Region (ITS) Compromise the Typing and Identification of Strains within the Acinetobacter calcoaceticus-baumannii (Acb) Complex and Closely Related Members

    PubMed Central

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J.

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2–13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species. PMID:25141005

  16. Insertions or deletions (Indels) in the rrn 16S-23S rRNA gene internal transcribed spacer region (ITS) compromise the typing and identification of strains within the Acinetobacter calcoaceticus-baumannii (Acb) complex and closely related members.

    PubMed

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2-13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species.

  17. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    PubMed

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  18. An unusual Y chromosome of Drosophila simulans carrying amplified rDNA spacer without rRNA genes.

    PubMed

    Lohe, A R; Roberts, P A

    1990-06-01

    The X and Y chromosomes of Drosophila melanogaster each contain a cluster of several hundred ribosomal RNA genes (rDNA). A nontranscribed spacer region separates adjacent rRNA genes and contains tandem copies of 240 bp repeats that include the initiation site for RNA polymerase I transcription. We show here that Drosophila simulans, a sibling species of D. melanogaster, contains few, if any, rRNA genes on its Y chromosome but carries instead a large block (3,000 kb or 12,500 copies) of 240 bp nontranscribed spacer repeats. The repeats are located at the tip of the long arm of the simulans Y chromosome, in contrast to their location among rRNA genes on the short arm of the Y chromosome of D. melanogaster. The bobbed mutation in homozygous females of D. melanogaster shortens and thins the bristles, owing to a partial deletion of rRNA genes on the X chromosome. The bristles of bobbed/Y males are normal owing to the presence of a full complement of rRNA genes on the Y chromosome. Peculiarly, in bobbed/Y males of D. simulans the short bristle phenotype does not return to normal but is enhanced by the presence of the Y chromosome. We propose that the 12,500 nontranscribed spacer repeats on the Y chromosome are responsible for this biological effect by competition for a protein factor(s) essential for normal levels of rDNA transcription at the X-linked locus.

  19. Ecotypes of planktonic actinobacteria with identical 16S rRNA genes adapted to thermal niches in temperate, subtropical, and tropical freshwater habitats.

    PubMed

    Hahn, Martin W; Pöckl, Matthias

    2005-02-01

    Seven strains with identical 16S rRNA genes affiliated with the Luna2 cluster (Actinobacteria) were isolated from six freshwater habitats located in temperate (Austria and Australia), subtropical (People's Republic of China), and tropical (Uganda) climatic zones. The isolates had sequence differences at zero to five positions in a 2,310-nucleotide fragment of the ribosomal operon, including part of the intergenic spacer upstream of the 16S rRNA gene, the complete 16S rRNA gene, the complete 16S-23S internal transcribed spacer (ITS1), and a short part of the 23S rRNA gene. Most of the few sequence differences found were located in the internal transcribed spacer sequences. Two isolates obtained from habitats in Asia and Europe, as well as two isolates obtained from different habitats in the People's Republic of China, had identical sequences for the entire fragment sequenced. In spite of minimal sequence differences in the part of the ribosomal operon investigated, the strains exhibited significant differences in their temperature response curves (with one exception), as well as pronounced differences in their temperature optima (25.0 to 35.6 degrees C). The observed differences in temperature adaptation were generally in accordance with the thermal conditions in the habitats where the strains were isolated. Strains obtained from temperate zone habitats had the lowest temperature optima, strains from subtropical habitats had intermediate temperature optima, and a strain from a tropical habitat had the highest temperature optimum. Based on the observed temperature responses, we concluded that the strains investigated are well adapted to the thermal conditions in their home habitats. Consequently, these closely related strains represent different ecotypes adapted to different thermal niches.

  20. Sequence determination of rRNA genes of pathogenic Vibrio species and whole-cell identification of Vibrio vulnificus with rRNA-targeted oligonucleotide probes.

    PubMed

    Aznar, R; Ludwig, W; Amann, R I; Schleifer, K H

    1994-04-01

    A comparative analysis of seven new 16S rRNA gene sequences of pathogenic Vibrio species with previously published vibrio sequences confirmed that Vibrio vulnificus represents a group that is not closely related to the core organisms of the genus Vibrio. In addition, we found that V. vulnificus, Listonella (Vibrio) anguillarum and Vibrio diazotrophicus branch off separately from the core group. A comparison of the 16S rRNA gene sequences of V. vulnificus strains belonging to biotypes 1 and 2 revealed that the sequences of all but four biotype 1 strains were identical to each other but slightly different (17 bases) from the sequences of the rest of the V. vulnificus strains investigated. In addition, the sequences of variable regions of the 23S rRNA genes of Vibrio fluvialis, Vibrio furnissii, Vibrio harveyi, Vibrio cholerae, and V. vulnificus C7184 and TW1 were determined, aligned, and compared with all available bacterial 23S rRNA sequences in order to search for specific target sites. As a result, four oligonucleotide probes specific for V. vulnificus were synthesized, and the specificities of these probes were evaluated by dot blot hybridization to membrane-bound RNAs from 21 V. vulnificus strains, 13 strains belonging to other Vibrio species, 61 strains belonging to species that are members of the alpha, beta, and gamma subclasses of the Proteobacteria, and 3 eucaryotic microorganisms. Two probes hybridized with all of the V. vulnificus strains tested, and the other two probes distinguished V. vulnificus biotype 1 strains from all other organisms. In situ identification of V. vulnificus by using tetramethylrhodamine- or fluorescein-labelled oligonucleotides is now possible.

  1. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    PubMed

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  2. Structural and functional insights into the molecular mechanism of rRNA m6A methyltransferase RlmJ.

    PubMed

    Punekar, Avinash S; Liljeruhm, Josefine; Shepherd, Tyson R; Forster, Anthony C; Selmer, Maria

    2013-11-01

    RlmJ catalyzes the m(6)A2030 methylation of 23S rRNA during ribosome biogenesis in Escherichia coli. Here, we present crystal structures of RlmJ in apo form, in complex with the cofactor S-adenosyl-methionine and in complex with S-adenosyl-homocysteine plus the substrate analogue adenosine monophosphate (AMP). RlmJ displays a variant of the Rossmann-like methyltransferase (MTase) fold with an inserted helical subdomain. Binding of cofactor and substrate induces a large shift of the N-terminal motif X tail to make it cover the cofactor binding site and trigger active-site changes in motifs IV and VIII. Adenosine monophosphate binds in a partly accommodated state with the target N6 atom 7 Å away from the sulphur of AdoHcy. The active site of RlmJ with motif IV sequence 164DPPY167 is more similar to DNA m(6)A MTases than to RNA m(6)2A MTases, and structural comparison suggests that RlmJ binds its substrate base similarly to DNA MTases T4Dam and M.TaqI. RlmJ methylates in vitro transcribed 23S rRNA, as well as a minimal substrate corresponding to helix 72, demonstrating independence of previous modifications and tertiary interactions in the RNA substrate. RlmJ displays specificity for adenosine, and mutagenesis experiments demonstrate the critical roles of residues Y4, H6, K18 and D164 in methyl transfer. PMID:23945937

  3. Rapid Diagnosis of Bacteremia by Universal Amplification of 23S Ribosomal DNA Followed by Hybridization to an Oligonucleotide Array

    PubMed Central

    Anthony, R. M.; Brown, T. J.; French, G. L.

    2000-01-01

    The rapid identification of bacteria in blood cultures and other clinical specimens is important for patient management and antimicrobial therapy. We describe a rapid (<4 h) detection and identification system that uses universal PCR primers to amplify a variable region of bacterial 23S ribosomal DNA, followed by reverse hybridization of the products to a panel of oligonucleotides. This procedure was successful in discriminating a range of bacteria in pure cultures. When this procedure was applied directly to 158 unselected positive blood culture broths on the day when growth was detected, 125 (79.7%) were correctly identified, including 4 with mixed cultures. Nine (7.2%) yielded bacteria for which no oligonucleotide targets were present in the oligonucleotide panel, and 16 culture-positive broths (10.3%) produced no PCR product. In seven of the remaining eight broths, streptococci were identified but not subsequently grown, and one isolate of Staphylococcus aureus was misidentified as a coagulase-negative staphylococcus. The accuracy, range, and discriminatory power of the assay can be continually extended by adding further oligonucleotides to the panel without significantly increasing complexity or cost. PMID:10655385

  4. 23(S),25(R)-1,25-dihydroxyvitamin D3-26,23-lactone stimulates murine bone formation in vivo

    SciTech Connect

    Shima, M.; Tanaka, H.; Norman, A.W.; Yamaoka, K.; Yoshikawa, H.; Takaoka, K.; Ishizuka, S.; Seino, Y. )

    1990-02-01

    23(S),25(R)-1,25-Dihydroxyvitamin D3-26,23-lactone (1,25-lactone) has been shown to have unique actions different from those of 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3). In contrast to 1,25-(OH)2D3, 1,25-lactone causes a significant reduction in the serum Ca2+ level, stimulates collagen production in an osteoblastic cell line, and inhibits bone resorption induced by 1,25-(OH)2D3. A possible effect of 1,25-lactone on bone formation was examined in experiments on ectopic bone formation using a bone-inducing factor derived from Dunn osteosarcomas. 1,25-Lactone, a metabolite of 1,25-(OH)2D3, increased (3H)proline uptake at the stage of chondrogenesis and {sup 85}Sr uptake during bone formation. Significantly enlarged bone was also induced by this compound 3 weeks after implantation. These results suggest that the 1,25-lactone may be able to stimulate bone formation under in vivo conditions.

  5. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    PubMed

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association. PMID:26210661

  6. Two novel point mutations in clinical Staphylococcus aureus reduce linezolid susceptibility and switch on the stringent response to promote persistent infection.

    PubMed

    Gao, Wei; Chua, Kyra; Davies, John K; Newton, Hayley J; Seemann, Torsten; Harrison, Paul F; Holmes, Natasha E; Rhee, Hyun-Woo; Hong, Jong-In; Hartland, Elizabeth L; Stinear, Timothy P; Howden, Benjamin P

    2010-01-01

    Staphylococcus aureus frequently invades the human bloodstream, leading to life threatening bacteremia and often secondary foci of infection. Failure of antibiotic therapy to eradicate infection is frequently described; in some cases associated with altered S. aureus antimicrobial resistance or the small colony variant (SCV) phenotype. Newer antimicrobials, such as linezolid, remain the last available therapy for some patients with multi-resistant S. aureus infections. Using comparative and functional genomics we investigated the molecular determinants of resistance and SCV formation in sequential S. aureus isolates from a patient who had a persistent and recurrent S. aureus infection, after failed therapy with multiple antimicrobials, including linezolid. Two point mutations in key staphylococcal genes dramatically affected clinical behaviour of the bacterium, altering virulence and antimicrobial resistance. Most strikingly, a single nucleotide substitution in relA (SACOL1689) reduced RelA hydrolase activity and caused accumulation of the intracellular signalling molecule guanosine 3', 5'-bis(diphosphate) (ppGpp) and permanent activation of the stringent response, which has not previously been reported in S. aureus. Using the clinical isolate and a defined mutant with an identical relA mutation, we demonstrate for the first time the impact of an active stringent response in S. aureus, which was associated with reduced growth, and attenuated virulence in the Galleria mellonella model. In addition, a mutation in rlmN (SACOL1230), encoding a ribosomal methyltransferase that methylates 23S rRNA at position A2503, caused a reduction in linezolid susceptibility. These results reinforce the exquisite adaptability of S. aureus and show how subtle molecular changes cause major alterations in bacterial behaviour, as well as highlighting potential weaknesses of current antibiotic treatment regimens.

  7. Bases in 16S rRNA important for subunit association, tRNA binding, and translocation.

    PubMed

    Shi, Xinying; Chiu, Katie; Ghosh, Srikanta; Joseph, Simpson

    2009-07-28

    Ribosomes are the cellular machinery responsible for protein synthesis. A well-orchestrated step in the elongation cycle of protein synthesis is the precise translocation of the tRNA-mRNA complex within the ribosome. Here we report the application of a new in vitro modification-interference method for the identification of bases in 16S rRNA that are essential for translocation. Our results suggest that conserved bases U56, U723, A1306, A1319, and A1468 in 16S rRNA are important for translocation. These five bases were deleted or mutated so their role in translation could be studied. Depending on the type of mutation, we observed inhibition of growth rate, subunit association, tRNA binding, and/or translocation. Interestingly, deletion of U56 or A1319 or mutation of A1319 to C showed a lethal phenotype and were defective in protein synthesis in vitro. Further analysis showed that deletion of U56 or A1319 caused defects in 30S subunit assembly, subunit association, and tRNA binding. In contrast, the A1319C mutation showed no defects in subunit association; however, the extent of tRNA binding and translocation was significantly reduced. These results show that conserved bases located as far as 100 A from the tRNA binding sites can be important for translation.

  8. Evolutionary relationships amongst archaebacteria. A comparative study of 23 S ribosomal RNAs of a sulphur-dependent extreme thermophile, an extreme halophile and a thermophilic methanogen.

    PubMed

    Leffers, H; Kjems, J; Ostergaard, L; Larsen, N; Garrett, R A

    1987-05-01

    The 23 S RNA genes representative of each of the main archaebacterial subkingdoms, Desulfurococcus mobilis an extreme thermophile, Halococcus morrhuae an extreme halophile and Methanobacterium thermoautotrophicum a thermophilic methanogen, were cloned and sequenced. The inferred RNA sequences were aligned with all the available 23 S-like RNAs of other archaebacteria, eubacteria/chloroplasts and the cytoplasm of eukaryotes. Universal secondary structural models containing six major structural domains were refined, and extended, using the sequence comparison approach. Much of the present structure was confirmed but six new helices were added, including one that also exists in the eukaryotic 5.8 S RNA, and extensions were made to several existing helices. The data throw doubt on whether the 5' and 3' ends of the 23 S RNA interact, since no stable helix can form in either the extreme thermophile or the methanogen RNA. A few secondary structural features, specific to the archaebacterial RNAs were identified; two of these were supported by a comparison of the archaebacterial RNA sequences, and experimentally, using chemical and ribonuclease probes. Seven tertiary structural interactions, common to all 23 S-like RNAs, were predicted within unpaired regions of the secondary structural model on the basis of co-variation of nucleotide pairs; two lie in the region of the 23 S RNA corresponding to 5.8 S RNA but they are not conserved in the latter. The flanking sequences of each of the RNAs could base-pair to form long RNA processing stems. They were not conserved in sequence but each exhibited a secondary structural feature that is common to all the archaebacterial stems for both 16 S and 23 S RNAs and constitutes a processing site. Kingdom-specific nucleotides have been identified that are associated with antibiotic binding sites at functional centres in 23 S-like RNAs: in the peptidyl transferase centre (erythromycin-domain V) the archaebacterial RNAs classify with the

  9. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides

    PubMed Central

    Almutairi, Mashal M.; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A.; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H.; Mankin, Alexander S.

    2015-01-01

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism. PMID:26438831

  10. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides.

    PubMed

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H; Mankin, Alexander S

    2015-10-20

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism.

  11. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea.

    PubMed

    Lee, Zarraz May-Ping; Bussema, Carl; Schmidt, Thomas M

    2009-01-01

    A dramatic exception to the general pattern of single-copy genes in bacterial and archaeal genomes is the presence of 1-15 copies of each ribosomal RNA encoding gene. The original version of the Ribosomal RNA Database (rrnDB) cataloged estimates of the number of 16S rRNA-encoding genes; the database now includes the number of genes encoding each of the rRNAs (5S, 16S and 23S), an internally transcribed spacer region, and the number of tRNA genes. The rrnDB has been used largely by microbiologists to predict the relative rate at which microbial populations respond to favorable growth conditions, and to interpret 16S rRNA-based surveys of microbial communities. To expand the functionality of the rrnDB (http://ribosome.mmg.msu.edu/rrndb/index.php), the search engine has been redesigned to allow database searches based on 16S rRNA gene copy number, specific organisms or taxonomic subsets of organisms. The revamped database also computes average gene copy numbers for any collection of entries selected. Curation tools now permit rapid updates, resulting in an expansion of the database to include data for 785 bacterial and 69 archaeal strains. The rrnDB continues to serve as the authoritative, curated source that documents the phylogenetic distribution of rRNA and tRNA genes in microbial genomes.

  12. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  13. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    PubMed

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  14. Impact of azithromycin resistance mutations on the virulence and fitness of Chlamydia caviae in guinea pigs.

    PubMed

    Binet, Rachel; Bowlin, Anne K; Maurelli, Anthony T; Rank, Roger G

    2010-03-01

    Azithromycin (AZM) is a major drug used in the treatment and prophylaxis of infections caused by Chlamydia, yet no significant clinical resistance has been reported for these obligate intracellular bacteria. Nevertheless, spontaneous AZM resistance (Azm(r)) arose in vitro at frequencies ranging from 3 x 10(-8) to 8 x 10(-10) for clonal isolates of Chlamydia caviae, which is a natural pathogen of guinea pigs. Sequencing of the unique 23S rRNA gene copy in 44 independent Azm(r) isolates identified single mutations at position A(2058) or A(2059) (Escherichia coli numbering system). While SP(6)AZ(1) (A(2058)C) and SP(6)AZ(2) (A(2059)C) Azm(r) mutants showed growth defects in cell culture and were less pathogenic in the guinea pig ocular infection model than in the parent SP(6), the three isogenic C. caviae isolates grew equally well in the animal. On the other hand, coinoculation of the C. caviae parent strain with one of the Azm(r) strains was detrimental for the mutant strain. This apparent lack of association between pathology and bacterial load in vivo showed that virulence of the two Azm(r) mutants of C. caviae was attenuated. While chlamydial growth in vitro reflects the ability of the bacteria to multiply in permissive cells, survival in the host is a balance between cellular multiplication and clearance by the host immune system. The obligate intracellular nature of Chlamydia may therefore limit emergence of resistance in vivo due to the strength of the immune response induced by the wild-type antibiotic-sensitive bacteria at the time of antibiotic treatment.

  15. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    PubMed Central

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J.; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I–V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC. PMID:27749897

  16. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  17. A network of assembly factors is involved in remodeling rRNA elements during preribosome maturation

    PubMed Central

    Baßler, Jochen; Paternoga, Helge; Holdermann, Iris; Thoms, Matthias; Granneman, Sander; Barrio-Garcia, Clara; Nyarko, Afua; Stier, Gunter; Clark, Sarah A.; Schraivogel, Daniel; Kallas, Martina; Beckmann, Roland; Tollervey, David

    2014-01-01

    Eukaryotic ribosome biogenesis involves ∼200 assembly factors, but how these contribute to ribosome maturation is poorly understood. Here, we identify a network of factors on the nascent 60S subunit that actively remodels preribosome structure. At its hub is Rsa4, a direct substrate of the force-generating ATPase Rea1. We show that Rsa4 is connected to the central protuberance by binding to Rpl5 and to ribosomal RNA (rRNA) helix 89 of the nascent peptidyl transferase center (PTC) through Nsa2. Importantly, Nsa2 binds to helix 89 before relocation of helix 89 to the PTC. Structure-based mutations of these factors reveal the functional importance of their interactions for ribosome assembly. Thus, Rsa4 is held tightly in the preribosome and can serve as a “distribution box,” transmitting remodeling energy from Rea1 into the developing ribosome. We suggest that a relay-like factor network coupled to a mechano-enzyme is strategically positioned to relocate rRNA elements during ribosome maturation. PMID:25404745

  18. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-08-24

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon.

  19. Functional Specialization of Domains Tandemly Duplicated Witin 16S rRNA Methyltransferase RsmC

    SciTech Connect

    Sunita,S.; Purta, E.; Durawa, M.; Tkaczuk, K.; Swaathi, J.; Bujnicki, J.; Sivaraman, J.

    2007-01-01

    RNA methyltransferases (MTases) are important players in the biogenesis and regulation of the ribosome, the cellular machine for protein synthesis. RsmC is a MTase that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to G1207 of 16S rRNA. Mutations of G1207 have dominant lethal phenotypes in Escherichia coli, underscoring the significance of this modified nucleotide for ribosome function. Here we report the crystal structure of E. coli RsmC refined to 2.1 Angstroms resolution, which reveals two homologous domains tandemly duplicated within a single polypeptide. We characterized the function of the individual domains and identified key residues involved in binding of rRNA and SAM, and in catalysis. We also discovered that one of the domains is important for the folding of the other. Domain duplication and subfunctionalization by complementary degeneration of redundant functions (in particular substrate binding versus catalysis) has been reported for many enzymes, including those involved in RNA metabolism. Thus, RsmC can be regarded as a model system for functional streamlining of domains accompanied by the development of dependencies concerning folding and stability.

  20. A network of assembly factors is involved in remodeling rRNA elements during preribosome maturation.

    PubMed

    Baßler, Jochen; Paternoga, Helge; Holdermann, Iris; Thoms, Matthias; Granneman, Sander; Barrio-Garcia, Clara; Nyarko, Afua; Lee, Woonghee; Stier, Gunter; Clark, Sarah A; Schraivogel, Daniel; Kallas, Martina; Beckmann, Roland; Tollervey, David; Barbar, Elisar; Sinning, Irmi; Hurt, Ed

    2014-11-24

    Eukaryotic ribosome biogenesis involves ∼200 assembly factors, but how these contribute to ribosome maturation is poorly understood. Here, we identify a network of factors on the nascent 60S subunit that actively remodels preribosome structure. At its hub is Rsa4, a direct substrate of the force-generating ATPase Rea1. We show that Rsa4 is connected to the central protuberance by binding to Rpl5 and to ribosomal RNA (rRNA) helix 89 of the nascent peptidyl transferase center (PTC) through Nsa2. Importantly, Nsa2 binds to helix 89 before relocation of helix 89 to the PTC. Structure-based mutations of these factors reveal the functional importance of their interactions for ribosome assembly. Thus, Rsa4 is held tightly in the preribosome and can serve as a "distribution box," transmitting remodeling energy from Rea1 into the developing ribosome. We suggest that a relay-like factor network coupled to a mechano-enzyme is strategically positioned to relocate rRNA elements during ribosome maturation.

