Sample records for 23s rrna sequences

  1. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.


    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio


    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  2. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington


    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  3. Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

    PubMed Central

    Takaiwa, F; Sugiura, M


    The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which contain intervening sequences of 707 bp and 710 bp, respectively. Strong homology between the two intervening sequences is observed. These spacer tRNAs are synthesized as part of an 8.2 kb precursor molecule containing 16S and 23S rRNA sequences. Images PMID:6281739

  4. The sequence of Methanospirillum hungatei 23S rRNA confirms the specific relationship between the extreme halophiles and the Methanomicrobiales

    NASA Technical Reports Server (NTRS)

    Burggraf, S.; Ching, A.; Stetter, K. O.; Woese, C. R.


    We have determined the sequence of the 23S rRNA from the methanogenic archaeon Methanospirillum hungatei. This is the first such sequence from a member of the Methanomicrobiales. Moreover, it brings additional evidence to bear on the possible specific relationship between this particular group of methanogens and the extreme halophiles. Such evidence is critical in that several new (and relatively untested) methods of phylogenetic inference have lead to the controversial conclusion that the extreme halophiles are either not related to the archaea, or are only peripherally so. Analysis of the Methanospirillum hungatei 23S rRNA sequence shows the Methanomicrobiales are indeed a sister group of the extreme halophiles, further strengthening the conclusions reached from analysis of 16S rRNA sequences.

  5. Identification of Lactobacillus Isolates from the Gastrointestinal Tract, Silage, and Yoghurt by 16S-23S rRNA Gene Intergenic Spacer Region Sequence Comparisons

    PubMed Central

    Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Ng, J.; Munro, K.; Alatossava, T.


    Lactobacillus isolates were identified by PCR amplification and sequencing of the region between the 16S and 23S rRNA genes (spacer region). The sequences obtained from the isolates were compared to those of reference strains held in GenBank. A similarity of 97.5% or greater was considered to provide identification. To check the reliability of the method, the V2-V3 region of the 16S rRNA gene was amplified and sequenced in the case of isolates whose spacer region sequences were less than 99% similar to that of a reference strain. Confirmation of identity was obtained in all instances. Spacer region sequencing provided rapid and accurate identification of Lactobacillus isolates obtained from gastrointestinal, yoghurt, and silage samples. It had an advantage over 16S V2-V3 sequence comparisons because it distinguished between isolates of Lactobacillus casei and Lactobacillus rhamnosus. PMID:10473450

  6. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.


    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H


    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  7. Phylogeny of bradyrhizobia from Chinese cowpea miscellany inferred from 16S rRNA, atpD, glnII, and 16S-23S intergenic spacer sequences.


    Zhang, Sufang; Xie, Fuli; Yang, Jiangke; Li, Youguo


    The cowpea (Vigna unguiculata L.), peanut (Arachis hypogaea L.), and mung bean (Vigna radiata L.) belong to a group of plants known as the "cowpea miscellany" plants, which are widely cultivated throughout the tropic and subtropical zones of Africa and Asia. However, the phylogeny of the rhizobial strains that nodulate these plants is poorly understood. Previous studies have isolated a diversity of rhizobial strains from cowpea miscellany hosts and have suggested that, phylogenetically, they are from different species. In this work, the phylogeny of 42 slow-growing rhizobial strains, isolated from root nodules of cowpea, peanut, and mung bean from different geographical regions of China, was investigated using sequences from the 16S rRNA, atpD and glnII genes, and the 16S-23S rRNA intergenic spacer. The indigenous rhizobial strains from the cowpea miscellany could all be placed in the genus Bradyrhizobium , and Bradyrhizobium liaoningense and Bradyrhizobium yuanmingense were the main species. Phylogenies derived from housekeeping genes were consistent with phylogenies generated from the ribosomal gene. Mung bean rhizobia clustered only into B. liaoningense and B. yuanmingense and were phylogenetically less diverse than cowpea and peanut rhizobia. Geographical origin was significantly reflected in the phylogeny of mung bean rhizobia. Most cowpea rhizobia were more closely related to the 3 major groups B. liaoningense, B. yuanmingense, and Bradyrhizobium elkanii than to the minor groups Bradyrhizobium japonicum or Bradyrhizobium canariense . However, most peanut rhizobia were more closely related to the 2 major groups B. liaoningense and B. yuanmingense than to the minor group B. elkanii.

  8. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.


    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver


    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  9. Species-level identification of isolates of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex by sequence analysis of the 16S-23S rRNA gene spacer region.


    Chang, Hsien Chang; Wei, Yu Fang; Dijkshoorn, Lenie; Vaneechoutte, Mario; Tang, Chung Tao; Chang, Tsung Chain


    The species Acinetobacter calcoaceticus, A. baumannii, genomic species 3, and genomic species 13TU included in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex are genetically highly related and difficult to distinguish phenotypically. Except for A. calcoaceticus, they are all important nosocomial species. In the present study, the usefulness of the 16S-23S rRNA gene intergenic spacer (ITS) sequence for the differentiation of (genomic) species in the A. calcoaceticus-A. baumannii complex was evaluated. The ITSs of 11 reference strains of the complex and 17 strains of other (genomic) species of Acinetobacter were sequenced. The ITS lengths (607 to 638 bp) and sequences were highly conserved for strains within the A. calcoaceticus-A. baumannii complex. Intraspecies ITS sequence similarities ranged from 0.99 to 1.0, whereas interspecies similarities varied from 0.86 to 0.92. By using these criteria, 79 clinical isolates identified as A. calcoaceticus (18 isolates) or A. baumannii (61 isolates) with the API 20 NE system (bioMerieux Vitek, Marcy l'Etoile, France) were identified as A. baumannii (46 isolates), genomic species 3 (19 isolates), and genomic species 13TU (11 isolates) by ITS sequencing. An identification rate of 96.2% (76 of 79 isolates) was obtained by using ITS sequence analysis for identification of isolates in the A. calcoaceticus-A. baumannii complex, and the accuracy of the method was confirmed for a subset of strains by amplified rRNA gene restriction analysis and genomic DNA analysis by AFLP analysis by using libraries of profiles of reference strains. In conclusion, ITS sequence-based identification is reliable and provides a promising tool for elucidation of the clinical significance of the different species of the A. calcoaceticus-A. baumannii complex.

  10. Comparison of sequence differences in a variable 23S rRNA domain among sets of cryptic species of ciliated protozoa.


    Nanney, D L; Park, C; Preparata, R; Simon, E M


    Studies were undertaken to discover the relative molecular distances separating some familiar forms of ciliated protozoa, and the genetic species they include. Sequences of 190 bases of the D2 domain of the large ribosomal nucleic acid molecule were obtained by polymerase chain reaction from protists of three distinctive groups of ciliated protozoa-Colpoda, Paramecium and Tetrahymena. Evolutionary trees were constructed for each set of sequences using the PHYLOGEN 1.0 string programs. All three groups of ciliates manifested large molecular diversity among strains difficult or impossible to distinguish morphologically. The largest single evolutionary distance within a group was the 75 differences separating Tetrahymena paravorax from the other tetrahymenids. The largest mean distance for a group was the 21.2 for the colpodids. In all the protist groups the large molecular diversity is obscured by morphological conservatism associated with constraints of ancient designs. The molecular diversity within morphotypes argues for long evolutionary coexistence of species differentiated from each other in significant physiological, ecological, or nutritional ways.

  11. Two Cases of Mycoplasma pneumoniae Pneumonia with A2063G Mutation in the 23S rRNA Gene in Siblings

    PubMed Central

    Hong, Joo Hee; Chun, Jin Kyong; Oh, Ki Jin; Kim, Juwon; Yoon, Kap Jun


    We describe 2 cases of pneumonia caused by the same macrolide-resistant Mycoplasma pneumoniae in siblings. M. pneumoniae was identified using real-time PCR. Direct sequence analysis of the 23S rRNA gene revealed a point mutation in V domain (A2063G) of the 23S rRNA gene. PMID:23301225

  12. Sequence specific detection of bacterial 23S ribosomal RNA by TLR13

    PubMed Central

    Li, Xiao-Dong; Chen, Zhijian J


    Toll-like receptors (TLRs) detect microbial infections and trigger innate immune responses. Among vertebrate TLRs, the role of TLR13 and its ligand are unknown. Here we show that TLR13 detects the 23S ribosomal RNA of both gram-positive and gram-negative bacteria. A sequence containing 13 nucleotides near the active site of 23S rRNA ribozyme, which catalyzes peptide bond synthesis, was both necessary and sufficient to trigger TLR13-dependent interleukin-1β production. Single point mutations within this sequence destroyed the ability of the 23S rRNA to stimulate the TLR13 pathway. Knockout of TLR13 in mice abolished the induction of interleukin-1β and other cytokines by the 23S rRNA sequence. Thus, TLR13 detects bacterial RNA with exquisite sequence specificity. DOI: PMID:23110254

  13. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.


    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G


    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  14. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.


    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  15. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.


    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho


    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  16. Case of Localized Recombination in 23S rRNA Genes from Divergent Bradyrhizobium Lineages Associated with Neotropical Legumes

    PubMed Central

    Parker, Matthew A.


    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5′ portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5′ 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii. PMID:11319084

  17. Case of localized recombination in 23S rRNA genes from divergent bradyrhizobium lineages associated with neotropical legumes.


    Parker, M A


    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5' portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5' 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii.

  18. Pyrosequencing of plastid 23S rRNA genes reveals diverse and dynamic cyanobacterial and algal populations in two eutrophic lakes.


    Steven, Blaire; McCann, Sage; Ward, Naomi L


    Pyrosequencing of plastid 23S rRNA genes was performed to determine the usefulness of this methodology for describing spatial and temporal patterns of algal diversity in two eutrophic lakes. The majority of the sequences were identified as known cyanobacteria or eukaryotic algae (> 70% of sequence reads), indicating this approach can specifically recover algal sequences from complex communities. Furthermore, estimated coverage of the data sets indicated that the majority of the 23S rRNA genetic diversity was recovered in these surveys. Communities from algal mats could be clearly distinguished from algae in the water column, and the communities could be readily differentiated between the two lakes, suggesting that the plastid 23S rRNA sequencing was able to distinguish niche and biogeographic partitioning of algal communities. Within the sequence data sets, the ratio of cyanobacteria to eukaryotic algae fluctuated over the course of sampling, with cyanobacteria 23S rRNA sequences being more abundant in later samples. In addition, the eukaryotic algae communities showed large shifts in composition over the course of sampling. Taken together, these data demonstrate the usefulness of targeted plastid 23S rRNA sequencing for describing the structure and dynamics of complex algal communities.

  19. Gram-positive bacteria with a high DNA G+C content are characterized by a common insertion within their 23S rRNA genes.


    Roller, C; Ludwig, W; Schleifer, K H


    An insertion of about 100 bases within the central part of the 23S rRNA genes was found to be a phylogenetic marker for the bacterial line of descent of Gram-positive bacteria with a high DNA G + C content. The insertion was present in 23S rRNA genes of 64 strains representing the major phylogenetic groups of Gram-positive bacteria with a high DNA G+C content, whereas it was not found in 23S rRNA genes of 55 (eu)bacteria representing Gram-positive bacteria with a low DNA G + C content and all other known (eu)bacterial phyla. The presence of the insertion could be easily demonstrated by comparative gel electrophoretic analysis of in vitro-amplified 23S rDNA fragments, which contained the insertion. The nucleotide sequences of the amplified fragments were determined and sequence similarities of at least 44% were found. The overall similarity values are lower than those of 16S and 23S rRNA sequences of the particular organism. Northern hybridization experiments indicated the presence of the insertion within the mature 23S rRNA of Corynebacterium glutamicum.

  20. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.


    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya


    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  1. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.


    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya


    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence. PMID:26904019

  2. 16S–23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    PubMed Central

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya


    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S–23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S–23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2–57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes), ITSAla(TGC), ITSAla(TGC)+Ile(GAT), ITSIle(GAT)+Ala(TGC), and ITS Ile(GAT)+Pseudo. All of the identified tRNAAla(TGC) molecules consisted of 73 bases, and all of the tRNAIle(GAT) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S–23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence. PMID:26904019

  3. New Site of Modification of 23S rRNA Associated with Clarithromycin Resistance of Helicobacter pylori Clinical Isolates

    PubMed Central

    Fontana, Carla; Favaro, Marco; Minelli, Silvia; Criscuolo, Anna Angela; Pietroiusti, Antonio; Galante, Alberto; Favalli, Cartesio


    Resistance of Helicobacter pylori to clarithromycin occurs with a prevalence ranging from 0 to 15%. This has an important clinical impact on dual and triple therapies, in which clarithromycin seems to be the better choice to achieve H. pylori eradication. In order to evaluate the possibility of new mechanisms of clarithromycin resistance, a PCR assay that amplified a portion of 23S rRNA from H. pylori isolates was used. Gastric tissue biopsy specimens from 230 consecutive patients were cultured for H. pylori isolation. Eighty-six gastric biopsy specimens yielded H. pylori-positive results, and among these 12 isolates were clarithromycin resistant. The latter were studied to detect mutations in the 23S rRNA gene. Sequence analysis of the 1,143-bp PCR product (portion of the 23S rRNA gene) did not reveal mutation such as that described at position 2142 to 2143. On the contrary, our findings show, for seven isolates, a T-to-C transition at position 2717. This mutation conferred a low level of resistance, equivalent to the MIC for the isolates, selected using the E-test as well as using the agar dilution method: 1 μg/ml. Moreover, T2717C transition is located in a highly conserved region of the 23S RNA associated with functional sites: domain VI. This fact has a strong effect on the secondary structure of the 23S RNA and on its interaction with macrolide. Mutation at position 2717 also generated an HhaI restriction site; therefore, restriction analysis of the PCR product also permits a rapid detection of resistant isolates. PMID:12435674

  4. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.


    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  5. Atypical processing in domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004(T) at a position homologous to an rRNA fragmentation site in protozoa.


    Klein, Franziska; Samorski, Regina; Klug, Gabriele; Evguenieva-Hackenberg, Elena


    For still unknown reasons, the 23S rRNA of many alpha-Proteobacteria shows a unique fragmentation pattern compared to other bacteria. The 23S rRNA processing involves RNase III and additional, yet unidentified enzymes. The alpha-proteobacterium Rhizobium leguminosarum ATCC 10004(T) possesses two fragmentation sites in its 23S rRNA. The first one harbors an intervening sequence in helix 9 which is cleaved by RNase III. We demonstrate that the mature 5' end of the resulting 2.6-kb rRNA fragment is generated by additional removal of helix 10. A fraction of the 2.6-kb rRNA is further processed in domain III, giving rise to two 1.3-kb rRNA fragments. We mapped the domain III fragmentation site and found it to be at a position which has only been reported for trypanosomatid protozoa. This fragmentation site is also unique in that it lacks an intervening sequence. We found that the simultaneous occurrence of 2.6-kb and 1.3-kb rRNA fragments is not due to interoperonal sequence differences but rather reflects slow processing. The different characteristics of the two fragmentation sites in the 23S rRNA suggest that they are processed by different mechanisms. Interestingly, the amount of 2.6-kb rRNA varies during culture growth. We observed a transient increase in the relative amount of 2.6-kb rRNA fragments during the first hours after inoculation, which points to changes in the ratio of rRNA synthesis rate to domain III processing rate during the growth of a culture.

  6. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips


    Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.


    The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  7. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.


    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B


    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value <0.0001). dPCR quantification was also consistent with quantitative PCR (qPCR) measurements as well as cell counts for BioBall reference standard and 24 environmental water samples. qPCR and dPCR quantification of enterococci in the 24 environmental samples were significantly correlated (linear regression slope =1.08, R(2) of 0.96, and p value <0.0001); the group mean of the qPCR measurements was 0.19 log units higher than that of the dPCR measurements. At environmentally relevant concentrations, dPCR quantification was more precise (i.e., had narrower 95% confidence intervals than qPCR quantification). We observed that humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  8. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.


    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V


    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  9. Analysis of 16S-23S rRNA Intergenic Spacer Regions of Vibrio cholerae and Vibrio mimicus

    PubMed Central

    Chun, Jongsik; Huq, Anwarul; Colwell, Rita R.


    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3′ end of the 16S and the 5′ end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae. PMID:10224020

  10. Lactobacillus species identification by amplified ribosomal 16S-23S rRNA restriction fragment length polymorphism analysis.


    Sandes, S H C; Alvin, L B; Silva, B C; Zanirati, D F; Jung, L R C; Nicoli, J R; Neumann, E; Nunes, A C


    Lactic acid bacteria strains are commonly used for animal and human consumption due to their probiotic properties. One of the major genera used is Lactobacillus, a highly diverse genus comprised of several closely related species. The selection of new strains for probiotic use, especially strains of Lactobacillus, is the focus of several research groups. Accurate identification to species level is fundamental for research on new strains, as well as for safety assessment and quality assurance. The 16S-23S internal transcribed spacer (ITS-1) is a deeply homologous region among prokaryotes that is commonly used for identification to the species level because it is able to acquire and accumulate mutations without compromising general bacterial metabolism. In the present study, 16S-23S ITS regions of 45 Lactobacillus species (48 strains) were amplified and subjected to independent enzymatic digestions, using 12 restriction enzymes that recognise six-base sequences. Twenty-nine species showed unique restriction patterns, and could therefore be precisely identified solely by this assay (64%). This approach proved to be reproducible, allowing us to establish simplified restriction patterns for each evaluated species. The restriction patterns of each species were similar among homologous strains, and to a large extent reflected phylogenetic relationships based on 16S rRNA sequences, demonstrating the promising nature of this region for evolutionary studies.

  11. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    PubMed Central


    Background Francisella (F.) tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR) have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH) assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples. PMID:20205957

  12. Differentiation of non-pylori Helicobacter species based on PCR-restriction fragment length polymorphism of the 23S rRNA gene.


    Yadegar, Abbas; Alebouyeh, Masoud; Lawson, Andy J; Mirzaei, Tabassom; Nazemalhosseini Mojarad, Ehsan; Zali, Mohammad Reza


    Phenotypic identification of non-pylori Helicobacter species has always been problematic and time-consuming in comparison with many other bacteria. We developed a rapid two-step identification assay based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 23S rRNA gene for differentiating between non-pylori Helicobacter species. A new genus-specific primer pair based on all available complete and partial 23S rRNA sequences of Helicobacter species was designed. In silico restriction analysis of variable regions of the 23S rRNA gene suggested SmaI and HindIII endonucleases would provide a good level of differentiation. Analysis of the obtained 23S rRNA RFLP patterns divided all Helicobacter study strains into three species groups (groups A-C) and 12 unique restriction patterns. Wolinella succinogenes also gave a unique pattern. Our proposed PCR-RFLP method was found to be as a valuable tool for routine identification of non-pylori Helicobacter species from human or animal samples.

  13. Rapid assay of A2058T-mutated 23S rRNA allelic profiles associated with high-level macrolide resistance in Moraxella catarrhalis.


    Saito, Ryoichi; Kasai, Ayako; Ogihara, Shinji; Yamada, Kageto; Tao, Kazuyuki


    We report on a restriction fragment-length polymorphism (HpyCH4III) assay for profile analysis of 23S rRNA gene A2058T-mutated alleles associated with high-level macrolide resistance in Moraxella catarrhalis. Our assay results were supported by DNA sequencing analysis, allowed for simultaneous testing of many strains, and produced results from pure-cultured colonies within 4 h.

  14. Mycobacterial toxin MazF-mt6 inhibits translation through cleavage of 23S rRNA at the ribosomal A site.


    Schifano, Jason M; Edifor, Regina; Sharp, Jared D; Ouyang, Ming; Konkimalla, Arvind; Husson, Robert N; Woychik, Nancy A


    The Mycobacterium tuberculosis genome contains an unusually high number of toxin-antitoxin modules, some of which have been suggested to play a role in the establishment and maintenance of latent tuberculosis. Nine of these toxin-antitoxin loci belong to the mazEF family, encoding the intracellular toxin MazF and its antitoxin inhibitor MazE. Nearly every MazF ortholog recognizes a unique three- or five-base RNA sequence and cleaves mRNA. As a result, these toxins selectively target a subset of the transcriptome for degradation and are known as "mRNA interferases." Here we demonstrate that a MazF family member from M. tuberculosis, MazF-mt6, has an additional role--inhibiting translation through targeted cleavage of 23S rRNA in the evolutionarily conserved helix/loop 70. We first determined that MazF-mt6 cleaves mRNA at (5')UU↓CCU(3') sequences. We then discovered that MazF-mt6 also cleaves M. tuberculosis 23S rRNA at a single UUCCU in the ribosomal A site that contacts tRNA and ribosome recycling factor. To gain further mechanistic insight, we demonstrated that MazF-mt6-mediated cleavage of rRNA can inhibit protein synthesis in the absence of mRNA cleavage. Finally, consistent with the position of 23S rRNA cleavage, MazF-mt6 destabilized 50S-30S ribosomal subunit association. Collectively, these results show that MazF toxins do not universally act as mRNA interferases, because MazF-mt6 inhibits protein synthesis by cleaving 23S rRNA in the ribosome active center. PMID:23650345

  15. 23S rRNA gene mutations contributing to macrolide resistance in Campylobacter jejuni and Campylobacter coli

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Operon specific 23S rRNA mutations affecting minimum inhibitory concentrations (MICs) of macrolides (erythromycin [ERY], azithromycin [AZM], tylosin [TYL]) and a lincosamide (clindamycin [CLI]) were examined in a collection of Campylobacter jejuni and C. coli isolates. The three copies of the Campy...

  16. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    SciTech Connect

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D.


    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  17. Discrimination of Bacillus anthracis and Closely Related Microorganisms by Analysis of 16S and 23S rRNA with Oligonucleotide Microarray

    PubMed Central

    Bavykin, Sergei G.; Mikhailovich, Vladimir M.; Zakharyev, Vladimir M.; Lysov, Yuri p.; Kelly, John J.; Alferov, Oleg S.; Gavin, Igor M.; Kukhtin, Alexander V.; Jackman, Joany; Stahl, David A.; Chandler, Darrell; Mirzabekov, Andrei D.


    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 minutes. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead

  18. Variations in the 16S-23S rRNA internal transcribed spacer of fibrolytic Butyrivibrio isolates from the reindeer rumen.


    Præsteng, Kirsti E; Mackie, Roderick I; Cann, Isaac K O; Mathiesen, Svein D; Sundset, Monica A


    Strains of Butyrivibrio are principal cellulytic bacteria in the rumen of the High Arctic Svalbard reindeer ( Rangifer tarandus platyrhynchus ). According to phylogenetic analysis based on 16S rRNA gene sequencing, Butyrivibrio can be divided into three subgroups within the Clostridia class of the phylum Firmicutes, but the current phenotypic and genotypic differentiation within the family Lachnospiraceae is insufficient. This current study describes the sequence diversity of the 16S-23S rRNA intergenic transcribed spacer (ITS) region of Butyrivibrio isolates from reindeer. A total of 17 different ITS sequences with sizes between 449 and 784 nt were obtained. Genes encoding tRNA(Ile) and tRNA(Ala) were identified in four of the sequences. Phylogenetic neighbor-joining trees were constructed based on the ITS sequence and compared with a phylogenetic neighbor-joining tree based on 16S rRNA gene sequences previously obtained for the same isolates. These comparisons indicated a better differentiation between strains in the ITS sequence than the 16S rRNA gene based tree. Through this study, a better means for identifying and tracking fibrolytic and potentially probiotic Butyrivibrio strains in reindeer and other ruminants has been provided.