  1. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  2. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  3. Development of a second generation experiment to measure the 2(3)S(1) transition to 2(3)P(J) intervals in positronium

    NASA Astrophysics Data System (ADS)

    Engbrecht, Jason John

    Positronium has proven to be a rich testing ground for Quantum Electrodynamics over the last half of the twentieth century. The 23S1 → 23PJ intervals in positronium have previously been measured and disagreements currently exist amongst various experiments and between some experiments and theoretical predictions. Furthermore, recent advances in theory have produced predictions with much higher precision than the current experiments. Therefore, work has been done to develop a 2 nd generation experiment to measure the 23S1 → 23PJ intervals in positronium. Previous experiments used the enhancement of the Lyman-a radiation from the 23P J states in order to observe the 23S1 → 23PJ resonance line. In the 2nd generation experiment the 23S1 positronium is observed by photo-ionizing the positronium and detecting the photo-positron. This signal is then depleted when microwave radiation is applied on resonance as compared to the signal off resonance. The ultimate goal of the 2nd generation experiment is to improve the precision of the measurement of the 2 3S1 → 23P2 interval from 1.5 MHz to 100 kHz. This dissertation describes the current status of the development of this 2nd generation experiment. This includes the development of all of the major subsystems necessary for detecting the 23S 1 → 23PJ transition, including the accumulated positron beam, the pulsed laser beam, the microwave delivery apparatus, and the interaction region. Results are presented showing the first photo-positron signal using an accumulated positron beam. The rate of this signal is approximately 100 mHz as compared to 15 mHz in the 1st generation experiments. This rate is sufficient to produce a 23S1 → 23P2 interval measurement with precision of 3 MHz with 8 hours of data acquisition and 600 kHz after 30 days. Potential improvements to the technique are suggested to allow for a 100 kHz measurement. Additionally, results are presented for Doppler broadening measurements of thermalization of

  4. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  5. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  6. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  7. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  8. Shewanella sp. O23S as a Driving Agent of a System Utilizing Dissimilatory Arsenate-Reducing Bacteria Responsible for Self-Cleaning of Water Contaminated with Arsenic

    PubMed Central

    Drewniak, Lukasz; Stasiuk, Robert; Uhrynowski, Witold; Sklodowska, Aleksandra

    2015-01-01

    The purpose of this study was a detailed characterization of Shewanella sp. O23S, a strain involved in arsenic transformation in ancient gold mine waters contaminated with arsenic and other heavy metals. Physiological analysis of Shewanella sp. O23S showed that it is a facultative anaerobe, capable of growth using arsenate, thiosulfate, nitrate, iron or manganite as a terminal electron acceptor, and lactate or citrate as an electron donor. The strain can grow under anaerobic conditions and utilize arsenate in the respiratory process in a broad range of temperatures (10–37 °C), pH (4–8), salinity (0%–2%), and the presence of heavy metals (Cd, Co, Cr, Cu, Mn, Mo, Se, V and Zn). Under reductive conditions this strain can simultaneously use arsenate and thiosulfate as electron acceptors and produce yellow arsenic (III) sulfide (As2S3) precipitate. Simulation of As-removal from water containing arsenate (2.5 mM) and thiosulfate (5 mM) showed 82.5% efficiency after 21 days of incubation at room temperature. Based on the obtained results, we have proposed a model of a microbially mediated system for self-cleaning of mine waters contaminated with arsenic, in which Shewanella sp. O23S is the main driving agent. PMID:26121297

  9. Shewanella sp. O23S as a Driving Agent of a System Utilizing Dissimilatory Arsenate-Reducing Bacteria Responsible for Self-Cleaning of Water Contaminated with Arsenic.

    PubMed

    Drewniak, Lukasz; Stasiuk, Robert; Uhrynowski, Witold; Sklodowska, Aleksandra

    2015-06-25

    The purpose of this study was a detailed characterization of Shewanella sp. O23S, a strain involved in arsenic transformation in ancient gold mine waters contaminated with arsenic and other heavy metals. Physiological analysis of Shewanella sp. O23S showed that it is a facultative anaerobe, capable of growth using arsenate, thiosulfate, nitrate, iron or manganite as a terminal electron acceptor, and lactate or citrate as an electron donor. The strain can grow under anaerobic conditions and utilize arsenate in the respiratory process in a broad range of temperatures (10-37 °C), pH (4-8), salinity (0%-2%), and the presence of heavy metals (Cd, Co, Cr, Cu, Mn, Mo, Se, V and Zn). Under reductive conditions this strain can simultaneously use arsenate and thiosulfate as electron acceptors and produce yellow arsenic (III) sulfide (As2S3) precipitate. Simulation of As-removal from water containing arsenate (2.5 mM) and thiosulfate (5 mM) showed 82.5% efficiency after 21 days of incubation at room temperature. Based on the obtained results, we have proposed a model of a microbially mediated system for self-cleaning of mine waters contaminated with arsenic, in which Shewanella sp. O23S is the main driving agent.

  10. hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0.

    PubMed

    Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

    2015-01-01

    Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5'-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site.

  11. New polymorphic mtDNA restriction site in the 12S rRNA gene detected in Tunisian patients with non-syndromic hearing loss

    SciTech Connect

    Mkaouar-Rebai, Emna Tlili, Abdelaziz; Masmoudi, Saber; Charfeddine, Ilhem; Fakhfakh, Faiza

    2008-05-09

    The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndromic hearing loss and 100 hearing individuals were analysed in this study. A PCR-RFLP analysis with HaeIII restriction enzyme showed the presence of the A1555G mutation in the 12S rRNA gene in only one out of the 100 patients. In addition, PCR-RFLP and radioactive PCR revealed the presence of a new HaeIII polymorphic restriction site in the same gene of 12S rRNA site in 4 patients with non-syndromic hearing loss. UVIDOC-008-XD analyses showed the presence of this new polymorphic restriction site with a variable heteroplasmic rates at position +1517 of the human mitochondrial genome. On the other hand, direct sequencing of the entire mitochondrial 12S rRNA gene in the 100 patients and in 100 hearing individuals revealed the presence of the A750G and A1438G polymorphisms and the absence of the C1494T, T1095C and 961insC mutations in all the tested individuals. Sequencing of the whole mitochondrial genome in the 4 patients showing the new HaeIII polymorphic restriction site revealed only the presence of the A8860G transition in the MT-ATP6 gene and the A4769G polymorphism in the ND2 gene.

  12. Leader peptides of inducible chloramphenicol resistance genes from gram-positive and gram-negative bacteria bind to yeast and Archaea large subunit rRNA.

    PubMed Central

    Harrod, R; Lovett, P S

    1997-01-01

    catA86 is the second gene in a constitutively transcribed, two-gene operon cloned from Bacillus pumilus . The region that intervenes between the upstream gene, termed the leader, and the catA86 coding sequence contains a pair of inverted repeat sequences which cause sequestration of the catA86 ribosome binding site in mRNA secondary structure. As a consequence, the catA86 coding sequence is untranslatable in the absence of inducer. Translation of the catA86 coding sequence is induced by chloramphenicol in Gram-positives and induction requires a function of the leader coding sequence. The leader-encoded peptide has been proposed to instruct its translating ribosome to pause at leader codon 6, enabling chloramphenicol to stall the ribosome at that site. Ribosome stalling causes destabilization of the RNA secondary structure, exposing the catA86 ribosome binding site, allowing activation of its translation. A comparable mechanism of induction by chloramphenicol has been proposed for the regulated cmlA gene from Gram-negative bacteria. The catA86 and cmlA leader-encoded peptides are in vitro inhibitors of peptidyl transferase, which is thought to be the basis for selection of the site of ribosome stalling. Both leader-encoded peptides have been shown to alter the secondary structure of Escherichia coli 23S rRNA in vitro. All peptide-induced changes in rRNA conformation are within domains IV and V, which contains the peptidyl transferase center. Here we demonstrate that the leader peptides alter the conformation of domains IV and V of large subunit rRNA from yeast and a representative of the Archaea. The rRNA target for binding the leader peptides is therefore conserved across kingdoms. PMID:9108153

  13. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    PubMed Central

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2015-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. PMID:25539917

  14. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    PubMed

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria.

  15. RRP5 is required for formation of both 18S and 5.8S rRNA in yeast.

    PubMed Central

    Venema, J; Tollervey, D

    1996-01-01

    Three of the four eukaryotic ribosomal RNA molecules (18S, 5.8S and 25-28S) are synthesized as a single precursor which is subsequently processed into the mature rRNAs by a complex series of cleavage and modification reactions. In the yeast Saccharomyces cerevisiae, the early pre-rRNA cleavages at sites A0, A1 and A2, required for the synthesis of 18S rRNA, are inhibited in strains lacking RNA or protein components of the U3, U14, snR10 and snR30 small nucleolar ribonucleoproteins (snoRNPs). The subsequent cleavage at site A3, required for formation of the major, short form of 5.8S rRNA, is carried out by another ribonucleoprotein, RNase MRP. A screen for mutations showing synthetic lethality with deletion of the non-essential snoRNA, snR10, identified a novel gene, RRP5, which is essential for viability and encodes a 193 kDa nucleolar protein. Genetic depletion of Rrp5p inhibits the synthesis of 18S rRNA and, unexpectedly, also of the major short form of 5.8S rRNA. Pre-rRNA processing is concomitantly impaired at sites A0, A1, A2 and A3. This distinctive phenotype makes Rrp5p the first cellular component simultaneously required for the snoRNP-dependent cleavage at sites A0, A1 and A2 and the RNase MRP-dependent cleavage at A3 and provides evidence for a close interconnection between these processing events. Putative RRP5 homologues from Caenorhabditis elegans and humans were also identified, suggesting that the critical function of Rrp5p is evolutionarily conserved. Images PMID:8896463

  16. Development of a PCR assay based on the 16S-23S rDNA internal transcribed spacer for identification of strictly anaerobic bacterium Zymophilus.

    PubMed

    Felsberg, Jurgen; Jelínková, Markéta; Kubizniaková, Petra; Matoulková, Dagmar

    2015-06-01

    PCR-primers were designed for identification of strictly anaerobic bacteria of the genus Zymophilus based on genus-specific sequences of the 16S-23S rDNA internal transcribed spacer region. The specificity of the primers was tested against 37 brewery-related non-target microorganisms that could potentially occur in the same brewery specimens. None DNA was amplified from any of the non-Zymophilus strains tested including genera from the same family (Pectinatus, Megasphaera, Selenomonas), showing thus 100% specificity. PCR assay developed in this study allows an extension of the spectra of detected beer spoilage microorganisms in brewery laboratories. PMID:25725268

  17. Characterization of the Lancefield group C streptococcus 16S-23S RNA gene intergenic spacer and its potential for identification and sub-specific typing.

    PubMed Central

    Chanter, N.; Collin, N.; Holmes, N.; Binns, M.; Mumford, J.

    1997-01-01

    The 16S-23S RNA gene intergenic spacers of isolates of Streptococcus equi (n = 5), S. zooepidemicus (n = 5), S. equisimilis (n = 3) and S. dysgalactiae (n = 2) were sequenced and compared. There were distinct regions within the spacer, arranged in the order 1-9 for all S. equi and one S. zooepidemicus isolate and 1,2 and 4-9 for the remaining isolates. Region 4 was identical to the tRNA(ala) gene found in the 16S-23S intergenic spacers of other streptococci. Regions 1, 5, 6 and 7 had distinct variations, each conserved in different isolates. However, amongst the intergenic spacers there were different combinations of variant regions, suggesting a role for DNA recombination in their evolution. The intergenic spacer of all isolates of S. equi and one S. zooepidemicus isolate were almost identical. Primers derived from the variant sequences of regions 1 and 5 to 6 were used to group all S. zooepidemicus (n = 17) and S. equi (n = 5) into 1 of 8 types by polymerase chain reaction; three S. zooepidemicus isolates typed the same as S. equi. S. equi and S. zooepidemicus were clearly distinguishable from S. equisimilis and S. dysgalactiae which had shorter regions 5 and 6 and no region 7. Most homology for the group C sequences was found in previously published sequences for the 16S-23S intergenic spacers of S. anginosis, S. constellatus, S. intermedius, S. salivarius and S. agalactiae. A 75-90 nucleotide length shared with S. anginosus and S. intermedius in opposite orientations in the two main variants of region 6 supported the role for DNA recombination in the evolution of the spacer. The 16S-23S intergenic spacers indicate that S. zooepidemicus was the archetypal species for S. equi and that both are genetically more distant from S. equisimilis and S. dysgalactiae. The intergenic spacer can be used to identify specifically the group C streptococci and as an epidemiological marker for S. zooepidemicus. PMID:9129589

  18. Silenced rRNA genes are activated and substitute for partially eliminated active homeologs in the recently formed allotetraploid, Tragopogon mirus (Asteraceae).

    PubMed

    Dobešová, E; Malinská, H; Matyášek, R; Leitch, A R; Soltis, D E; Soltis, P S; Kovařík, A

    2015-03-01

    To study the relationship between uniparental rDNA (encoding 18S, 5.8S and 26S ribosomal RNA) silencing (nucleolar dominance) and rRNA gene dosage, we studied a recently emerged (within the last 80 years) allotetraploid Tragopogon mirus (2n=24), formed from the diploid progenitors T. dubius (2n=12, D-genome donor) and T. porrifolius (2n=12, P-genome donor). Here, we used molecular, cytogenetic and genomic approaches to analyse rRNA gene activity in two sibling T. mirus plants (33A and 33B) with widely different rRNA gene dosages. Plant 33B had ~400 rRNA genes at the D-genome locus, which is typical for T. mirus, accounting for ~25% of total rDNA. We observed characteristic expression dominance of T. dubius-origin genes in all organs. Its sister plant 33A harboured a homozygous macrodeletion that reduced the number of T. dubius-origin genes to about 70 copies (~4% of total rDNA). It showed biparental rDNA expression in root, flower and callus, but not in leaf where D-genome rDNA dominance was maintained. There was upregulation of minor rDNA variants in some tissues. The RNA polymerase I promoters of reactivated T. porrifolius-origin rRNA genes showed reduced DNA methylation, mainly at symmetrical CG and CHG nucleotide motifs. We hypothesise that active, decondensed rDNA units are most likely to be deleted via recombination. The silenced homeologs could be used as a 'first reserve' to ameliorate mutational damage and contribute to evolutionary success of polyploids. Deletion and reactivation cycles may lead to bidirectional homogenisation of rRNA arrays in the long term. PMID:25537492

  19. The GA motif: an RNA element common to bacterial antitermination systems, rRNA, and eukaryotic RNAs.

    PubMed Central

    Winkler, W C; Grundy, F J; Murphy, B A; Henkin, T M

    2001-01-01

    Two different transcription termination control mechanisms, the T box and S box systems, are used to regulate transcription of many bacterial aminoacyl-tRNA synthetase, amino acid biosynthesis, and amino acid transport genes. Both of these regulatory mechanisms involve an untranslated mRNA leader region capable of adopting alternate structural conformations that result in transcription termination or transcription elongation into the downstream region. Comparative analyses revealed a small RNA secondary structural element, designated the GA motif, that is highly conserved in both T box and S box leader sequences. The motif consists of two short helices separated by an asymmetric internal loop, with highly conserved GA dinucleotide sequences on either side of the internal loop. Site-directed mutagenesis of this motif in model T and S box leader sequences indicated that it is essential for transcriptional regulation in both systems. This motif is similar to the binding site of yeast ribosomal protein L30, the Snu13p binding sites found in U4 snRNA and box C/D snoRNAs, and two elements in 23S rRNA. PMID:11497434

  20. Assignment of the Schüler band of the ammonium radical to the 3 p2F2-3 s2A1 electronic transition

    NASA Astrophysics Data System (ADS)

    Watson, James K. G.

    1984-09-01

    Various visible emission bands observed by Schuster and by Schüler, Michel, and Grün when ammonia was subjected to a discharge or to electron beam excitation have been shown by Herzberg to be due to the ammonium radical, NH 4. It is proposed here that the main band of Schüler et al. near 6635 Å in NH 4 and 6750 Å in ND 4 is the 0-0 band of the electronic transition 3 p2F2-3 s2A1 of the odd electron outside the closed-shell NH 4+ or ND 4+ core, analogous to the D lines of the isoelectronic Na atom. This interpretation is consistent with recent work by Porter and co-workers on neutralized-ion-beam spectroscopy and by Hunziker and co-workers on the absorption spectrum of ND 4 by laser frequency modulation spectroscopy. The theory of the rotational structure of a p2F2- s2A1 electronic transition is developed. In the accompanying paper by Alberti, Huber, and Watson on the absorption spectrum of the Schüler band obtained in a flash discharge experiment, it is shown that the observed rotational structure is fully explained by this assignment. The other visible bands of the ammonium radical may represent vibrational structure of the 3 p2F2-3 s2A1 electronic transition.

  1. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  2. Bud23 methylates G1575 of 18S rRNA and is required for efficient nuclear export of pre-40S subunits.

    PubMed

    White, Joshua; Li, Zhihua; Sardana, Richa; Bujnicki, Janusz M; Marcotte, Edward M; Johnson, Arlen W

    2008-05-01

    BUD23 was identified from a bioinformatics analysis of Saccharomyces cerevisiae genes involved in ribosome biogenesis. Deletion of BUD23 leads to severely impaired growth, reduced levels of the small (40S) ribosomal subunit, and a block in processing 20S rRNA to 18S rRNA, a late step in 40S maturation. Bud23 belongs to the S-adenosylmethionine-dependent Rossmann-fold methyltransferase superfamily and is related to small-molecule methyltransferases. Nevertheless, we considered that Bud23 methylates rRNA. Methylation of G1575 is the only mapped modification for which the methylase has not been assigned. Here, we show that this modification is lost in bud23 mutants. The nuclear accumulation of the small-subunit reporters Rps2-green fluorescent protein (GFP) and Rps3-GFP, as well as the rRNA processing intermediate, the 5' internal transcribed spacer 1, indicate that bud23 mutants are defective for small-subunit export. Mutations in Bud23 that inactivated its methyltransferase activity complemented a bud23Delta mutant. In addition, mutant ribosomes in which G1575 was changed to adenosine supported growth comparable to that of cells with wild-type ribosomes. Thus, Bud23 protein, but not its methyltransferase activity, is important for biogenesis and export of the 40S subunit in yeast.

  3. Decoupled distance-decay patterns between dsrA and 16S rRNA genes among salt marsh sulfate-reducing bacteria.

    PubMed

    Angermeyer, Angus; Crosby, Sarah C; Huber, Julie A

    2016-01-01

    In many habitats, microorganisms exhibit significant distance-decay patterns as determined by analysis of the 16S rRNA gene and various other genetic elements. However, there have been few studies that examine how the similarities of both taxonomic and functional genes co-vary over geographic distance within a group of ecologically related microbes. Here, we determined the biogeographic patterns of the functional dissimilatory sulfite reductase gene (dsrA) and the 16S rRNA gene in sulfate-reducing bacterial communities of US East Coast salt marsh sediments. Distance-decay, ordination and statistical analyses revealed that the distribution of 16S rRNA genes is strongly influenced by geographic distance and environmental factors, whereas the dsrA gene is not. Together, our results indicate that 16S rRNA genes are likely dispersal limited and under environmental selection, whereas dsrA genes appear randomly distributed and not selected for by any expected environmental variables. Selection, drift, dispersal and mutation are all factors that may help explain the decoupled biogeographic patterns for the two genes. These data suggest that both the taxonomic and functional elements of microbial communities should be considered in future studies of microbial biogeography to aid in our understanding of the diversity, distribution and function of microorganisms in the environment. PMID:25727503

  4. Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns*

    PubMed Central

    Atherly, Todd; Ziemer, Cherie J

    2014-01-01

    One-hundred-and-three isolates of Bacteroides ovatus,B. thetaiotaomicron, and B. xylanisolvens were recovered from cow, goat, human, and pig fecal enrichments with cellulose or xylan/pectin. Isolates were compared using 16S rRNA gene sequencing, repetitive sequence-based polymerase chain reaction (rep-PCR), and phenotypic microarrays. Analysis of 16S rRNA gene sequences revealed high sequence identity in these Bacteroides; with distinct phylogenetic groupings by bacterial species but not host origin. Phenotypic microarray analysis demonstrated these Bacteroides shared the ability to utilize many of the same carbon substrates, without differences due to species or host origin, indicative of their broad carbohydrate fermentation abilities. Limited nitrogen substrates were utilized; in addition to ammonia, guanine, and xanthine, purine derivatives were utilized by most isolates followed by a few amino sugars. Only rep-PCR analysis demonstrated host-specific patterns, indicating that genomic changes due to coevolution with host did not occur by mutation in the 16S rRNA gene or by a gain or loss of carbohydrate utilization genes within these Bacteroides. This is the first report to indicate that host-associated genomic differences are outside of 16S rRNA gene and carbohydrate utilization genes and suggest conservation of specific bacterial species with the same functionality across mammalian hosts for this Bacteroidetes clade. PMID:24532571

  5. Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns.

    PubMed

    Atherly, Todd; Ziemer, Cherie J

    2014-04-01

    One-hundred-and-three isolates of Bacteroides ovatus, B. thetaiotaomicron, and B. xylanisolvens were recovered from cow, goat, human, and pig fecal enrichments with cellulose or xylan/pectin. Isolates were compared using 16S rRNA gene sequencing, repetitive sequence-based polymerase chain reaction (rep-PCR), and phenotypic microarrays. Analysis of 16S rRNA gene sequences revealed high sequence identity in these Bacteroides; with distinct phylogenetic groupings by bacterial species but not host origin. Phenotypic microarray analysis demonstrated these Bacteroides shared the ability to utilize many of the same carbon substrates, without differences due to species or host origin, indicative of their broad carbohydrate fermentation abilities. Limited nitrogen substrates were utilized; in addition to ammonia, guanine, and xanthine, purine derivatives were utilized by most isolates followed by a few amino sugars. Only rep-PCR analysis demonstrated host-specific patterns, indicating that genomic changes due to coevolution with host did not occur by mutation in the 16S rRNA gene or by a gain or loss of carbohydrate utilization genes within these Bacteroides. This is the first report to indicate that host-associated genomic differences are outside of 16S rRNA gene and carbohydrate utilization genes and suggest conservation of specific bacterial species with the same functionality across mammalian hosts for this Bacteroidetes clade.

  6. Decoupled distance-decay patterns between dsrA and 16S rRNA genes among salt marsh sulfate-reducing bacteria.

    PubMed

    Angermeyer, Angus; Crosby, Sarah C; Huber, Julie A

    2016-01-01

    In many habitats, microorganisms exhibit significant distance-decay patterns as determined by analysis of the 16S rRNA gene and various other genetic elements. However, there have been few studies that examine how the similarities of both taxonomic and functional genes co-vary over geographic distance within a group of ecologically related microbes. Here, we determined the biogeographic patterns of the functional dissimilatory sulfite reductase gene (dsrA) and the 16S rRNA gene in sulfate-reducing bacterial communities of US East Coast salt marsh sediments. Distance-decay, ordination and statistical analyses revealed that the distribution of 16S rRNA genes is strongly influenced by geographic distance and environmental factors, whereas the dsrA gene is not. Together, our results indicate that 16S rRNA genes are likely dispersal limited and under environmental selection, whereas dsrA genes appear randomly distributed and not selected for by any expected environmental variables. Selection, drift, dispersal and mutation are all factors that may help explain the decoupled biogeographic patterns for the two genes. These data suggest that both the taxonomic and functional elements of microbial communities should be considered in future studies of microbial biogeography to aid in our understanding of the diversity, distribution and function of microorganisms in the environment.

  7. Mutations in eukaryotic 18S ribosomal RNA affect translational fidelity and resistance to aminoglycoside antibiotics.

    PubMed

    Chernoff, Y O; Vincent, A; Liebman, S W

    1994-02-15

    Mutations have been created in the Saccharomyces cerevisiae 18S rRNA gene that correspond to those known to be involved in the control of translational fidelity or antibiotic resistance in prokaryotes. Yeast strains, in which essentially all chromosomal rDNA repeats are deleted and all cellular rRNAs are encoded by plasmid, have been constructed that contain only mutant 18S rRNA. In Escherichia coli, a C-->U substitution at position 912 of the small subunit rRNA causes streptomycin resistance. Eukaryotes normally carry U at the corresponding position and are naturally resistant to streptomycin. We show that a U-->C transition (rdn-4) at this position of the yeast 18S rRNA gene decreases resistance to streptomycin. The rdn-4 mutation also increases resistance to paromomycin and G-418, and inhibits nonsense suppression induced by paromomycin. The same phenotypes, as well as a slow growth phenotype, are also associated with rdn-2, whose prokaryotic counterpart, 517 G-->A, manifests itself as a suppressor rather than an antisuppressor. Neither rdn-2- nor rdn-4-related phenotypes could be detected in the presence of the normal level of wild-type rDNA repeats. Our data demonstrate that eukaryotic rRNA is involved in the control of translational fidelity, and indicate that rRNA features important for interactions with aminoglycosides have been conserved throughout evolution.

  8. The Dynamics of Atom-Surface Interactions Involving HELIUM(2(1)S), HELIUM(2(3)P) and Electron-Spin HELIUM(2(3)S) Atoms

    NASA Astrophysics Data System (ADS)

    Oro, David Michael

    1994-01-01

    For several years Metastable Atom Deexcitation Spectroscopy (MDS) has been employed as a probe of surface electronic structure offering unparalleled surface specificity. In MDS a thermal-energy beam of rare-gas metastable atoms is directed at the surface under study, and the energy distribution of electrons ejected as a result of metastable atom deexcitation is measured. However, correct interpretation of the data requires detailed knowledge of the dynamics of the deexcitation process. In the present work spin -labeling techniques, specifically the use of electron-spin -polarized metastable He(2^3S) atoms, coupled with spin analysis of the ejected electrons, are used to probe the dynamics of He(2^3S) deexcitation at a variety of surfaces. Such measurements, coupled with studies of the deexcitation of He(2 ^1S) and He(2^3P) atoms at Cu(100) and Au(100) show that each species deexcites exclusively through resonance ionization followed by Auger neutralization. The data also provide the first direct confirmation of spin correlation in the Auger neutralization of ions outside a paramagnetic surface. Two proposed models for spin correlation are discussed and potential experimental tests for distinguishing between them are suggested. Studies of SPMDS at surfaces comprising layers of Ar or Xe atoms frozen onto a cryogenically cooled substrate are described and exhibit behavior similar to that observed in gas phase Penning ionization studies indicating that ejection results, in part, from surface Penning ionization (SPI). For Xe, however, additional features are observed and can be attributed to resonance ionization of the incident excited atoms followed by neutralization of the resulting He^+ ions through an interaction involving neighboring Xe atoms in the film. These results provide a rare example of a surface at which the rates for resonance ionization and Auger deexcitation are comparable. Also, the data show that the electron yield from both films is substantially higher than that from atomically clean metal surfaces. Potential experimental applications of the large spin correlation in He(2^3S) deexcitation at Cu and Au, and of deexcitation at Xe(100) and Ar(100) films are discussed.

  9. Effects of single-base substitutions within the acanthamoeba castellanii rRNA promoter on transcription and on binding of transcription initiation factor and RNA polymerase I

    SciTech Connect

    Kownin, P.; Bateman, E.; Paule, M.R.

    1988-02-01

    Single-point mutations were introduced into the promoter region of the Acanthamoeba castellanii rRNA gene by chemical mutagen treatment of a single-stranded clone in vitro, followed by reverse transcription and cloning of the altered fragment. The promoter mutants were tested for transcription initiation factor (TIF) binding by a template commitment assay plus DNase I footprinting and for transcription by an in vitro runoff assay. Point mutations within the previously identified TIF interaction region (between -20 and -47, motifs A and B) indicated that TIF interacts most strongly with a sequence centered at -29 and less tightly with sequences upstream and downstream. Some alterations of the base sequence closer to the transcription start site (and outside the TIF-protected site) also significantly decrease specific RNA synthesis in vitro. These were within the region which is protected from DNAse I digestion by polymerase I, but these mutations did not detectably affect the binding of polymerase to the promoter.

  10. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  11. DNA fingerprinting of Paenibacillus popilliae and Paenibacillus lentimorbus using PCR-amplified 16S-23S rDNA intergenic transcribed spacer (ITS) regions.

    PubMed

    Dingman, Douglas W

    2009-01-01

    Failure to identify correctly the milky disease bacteria, Paenibacillus popilliae and Paenibacillus lentimorbus, has resulted in published research errors and commercial production problems. A DNA fingerprinting procedure, using PCR amplification of the 16S-23S rDNA intergenic transcribed spacer (ITS) regions, has been shown to easily and accurately identify isolates of milky disease bacteria. Using 34 P. popilliae and 15 P. lentimorbus strains, PCR amplification of different ITS regions produced three DNA fingerprints. For P. lentimorbus phylogenic group 2 strains and for all P. popilliae strains tested, electrophoresis of amplified DNA produced a migratory pattern (i.e., ITS-PCR fingerprint) exhibiting three DNA bands. P. lentimorbus group 1 strains also produced this ITS-PCR fingerprint. However, the fingerprint was phase-shifted toward larger DNA sizes. Alignment of the respective P. popilliae and P. lentimorbus group 1 ITS DNA sequences showed extensive homology, except for a 108bp insert in all P. lentimorbus ITS regions. This insert occurred at the same location relative to the 23S rDNA and accounted for the phase-shift difference in P. lentimorbus group 1 DNA fingerprints. At present, there is no explanation for this 108bp insert. The third ITS-PCR fingerprint, produced by P. lentimorbus group 3 strains, exhibited approximately eight DNA bands. Comparison of the three fingerprints of milky disease bacteria to the ITS-PCR fingerprints of other Paenibacillus species demonstrated uniqueness. ITS-PCR fingerprinting successfully identified eight unknown isolates as milky disease bacteria. Therefore, this procedure can serve as a standard protocol to identify P. popilliae and P. lentimorbus.

  12. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  13. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  14. Posttranscriptional down-regulation of small ribosomal subunit proteins correlates with reduction of 18S rRNA in RPS19 deficiency.

    PubMed

    Badhai, Jitendra; Fröjmark, Anne-Sophie; Razzaghian, Hamid Reza; Davey, Edward; Schuster, Jens; Dahl, Niklas

    2009-06-18

    Ribosomal protein S19 (RPS19) is mutated in patients with Diamond-Blackfan anemia (DBA). We hypothesized that decreased levels of RPS19 lead to a coordinated down-regulation of other ribosomal (r-)proteins at the subunit level. We show that small interfering RNA (siRNA) knock-down of RPS19 results in a relative decrease of small subunit (SSU) r-proteins (S20, S21 and S24) when compared to large subunit (LSU) r-proteins (L3, L9, L30 and L38). This correlates with a relative decrease in 18S rRNA with respect to 28S rRNA. The r-protein mRNA levels remain relatively unchanged indicating a post transcriptional regulation of r-proteins at the level of subunit formation.

  15. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  16. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  17. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  18. Nucleolar localization elements in U8 snoRNA differ from sequences required for rRNA processing.

    PubMed Central

    Lange, T S; Borovjagin, A V; Gerbi, S A

    1998-01-01

    U8 small nucleolar RNA (snoRNA) is essential for metazoan ribosomal RNA (rRNA) processing in nucleoli. The sequences and structural features in Xenopus U8 snoRNA that are required for its nucleolar localization were analyzed. Fluorescein-labeled U8 snoRNA was injected into Xenopus oocyte nuclei, and fluorescence microscopy of nucleolar preparations revealed that wild-type Xenopus U8 snoRNA localized to nucleoli, regardless of the presence or nature of the 5' cap on the injected U8 snoRNA. Nucleolar localization was observed when loops or stems in the 5' portion of U8 that are critical for U8 snoRNA function in rRNA processing were mutated. Therefore, sites of interaction in U8 snoRNA that potentially tether it to pre-rRNA are not essential for nucleolar localization of U8. Boxes C and D are known to be nucleolar localization elements (NoLEs) for U8 snoRNA and other snoRNAs of the Box C/D family. However, the spatial relationship of Box C to Box D was not crucial for U8 nucleolar localization, as demonstrated here by deletion of sequences in the two stems that separate them. These U8 mutants can localize to nucleoli and function in rRNA processing as well. The single-stranded Cup region in U8, adjacent to evolutionarily conserved Box C, functions as a NoLE in addition to Boxes C and D. Cup is unique to U8 snoRNA and may help bind putative protein(s) needed for nucleolar localization. Alternatively, Cup may help to retain U8 snoRNA within the nucleolus. PMID:9671052

  19. Genetic identification of yeast 18S rRNA residues required for efficient recruitment of initiator tRNA(Met) and AUG selection.

    PubMed

    Dong, Jinsheng; Nanda, Jagpreet S; Rahman, Hafsa; Pruitt, Margaret R; Shin, Byung-Sik; Wong, Chi-Ming; Lorsch, Jon R; Hinnebusch, Alan G

    2008-08-15

    High-resolution structures of bacterial 70S ribosomes have provided atomic details about mRNA and tRNA binding to the decoding center during elongation, but such information is lacking for preinitiation complexes (PICs). We identified residues in yeast 18S rRNA critical in vivo for recruiting methionyl tRNA(i)(Met) to 40S subunits during initiation by isolating mutations that derepress GCN4 mRNA translation. Several such Gcd(-) mutations alter the A928:U1389 base pair in helix 28 (h28) and allow PICs to scan through the start codons of upstream ORFs that normally repress GCN4 translation. The A928U substitution also impairs TC binding to PICs in a reconstituted system in vitro. Mutation of the bulge G926 in h28 and certain other residues corresponding to direct contacts with the P-site codon or tRNA in bacterial 70S complexes confer Gcd(-) phenotypes that (like A928 substitutions) are suppressed by overexpressing tRNA(i)(Met). Hence, the nonconserved 928:1389 base pair in h28, plus conserved 18S rRNA residues corresponding to P-site contacts in bacterial ribosomes, are critical for efficient Met-tRNA(i)(Met) binding and AUG selection in eukaryotes.

  20. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  1. Axial and equatorial hydrogen-bond conformers between (CH2)3S and H(D)F: Fourier transform infrared spectroscopy and ab initio calculations.

    PubMed

    Madebène, B; Asselin, P; Soulard, P; Alikhani, M E

    2011-08-21

    The coexistence of axial and equatorial hydrogen-bonded conformers of 1 : 1 (CH(2))(3)S-HF (and -DF) has been observed in the same adiabatic expansion of a supersonic jet seeded with argon and in a static absorption cell at room temperature. High level calculations computed the axial conformer to be the most stable one with a small energy difference with respect to the equatorial one, in full agreement with previous microwave experiments. On the grounds of band contour simulations of FTIR spectra and ab initio energetic and anharmonic vibrational calculations, two pairs of ν(s) HF donor stretching bands, observed in a series of jet-FTIR spectra at 3457.9 and 3480.5 cm(-1) have been respectively assigned to the axial and equatorial forms of the 1 : 1 complex. In the jet-FTIR spectra series with HF, the assignment of an additional broad band (about 200 cm(-1) higher in frequency with respect to ν(s)) to a 1 : 2 complex has been supported by theoretical investigations. Experimental detection of both axial and equatorial forms of a cyclic trimer has been confirmed by calculated energetic and vibrational properties. The nature of hydrogen bonding has been examined within topological frameworks. The energetic partitioning within the 1 : 1 dimers has been elucidated with SAPT techniques. Interestingly, the interconversion pathway between two 1 : 1 structures has been explored and it was seen that the formation of the 1 : 1 complex affects the interconversion barrier on the ring puckering motion. The band contour analysis of gas phase FTIR experiments provided a consistent set of vibrational frequencies and anharmonic coupling constants, in good agreement with ab initio anharmonic vibrational calculations. Finally, from a series of cell-FTIR spectra recorded at different partial pressures of (CH(2))(3)S and HF monomers, the absorption signal of the 1 : 1 complex could be isolated which enabled to estimate the equilibrium constant K(p) = 0.023 at 298 K for the dimerization.

  2. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  3. Stereodynamics and outer valence ionic States of ferrocene in collisional ionization with a He*(2(3)S) metastable atom by two-dimensional penning ionization electron spectroscopy.

    PubMed

    Kishimoto, Naoki; Ohno, Koichi

    2009-01-22

    Outer valence ionic states of ferrocene were investigated by means of Penning ionization electron spectroscopy upon collision with metastable He*(2(3)S) excited atoms. By two-dimensional measurement combining electron spectroscopy and collision-energy-resolved technique of the metastable atomic beam, ionic-state-resolved measurements of collision energy dependence of partial Penning ionization cross sections (CEDPICS) were carried out. Since the partial Penning ionization cross sections can be connected with spatial extension of corresponding molecular orbitals (MOs) outside the boundary surface for the collision with He* atoms, different slope values of CEDPICS were related with stereodynamics in Penning ionization as well as anisotropic interaction around the ionization region: attractive interaction around ligand pi orbitals and repulsive interaction around ligand sigma orbtials and the metal atom. The observed negative collision energy dependence of ionization cross sections for the first ((2)E(2)') and second ((2)A(1)') ionic states was consistent with configuration interactions suggested by ab initio MO calculations [J. Chem. Phys. 2002, 117, 6533], which is due to the strong electron correlation effects beyond the one-electron MO description.

  4. Collision-energy-resolved penning ionization electron spectroscopy of glycine with He(2(3)S) metastable atoms: conformational isomers in collisional ionization.

    PubMed

    Yamakita, Yoshihiro; Ohno, Koichi

    2009-10-01

    Conformationally dependent ionization of the simplest amino acid, glycine, is studied by Penning ionization electron spectroscopy with velocity-resolved metastable He*(2(3)S) atoms. The observed He I ultraviolet photoelectron and Penning ionization electron spectra are reproduced by superimposed theoretical spectra, assuming thermal distributions of conformers. The conformations of amino acids are determined by analyzing the observed Penning ionization cross sections, peak shifts, and collision energy dependences of partial ionization cross sections (CEDPICS). The Penning ionization cross sections are governed by collisionally accessible exterior electron densities. When the amino and carbonyl groups are exposed to He* access, the nonbonding orbitals of N (n(N)) and O atoms (n(O)) give rise to strong bands. The observed negative peak shifts and negative CEDPICS for the n(N) and n(O) orbitals suggest the presence of attractive interactions around their electron distributions. The most attractive wells are estimated to be approximately 400 meV in the direction of the n(N) orbitals by ab initio model calculations. A conformer possessing dual hydrogen bonds contributes predominantly to the spectra.

  5. Elucidation of separate, but collaborative functions of the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 in mitochondrial biogenesis reveals new insight into maternally inherited deafness.

    PubMed

    Cotney, Justin; McKay, Sharen E; Shadel, Gerald S

    2009-07-15

    Mitochondrial biogenesis is controlled by signaling networks that relay information to and from the organelles. However, key mitochondrial factors that mediate such pathways and how they contribute to human disease are not understood fully. Here we demonstrate that the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 are key downstream effectors of mitochondrial biogenesis that perform unique, yet cooperative functions. The primary function of h-mtTFB2 is mtDNA transcription and maintenance, which is independent of its rRNA methyltransferase activity, while that of h-mtTFB1 is mitochondrial 12S rRNA methylation needed for normal mitochondrial translation, metabolism and cell growth. Over-expression of h-mtTFB1 causes 12S rRNA hypermethylation, aberrant mitochondrial biogenesis and increased sorbitol-induced cell death. These phenotypes are recapitulated in cells harboring the pathogenic A1555G mtDNA mutation, implicating a deleterious rRNA methylation-dependent retrograde signal in maternally inherited deafness pathology and shedding significant insight into how h-mtTFB1 acts as a nuclear modifier of this disease.

  6. Elucidation of separate, but collaborative functions of the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 in mitochondrial biogenesis reveals new insight into maternally inherited deafness

    PubMed Central

    Cotney, Justin; McKay, Sharen E.; Shadel, Gerald S.

    2009-01-01

    Mitochondrial biogenesis is controlled by signaling networks that relay information to and from the organelles. However, key mitochondrial factors that mediate such pathways and how they contribute to human disease are not understood fully. Here we demonstrate that the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 are key downstream effectors of mitochondrial biogenesis that perform unique, yet cooperative functions. The primary function of h-mtTFB2 is mtDNA transcription and maintenance, which is independent of its rRNA methyltransferase activity, while that of h-mtTFB1 is mitochondrial 12S rRNA methylation needed for normal mitochondrial translation, metabolism and cell growth. Over-expression of h-mtTFB1 causes 12S rRNA hypermethylation, aberrant mitochondrial biogenesis and increased sorbitol-induced cell death. These phenotypes are recapitulated in cells harboring the pathogenic A1555G mtDNA mutation, implicating a deleterious rRNA methylation-dependent retrograde signal in maternally inherited deafness pathology and shedding significant insight into how h-mtTFB1 acts as a nuclear modifier of this disease. PMID:19417006

  7. Mutational landscape of yeast mutator strains.

    PubMed

    Serero, Alexandre; Jubin, Claire; Loeillet, Sophie; Legoix-Né, Patricia; Nicolas, Alain G

    2014-02-01

    The acquisition of mutations is relevant to every aspect of genetics, including cancer and evolution of species on Darwinian selection. Genome variations arise from rare stochastic imperfections of cellular metabolism and deficiencies in maintenance genes. Here, we established the genome-wide spectrum of mutations that accumulate in a WT and in nine Saccharomyces cerevisiae mutator strains deficient for distinct genome maintenance processes: pol32Δ and rad27Δ (replication), msh2Δ (mismatch repair), tsa1Δ (oxidative stress), mre11Δ (recombination), mec1Δ tel1Δ (DNA damage/S-phase checkpoints), pif1Δ (maintenance of mitochondrial genome and telomere length), cac1Δ cac3Δ (nucleosome deposition), and clb5Δ (cell cycle progression). This study reveals the diversity, complexity, and ultimate unique nature of each mutational spectrum, composed of punctual mutations, chromosomal structural variations, and/or aneuploidies. The mutations produced in clb5Δ/CCNB1, mec1Δ/ATR, tel1Δ/ATM, and rad27Δ/FEN1 strains extensively reshape the genome, following a trajectory dependent on previous events. It comprises the transmission of unstable genomes that lead to colony mosaicisms. This comprehensive analytical approach of mutator defects provides a model to understand how genome variations might accumulate during clonal evolution of somatic cell populations, including tumor cells.

  8. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    PubMed

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii.