  19. PCR-based method for targeting 16S-23S rRNA intergenic spacer regions among Vibrio species

    PubMed Central


    Background The genus Vibrio is a diverse group of Gram-negative bacteria comprised of 74 species. Furthermore, the genus has and is expected to continue expanding with the addition of several new species annually. Consequently, it is of paramount importance to have a method which is able to reliably and efficiently differentiate the numerous Vibrio species. Results In this study, a novel and rapid polymerase chain reaction (PCR)-based intergenic spacer (IGS)-typing system for vibrios was developed that is based on the well-known IGS regions located between the 16S and 23S rRNA genes on the bacterial chromosome. The system was optimized to resolve heteroduplex formation as well as to take advantage of capillary gel electrophoresis technology such that reproducible analyses could be achieved in a rapid manner. System validation was achieved through testing of 69 archetypal Vibrio strains, representing 48 Vibrio species, from which an 'IGS-type' profile database was generated. These data, presented here in several cluster analyses, demonstrated successful differentiation of the 69 type strains showing that this PCR-based fingerprinting method easily discriminates bacterial strains at the species level among Vibrio. Furthermore, testing 36 strains each of V. parahaemolyticus and V. vulnificus, important food borne pathogens, isolated from a variety of geographical locations with the IGS-typing method demonstrated distinct IGS-typing patterns indicative of subspecies divergence in both populations making this technique equally useful for intraspecies differentiation, as well. Conclusion This rapid, reliable and efficient IGS-typing system, especially in combination with 16S rRNA gene sequencing, has the capacity to not only discern and identify vibrios at the species level but, in some cases, at the sub-species level, as well. This procedure is particularly well-suited for preliminary species identification and, lends itself nicely to epidemiological investigations

  20. Evaluation of the 23S rRNA gene as target for qPCR based quantification of Frankia in soils.


    Samant, Suvidha; Amann, Rudolf I; Hahn, Dittmar


    The 23S rRNA gene was evaluated as target for the development of Sybr Green-based quantitative PCR (qPCR) for the analysis of nitrogen-fixing members of the genus Frankia or subgroups of these in soil. A qPCR with a primer combination targeting all nitrogen-fixing frankiae (clusters 1, 2 and 3) resulted in numbers similar to those obtained with a previously developed qPCR using nifH gene sequences, both with respect to introduced and indigenous Frankia populations. Primer combinations more specifically targeting three subgroups of the Alnus host infection group (cluster 1) or members of the Elaeagnus host infection group (cluster 3) were specific for introduced strains of the target group, with numbers corresponding to those obtained by quantification of nitrogen-fixing frankiae with both the 23S rRNA and nifH genes as target. Method verification on indigenous Frankia populations in soils, i.e. in depth profiles from four sites at an Alnus glutinosa stand, revealed declining numbers in the depth profiles, with similar abundance of all nitrogen-fixing frankiae independent of 23S rRNA or nifH gene targets, and corresponding numbers of one group of frankiae of the Alnus host infection only, with no detections of frankiae representing the Elaeagnus, Casuarina, or a second subgroup of the Alnus host infection groups. PMID:24315016

  1. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips


    Bavykin, Sergei G.; Mirzabekov, Andrei D.


    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  2. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich


    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  3. Essential role of conserved DUF177A protein in plastid 23S rRNA accumulation and plant embryogenesis

    PubMed Central

    Yang, Jiani; Suzuki, Masaharu; McCarty, Donald R.


    DUF177 proteins are nearly universally conserved in bacteria and plants except the Chlorophyceae algae. Thus far, duf177 mutants in bacteria have not established a function. In contrast, duf177a mutants have embryo lethal phenotypes in maize and Arabidopsis. In maize inbred W22, duf177a mutant embryos arrest at an early transition stage, whereas the block is suppressed in the B73 inbred background, conditioning an albino seedling phenotype. Background-dependent embryo lethal phenotypes are characteristic of maize plastid gene expression mutants. Consistent with the plastid gene expression hypothesis, quantitative real-time PCR revealed a significant reduction of 23S rRNA in an Escherichia coli duf177 knockout. Plastid 23S rRNA contents of duf177a mutant tissues were also markedly reduced compared with the wild-type, whereas plastid 16S, 5S, and 4.5S rRNA contents were less affected, indicating that DUF177 is specifically required for accumulation of prokaryote-type 23S rRNA. An AtDUF177A–green fluorescent protein (GFP) transgene controlled by the native AtDUF177A promoter fully complemented the Arabidopsis atduf177a mutant. Transient expression of AtDUF177A–GFP in Nicotiana benthamiana leaves showed that the protein was localized in chloroplasts. The essential role of DUF177A in chloroplast–ribosome formation is reminiscent of IOJAP, another highly conserved ribosome-associated protein, suggesting that key mechanisms controlling ribosome formation in plastids evolved from non-essential pathways for regulation of the prokaryotic ribosome. PMID:27574185

  4. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis

    PubMed Central

    Yang, Leiyun; Yang, Fen; Wang, Yi; Zhu, Jian-Kang; Hua, Jian


    Plants have varying abilities to tolerate chilling (low but not freezing temperatures), and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance. PMID:27138552

  5. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis.


    Wang, Shuai; Bai, Ge; Wang, Shu; Yang, Leiyun; Yang, Fen; Wang, Yi; Zhu, Jian-Kang; Hua, Jian


    Plants have varying abilities to tolerate chilling (low but not freezing temperatures), and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance. PMID:27138552

  6. Methylation of 23S rRNA Nucleotide G748 by RlmAII Methyltransferase Renders Streptococcus pneumoniae Telithromycin Susceptible

    PubMed Central

    Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko


    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046

  7. Low prevalence of clarithromycin-resistant Helicobacter pylori isolates with A2143G point mutation in the 23S rRNA gene in North India.


    Gehlot, Valentina; Mahant, Shweta; Mukhopadhyay, Asish Kumar; Das, Kunal; Alam, Jawed; Ghosh, Prachetash; Das, Rajashree


    Resistance of Helicobacter pylori to clarithromycin is associated with a single base substitution in the 23S rRNA gene. In this study, clarithromycin-resistant H. pylori isolates were analysed for the presence of 23S rRNA gene mutations. H. pylori were isolated from 68 patients suffering from various gastroduodenal diseases in North India. Minimum inhibitory concentrations (MICs) were determined by the agar dilution method, and point mutations in clarithromycin-resistant strains were identified by PCR-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing. Clarithromycin resistance was observed in 11.8% (8/68) of the H. pylori isolates in North India. The A2143G point mutation in the 23S rRNA gene was found in 87.5% (7/8) of the clarithromycin-resistant strains, and the A2142G mutation in association with the T2182C mutation was found in 12.5% (1/8). In conclusion, the continued high prevalence of clarithromycin-sensitive H. pylori strains (88.2%) observed in this study allows the use of the triple-therapy regimen for the treatment of H. pylori infection in this region. Surveillance studies need to be conducted at regular intervals for clarithromycin resistance in the population. To our knowledge, this is the first study in India to report that point mutations at position A2143G and at A2142G in association with T2182C are associated with clarithromycin resistance, confirming reports from other parts of the world. PMID:27530837

  8. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly.


    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu


    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2'-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2'-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  9. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly

    PubMed Central

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu


    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2′-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2′-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  10. Methylation sites in Escherichia coli ribosomal RNA: localization and identification of four new sites of methylation in 23S rRNA.


    Smith, J E; Cooperman, B S; Mitchell, P


    Four previously undetermined sites of methylation are mapped in Escherichia coli 23S rRNA employing a novel combination of methods. First, using a double-isotope approach, the total number of methyl groups in 23S rRNA was determined to be 14.9 +/- 1.6. Second, hybridization of methyl-labeled rRNA to complementary DNA restriction fragments and PAGE analysis were used to purify RNA-DNA heteroduplexes and to quantify methyl groups within specific 23S rRNA fragments. Third, the methylated nucleosides in these fragments were identified and quantified using HPLC, confirming the presence of 14 methylation sites in 23S rRNA, four more than had been previously identified. In contrast, a similar set of analyses conducted on 16S rRNA gave evidence for 10 sites of methylation, at all approximate locations consistent with published 16S methylated nucleoside identities and locations. Selected regions of the 23S rRNA molecule containing previously unidentified methylated nucleosides were released by site-directed cleavage with ribonuclease H and isolated by PAGE. Sites of methylation within the RNA fragments were determined by classical oligonucleotide analyses. The four newly identified methylation sites in 23S rRNA are m2G-1835, m5C-1962, m6A-2503, and m2G at one of positions 2445-2447. Together with previously described sites of modification, these new sites form a group that is clustered in a current model for the three-dimensional organization of the 23S rRNA in the 50S ribosomal subunit, at a locus congruent with nucleotides previously implicated in ribosomal function. PMID:1384701

  11. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.


    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara


    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing.

  12. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.


    Bae, Hee-Sung; Hou, Aixin


    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods.

  13. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.


    Bae, Hee-Sung; Hou, Aixin


    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods. PMID:23269456

  14. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.


    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara


    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing. PMID:12957895

  15. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.


    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong


    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends.

  16. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA.


    Sunita, S; Zhenxing, H; Swaathi, J; Cygler, Miroslaw; Matte, Allan; Sivaraman, J


    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine (Psi) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E.coli RluF at 2.6A resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of Psi-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  17. Rapid Detection of Mutations in the 23S rRNA Gene of Helicobacter pylori That Confers Resistance to Clarithromycin Treatment to the Bacterium

    PubMed Central

    Matsumura, Masayuki; Hikiba, Yoko; Ogura, Keiji; Togo, Goichi; Tsukuda, Izumi; Ushikawa, Kenji; Shiratori, Yasushi; Omata, Masao


    We developed a new method capable of detecting point mutations in the 23S rRNA gene of Helicobacter pylori using a LightCycler. Our method can detect a mutation in this gene in less than 1 h and can process many samples at once, thereby contributing to the selection of patients suitable for clarithromycin-based therapy. PMID:11158129

  18. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.


    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles


    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  19. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.


    Sciuto, Katia; Moro, Isabella


    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis. PMID:27546720

  20. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.


    Sciuto, Katia; Moro, Isabella


    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  1. Domain I of 23S rRNA competes with a paused transcription complex for ribosomal protein L4 of Escherichia coli.

    PubMed Central

    Zengel, J M; Lindahl, L


    Ribosomal protein L4 of Escherichia coli regulates expression of its own eleven gene S10 operon both by inhibiting translation and by stimulating premature termination of transcription. Both regulatory processes presumably involve L4 recognition of the S10 leader RNA. To help define L4's regulatory target, we have investigated the protein's cognate target on 23S rRNA. Binding of L4 to various fragments of the 23S rRNA was monitored by determining their ability to sequester L4 in an in vitro transcription system and thereby eliminate the protein's effect on transcription. Using this approach we identified a region of about 110 bases within domain I of 23S rRNA which binds L4. A two base deletion within this region, close to the base to which L4 has been cross-linked in intact 50S subunits, eliminates L4 binding. These results also confirm the prediction of the autogenous control model, that L4 bound to its target on rRNA is not active in regulating transcription of the S10 operon. Images PMID:7685080

  2. Magnesium ions mediate contacts between phosphoryl oxygens at positions 2122 and 2176 of the 23S rRNA and ribosomal protein L1.

    PubMed Central

    Drygin, D; Zimmermann, R A


    The complex of ribosomal protein L1 with 23S rRNA from Escherichia coli is of great interest because of the unique structural and functional aspects of this ribonucleoprotein domain. We have minimized the binding site for protein L1 on the 23S rRNA to nt 2120-2129, 2159-2162, and 2167-2178. This RNA fragment consists of two helices as well as an interconnecting loop of unknown structure. RNA molecules corresponding to the minimized L1 binding site, in which G, A, U, or C were individually replaced by their deoxyribo- (dN) or alpha-thio- (rNaS) analogs have been synthesized by T7 transcription in vitro and analyzed for their ability to bind protein L1. It has been demonstrated that the substitution of rNaS at position 2122 or 2176 decreases the affinity of the RNA for the protein in the presence of magnesium five- to tenfold, whereas the same changes have little effect on binding in the presence of manganese. This suggests that Rp oxygens in the phosphates preceding positions 2122 and 2176 are coordinated with Mg2+ and may participate in L1-23S rRNA interaction via magnesium bridges. We have also shown that this interaction is impaired by the presence of dC at position 2122 coupled with the presence of deoxyribonucleotide(s) at other positions in the RNA. This study demonstrates that the ribose-phosphate backbone of the helix encompassing nt 2120-2124/2174-2178 is intimately involved in the interaction of protein L1 with the 23S rRNA. In particular, we suggest that this helix is positioned in the cleft between the two domains of protein L1. PMID:11142372

  3. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    NASA Astrophysics Data System (ADS)

    Okamura, K.; Hisada, T.; Takata, K.; Hiraishi, A.


    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  4. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed Central

    Stelzl, U; Nierhaus, K H


    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied. PMID:11345438

  5. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.


    Stelzl, U; Nierhaus, K H


    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied.

  6. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko


    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  7. High-level azithromycin resistance occurs in Neisseria gonorrhoeae as a result of a single point mutation in the 23S rRNA genes.


    Chisholm, Stephanie A; Dave, Jayshree; Ison, Catherine A


    High-level azithromycin resistance (AZM-HR), defined as a MIC of > or = 256 mg/liter, emerged in Neisseria gonorrhoeae in the United Kingdom in 2004. To determine the mechanism of this novel phenotype, isolates from the United Kingdom that were AZM-HR (n, 19), moderately AZM resistant (MICs, 2 to 8 mg/liter) (n, 26), or sensitive (MICs, 0.12 to 0.25 mg/liter) (n, 4) were screened for methylase (erm) genes and for mutations in the mtrR promoter region, associated with efflux pump upregulation. All AZM-resistant isolates and 12 sensitive isolates were screened for mutations in domain V of each 23S rRNA allele. All AZM-HR isolates contained the A2059G mutation (Escherichia coli numbering) in three (3 isolates) or four (16 isolates) 23S rRNA alleles. Most (22/26) moderately AZM resistant isolates contained the C2611T mutation in at least 3/4 alleles. The remainder contained four wild-type alleles, as did 8/12 sensitive isolates, while one allele was mutated in the remaining four sensitive isolates. Serial passage of AZM-sensitive colonies on an erythromycin-containing medium selected AZM-HR if the parent strain already contained mutation A2059G in one 23S rRNA allele. The resultant AZM-HR strains contained four mutated alleles. Eight isolates (five moderately AZM resistant and three AZM-HR) contained mutations in the mtrR promoter. No methylase genes were detected. This is the first evidence that AZM-HR in gonococci may result from a single point mutation (A2059G) in the peptidyltransferase loop in domain V of the 23S rRNA gene. Mutation of a single allele is insufficient to confer AZM-HR, but AZM-HR can develop under selection pressure. The description of a novel resistance mechanism will aid in screening for the AZM-HR phenotype. PMID:20585125

  8. Cyanobacterial Ecotypes in Different Optical Microenvironments of a 68°C Hot Spring Mat Community Revealed by 16S-23S rRNA Internal Transcribed Spacer Region Variation†

    PubMed Central

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea; Ward, David M.


    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynthesis demonstrated the existence of physiologically distinct Synechococcus populations at different depths along a light gradient quantified by scalar irradiance microprobes. Molecular methods were used to evaluate whether physiologically distinct populations could be correlated with genetically distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S rRNA genes suggested the existence of closely related but genetically distinct populations corresponding to different functional populations occurring at different depths. PMID:12732563

  9. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.


    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K


    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  10. Bacteria evade immune recognition via TLR13 and binding of their 23S rRNA by MLS antibiotics by the same mechanisms

    PubMed Central

    Hochrein, Hubertus; Kirschning, Carsten J.


    The immune system recognizes pathogens and other danger by means of pattern recognition receptors. Recently, we have demonstrated that the orphan Toll-like receptor 13 (TLR13) senses a defined sequence of the bacterial rRNA and that bacteria use specific mechanisms to evade macrolide lincosamide streptogramin (MLS) antibiotics detection via TLR13. PMID:23802068

  11. Escherichia coli and Enterococcus spp. in rainwater tank samples: comparison of culture-based methods and 23S rRNA gene quantitative PCR assays.


    Ahmed, W; Richardson, K; Sidhu, J P S; Toze, S


    In this study, culture-based methods and quantitative PCR (qPCR) assays were compared with each other for the measurement of Escherichia coli and Enterococcus spp. in water samples collected from rainwater tanks in Southeast Queensland, Australia. Among the 50 rainwater tank samples tested, 26 (52%) and 46 (92%) samples yielded E. coli numbers as measured by EPA Method 1603 and E. coli 23S rRNA gene qPCR assay, respectively. Similarly, 49 (98%) and 47 (94%) samples yielded Enterococcus spp. numbers as measured by EPA Method 1600 and Enterococcus spp. 23S rRNA gene qPCR assay, respectively. The mean E. coli (2.49 ± 0.85) log(10) and Enterococcus spp. (2.72 ± 0.32) log(10) numbers as measured by qPCR assays were significantly (P < 0001) different than E. coli (0.91 ± 0.80) log(10) and Enterococcus spp. (1.86 ± 0.60) log(10) numbers as measured by culture-based method. Weak but significant correlations were observed between both EPA Method 1603 and the E. coli qPCR assay (r = 0.47, P = 0.0009), and EPA Method 1600 and the Enterococcus spp. qPCR assay (r = 0.42, P = 0.002). Good qualitative agreement was found between the culture-based method and the Enterococcus spp. qPCR assay in terms of detecting fecal pollution in water samples from the studied rainwater tanks. More research studies, however, are needed to shed some light on the discrepancies associated with the culture-based methods and qPCR assays for measuring fecal indicator bacteria.

  12. SrmB, a DEAD-box helicase involved in Escherichia coli ribosome assembly, is specifically targeted to 23S rRNA in vivo

    PubMed Central

    Trubetskoy, Dmitrii; Proux, Florence; Allemand, Frédéric; Dreyfus, Marc; Iost, Isabelle


    DEAD-box proteins play specific roles in remodeling RNA or ribonucleoprotein complexes. Yet, in vitro, they generally behave as nonspecific RNA-dependent ATPases, raising the question of what determines their specificity in vivo. SrmB, one of the five Escherichia coli DEAD-box proteins, participates in the assembly of the large ribosomal subunit. Moreover, when overexpressed, it compensates for a mutation in L24, the ribosomal protein (r-protein) thought to initiate assembly. Here, using the tandem affinity purification (TAP) procedure, we show that SrmB forms a complex with r-proteins L4, L24 and a region near the 5′-end of 23S rRNA that binds these proteins. In vitro reconstitution experiments show that the stability of this complex reflects cooperative interactions of SrmB with L4, L24 and rRNA. These observations are consistent with an early role of SrmB in assembly and explain the genetic link between SrmB and L24. Besides its catalytic core, SrmB possesses a nonconserved C-terminal extension that, we show, is not essential for SrmB function and specificity. In this regard, SrmB differs from DbpA, another DEAD-box protein involved in ribosome assembly. PMID:19734346

  13. SrmB, a DEAD-box helicase involved in Escherichia coli ribosome assembly, is specifically targeted to 23S rRNA in vivo.


    Trubetskoy, Dmitrii; Proux, Florence; Allemand, Frédéric; Dreyfus, Marc; Iost, Isabelle


    DEAD-box proteins play specific roles in remodeling RNA or ribonucleoprotein complexes. Yet, in vitro, they generally behave as nonspecific RNA-dependent ATPases, raising the question of what determines their specificity in vivo. SrmB, one of the five Escherichia coli DEAD-box proteins, participates in the assembly of the large ribosomal subunit. Moreover, when overexpressed, it compensates for a mutation in L24, the ribosomal protein (r-protein) thought to initiate assembly. Here, using the tandem affinity purification (TAP) procedure, we show that SrmB forms a complex with r-proteins L4, L24 and a region near the 5'-end of 23S rRNA that binds these proteins. In vitro reconstitution experiments show that the stability of this complex reflects cooperative interactions of SrmB with L4, L24 and rRNA. These observations are consistent with an early role of SrmB in assembly and explain the genetic link between SrmB and L24. Besides its catalytic core, SrmB possesses a nonconserved C-terminal extension that, we show, is not essential for SrmB function and specificity. In this regard, SrmB differs from DbpA, another DEAD-box protein involved in ribosome assembly.

  14. Identification of Carnobacterium species by restriction fragment length polymorphism of the 16S-23S rRNA gene intergenic spacer region and species-specific PCR.


    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier


    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in order to obtain restriction profiles for all of the species. Three PCR amplicons, which were designated small ISR (S-ISR), medium ISR (M-ISR), and large ISR (L-ISR), were obtained for all Carnobacterium species. The L-ISR sequence revealed the presence of two tRNA genes, tRNA(Ala) and tRNA(Ile), which were separated by a spacer region that varied from 24 to 38 bp long. This region was variable among the species, allowing the design of species-specific primers. These primers were tested and proved to be species specific. The identification method based on the 16S-23S rDNA ISR, using PCR-RFLP and specific primers, is very suitable for the rapid low-cost identification and discrimination of all of the Carnobacterium species from other phylogenetically related lactic acid bacteria.

  15. Genotypic Characterization of Bradyrhizobium Strains Nodulating Small Senegalese Legumes by 16S-23S rRNA Intergenic Gene Spacers and Amplified Fragment Length Polymorphism Fingerprint Analyses

    PubMed Central

    Doignon-Bourcier, Florence; Willems, Anne; Coopman, Renata; Laguerre, Gisele; Gillis, Monique; de Lajudie, Philippe


    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations. PMID:10966419

  16. Genotypic characterization of Bradyrhizobium strains nodulating small Senegalese legumes by 16S-23S rRNA intergenic gene spacers and amplified fragment length polymorphism fingerprint analyses.


    Doignon-Bourcier, F; Willems, A; Coopman, R; Laguerre, G; Gillis, M; de Lajudie, P


    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations.

  17. Development of a 16S-23S rRNA intergenic spacer-based quantitative PCR assay for improved detection and enumeration of Lactococcus garvieae.


    Thanh, Hien Dang; Park, Hee Kuk; Kim, Wonyong; Shin, Hyoung-Shik


    Lactococcus garvieae is an important foodborne pathogen causing lactococcosis associated with hemorrhagic septicemia in fish worldwide. A real-time quantitative polymerase chain reaction (qPCR) protocol targeting the 16S-23S rRNA intergenic spacer (ITS) region was developed for the detection and enum-eration of L. garvieae. The specificity was evaluated using genomic DNAs extracted from 66 cocci strains. Fourteen L. garvieae strains tested were positive, whereas 52 other strains including Lactococcus lactis ssp. lactis, Lactococcus lactis ssp. hordniae and Lactococcus lactis ssp. cremoris did not show a specific signal. The minimal limit of detection was 2.63 fg of purified genomic DNA, equivalent to 1 genome of L. garvieae. The optimized protocol was applied for the survey of L. garvieae in naturally contaminated fish samples. Our results suggest that the qPCR protocol using ITS is a sensitive and efficient tool for the rapid detection and enumeration of L. garvieae in fish and fish-containing foods.

  18. Identification of virulence factors in 16S-23S rRNA intergenic spacer genotyped Staphylococcus aureus isolated from water buffaloes and small ruminants.