  9. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    PubMed

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. PMID:26818674

  10. Mutation accumulation and fitness in mutator subpopulations of Escherichia coli.

    PubMed

    Maharjan, Ram P; Liu, Bin; Li, Yang; Reeves, Peter R; Wang, Lei; Ferenci, Thomas

    2013-02-23

    Bacterial populations in clinical and laboratory settings contain a significant proportion of mutants with elevated mutation rates (mutators). Mutators have a particular advantage when multiple beneficial mutations are needed for fitness, as in antibiotic resistance. Nevertheless, high mutation rates potentially lead to increasing numbers of deleterious mutations and subsequently to the decreased fitness of mutators. To test how fitness changed with mutation accumulation, genome sequencing and fitness assays of nine Escherichia coli mutY mutators were undertaken in an evolving chemostat population at three time points. Unexpectedly, the fitness in members of the mutator subpopulation became constant despite a growing number of mutations over time. To test if the accumulated mutations affected fitness, we replaced each of the known beneficial mutations with wild-type alleles in a mutator isolate. We found that the other 25 accumulated mutations were not deleterious. Our results suggest that isolates with deleterious mutations are eliminated by competition in a continuous culture, leaving mutators with mostly neutral mutations. Interestingly, the mutator-non-mutator balance in the population reversed after the fitness plateau of mutators was reached, suggesting that the mutator-non-mutator ratio in populations has more to do with competition between members of the population than the accumulation of deleterious mutations.

  11. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  12. rRNA suppressor of a eukaryotic translation initiation factor 5B/initiation factor 2 mutant reveals a binding site for translational GTPases on the small ribosomal subunit.

    PubMed

    Shin, Byung-Sik; Kim, Joo-Ran; Acker, Michael G; Maher, Kathryn N; Lorsch, Jon R; Dever, Thomas E

    2009-02-01

    The translational GTPases promote initiation, elongation, and termination of protein synthesis by interacting with the ribosome. Mutations that impair GTP hydrolysis by eukaryotic translation initiation factor 5B/initiation factor 2 (eIF5B/IF2) impair yeast cell growth due to failure to dissociate from the ribosome following subunit joining. A mutation in helix h5 of the 18S rRNA in the 40S ribosomal subunit and intragenic mutations in domain II of eIF5B suppress the toxic effects associated with expression of the eIF5B-H480I GTPase-deficient mutant in yeast by lowering the ribosome binding affinity of eIF5B. Hydroxyl radical mapping experiments reveal that the domain II suppressors interface with the body of the 40S subunit in the vicinity of helix h5. As the helix h5 mutation also impairs elongation factor function, the rRNA and eIF5B suppressor mutations provide in vivo evidence supporting a functionally important docking of domain II of the translational GTPases on the body of the small ribosomal subunit.

  13. Analysis of mRNA decay and rRNA processing in Escherichia coli multiple mutants carrying a deletion in RNase III.

    PubMed Central

    Babitzke, P; Granger, L; Olszewski, J; Kushner, S R

    1993-01-01

    RNase III is an endonuclease involved in processing both rRNA and certain mRNAs. To help determine whether RNase III (rnc) is required for general mRNA turnover in Escherichia coli, we have created a deletion-insertion mutation (delta rnc-38) in the structural gene. In addition, a series of multiple mutant strains containing deficiencies in RNase II (rnb-500), polynucleotide phosphorylase (pnp-7 or pnp-200), RNase E (rne-1 or rne-3071), and RNase III (delta rnc-38) were constructed. The delta rnc-38 single mutant was viable and led to the accumulation of 30S rRNA precursors, as has been previously observed with the rnc-105 allele (P. Gegenheimer, N. Watson, and D. Apirion, J. Biol. Chem. 252:3064-3073, 1977). In the multiple mutant strains, the presence of the delta rnc-38 allele resulted in the more rapid decay of pulse-labeled RNA but did not suppress conditional lethality, suggesting that the lethality associated with altered mRNA turnover may be due to the stabilization of specific mRNAs. In addition, these results indicate that RNase III is probably not required for general mRNA decay. Of particular interest was the observation that the delta rnc-38 rne-1 double mutant did not accumulate 30S rRNA precursors at 30 degrees C, while the delta rnc-38 rne-3071 double mutant did. Possible explanations of these results are discussed. Images PMID:8416898

  14. UV Signature Mutations

    PubMed Central

    2014-01-01

    Sequencing complete tumor genomes and exomes has sparked the cancer field's interest in mutation signatures for identifying the tumor's carcinogen. This review and meta-analysis discusses signatures and their proper use. We first distinguish between a mutagen's canonical mutations – deviations from a random distribution of base changes to create a pattern typical of that mutagen – and the subset of signature mutations, which are unique to that mutagen and permit inference backward from mutations to mutagen. To verify UV signature mutations, we assembled literature datasets on cells exposed to UVC, UVB, UVA, or solar simulator light (SSL) and tested canonical UV mutation features as criteria for clustering datasets. A confirmed UV signature was: ≥60% of mutations are C→T at a dipyrimidine site, with ≥5% CC→TT. Other canonical features such as a bias for mutations on the non-transcribed strand or at the 3' pyrimidine had limited application. The most robust classifier combined these features with criteria for the rarity of non-UV canonical mutations. In addition, several signatures proposed for specific UV wavelengths were limited to specific genes or species; non-signature mutations induced by UV may cause melanoma BRAF mutations; and the mutagen for sunlight-related skin neoplasms may vary between continents. PMID:25354245

  15. Interaction between 25S rRNA A loop and eukaryotic translation initiation factor 5B promotes subunit joining and ensures stringent AUG selection.

    PubMed

    Hiraishi, Hiroyuki; Shin, Byung-Sik; Udagawa, Tsuyoshi; Nemoto, Naoki; Chowdhury, Wasimul; Graham, Jymie; Cox, Christian; Reid, Megan; Brown, Susan J; Asano, Katsura

    2013-09-01

    In yeast, 25S rRNA makes up the major mass and shape of the 60S ribosomal subunit. During the last step of translation initiation, eukaryotic initiation factor 5B (eIF5B) promotes the 60S subunit joining with the 40S initiation complex (IC). Malfunctional 60S subunits produced by misfolding or mutation may disrupt the 40S IC stalling on the start codon, thereby altering the stringency of initiation. Using several point mutations isolated by random mutagenesis, here we studied the role of 25S rRNA in start codon selection. Three mutations changing bases near the ribosome surface had strong effects, allowing the initiating ribosomes to skip both AUG and non-AUG codons: C2879U and U2408C, altering the A loop and P loop, respectively, of the peptidyl transferase center, and G1735A, mapping near a Eukarya-specific bridge to the 40S subunit. Overexpression of eIF5B specifically suppressed the phenotype caused by C2879U, suggesting functional interaction between eIF5B and the A loop. In vitro reconstitution assays showed that C2879U decreased eIF5B-catalyzed 60S subunit joining with a 40S IC. Thus, eIF5B interaction with the peptidyl transferase center A loop increases the accuracy of initiation by stabilizing the overall conformation of the 80S initiation complex. This study provides an insight into the effect of ribosomal mutations on translation profiles in eukaryotes.

  16. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  17. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  18. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  19. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  20. Nucleolar Assembly of the Rrna Processing Machinery in Living Cells

    PubMed Central

    Savino, Tulia Maria; Gébrane-Younès, Jeannine; De Mey, Jan; Sibarita, Jean-Baptiste; Hernandez-Verdun, Danièle

    2001-01-01

    To understand how nuclear machineries are targeted to accurate locations during nuclear assembly, we investigated the pathway of the ribosomal RNA (rRNA) processing machinery towards ribosomal genes (nucleolar organizer regions [NORs]) at exit of mitosis. To follow in living cells two permanently transfected green fluorescence protein–tagged nucleolar proteins, fibrillarin and Nop52, from metaphase to G1, 4-D time-lapse microscopy was used. In early telophase, fibrillarin is concentrated simultaneously in prenucleolar bodies (PNBs) and NORs, whereas PNB-containing Nop52 forms later. These distinct PNBs assemble at the chromosome surface. Analysis of PNB movement does not reveal the migration of PNBs towards the nucleolus, but rather a directional flow between PNBs and between PNBs and the nucleolus, ensuring progressive delivery of proteins into nucleoli. This delivery appeared organized in morphologically distinct structures visible by electron microscopy, suggesting transfer of large complexes. We propose that the temporal order of PNB assembly and disassembly controls nucleolar delivery of these proteins, and that accumulation of processing complexes in the nucleolus is driven by pre-rRNA concentration. Initial nucleolar formation around competent NORs appears to be followed by regroupment of the NORs into a single nucleolus 1 h later to complete the nucleolar assembly. This demonstrates the formation of one functional domain by cooperative interactions between different chromosome territories. PMID:11381093

  1. Characterization and evolution of cell division and cell wall synthesis genes in the bacterial phyla Verrucomicrobia, Lentisphaerae, Chlamydiae, and Planctomycetes and phylogenetic comparison with rRNA genes.

    PubMed

    Pilhofer, Martin; Rappl, Kristina; Eckl, Christina; Bauer, Andreas Peter; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Petroni, Giulio

    2008-05-01

    In the past, studies on the relationships of the bacterial phyla Planctomycetes, Chlamydiae, Lentisphaerae, and Verrucomicrobia using different phylogenetic markers have been controversial. Investigations based on 16S rRNA sequence analyses suggested a relationship of the four phyla, showing the branching order Planctomycetes, Chlamydiae, Verrucomicrobia/Lentisphaerae. Phylogenetic analyses of 23S rRNA genes in this study also support a monophyletic grouping and their branching order--this grouping is significant for understanding cell division, since the major bacterial cell division protein FtsZ is absent from members of two of the phyla Chlamydiae and Planctomycetes. In Verrucomicrobia, knowledge about cell division is mainly restricted to the recent report of ftsZ in the closely related genera Prosthecobacter and Verrucomicrobium. In this study, genes of the conserved division and cell wall (dcw) cluster (ddl, ftsQ, ftsA, and ftsZ) were characterized in all verrucomicrobial subdivisions (1 to 4) with cultivable representatives (1 to 4). Sequence analyses and transcriptional analyses in Verrucomicrobia and genome data analyses in Lentisphaerae suggested that cell division is based on FtsZ in all verrucomicrobial subdivisions and possibly also in the sister phylum Lentisphaerae. Comprehensive sequence analyses of available genome data for representatives of Verrucomicrobia, Lentisphaerae, Chlamydiae, and Planctomycetes strongly indicate that their last common ancestor possessed a conserved, ancestral type of dcw gene cluster and an FtsZ-based cell division mechanism. This implies that Planctomycetes and Chlamydiae may have shifted independently to a non-FtsZ-based cell division mechanism after their separate branchings from their last common ancestor with Verrucomicrobia.

  2. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  3. Specific interactions of the L10(L12)4 ribosomal protein complex with mRNA, rRNA, and L11.

    PubMed

    Iben, James R; Draper, David E

    2008-03-01

    Large ribosomal subunit proteins L10 and L12 form a pentameric protein complex, L10(L12) 4, that is intimately involved in the ribosome elongation cycle. Its contacts with rRNA or other ribosomal proteins have been only partially resolved by crystallography. In Escherichia coli, L10 and L12 are encoded from a single operon for which L10(L12) 4 is a translational repressor that recognizes a secondary structure in the mRNA leader. In this study, L10(L12) 4 was expressed from the moderate thermophile Bacillus stearothermophilus to quantitatively compare strategies for binding of the complex to mRNA and ribosome targets. The minimal mRNA recognition structure is widely distributed among bacteria and has the potential to form a kink-turn structure similar to one identified in the rRNA as part of the L10(L12) 4 binding site. Mutations in equivalent positions between the two sequences have similar effects on L10(L12) 4-RNA binding affinity and identify the kink-turn motif and a loop AA sequence as important recognition elements. In contrast to the larger rRNA structure, the mRNA apparently positions the kink-turn motif and loop for protein recognition without the benefit of Mg (2+)-dependent tertiary structure. The mRNA and rRNA fragments bind L10(L12) 4 with similar affinity ( approximately 10 (8) M (-1)), but fluorescence binding studies show that a nearby protein in the ribosome, L11, enhances L10(L12) 4 binding approximately 100-fold. Thus, mRNA and ribosome targets use similar RNA features, held in different structural contexts, to recognize L10(L12) 4, and the ribosome ensures the saturation of its L10(L12) 4 binding site by means of an additional protein-protein interaction. PMID:18247578

  4. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  5. The rluC gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 955, 2504, and 2580 in 23 S ribosomal RNA.

    PubMed

    Conrad, J; Sun, D; Englund, N; Ofengand, J

    1998-07-17

    Escherichia coli ribosomal RNA contains 10 pseudouridines, one in the 16 S RNA and nine in the 23 S RNA. Previously, the gene for the synthase responsible for the 16 S RNA pseudouridine was identified and cloned, as was a gene for a synthase that makes a single pseudouridine in 23 S RNA. The yceC open reading frame of E. coli is one of a set of genes homologous to these previously identified ribosomal RNA pseudouridine synthases. In this work, the gene was cloned, overexpressed, and shown to code for a pseudouridine synthase able to react with in vitro transcripts of 23 S ribosomal RNA. Deletion of the gene and analysis of the 23 S RNA from the deletion strain for the presence of pseudouridine at its nine known sites revealed that this synthase is solely responsible in vivo for the synthesis of three of the nine pseudouridine residues, at positions 955, 2504, and 2580. Therefore, this gene has been renamed rluC. Despite the absence of one-third of the normal complement of pseudouridines, there was no change in the exponential growth rate in either LB or M-9 medium at temperatures ranging from 24 to 42 degrees C. From this work and our previous studies, we have now identified three synthases that account for 50% of the pseudouridines in the E. coli ribosome.

  6. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  7. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  8. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  9. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  10. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  11. Gestational mutations in radiation carcinogenesis

    NASA Astrophysics Data System (ADS)

    Meza, R.; Luebeck, G.; Moolgavkar, S.

    Mutations in critical genes during gestation could increase substantially the risk of cancer. We examine the consequences of such mutations using the Luebeck-Moolgavkar model for colorectal cancer and the Lea-Coulson modification of the Luria-Delbruck model for the accumulation of mutations during gestation. When gestational mutation rates are high, such mutations make a significant contribution to cancer risk even for adult tumors. Furthermore, gestational mutations ocurring at distinct times during emryonic developmemt lead to substantially different numbers of mutated cells at birth, with early mutations leading to a large number (jackpots) of mutated cells at birth and mutation occurring late leading to only a few mutated cells. Thus gestational mutations could confer considerable heterogeneity of the risk of cancer. If the fetus is exposed to an environmental mutagen, such as ionizing radiation, the gestational mutation rate would be expected to increase. We examine the consequences of such exposures during gestation on the subsequent development of cancer.

  12. Mutation rates as adaptations.

    PubMed

    Maley, C

    1997-06-01

    In order to better understand life, it is helpful to look beyond the envelop of life as we know it. A simple model of coevolution was implemented with the addition of a gene for the mutation rate of the individual. This allowed the mutation rate itself to evolve in a lineage. The model shows that when the individuals interact in a sort of zero-sum game, the lineages maintain relatively high mutation rates. However, when individuals engage in interactions that have greater consequences for one individual in the interaction than the other, lineages tend to evolve relatively low mutation rates. This model suggests that one possible cause for differential mutation rates across genes may be the coevolutionary pressure of the various forms of interactions with other genes. PMID:9219670

  13. Mutation and premating isolation.

    PubMed

    Woodruff, R C; Thompson, J N

    2002-11-01

    While premating isolation might be traceable to different genetic mechanisms in different species, evidence supports the idea that as few as one or two genes may often be sufficient to initiate isolation. Thus, new mutation can theoretically play a key role in the process. But it has long been thought that a new isolation mutation would fail, because there would be no other individuals for the isolation-mutation-carrier to mate with. We now realize that premeiotic mutations are very common and will yield a cluster of progeny carrying the same new mutant allele. In this paper, we discuss the evidence for genetically simple premating isolation barriers and the role that clusters of an isolation mutation may play in initiating allopatric, and even sympatric, species divisions.

  14. Multiplex detection of mutations.

    PubMed

    Perlin, David S; Balashov, Sergey; Park, Steven

    2008-01-01

    Rapid and reliable detection of mutations at the genetic level is an integral part of modern molecular diagnostics. These mutations can range from dominant single nucleotide polymorphisms within specific loci to codominant heterozygotic insertions and they present considerable challenges to investigators in developing rapid nucleic acid-based amplification assays that can distinguish wild-type from mutant alleles. The recent improvements of real-time polymerase chain reaction (PCR) using self-reporting fluorescence probes have given researchers a powerful tool in developing assays for mutation detection that can be multiplexed for high-throughput screening of multiple mutations and cost effectiveness. Here we describe an application of a multiplexed real-time PCR assay using Molecular Beacon probes for the detection of mutations in codon 54 of the CYP51A gene in Aspergillus fumigatus conferring triazole resistance.

  15. Mutation and premating isolation

    NASA Technical Reports Server (NTRS)

    Woodruff, R. C.; Thompson, J. N. Jr

    2002-01-01

    While premating isolation might be traceable to different genetic mechanisms in different species, evidence supports the idea that as few as one or two genes may often be sufficient to initiate isolation. Thus, new mutation can theoretically play a key role in the process. But it has long been thought that a new isolation mutation would fail, because there would be no other individuals for the isolation-mutation-carrier to mate with. We now realize that premeiotic mutations are very common and will yield a cluster of progeny carrying the same new mutant allele. In this paper, we discuss the evidence for genetically simple premating isolation barriers and the role that clusters of an isolation mutation may play in initiating allopatric, and even sympatric, species divisions.

  16. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  17. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  18. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  19. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  20. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.

    PubMed

    Coleman, Annette W

    2015-03-01

    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  1. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  2. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  3. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  4. Complementarity of Bacillus subtilis 16S rRNA with sites of antibiotic-dependent ribosome stalling in cat and erm leaders.

    PubMed Central

    Rogers, E J; Ambulos, N P; Lovett, P S

    1990-01-01

    Inducible cat and erm genes are regulated by translational attenuation. In this regulatory model, gene activation results from chloramphenicol- or erythromycin-dependent stalling of a ribosome at a precise site in the leader region of cat or erm transcripts. The stalled ribosome is believed to destabilize a downstream region of RNA secondary structure that sequesters the ribosome-binding site for the cat or erm coding sequence. Here we show that the ribosome stall sites in cat and erm leader mRNAs, designated crb and erb, respectively, are largely complementary to an internal sequence in 16S rRNA of Bacillus subtilis. A tetracycline resistance gene that is likely regulated by translational attenuation also contains a sequence in its leader mRNA, trb, which is complementary to a sequence in 16S rRNA that overlaps with the crb and erb complements. An in vivo assay is described which is designed to test whether 16S rRNA of a translating ribosome can interact with the crb sequence in mRNA in an inducer-dependent reaction. The assay compares the growth rate of cells expressing crb-86 with the growth rate of cells lacking crb-86 in the presence of subinhibitory levels of inducers of cat-86, chloramphenicol, fluorothiamphenicol, amicetin, or erythromycin. Under these conditions, crb-86 retarded growth. Deletion of the crb-86 sequence, insertion of ochre mutations into crb-86, or synonymous codon changes in crb-86 that decreased its complementarity with 16S rRNA all eliminated from detection inducer-dependent growth retardation. Lincomycin, a ribosomally targeted antibiotic that is not an inducer of cat-86, failed to selectively retard the growth of cells expressing crb-86. We suggest that cat-86 inducers enable the crb-86 sequence in mRNA to base pair with 16S rRNA of translating ribosome. When the base pairing is extensive, as with crb-86, ribosomes become transiently trapped on crb and are temporarily withdrawn from protein synthesis to the extent that growth rate

  5. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  6. Magnetic and electrical properties of Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystals

    SciTech Connect

    Bodnar, I. V.; Trukhanov, S. V.; Barugu, T. H.

    2015-10-15

    The magnetic and electrical properties of the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal are studied in the temperature range 4–300 K and in magnetic fields of 0–14 T. It is established that the sample under study is paramagnetic. In the ground state, short-range-order correlations typical of a spin glass with a freezing temperature of 10 K are detected. The magnetic ordering temperature is 15 K. The sample is a semiconductor with a resistivity of 3.5 kΩ cm at room temperature. For the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal, a mechanism for the formation of magnetic and electrical states is suggested.

  7. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  8. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  9. Phylogenetic analysis of vertically transmitted psyllid endosymbionts (Candidatus Carsonella ruddii) based on atpAGD and rpoC: comparisons with 16S-23S rDNA-derived phylogeny.

    PubMed

    Thao, M L; Clark, M A; Burckhardt, D H; Moran, N A; Baumann, P

    2001-06-01

    Psyllids are insects that harbor endosymbionts (Candidatuus Carsonella ruddii) within specialized cells found in the insect's body cavity. Previous phylogenetic analyses based on endosymbiont 16S-23S ribosomal DNA and a host gene were concordant (M.L. Thao, et al., Appl. Env. Microbiol. 66:2898, 2000). Additional analyses with atpAGD and rpoBC gave similar trees showing the agreement expected from organisms that evolve through vertical transmission with no gene exchange.

  10. Temperature-sensitive respiratory-deficient mitochondrial mutations: isolation and genetic mapping.

    PubMed

    Bolotin-Fukuhara, M; Fay, G; Fukuhara, H

    1977-04-29

    In order to find new genetic loci and functions on the yeast mitochondrial DNA, especially mutations affecting the mitochondrial protein synthesis apparatus, temperature sensitive mutants have been isolated after MnCl2 mutagenesis and mitochondrial and nuclear mutants classified according to their pattern of recombination with three rho- tester strains. Eighteen cold- and heat-sensitive respiratory deficient mitochondrial mutants have been isolated and localized on the mitochondrial genome by deletion mapping using 113 rho- strains. Eight of them appear to represent new loci, among which some are probably mutations of the tRNA and rRNA genes.

  11. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  12. Resistance mutations generate divergent antibiotic susceptibility profiles against translation inhibitors

    PubMed Central

    Cocozaki, Alexis I.; Altman, Roger B.; Huang, Jian; Buurman, Ed T.; Kazmirski, Steven L.; Doig, Peter; Prince, D. Bryan; Blanchard, Scott C.; Cate, Jamie H. D.; Ferguson, Andrew D.