    Cremonesi, P; Zottola, T; Locatelli, C; Pollera, C; Castiglioni, B; Scaccabarozzi, L; Moroni, P


    Staphylococcus aureus is an important human and animal pathogen, and is regarded as an important cause of intramammary infection (IMI) in ruminants. Staphylococcus aureus genetic variability and virulence factors have been well studied in veterinary medicine, especially in cows as support for control and management of IMI. The aim of the present study was to genotype 71 Staph. aureus isolates from the bulk tank and foremilk of water buffaloes (n=40) and from udder tissue (n=7) and foremilk (n=24) from small ruminants. The method used was previously applied to bovine Staph. aureus and is based on the amplification of the 16S-23S rRNA intergenic spacer region. The technique applied was able to identify different Staph. aureus genotypes isolated from dairy species other than the bovine species, and cluster the genotypes according to species and herds. Virulence gene distribution was consistent with genotype differentiation. The isolates were also characterized through determination of the presence of 19 virulence-associated genes by specific PCR. Enterotoxins A, C, D, G, I, J, and L were associated with Staph. aureus isolates from buffaloes, whereas enterotoxins C and L were linked to small ruminants. Genes coding for methicillin resistance, Panton-Valentine leukocidin, exfoliative toxins A and B, and enterotoxins B, E, and H were undetected. These findings indicate that RNA template-specific PCR is a valid technique for typing Staph. aureus from buffaloes and small ruminants and is a useful tool for understanding udder infection epidemiology.

  19. Thermotoga maritima ribonuclease III. Characterization of thermostable biochemical behavior and analysis of conserved base pairs that function as reactivity epitopes for the Thermotoga 23S rRNA precursor.


    Nathania, Lilian; Nicholson, Allen W


    The cleavage of double-stranded (ds) RNA by ribonuclease III is a conserved early step in bacterial rRNA maturation. Studies on the mechanism of dsRNA cleavage by RNase III have focused mainly on the enzymes from mesophiles such as Escherichia coli. In contrast, neither the catalytic properties of extremophile RNases III nor the structures and reactivities of their cognate substrates have been described. The biochemical behavior of RNase III of the hyperthermophilic bacterium Thermotoga maritima was analyzed using purified recombinant enzyme. T. maritima (Tm) RNase III catalytic activity exhibits a broad optimal temperature range of approximately 40-70 degrees C, with significant activity at 95 degrees C. Tm-RNase III cleavage of substrate is optimally supported by Mg(2+) at >or=1 mM concentrations. Mn(2+), Co(2+), and Ni(2+) also support activity but with reduced efficiencies. The enzyme functions optimally at pH 8 and approximately 50-80 mM salt concentrations. Small RNA hairpins that incorporate the 16S and 23S pre-rRNA stem sequences are efficiently cleaved by Tm-RNase III at sites that are consistent with production in vivo of the immediate precursors to the mature rRNAs. Analysis of pre-23S substrate variants reveals a dependence of reactivity on the base-pair (bp) sequence in the proximal box (pb), a site of protein contact that functions as a positive recognition determinant for Escherichia coli (Ec) RNase III substrates. The dependence of reactivity on the pb sequence is similar to that observed with Ec-RNase III substrates. In fact, Tm-RNase III cleaves an Ec-RNase III substrate with identical specificity and is inhibited by antideterminant bp that also inhibit Ec-RNase III. These results indicate the conservation, across a broad phylogenetic distance, of positive and negative determinants of reactivity of bacterial RNase III substrates.

  20. A Novel SimpleProbe PCR Assay for Detection of Mutations in the 23S rRNA Gene Associated with Macrolide Resistance in Mycoplasma genitalium in Clinical Samples

    PubMed Central

    Lysvand, Hilde; Pukstad, Brita; Nordbø, Svein Arne


    Macrolide-resistant strains of Mycoplasma genitalium are an increasing problem throughout the world, and the implementation of a rapid and sensitive assay for mutation detection to guide treatment is needed. Macrolide-resistant strains have been shown to contain base substitutions in positions 2058 and 2059 (Escherichia coli numbering) in region V of the 23S rRNA gene. In this study, we present a SimpleProbe PCR followed by melting curve analysis to differentiate between macrolide-resistant mutants and wild types. The assay was performed on 159 Mycoplasma genitalium-positive samples, and the results were compared with DNA sequencing. We also looked at the prevalence of macrolide-resistant strains in a Norwegian population. Of 139 samples characterized successfully by sequencing, 54 (39%) were wild types and 85 (61%) were mutants, consisting of 59 (42%) A2059G, 24 (17%) A2058G, 1 (1%) A2058T, and 1 (1%) A2059C mutation. The melting curve analysis correctly differentiated between wild-type and mutant strains in all cases, but it could not identify the different mutant types. The SimpleProbe PCR proved to be a simple, rapid, and reliable method for the detection of macrolide-resistant isolates of Mycoplasma genitalium in a clinical setting. PMID:27487958

  1. Touchdown Enzyme Time Release-PCR for Detection and Identification of Chlamydia trachomatis, C. pneumoniae, and C. psittaci Using the 16S and 16S-23S Spacer rRNA Genes

    PubMed Central

    Madico, Guillermo; Quinn, Thomas C.; Boman, Jens; Gaydos, Charlotte A.


    Three touchdown enzyme time release (TETR)-PCR assays were used to amplify different DNA sequences in the variable regions of the 16S and 16S-23S spacer rRNA genes specific for Chlamydia trachomatis, Chlamydia pneumoniae, and Chlamydia psittaci as improved tests for sensitive diagnosis and rapid species differentiation. The TETR-PCR protocol used 60 cycles of amplification, which provided improved analytical sensitivity (0.004 to 0.063 inclusion-forming unit of Chlamydia species per PCR). The sensitivity of TETR-PCR with primer set CTR 70-CTR 71 was 96.7%, and the specificity was 99.6%, compared to those of the AMPLICOR PCR for the detection of C. trachomatis in vaginal swab samples. TETR-PCR for C. pneumoniae with primer set CPN 90-CPN 91 was 90% sensitive and 93.3% specific compared with a nested PCR with primer set CP1/2-CPC/D for clinical respiratory samples. TETR-PCR for C. psittaci with primer set CPS 100-CPS 101 showed substantial agreement with cell culturing (κ, 0.78) for animal tissue samples. Primer sets were then combined into a single multiplex TETR-PCR test. The respective 315-, 195-, and 111-bp DNA target products were precisely amplified when DNA from each of the respective Chlamydia species or combinations of them was used. Multiplex chlamydia TETR-PCR correctly identified one strain of each of the 15 serovars of C. trachomatis, 22 isolates of C. pneumoniae, and 20 isolates of C. psittaci. The primer sets were specific for each species. No target products were amplified when DNA from C. pecorum or a variety of other microorganisms was tested for specificity. TETR-PCR with primers selected for specific sequences in the 16S and 16S-23S spacer rRNA genes is a valuable test that could be used either with individual primers or in a multiplex assay for the identification and differentiation of Chlamydia species from culture isolates or for the detection of chlamydiae in clinical samples. PMID:10699002

  2. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.


    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C


    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  3. Evaluation of a fluorescence-labelled oligonucleotide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears.

    PubMed Central

    Nordentoft, S; Christensen, H; Wegener, H C


    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all of the S. enterica subspecies and S. bongori, an 18-mer oligonucleotide probe was selected. The specificity of the probe was tested by in situ hybridization to bacterial cell smears of pure cultures. Forty-nine of 55 tested Salmonella serovars belonging to subspecies I, II, IIIb, IV, and VI hybridized with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin-fixed, paraffin-embedded tissue from experimentally infected mice or from animals with a history of clinical salmonellosis. In these tissue sections the probe hybridized specifically to Salmonella serovars, allowing for the detection of single bacterial cells. The development of a fluorescence-labelled specific oligonucleotide probe makes the FISH technique a promising tool for the rapid identification of S. enterica in bacterial smears, as well as for the detection of S. enterica in histological tissue sections. PMID:9316923

  4. DNA sequence heterogeneity in the three copies of the long 16S-23S rDNA spacer of Enterococcus faecalis isolates.


    Gürtler, V; Rao, Y; Pearson, S R; Bates, S M; Mayall, B C


    The possibility of intragenic heterogeneity between copies of the long intergenic (16S-23S rDNA) spacer region (LISR) was investigated by specific amplification of this region from 21 Enterococcus faecalis isolates. Three copies of the LISR (rrnA, B and C) were demonstrated by hybridization of the LISR to genomic DNA cleaved with I-Ceul and SmaI. When the LISR amplicon was digested with Tsp509I, two known nucleotide substitutions were detected, one 4 nt upstream from the 5' end of the tRNA(ala) gene (allele rrnB has the Tsp509I site and rrnA and C do not) and the other 22 nt downstream from the 3' end of the tRNA(ala) gene (rrnC has the Tsp509I site). Sequence differences at these sites were detected at the allelic level (alleles rrnA, B and C) and different combinations of these alleles were designated Tsp Types. Using densitometry to analyse bands from electrophoresis gels, the intra-isolate ratios of the separate alleles (rrnA:rrnB:rrnC) were determined in each Tsp Type: I (0:3:0), II (1:2:0), III (2:0:1), IV (3:0:0), V (2:1:0) and VI (1:1:1). Sequence variation between the three copies of the LISR was confirmed by the detection of at least five other intra-isolate nucleotide substitutions using heteroduplex analysis by conformation-sensitive gel electrophoresis (CSGE) that were not detected by Tsp509I cleavage. Perpendicular denaturing gradient gel electrophoresis was capable of resolving homoduplexes; six to seven out of a possible nine curves were obtained in some isolates. In the isolate where seven curves were obtained one or more further nucleotide substitutions, not detected by Tsp509I cleavage or CSGE, were detected. On the basis of LISR sequence heterogeneity, isolates were categorized into homogeneous (only one allele sequence present) and heterogeneous (two or three allele sequences present). The transition between homogeneous and heterogeneous LISRs may be useful in studying evolutionary mechanisms between E. faecalis isolates.

  5. Determination of the nucleotide sequence of the 23S ribosomal RNA and flanking spacers of an Enterococcus faecium strain, reveals insertion-deletion events in the ribosomal spacer 1 of enterococci.


    Naimi, A; Beck, G; Monique, M; Lefèbvre, G; Branlanti, C


    The usefulness of 16S-23S (ITS1) and 23S-5S (ITS2) ribosomal spacer nucleotide sequence determination, as a complementary approach to the biochemical tests traditionally used for enterococcal species identification, is shown by its application to the identification of a strain, E27, isolated from a natural bacteria mixture used for cheese production. Using combined approaches we showed, unambiguously, that strain E27 belongs to the Enterococcus faecium species. However, its ITS1 region has an interesting peculiarity. In our previous study of ITS1s from various enterococcal species (NAIMI et al., 1997, Microbiology 143, 823-834), the ITS1s of the two E. faecium strains studied, were found to contain an additional 115-nt long stem-loop structure as compared to the ITS1s of other enterococci, only one out of the 3 ITS1s of E. hirae ATCC 9790, was found to contain a similar 107-nt long stem-loop structure. The ITS1 of strain E27 is 100% identical to that of E. faecium ATCC 19434T, except that the 115-nt additional fragment is absent. This strongly suggests the existence of lateral DNA transfer or DNA recombination events at a hot spot position of the ITS1s from E. faecium and E. hirae. Small and large ITS1 nucleotide sequence determination for strain E27 generalized the notion of two kinds of ITSs in enterococci: one with a tRNA(Ala) gene, one without tRNA gene. To complete strain E27 characterization, its 23S rRNA sequence was established. This is the first complete 23S rRNA nucleotide sequence determined for an enterococcal species.

  6. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.


    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H


    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here.

  7. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.


    Herzog, M; Maroteaux, L


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  8. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  9. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.


    Herzog, M; Maroteaux, L


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  10. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    SciTech Connect

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.


    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  11. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    NASA Astrophysics Data System (ADS)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.


    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  12. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.


    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu


    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis.

  13. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.


    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu


    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis. PMID:26038763

  14. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.


    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E


    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  15. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.


    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  16. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.


    Hori, H; Osawa, S; Iwabuchi, M


    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  17. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  18. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.


    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A


    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  19. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.


    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  20. AtPPR2, an Arabidopsis pentatricopeptide repeat protein, binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis

    PubMed Central

    Lu, Yuqing; Li, Cong; Wang, Hai; Chen, Hao; Berg, Howard; Xia, Yiji


    SUMMARY Pentatricopeptide repeat (PPR) proteins are mainly involved in regulating post-transcriptional processes in mitochondria and plastids, including chloroplasts. Mutations in the Arabidopsis PPR2 gene have previously been found to cause defects in seed development and reduced transmission through male and female gametophytes. However, the exact function of AtPPR2 has not been defined. We found that a loss-of-function mutation of AtPPR2 leads to arrest of the first mitotic division during both male and female gametogenesis. In addition, the Atppr2 mutation causes delayed embryogenesis, leading to embryonic lethality. Mutation in emb2750, which appears to be a weak mutant allele of the AtPPR2 locus, also results in defective seeds. However, a majority of emb2750 seeds were able to germinate, but their cotyledons were albino and often deformed, and growth of the emb2750 seedlings were arrested after germination. AtPPR2 is mainly expressed in plant parts that undergo cell division, and AtPPR2 protein was localized to chloroplasts. RNA immunoprecipitation and protein gel mobility shift assays showed that AtPPR2 binds to plastid 23S rRNA. Our study adds to a growing body of evidence that plastids and/or chloroplasts play a key role in cell division. AtPPR2 may modulate the translational process to fine-tune plastid function, thereby regulating cell division. PMID:21435048

  1. Linezolid-resistant Staphylococcus haemolyticus and Staphylococcus hominis: single and double mutations at the domain V of 23S rRNA among isolates from a Rio de Janeiro hospital.


    Chamon, Raiane Cardoso; Iorio, Natalia Lopes Pontes; Cavalcante, Fernanda Sampaio; Teodoro, Cristiane R S; de Oliveira, Ana Paula Chaves; Maia, Fernanda; dos Santos, Kátia Regina Netto


    In this work, the molecular and phenotypic antimicrobial resistance and clonal diversity of 10 linezolid-resistant Staphylococcus spp. isolates were investigated. The 7 Staphylococcus haemolyticus isolates presented Staphylococcal cassete chromosome mec (SCCmec) V and belonged to the same pulsed-field gel electrophoresis pulsotype. Their MICs for oxacillin, vancomycin, and linezolid were ≥ 256 μg/mL, 1-4 μg/mL, and 8-16 μg/mL, respectively. The 3 S. hominis presented MIC values 32 to >256 μg/mL, 2-4 μg/mL, and 12-24 μg/mL, and all carried the nontypeable SCCmec (ccr1 + mecA class) and belonged to 2 different genotypes. The cfr gene was not found, but the mutation G2603T was detected in S. haemolyticus and C2190T and G2603T in Staphylococcus hominis in 23S rRNA. This study demonstrates the spread of a linezolid-resistant S. haemolyticus genotype and, for the first time, describes the mutation C2190T among S. hominis isolates with a double mutation in Brazil.

  2. Sequence determination of rRNA genes of pathogenic Vibrio species and whole-cell identification of Vibrio vulnificus with rRNA-targeted oligonucleotide probes.


    Aznar, R; Ludwig, W; Amann, R I; Schleifer, K H


    A comparative analysis of seven new 16S rRNA gene sequences of pathogenic Vibrio species with previously published vibrio sequences confirmed that Vibrio vulnificus represents a group that is not closely related to the core organisms of the genus Vibrio. In addition, we found that V. vulnificus, Listonella (Vibrio) anguillarum and Vibrio diazotrophicus branch off separately from the core group. A comparison of the 16S rRNA gene sequences of V. vulnificus strains belonging to biotypes 1 and 2 revealed that the sequences of all but four biotype 1 strains were identical to each other but slightly different (17 bases) from the sequences of the rest of the V. vulnificus strains investigated. In addition, the sequences of variable regions of the 23S rRNA genes of Vibrio fluvialis, Vibrio furnissii, Vibrio harveyi, Vibrio cholerae, and V. vulnificus C7184 and TW1 were determined, aligned, and compared with all available bacterial 23S rRNA sequences in order to search for specific target sites. As a result, four oligonucleotide probes specific for V. vulnificus were synthesized, and the specificities of these probes were evaluated by dot blot hybridization to membrane-bound RNAs from 21 V. vulnificus strains, 13 strains belonging to other Vibrio species, 61 strains belonging to species that are members of the alpha, beta, and gamma subclasses of the Proteobacteria, and 3 eucaryotic microorganisms. Two probes hybridized with all of the V. vulnificus strains tested, and the other two probes distinguished V. vulnificus biotype 1 strains from all other organisms. In situ identification of V. vulnificus by using tetramethylrhodamine- or fluorescein-labelled oligonucleotides is now possible.

  3. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.


    French, C K; Fouts, D L; Manning, J E


    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  4. Crystal structure of the RluD pseudouridine synthase catalytic module, an enzyme that modifies 23S rRNA and is essential for normal cell growth of Escherichia coli.


    Sivaraman, J; Iannuzzi, Pietro; Cygler, Miroslaw; Matte, Allan


    Pseudouridine (5-beta-D-ribofuranosyluracil, Psi) is the most commonly found modified base in RNA. Conversion of uridine to Psi is performed enzymatically in both prokaryotes and eukaryotes by pseudouridine synthases (EC The Escherichia coli Psi-synthase RluD modifies uridine to Psi at positions 1911, 1915 and 1917 within 23S rRNA. RluD also possesses a second function related to proper assembly of the 50S ribosomal subunit that is independent of Psi-synthesis. Here, we report the crystal structure of the catalytic module of RluD (residues 68-326; DeltaRluD) refined at 1.8A to a final R-factor of 21.8% (R(free)=24.3%). DeltaRluD is a monomeric enzyme having an overall mixed alpha/beta fold. The DeltaRluD molecule consists of two subdomains, a catalytic subdomain and C-terminal subdomain with the RNA-binding cleft formed by loops extending from the catalytic sub-domain. The catalytic sub-domain of DeltaRluD has a similar fold as in TruA, TruB and RsuA, with the location of the RNA-binding cleft, active-site and conserved, catalytic Asp residue superposing in all four structures. Superposition of the crystal structure of TruB bound to a T-stem loop with RluD reveals that similar RNA-protein interactions for the flipped-out uridine base would exist in both structures, implying that base-flipping is necessary for catalysis. This observation also implies that the specificity determinants for site-specific RNA-binding and recognition likely reside in parts of RluD beyond the active site.

  5. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.


    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B


    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  6. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.


    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B


    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  7. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R


    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  8. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant.

    PubMed Central

    Douthwaite, S; Prince, J B; Noller, H F


    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of 23S rRNA by replacement of restriction fragments in the wild-type plasmid by corresponding fragments from the mutant plasmid. DNA sequencing showed that positions 1219-1230 of the 23S rRNA gene are deleted in the mutant. Since all previously characterized rRNA mutations conferring resistance to erythromycin show changes exclusively in domain V, our present findings provide direct evidence for functional interaction between domains II and V of 23S rRNA. Images PMID:3909142

  9. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.


    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  10. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.


    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng


    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  11. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin


    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  12. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.


    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin


    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  13. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.


    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin


    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  14. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.

    PubMed Central

    Pettersson, B; Johansson, K E; Uhlén, M


    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing was performed in both directions. One previously unclassified avian mycoplasma was found to belong to the Mycoplasma lipophilum cluster of the hominis group. Microheterogeneities were discovered in the rRNA operons of Mycoplasma mycoides subsp. mycoides (SC type), confirming the existence of two different rRNA operons. The 16S rRNA sequence of M. mycoides subsp. capri was identical to that of M. mycoides subsp. mycoides (type SC), except that no microheterogeneities were revealed. Furthermore, automated solid-phase DNA sequencing was used to identify a mycoplasmal contamination of a cell culture as Mycoplasma hyorhinis, which proved to be very difficult by conventional methods. The results suggest that the direct solid-phase DNA sequencing procedure is a powerful tool for identification of mycoplasmas and is also useful in taxonomic studies. Images PMID:7521158

  15. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.


    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  16. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.


    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  17. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.


    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C


    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  18. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.


    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C


    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  19. Phylogeny of protostome worms derived from 18S rRNA sequences.


    Winnepenninckx, B; Backeljau, T; De Wachter, R


    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  20. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.


    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G


    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  1. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.


    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia


    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  2. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.


    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia


    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  3. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.


    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D


    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  4. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.


    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S


    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  5. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.


    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  6. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system

    PubMed Central

    Jenior, Matthew L.; Koumpouras, Charles C.; Westcott, Sarah L.; Highlander, Sarah K.


    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina’s MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3–V5, V1–V3, V1–V5, V1–V6, and V1–V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1–V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina’s MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  7. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.


    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K


    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  8. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.


    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K


    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  9. Identification of two Escherichia coli pseudouridine synthases that show multisite specificity for 23S RNA.


    Huang, L; Ku, J; Pookanjanatavip, M; Gu, X; Wang, D; Greene, P J; Santi, D V


    Several putative Escherichia coli pseudouridine (Psi) synthases have been identified by iterative searching of genomic databases for ORFs homologous to known Psi synthases [Gustafsson et al. (1996) Nucleic Acids Res. 24, 3756-3762]. Of these, yceC and yfiI were proposed to encode Psi synthases which modify 23S rRNA. In the present work, yceC and yfiI were cloned and overexpressed in E. coli, and the encoded enzymes, YceC and YfiI, were purified to homogeneity. Both proteins converted Urd residues of rRNA to Psi, thus confirming their identities as Psi synthases. However, in in vitro experiments both enzymes extensively modified Urd residues of both 23S rRNA and 16S rRNA. Gene-disruption of yceCresulted in the absence of Psi modification at positions U955, 2504, and 2580 of 23S RNA, thus identifying these sites as in vivo targets for YceC. Likewise, yfiI disruption resulted in the absence of Psi modification at positions U1911, 1917, and possibly 1915 of 23S RNA. Disruption of yceC did not affect the growth under the conditions tested, whereas yfiI-disrupted cells showed a dramatic decrease in growth rate. Since YceC and YfiI hypermodify RNA in vitro, factors in addition to ribonucleotide sequence must contribute to the in vivo specificity of these enzymes.

  10. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    PubMed Central

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J.; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A


    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I–V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC. PMID:27749897

  11. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A


    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  12. An rRNA variable region has an evolutionarily conserved essential role despite sequence divergence.

    PubMed Central

    Sweeney, R; Chen, L; Yao, M C


    Regions extremely variable in size and sequence occur at conserved locations in eukaryotic rRNAs. The functional importance of one such region was determined by gene reconstruction and replacement in Tetrahymena thermophila. Deletion of the D8 region of the large-subunit rRNA inactivates T. thermophila rRNA genes (rDNA): transformants containing only this type of rDNA are unable to grow. Replacement with an unrelated sequence of similar size or a variable region from a different position in the rRNA also inactivated the rDNA. Mutant rRNAs resulting from such constructs were present only in precursor forms, suggesting that these rRNAs are deficient in either processing or stabilization of the mature form. Replacement with D8 regions from three other organisms restored function, even though the sequences are very different. Thus, these D8 regions share an essential functional feature that is not reflected in their primary sequences. Similar tertiary structures may be the quality these sequences share that allows them to function interchangeably. Images PMID:8196658

  13. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.


    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D


    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  14. In situ probing of gram-positive bacteria with high DNA G + C content using 23S rRNA-targeted oligonucleotides.