    2016-01-01

    Mutations conferring resistance to translation inhibitors often alter the structure of rRNA. Reduced susceptibility to distinct structural antibiotic classes may, therefore, emerge when a common ribosomal binding site is perturbed, which significantly reduces the clinical utility of these agents. The translation inhibitors negamycin and tetracycline interfere with tRNA binding to the aminoacyl-tRNA site on the small 30S ribosomal subunit. However, two negamycin resistance mutations display unexpected differential antibiotic susceptibility profiles. Mutant U1060A in 16S Escherichia coli rRNA is resistant to both antibiotics, whereas mutant U1052G is simultaneously resistant to negamycin and hypersusceptible to tetracycline. Using a combination of microbiological, biochemical, single-molecule fluorescence transfer experiments, and X-ray crystallography, we define the specific structural defects in the U1052G mutant 70S E. coli ribosome that explain its divergent negamycin and tetracycline susceptibility profiles. Unexpectedly, the U1052G mutant ribosome possesses a second tetracycline binding site that correlates with its hypersusceptibility. The creation of a previously unidentified antibiotic binding site raises the prospect of identifying similar phenomena in antibiotic-resistant pathogens in the future. PMID:27382179

  13. Mutations in man

    SciTech Connect

    Obe, G.

    1984-01-01

    This book contains 13 selections that cover some of the following topics: DNA repair, gene or point mutations, aspects of nondisjunction, origin and significance of chromosomal alterations, structure and organization of the human genome, and mutagenic activity of cigarette smoke.

  14. Comparing Mutational Variabilities

    PubMed Central

    Houle, D.; Morikawa, B.; Lynch, M.

    1996-01-01

    We have reviewed the available data on V(M), the amount of genetic variation in phenotypic traits produced each generation by mutation. We use these data to make several qualitative tests of the mutation-selection balance hypothesis for the maintenance of genetic variance (MSB). To compare V(M) values, we use three dimensionless quantities: mutational heritability, V(M)/V(E); the mutational coefficient of variation, CV(M); and the ratio of the standing genetic variance to V(M), V(G)/V(M). Since genetic coefficients of variation for life history traits are larger than those for morphological traits, we predict that under MSB, life history traits should also have larger CV(M). This is confirmed; life history traits have a median CV(M) value more than six times higher than that for morphological traits. V(G)/V(M) approximates the persistence time of mutations under MSB in an infinite population. In order for MSB to hold, V(G)/V(M) must be small, substantially less than 1000, and life history traits should have smaller values than morphological traits. V(G)/V(M) averages about 50 generations for life history traits and 100 generations for morphological traits. These observations are all consistent with the predictions of a mutation-selection balance model. PMID:8807316

  15. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  16. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  17. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  18. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  19. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  20. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  1. U17/snR30 is a ubiquitous snoRNA with two conserved sequence motifs essential for 18S rRNA production.

    PubMed

    Atzorn, Vera; Fragapane, Paola; Kiss, Tamás

    2004-02-01

    Saccharomyces cerevisiae snR30 is an essential box H/ACA small nucleolar RNA (snoRNA) required for the processing of 18S rRNA. Here, we show that the previously characterized human, reptilian, amphibian, and fish U17 snoRNAs represent the vertebrate homologues of yeast snR30. We also demonstrate that U17/snR30 is present in the fission yeast Schizosaccharomyces pombe and the unicellular ciliated protozoan Tetrahymena thermophila. Evolutionary comparison revealed that the 3'-terminal hairpins of U17/snR30 snoRNAs contain two highly conserved sequence motifs, the m1 (AUAUUCCUA) and m2 (AAACCAU) elements. Mutation analysis of yeast snR30 demonstrated that the m1 and m2 elements are essential for early cleavages of the 35S pre-rRNA and, consequently, for the production of mature 18S rRNA. The m1 and m2 motifs occupy the opposite strands of an internal loop structure, and they are located invariantly 7 nucleotides upstream from the ACA box of U17/snR30 snoRNAs. U17/snR30 is the first identified box H/ACA snoRNA that possesses an evolutionarily conserved role in the nucleolytic processing of eukaryotic pre-rRNA.

  2. Crystal Structure of Rcl1 an Essential Component of the Eukaryal pre-rRNA Processosome Implicated in 18s rRNA Biogenesis

    SciTech Connect

    T Tanaka; P Smith; S Shuman

    2011-12-31

    Rcl1 is an essential nucleolar protein required for U3 snoRNA-guided pre-rRNA processing at sites flanking the 18S rRNA sequence. A potential catalytic role for Rcl1 during pre-rRNA cleavage has been suggested based on its primary structure similarity to RNA 3'-terminal phosphate cyclase (Rtc) enzymes, which perform nucleotidyl transfer and phosphoryl transfer reactions at RNA ends. Here, we report the 2.6 {angstrom} crystal structure of a biologically active yeast Rcl1, which illuminates its modular 4-domain architecture and overall homology with RNA cyclases while revealing numerous local differences that account for why Rtcs possess metal-dependent adenylyltransferase activity and Rcls do not. A conserved oxyanion-binding site in Rcl1 was highlighted for possible catalytic or RNA-binding functions. However, the benign effects of mutations in and around the anion site on Rcl1 activity in vivo militate against such a role.

  3. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  4. Decreases in average bacterial community rRNA operon copy number during succession

    PubMed Central

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-01-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  5. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  6. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  7. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  8. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  9. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).

    PubMed

    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L

    2000-09-01

    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  10. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  11. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  12. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    PubMed

    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  13. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  14. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  15. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  16. Mutational spectrum drives the rise of mutator bacteria.

    PubMed

    Couce, Alejandro; Guelfo, Javier R; Blázquez, Jesús

    2013-01-01

    Understanding how mutator strains emerge in bacterial populations is relevant both to evolutionary theory and to reduce the threat they pose in clinical settings. The rise of mutator alleles is understood as a result of their hitchhiking with linked beneficial mutations, although the factors that govern this process remain unclear. A prominent but underappreciated fact is that each mutator allele increases only a specific spectrum of mutational changes. This spectrum has been speculated to alter the distribution of fitness effects of beneficial mutations, potentially affecting hitchhiking. To study this possibility, we analyzed the fitness distribution of beneficial mutations generated from different mutator and wild-type Escherichia coli strains. Using antibiotic resistance as a model system, we show that mutational spectra can alter these distributions substantially, ultimately determining the competitive ability of each strain across environments. Computer simulation showed that the effect of mutational spectrum on hitchhiking dynamics follows a non-linear function, implying that even slight spectrum-dependent fitness differences are sufficient to alter mutator success frequency by several orders of magnitude. These results indicate an unanticipated central role for the mutational spectrum in the evolution of bacterial mutation rates. At a practical level, this study indicates that knowledge of the molecular details of resistance determinants is crucial for minimizing mutator evolution during antibiotic therapy.

  17. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  18. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  19. mtDNA mutation C1494T, haplogroup A, and hearing loss in Chinese

    SciTech Connect

    Wang Chengye; Kong Qingpeng; Yao Yonggang . E-mail: ygyaozh@yahoo.com; Zhang Yaping

    2006-09-22

    Mutation C1494T in mitochondrial 12S rRNA gene was recently reported in two large Chinese families with aminoglycoside-induced and nonsyndromic hearing loss (AINHL) and was claimed to be pathogenic. This mutation, however, was first reported in a sample from central China in our previous study that was aimed to reconstruct East Asian mtDNA phylogeny. All these three mtDNAs formed a subclade defined by mutation C1494T in mtDNA haplogroup A. It thus seems that mutation C1494T is a haplogroup A-associated mutation and this matrilineal background may contribute a high risk for the penetrance of mutation C1494T in Chinese with AINHL. To test this hypothesis, we first genotyped mutation C1494T in 553 unrelated individuals from three regional Chinese populations and performed an extensive search for published complete or near-complete mtDNA data sets (>3000 mtDNAs), we then screened the C1494T mutation in 111 mtDNAs with haplogroup A status that were identified from 1823 subjects across China. The search for published mtDNA data sets revealed no other mtDNA besides the above-mentioned three carrying mutation C1494T. None of the 553 randomly selected individuals and the 111 haplogroup A mtDNAs was found to bear this mutation. Therefore, our results suggest that C1494T is a very rare event. The mtDNA haplogroup A background in general is unlikely to play an active role in the penetrance of mutation C1494T in AINHL.

  20. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  1. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  2. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  3. Mutations in Lettuce Improvement

    PubMed Central

    Mou, Beiquan

    2011-01-01

    Lettuce is a major vegetable in western countries. Mutations generated genetic variations and played an important role in the domestication of the crop. Many traits derived from natural and induced mutations, such as dwarfing, early flowering, male sterility, and chlorophyll deficiency, are useful in physiological and genetic studies. Mutants were also used to develop new lettuce products including miniature and herbicide-tolerant cultivars. Mutant analysis was critical in lettuce genomic studies including identification and cloning of disease-resistance genes. Mutagenesis combined with genomic technology may provide powerful tools for the discovery of novel gene alleles. In addition to radiation and chemical mutagens, unconventional approaches such as tissue or protoplast culture, transposable elements, and space flights have been utilized to generate mutants in lettuce. Since mutation breeding is considered nontransgenic, it is more acceptable to consumers and will be explored more in the future for lettuce improvement. PMID:22287955

  4. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A

    1995-01-01

    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  5. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  6. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    PubMed

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  7. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  8. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  9. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  10. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  11. DExD-box RNA-helicases in Listeria monocytogenes are important for growth, ribosomal maturation, rRNA processing and virulence factor expression

    PubMed Central

    Bäreclev, Caroline; Vaitkevicius, Karolis; Netterling, Sakura; Johansson, Jörgen

    2014-01-01

    RNA-helicases are proteins required for the unwinding of occluding secondary RNA structures, especially at low temperatures. In this work, we have deleted all 4 DExD-box RNA helicases in various combinations in the Gram-positive pathogen Listeria monocytogenes. Our results show that 3 out of 4 RNA-helicases were important for growth at low temperatures, whereas the effect was less prominent at 37°C. Over-expression of one RNA-helicase, Lmo1450, was able to overcome the reduced growth of the quadruple mutant strain at temperatures above 26°C, but not at lower temperatures. The maturation of ribosomes was affected in different degrees in the various strains at 20°C, whereas the effect was marginal at 37°C. This was accompanied by an increased level of immature 23S rRNA precursors in some of the RNA-helicase mutants at low temperatures. Although the expression of the PrfA regulated virulence factors ActA and LLO decreased in the quadruple mutant strain, this strain showed a slightly increased infection ability. Interestingly, even though the level of the virulence factor LLO was decreased in the quadruple mutant strain as compared with the wild-type strain, the hly-transcript (encoding LLO) was increased. Hence, our results could suggest a role for the RNA-helicases during translation. In this work, we show that DExD-box RNA-helicases are involved in bacterial virulence gene-expression and infection of eukaryotic cells. PMID:25590644

  12. The spatio-temporal distribution of He (23S1) metastable atoms in a MHz-driven helium plasma jet is influenced by the oxygen/nitrogen ratio of the surrounding atmosphere

    NASA Astrophysics Data System (ADS)

    Winter, J.; Santos Sousa, J.; Sadeghi, N.; Schmidt-Bleker, A.; Reuter, S.; Puech, V.

    2015-04-01

    The density of helium He (23S1) metastable atoms is measured in a 1.6 mm diameter MHz-driven atmospheric pressure helium plasma jet by laser absorption spectroscopy with spatial and temporal resolution. The surrounding atmosphere of the jet is varied from pure oxygen to pure nitrogen with a gas shielding device. The highest metastable density of 1.3 × 1013 cm-3 is obtained in the center of the jet close to the nozzle exit at normal atmospheric air conditions. Within 0.3 mm in the radial direction and 2 mm in the axial direction, the He metastable density drops below the detection limit. The obtained He metastable lifetime is almost independent of the shielding gas composition. By analyzing the diffusion of shielding gas species into the effluent it is concluded that their density is too low to explain the observed He metastable lifetime. Instead, impurities from the feed gas, especially water molecules, are more likely to be responsible. However, a drastic change in metastable He density is observed when decreasing the amount of oxygen in the shielding gas. The lower the oxygen amount, the lower the metastable He density. For pure nitrogen, no He metastables are detected at all. By exchanging nitrogen with argon, a similar behavior is observed. Thus, it is concluded that it is the absence of ambient oxygen rather than the elevated presence of nitrogen, which is responsible for the observed decrease in the He (23S1) density.

  13. Localisation of a series of intra-RNA cross-links in the secondary and tertiary structure of 23S RNA, induced by ultraviolet irradiation of Escherichia coli 50S ribosomal subunits.

    PubMed Central

    Stiege, W; Glotz, C; Brimacombe, R

    1983-01-01

    Intra-RNA cross-links were introduced into E. coli 50S ribosomal subunits by mild ultraviolet irradiation. The subunits were partially digested with cobra venom nuclease, and the cross-linked RNA complexes were isolated by two-dimensional electrophoresis. Many of the complexes were submitted to a second partial digestion procedure. Oligonucleotide analysis of the RNA fragments obtained in this manner enabled cross-links between the following ribonuclease T1 oligonucleotides in the 23S RNA to be established: positions 292-296 and 339-350; 601-604 and 652-656; 1018-1022 and 1140-1149; 1433-1435 and 1556-1560; 1836-1839 and 1898-1903; 2832-2834 (tentative) and 2878-2885; 2849-2852 and 2865-2867 (tentative); 739-748 and 2609-2618; 571-577 and 2030-2032; 1777-1792 (tentative) and 2584-2588. The first seven of these cross-links lie within the secondary structure of the 23S RNA, whereas the last three are tertiary structural cross-links. The degree of precision of the individual determinations was variable, depending on the nucleotide sequence in the vicinity of the cross-link site concerned. Images PMID:6340065

  14. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  15. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  16. Duplex-specific nuclease efficiently removes rRNA for prokaryotic RNA-seq.

    PubMed

    Yi, Hana; Cho, Yong-Joon; Won, Sungho; Lee, Jong-Eun; Jin Yu, Hyung; Kim, Sujin; Schroth, Gary P; Luo, Shujun; Chun, Jongsik

    2011-11-01

    Next-generation sequencing has great potential for application in bacterial transcriptomics. However, unlike eukaryotes, bacteria have no clear mechanism to select mRNAs over rRNAs; therefore, rRNA removal is a critical step in sequencing-based transcriptomics. Duplex-specific nuclease (DSN) is an enzyme that, at high temperatures, degrades duplex DNA in preference to single-stranded DNA. DSN treatment has been successfully used to normalize the relative transcript abundance in mRNA-enriched cDNA libraries from eukaryotic organisms. In this study, we demonstrate the utility of this method to remove rRNA from prokaryotic total RNA. We evaluated the efficacy of DSN to remove rRNA by comparing it with the conventional subtractive hybridization (Hyb) method. Illumina deep sequencing was performed to obtain transcriptomes from Escherichia coli grown under four growth conditions. The results clearly showed that our DSN treatment was more efficient at removing rRNA than the Hyb method was, while preserving the original relative abundance of mRNA species in bacterial cells. Therefore, we propose that, for bacterial mRNA-seq experiments, DSN treatment should be preferred to Hyb-based methods.

  17. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    PubMed Central

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  18. Occurrence of fragmented 16S rRNA in an obligate bacterial endosymbiont of Paramecium caudatum.

    PubMed Central

    Springer, N; Ludwig, W; Amann, R; Schmidt, H J; Görtz, H D; Schleifer, K H

    1993-01-01

    The phylogenetic position of Caedibacter caryophila, a so far noncultured killer symbiont of Paramecium caudatum, was elucidated by comparative sequence analysis of in vitro amplified 16S rRNA genes (rDNA). C. caryophila is a member of the alpha subclass of the Proteobacteria phylum. Within this subclass C. caryophila is moderately related to Holospora obtusa, which is another obligate endosymbiont of Paramecium caudatum, and to Rickettsia. A 16S rRNA targeted specific hybridization probe was designed and used for in situ detection of C. caryophila within its host cell. Comparison of the 16S rDNA primary structure of C. caryophila with homologous sequences from other bacteria revealed an unusual insertion of 194 base pairs within the 5'-terminal part of the corresponding gene. The intervening sequence is not present in mature 16S rRNA of C. caryophila. It was demonstrated that C. caryophila contained fragmented 16S rRNA. Images Fig. 5 Fig. 6 PMID:8234331

  19. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  20. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    PubMed

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  1. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    PubMed

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  2. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    PubMed

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  3. Distribution of rRNA introns in the three-dimensional structure of the ribosome.

    PubMed

    Jackson, Scott; Cannone, Jamie; Lee, Jung; Gutell, Robin; Woodson, Sarah

    2002-10-11

    More than 1200 introns have been documented at over 150 unique sites in the small and large subunit ribosomal RNA genes (as of February 2002). Nearly all of these introns are assigned to one of four main types: group I, group II, archaeal and spliceosomal. This sequence information has been organized into a relational database that is accessible through the Comparative RNA Web Site (http://www.rna.icmb.utexas.edu/) While the rRNA introns are distributed across the entire tree of life, the majority of introns occur within a few phylogenetic groups. We analyzed the distributions of rRNA introns within the three-dimensional structures of the 30S and 50S ribosomes. Most sites in rRNA genes that contain introns contain only one type of intron. While the intron insertion sites occur at many different coordinates, the majority are clustered near conserved residues that form tRNA binding sites and the subunit interface. Contrary to our expectations, many of these positions are not accessible to solvent in the mature ribosome. The correlation between the frequency of intron insertions and proximity of the insertion site to functionally important residues suggests an association between intron evolution and rRNA function.

  4. Frequency of spontaneous mutations that confer antibiotic resistance in Chlamydia spp.

    PubMed

    Binet, Rachel; Maurelli, Anthony T

    2005-07-01

    Mutations in rRNA genes (rrn) that confer resistance to ribosomal inhibitors are typically recessive or weakly codominant and have been mostly reported for clinical strains of pathogens possessing only one or two rrn operons, such as Helicobacter pylori and Mycobacterium spp. An analysis of the genome sequences of several members of the Chlamydiaceae revealed that these obligate intracellular bacteria harbor only one or two sets of rRNA genes. To study the contribution of rRNA mutations to the emergence of drug resistance in the Chlamydiaceae, we used the sensitivities of Chlamydia trachomatis L2 (two rrn operons) and Chlamydophila psittaci 6BC (one rrn operon) to the aminoglycoside spectinomycin as a model. Confluent cell monolayers were infected in a plaque assay with about 10(8) wild-type infectious particles and then treated with the antibiotic. After a 2-week incubation time, plaques formed by spontaneous spectinomycin-resistant (Spc(r)) mutants appeared with a frequency of 5 x 10(-5) for C. psittaci 6BC. No Spc(r) mutants were isolated for C. trachomatis L2, although the frequencies of rifampin resistance were in the same range for both strains (i.e., 10(-7)). The risk of emergence of Chlamydia strains resistant to tetracyclines and macrolides, the ribosomal drugs currently used to treat chlamydial infections, is discussed.

  5. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  6. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  7. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  8. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    PubMed

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  9. Ptc6 Is Required for Proper Rapamycin-Induced Down-Regulation of the Genes Coding for Ribosomal and rRNA Processing Proteins in S. cerevisiae

    PubMed Central

    González, Asier; Casado, Carlos; Ariño, Joaquín; Casamayor, Antonio

    2013-01-01

    Ptc6 is one of the seven components (Ptc1-Ptc7) of the protein phosphatase 2C family in the yeast Saccharomyces cerevisiae. In contrast to other type 2C phosphatases, the cellular role of this isoform is poorly understood. We present here a comprehensive characterization of this gene product. Cells lacking Ptc6 are sensitive to zinc ions, and somewhat tolerant to cell-wall damaging agents and to Li+. Ptc6 mutants are sensitive to rapamycin, albeit to lesser extent than ptc1 cells. This phenotype is not rescued by overexpression of PTC1 and mutation of ptc6 does not reproduce the characteristic genetic interactions of the ptc1 mutation with components of the TOR pathway, thus suggesting different cellular roles for both isoforms. We show here that the rapamycin-sensitive phenotype of ptc6 cells is unrelated to the reported role of Pt6 in controlling pyruvate dehydrogenase activity. Lack of Ptc6 results in substantial attenuation of the transcriptional response to rapamycin, particularly in the subset of repressed genes encoding ribosomal proteins or involved in rRNA processing. In contrast, repressed genes involved in translation are Ptc6-independent. These effects cannot be attributed to the regulation of the Sch9 kinase, but they could involve modulation of the binding of the Ifh1 co-activator to specific gene promoters. PMID:23704987

  10. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  11. Whole-exome sequencing and functional studies identify RPS29 as a novel gene mutated in multicase Diamond-Blackfan anemia families.

    PubMed

    Mirabello, Lisa; Macari, Elizabeth R; Jessop, Lea; Ellis, Steven R; Myers, Timothy; Giri, Neelam; Taylor, Alison M; McGrath, Katherine E; Humphries, Jessica M; Ballew, Bari J; Yeager, Meredith; Boland, Joseph F; He, Ji; Hicks, Belynda D; Burdett, Laurie; Alter, Blanche P; Zon, Leonard; Savage, Sharon A

    2014-07-01

    Diamond-Blackfan anemia (DBA) is a cancer-prone inherited bone marrow failure syndrome. Approximately half of DBA patients have a germ-line mutation in a ribosomal protein gene. We used whole-exome sequencing to identify disease-causing genes in 2 large DBA families. After filtering, 1 nonsynonymous mutation (p.I31F) in the ribosomal protein S29 (RPS29[AUQ1]) gene was present in all 5 DBA-affected individuals and the obligate carrier, and absent from the unaffected noncarrier parent in 1 DBA family. A second DBA family was found to have a different nonsynonymous mutation (p.I50T) in RPS29. Both mutations are amino acid substitutions in exon 2 predicted to be deleterious and resulted in haploinsufficiency of RPS29 expression compared with wild-type RPS29 expression from an unaffected control. The DBA proband with the p.I31F RPS29 mutation had a pre-ribosomal RNA (rRNA) processing defect compared with the healthy control. We demonstrated that both RPS29 mutations failed to rescue the defective erythropoiesis in the rps29(-/-) mutant zebra fish DBA model. RPS29 is a component of the small 40S ribosomal subunit and essential for rRNA processing and ribosome biogenesis. We uncovered a novel DBA causative gene, RPS29, and showed that germ-line mutations in RPS29 can cause a defective erythropoiesis phenotype using a zebra fish model. PMID:24829207

  12. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    PubMed

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-01

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. PMID:27346687

  13. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    PubMed

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-01

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit.