    Roller, C; Wagner, M; Amann, R; Ludwig, W; Schleifer, K H


    23S-rRNA-targeted oligonucleotide probes were designed for the phylogenetic group 'Gram-positive bacteria with high G + C content of DNA' (GPBHGC). A sequence idiosyncrasy in two adjacent base pairs in the stem of helix 69 in domain IV of the 23S rRNA is present in all hitherto analysed strains of GPBHGC. An oligonucleotide probe targeted to this region hybridized only with strains of GPBHGC and was successfully used for in situ monitoring of these cells in activated sludge. Another unique feature of the 23S rRNA molecules of GPBHGC is a large insertion in domain III. Fluorescent oligonucleotides targeted to the highly variable regions of the rRNA within the insertions of Corynebacterium glutamicum DSM 20300, Aureobacterium testaceum DSM 20166 and Brevibacterium sp. DSM 20165 hybridized specifically to their target strains, whereas probing with oligonucleotides complementary to the rRNA-coding strand of the 23S rDNA and to the spacer between 16S and 23S rRNA of C. glutamicum did not result in detectable fluorescence. This confirmed that the large 23S insertions are indeed present in 23S rRNAs of GPBHGC and provide potential target sites for highly specific nucleic acid probes.

  15. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.


    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  16. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.


    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem


    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen.

  17. Comparison of two approaches for the classification of 16S rRNA gene sequences.


    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan


    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  18. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr


    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  19. Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences.


    Yarza, Pablo; Yilmaz, Pelin; Pruesse, Elmar; Glöckner, Frank Oliver; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Whitman, William B; Euzéby, Jean; Amann, Rudolf; Rosselló-Móra, Ramon


    Publicly available sequence databases of the small subunit ribosomal RNA gene, also known as 16S rRNA in bacteria and archaea, are growing rapidly, and the number of entries currently exceeds 4 million. However, a unified classification and nomenclature framework for all bacteria and archaea does not yet exist. In this Analysis article, we propose rational taxonomic boundaries for high taxa of bacteria and archaea on the basis of 16S rRNA gene sequence identities and suggest a rationale for the circumscription of uncultured taxa that is compatible with the taxonomy of cultured bacteria and archaea. Our analyses show that only nearly complete 16S rRNA sequences give accurate measures of taxonomic diversity. In addition, our analyses suggest that most of the 16S rRNA sequences of the high taxa will be discovered in environmental surveys by the end of the current decade.

  20. Virtual metagenome reconstruction from 16S rRNA gene sequences.


    Okuda, Shujiro; Tsuchiya, Yuki; Kiriyama, Chiho; Itoh, Masumi; Morisaki, Hisao


    Microbial ecologists have investigated roles of species richness and diversity in a wide variety of ecosystems. Recently, metagenomics have been developed to measure functions in ecosystems, but this approach is cost-intensive. Here we describe a novel method for the rapid and efficient reconstruction of a virtual metagenome in environmental microbial communities without using large-scale genomic sequencing. We demonstrate this approach using 16S rRNA gene sequences obtained from denaturing gradient gel electrophoresis analysis, mapped to fully sequenced genomes, to reconstruct virtual metagenome-like organizations. Furthermore, we validate a virtual metagenome using a published metagenome for cocoa bean fermentation samples, and show that metagenomes reconstructed from biofilm formation samples allow for the study of the gene pool dynamics that are necessary for biofilm growth.

  1. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.


    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C


    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  2. Primer and platform effects on 16S rRNA tag sequencing


    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  3. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  4. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.


    Soni, Dharmendra Kumar; Dubey, Suresh Kumar


    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  5. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  6. Evaluation of 16S Rrna amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  7. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.


    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  8. Phylogeny of the bodonid flagellates (Kinetoplastida) based on small-subunit rRNA gene sequences.


    Dolezel, D; Jirků, M; Maslov, D A; Lukes, J


    The phylogeny of kinetoplastid flagellates was investigated by determining the sequences of the small-subunit (18S) rRNA from Bodo designis, Bodo saltans K, Bodo saltans P, Bodo sorokini, Bodo sp. (cf. uncinatus), Cruzella marina, Cryptobia helicis, Dimastigella mimosa and Parabodo nitrophilus and analysing these data together with several previously obtained sequences. The root of the kinetoplastid tree was tentatively determined to be attached to the branch of B. designis and/or Cruzella marina. Within this topology, the suborder Trypanosomatina appears as a late-emerging monophyletic group, while the suborder Bodonina is paraphyletic. Within the bodonid subtree, the branches of parasitic organisms were intermingled with free-living ones, implying multiple transitions to parasitism. The tree indicates that the genera Cryptobia and Bodo are artificial taxa. In addition, the separation of the fish cryptobias and Trypanoplasma borreli as different genera was not supported.

  9. Origin of the Mesozoa inferred from 18S rRNA gene sequences.


    Pawlowski, J; Montoya-Burgos, J I; Fahrni, J F; Wüest, J; Zaninetti, L


    The phylum Mesozoa comprises small, simply organized wormlike parasites of marine invertebrates and is composed of two classes, the Rhombozoa and the Orthonectida. The origin of Mesozoa is uncertain; they are classically considered either as degenerate turbellarians or as primitive multicellular animals related to ciliated protists. In order to precisely determine the phylogenetic position of this group we sequenced the complete 18S rRNA gene of one rhombozoid, Dicyema sp., and one orthonectid, Rhopalura ophiocomae. The sequence analysis shows that the Mesozoa branch early in the animal evolution, closely to nematodes and myxozoans. Our data indicate probably separate origins of rhombozoids and orthonectids, suggesting that their placement in the same phylum needs to be revised.

  10. Insertions or Deletions (Indels) in the rrn 16S-23S rRNA Gene Internal Transcribed Spacer Region (ITS) Compromise the Typing and Identification of Strains within the Acinetobacter calcoaceticus-baumannii (Acb) Complex and Closely Related Members

    PubMed Central

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J.


    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2–13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species. PMID:25141005

  11. Insertions or deletions (Indels) in the rrn 16S-23S rRNA gene internal transcribed spacer region (ITS) compromise the typing and identification of strains within the Acinetobacter calcoaceticus-baumannii (Acb) complex and closely related members.


    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J


    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2-13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species.

  12. Cloning, in vitro transcription, and biological activity of Escherichia coli 23S ribosomal RNA.


    Weitzmann, C J; Cunningham, P R; Ofengand, J


    The 23S rRNA gene was excised from the rrnB operon of pKK3535 and ligated into pUC19 behind the strong class III T7 promoter so that the correct 5' end of mature 23S RNA was produced upon transcription by T7 RNA polymerase. At the 3' end, generation of a restriction site for linearization required the addition of 2 adenosine residues to the mature 23S sequence. In vitro runoff transcripts were indistinguishable from natural 23S RNA in size on denaturing gels and in 5'-terminal sequence. The length and sequence of the 3' terminal T1 fragment was also as expected from the DNA sequence, except that an additional C, A, or U residue was added to 21%, 18%, or 5% of the molecules, respectively. Typical transcription reactions yielded 500-700 moles RNA per mole template. This transcript was used as a substrate for methyl transfer from S-adenosyl methionine catalyzed by Escherichia coli cell extracts. The majority (50-65%) of activity observed in a crude (S30) extract appeared in the post-ribosomal supernatant (S100). Activities catalyzing formation of m5C, m5U, m2G, and m6A residues in the synthetic transcript were observed. PMID:2194163

  13. DECIPHER, a search-based approach to chimera identification for 16S rRNA sequences.


    Wright, Erik S; Yilmaz, L Safak; Noguera, Daniel R


    DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (

  14. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.


    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary


    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  15. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.


    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C


    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  16. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.


    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa


    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  17. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa


    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  18. Strategy for microbiome analysis using 16S rRNA gene sequence analysis on the Illumina sequencing platform.


    Ram, Jeffrey L; Karim, Aos S; Sendler, Edward D; Kato, Ikuko


    Understanding the identity and changes of organisms in the urogenital and other microbiomes of the human body may be key to discovering causes and new treatments of many ailments, such as vaginosis. High-throughput sequencing technologies have recently enabled discovery of the great diversity of the human microbiome. The cost per base of many of these sequencing platforms remains high (thousands of dollars per sample); however, the Illumina Genome Analyzer (IGA) is estimated to have a cost per base less than one-fifth of its nearest competitor. The main disadvantage of the IGA for sequencing PCR-amplified 16S rRNA genes is that the maximum read-length of the IGA is only 100 bases; whereas, at least 300 bases are needed to obtain phylogenetically informative data down to the genus and species level. In this paper we describe and conduct a pilot test of a multiplex sequencing strategy suitable for achieving total reads of > 300 bases per extracted DNA molecule on the IGA. Results show that all proposed primers produce products of the expected size and that correct sequences can be obtained, with all proposed forward primers. Various bioinformatic optimization of the Illumina Bustard analysis pipeline proved necessary to extract the correct sequence from IGA image data, and these modifications of the data files indicate that further optimization of the analysis pipeline may improve the quality rankings of the data and enable more sequence to be correctly analyzed. The successful application of this method could result in an unprecedentedly deep description (800,000 taxonomic identifications per sample) of the urogenital and other microbiomes in a large number of samples at a reasonable cost per sample. PMID:21361774

  19. CATCh, an ensemble classifier for chimera detection in 16S rRNA sequencing studies.


    Mysara, Mohamed; Saeys, Yvan; Leys, Natalie; Raes, Jeroen; Monsieurs, Pieter


    In ecological studies, microbial diversity is nowadays mostly assessed via the detection of phylogenetic marker genes, such as 16S rRNA. However, PCR amplification of these marker genes produces a significant amount of artificial sequences, often referred to as chimeras. Different algorithms have been developed to remove these chimeras, but efforts to combine different methodologies are limited. Therefore, two machine learning classifiers (reference-based and de novo CATCh) were developed by integrating the output of existing chimera detection tools into a new, more powerful method. When comparing our classifiers with existing tools in either the reference-based or de novo mode, a higher performance of our ensemble method was observed on a wide range of sequencing data, including simulated, 454 pyrosequencing, and Illumina MiSeq data sets. Since our algorithm combines the advantages of different individual chimera detection tools, our approach produces more robust results when challenged with chimeric sequences having a low parent divergence, short length of the chimeric range, and various numbers of parents. Additionally, it could be shown that integrating CATCh in the preprocessing pipeline has a beneficial effect on the quality of the clustering in operational taxonomic units. PMID:25527546

  20. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.


    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan


    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  1. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing

    PubMed Central

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan


    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  2. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA.

    PubMed Central

    Weller, R; Weller, J W; Ward, D M


    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences from three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type. Images PMID:1711832

  3. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA

    SciTech Connect

    Weller, R.; Ward, D.M. ); Weller, J.W. )


    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences form three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type.

  4. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.


    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V


    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  5. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.


    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V


    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences.

  6. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.


    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  7. CLUSTOM: a novel method for clustering 16S rRNA next generation sequences by overlap minimization.


    Hwang, Kyuin; Oh, Jeongsu; Kim, Tae-Kyung; Kim, Byung Kwon; Yu, Dong Su; Hou, Bo Kyeng; Caetano-Anollés, Gustavo; Hong, Soon Gyu; Kim, Kyung Mo


    The recent nucleic acid sequencing revolution driven by shotgun and high-throughput technologies has led to a rapid increase in the number of sequences for microbial communities. The availability of 16S ribosomal RNA (rRNA) gene sequences from a multitude of natural environments now offers a unique opportunity to study microbial diversity and community structure. The large volume of sequencing data however makes it time consuming to assign individual sequences to phylotypes by searching them against public databases. Since ribosomal sequences have diverged across prokaryotic species, they can be grouped into clusters that represent operational taxonomic units. However, available clustering programs suffer from overlap of sequence spaces in adjacent clusters. In natural environments, gene sequences are homogenous within species but divergent between species. This evolutionary constraint results in an uneven distribution of genetic distances of genes in sequence space. To cluster 16S rRNA sequences more accurately, it is therefore essential to select core sequences that are located at the centers of the distributions represented by the genetic distance of sequences in taxonomic units. Based on this idea, we here describe a novel sequence clustering algorithm named CLUSTOM that minimizes the overlaps between adjacent clusters. The performance of this algorithm was evaluated in a comparative exercise with existing programs, using the reference sequences of the SILVA database as well as published pyrosequencing datasets. The test revealed that our algorithm achieves higher accuracy than ESPRIT-Tree and mothur, few of the best clustering algorithms. Results indicate that the concept of an uneven distribution of sequence distances can effectively and successfully cluster 16S rRNA gene sequences. The algorithm of CLUSTOM has been implemented both as a web and as a standalone command line application, which are available at

  8. Filtering and ranking techniques for automated selection of high-quality 16S rRNA gene sequences.


    De Smet, Wim; De Loof, Karel; De Vos, Paul; Dawyndt, Peter; De Baets, Bernard


    StrainInfo has augmented its type strain and species/subspecies passports with a recommendation for a high-quality 16S rRNA gene sequence available from the public sequence databases. These recommendations are generated by an automated pipeline that collects all candidate 16S rRNA gene sequences for a prokaryotic type strain, filters out low-quality sequences and retains a high-quality sequence from the remaining pool. Due to thorough automation, recommendations can be renewed daily using the latest updates of the public sequence databases and the latest species descriptions. We discuss the quality criteria constructed to filter and rank available 16S rRNA gene sequences, and show how a partially ordered set (poset) ranking algorithm can be applied to solve the multi-criteria ranking problem of selecting the best candidate sequence. The proof of concept of the recommender system is validated by comparing the results of automated selection with an expert selection made in the All-Species Living Tree Project. Based on these validation results, the pipeline may reliably be applied for non-type strains and developed further for the automated selection of housekeeping genes.

  9. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.


    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin


    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

  10. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.


    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike


    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type.

  11. First report of neonatal bacteremia caused by "Haemophilus quentini" diagnosed by 16S rRNA gene sequencing, Italy.


    Giufrè, Maria; Cardines, Rita; Degl'Innocenti, Roberto; Cerquetti, Marina


    We report the first case of neonatal bacteremia caused by a "Haemophilus quentini" isolate in Italy. The isolate was differentiated from H. influenzae by 16S rRNA sequencing and was characterized by comparison with the wild-type "H. quentini" CCUG 36167. Both isolates carried substitutions in penicillin-binding protein 3 but were susceptible to aminopenicillins.

  12. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.


    Dingman, Douglas W


    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions.

  13. Metagenomic data of fungal internal transcribed Spacer and 18S rRNA gene sequences from Lonar lake sediment, India.


    Dudhagara, Pravin; Ghelani, Anjana; Bhavsar, Sunil; Bhatt, Shreyas


    The data in this article contains the sequences of fungal Internal Transcribed Spacer (ITS) and 18S rRNA gene from a metagenome of Lonar soda lake, India. Sequences were amplified using fungal specific primers, which amplified the amplicon lined between the 18S and 28S rRNA genes. Data were obtained using Fungal tag-encoded FLX amplicon pyrosequencing (fTEFAP) technique and used to analyze fungal profile by the culture-independent method. Primary analysis using PlutoF 454 pipeline suggests the Lonar lake mycobiome contained the 29 different fungal species. The raw sequencing data used to perform this analysis along with FASTQ file are located in the NCBI Sequence Read Archive (SRA) under accession No. SRX889598 (

  14. Evolution of green plants as deduced from 5S rRNA sequences.


    Hori, H; Lim, B L; Osawa, S


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  15. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  16. Evolution of green plants as deduced from 5S rRNA sequences.


    Hori, H; Lim, B L; Osawa, S


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  17. An improved amplification and sequencing strategy for phylogenetic studies using the mitochondrial large subunit rRNA gene.


    Parker, A; Kornfield, I


    Numerous molecular systematic studies have employed variation in the mitochondrial large subunit (16s) rRNA gene to infer patterns of relationship among species and higher taxa. The primers most commonly employed in 16s rRNA amplification and sequencing bracket an approximately 600 bp portion of this gene. However, most of the informative variation occurs within a 200 bp subset of this segment. We describe a novel primer pair designed to amplify this variable region in a wide range of taxa, allowing broader application and considerable streamlining of data acquisition for studies using this gene.

  18. Selective Recovery of 16S rRNA Sequences from Natural Microbial Communities in the Form of cDNA.


    Weller, R; Ward, D M


    Cloning of cDNA obtained from 16S rRNA (16S rcDNA) selectively retrieves species-specific sequence information useful for analyzing the composition and structure of natural microbial communities. With this technique we obtained recombinant 16S rcDNA libraries from Escherichia coli and from a model hot-spring cyanobacterial-mat community. The recombinant plasmids contained exclusively 16S rRNA-derived inserts. This selective approach is independent of biasing culture techniques and eliminates the laborious screening required to locate 16S rRNA gene-bearing recombinants in genomic DNA libraries obtained from natural communities. PMID:16347975

  19. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  20. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  1. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  2. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].


    Petrov, N B; Vladychenskaia, N S


    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies. PMID:16083008

  3. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.


    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R


    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms.

  4. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences

    PubMed Central

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna


    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  5. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.


    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna


    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  6. Testing evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences.


    Garcia-Mazcorro, Jose F


    The 16S rRNA gene has been widely used as a marker of gut bacterial diversity and phylogeny, yet we do not know the model of evolution that best explains the differences in its nucleotide composition within and among taxa. Over 46 000 good-quality near-full-length 16S rRNA gene sequences from five bacterial phyla were obtained from the ribosomal database project (RDP) by study and, when possible, by within-study characteristics (e.g. anatomical region). Using alignments (RDPX and MUSCLE) of unique sequences, the FINDMODEL tool available at was utilized to find the model of character evolution (28 models were available) that best describes the input sequence data, based on the Akaike information criterion. The results showed variable levels of agreement (from 33% to 100%) in the chosen models between the RDP-based and the MUSCLE-based alignments among the taxa. Moreover, subgroups of sequences (using either alignment method) from the same study were often explained by different models. Nonetheless, the different representatives of the gut microbiota were explained by different proportions of the available models. This is the first report using evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences. PMID:23808388

  7. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.


    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna


    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences.

  8. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.


    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R


    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms. PMID:25704228

  9. Phylogenetic diversity of bacterial symbionts of Solemya hosts based on comparative sequence analysis of 16S rRNA genes.

    PubMed Central

    Krueger, D M; Cavanaugh, C M


    The bacterial endosymbionts of two species of the bivalve genus Solemya from the Pacific Ocean, Solemya terraeregina and Solemya pusilla, were characterized. Prokaryotic cells resembling gram-negative bacteria were observed in the gills of both host species by transmission electron microscopy. The ultrastructure of the symbiosis in both host species is remarkably similar to that of all previously described Solemya spp. By using sequence data from 16S rRNA, the identity and evolutionary origins of the S. terraeregina and S. pusilla symbionts were also determined. Direct sequencing of PCR-amplified products from host gill DNA with primers specific for Bacteria 16S rRNA genes gave a single, unambiguous sequence for each of the two symbiont species. In situ hybridization with symbiont-specific oligonucleotide probes confirmed that these gene sequences belong to the bacteria residing in the hosts gills. Phylogenetic analyses of the 16S rRNA gene sequences by both distance and parsimony methods identify the S. terraeregina and S. pusilla symbionts as members of the gamma subdivision of the Proteobacteria. In contrast to symbionts of other bivalve families, which appear to be monophyletic, the S. terraeregina and S. pusilla symbionts share a more recent common ancestry with bacteria associating endosymbiotically with bivalves of the superfamily Lucinacea than with other Solemya symbionts (host species S. velum, S. occidentalis, and S. reidi). Overall, the 16S rRNA gene sequence data suggest that the symbionts of Solemya hosts represent at least two distinct bacterial lineages within the gamma-Proteobacteria. While it is increasingly clear that all extant species of Solemya live in symbiosis with specific bacteria, the associations appear to have multiple evolutionary origins. PMID:8979342

  10. Organization, structure, and variability of the rRNA operon of the Whipple's disease bacterium (Tropheryma whippelii).


    Maiwald, M; von Herbay, A; Lepp, P W; Relman, D A


    Whipple's disease is a systemic disorder associated with a cultivation-resistant, poorly characterized actinomycete, Tropheryma whippelii. We determined a nearly complete rRNA operon sequence of T. whippelii from specimens from 3 patients with Whipple's disease, as well as partial operon sequences from 43 patients. Variability was observed in the 16S-23S rRNA spacer sequences, leading to the description of five distinct sequence types. One specimen contained two spacer sequence types, raising the possibility of a double infection. Secondary structure models for the primary rRNA transcript and mature rRNAs revealed rare or unique features.

  11. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    SciTech Connect

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja


    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  12. MtHc: a motif-based hierarchical method for clustering massive 16S rRNA sequences into OTUs.


    Wei, Ze-Gang; Zhang, Shao-Wu


    The recent sequencing revolution driven by high-throughput technologies has led to rapid accumulation of 16S rRNA sequences for microbial communities. Clustering short sequences into operational taxonomic units (OTUs) is an initial crucial process in analyzing metagenomic data. Although many methods have been proposed for OTU inferences, a major challenge is the balance between inference accuracy and computational efficiency. To address these challenges, we present a novel motif-based hierarchical method (namely MtHc) for clustering massive 16S rRNA sequences into OTUs with high clustering accuracy and low memory usage. Suppose all the 16S rRNA sequences can be used to construct a complete weighted network, where sequences are viewed as nodes, each pair of sequences is connected by an imaginary edge, and the distance of a pair of sequences represents the weight of the edge. MtHc consists of three main phrases. First, heuristically search the motif that is defined as n-node sub-graph (in the present study, n = 3, 4, 5), in which the distance between any two nodes is less than a threshold. Second, use the motif as a seed to form candidate clusters by computing the distances of other sequences with the motif. Finally, hierarchically merge the candidate clusters to generate the OTUs by only calculating the distances of motifs between two clusters. Compared with the existing methods on several simulated and real-life metagenomic datasets, we demonstrate that MtHc has higher clustering performance, less memory usage and robustness for setting parameters, and that it is more effective to handle the large-scale metagenomic datasets. The MtHC software can be freely download from for academic users.

  13. MtHc: a motif-based hierarchical method for clustering massive 16S rRNA sequences into OTUs.


    Wei, Ze-Gang; Zhang, Shao-Wu


    The recent sequencing revolution driven by high-throughput technologies has led to rapid accumulation of 16S rRNA sequences for microbial communities. Clustering short sequences into operational taxonomic units (OTUs) is an initial crucial process in analyzing metagenomic data. Although many methods have been proposed for OTU inferences, a major challenge is the balance between inference accuracy and computational efficiency. To address these challenges, we present a novel motif-based hierarchical method (namely MtHc) for clustering massive 16S rRNA sequences into OTUs with high clustering accuracy and low memory usage. Suppose all the 16S rRNA sequences can be used to construct a complete weighted network, where sequences are viewed as nodes, each pair of sequences is connected by an imaginary edge, and the distance of a pair of sequences represents the weight of the edge. MtHc consists of three main phrases. First, heuristically search the motif that is defined as n-node sub-graph (in the present study, n = 3, 4, 5), in which the distance between any two nodes is less than a threshold. Second, use the motif as a seed to form candidate clusters by computing the distances of other sequences with the motif. Finally, hierarchically merge the candidate clusters to generate the OTUs by only calculating the distances of motifs between two clusters. Compared with the existing methods on several simulated and real-life metagenomic datasets, we demonstrate that MtHc has higher clustering performance, less memory usage and robustness for setting parameters, and that it is more effective to handle the large-scale metagenomic datasets. The MtHC software can be freely download from for academic users. PMID:25912934

  14. Sequence requirements for maturation of the 5' terminus of human 18 S rRNA in vitro.


    Yu, Y T; Nilsen, T W


    Creation of the mature 5' terminus of human 18 S rRNA in vitro occurs via a two-step processing reaction. In the first step, an endonucleolytic activity found in HeLa cell nucleolar extract cleaves an rRNA precursor spanning the external transcribed spacer-18 S boundary at a position 3 bases upstream from the mature 18 S terminus leaving 2',3'-cyclic phosphate, 5' hydroxyl termini. In the second step, a nucleolytic activity(s) found in HeLa cell cytoplasmic extract removes the 3 extra bases and creates the authentic 5'-phosphorylated terminus of 18 S rRNA. Here we have examined the sequence requirements for the trimming reaction. The trimming activity(s), in addition to requiring a 5' hydroxyl terminus, prefers the naturally occurring adenosine as the 5'-terminal base. By a combination of deletion, site-directed mutagenesis, and chemical modification interference approaches we have also identified a region of 18 S rRNA spanning bases +6 to +25 (with respect to the mature 5' end) which comprises a critical recognition sequence for the trimming activity(s). PMID:1577760

  15. Identification of nine sequence types of the 16S rRNA genes of Campylobacter jejuni subsp. jejuni isolated from broilers

    PubMed Central

    Hansson, Ingrid; Persson, Marianne; Svensson, Linda; Engvall, Eva Olsson; Johansson, Karl-Erik


    Background Campylobacter is the most commonly reported bacterial cause of enteritis in humans in the EU Member States and other industrialized countries. One significant source of infection is broilers and consumption of undercooked broiler meat. Campylobacter jejuni is the Campylobacter sp. predominantly found in infected humans and colonized broilers. Sequence analysis of the 16S rRNA gene is very useful for identification of bacteria to genus and species level. The objectives in this study were to determine the degree of intraspecific variation in the 16S rRNA genes of C. jejuni and C. coli and to determine whether the 16S rRNA sequence types correlated with genotypes generated by PFGE analysis of SmaI restricted genomic DNA of the strains. Methods The 16S rRNA genes of 45 strains of C. jejuni and two C. coli strains isolated from broilers were sequenced and compared with 16S rRNA sequences retrieved from the Ribosomal Database Project or GenBank. The strains were also genotyped by PFGE after digestion with SmaI. Results Sequence analyses of the 16S rRNA genes revealed nine sequence types of the Campylobacter strains and the similarities between the different sequence types were in the range 99.6–99.9%. The number of nucleotide substitutions varied between one and six among the nine 16S rRNA sequence types. One of the nine 16S rRNA sequence profiles was common to 12 of the strains from our study and two of these were identified as Campylobacter coli by PCR/REA. The other 10 strains were identified as Campylobacter jejuni. Five of the nine sequence types were also found among the Campylobacter sequences deposited in GenBank. The three 16S rRNA genes in the analysed strains were identical within each individual strain for all 47 strains. Conclusion C. jejuni and C. coli seem to lack polymorphisms in their 16S rRNA gene, but phylogenetic analysis based on 16S rRNA sequences was not always sufficient for differentiation between C. jejuni and C. coli. The strains

  16. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    PubMed Central

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.


    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene. PMID:11825992

  17. Genome sequencing and annotation of Cellulomonas sp. HZM.


    Chua, Patric; Har, Zi Mei; Austin, Christopher M; Yule, Catherine M; Dykes, Gary A; Lee, Sui Mae


    We report the draft genome sequence of Cellulomonas sp. HZM, isolated from a tropical peat swamp forest. The draft genome size is 3,559,280 bp with a G + C content of 73% and contains 3 rRNA sequences (single copies of 5S, 16S and 23S rRNA).

  18. Genome sequencing and annotation of Cellulomonas sp. HZM

    PubMed Central

    Chua, Patric; Har, Zi Mei; Austin, Christopher M.; Yule, Catherine M.; Dykes, Gary A.; Lee, Sui Mae


    We report the draft genome sequence of Cellulomonas sp. HZM, isolated from a tropical peat swamp forest. The draft genome size is 3,559,280 bp with a G + C content of 73% and contains 3 rRNA sequences (single copies of 5S, 16S and 23S rRNA). PMID:26484221

  19. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.


    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia


    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  20. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia


    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  1. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences.


    Distel, D L; Lane, D J; Olsen, G J; Giovannoni, S J; Pace, B; Pace, N R; Stahl, D A; Felbeck, H


    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis [C. R. Woese, Microbiol. Rev. 51: 221-271, 1987]). Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species. PMID:3286609

  2. Phylogenetic positions of Clostridium chauvoei and Clostridium septicum based on 16S rRNA gene sequences.


    Kuhnert, P; Capaul, S E; Nicolet, J; Frey, J


    The sequences of the 16S rRNA genes (rrs genes) of Clostridium chauvoei, the causative agent of blackleg in cattle, and the phenotypically related organism Clostridium septicum were determined. After amplification of 1,507-bp PCR fragments from the corresponding rrs genes, the sequences were determined in a single round of sequencing by using conserved region primers. A sequence similarity analysis of the sequences revealed the close phylogenetic relationship of C. chauvoei and C. septicum in Clostridium cluster I (M. D. Collins, P. A. Lawson, A. Willems, J. J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J. A. E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994), which includes Clostridium carnis, Clostridium perfringens, Clostridium botulinum, and Clostridium tetani. We found that 99.3% of the nucleotides in the genes of C. chauvoei and C. septicum are identical.

  3. Phylogenetic affiliation of SSU rRNA genes generated by massively parallel sequencing: new insights into the freshwater protist diversity.


    Taib, Najwa; Mangot, Jean-François; Domaizon, Isabelle; Bronner, Gisèle; Debroas, Didier


    Recent advances in next-generation sequencing (NGS) technologies spur progress in determining the microbial diversity in various ecosystems by highlighting, for example, the rare biosphere. Currently, high-throughput pyrotag sequencing of PCR-amplified SSU rRNA gene regions is mainly used to characterize bacterial and archaeal communities, and rarely to characterize protist communities. In addition, although taxonomic assessment through phylogeny is considered as the most robust approach, similarity and probabilistic approaches remain the most commonly used for taxonomic affiliation. In a first part of this work, a tree-based method was compared with different approaches of taxonomic affiliation (BLAST and RDP) of 18S rRNA gene sequences and was shown to be the most accurate for near full-length sequences and for 400 bp amplicons, with the exception of amplicons covering the V5-V6 region. Secondly, the applicability of this method was tested by running a full scale test using an original pyrosequencing dataset of 18S rRNA genes of small lacustrine protists (0.2-5 µm) from eight freshwater ecosystems. Our results revealed that i) fewer than 5% of the operational taxonomic units (OTUs) identified through clustering and phylogenetic affiliation had been previously detected in lakes, based on comparison to sequence in public databases; ii) the sequencing depth provided by the NGS coupled with a phylogenetic approach allowed to shed light on clades of freshwater protists rarely or never detected with classical molecular ecology approaches; and iii) phylogenetic methods are more robust in describing the structuring of under-studied or highly divergent populations. More precisely, new putative clades belonging to Mamiellophyceae, Foraminifera, Dictyochophyceae and Euglenida were detected. Beyond the study of protists, these results illustrate that the tree-based approach for NGS based diversity characterization allows an in-depth description of microbial communities

  4. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.


    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa


    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product. PMID:26925607

  5. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.


    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa


    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product.

  6. Description of an unusual Neisseria meningitidis isolate containing and expressing Neisseria gonorrhoeae-Specific 16S rRNA gene sequences.


    Walcher, Marion; Skvoretz, Rhonda; Montgomery-Fullerton, Megan; Jonas, Vivian; Brentano, Steve


    An apparently rare Neisseria meningitidis isolate containing one copy of a Neisseria gonorrhoeae 16S rRNA gene is described herein. This isolate was identified as N. meningitidis by biochemical identification methods but generated a positive signal with Gen-Probe Aptima assays for the detection of Neisseria gonorrhoeae. Direct 16S rRNA gene sequencing of the purified isolate revealed mixed bases in signature regions that allow for discrimination between N. meningitidis and N. gonorrhoeae. The mixed bases were resolved by sequencing individually PCR-amplified single copies of the genomic 16S rRNA gene. A total of 121 discrete sequences were obtained; 92 (76%) were N. meningitidis sequences, and 29 (24%) were N. gonorrhoeae sequences. Based on the ratio of species-specific sequences, the N. meningitidis strain seems to have replaced one of its four intrinsic 16S rRNA genes with the gonococcal gene. Fluorescence in situ hybridization (FISH) probes specific for meningococcal and gonococcal rRNA were used to demonstrate the expression of the rRNA genes. Interestingly, the clinical isolate described here expresses both N. meningitidis and N. gonorrhoeae 16S rRNA genes, as shown by positive FISH signals with both probes. This explains why the probes for N. gonorrhoeae in the Gen-Probe Aptima assays cross-react with this N. meningitidis isolate. The N. meningitidis isolate described must have obtained N. gonorrhoeae-specific DNA through interspecies recombination.

  7. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing.


    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau


    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0-9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community.

  8. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  9. Analysis of 18S rRNA gene sequences suggests significant molecular differences between Macrodasyida and Chaetonotida (Gastrotricha).


    Manylov, Oleg G; Vladychenskaya, Natalia S; Milyutina, Irina A; Kedrova, Olga S; Korokhov, Nikolai P; Dvoryanchikov, Gennady A; Aleshin, Vladimir V; Petrov, Nikolai B


    Partial 18S rRNA gene sequences of four macrodasyid and one chaetonotid gastrotrichs were obtained and compared with the available sequences of other gastrotrich species and representatives of various metazoan phyla. Contrary to the earlier molecular data, the gastrotrich sequences did not comprise a monophyletic group but formed two distinct clades, corresponding to the Macrodasyida and Chaetonotida, with the basal position occupied by the sequences of Tetranchyroderma sp. and Xenotrichula sp., respectively. Depending on the taxon sampling and methods of analysis, the two clades were separated by various combinations of clades Rotifera, Gnathostomulida, and Platyhelminthes, and never formed a clade with Nematoda. Thus, monophyly of the Gastrotricha is not confirmed by analysis of the presently available molecular data. PMID:15012964

  10. Analysis of 18S rRNA gene sequences suggests significant molecular differences between Macrodasyida and Chaetonotida (Gastrotricha).


    Manylov, Oleg G; Vladychenskaya, Natalia S; Milyutina, Irina A; Kedrova, Olga S; Korokhov, Nikolai P; Dvoryanchikov, Gennady A; Aleshin, Vladimir V; Petrov, Nikolai B


    Partial 18S rRNA gene sequences of four macrodasyid and one chaetonotid gastrotrichs were obtained and compared with the available sequences of other gastrotrich species and representatives of various metazoan phyla. Contrary to the earlier molecular data, the gastrotrich sequences did not comprise a monophyletic group but formed two distinct clades, corresponding to the Macrodasyida and Chaetonotida, with the basal position occupied by the sequences of Tetranchyroderma sp. and Xenotrichula sp., respectively. Depending on the taxon sampling and methods of analysis, the two clades were separated by various combinations of clades Rotifera, Gnathostomulida, and Platyhelminthes, and never formed a clade with Nematoda. Thus, monophyly of the Gastrotricha is not confirmed by analysis of the presently available molecular data.

  11. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  12. Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.


    Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia


    We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

  13. Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences.


    Passamaneck, Yale J; Schander, Christoffer; Halanych, Kenneth M


    The Mollusca represent one of the most morphologically diverse animal phyla, prompting a variety of hypotheses on relationships between the major lineages within the phylum based upon morphological, developmental, and paleontological data. Analyses of small-ribosomal RNA (SSU rRNA) gene sequence have provided limited resolution of higher-level relationships within the Mollusca. Recent analyses suggest large-subunit (LSU) rRNA gene sequences are useful in resolving deep-level metazoan relationships, particularly when combined with SSU sequence. To this end, LSU (approximately 3.5 kb in length) and SSU (approximately 2 kb) sequences were collected for 33 taxa representing the major lineages within the Mollusca to improve resolution of intraphyletic relationships. Although the LSU and combined LSU+SSU datasets appear to hold potential for resolving branching order within the recognized molluscan classes, low bootstrap support was found for relationships between the major lineages within the Mollusca. LSU+SSU sequences also showed significant levels of rate heterogeneity between molluscan lineages. The Polyplacophora, Gastropoda, and Cephalopoda were each recovered as monophyletic clades with the LSU+SSU dataset. While the Bivalvia were not recovered as monophyletic clade in analyses of the SSU, LSU, or LSU+SSU, the Shimodaira-Hasegawa test showed that likelihood scores for these results did not differ significantly from topologies where the Bivalvia were monophyletic. Analyses of LSU sequences strongly contradict the widely accepted Diasoma hypotheses that bivalves and scaphopods are closely related to one another. The data are consistent with recent morphological and SSU analyses suggesting scaphopods are more closely related to gastropods and cephalopods than to bivalves. The dataset also presents the first published DNA sequences from a neomeniomorph aplacophoran, a group considered critical to our understanding of the origin and early radiation of the Mollusca

  14. Comparison of MALDI-TOF MS, Housekeeping Gene Sequencing, and 16S rRNA Gene Sequencing for Identification of Aeromonas Clinical Isolates

    PubMed Central

    Shin, Hee Bong; Yoon, Jihoon; Lee, Yangsoon; Kim, Myung Sook


    Purpose The genus Aeromonas is a pathogen that is well known to cause severe clinical illnesses, ranging from gastroenteritis to sepsis. Accurate identification of A. hydrophila, A. caviae, and A. veronii is important for the care of patients. However, species identification remains difficult using conventional methods. The aim of this study was to compare the accuracy of different methods of identifying Aeromonas at the species level: a biochemical method, matrix-assisted laser desorption ionization mass spectrometry-time of flight (MALDI-TOF MS), 16S rRNA sequencing, and housekeeping gene sequencing (gyrB, rpoB). Materials and Methods We analyzed 65 Aeromonas isolates recovered from patients at a university hospital in Korea between 1996 and 2012. The isolates were recovered from frozen states and tested using the following four methods: a conventional biochemical method, 16S rRNA sequencing, housekeeping gene sequencing with phylogenetic analysis, and MALDI-TOF MS. Results The conventional biochemical method and 16S rRNA sequencing identified Aeromonas at the genus level very accurately, although species level identification was unsatisfactory. MALDI-TOF MS system correctly identified 60 (92.3%) isolates at the species level and an additional four (6.2%) at the genus level. Overall, housekeeping gene sequencing with phylogenetic analysis was found to be the most accurate in identifying Aeromonas at the species level. Conclusion The most accurate method of identification of Aeromonas to species level is by housekeeping gene sequencing, although high cost and technical difficulty hinder its usage in clinical settings. An easy-to-use identification method is needed for clinical laboratories, for which MALDI-TOF MS could be a strong candidate. PMID:25684008

  15. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.


    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui


    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  16. Massively parallel rRNA gene sequencing exacerbates the potential for biased community diversity comparisons due to variable library sizes

    SciTech Connect

    Gihring, Thomas; Green, Stefan; Schadt, Christopher Warren


    Technologies for massively parallel sequencing are revolutionizing microbial ecology and are vastly increasing the scale of ribosomal RNA (rRNA) gene studies. Although pyrosequencing has increased the breadth and depth of possible rRNA gene sampling, one drawback is that the number of reads obtained per sample is difficult to control. Pyrosequencing libraries typically vary widely in the number of sequences per sample, even within individual studies, and there is a need to revisit the behaviour of richness estimators and diversity indices with variable gene sequence library sizes. Multiple reports and review papers have demonstrated the bias in non-parametric richness estimators (e.g. Chao1 and ACE) and diversity indices when using clone libraries. However, we found that biased community comparisons are accumulating in the literature. Here we demonstrate the effects of sample size on Chao1, ACE, CatchAll, Shannon, Chao-Shen and Simpson's estimations specifically using pyrosequencing libraries. The need to equalize the number of reads being compared across libraries is reiterated, and investigators are directed towards available tools for making unbiased diversity comparisons.

  17. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers.


    Myer, Phillip R; Kim, MinSeok; Freetly, Harvey C; Smith, Timothy P L


    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplification primer selection, and read length, which can affect the apparent microbial community. In this study, we compared short read 16S rRNA variable regions, V1-V3, with that of near-full length 16S regions, V1-V8, using highly diverse steer rumen microbial communities, in order to examine the impact of technology selection on phylogenetic profiles. Short paired-end reads from the Illumina MiSeq platform were used to generate V1-V3 sequence, while long "circular consensus" reads from the Pacific Biosciences RSII instrument were used to generate V1-V8 data. The two platforms revealed similar microbial operational taxonomic units (OTUs), as well as similar species richness, Good's coverage, and Shannon diversity metrics. However, the V1-V8 amplified ruminal community resulted in significant increases in several orders of taxa, such as phyla Proteobacteria and Verrucomicrobia (P < 0.05). Taxonomic classification accuracy was also greater in the near full-length read. UniFrac distance matrices using jackknifed UPGMA clustering also noted differences between the communities. These data support the consensus that longer reads result in a finer phylogenetic resolution that may not be achieved by shorter 16S rRNA gene fragments. Our work on the cattle rumen bacterial community demonstrates that utilizing near full-length 16S reads may be useful in conducting a more thorough study, or for developing a niche-specific database to use in analyzing data from shorter read technologies when budgetary constraints preclude use of near-full length 16S sequencing. PMID:27282101

  18. Comparison of Traditional Phenotypic Identification Methods with Partial 5′ 16S rRNA Gene Sequencing for Species-Level Identification of Nonfermenting Gram-Negative Bacilli▿

    PubMed Central

    Cloud, Joann L.; Harmsen, Dag; Iwen, Peter C.; Dunn, James J.; Hall, Gerri; LaSala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L.; Mellmann, Alexander


    Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5′ 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB. PMID:20164273

  19. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    PubMed Central

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau


    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0–9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community. PMID:25798135

  20. Nucleolar localization elements in U8 snoRNA differ from sequences required for rRNA processing.

    PubMed Central

    Lange, T S; Borovjagin, A V; Gerbi, S A


    U8 small nucleolar RNA (snoRNA) is essential for metazoan ribosomal RNA (rRNA) processing in nucleoli. The sequences and structural features in Xenopus U8 snoRNA that are required for its nucleolar localization were analyzed. Fluorescein-labeled U8 snoRNA was injected into Xenopus oocyte nuclei, and fluorescence microscopy of nucleolar preparations revealed that wild-type Xenopus U8 snoRNA localized to nucleoli, regardless of the presence or nature of the 5' cap on the injected U8 snoRNA. Nucleolar localization was observed when loops or stems in the 5' portion of U8 that are critical for U8 snoRNA function in rRNA processing were mutated. Therefore, sites of interaction in U8 snoRNA that potentially tether it to pre-rRNA are not essential for nucleolar localization of U8. Boxes C and D are known to be nucleolar localization elements (NoLEs) for U8 snoRNA and other snoRNAs of the Box C/D family. However, the spatial relationship of Box C to Box D was not crucial for U8 nucleolar localization, as demonstrated here by deletion of sequences in the two stems that separate them. These U8 mutants can localize to nucleoli and function in rRNA processing as well. The single-stranded Cup region in U8, adjacent to evolutionarily conserved Box C, functions as a NoLE in addition to Boxes C and D. Cup is unique to U8 snoRNA and may help bind putative protein(s) needed for nucleolar localization. Alternatively, Cup may help to retain U8 snoRNA within the nucleolus. PMID:9671052

  1. Identification and phylogeny of Arabian snakes: Comparison of venom chromatographic profiles versus 16S rRNA gene sequences.


    Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad


    Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species. PMID:25313278

  2. Large-subunit rRNA sequence of the chytridiomycete Blastocladiella emersonii, and implications for the evolution of zoosporic fungi.


    Van der Auwera, G; De Wachter, R


    The 5.8S and 28S ribosomal RNA sequences of the chytridiomycete Blastocladiella emersonii were determined. These data were combined with 18S rRNA sequences in order to carry out a phylogenetic analysis based on distance matrix, parsimony, and maximum likelihood methods. The new data confirmed that chytridiomycetes are true fungi and not protists, as was already suggested on the basis of biochemical, ultrastructural, and 18S rRNA data. Within the fungal clade, B. emersonii formed the first line of divergence. The position of the fungi within the eukaryotic "crown" taxa was also reassessed, and the alveolate-stramenopile cluster appeared as their sister group. The stramenopiles also comprise a number of zoosporic fungi, which resemble chytridiomycetes in so many respects, e.g., production of motile spores, thallus morphology, and absorptive nutrition, that they have been classified together with them in the past. This suggests that the possible common ancestor of the fungi, stramenopiles, and alveolates may have been a zoosporic fungus, which would mean that zoosporic fungi are paraphyletic instead of polyphyletic as previously suggested.

  3. Evaluation of 16SpathDB 2.0, an automated 16S rRNA gene sequence database, using 689 complete bacterial genomes.


    Teng, Jade L L; Ho, Tom C C; Yeung, Ronald S Y; Wong, Annette Y P; Wang, Haiyin; Chen, Chen; Fung, Kitty S C; Lau, Susanna K P; Woo, Patrick C Y


    Interpretation of 16S rRNA sequences is a difficult problem faced by clinical microbiologists and technicians. In this study, we evaluated the updated 16SpathDB 2.0 database, using 689 16S rRNA sequences from 689 complete genomes of medically important bacteria. Among these 689 16S rRNA sequences, none was wrongly identified, with 35.8% reported as a single bacterial species having >98% identity with the query sequence (category 1), 63.9% reported as more than 1 bacterial species having >98% identity with the query sequence (category 2), 0.3% reported to the genus level (category 3), and none reported as no match (category 4). For the 16S rRNA sequences of non-duplicated bacterial species reported as category 1 or 2, the percentage of bacterial species reported as category 1 was significantly higher for anaerobic Gram-positive/Gram-negative bacteria than aerobic/facultative anaerobic Gram-positive/Gram-negative bacteria. 16SpathDB 2.0 is a user-friendly and accurate database for 16S rRNA sequence interpretation in clinical laboratories.

  4. Automatic identification of large collections of protein-coding or rRNA sequences.


    Arigon, Anne-Muriel; Perrière, Guy; Gouy, Manolo


    The number of available genomic sequences is growing very fast, due to the development of massive sequencing techniques. Sequence identification is needed and contributes to the assessment of gene and species evolutionary relationships. Automated bioinformatics tools are thus necessary to carry out these identification operations in an accurate and fast way. We developed HoSeqI (Homologous Sequence Identification), a software environment allowing this kind of automated sequence identification using homologous gene family databases. HoSeqI is accessible through a Web interface ( allowing to identify one or several sequences and to visualize resulting alignments and phylogenetic trees. We also implemented another application, MultiHoSeqI, to quickly add a large set of sequences to a family database in order to identify them, to update the database, or to help automatic genome annotation. Lately, we developed an application, ChiSeqI (Chimeric Sequence Identification), to automate the processes of identification of bacterial 16S ribosomal RNA sequences and of detection of chimeric sequences.

  5. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.


    Dorsch, M; Lane, D; Stackebrandt, E


    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  6. Phylogeny of some mycoplasmas from ruminants based on 16S rRNA sequences and definition of a new cluster within the hominis group.