  14. Association between idiopathic hearing loss and mitochondrial DNA mutations: A study on 169 hearing-impaired subjects

    PubMed Central

    GUARAN, VALERIA; ASTOLFI, LAURA; CASTIGLIONE, ALESSANDRO; SIMONI, EDI; OLIVETTO, ELENA; GALASSO, MARCO; TREVISI, PATRIZIA; BUSI, MICOL; VOLINIA, STEFANO; MARTINI, ALESSANDRO

    2013-01-01

    Mutations in mitochondrial DNA (mtDNA) have been shown to be an important cause of sensorineural hearing loss (SNHL). In this study, we performed a clinical and genetic analysis of 169 hearing-impaired patients and some of their relatives suffering from idiopathic SNHL, both familial and sporadic. The analysis of four fragments of their mtDNA identified several polymorphisms, the well known pathogenic mutation, A1555G, and some novel mutations in different genes, implying changes in the aminoacidic sequence. A novel sporadic mutation in 12S rRNA (MT-RNR1), not previously reported in the literature, was found in a case of possible aminoglycoside-induced progressive deafness. PMID:23969527

  15. Cosegregation of the mitochondrial DNA A1555G and G4309A mutations results in deafness and mitochondrial myopathy.

    PubMed

    Campos, Y; García, A; López, A; Jiménez, S; Rubio, J C; Del Hoyo, P; Bustos, F; Martín, M A; Cabello, A; Ricoy, J R; Arenas, J

    2002-02-01

    We report a patient with progressive external ophthalmoplegia (PEO), exercise intolerance, and deafness after aminoglycoside exposure, harboring two pathogenic mutations in her mtDNA: an A1555G in the 12S rRNA gene and a G4309A in the tRNA(Ile) gene. Muscle histochemistry showed abundant ragged-red fibers, and biochemistry revealed normal respiratory chain function. The A1555G mutation was homoplasmic in blood from the proband and from all maternal relatives. The G4309A mutation was abundant in the proband's muscle, less abundant in her blood, still less abundant in the mother's blood, and absent in blood from other maternal relatives. Family members were asymptomatic. Our data suggest that the former mutation resulted in aminoglycoside-induced deafness and the latter caused PEO plus exercise intolerance.

  16. Sex and deleterious mutations.

    PubMed

    Gordo, Isabel; Campos, Paulo R A

    2008-05-01

    The evolutionary advantage of sexual reproduction has been considered as one of the most pressing questions in evolutionary biology. While a pluralistic view of the evolution of sex and recombination has been suggested by some, here we take a simpler view and try to quantify the conditions under which sex can evolve given a set of minimal assumptions. Since real populations are finite and also subject to recurrent deleterious mutations, this minimal model should apply generally to all populations. We show that the maximum advantage of recombination occurs for an intermediate value of the deleterious effect of mutations. Furthermore we show that the conditions under which the biggest advantage of sex is achieved are those that produce the fastest fitness decline in the corresponding asexual population and are therefore the conditions for which Muller's ratchet has the strongest effect. We also show that the selective advantage of a modifier of the recombination rate depends on its strength. The quantification of the range of selective effects that favors recombination then leads us to suggest that, if in stressful environments the effect of deleterious mutations is enhanced, a connection between sex and stress could be expected, as it is found in several species.

  17. Mutator and MULE Transposons.

    PubMed

    Lisch, Damon

    2015-04-01

    The Mutator system of transposable elements (TEs) is a highly mutagenic family of transposons in maize. Because they transpose at high rates and target genic regions, these transposons can rapidly generate large numbers of new mutants, which has made the Mutator system a favored tool for both forward and reverse mutagenesis in maize. Low copy number versions of this system have also proved to be excellent models for understanding the regulation and behavior of Class II transposons in plants. Notably, the availability of a naturally occurring locus that can heritably silence autonomous Mutator elements has provided insights into the means by which otherwise active transposons are recognized and silenced. This chapter will provide a review of the biology, regulation, evolution and uses of this remarkable transposon system, with an emphasis on recent developments in our understanding of the ways in which this TE system is recognized and epigenetically silenced as well as recent evidence that Mu-like elements (MULEs) have had a significant impact on the evolution of plant genomes.

  18. OXPHOS mutations and neurodegeneration

    PubMed Central

    Koopman, Werner J H; Distelmaier, Felix; Smeitink, Jan AM; Willems, Peter HGM

    2013-01-01

    Mitochondrial oxidative phosphorylation (OXPHOS) sustains organelle function and plays a central role in cellular energy metabolism. The OXPHOS system consists of 5 multisubunit complexes (CI–CV) that are built up of 92 different structural proteins encoded by the nuclear (nDNA) and mitochondrial DNA (mtDNA). Biogenesis of a functional OXPHOS system further requires the assistance of nDNA-encoded OXPHOS assembly factors, of which 35 are currently identified. In humans, mutations in both structural and assembly genes and in genes involved in mtDNA maintenance, replication, transcription, and translation induce ‘primary' OXPHOS disorders that are associated with neurodegenerative diseases including Leigh syndrome (LS), which is probably the most classical OXPHOS disease during early childhood. Here, we present the current insights regarding function, biogenesis, regulation, and supramolecular architecture of the OXPHOS system, as well as its genetic origin. Next, we provide an inventory of OXPHOS structural and assembly genes which, when mutated, induce human neurodegenerative disorders. Finally, we discuss the consequences of mutations in OXPHOS structural and assembly genes at the single cell level and how this information has advanced our understanding of the role of OXPHOS dysfunction in neurodegeneration. PMID:23149385

  19. Active community profiling via capillary electrophoresis single-strand conformation polymorphism analysis of amplified 16S rRNA and 16S rRNA genes.

    PubMed

    Hiibel, Sage R; Pruden, Amy; Crimi, Barbara; Reardon, Kenneth F

    2010-12-01

    Here, we report the validation and advancement of a high-throughput method for fingerprinting the active members of a microbial community. This method, termed active community profiling (ACP), provides information about both the composition and the activity of mixed microbial cultures via comparative measurements of amplified 16S rRNA (RNA) and 16S rRNA genes (DNA). Capillary electrophoresis is used to resolve single-strand conformation polymorphisms of polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) products, producing electropherograms representative of the community structure. Active members of the community are distinguished by elevated RNA:DNA peak area ratios. Chemostat experiments with defined populations were conducted to validate the ACP approach. Using a pure culture of Escherichia coli, a direct correlation was found between the growth rate and the RNA:DNA peak ratio. In a second validation experiment, a binary culture of E. coli and Pseudomonas putida was subjected to a controlled environmental change consisting of a shift to anaerobic conditions. ACP revealed the expected cessation of growth of P. putida, an obligate aerobe, while the corresponding DNA-only analysis indicated no change in the culture. Finally, ACP was applied to a complex microbial community, and a novel binning approach was demonstrated for integrating the RNA and DNA electropherograms. ACP thus represents a significant advance from traditional DNA-based profiling techniques, which do not distinguish active from inactive or dead cells, and is well suited for high-throughput community analysis.

  20. Mucopolysaccharidosis IVA mutations in Chinese patients: 16 novel mutations.

    PubMed

    Wang, Zheng; Zhang, Weimin; Wang, Yun; Meng, Yan; Su, Liang; Shi, Huiping; Huang, Shangzhi

    2010-08-01

    Mucopolysaccharidosis IVA (MPS IVA; Morquio A syndrome) is a lysosomal storage disease caused by deficiency of N-acetylgalactosamine-6-sulfatase (GALNS) and transmitted as an autosomal recessive trait. This is the first systematic mutation screen in Chinese MPS IVA patients. Mutation detections in 24 unrelated Chinese MPS IVA patients were performed by PCR and direct sequencing of exons or the mRNA of GALNS. A total of 42 mutant alleles were identified, belonging to 27 different mutations. Out of the 27 mutations, 16 were novel, including 2 splicing mutations (c.567-1G>T and c.634-1G>A), 2 nonsense mutations (p.W325X and p.Q422X) and 12 missense mutations (p.T88I, p.H142R, p.P163H, p.G168L, p.H236D, p.N289S, p.T312A, p.G316V, p.A324E, p.L366P, p.Q422K and p.F452L). p.G340D was found to be a common mutation in the Chinese MPS IVA patients, accounting for 16.7% of the total number of mutant alleles. The results show that the mutations in Chinese MPS IVA patients are also family specific but have a different mutation spectrum as compared to those of other populations.

  1. Calreticulin Mutations in Myeloproliferative Neoplasms

    PubMed Central

    Lavi, Noa

    2014-01-01

    With the discovery of the JAK2V617F mutation in patients with Philadelphia chromosome-negative (Ph−) myeloproliferative neoplasms (MPNs) in 2005, major advances have been made in the diagnosis of MPNs, in understanding of their pathogenesis involving the JAK/STAT pathway, and finally in the development of novel therapies targeting this pathway. Nevertheless, it remains unknown which mutations exist in approximately one-third of patients with non-mutated JAK2 or MPL essential thrombocythemia (ET) and primary myelofibrosis (PMF). At the end of 2013, two studies identified recurrent mutations in the gene encoding calreticulin (CALR) using whole-exome sequencing. These mutations were revealed in the majority of ET and PMF patients with non-mutated JAK2 or MPL but not in polycythemia vera patients. Somatic 52-bp deletions (type 1 mutations) and recurrent 5-bp insertions (type 2 mutations) in exon 9 of the CALR gene (the last exon encoding the C-terminal amino acids of the protein calreticulin) were detected and found always to generate frameshift mutations. All detected mutant calreticulin proteins shared a novel amino acid sequence at the C-terminal. Mutations in CALR are acquired early in the clonal history of the disease, and they cause activation of JAK/STAT signaling. The CALR mutations are the second most frequent mutations in Ph− MPN patients after the JAK2V617F mutation, and their detection has significantly improved the diagnostic approach for ET and PMF. The characteristics of the CALR mutations as well as their diagnostic, clinical, and pathogenesis implications are discussed in this review. PMID:25386351

  2. Maternally inherited deafness associated with a T1095C mutation in the mDNA.

    PubMed

    Tessa, A; Giannotti, A; Tieri, L; Vilarinho, L; Marotta, G; Santorelli, F M

    2001-02-01

    Hearing loss is a relatively frequent defect in children with a genetic or predisposition basis in about 50% of cases. Mitochondrial DNA (mtDNA)-associated disorder often present with sensorineural hearing loss (SNHL) either in isolation or as a part of a multisystem disorder in adults but the frequency in pediatric cases is unknown. We analysed deafness-related mtDNA mutations in 80 deaf children to assess the relative frequency of alterations in childhood-onset SNHL. In 16 patients in whom maternal inheritance was possible, we screened for new mutations likely to affect mitochondrial protein synthesis. In one child we detected a novel mutation (T1095C) in the 12S rRNA gene. This mutation fulfils the suggested criteria for definition of a disease-related nucleotide variant. No mutations were found in other patients. Although we cannot exclude the presence of still undefined new mtDNA mutations, our data suggest that mtDNA defect are not common in childhood-onset SNHL.

  3. Development of a tunable Fabry-Perot etalon-based near-infrared interference spectrometer for measurement of the HeI 23S-23P spectral line shape in magnetically confined torus plasmas

    NASA Astrophysics Data System (ADS)

    Ogane, S.; Shikama, T.; Zushi, H.; Hasuo, M.

    2015-10-01

    In magnetically confined torus plasmas, the local emission intensity, temperature, and flow velocity of atoms in the inboard and outboard scrape-off layers can be separately measured by a passive emission spectroscopy assisted by observation of the Zeeman splitting in their spectral line shape. To utilize this technique, a near-infrared interference spectrometer optimized for the observation of the helium 23S-23P transition spectral line (wavelength 1083 nm) has been developed. The applicability of the technique to actual torus devices is elucidated by calculating the spectral line shapes expected to be observed in LHD and QUEST (Q-shu University Experiment with Steady State Spherical Tokamak). In addition, the Zeeman effect on the spectral line shape is measured using a glow-discharge tube installed in a superconducting magnet.

  4. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  5. Simultaneous Screening of Multiple Mutations by Invader Assay Improves Molecular Diagnosis of Hereditary Hearing Loss: A Multicenter Study

    PubMed Central

    Usami, Shin-ichi; Nishio, Shin-ya; Nagano, Makoto; Abe, Satoko; Yamaguchi, Toshikazu

    2012-01-01

    Although etiological studies have shown genetic disorders to be a common cause of congenital/early-onset sensorineural hearing loss, there have been no detailed multicenter studies based on genetic testing. In the present report, 264 Japanese patients with bilateral sensorineural hearing loss from 33 ENT departments nationwide participated. For these patients, we first applied the Invader assay for screening 47 known mutations of 13 known deafness genes, followed by direct sequencing as necessary. A total of 78 (29.5%) subjects had at least one deafness gene mutation. Mutations were more frequently found in the patients with congenital or early-onset hearing loss, i.e., in those with an awareness age of 0–6 years, mutations were significantly higher (41.8%) than in patients with an older age of awareness (16.0%). Among the 13 genes, mutations in GJB2 and SLC26A4 were mainly found in congenital or early-onset patients, in contrast with mitochondrial mutations (12S rRNA m.1555A>G, tRNA(Leu(UUR)) m.3243A>G), which were predominantly found in older-onset patients. The present method of simultaneous screening of multiple deafness mutations by Invader assay followed by direct sequencing will enable us to detect deafness mutations in an efficient and practical manner for clinical use. PMID:22384008

  6. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    PubMed

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  7. A renaissance for the pioneering 16S rRNA gene

    SciTech Connect

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  8. Detection and identification of mycobacteria by amplification of rRNA.

    PubMed

    Böddinghaus, B; Rogall, T; Flohr, T; Blöcker, H; Böttger, E C

    1990-08-01

    Oligonucleotides specific at a genus, group, or species level were defined by a systematic comparison of small-subunit rRNA sequences from Mycobacterium tuberculosis, M. bovis, M. africanum, M. bovis BCG, M. avium, M. kansasii, M. marinum, M. gastri, M. chelonae, M. smegmatis, M. terrae, M. nonchromogenicum, M. xenopi, M. malmoense, M. szulgai, M. scrofulaceum, M. fortuitum, M. gordonae, M. intracellulare, M. simiae, M. flavescens, M. paratuberculosis, M. sphagni, M. cookii, M. komossense, M. phlei, and M. farcinica. On the basis of the defined oligonucleotides, the polymerase chain reaction technique was explored to develop a sensitive taxon-specific detection system for mycobacteria. By using M. tuberculosis as a model system, fewer than 10 bacteria could be reliably detected by this kind of assay. These results suggest that amplification of rRNA sequences by the polymerase chain reaction may provide a highly sensitive and specific tool for the direct detection of microorganisms without the need for prior cultivation.

  9. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  10. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images.

    PubMed

    Stoeck, Thorsten; Fowle, William H; Epstein, Slava S

    2003-11-01

    Each year, thousands of new protistan 18S rRNA sequences are detected in environmental samples. Many of these sequences are molecular signatures of new protistan species, classes, and/or kingdoms that have never been seen before. The main goal of this study was to enable visualization of these novel organisms and to conduct quality ultrastructural examination. We achieved this goal by modifying standard procedures for cell fixation, fluorescence in situ hybridization, and scanning electron microscopy (SEM) and by making these methodologies work in concert. As a result, the same individual cell can now be detected by 18S rRNA-targeted fluorochrome-labeled probes and then viewed by SEM to reveal its diagnostic morphological characteristics. The method was successfully tested on a wide range of protists (alveolates, stramenopiles, kinetoplastids, and cryptomonads). The new methodology thus opens a way for fine microscopy studies of many organisms previously known exclusively by their 18S rRNA sequences.

  11. [Spontaneous spectinomycin resistance mutations of the chloroplast rrn16 gene in Daucus carota callus lines].

    PubMed

    Filipenko, E A; Sidorchuk, Iu V; Deĭneko, E V

    2011-01-01

    Bioballistic transformation of carrot Daucus carota L. callus cultures with a plasmid containing the aadA (aminoglycoside 3'-adenyltransferase) gene and subsequent selection oftransformants on a selective medium containing spectinomycin (100-500 mg/l) yielded ten callus lines resistant to this antibiotic. PCR analysis did not detect exogenous DNA in the genomes of spectinomycin-resistant calluses. Resistance proved to be due to spontaneous mutations that occurred in two different regions of the chloroplast rrn16 gene, which codes for the 16S rRNA. Six lines displayed the G > T or G > C transverions in position 1012 of the rrn16 gene, and three lines had the A > G transition in position 1138 of the gene. Chloroplast mutations arising during passages of callus cultures in the presence of spectinomycin were described in D. carota for the first time. The cause of spectinomycin resistance was not identified in one line. The mutations observed in the D. carota plastid genome occurred in the region that is involved in the formation of a double-stranded region at the 3' end of the 16S rRNA and coincided in positions with the nucleotide substitutions found in spectinomycin-resistant plants of tobacco Nicotiana tabacum L. and bladderpod Lesquerella fendleri L.

  12. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  13. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    SciTech Connect

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  14. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  15. Phylogenetic analysis based evolutionary study of 16S rRNA in known Pseudomonas sp

    PubMed Central

    Adhikari, Arindam; Nandi, Suvodip; Bhattacharya, Indrabrata; Roy, Mithu De; Mandal, Tanusri; Dutta, Subrata

    2015-01-01

    Molecular evolution analysis of 16S rRNA sequences of native Pseudomonas strains and different fluorescent pseudomonads were conducted on the basis of Molecular Evolutionary Genetics Analysis version 5.2 (MEGA5.2). Topological evaluations show common origin for native strains with other known strains with available sequences at GenBank database. Phylogenetic affiliation of different Pseudomonas sp based on 16S rRNA gene shows that molecular divergence contributes to the genetic diversity of Pseudomonas sp. Result indicate direct dynamic interactions with the rhizospheric pathogenic microbial community. The selection pressure acting on 16S rRNA gene was related to the nucleotide diversity of Pseudomonas sp in soil rhizosphere community among different agricultural crops. Besides, nucleotide diversity among the whole population was very low and tajima test statistic value (D) was also slightly positive (Tajima׳s test statistics D value 0.351). This data indicated increasing trends of infection of soil-borne pathogens under gangetic-alluvial regions of West Bengal due to high degree of nucleotide diversity with decreased population of plant growth promoting rhizobacteria like fluorescent Pseudomonads in soil. PMID:26664032

  16. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  17. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  18. An rRNA variable region has an evolutionarily conserved essential role despite sequence divergence.

    PubMed Central

    Sweeney, R; Chen, L; Yao, M C

    1994-01-01

    Regions extremely variable in size and sequence occur at conserved locations in eukaryotic rRNAs. The functional importance of one such region was determined by gene reconstruction and replacement in Tetrahymena thermophila. Deletion of the D8 region of the large-subunit rRNA inactivates T. thermophila rRNA genes (rDNA): transformants containing only this type of rDNA are unable to grow. Replacement with an unrelated sequence of similar size or a variable region from a different position in the rRNA also inactivated the rDNA. Mutant rRNAs resulting from such constructs were present only in precursor forms, suggesting that these rRNAs are deficient in either processing or stabilization of the mature form. Replacement with D8 regions from three other organisms restored function, even though the sequences are very different. Thus, these D8 regions share an essential functional feature that is not reflected in their primary sequences. Similar tertiary structures may be the quality these sequences share that allows them to function interchangeably. Images PMID:8196658

  19. Proteins associated with rRNA in the Escherichia coli ribosome.

    PubMed

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  20. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae.

    PubMed

    Thota, Swarna Gowri; Unnikannan, C P; Thampatty, Sitalakshmi R; Manorama, R; Bhandari, Rashna

    2015-02-15

    Ribosome biogenesis is an essential cellular process regulated by the metabolic state of a cell. We examined whether inositol pyrophosphates, energy-rich derivatives of inositol that act as metabolic messengers, play a role in ribosome synthesis in the budding yeast, Saccharomyces cerevisiae. Yeast strains lacking the inositol hexakisphosphate (IP6) kinase Kcs1, which is required for the synthesis of inositol pyrophosphates, display increased sensitivity to translation inhibitors and decreased protein synthesis. These phenotypes are reversed on expression of enzymatically active Kcs1, but not on expression of the inactive form. The kcs1Δ yeast cells exhibit reduced levels of ribosome subunits, suggesting that they are defective in ribosome biogenesis. The rate of rRNA synthesis, the first step of ribosome biogenesis, is decreased in kcs1Δ yeast strains, suggesting that RNA polymerase I (Pol I) activity may be reduced in these cells. We determined that the Pol I subunits, A190, A43 and A34.5, can accept a β-phosphate moiety from inositol pyrophosphates to undergo serine pyrophosphorylation. Although there is impaired rRNA synthesis in kcs1Δ yeast cells, we did not find any defect in recruitment of Pol I on rDNA, but observed that the rate of transcription elongation was compromised. Taken together, our findings highlight inositol pyrophosphates as novel regulators of rRNA transcription.