    Pettersson, B; Uhlén, M; Johansson, K E


    Almost complete (> 96%) 16S rRNA sequences from nine ruminant mycoplasmas have been determined by solid-phase DNA sequencing. Polymorphisms were found in four of the 16S rRNA sequences, which indicated the existence of two different rRNA operons. Seven polymorphisms were found in Mycoplasma agalatiae, three were found in Mycoplasma bovis, one was found in Mycoplasma alkalescens, and one was found in Mycoplasma bovirhinis. The sequence data were used for construction of phylogenetic trees. All but one of the ruminant mycoplasmas sequenced in this work clustered in the hominis group. A close relationship was found between M. agalactiae and M. bovis, with a 99% nucleotide similarity between their 16S rRNA sequences. They were also found to be members of the Mycoplasma lipophilum cluster of the hominis group. Furthermore, the 16S rRNA comparisons showed that Mycoplasma alkalescens and Mycoplasma canadense are closely related (> 98.5%), and these species were found to cluster in the Mycoplasma hominis cluster of the hominis group. Interestingly, M. bovirhinis grouped in a new phylogenetic cluster of the hominis group. The new cluster, which was supported by bootstrap percentage values, signature nucleotide analysis, and higher-order structural elements, was named the Mycoplasma synoviae cluster. Mycoplasma bovoculi, Mycoplasma conjunctivae, and Mycoplasma ovipneumoniae clustered in the Mycoplasma neurolyticum cluster of the hominis group. Mycoplasma alvi clustered with Mycoplasma pirum in the M. pneumoniae cluster of the pneumoniae group.

  7. Phylogenetic position of foraminifera inferred from LSU rRNA gene sequences.


    Pawlowski, J; Bolivar, I; Guiard-Maffia, J; Gouy, M


    A 5'-terminal region of 1600-1800 base pairs was amplified, cloned, and sequenced in the large subunit rDNA (LSU rDNA) of four species of foraminifera. These sequences were compared with the homologous regions of 16 eukaryotic taxa in order to establish the phylogenetic position of foraminifera. Analysis of 610 unambiguously aligned bases shows that foraminifera branch closely to plasmodial and cellular slime molds in the middle of the eukaryotic tree--that is, much earlier than suggested by the fossil record. These data, the first DNA sequences reported for foraminifera, will help analyze this class of protists and the early evolution of eukaryotes.

  8. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.


    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  9. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences

    PubMed Central

    Langille, Morgan G. I.; Zaneveld, Jesse; Caporaso, J. Gregory; McDonald, Daniel; Knights, Dan; Reyes, Joshua A.; Clemente, Jose C.; Burkepile, Deron E.; Vega Thurber, Rebecca L.; Knight, Rob; Beiko, Robert G.; Huttenhower, Curtis


    Profiling phylogenetic marker genes, such as the 16S rRNA gene, is a key tool for studies of microbial communities but does not provide direct evidence of a community’s functional capabilities. Here we describe PICRUSt (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States), a computational approach to predict the functional composition of a metagenome using marker gene data and a database of reference genomes. PICRUSt uses an extended ancestral-state reconstruction algorithm to predict which gene families are present and then combines gene families to estimate the composite metagenome. Using 16S information, PICRUSt recaptures key findings from the Human Microbiome Project and accurately predicts the abundance of gene families in host-associated and environmental communities, with quantifiable uncertainty. Our results demonstrate that phylogeny and function are sufficiently linked that this ‘predictive metagenomic’ approach should provide useful insights into the thousands of uncultivated microbial communities for which only marker gene surveys are currently available. PMID:23975157

  10. Spatiotemporal analysis of bacterial diversity in sediments of Sundarbans using parallel 16S rRNA gene tag sequencing.


    Basak, Pijush; Majumder, Niladri Shekhar; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Chakraborty, Arpita; SenGupta, Sohan; Roy, Arunava; Mukherjee, Arghya; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree


    The influence of temporal and spatial variations on the microbial community composition was assessed in the unique coastal mangrove of Sundarbans using parallel 16S rRNA gene pyrosequencing. The total sediment DNA was extracted and subjected to the 16S rRNA gene pyrosequencing, which resulted in 117 Mbp of data from three experimental stations. The taxonomic analysis of the pyrosequencing data was grouped into 24 different phyla. In general, Proteobacteria were the most dominant phyla with predominance of Deltaproteobacteria, Alphaproteobacteria, and Gammaproteobacteria within the sediments. Besides Proteobacteria, there are a number of sequences affiliated to the following major phyla detected in all three stations in both the sampling seasons: Actinobacteria, Bacteroidetes, Planctomycetes, Acidobacteria, Chloroflexi, Cyanobacteria, Nitrospira, and Firmicutes. Further taxonomic analysis revealed abundance of micro-aerophilic and anaerobic microbial population in the surface layers, suggesting anaerobic nature of the sediments in Sundarbans. The results of this study add valuable information about the composition of microbial communities in Sundarbans mangrove and shed light on possible transformations promoted by bacterial communities in the sediments. PMID:25256302

  11. Molecular phylogenetics in 2D: ITS2 rRNA evolution and sequence-structure barcode from Veneridae to Bivalvia.


    Salvi, Daniele; Mariottini, Paolo


    In this study, we analyzed the nuclear ITS2 rRNA primary sequence and secondary structure in Veneridae and comparatively with 20 Bivalvia taxa to test the phylogenetic resolution of this marker and its suitability for molecular diagnosis at different taxonomic levels. Maximum likelihood and Bayesian trees based on primary sequences were congruent with (profile-) neighbor-joining trees based on a combined model of sequence-structure evolution. ITS2 showed higher resolution below the subfamily level, providing a phylogenetic signal comparable to (mitochondrial/nuclear) gene fragments 2-5 times longer. Structural elements of the ITS2 folding, such as specific mismatch pairing and compensatory base changes, provided further support for the monophyly of some groups and for their phylogenetic relationships. Veneridae ITS2 folding is structured in six domains (DI-VI) and shows five striking sequence-structure features. Two of them, the Basal and Apical STEMs, are common to Bivalvia, while the presence of both the Branched STEM and the Y/R stretches occurs in five superfamilies of the two Heterodonta orders Myoida and Veneroida, thus questioning their reciprocal monophyly. Our results validated the ITS2 as a suitable marker for venerids phylogenetics and taxonomy, and underlined the significance of including secondary structure information for both applications at several systematic levels within bivalves.

  12. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing.


    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree


    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans.

  13. Molecular phylogeny of the Heterotrichea (Ciliophora, Postciliodesmatophora) based on small subunit rRNA gene sequences.


    Schmidt, Stephanie L; Foissner, Wilhelm; Schlegel, Martin; Bernhard, Detlef


    A comprehensive molecular analysis of the phylogenetic relationships within the Heterotrichea including all described families is still lacking. For this reason, the complete nuclear small subunit (SSU) rDNA was sequenced from further representatives of the Blepharismidae and the Stentoridae. In addition, the SSU rDNA of a new, undescribed species of the genus Condylostomides (Condylostomatidae) was sequenced. The detailed phylogenetic analyses revealed a consistent branching pattern: while the terminal branches are generally well resolved, the basal relationships remain unsolved. Moreover, the data allow some conclusions about the macronuclear evolution within the genera Blepharisma, Stentor, and Spirostomum suggesting that a single, compact macronucleus represents the ancestral state. PMID:17669161

  14. 16S rRNA gene sequencing is a non-culture method of defining the specific bacterial etiology of ventilator-associated pneumonia.


    Xia, Li-Ping; Bian, Long-Yan; Xu, Min; Liu, Ying; Tang, Ai-Ling; Ye, Wen-Qin


    Ventilator-associated pneumonia (VAP) is an acquired respiratory tract infection following tracheal intubation. The most common hospital-acquired infection among patients with acute respiratory failure, VAP is associated with a mortality rate of 20-30%. The standard bacterial culture method for identifying the etiology of VAP is not specific, timely, or accurate in identifying the bacterial pathogens. This study used 16S rRNA gene metagenomic sequencing to identify and quantify the pathogenic bacteria in lower respiratory tract and oropharyngeal samples of 55 VAP patients. Sequencing of the 16S rRNA gene has served as a valuable tool in bacterial identification, particularly when other biochemical, molecular, or phenotypic identification techniques fail. In this study, 16S rRNA gene sequencing was performed in parallel with the standard bacterial culture method to identify and quantify bacteria present in the collected patient samples. Sequence analysis showed the colonization of multidrug-resistant strains in VAP secretions. Further, this method identified Prevotella, Proteus, Aquabacter, and Sphingomonas bacterial genera that were not detected by the standard bacterial culture method. Seven categories of bacteria, Streptococcus, Neisseria, Corynebacterium, Acinetobacter, Staphylococcus, Pseudomonas and Klebsiella, were detectable by both 16S rRNA gene sequencing and standard bacterial culture methods. Further, 16S rRNA gene sequencing had a significantly higher sensitivity in detecting Streptococcus and Pseudomonas when compared to standard bacterial culture. Together, these data present 16S rRNA gene sequencing as a novel VAP diagnosis tool that will further enable pathogen-specific treatment of VAP.

  15. [Cloning and sequencing of 16S rRNA gene of Phytoplasma CWB1 strain associated with cactus witches' broom].


    Cai, H; Li, F; Kong, B; Chen, H


    A 1.5 kb DNA fragment was amplified in DNA samples extracted from Opuntia salmiana porm showed witches'-broom symptom. The result indicates the existence of phytoplasma associated with this disease and this phytoplasma was designated as CWB1. The amplified fragment was ligated to pGEM-T easy vector and then transformed into JM109 strain of E. coli. Cloned DNA fragments were verified by PCR, restriction endonuclease (EcoRI) digestion and sequence analysis. The result revealed that the 16S rRNA gene of CWB1 consists of 1489 bp and shared 99.7% homology with Faba bean phyllody which belongs to phytoplasma 16S rII-C subgroup. So we can classify this strain into phytoplasma 16S rII-C subgroup. PMID:12552825

  16. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.


    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina


    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  17. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.


    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina


    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis.

  18. Identification of bovine Neospora parasites by PCR amplification and specific small-subunit rRNA sequence probe hybridization.


    Ho, M S; Barr, B C; Marsh, A E; Anderson, M L; Rowe, J D; Tarantal, A F; Hendrickx, A G; Sverlow, K; Dubey, J P; Conrad, P A


    Neospora is a newly recognized genus of pathogenic coccidia, closely related to Toxoplasma gondii, that can cause abortion or congenital disease in a variety of domestic animal hosts. On the basis of the small-subunit rRNA gene sequences of Neospora spp. and other apicomplexa coccidia, oligonucleotide primers COC-1 and COC-2 were used for PCR amplification of conserved sequences of approximately 300 bp in size. A Neospora-specific chemiluminescent probe hybridized to Southern blots of amplification products from Neospora DNA but not to Southern blots with amplified DNA from the other coccidian parasites tested. A Toxoplasma-specific probe whose sequence differed from that of the probe for Neospora spp. by a single base pair was used to distinguish these parasites by specific Southern blot hybridization. The PCR system detected as few as one Neospora tachyzoite in the culture medium or five tachyzoites in samples of whole blood or amniotic fluid spiked with Neospora parasites. In addition, Neospora PCR products were successfully amplified from whole blood and amniotic fluid samples of experimentally infected bovine and rhesus macaque fetuses. These results indicate that this PCR and probe hybridization system could be a valuable adjunct to serology and immunohistochemistry for the diagnosis of Neospora infections in bovine or primate fetuses.

  19. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.


    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo


    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  20. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K


    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  1. Phylogenetic relationships of Indian caecilians (Amphibia: Gymnophiona) inferred from mitochondrial rRNA gene sequences.


    Wilkinson, Mark; A Sheps, Jonathan; Oommen, Oommen V; Cohen, Bernard L


    India has a diverse caecilian fauna, including representatives of three of the six currently recognized families, the Caeciliidae, Ichthyophiidae, the endemic Uraeotyphlidae, but previous molecular phylogenetic studies of caecilians have not included sequences for any Indian caecilians. Partial 12S and 16S mitochondrial gene sequences were obtained for a single representative of each of the caecilian families found in India and aligned against previously reported sequences for 13 caecilian species. The resulting alignment (16 taxa, 1200 sites, of which 288 cannot be aligned unambiguously) was analyzed using parsimony, maximum-likelihood, and distance methods. As judged by bootstrap proportions, decay indices, and leaf stabilities, well-supported relationships of the Indian caecilians are recovered from the alignment. The data (1) corroborate the hypothesis, based on morphology, that the Uraeotyphlidae and Ichthyophiidae are sister taxa, (2) recover a monophyletic Ichthyophiidae, including Indian and South East Asian representatives, and (3) place the Indian caeciliid Gegeneophis ramaswamii as the sister group of the caeciliid caecilians of the Seychelles. Rough estimates of divergence times suggest an origin of the Uraeotyphlidae and Ichthyophiidae while India was isolated from Laurasia and Africa and are most consistent with an Indian origin of these families and subsequent dispersal of ichthyophiids into South East Asia.

  2. Phylogeny of trichomonads inferred from small-subunit rRNA sequences.


    Gunderson, J; Hinkle, G; Leipe, D; Morrison, H G; Stickel, S K; Odelson, D A; Breznak, J A; Nerad, T A; Müller, M; Sogin, M L


    Small subunit (16S-like) ribosomal RNA sequences were obtained from representatives of all four families constituting the order Trichomonadida. Comparative sequence analysis revealed that the Trichomonadida are a monophyletic lineage and a deep branch of the eukaryotic tree. Relative to the early divergent eukaryotic assemblages the branching pattern within the Trichomonadida is very shallow. This pattern suggests the Trichomonadida radiated recently, perhaps in conjunction with their animal hosts. From a morphological perspective the Devescovinidae and Calonymphidae are considered more derived than the Monocercomonadidae and Trichomonadidae. Molecular trees inferred by distance, parsimony and likelihood techniques consistently show the Devescovinidae and Calonymphidae are the earliest diverging lineages within the Trichomonadida, however bootstrap values do not strongly support a particular branching order. In an analysis of all known 16S-like ribosomal RNA sequences, the Trichomonadida share most recent common ancestry with unidentified protists from the hindgut of the termite Reticulitermes flavipes. The position of two putative free-living trichomonads in the tree is indicative of derivation from symbionts rather than direct descent from some free-living ancestral trichomonad.

  3. Phylogenetic relationships of Indian caecilians (Amphibia: Gymnophiona) inferred from mitochondrial rRNA gene sequences.


    Wilkinson, Mark; A Sheps, Jonathan; Oommen, Oommen V; Cohen, Bernard L


    India has a diverse caecilian fauna, including representatives of three of the six currently recognized families, the Caeciliidae, Ichthyophiidae, the endemic Uraeotyphlidae, but previous molecular phylogenetic studies of caecilians have not included sequences for any Indian caecilians. Partial 12S and 16S mitochondrial gene sequences were obtained for a single representative of each of the caecilian families found in India and aligned against previously reported sequences for 13 caecilian species. The resulting alignment (16 taxa, 1200 sites, of which 288 cannot be aligned unambiguously) was analyzed using parsimony, maximum-likelihood, and distance methods. As judged by bootstrap proportions, decay indices, and leaf stabilities, well-supported relationships of the Indian caecilians are recovered from the alignment. The data (1) corroborate the hypothesis, based on morphology, that the Uraeotyphlidae and Ichthyophiidae are sister taxa, (2) recover a monophyletic Ichthyophiidae, including Indian and South East Asian representatives, and (3) place the Indian caeciliid Gegeneophis ramaswamii as the sister group of the caeciliid caecilians of the Seychelles. Rough estimates of divergence times suggest an origin of the Uraeotyphlidae and Ichthyophiidae while India was isolated from Laurasia and Africa and are most consistent with an Indian origin of these families and subsequent dispersal of ichthyophiids into South East Asia. PMID:12099794

  4. A method for high precision sequencing of near full-length 16S rRNA genes on an Illumina MiSeq

    PubMed Central

    Darling, Aaron E.


    Background The bacterial 16S rRNA gene has historically been used in defining bacterial taxonomy and phylogeny. However, there are currently no high-throughput methods to sequence full-length 16S rRNA genes present in a sample with precision. Results We describe a method for sequencing near full-length 16S rRNA gene amplicons using the high throughput Illumina MiSeq platform and test it using DNA from human skin swab samples. Proof of principle of the approach is demonstrated, with the generation of 1,604 sequences greater than 1,300 nt from a single Nano MiSeq run, with accuracy estimated to be 100-fold higher than standard Illumina reads. The reads were chimera filtered using information from a single molecule dual tagging scheme that boosts the signal available for chimera detection. Conclusions This method could be scaled up to generate many thousands of sequences per MiSeq run and could be applied to other sequencing platforms. This has great potential for populating databases with high quality, near full-length 16S rRNA gene sequences from under-represented taxa and environments and facilitates analyses of microbial communities at higher resolution. PMID:27688981

  5. A method for high precision sequencing of near full-length 16S rRNA genes on an Illumina MiSeq

    PubMed Central

    Darling, Aaron E.


    Background The bacterial 16S rRNA gene has historically been used in defining bacterial taxonomy and phylogeny. However, there are currently no high-throughput methods to sequence full-length 16S rRNA genes present in a sample with precision. Results We describe a method for sequencing near full-length 16S rRNA gene amplicons using the high throughput Illumina MiSeq platform and test it using DNA from human skin swab samples. Proof of principle of the approach is demonstrated, with the generation of 1,604 sequences greater than 1,300 nt from a single Nano MiSeq run, with accuracy estimated to be 100-fold higher than standard Illumina reads. The reads were chimera filtered using information from a single molecule dual tagging scheme that boosts the signal available for chimera detection. Conclusions This method could be scaled up to generate many thousands of sequences per MiSeq run and could be applied to other sequencing platforms. This has great potential for populating databases with high quality, near full-length 16S rRNA gene sequences from under-represented taxa and environments and facilitates analyses of microbial communities at higher resolution.

  6. Nearly complete 28S rRNA gene sequences confirm new hypotheses of sponge evolution.


    Thacker, Robert W; Hill, April L; Hill, Malcolm S; Redmond, Niamh E; Collins, Allen G; Morrow, Christine C; Spicer, Lori; Carmack, Cheryl A; Zappe, Megan E; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C; Bangalore, Purushotham V


    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  7. Nearly Complete 28S rRNA Gene Sequences Confirm New Hypotheses of Sponge Evolution

    PubMed Central

    Thacker, Robert W.; Hill, April L.; Hill, Malcolm S.; Redmond, Niamh E.; Collins, Allen G.; Morrow, Christine C.; Spicer, Lori; Carmack, Cheryl A.; Zappe, Megan E.; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C.; Bangalore, Purushotham V.


    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  8. Analysis of the primary sequence and secondary structure of the unusually long SSU rRNA of the soil bug, Armadillidium vulgare.


    Choe, C P; Hancock, J M; Hwang, U W; Kim, W


    The complete nucleotide sequence of the SSU rRNA gene from the soil bug, Armadillidium vulgare (Crustacea, Isopoda), was determined. It is 3214 bp long, with a GC content of 56.3%. It is not only the longest SSU rRNA gene among Crustacea but also longer than any other SSU rRNA gene except that of the strepsipteran insect, Xenos vesparum (3316 bp). The unusually long sequence of this species is explained by the long sequences of variable regions V4 and V7, which make up more than half of the total length. RT-PCR analysis of these two regions showed that the long sequences also exist in the mature rRNA and sequence simplicity analysis revealed the presence of slippage motifs in these two regions. The putative secondary structure of the rRNA is typical for eukaryotes except for the length and shape variations of the V2, V4, V7, and V9 regions. Each of the V2, V4, and V7 regions was elongated, while the V9 region was shortened. In V2, two bulges, located between helix 8 and helix 9 and between helix 9 and helix 10, were elongated. In V4, stem E23-3 was dramatically expanded, with several small branched stems. In V7, stem 43 was branched and expanded. Comparisons with the unusually long SSU rRNAs of other organisms imply that the increase in total length of SSU rRNA is due mainly to expansion in the V4 and V7 regions. PMID:10594181

  9. Polymerase chain reaction using 16S rRNA gene sequences distinguishes the two biovars of Ureaplasma urealyticum.

    PubMed Central

    Robertson, J A; Vekris, A; Bebear, C; Stemke, G W


    Several fundamental phenotypic and genotypic differences have separated strains of the genital mycoplasma Ureaplasma urealyticum into two clusters or biovars. However, the lack of an easily performed and unambiguous test to discriminate between them has hampered investigation of the relationship between these biovars and disease. We determined the 16S rRNA nucleotide sequence of U. urealyticum 27, the serovar 3 standard and representative of the parvo biovar (serovars 1, 3, 6, and 14). This sequence was compared with the published sequence of U. urealyticum T960, which is the type strain and the serovar 8 standard and is representative of the T960 biovar which is composed of the 10 intervening serovars. Homology between the two sequences was 98.8%; differences were exploited to provide primers for biovar-specific polymerase chain reactions (PCRs). The results of these reactions placed all 14 serovar standard strains into the correct biovar. The PCRs were also applied to 10 cloned and 8 noncloned isolates that had been serotyped earlier. For 16 of them, we deduced their biovars from the serotyping data and then confirmed them by PCR. One unpredictable isolate and one nonserotypeable isolate were also classified as to biovar. Thus, we have developed a method for biotyping U. urealyticum that is applicable to both laboratory-adapted strains and wild-type isolates and that is appropriate for testing large numbers of clinical isolates. The amplification by the T960 biovar PCR protocol of DNAs from ureaplasmas of animals and certain Mycoplasma species suggested that the parvo biovar has diverged from the mainstream of the evolution of this clade. Images PMID:7681846

  10. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease.


    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H


    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  11. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung


    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB ( based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  12. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers.


    Myer, Phillip R; Kim, MinSeok; Freetly, Harvey C; Smith, Timothy P L


    Amplicon sequencing utilizing next-generation platforms has significantly transformed how research is conducted, specifically microbial ecology. However, primer and sequencing platform biases can confound or change the way scientists interpret these data. The Pacific Biosciences RSII instrument may also preferentially load smaller fragments, which may also be a function of PCR product exhaustion during sequencing. To further examine theses biases, data is provided from 16S rRNA rumen community analyses. Specifically, data from the relative phylum-level abundances for the ruminal bacterial community are provided to determine between-sample variability. Direct sequencing of metagenomic DNA was conducted to circumvent primer-associated biases in 16S rRNA reads and rarefaction curves were generated to demonstrate adequate coverage of each amplicon. PCR products were also subjected to reduced amplification and pooling to reduce the likelihood of PCR product exhaustion during sequencing on the Pacific Biosciences platform. The taxonomic profiles for the relative phylum-level and genus-level abundance of rumen microbiota as a function of PCR pooling for sequencing on the Pacific Biosciences RSII platform were provided. For more information, see "Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers" P.R. Myer, M. Kim, H.C. Freetly, T.P.L. Smith (2016) [1]. PMID:27508263

  13. First report on the bacterial diversity in the distal gut of dholes (Cuon alpinus) by using 16S rRNA gene sequences analysis.


    Chen, Lei; Zhang, Honghai; Liu, Guangshuai; Sha, Weilai


    The aim of this study was to investigate the bacterial community in the distal gut of dholes (Cuon alpinus) based on the analysis of bacterial 16S rRNA gene sequences. Fecal samples were collected from five healthy unrelated dholes captured from Qilian Mountain in Gansu province of China. The diversity of the fecal bacteria community was investigated by constructing a polymerase chain reaction (PCR)-amplified 16S rRNA gene clone library. Bacterial 16S rRNA gene was amplified by using universal bacterial primers 27F and 1492R. A total of 275 chimera-free near full length 16S rRNA gene sequences were collected, and 78 non-redundant bacteria phylotypes (operational taxonomical units, OTUs) were identified according to the 97 % sequence similarity. Forty-two OTUs (53.8 %) showed less than 98 % sequence similarity to 16S rRNA gene sequences reported previously. Phylogenetic analysis demonstrated that dhole bacterial community comprised five different phyla, with the majority of sequences being classified within the phylum Bacteroidetes (64.7 %), followed by Firmicutes (29.8 %), Fusobacteria (4.7 %),Proteobacteria (0.4 %), and Actinobacteria (0.4 %). The only order Bacteroidales in phylum Bacteroidetes was the most abundant bacterial group in the intestinal bacterial community of dholes. Firmicutes and Bacteroidetes were the two most diverse bacterial phyla with 46.2 and 44.9 % of OTUs contained, respectively. Bacteroidales and Clostridiales were the two most diverse bacterial orders that contained 44.9 and 39.7 % of OTUs, respectively. PMID:26423781

  14. First report on the bacterial diversity in the distal gut of dholes (Cuon alpinus) by using 16S rRNA gene sequences analysis.