  1. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  2. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  3. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.

    PubMed

    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem

    2016-02-01

    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen.

  4. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  5. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-01

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. PMID:26776729

  6. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  7. Filaggrin mutations and the skin.

    PubMed

    De, Dipankar; Handa, Sanjeev

    2012-01-01

    Filaggrin is very important in the terminal differentiation of the skin and the formation of cornified envelope in the stratum corneum. Several mutations in the filaggrin gene have been identified in the last decade, mostly from the European countries. Loss of function mutations in the filaggrin gene results in reduced production of filaggrin, depending on the type and site of mutation. Such mutations in the filaggrin gene have been shown to be the most significant genetic risk factor for development of atopic dermatitis and undoubtedly has a role in the pathogenesis of ichthyosis vulgaris. Though there is theoretical possibility of association with hand eczema and allergic contact dermatitis; in clinical studies, the strength of these associations was not significantly strong. In this review, we have discussed the structure and function of filaggrin, basic genetics, type of mutations in filaggrin gene, and association of such mutations with different dermatoses.

  8. Design and Experimental Application of a Novel Non-Degenerate Universal Primer Set that Amplifies Prokaryotic 16S rRNA Genes with a Low Possibility to Amplify Eukaryotic rRNA Genes

    PubMed Central

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities. PMID:24277737

  9. Design and experimental application of a novel non-degenerate universal primer set that amplifies prokaryotic 16S rRNA genes with a low possibility to amplify eukaryotic rRNA genes.

    PubMed

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.

  10. Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

    PubMed

    Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

    2013-08-01

    Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

  11. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F

    1978-01-01

    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  12. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  13. Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences.

    PubMed

    Yarza, Pablo; Yilmaz, Pelin; Pruesse, Elmar; Glöckner, Frank Oliver; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Whitman, William B; Euzéby, Jean; Amann, Rudolf; Rosselló-Móra, Ramon

    2014-09-01

    Publicly available sequence databases of the small subunit ribosomal RNA gene, also known as 16S rRNA in bacteria and archaea, are growing rapidly, and the number of entries currently exceeds 4 million. However, a unified classification and nomenclature framework for all bacteria and archaea does not yet exist. In this Analysis article, we propose rational taxonomic boundaries for high taxa of bacteria and archaea on the basis of 16S rRNA gene sequence identities and suggest a rationale for the circumscription of uncultured taxa that is compatible with the taxonomy of cultured bacteria and archaea. Our analyses show that only nearly complete 16S rRNA sequences give accurate measures of taxonomic diversity. In addition, our analyses suggest that most of the 16S rRNA sequences of the high taxa will be discovered in environmental surveys by the end of the current decade.

  14. Loss-of-function mutations in the RNA biogenesis factor NAF1 predispose to pulmonary fibrosis-emphysema.

    PubMed

    Stanley, Susan E; Gable, Dustin L; Wagner, Christa L; Carlile, Thomas M; Hanumanthu, Vidya Sagar; Podlevsky, Joshua D; Khalil, Sara E; DeZern, Amy E; Rojas-Duran, Maria F; Applegate, Carolyn D; Alder, Jonathan K; Parry, Erin M; Gilbert, Wendy V; Armanios, Mary

    2016-08-10

    Chronic obstructive pulmonary disease and pulmonary fibrosis have been hypothesized to represent premature aging phenotypes. At times, they cluster in families, but the genetic basis is not understood. We identified rare, frameshift mutations in the gene for nuclear assembly factor 1, NAF1, a box H/ACA RNA biogenesis factor, in pulmonary fibrosis-emphysema patients. The mutations segregated with short telomere length, low telomerase RNA levels, and extrapulmonary manifestations including myelodysplastic syndrome and liver disease. A truncated NAF1 was detected in cells derived from patients, and, in cells in which the frameshift mutation was introduced by genome editing, telomerase RNA levels were reduced. The mutant NAF1 lacked a conserved carboxyl-terminal motif, which we show is required for nuclear localization. To understand the disease mechanism, we used CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated protein-9 nuclease) to generate Naf1(+/-) mice and found that they had half the levels of telomerase RNA. Other box H/ACA RNA levels were also decreased, but rRNA pseudouridylation, which is guided by snoRNAs, was intact. Moreover, first-generation Naf1(+/-) mice showed no evidence of ribosomal pathology. Our data indicate that disease in NAF1 mutation carriers is telomere-mediated; they show that NAF1 haploinsufficiency selectively disturbs telomere length homeostasis by decreasing the levels of telomerase RNA while sparing rRNA pseudouridylation. PMID:27510903

  15. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    PubMed

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  16. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  17. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    PubMed

    Zhang, Chenyu; Kuspa, Adam

    2009-01-01

    Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA) is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial protein synthesis in D

  18. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    PubMed

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (<1%) have disproportionally high ratios of rRNA to rDNA, an indication of higher protein synthesis, compared to abundant taxa (≥1%) and suggests that rare taxa likely play an unrecognized role in bioreactor performance. There were also significant differences in community-wide rRNA expression signatures at 20-day SRT: anaerobic-oxic-anoxic periods were the primary driver of rRNA similarity. These results indicate differential expression of rRNA at high SRTs, which may further explain why high SRTs promote higher rates of micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  19. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  20. Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

    PubMed

    Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

    2014-07-24

    The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated.

  1. Identification of Staphylococcus saprophyticus isolated from patients with urinary tract infection using a simple set of biochemical tests correlating with 16S-23S interspace region molecular weight patterns.

    PubMed

    Ferreira, Adriano Martison; Bonesso, Mariana Fávero; Mondelli, Alessandro Lia; da Cunha, Maria de Lourdes Ribeiro de Souza

    2012-12-01

    The emergence of Staphylococcus spp. not only as human pathogens, but also as reservoirs of antibiotic resistance determinants, requires the development of methods for their rapid and reliable identification in medically important samples. The aim of this study was to compare three phenotypic methods for the identification of Staphylococcus spp. isolated from patients with urinary tract infection using the PCR of the 16S-23S interspace region generating molecular weight patterns (ITR-PCR) as reference. All 57 S. saprophyticus studied were correctly identified using only the novobiocin disk. A rate of agreement of 98.0% was obtained for the simplified battery of biochemical tests in relation to ITR-PCR, whereas the Vitek I system and novobiocin disk showed 81.2% and 89.1% agreement, respectively. No other novobiocin-resistant non-S. saprophyticus strain was identified. Thus, the novobiocin disk is a feasible alternative for the identification of S. saprophyticus in urine samples in laboratories with limited resources. ITR-PCR and the simplified battery of biochemical tests were more reliable than the commercial systems currently available. This study confirms that automated systems are still unable to correctly differentiate CoNS species and that simple, reliable and inexpensive methods can be used for routine identification.

  2. 1s2s2p{sup 2}3s {sup 6}P-1s2p{sup 3}3s {sup 6}S{sup o} Transitions in O IV

    SciTech Connect

    Lin Bin; Berry, H. Gordon; Shibata, Tomohiro; Livingston, A. Eugene; Savukov, Igor; Garnir, Henri-Pierre; Bastin, Thierry; Desesquelles, J.

    2003-06-01

    The energies and lifetimes of doubly excited sextet states of boron-like O IV, F V, and Ne VI are calculated with the multiconfiguration Hartree-Fock approach, including QED and higher-order corrections, and also with the multiconfiguration Dirac-Fock GRASP code. The wavelengths and transition rates of electric-dipole transitions from the inner-shell excited terms 1s2s2p{sup 2}3s {sup 6}P-1s2p{sup 3}3s {sup 6}S{sup o} are investigated by beam-foil spectroscopy in the XUV spectral region. The predicted transition wavelengths agree with the experiment. The higher-order corrections, fine structures, and spectrum with high wavelength resolution are found to be critically important in these comparisons. Nine new lines have been identified. The ground sextet states of boronlike atoms are metastable and well above several ionization levels. These are possible candidates for XUV and soft x-ray lasers.

  3. Analysis, optimization and verification of Illumina-generated 16S rRNA gene amplicon surveys.

    PubMed

    Nelson, Michael C; Morrison, Hilary G; Benjamino, Jacquelynn; Grim, Sharon L; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  4. Multi-site-specific 16S rRNA Methyltransferase RsmF from Thermus thermophilus

    SciTech Connect

    Demirci, H.; Larsen, L; Hansen, T; Rasmussen, A; Cadambi, A; Gregory, S; Kirpekar, F; Jogl, G

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m{sup 5}C) modifications in 16S rRNA of Thermus thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m{sup 5}C967. In contrast to E. coli RsmF, which introduces a single m{sup 5}C1407 modification, T. thermophilus RsmF modifies three positions, generating m{sup 5}C1400 and m{sup 5}C1404 in addition to m{sup 5}C1407. These three residues are clustered near the decoding site of the ribosome, but are situated in distinct structural contexts, suggesting a requirement for flexibility in the RsmF active site that is absent from the E. coli enzyme. Two of these residues, C1400 and C1404, are sufficiently buried in the mature ribosome structure so as to require extensive unfolding of the rRNA to be accessible to RsmF. In vitro, T. thermophilus RsmF methylates C1400, C1404, and C1407 in a 30S subunit substrate, but only C1400 and C1404 when naked 16S rRNA is the substrate. The multispecificity of T. thermophilus RsmF is potentially explained by three crystal structures of the enzyme in a complex with cofactor S-adenosyl-methionine at up to 1.3 {angstrom} resolution. In addition to confirming the overall structural similarity to E. coli RsmF, these structures also reveal that key segments in the active site are likely to be dynamic in solution, thereby expanding substrate recognition by T. thermophilus RsmF.

  5. Comparative analysis of dinoflagellate chloroplast genomes reveals rRNA and tRNA genes

    PubMed Central

    Barbrook, Adrian C; Santucci, Nicole; Plenderleith, Lindsey J; Hiller, Roger G; Howe, Christopher J

    2006-01-01

    Background Peridinin-containing dinoflagellates have a highly reduced chloroplast genome, which is unlike that found in other chloroplast containing organisms. Genome reduction appears to be the result of extensive transfer of genes to the nuclear genome. Unusually the genes believed to be remaining in the chloroplast genome are found on small DNA 'minicircles'. In this study we present a comparison of sets of minicircle sequences from three dinoflagellate species. Results PCR was used to amplify several minicircles from Amphidinium carterae so that a homologous set of gene-containing minicircles was available for Amphidinium carterae and Amphidinium operculatum, two apparently closely related peridinin-containing dinoflagellates. We compared the sequences of these minicircles to determine the content and characteristics of their chloroplast genomes. We also made comparisons with minicircles which had been obtained from Heterocapsa triquetra, another peridinin-containing dinoflagellate. These in silico comparisons have revealed several genetic features which were not apparent in single species analyses. The features include further protein coding genes, unusual rRNA genes, which we show are transcribed, and the first examples of tRNA genes from peridinin-containing dinoflagellate chloroplast genomes. Conclusion Comparative analysis of minicircle sequences has allowed us to identify previously unrecognised features of dinoflagellate chloroplast genomes, including additional protein and RNA genes. The chloroplast rRNA gene sequences are radically different from those in other organisms, and in many ways resemble the rRNA genes found in some highly reduced mitochondrial genomes. The retention of certain tRNA genes in the dinoflagellate chloroplast genome has important implications for models of chloroplast-mitochondrion interaction. PMID:17123435

  6. Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene Amplicon Surveys

    PubMed Central

    Nelson, Michael C.; Morrison, Hilary G.; Benjamino, Jacquelynn; Grim, Sharon L.; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  7. Phylogeny of the Centrohelida inferred from SSU rRNA, tubulins, and actin genes.

    PubMed

    Sakaguchi, Miako; Nakayama, Takeshi; Hashimoto, Tetsuo; Inouye, Isao

    2005-12-01

    Amoeboid protists are major targets of recent molecular phylogeny in connection with reconstruction of global phylogeny of eukaryotes as well as the search for the root of eukaryotes. The Centrohelida are one of the major groups of Heliozoa, classified in the Actinopodida, whose evolutionary position is not well understood. To clarify the relationships between the Centrohelida and other eukaryotes, we sequenced SSU rRNA, alpha-tubulin, and beta-tubulin genes from a centroheliozoan protist, Raphidiophrys contractilis. The SSU rRNA phylogeny showed that the Centrohelida are not closely related to other heliozoan groups, Actinophryida, Desmothoracida, or Taxopodida. Maximum likelihood analyses of the combined phylogeny using a concatenate model for an alpha- + beta-tubulin + actin data set, and a separate model for SSU rRNA, alpha- and beta-tubulin, and actin gene data sets revealed the best tree, in which the Centrohelida have a closer relationship to Rhodophyta than to other major eukaryotic groups. However, both weighted Shimodaira-Hasegawa and approximately unbiased tests for the concatenate protein phylogeny did not reject alternative trees in which Centrohelida were constrained to be sisters to the Amoebozoa. Moreover, alternative trees in which Centrohelida were placed at the node branching before and after Amoebozoa or Viridiplantae were not rejected by the WSH tests. These results narrowed the possibilities for the position of Centrohelida to a sister to the Rhodophyta, to the Amoebozoa, or to an independent branch between the branchings of Amoebozoa and Rhodophyta (or possibly Plantae) at the basal position within the bikonts clade in the eukaryotic tree.

  8. Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.

    PubMed

    Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo

    2011-05-01

    A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T)  = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.

  9. Greengenes, a Chimera-checked 16S rRNA gene database and workbenchcompatible with ARB

    SciTech Connect

    DeSantis, Todd Z.; Hugenholtz, Philip; Larsen, Neils; Rojas,Mark; Brodie, Eoin L.; Keller, Keith; Huber, Thomas; Dalevi, Daniel; Hu,Ping; Andersen, Gary L.

    2006-04-10

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that in congruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3 percent of environmental sequences and 0.2 percent of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  10. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  11. Evolutionary diversity of eukaryotic small-subunit rRNA genes.

    PubMed

    Sogin, M L; Elwood, H J; Gunderson, J H

    1986-03-01

    The small-subunit rRNA gene sequences of the flagellated protists Euglena gracilis and Trypanosoma brucei were determined and compared to those of other eukaryotes. A phylogenetic tree was constructed in which the earliest branching among the eukaryotes is represented by E. gracilis. The E. gracilis divergence far antedates a period of massive evolutionary radiation that gave rise to the plants, animals, fungi, and certain groups of protists such as ciliates and the acanthamoebae. The genetic diversity in this collection of eukaryotes is seen to exceed that displayed within either the eubacterial or the archaebacterial lines of descent.

  12. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.

    PubMed

    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C

    2014-08-01

    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  13. Ramifications of four concurrent thrombophilic mutations and one hypofibrinolytic mutation.

    PubMed

    Glueck, Charles J; Goldenberg, Naila; Wang, Ping; Aregawi, Dawit

    2004-10-01

    A kindred was examined in which the 48-year-old white female proband with three deep venous thrombosis-pulmonary emboli events had four thrombophilic and one hypofibrinolytic mutations, and in which her 14-year-old asymptomatic daughter had four thrombophilic mutations. The proband was heterozygous for the G1691A factor V Leiden, G20210A prothrombin, and platelet glycoprotein IIIa PL A1/A2 mutations, had high factor VIII (221%), and was homozygous for the 4G4G plasminogen activator inhibitor-1 gene mutation, with high plasminogen activator inhibitor activity (23.7 U/mL). Her 14-year-old daughter was homozygous for the G1691A factor V Leiden and platelet glycoprotein IIb-IIIa PL A2/A2 mutations, compound heterozygous for the C677T and A1298C methylenetetrahydrofolate reductase (MTHFR) mutations, and heterozygous for the G20210A prothrombin mutation, a combination with an estimated likelihood of 1.6 x 10(-7). In 247 white healthy controls, there was no V Leiden homozygosity and no V Leiden-prothrombin gene compound heterozygosity. Heterozygosity for the V Leiden and prothrombin gene mutations was 3.2% and 4.1%, respectively. Homozygosity for the platelet glycoprotein IIb-IIIa PL A2A2, PAI-1 gene 4G4G, and C677T MTHFR mutations was 3.2%, 22.7%, and 12%, respectively. The proband will receive anticoagulation therapy for life. Beyond aspirin, avoidance of exogenous estrogens, and enoxaparin prophylaxis during pregnancy, it is not known whether the proband's daughter should have lifelong anticoagulation therapy, or only after her first thrombotic event. PMID:15497023

  14. Parkinsonism Associated with Glucocerebrosidase Mutation

    PubMed Central

    Sunwoo, Mun-Kyung; Kim, Seung-Min; Lee, Sarah

    2011-01-01

    Background Gaucher's disease is an autosomal recessive, lysosomal storage disease caused by mutations of the β-glucocerebrosidase gene (GBA). There is increasing evidence that GBA mutations are a genetic risk factor for the development of Parkinson's disease (PD). We report herein a family of Koreans exhibiting parkinsonism-associated GBA mutations. Case Report A 44-year-old woman suffering from slowness and paresthesia of the left arm for the previous 1.5years, visited our hospital to manage known invasive ductal carcinoma. During a preoperative evaluation, she was diagnosed with Gaucher's disease and double mutations of S271G and R359X in GBA. Parkinsonian features including low amplitude postural tremors, rigidity, bradykinesia and shuffling gait were observed. Genetic analysis also revealed that her older sister, who had also been diagnosed with PD and had been taking dopaminergic drugs for 8-years, also possessed a heterozygote R359X mutation in GBA. 18F-fluoropropylcarbomethoxyiodophenylnortropane positron-emission tomography in these patients revealed decreased uptake of dopamine transporter in the posterior portion of the bilateral putamen. Conclusions This case study demonstrates Korean familial cases of PD with heterozygote mutation of GBA, further supporting the association between PD and GBA mutation. PMID:21779299

  15. Intragenomic heterogeneity and intergenomic recombination among Vibrio parahaemolyticus 16S rRNA genes.

    PubMed

    Harth, Erika; Romero, Jaime; Torres, Rafael; Espejo, Romilio T

    2007-08-01

    Vibrio parahaemolyticus is a marine bacterium bearing 11 copies of ribosomal operons. In some strains, such as RIMD2210633, the genome includes identical copies of 16S rRNA genes (rrs). However, it is known that other strains of the species, such as strains ATCC 17802 and RIMD2210856, show conspicuous intragenomic rrs heterogeneity. The extent and diversity of the rrs heterogeneity in V. parahaemolyticus were studied in further detail by characterization of the rrs copies in environmental isolates belonging to 21 different genotype groups. Thirteen of these groups showed intragenomic heterogeneity, containing altogether 16 sequences differing within a 25 bp segment of their rrs. These sequences grouped into four clusters differing in at least four nucleotide sites. Some isolates contained rrs alleles from up to three different clusters. Each segment sequence conserved the stem-loop characteristic of the 16S rRNA structure of this 25 bp sequence. The double-stranded stem sequence was quite variable, but almost every variation had a compensatory change to maintain seven to eight paired bases. Conversely, the single-strand loop sequence was conserved. The results may be explained as a consequence of recombination among rrs evolving in different bacteria. The results suggest that intergenomic rrs recombination is very high in V. parahaemolyticus and that it occurs solely among Vibrio species. This high rrs homologous intergenomic recombination could be an effective mechanism to maintain intragenomic rrs cohesion, mediating the dispersal of the most abundant rrs version among the 11 intragenomic loci. PMID:17660428

  16. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    PubMed

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  17. Greengenes: 16S rRNA Database and Workbench Compatible with ARB

    DOE Data Explorer

    DeSantis, T. Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E. L.; Keller, K.; Huber, T.; Dalevi, D. Hu, P. Andersen, G. L.

    Greengenes was developed, as the abstract of an AEM reprint states, to "addresse limitations of public repositories by providing chimera screening, standard alignment, and taxonomic classification using multiple published taxonomies. It was found that there is incongruent taxonomic nomenclature among curators even at the phylum level. Putative chimeras were identified in 3% of environmental sequences and in 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages in the Archaea and Bacteria....Greengenes is also a functional workbench to assist in analysis of user-generated 16S rRNA gene sequences. Batches of sequencing reads can be uploaded for quality-based trimming and creation of multiple-sequence alignments (9). Three types of non-MSA similarity searches are also available, seed extension by BLAST (1), similarity based on shared 7-mers by a tool called Simrank, and a direct degenerative pattern match for probe/primer evaluation. Results are displayed using user-preferred taxonomic nomenclature and can be saved between sessions. [Taken from DeSantis, T. Z., P. Hugenholtz, N. Larsen, M. Rojas, E. L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu, and G. L. Andersen. 2006. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl Environ Microbiol 72:5069-72, pages 1 and 3] (Specialized Interface)

  18. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    PubMed

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  19. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor.

    PubMed

    Gerasimova, Yulia V; Kolpashchikov, Dmitry M

    2013-03-15

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a completely complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, Escherichia coli16S rRNA was detected in real time with the detection limit of ~0.17 nM. The high specificity of the analysis was proven by differentiating Bacillus subtilis from E. coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds.