    Chen, Lei; Zhang, Honghai; Liu, Guangshuai; Sha, Weilai


    The aim of this study was to investigate the bacterial community in the distal gut of dholes (Cuon alpinus) based on the analysis of bacterial 16S rRNA gene sequences. Fecal samples were collected from five healthy unrelated dholes captured from Qilian Mountain in Gansu province of China. The diversity of the fecal bacteria community was investigated by constructing a polymerase chain reaction (PCR)-amplified 16S rRNA gene clone library. Bacterial 16S rRNA gene was amplified by using universal bacterial primers 27F and 1492R. A total of 275 chimera-free near full length 16S rRNA gene sequences were collected, and 78 non-redundant bacteria phylotypes (operational taxonomical units, OTUs) were identified according to the 97 % sequence similarity. Forty-two OTUs (53.8 %) showed less than 98 % sequence similarity to 16S rRNA gene sequences reported previously. Phylogenetic analysis demonstrated that dhole bacterial community comprised five different phyla, with the majority of sequences being classified within the phylum Bacteroidetes (64.7 %), followed by Firmicutes (29.8 %), Fusobacteria (4.7 %),Proteobacteria (0.4 %), and Actinobacteria (0.4 %). The only order Bacteroidales in phylum Bacteroidetes was the most abundant bacterial group in the intestinal bacterial community of dholes. Firmicutes and Bacteroidetes were the two most diverse bacterial phyla with 46.2 and 44.9 % of OTUs contained, respectively. Bacteroidales and Clostridiales were the two most diverse bacterial orders that contained 44.9 and 39.7 % of OTUs, respectively.

  15. The Protist Ribosomal Reference database (PR2): a catalog of unicellular eukaryote small sub-unit rRNA sequences with curated taxonomy.


    Guillou, Laure; Bachar, Dipankar; Audic, Stéphane; Bass, David; Berney, Cédric; Bittner, Lucie; Boutte, Christophe; Burgaud, Gaétan; de Vargas, Colomban; Decelle, Johan; Del Campo, Javier; Dolan, John R; Dunthorn, Micah; Edvardsen, Bente; Holzmann, Maria; Kooistra, Wiebe H C F; Lara, Enrique; Le Bescot, Noan; Logares, Ramiro; Mahé, Frédéric; Massana, Ramon; Montresor, Marina; Morard, Raphael; Not, Fabrice; Pawlowski, Jan; Probert, Ian; Sauvadet, Anne-Laure; Siano, Raffaele; Stoeck, Thorsten; Vaulot, Daniel; Zimmermann, Pascal; Christen, Richard


    The interrogation of genetic markers in environmental meta-barcoding studies is currently seriously hindered by the lack of taxonomically curated reference data sets for the targeted genes. The Protist Ribosomal Reference database (PR(2), provides a unique access to eukaryotic small sub-unit (SSU) ribosomal RNA and DNA sequences, with curated taxonomy. The database mainly consists of nuclear-encoded protistan sequences. However, metazoans, land plants, macrosporic fungi and eukaryotic organelles (mitochondrion, plastid and others) are also included because they are useful for the analysis of high-troughput sequencing data sets. Introns and putative chimeric sequences have been also carefully checked. Taxonomic assignation of sequences consists of eight unique taxonomic fields. In total, 136 866 sequences are nuclear encoded, 45 708 (36 501 mitochondrial and 9657 chloroplastic) are from organelles, the remaining being putative chimeric sequences. The website allows the users to download sequences from the entire and partial databases (including representative sequences after clustering at a given level of similarity). Different web tools also allow searches by sequence similarity. The presence of both rRNA and rDNA sequences, taking into account introns (crucial for eukaryotic sequences), a normalized eight terms ranked-taxonomy and updates of new GenBank releases were made possible by a long-term collaboration between experts in taxonomy and computer scientists.

  16. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.


    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes


    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

  17. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.


    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes


    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products. PMID:26898909

  18. Identification by 16S rRNA gene sequencing of an Actinomyces hongkongensis isolate recovered from a patient with pelvic actinomycosis.


    Flynn, A N; Lyndon, C A; Church, D L


    A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.

  19. Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)


    Tremblay, Julien [DOE JGI


    Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  20. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern United States, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA gene (SSU rRNA). Howe...

  1. Phylogeny and evolutionary genetics of Frankia strains based on 16S rRNA and nifD-K gene sequences.


    Mishra, Arun Kumar; Singh, Pawan Kumar; Singh, Prashant; Singh, Anumeha; Singh, Satya Shila; Srivastava, Amrita; Srivastava, Alok Kumar; Sarma, Hridip Kumar


    16S rRNA and nifD-nifK sequences were used to study the molecular phylogeny and evolutionary genetics of Frankia strains isolated from Hippöphae salicifolia D. Don growing at different altitudes (ecologically classified as riverside and hillside isolates) of the Eastern Himalayan region of North Sikkim, India. Genetic information for the small subunit rRNA (16S rRNA) revealed that the riverside Frankia isolates markedly differed from the hillside isolates suggesting that the riverside isolates are genetically compact. Further, for enhanced resolutions, the partial sequence of nifD (3' end), nifK (5' end) and nifD-K IGS region have been investigated. The sequences obtained, failed to separate riverside isolates and hillside isolates, thus suggesting a possible role of genetic transfer events either from hillside to riverside or vice versa. The evolutionary genetic analyses using evogenomic extrapolations of gene sequence data obtained from 16S rRNA and nifD-K provided differing equations with the pace of evolution being more appropriately, intermediate. Values of recombination frequency (R), nucleotide diversity per site (Pi), and DNA divergence estimates supported the existence of an intermixed zone where spatial isolations occurred in sync with the temporal estimates. J. Basic Microbiol. 2015, 54, 1-9. PMID:25871924

  2. Analysis of partial sequences of genes coding for 16S rRNA of actinomycetes isolated from Casuarina equisetifolia nodules in Mexico.

    PubMed Central

    Niner, B M; Brandt, J P; Villegas, M; Marshall, C R; Hirsch, A M; Valdés, M


    Filamentous bacteria isolated from surface-sterilized nodules of Casuarina equisetifolia trees in México were capable of reducing acetylene, a diagnostic test for nitrogenase, but were unable to nodulate their host. Analysis of partial 16S rRNA gene sequences suggests that the Mexican isolates are not Frankia strains but members of a novel clade. PMID:8702297

  3. Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    SciTech Connect

    Tremblay, Julien


    Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  4. Phylogeny and evolutionary genetics of Frankia strains based on 16S rRNA and nifD-K gene sequences.


    Mishra, Arun Kumar; Singh, Pawan Kumar; Singh, Prashant; Singh, Anumeha; Singh, Satya Shila; Srivastava, Amrita; Srivastava, Alok Kumar; Sarma, Hridip Kumar


    16S rRNA and nifD-nifK sequences were used to study the molecular phylogeny and evolutionary genetics of Frankia strains isolated from Hippöphae salicifolia D. Don growing at different altitudes (ecologically classified as riverside and hillside isolates) of the Eastern Himalayan region of North Sikkim, India. Genetic information for the small subunit rRNA (16S rRNA) revealed that the riverside Frankia isolates markedly differed from the hillside isolates suggesting that the riverside isolates are genetically compact. Further, for enhanced resolutions, the partial sequence of nifD (3' end), nifK (5' end) and nifD-K IGS region have been investigated. The sequences obtained, failed to separate riverside isolates and hillside isolates, thus suggesting a possible role of genetic transfer events either from hillside to riverside or vice versa. The evolutionary genetic analyses using evogenomic extrapolations of gene sequence data obtained from 16S rRNA and nifD-K provided differing equations with the pace of evolution being more appropriately, intermediate. Values of recombination frequency (R), nucleotide diversity per site (Pi), and DNA divergence estimates supported the existence of an intermixed zone where spatial isolations occurred in sync with the temporal estimates. J. Basic Microbiol. 2015, 54, 1-9.

  5. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.


    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche.

  6. Phylogenetic relationships among Linguatula serrata isolates from Iran based on 18S rRNA and mitochondrial cox1 gene sequences.


    Ghorashi, Seyed Ali; Tavassoli, Mousa; Peters, Andrew; Shamsi, Shokoofeh; Hajipour, Naser


    The phylogenetic relationships among seven Linguatula serrata (L. serrata) isolates collected from cattle, goats, sheep, dogs and camels in different geographical locations of Iran were investigated using partial 18S ribosomal RNA (rRNA) and partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequences. The nucleotide sequences were analysed in order to determine the phylogenetic relationships between the isolates. Higher sequence diversity and intraspecies variation was observed in the cox1 gene compared to 18S rRNA sequences. Phylogenetic analysis of the cox1 gene placed all L. serrata isolates in a sister clade to L. arctica. The Mantel regression analysis revealed no association between genetic variations and host species or geographical location, perhaps due to the small sample size. However, genetic variations between L. serrata isolates in Iran and those isolated in other parts of the world may exist and could reveal possible evolutionary relationships.

  7. Phylogenetic relationships among Linguatula serrata isolates from Iran based on 18S rRNA and mitochondrial cox1 gene sequences.


    Ghorashi, Seyed Ali; Tavassoli, Mousa; Peters, Andrew; Shamsi, Shokoofeh; Hajipour, Naser


    The phylogenetic relationships among seven Linguatula serrata (L. serrata) isolates collected from cattle, goats, sheep, dogs and camels in different geographical locations of Iran were investigated using partial 18S ribosomal RNA (rRNA) and partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequences. The nucleotide sequences were analysed in order to determine the phylogenetic relationships between the isolates. Higher sequence diversity and intraspecies variation was observed in the cox1 gene compared to 18S rRNA sequences. Phylogenetic analysis of the cox1 gene placed all L. serrata isolates in a sister clade to L. arctica. The Mantel regression analysis revealed no association between genetic variations and host species or geographical location, perhaps due to the small sample size. However, genetic variations between L. serrata isolates in Iran and those isolated in other parts of the world may exist and could reveal possible evolutionary relationships. PMID:27149706

  8. Relationships between parasitoid wasps (Hymenoptera: Braconidae: Opiinae), fruit flies (Diptera: Tephritidae) and their host plants based on 16S rRNA, 12S rRNA, and ND1 gene sequences

    NASA Astrophysics Data System (ADS)

    Ibrahim, N. J.; Md-Zain, B. M.; Yaakop, S.


    Opiinae is among the l0 largest subfamilies under the family Braconidae. Opiines species have great potential as natural enemies against fruit fly pests. Before using them as a biological control agent, construction of the phylogenetic trees could facilitate in the molecular identification of individual species and their relationships among members of the Opiines, as well as between Opiines and their host plants. Larval specimens of tephritids were collected from four crop species at five localities throughout the Peninsular Malaysia. A total of 44 specimens of opiines had successfully emerged from the hosts, fruit fly larvae. The DNA sequences of 12S and 16S rRNA were obtained for the braconids while the mitochondrial ND1 sequences were obtained for the tephritids species through polymerase chain reaction. Maximum Parsimony and Bayesian trees were constructed by using PAUP 4.0b10 and MrBayes 3.1.2 to identify the relationships among the taxa. This study illustrates the phylogenetic relationships among parasitoid opiines collected and reared from parasitized fruit flies. The phylogenetic trees constructed based on the mitochondrial 12S and 16S rRNA sequences exhibited similar topology and sequence divergence. The opiines were divided into several clades and subclades according to the genus and species. Each clade also was supported by the similar host plants with high support values. However, their pests were not specific, except for Bactrocera cucurbitae. This study has reconfirmed the associations between Opiinae, tephritids, and host plants based on molecular data.

  9. Comparison of bacterial communities in the Solimões and Negro River tributaries of the Amazon River based on small subunit rRNA gene sequences.


    Peixoto, J C C; Leomil, L; Souza, J V; Peixoto, F B S; Astolfi-Filho, S


    The microbiota of the Amazon River basin has been little studied. We compared the structure of bacterial communities of the Solimões and Negro Rivers, the main Amazon River tributaries, based on analysis of 16S rRNA gene sequences. Water was sampled with a 3-L Van Dorn collection bottle; samples were collected at nine different points/depths totaling 27 L of water from each river. Total DNA was extracted from biomass retained by a 0.22-μm filter after sequential filtration of the water through 0.8- and 0.22-μm filters. The 16S rRNA gene was amplified by PCR, cloned and sequenced, and the sequences were analyzed with the PHYLIP and DOTUR programs to obtain the operational taxonomic units (OTUs) and to calculate the diversity and richness indices using the SPADE program. Taxonomic affiliation was determined using the naive Bayesian rRNA Classifier of the RDP II (Ribosomal Database Project). We recovered 158 sequences from the Solimões River grouped into 103 OTUs, and 197 sequences from the Negro River library grouped into 90 OTUs by the DOTUR program. The Solimões River was found to have a greater diversity of bacterial genera, and greater estimated richness of 446 OTUs, compared with 242 OTUs from the Negro River, as calculated by ACE estimator. The Negro River has less bacterial diversity, but more 16S rRNA gene sequences belonging to the bacterial genus Polynucleobacter were detected; 56 sequences from this genus were found (about 30% of the total sequences). We suggest that a more in-depth investigation be made to elucidate the role played by these bacteria in the river environment. These differences in bacterial diversity between Solimões and Negro Rivers could be explained by differences in organic matter content and pH of the rivers. PMID:22183948

  10. Extremely acidophilic protists from acid mine drainage host Rickettsiales-lineage endosymbionts that have intervening sequences in their 16S rRNA genes.


    Baker, Brett J; Hugenholtz, Philip; Dawson, Scott C; Banfield, Jillian F


    During a molecular phylogenetic survey of extremely acidic (pH < 1), metal-rich acid mine drainage habitats in the Richmond Mine at Iron Mountain, Calif., we detected 16S rRNA gene sequences of a novel bacterial group belonging to the order Rickettsiales in the Alphaproteobacteria. The closest known relatives of this group (92% 16S rRNA gene sequence identity) are endosymbionts of the protist Acanthamoeba. Oligonucleotide 16S rRNA probes were designed and used to observe members of this group within acidophilic protists. To improve visualization of eukaryotic populations in the acid mine drainage samples, broad-specificity probes for eukaryotes were redesigned and combined to highlight this component of the acid mine drainage community. Approximately 4% of protists in the acid mine drainage samples contained endosymbionts. Measurements of internal pH of the protists showed that their cytosol is close to neutral, indicating that the endosymbionts may be neutrophilic. The endosymbionts had a conserved 273-nucleotide intervening sequence (IVS) in variable region V1 of their 16S rRNA genes. The IVS does not match any sequence in current databases, but the predicted secondary structure forms well-defined stem loops. IVSs are uncommon in rRNA genes and appear to be confined to bacteria living in close association with eukaryotes. Based on the phylogenetic novelty of the endosymbiont sequences and initial culture-independent characterization, we propose the name "Candidatus Captivus acidiprotistae." To our knowledge, this is the first report of an endosymbiotic relationship in an extremely acidic habitat.

  11. Molecular epidemiology of Theileria annulata and identification of 18S rRNA gene and ITS regions sequences variants in apparently healthy buffaloes and cattle in Pakistan.


    Khan, Muhammad Kasib; He, Lan; Hussain, Altaf; Azam, Sabita; Zhang, Wen-Jie; Wang, Li-Xia; Zhang, Qing-Li; Hu, Min; Zhou, Yan-Qin; Zhao, Junlong


    A molecular epidemiological survey was conducted to determine the prevalence of piroplasms in buffaloes and cattle from Sheikhupura and Okara districts of Punjab, Pakistan using reverse line blot (RLB) hybridization assay. The genetic diversity within 18S rRNA gene and ITS regions sequences of various obtained Theileria species (spp.) was also investigated. Briefly, 102 blood samples from buffaloes and cattle in the study districts were collected on blood collection cards and brought to the laboratory. DNA was extracted; the V4 hypervariable region of 18S rRNA was amplified and analyzed using RLB. Out of total samples analyzed, 61 (59.8%) were hybridized with Babesia/Theileria (B/T) genus-specific probe. Only one species of piroplasm was detected in buffaloes and cattle in study districts, i.e. Theileria (T.) annulata. Six samples only hybridized with B/T genus-specific and Theileria genus-specific probes but not with any species-specific probe indicating the presence of novel species or variants. The sequences of 18S rRNA gene and ITS regions of these six samples revealed the presence of T. annulata variants as confirmed through sequence identity estimation and phylogenetic analyses. Meanwhile, an unexpected sequence variation was observed within the 18S rRNA gene and ITS regions sequences of T. annulata identified in the present study. This is the first report on the simultaneous detection of species of piroplasms infecting buffaloes and cattle in Pakistan and molecular characterization of T. annulata 18S rRNA gene and ITS regions. The present study may address the new insights into the epidemiology of theileriosis which will help researches in designing control strategies and developing various molecular diagnostic tools at national level.

  12. High-throughput 16S rRNA gene sequencing reveals alterations of mouse intestinal microbiota after radiotherapy.


    Kim, Young Suk; Kim, Jinu; Park, Soo-Je


    The mammalian gastrointestinal tract harbors a highly complex microbial community that comprises hundreds of different types of bacterial cells. The gastrointestinal microbiota plays an important role in the function of the host intestine. Most cancer patients undergoing pelvic irradiation experience side effects such as diarrhea; however, little is currently known about the effects of irradiation on the microorganisms colonizing the mucosal surfaces of the gastrointestinal tract. The aim of this study was to investigate the effects of gamma irradiation on the compositions of the large and small intestinal microbiotas. The gut microbiotas in control mice and mice receiving irradiation treatment were characterized by high-throughput sequencing of the bacterial 16S rRNA gene. Irradiation treatment induced significant alterations in the bacterial compositions of the large and small intestines at the genus level. Unexpectedly, irradiation treatment increased the number of operational taxonomic units in the small intestine but not the large intestine. In particular, irradiation treatment increased the level of the genera Alistipes in the large intestine and increased the level of the genus Corynebacterium in the small intestine. By contrast, compared with that in the corresponding control group, the level of the genera Prevotella was lower in the irradiated large intestine, and the level of the genera Alistipes was lower in the irradiated small intestine. Overall, the data presented here reveal the potential microbiological effects of pelvic irradiation on the gastrointestinal tracts of cancer patients.

  13. Major adaptive radiation in neritopsine gastropods estimated from 28S rRNA sequences and fossil records.


    Kano, Yasunori; Chiba, Satoshi; Kase, Tomoki


    A well-supported phylogeny of the Neritopsina, a gastropod superorder archaic in origin, radiated ecologically and diverse in morphology, is reconstructed based on partial 28S rRNA sequences. The result (Neritopsidae (Hydrocenidae (Helicinidae + Neritiliidae) (Neritidae + Phenacolepadidae))) is highly congruent with the fossil records and the character distribution of reproductive tracts in extant taxa. We suggest that the Neritopsina originated in subtidal shallow waters, invaded the land and became fully terrestrial at least three times in different clades, by the extinct Dawsonellidae in the Late Palaeozoic and by the Helicinidae and Hydrocenidae in the Mesozoic. Invasion of fresh- and brackish waters is prevalent among the Neritopsina as the Jurassic and freshwater ancestory is most probable for helicinids. The Phenacolepadidae, a group exclusively inhabiting dysoxic environments, colonized deep-sea hydrothermal vents and seeps in the Late Cretaceous or Early Cenozoic. Submarine caves have served as refuges for the archaic Neritopsidae since the Early to Middle Cenozoic, and the marine neritopsine slug Titiscania represents a highly specialized but relatively recent offshoot of this family. The Neritiliidae is another clade to be found utilizing submarine caves as shelter by the Oligocene; once adapted to the completely dark environment, but some neritiliids have immigrated to surface freshwater habitats. PMID:12495489

  14. Potential applications of next generation DNA sequencing of 16S rRNA gene amplicons in microbial water quality monitoring.


    Vierheilig, J; Savio, D; Ley, R E; Mach, R L; Farnleitner, A H; Reischer, G H


    The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multi-compartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems. PMID:26606090

  15. Potential applications of next generation DNA sequencing of 16S rRNA gene amplicons in microbial water quality monitoring.


    Vierheilig, J; Savio, D; Ley, R E; Mach, R L; Farnleitner, A H; Reischer, G H


    The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multi-compartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems.

  16. DNA-based classification and sequence heterogeneities in the 16S rRNA genes of Lactobacillus casei/paracasei and related species.


    Vásquez, Alejandra; Molin, Göran; Pettersson, Bertil; Antonsson, Martin; Ahrné, Siv


    The sequence differences within the 16S rRNA genes of Lactobacillus casei/paracasei and related species, Lactobacillus zeae and Lactobacillus rhamnosus, were investigated. Thirty-seven strains of mostly human or cheese origin were grouped by restriction endonuclease analysis (REA) of the total chromosomal DNA and by temporal temperature gradient gel electrophoresis (TTGE) of PCR-amplified 16S rRNA gene fragments. REA verified that all strains were genomically unique and singled out three major clusters, one L. rhamnosus-cluster and two clusters containing L. paracasei strains. The groups obtained by TTGE corresponded with one exception to the REA-clusters. In the TTGE clustering all L. paracasei strains formed one general group with one TTGE-band in common, and this group was sub-divided into five subgroups due to the presence of more than one TTGE-band in four of the subgroups. The occurrence of multiple TTGE-bands was investigated by amplifying and cloning of the 16S rRNA genes from the strains showing this phenomenon, thereby 12 clones from each strain were sequenced, demonstrating polymorphisms in almost all the cases. Subjecting the clones displaying sequence variations to TTGE as well as sequencing of 16S rDNA revealed by ribotyping of the strains, verified the presence of polymorphisms within the 16S rRNA genes. The migration characteristic of amplified DNA from a single clone corresponded to a specific band in the TTGE-pattern of the strain from which the clone originated. Southern blot hybridisation with a 16S rDNA probe demonstrated the presence of at least five 16S rRNA genes in L. casei/paracasei. A higher degree of variable positions than previously reported was observed in the 16S rRNA gene fragments of the members in the complex. Sequence comparison between the 16S rRNA gene copies of L. casei (CCUG 21451T) and L. zeae (CCUG 35515T) demonstrated that the two species shared almost the same sequence in some copies while the others were more different

  17. Identification of protein-coding sequences using the hybridization of 18S rRNA and mRNA during translation.


    Xing, Chuanhua; Bitzer, Donald L; Alexander, Winser E; Vouk, Mladen A; Stomp, Anne-Marie


    We introduce a new approach in this article to distinguish protein-coding sequences from non-coding sequences utilizing a period-3, free energy signal that arises from the interactions of the 3'-terminal nucleotides of the 18S rRNA with mRNA. We extracted the special features of the amplitude and the phase of the period-3 signal in protein-coding regions, which is not found in non-coding regions, and used them to distinguish protein-coding sequences from non-coding sequences. We tested on all the experimental genes from Saccharomyces cerevisiae and Schizosaccharomyces pombe. The identification was consistent with the corresponding information from GenBank, and produced better performance compared to existing methods that use a period-3 signal. The primary tests on some fly, mouse and human genes suggests that our method is applicable to higher eukaryotic genes. The tests on pseudogenes indicated that most pseudogenes have no period-3 signal. Some exploration of the 3'-tail of 18S rRNA and pattern analysis of protein-coding sequences supported further our assumption that the 3'-tail of 18S rRNA has a role of synchronization throughout translation elongation process. This, in turn, can be utilized for the identification of protein-coding sequences.