  20. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  1. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    PubMed

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans. PMID:26085946

  2. Bladder Cancer and Genetic Mutations.

    PubMed

    Zhang, Xiaoying; Zhang, Yangde

    2015-09-01

    The most common type of urinary bladder cancer is called as transitional cell carcinoma. The major risk factors for bladder cancer are environmental, tobacco smoking, exposure to toxic industrial chemicals and gases, bladder inflammation due to microbial and parasitic infections, as well as some adverse side-effects of medications. The genetic mutations in some chromosomal genes, such as FGFR3, RB1, HRAS, TP53, TSC1, and others, occur which form tumors in the urinary bladder. These genes play an important role in the regulation of cell division which prevents cells from dividing too quickly. The changes in the genes of human chromosome 9 are usually responsible for tumor in bladder cancer, but the genetic mutation of chromosome 22 can also result in bladder cancer. The identification of p53 gene mutation has been studied at NIH, Washington, DC, USA, in urine samples of bladder cancer patients. The invasive bladder cancers were determined for the presence of gene mutations on p53 suppressor gene. The 18 different bladder tumors were evaluated, and 11 (61 %) had genetic mutations of p53 gene. The bladder cancer studies have suggested that 70 % of bladder cancers involve a specific mutation in a particular gene, namely telomerase reverse transcriptase (TERT) gene. The TERT gene is involved in DNA protection, cellular aging processes, and cancer. The Urothelial carcinomas of the bladder have been described in Atlas of genetics and cytogenetics in oncology and hematology. HRAS is a proto-oncogene and has potential to cause cancer in several organs including the bladder. The TSC1 c. 1907 1908 del (E636fs) mutation in bladder cancer suggests that the location of the mutation is Exon 15 with frequency of TSC1 mutation of 11.7 %. The recent findings of BAP1 mutations have shown that it contributes to BRCA pathway alterations in bladder cancer. The discoveries of more gene mutations and new biomarkers and polymerase chain reaction bioassays for gene mutations in bladder

  3. Mutational landscape and underlying mutational processes in chronic lymphocytic leukemia.

    PubMed

    Kasar, S; Brown, J R

    2016-07-01

    Sequencing studies have been instrumental in understanding the genetic basis of chronic lymphocytic leukemia (CLL). Our recent whole-genome sequencing study focusing on lower cytogenetic risk CLL demonstrated that CLL mutations can be attributed to 3 key mutational processes-2 types of activation induced-cytidine deaminase (AID) signatures and an aging signature-that operate at different times throughout CLL evolution. PMID:27652313

  4. PPARγ mutations, lipodystrophy and diabetes.

    PubMed

    Astapova, Olga; Leff, Todd

    2014-11-01

    The focus of this review is the lipodystrophy syndrome caused by mutation in the PPARγ nuclear receptor - partial familial lipodystrophy FPLD3. To provide a broader context for how these mutations act to generate the clinical features of partial lipodystrophy we will review the basic biology of PPARγ and also survey the set PPARγ genetic variants that do not cause lipodystrophy, but are nonetheless associated with clinically related syndromes, specifically type 2 diabetes.

  5. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed Central

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-01-01

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

  6. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    PubMed Central

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  7. [Strategy of selecting 16S rRNA hypervariable regions for metagenome-phylogenetic marker genes based analysis].

    PubMed

    Zhang, Jun-yi; Zhu, Bing-chuan; Xu, Chao; Ding, Xiao; Li, Jun-feng; Zhang, Xue-gong; Lu, Zu-hong

    2015-11-01

    The advent of next generation sequencing technology enables parallel analysis of the whole microbial community from multiple samples. Particularly, sequencing 16S rRNA hypervariable tags has become the most efficient and cost-effective method for assessing microbial diversity. Due to its short read length of the 2nd-generation sequencing methods that cannot cover the full 16S rRNA genomic region, specific hypervariable regions or V-regions must be selected to act as the proxy. Over the past decade, selection of V-regions has not been consistent in assessing microbial diversity. Here we evaluated the current strategies of selecting 16S rRNA hypervariable regions for surveying microbial diversity. The environmental condition was considered as one of the important factors for selection of 16S rRNA hypervariable regions. We suggested that a pilot study to test different V-regions is required in bacterial diversity studies based on 16S rRNA genes.

  8. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-10-11

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years.

  9. Mutations in cardiovascular connexin genes.

    PubMed

    Molica, Filippo; Meens, Merlijn J P; Morel, Sandrine; Kwak, Brenda R

    2014-09-01

    Connexins (Cxs) form a family of transmembrane proteins comprising 21 members in humans. Cxs differ in their expression patterns, biophysical properties and ability to combine into homomeric or heteromeric gap junction channels between neighbouring cells. The permeation of ions and small metabolites through gap junction channels or hemichannels confers a crucial role to these proteins in intercellular communication and in maintaining tissue homeostasis. Among others, Cx37, Cx40, Cx43, Cx45 and Cx47 are found in heart, blood and lymphatic vessels. Mutations or polymorphisms in the genes coding for these Cxs have not only been implicated in cardiovascular pathologies but also in a variety of other disorders. While mutations in Cx43 are mostly linked to oculodentodigital dysplasia, Cx47 mutations are associated with Pelizaeus-Merzbacher-like disease and lymphoedema. Cx40 mutations are principally linked to atrial fibrillation. Mutations in Cx37 have not yet been described, but polymorphisms in the Cx37 gene have been implicated in the development of arterial disease. This review addresses current knowledge on gene mutations in cardiovascular Cxs systematically and links them to alterations in channel properties and disease.

  10. A functional relationship between helix 1 and the 900 tetraloop of 16S ribosomal RNA within the bacterial ribosome.

    PubMed

    Bélanger, François; Théberge-Julien, Gabriel; Cunningham, Philip R; Brakier-Gingras, Léa

    2005-06-01

    The conserved 900 tetraloop that caps helix 27 of 16S ribosomal RNA (rRNA) interacts with helix 24 of 16S rRNA and also with helix 67 of 23S rRNA, forming the intersubunit bridge B2c, proximal to the decoding center. In previous studies, we investigated how the interaction between the 900 tetraloop and helix 24 participates in subunit association and translational fidelity. In the present study, we investigated whether the 900 tetraloop is involved in other undetected interactions with different regions of the Escherichia coli 16S rRNA. Using a genetic complementation approach, we selected mutations in 16S rRNA that compensate for a 900 tetraloop mutation, A900G, which severely impairs subunit association and translational fidelity. Mutations were randomly introduced in 16S rRNA, using either a mutagenic XL1-Red E. coli strain or an error-prone PCR strategy. Gain-offunction mutations were selected in vivo with a specialized ribosome system. Two mutations, the deletion of U12 and the U12C substitution, were thus independently selected in helix 1 of 16S rRNA. This helix is located in the vicinity of helix 27, but does not directly contact the 900 tetraloop in the crystal structures of the ribosome. Both mutations correct the subunit association and translational fidelity defects caused by the A900G mutation, revealing an unanticipated functional interaction between these two regions of 16S rRNA.

  11. Genome destabilizing mutator alleles drive specific mutational trajectories in Saccharomyces cerevisiae.

    PubMed

    Stirling, Peter C; Shen, Yaoqing; Corbett, Richard; Jones, Steven J M; Hieter, Philip

    2014-02-01

    In addition to environmental factors and intrinsic variations in base substitution rates, specific genome-destabilizing mutations can shape the mutational trajectory of genomes. How specific alleles influence the nature and position of accumulated mutations in a genomic context is largely unknown. Understanding the impact of genome-destabilizing alleles is particularly relevant to cancer genomes where biased mutational signatures are identifiable. We first created a more complete picture of cellular pathways that impact mutation rate using a primary screen to identify essential Saccharomyces cerevisiae gene mutations that cause mutator phenotypes. Drawing primarily on new alleles identified in this resource, we measure the impact of diverse mutator alleles on mutation patterns directly by whole-genome sequencing of 68 mutation-accumulation strains derived from wild-type and 11 parental mutator genotypes. The accumulated mutations differ across mutator strains, displaying base-substitution biases, allele-specific mutation hotspots, and break-associated mutation clustering. For example, in mutants of POLα and the Cdc13-Stn1-Ten1 complex, we find a distinct subtelomeric bias for mutations that we show is independent of the target sequence. Together our data suggest that specific genome-instability mutations are sufficient to drive discrete mutational signatures, some of which share properties with mutation patterns seen in tumors. Thus, in a population of cells, genome-instability mutations could influence clonal evolution by establishing discrete mutational trajectories for genomes.

  12. Genome Destabilizing Mutator Alleles Drive Specific Mutational Trajectories in Saccharomyces cerevisiae

    PubMed Central

    Stirling, Peter C.; Shen, Yaoqing; Corbett, Richard; Jones, Steven J. M.; Hieter, Philip

    2014-01-01

    In addition to environmental factors and intrinsic variations in base substitution rates, specific genome-destabilizing mutations can shape the mutational trajectory of genomes. How specific alleles influence the nature and position of accumulated mutations in a genomic context is largely unknown. Understanding the impact of genome-destabilizing alleles is particularly relevant to cancer genomes where biased mutational signatures are identifiable. We first created a more complete picture of cellular pathways that impact mutation rate using a primary screen to identify essential Saccharomyces cerevisiae gene mutations that cause mutator phenotypes. Drawing primarily on new alleles identified in this resource, we measure the impact of diverse mutator alleles on mutation patterns directly by whole-genome sequencing of 68 mutation-accumulation strains derived from wild-type and 11 parental mutator genotypes. The accumulated mutations differ across mutator strains, displaying base-substitution biases, allele-specific mutation hotspots, and break-associated mutation clustering. For example, in mutants of POLα and the Cdc13–Stn1–Ten1 complex, we find a distinct subtelomeric bias for mutations that we show is independent of the target sequence. Together our data suggest that specific genome-instability mutations are sufficient to drive discrete mutational signatures, some of which share properties with mutation patterns seen in tumors. Thus, in a population of cells, genome-instability mutations could influence clonal evolution by establishing discrete mutational trajectories for genomes. PMID:24336748

  13. Responses of Wild-Type and Resistant Strains of the Hyperthermophilic Bacterium Thermotoga maritima to Chloramphenicol Challenge▿ †

    PubMed Central

    Montero, Clemente I.; Johnson, Matthew R.; Chou, Chung-Jung; Conners, Shannon B.; Geouge, Sarah G.; Tachdjian, Sabrina; Nichols, Jason D.; Kelly, Robert M.

    2007-01-01

    Transcriptomes and growth physiologies of the hyperthermophile Thermotoga maritima and an antibiotic-resistant spontaneous mutant were compared prior to and following exposure to chloramphenicol. While the wild-type response was similar to that of mesophilic bacteria, reduced susceptibility of the mutant was attributed to five mutations in 23S rRNA and phenotypic preconditioning to chloramphenicol. PMID:17557852

  14. Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2010-01-01

    Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

  15. The androgen receptor gene mutations database.

    PubMed

    Patterson, M N; Hughes, I A; Gottlieb, B; Pinsky, L

    1994-09-01

    The androgen receptor gene mutations database is a comprehensive listing of mutations published in journals and meetings proceedings. The majority of mutations are point mutations identified in patients with androgen insensitivity syndrome. Information is included regarding the phenotype, the nature and location of the mutations, as well as the effects of the mutations on the androgen binding activity of the receptor. The current version of the database contains 149 entries, of which 114 are unique mutations. The database is available from EMBL (NetServ@EMBL-Heidelberg.DE) or as a Macintosh Filemaker file (mc33001@musica.mcgill.ca).

  16. Mutator Dynamics on a Smooth Evolutionary Landscape

    NASA Astrophysics Data System (ADS)

    Kessler, David A.; Levine, Herbert

    1998-03-01

    We investigate a model of evolutionary dynamics on a smooth landscape which features a ``mutator'' allele which increases the mutation rate. We show that when the fitness is far from its equilibrium value the expected proportion of mutators approaches a value governed solely by the transition rates into and out of the mutator state, resulting in a much faster fitness increase than would be the case without the mutator allele. Near the fitness equilibrium, the mutators are severely suppressed, due to the detrimental effects of a large mutation rate near the fitness maximum. We discuss the results of a recent experiment on natural selection of E. coli in the light of our model.

  17. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    PubMed

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  18. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    PubMed

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  19. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded. PMID:10603259

  20. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    PubMed

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  1. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta.

    PubMed

    Mackey, L Y; Winnepenninckx, B; De Wachter, R; Backeljau, T; Emschermann, P; Garey, J R

    1996-05-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, two annelids, and a platyhelminth. Phylogenetic analyses of these data show that (1) entoprocts and lophophorates have spiralian, protostomous affinities, (2) Ento- and Ectoprocta are not sister taxa, (3) phoronids and brachiopods form a monophyletic clade, and (4) neither Ectoprocta or Annelida appear to be monophyletic. Both deuterostomous and pseudocoelomate features may have arisen at least two times in evolutionary history. These results advocate a Spiralia-Radialia-based classification rather than one based on the Protostomia-Deuterostomia concept.

  2. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.

    PubMed

    Dorsch, M; Lane, D; Stackebrandt, E

    1992-01-01

    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  3. Virtual metagenome reconstruction from 16S rRNA gene sequences.

    PubMed

    Okuda, Shujiro; Tsuchiya, Yuki; Kiriyama, Chiho; Itoh, Masumi; Morisaki, Hisao

    2012-01-01

    Microbial ecologists have investigated roles of species richness and diversity in a wide variety of ecosystems. Recently, metagenomics have been developed to measure functions in ecosystems, but this approach is cost-intensive. Here we describe a novel method for the rapid and efficient reconstruction of a virtual metagenome in environmental microbial communities without using large-scale genomic sequencing. We demonstrate this approach using 16S rRNA gene sequences obtained from denaturing gradient gel electrophoresis analysis, mapped to fully sequenced genomes, to reconstruct virtual metagenome-like organizations. Furthermore, we validate a virtual metagenome using a published metagenome for cocoa bean fermentation samples, and show that metagenomes reconstructed from biofilm formation samples allow for the study of the gene pool dynamics that are necessary for biofilm growth.

  4. Phylogeny of the bodonid flagellates (Kinetoplastida) based on small-subunit rRNA gene sequences.

    PubMed

    Dolezel, D; Jirků, M; Maslov, D A; Lukes, J

    2000-09-01

    The phylogeny of kinetoplastid flagellates was investigated by determining the sequences of the small-subunit (18S) rRNA from Bodo designis, Bodo saltans K, Bodo saltans P, Bodo sorokini, Bodo sp. (cf. uncinatus), Cruzella marina, Cryptobia helicis, Dimastigella mimosa and Parabodo nitrophilus and analysing these data together with several previously obtained sequences. The root of the kinetoplastid tree was tentatively determined to be attached to the branch of B. designis and/or Cruzella marina. Within this topology, the suborder Trypanosomatina appears as a late-emerging monophyletic group, while the suborder Bodonina is paraphyletic. Within the bodonid subtree, the branches of parasitic organisms were intermingled with free-living ones, implying multiple transitions to parasitism. The tree indicates that the genera Cryptobia and Bodo are artificial taxa. In addition, the separation of the fish cryptobias and Trypanoplasma borreli as different genera was not supported.

  5. Origin of the Mesozoa inferred from 18S rRNA gene sequences.

    PubMed

    Pawlowski, J; Montoya-Burgos, J I; Fahrni, J F; Wüest, J; Zaninetti, L

    1996-10-01

    The phylum Mesozoa comprises small, simply organized wormlike parasites of marine invertebrates and is composed of two classes, the Rhombozoa and the Orthonectida. The origin of Mesozoa is uncertain; they are classically considered either as degenerate turbellarians or as primitive multicellular animals related to ciliated protists. In order to precisely determine the phylogenetic position of this group we sequenced the complete 18S rRNA gene of one rhombozoid, Dicyema sp., and one orthonectid, Rhopalura ophiocomae. The sequence analysis shows that the Mesozoa branch early in the animal evolution, closely to nematodes and myxozoans. Our data indicate probably separate origins of rhombozoids and orthonectids, suggesting that their placement in the same phylum needs to be revised.

  6. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded.

  7. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  8. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    PubMed

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  9. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  10. Differential identification of Entamoeba spp. based on the analysis of 18S rRNA.

    PubMed

    Santos, Helena Lúcia Carneiro; Bandea, Rebecca; Martins, Luci Ana Fernandes; de Macedo, Heloisa Werneck; Peralta, Regina Helena Saramago; Peralta, Jose Mauro; Ndubuisi, Mackevin I; da Silva, Alexandre J

    2010-03-01

    Entamoeba histolytica is known to cause intestinal and extra-intestinal disease while the other Entamoeba species are not considered to be pathogenic. However, all Entamoeba spp. should be reported when identified in clinical samples. Entamoeba polecki, Entamoeba coli, and Entamoeba hartmanii can be differentiated morphologically from E. histolytica, but some of their diagnostic morphologic features overlap. E. histolytica, Entamoeba dispar, and Entamoeba moshkovskii are morphologically identical but can be differentiated using molecular tools. We developed a polymerase chain reaction (PCR) procedure followed by DNA sequencing of specific regions of 18S rRNA gene to differentiate the Entamoeba spp. commonly found in human stools. This approach was used to analyze 45 samples from cases evaluated for the presence of Entamoeba spp. by microscopy and a real-time PCR method capable of differential detection of E. histolytica and E. dispar. Our results demonstrated an agreement of approximately 98% (45/44) between the real-time PCR for E. histolytica and E. dispar and the 18S rRNA analysis described here. Five previously negative samples by microscopy revealed the presence of E. dispar, E. hartmanii, or E. coli DNA. In addition, we were able to detect E. hartmanii in a stool sample that had been previously reported as negative for Entamoeba spp. by microscopy. Further microscopic evaluation of this sample revealed the presence of E. hartmanii cysts, which went undetected during the first microscopic evaluation. This PCR followed by DNA sequencing will be useful to refine the diagnostic detection of Entamoeba spp. in stool and other clinical specimens.

  11. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  12. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  13. Ribosome biogenesis requires a highly diverged XRN family 5'->3' exoribonuclease for rRNA processing in Trypanosoma brucei.

    PubMed

    Sakyiama, Joseph; Zimmer, Sara L; Ciganda, Martin; Williams, Noreen; Read, Laurie K

    2013-10-01

    Although biogenesis of ribosomes is a crucial process in all organisms and is thus well conserved, Trypanosoma brucei ribosome biogenesis, of which maturation of rRNAs is an early step, has multiple points of divergence. Our aim was to determine whether in the processing of the pre-rRNA precursor molecule, 5'→3' exoribonuclease activity in addition to endonucleolytic cleavage is necessary in T. brucei as in other organisms. Our approach initiated with the bioinformatic identification of a putative 5'→3' exoribonuclease, XRNE, which is highly diverged from the XRN2/Rat1 enzyme responsible for rRNA processing in other organisms. Tagging this protein in vivo allowed us to classify XRNE as nucleolar by indirect immunofluorescence and identify by copurification interacting proteins, many of which were ribosomal proteins, ribosome biogenesis proteins, and/or RNA processing proteins. To determine whether XRNE plays a role in ribosome biogenesis in procyclic form cells, we inducibly depleted the protein by RNA interference. This resulted in the generation of aberrant preprocessed 18S rRNA and 5' extended 5.8S rRNA, implicating XRNE in rRNA processing. Polysome profiles of XRNE-depleted cells demonstrated abnormal features including an increase in ribosome small subunit abundance, a decrease in large subunit abundance, and defects in polysome assembly. Furthermore, the 5' extended 5.8S rRNA in XRNE-depleted cells was observed in the large subunit, monosomes, and polysomes in this gradient. Therefore, the function of XRNE in rRNA processing, presumably due to exonucleolytic activity very early in ribosome biogenesis, has consequences that persist throughout all biogenesis stages.

  14. Measurement of rRNA Variations in Natural Communities of Microorganisms on the Southeastern U.S. Continental Shelf †

    PubMed Central

    Kramer, Jonathan G.; Singleton, Fred L.

    1993-01-01

    The development of a clear understanding of the physiology of marine prokaryotes is complicated by the difficulties inherent in resolving the activity of various components of natural microbial communities. Application of appropriate molecular biological techniques offers a means of overcoming some of these problems. In this regard, we have used direct probing of bulk RNA purified from selective size fractions to examine variations in the rRNA content of heterotrophic communities and Synechococcus populations on the southeastern U.S. continental shelf. Heterotrophic communities in natural seawater cultures amended with selected substrates were examined. Synechococcus populations were isolated from the water column by differential filtration. The total cellular rRNA content of the target populations was assayed by probing RNA purified from these samples with an oligonucleotide complementing a universally conserved region in the eubacterial 16S rRNA (heterotrophs) or with a 1.5-kbp fragment encoding the Synechococcus sp. strain WH 7803 16S rRNA (cyanobacteria). The analyses revealed that heterotrophic bacteria responded to the addition of glucose and trace nutrients after a 6-h lag period. However, no response was detected after amino acids were added. The cellular rRNA content increased 48-fold before dropping to a value 20 times that detected before nutrients were added. Variations in the rRNA content from Synechococcus spp. followed a distinct diel pattern imposed by the phasing of cell division within the irradiance cycle. The results indicate that careful application of these appropriate molecular biological techniques can be of great use in discerning basic physiological characteristics of selected natural populations and the mechanisms which regulate growth at the subcellular level. Images PMID:16349009

  15. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  16. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences.

  17. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  18. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.

    PubMed

    Höfle, M G; Haas, H; Dominik, K

    1999-07-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  19. HFE mutations in the elderly.

    PubMed

    Willis, Gavin; Wimperis, Jennie Z; Smith, Katy; Fellows, Ian W; Jennings, Barbara A

    2003-01-01

    Most individuals diagnosed with hereditary hemochromatosis have mutations in both copies of the HFE gene, with such mutations being common in populations of north European origin. The number of individuals currently diagnosed and treated for hemochromatosis is small relative to the number carrying two HFE mutations. Studies searching for undiagnosed hemochromatosis cases among disease cohorts have generally failed to find the number of cases that would be expected if disease were the commonest outcome for individuals with two C282Y HFE mutations. Our aim was to test the hypothesis that individuals with two HFE mutations would be under-represented in an elderly population because many would have died from disease caused by hemochromatosis before they reached old age. This is a cross-sectional study of elderly patients referred for full blood counts at the Norfolk and Norwich University Hospital. We screened blood samples from 1,000 elderly men (aged 85 and over) and women (aged 89 and over) for the C282Y, H63D, and S65C mutations of the HFE gene. We also analyzed any recent laboratory data relevant to signs of hemochromatosis