  18. Sequence and conservation of a rRNA and tRNAVal mitochondrial gene fragment from Penaeus californiensis and comparison with Penaeus vannamei and Penaeus stylirostris.


    Gutiérrez-Millán, Luis Enrique; Peregrino-Uriarte, Alma Beatriz; Sotelo-Mundo, Rogerio; Vargas-Albores, Francisco; Yepiz-Plascencia, Gloria


    Penaeus californiensis is an important species for shrimp fisheries in the Pacific Ocean and has recently been described as a potential cultured species, mainly through the winter season in subtropical regions. A fragment of the mitochondrial 12S rRNA-tRNAVal-16S rRNA genes from P. californiensis was sequenced and compared with the corresponding regions from Penaeus vannamei and Penaeus stylirostris. Purified mitochondrial DNA was used for polymerase chain reaction amplification with primers for 12S and 16S rRNA genes. A 1379 +/- 1-bp fragment was obtained, including 90% 16S rRNA, tRNAVal, and a portion of 12S rRNA, cloned, and sequenced. Genetic distances were calculated according to the Kimura 2-parameter distance model, and maximum-likelihood analysis was applied with 1000 bootstrap replications. Sequence identity of P. californiensis with both P. vannamei and P. stylirostris was 0.88, while for P. vannamei and P. stylirostris the identity was 0.92. Maximum-likelihood analysis grouped P. vannamei and P. stylirostris separately from P. californiensis.

  19. Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

    PubMed Central

    Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.


    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

  20. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.


    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  1. Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.


    Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C


    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

  2. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    PubMed Central

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  3. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.


    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

  4. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).


    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C


    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples.

  5. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.


    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  6. Identification of Theileria parva and Theileria sp. (buffalo) 18S rRNA gene sequence variants in the African Buffalo (Syncerus caffer) in southern Africa.


    Chaisi, Mamohale E; Sibeko, Kgomotso P; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C


    Theileria parva is the causative agent of Corridor disease in cattle in South Africa. The African buffalo (Syncerus caffer) is the reservoir host, and, as these animals are important for eco-tourism in South Africa, it is compulsory to test and certify them disease free prior to translocation. A T. parva-specific real-time polymerase chain reaction (PCR) test based on the small subunit ribosomal RNA (18S rRNA) gene is one of the tests used for the diagnosis of the parasite in buffalo and cattle in South Africa. However, because of the high similarity between the 18S rRNA gene sequences of T. parva and Theileria sp. (buffalo), the latter is also amplified by the real-time PCR primers, although it is not detected by the T. parva-specific hybridization probes. Preliminary sequencing studies have revealed a small number of sequence differences within the 18S rRNA gene in both species but the extent of this sequence variation is unknown. The aim of the current study was to sequence the 18S rRNA genes of T. parva and Theileria sp. (buffalo), and to determine whether all identified genotypes can be correctly detected by the real-time PCR assay. The reverse line blot (RLB) hybridization assay was used to identify T. parva and Theileria sp. (buffalo) positive samples from buffalo blood samples originating from the Kruger National Park, Hluhluwe-iMfolozi Park, the Greater Limpopo Transfrontier Park, and a private game ranch in the Hoedspruit area. T. parva and Theileria sp. (buffalo) were identified in 42% and 28%, respectively, of 252 samples, mainly as mixed infections. The full-length 18S rRNA gene of selected samples was amplified, cloned and sequenced. From a total of 20 sequences obtained, 10 grouped with previously published T. parva sequences from GenBank while 10 sequences grouped with a previously published Theileria sp. (buffalo) sequence. All these formed a monophyletic group with known pathogenic Theileria species. Our phylogenetic analyses confirm the

  7. Guidelines for interpretation of 16S rRNA gene sequence-based results for identification of medically important aerobic Gram-positive bacteria.


    Woo, Patrick C Y; Teng, Jade L L; Wu, Jeff K L; Leung, Fion P S; Tse, Herman; Fung, Ami M Y; Lau, Susanna K P; Yuen, Kwok-Yung


    This study is believed to be the first to provide guidelines for facilitating interpretation of results based on full and 527 bp 16S rRNA gene sequencing and MicroSeq databases used for identifying medically important aerobic Gram-positive bacteria. Overall, full and 527 bp 16S rRNA gene sequencing can identify 24 and 40 % of medically important Gram-positive cocci (GPC), and 21 and 34 % of medically important Gram-positive rods (GPR) confidently to the species level, whereas the full-MicroSeq and 500-MicroSeq databases can identify 15 and 34 % of medically important GPC and 14 and 25 % of medically important GPR confidently to the species level. Among staphylococci, streptococci, enterococci, mycobacteria, corynebacteria, nocardia and members of Bacillus and related taxa (Paenibacillus, Brevibacillus, Geobacillus and Virgibacillus), the methods and databases are least useful for identification of staphylococci and nocardia. Only 0-2 and 2-13 % of staphylococci, and 0 and 0-10 % of nocardia, can be confidently and doubtfully identified, respectively. However, these methods and databases are most useful for identification of Bacillus and related taxa, with 36-56 and 11-14 % of Bacillus and related taxa confidently and doubtfully identified, respectively. A total of 15 medically important GPC and 18 medically important GPR that should be confidently identified by full 16S rRNA gene sequencing are not included in the full-MicroSeq database. A total of 9 medically important GPC and 21 medically important GPR that should be confidently identified by 527 bp 16S rRNA gene sequencing are not included in the 500-MicroSeq database. 16S rRNA gene sequence results of Gram-positive bacteria should be interpreted with basic phenotypic tests results. Additional biochemical tests or sequencing of additional gene loci are often required for definitive identification. To improve the usefulness of the MicroSeq databases, bacterial species that can be confidently identified by 16S rRNA

  8. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.


    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho


    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters. PMID:27033205

  9. Role of Universal 16S rRNA Gene PCR and Sequencing in Diagnosis of Prosthetic Joint Infection

    PubMed Central

    Garcia-Lechuz, J. M.; Alonso, P.; Villanueva, M.; Alcalá, L.; Gimeno, M.; Cercenado, E.; Sánchez-Somolinos, M.; Radice, C.; Bouza, E.


    The etiological diagnosis of prosthetic joint infection (PJI) requires the isolation of microorganisms from periprosthetic samples. Microbiological cultures often yield false-positive and false-negative results. 16S rRNA gene PCR combined with sequencing (16SPCR) has proven useful for diagnosing various infections. We performed a prospective study to compare the utility of this approach with that of culture to diagnose PJI using intraoperative periprosthetic samples. We analyzed 176 samples from 40 patients with PJI and 321 samples from 82 noninfected patients using conventional culture and 16SPCR. Three statistical studies were undertaken following a previously validated mathematical model: sample-to-sample analysis, calculation of the number of samples to be studied, and calculation of the number of positive samples necessary to diagnose PJI. When only the number of positive samples is taken into consideration, a 16SPCR-positive result in one sample has good specificity and positive predictive value for PJI (specificity, 96.3%; positive predictive value, 91.7%; and likelihood ratio [LR], 22), while 3 positive cultures with the same microorganism are necessary to achieve similar specificity. The best combination of results for 16SPCR was observed when 5 samples were studied and the same microorganism was detected in 2 of them (sensitivity, 94%; specificity, 100%; and LR, 69.62). The results for 5 samples with 2 positive cultures were 96% and 82%, respectively, and the likelihood ratio was 1.06. 16SPCR is more specific and has a better positive predictive value than culture for diagnosis of PJI. A positive 16SPCR result is largely suggestive of PJI, even when few samples are analyzed; however, culture is generally more sensitive. PMID:22170934

  10. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.


    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho


    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters.

  11. Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

    PubMed Central

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo


    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

  12. 16S rRNA Gene Sequence-Based Identification of Bacteria in Automatically Incubated Blood Culture Materials from Tropical Sub-Saharan Africa

    PubMed Central

    Schwarz, Norbert Georg; Hahn, Andreas; Boahen, Kennedy; Sarpong, Nimako; Adu-Sarkodie, Yaw; Halbgewachs, Eva; Marks, Florian; von Kalckreuth, Vera; Poppert, Sven; Loderstaedt, Ulrike; May, Jürgen; Hagen, Ralf Matthias


    Background The quality of microbiological diagnostic procedures depends on pre-analytic conditions. We compared the results of 16S rRNA gene PCR and sequencing from automatically incubated blood culture materials from tropical Ghana with the results of cultural growth after automated incubation. Methods Real-time 16S rRNA gene PCR and subsequent sequencing were applied to 1500 retained blood culture samples of Ghanaian patients admitted to a hospital with an unknown febrile illness after enrichment by automated culture. Results Out of all 1500 samples, 191 were culture-positive and 98 isolates were considered etiologically relevant. Out of the 191 culture-positive samples, 16S rRNA gene PCR and sequencing led to concordant results in 65 cases at species level and an additional 62 cases at genus level. PCR was positive in further 360 out of 1309 culture-negative samples, sequencing results of which suggested etiologically relevant pathogen detections in 62 instances, detections of uncertain relevance in 50 instances, and DNA contamination due to sample preparation in 248 instances. In two instances, PCR failed to detect contaminants from the skin flora that were culturally detectable. Pre-analytical errors caused many Enterobacteriaceae to be missed by culture. Conclusions Potentially correctable pre-analytical conditions and not the fastidious nature of the bacteria caused most of the discrepancies. Although 16S rRNA gene PCR and sequencing in addition to culture led to an increase in detections of presumably etiologically relevant blood culture pathogens, the application of this procedure to samples from the tropics was hampered by a high contamination rate. Careful interpretation of diagnostic results is required. PMID:26270631

  13. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5' UTRs and its implications for eukaryotic gene translation regulation.


    Pánek, Josef; Kolár, Michal; Vohradský, Jirí; Shivaya Valásek, Leos


    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA-rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5' untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5' UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5' UTRs of mRNAs.

  14. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing.


    Zhou, Jiemin; Zhou, Xuemei; Li, Yuguang; Xing, Jianmin


    Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities.

  15. Bacterial characterization of Beijing drinking water by flow cytometry and MiSeq sequencing of the 16S rRNA gene.


    Liu, Tingting; Kong, Weiwen; Chen, Nan; Zhu, Jing; Wang, Jingqi; He, Xiaoqing; Jin, Yi


    Flow cytometry (FCM) and 16S rRNA gene sequencing data are commonly used to monitor and characterize microbial differences in drinking water distribution systems. In this study, to assess microbial differences in drinking water distribution systems, 12 water samples from different sources water (groundwater, GW; surface water, SW) were analyzed by FCM, heterotrophic plate count (HPC), and 16S rRNA gene sequencing. FCM intact cell concentrations varied from 2.2 × 10(3) cells/mL to 1.6 × 10(4) cells/mL in the network. Characteristics of each water sample were also observed by FCM fluorescence fingerprint analysis. 16S rRNA gene sequencing showed that Proteobacteria (76.9-42.3%) or Cyanobacteria (42.0-3.1%) was most abundant among samples. Proteobacteria were abundant in samples containing chlorine, indicating resistance to disinfection. Interestingly, Mycobacterium, Corynebacterium, and Pseudomonas, were detected in drinking water distribution systems. There was no evidence that these microorganisms represented a health concern through water consumption by the general population. However, they provided a health risk for special crowd, such as the elderly or infants, patients with burns and immune-compromised people exposed by drinking. The combined use of FCM to detect total bacteria concentrations and sequencing to determine the relative abundance of pathogenic bacteria resulted in the quantitative evaluation of drinking water distribution systems. Knowledge regarding the concentration of opportunistic pathogenic bacteria will be particularly useful for epidemiological studies.

  16. Identification of Clinically Relevant Fungi and Prototheca Species by rRNA Gene Sequencing and Multilocus PCR Coupled with Electrospray Ionization Mass Spectrometry

    PubMed Central

    Wang, Rui-Ying; Li, Li; Cao, Ya-Hui; Chen, Yan-Qiong; Zhao, Hua-Zhen; Zhang, Qiang-Qiang; Wu, Ji-Qin; Weng, Xin-Hua; Cheng, Xun-Jia; Zhu, Li-Ping


    Background Multilocus PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS) is a new strategy for pathogen identification, but information about its application in fungal identification remains sparse. Methods One-hundred and twelve strains and isolates of clinically important fungi and Prototheca species were subjected to both rRNA gene sequencing and PCR/ESI-MS. Three regions of the rRNA gene were used as targets for sequencing: the 5′ end of the large subunit rRNA gene (D1/D2 region), and the internal transcribed spacers 1 and 2 (ITS1 and ITS2 regions). Microbial identification (Micro ID), acquired by combining results of phenotypic methods and rRNA gene sequencing, was used to evaluate the results of PCR/ESI-MS. Results For identification of yeasts and filamentous fungi, combined sequencing of the three regions had the best performance (species-level identification rate of 93.8% and 81.8% respectively). The highest species-level identification rate was achieved by sequencing of D1/D2 for yeasts (92.2%) and ITS2 for filamentous fungi (75.8%). The two Prototheca species could be identified to species level by D1/D2 sequencing but not by ITS1 or ITS2. For the 102 strains and isolates within the coverage of PCR/ESI-MS identification, 87.3% (89/102) achieved species-level identification, 100% (89/89) of which were concordant to Micro ID on species/complex level. The species-level identification rates for yeasts and filamentous fungi were 93.9% (62/66) and 75% (27/36) respectively. Conclusions rRNA gene sequencing provides accurate identification information, with the best results obtained by a combination of ITS1, ITS2 and D1/D2 sequencing. Our preliminary data indicated that PCR/ESI-MS method also provides a rapid and accurate identification for many clinical relevant fungi. PMID:24835205

  17. Phylogenetic affinities of Diplonema within the Euglenozoa as inferred from the SSU rRNA gene and partial COI protein sequences.


    Maslov, D A; Yasuhira, S; Simpson, L


    In order to shed light on the phylogenetic position of diplonemids within the phylum Euglenozoa, we have sequenced small subunit rRNA (SSU rRNA) genes from Diplonema (syn. Isonema) papillatum and Diplonema sp. We have also analyzed a partial sequence of the mitochondrial gene for cytochrome c oxidase subunit I from D. papillatum. With both markers, the maximum likelihood method favored a closer grouping of diplonemids with kinetoplastids, while the parsimony and distance suggested a closer relationship of diplonemids with euglenoids. In each case, the differences between the best tree and the alternative trees were small. The frequency of codon usage in the partial D. papillatum COI was different from both related groups; however, as is the case in kinetoplastids but not in Euglena, both the non-canonical UGA codon and the canonical UGG codon were used to encode tryptophan in Diplonema. PMID:10724517

  18. PAGE analysis of the heteroduplexes formed between PCR-amplified 16S rRNA genes: estimation of sequence similarity and rDNA complexity.


    Espejo, R T; Feijóo, C G; Romero, J; Vásquez, M


    Analysis of the 16S rRNA genes retrieved directly from different environments has proven to be a powerful tool that has greatly expanded our knowledge of microbial diversity and phylogeny. It is shown here that sequence similarity between 80 and 100% among 16S rDNAs can be estimated by the electrophoretic migration of their heteroduplexes. This was measured by hybridization and electrophoresis in polyacrylamide gels of the product obtained after PCR amplification of almost the entire 16S rRNA gene from different bacterial species. These heteroduplexes were also observed after amplification of samples containing DNA from two or more bacterial species and a procedure was applied to identify reliably heteroduplexes among the amplification products. The electrophoretic migration of the heteroduplexes observed after PCR was used to detect the presence of 16S rDNAs with different sequences in DNA extracted from both a mixture of two bacterial species and samples containing a natural bacterial community.

  19. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species.


    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H


    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  20. Evaluation of nucleic acid sequence based amplification using fluorescence resonance energy transfer (FRET-NASBA) in quantitative detection of Aspergillus 18S rRNA.


    Park, Chulmin; Kwon, Eun-Young; Shin, Na-Young; Choi, Su-Mi; Kim, Si-Hyun; Park, Sun Hee; Lee, Dong-Gun; Choi, Jung-Hyun; Yoo, Jin-Hong


    We attempted to apply fluorescence resonance energy transfer technology to nucleic acid sequence-based amplification (FRET-NASBA) on the platform of the LightCycler system to detect Aspergillus species. Primers and probes for the Aspergillus 18S rRNA were newly designed to avoid overlapping with homologous sequences of human 18s rRNA. NASBA using molecular beacon (MB) showed non-specific results which have been frequently observed from controls, although it showed higher sensitivity (10(-2) amol) than the FRET. FRET-NASBA showed a sensitivity of 10(-1) amol and a high fidelity of reproducibility from controls. As FRET technology was successfully applied to the NASBA assay, it could contribute to diverse development of the NASBA assay. These results suggest that FRET-NASBA could replace previous NASBA techniques in the detection of Aspergillus.

  1. Characterization of the rDNA unit and sequence analysis of the small subunit rRNA and 5.8S rRNA genes from Tritrichomonas foetus.


    Chakrabarti, D; Dame, J B; Gutell, R R; Yowell, C A


    The ribosomal RNA gene unit of the protozoan parasite Tritrichomonas foetus has been cloned and analyzed. Southern blot analysis of the genomic DNA showed that the ribosomal RNA gene unit is organized as a tandem head to tail repeat with a unit length of 6 kb. By Northern analysis a primary transcript of 5.8 kb was detected. Copy number analysis showed the presence of 12 copies of the ribosomal RNA gene unit. The lengths of the small subunit ribosomal RNA and 5.8S ribosomal RNA are 1571 bp and 159 bp, respectively, as determined by sequence analysis. The T. foetus small subunit ribosomal RNA sequence is one of the shortest eukaryotic small subunit rRNA sequences, similar in length to those from 2 other amitochondrial protists. Although shorter than the majority of the eukaryotic small subunit ribosomal RNAs, this sequence maintains the primary and secondary structure common to all eukaryotic small subunit ribosomal RNA structures, while truncating sequences found within the eukaryotic variable regions. The length of the large subunit ribosomal RNA was measured at 2.5 kb.

  2. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T


    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  3. Identification of Bacteria in Formalin-Fixed, Paraffin-Embedded Heart Valve Tissue via 16S rRNA Gene Nucleotide Sequencing

    PubMed Central

    Imrit, Kavita; Goldfischer, Michael; Wang, Jie; Green, Jaime; Levine, Jerome; Lombardo, Joseph; Hong, Tao


    We applied 16S rRNA gene sequencing to identify bacterial species present in formalin-fixed, paraffin-embedded heart valve tissue. In 40% (12/30) of the cases, we were able to identify the bacterium to the species-genus level. For more recent cases (≤4 years), the success rate was significantly improved, to 70% (P < 0.001). PMID:16825394

  4. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

    PubMed Central

    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  5. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences. [Calyptogena magnifica; Bathymodiolus thermophilus; Lucinoma annulata; Lucinoma aequizonata; Codakia orbicularis

    SciTech Connect

    Distel, D.L.; Lane, D.J.; Olsen, G.J.; Giovannoni, S.J.; Pace, B.; Pace, N.R.; Stahl, D.A.; Felbeck, H.


    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis. Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species.

  6. Phylogenetic reconstruction of the wolf spiders (Araneae: Lycosidae) using sequences from the 12S rRNA, 28S rRNA, and NADH1 genes: implications for classification, biogeography, and the evolution of web building behavior.


    Murphy, Nicholas P; Framenau, Volker W; Donnellan, Stephen C; Harvey, Mark S; Park, Yung-Chul; Austin, Andrew D


    Current knowledge of the evolutionary relationships amongst the wolf spiders (Araneae: Lycosidae) is based on assessment of morphological similarity or phylogenetic analysis of a small number of taxa. In order to enhance the current understanding of lycosid relationships, phylogenies of 70 lycosid species were reconstructed by parsimony and Bayesian methods using three molecular markers; the mitochondrial genes 12S rRNA, NADH1, and the nuclear gene 28S rRNA. The resultant trees from the mitochondrial markers were used to assess the current taxonomic status of the Lycosidae and to assess the evolutionary history of sheet-web construction in the group. The results suggest that a number of genera are not monophyletic, including Lycosa, Arctosa, Alopecosa, and Artoria. At the subfamilial level, the status of Pardosinae needs to be re-assessed, and the position of a number of genera within their respective subfamilies is in doubt (e.g., Hippasa and Arctosa in Lycosinae and Xerolycosa, Aulonia and Hygrolycosa in Venoniinae). In addition, a major clade of strictly Australasian taxa may require the creation of a new subfamily. The analysis of sheet-web building in Lycosidae revealed that the interpretation of this trait as an ancestral state relies on two factors: (1) an asymmetrical model favoring the loss of sheet-webs and (2) that the suspended silken tube of Pirata is directly descended from sheet-web building. Paralogous copies of the nuclear 28S rRNA gene were sequenced, confounding the interpretation of the phylogenetic analysis and suggesting that a cautionary approach should be taken to the further use of this gene for lycosid phylogenetic analysis.

  7. High-throughput amplicon sequencing of rRNA genes requires a copy number correction to accurately reflect the effects of management practices on soil nematode community structure.


    Darby, B J; Todd, T C; Herman, M A


    Nematodes are abundant consumers in grassland soils, but more sensitive and specific methods of enumeration are needed to improve our understanding of how different nematode species affect, and are affected by, ecosystem processes. High-throughput amplicon sequencing is used to enumerate microbial and invertebrate communities at a high level of taxonomic resolution, but the method requires validation against traditional specimen-based morphological identifications. To investigate the consistency between these approaches, we enumerated nematodes from a 25-year field experiment using both morphological and molecular identification techniques in order to determine the long-term effects of annual burning and nitrogen enrichment on soil nematode communities. Family-level frequencies based on amplicon sequencing were not initially consistent with specimen-based counts, but correction for differences in rRNA gene copy number using a genetic algorithm improved quantitative accuracy. Multivariate analysis of corrected sequence-based abundances of nematode families was consistent with, but not identical to, analysis of specimen-based counts. In both cases, herbivores, fungivores and predator/omnivores generally were more abundant in burned than nonburned plots, while bacterivores generally were more abundant in nonburned or nitrogen-enriched plots. Discriminate analysis of sequence-based abundances identified putative indicator species representing each trophic group. We conclude that high-throughput amplicon sequencing can be a valuable method for characterizing nematode communities at high taxonomic resolution as long as rRNA gene copy number variation is accounted for and accurate sequence databases are available. PMID:24103081

  8. High-throughput amplicon sequencing of rRNA genes requires a copy number correction to accurately reflect the effects of management practices on soil nematode community structure.


    Darby, B J; Todd, T C; Herman, M A


    Nematodes are abundant consumers in grassland soils, but more sensitive and specific methods of enumeration are needed to improve our understanding of how different nematode species affect, and are affected by, ecosystem processes. High-throughput amplicon sequencing is used to enumerate microbial and invertebrate communities at a high level of taxonomic resolution, but the method requires validation against traditional specimen-based morphological identifications. To investigate the consistency between these approaches, we enumerated nematodes from a 25-year field experiment using both morphological and molecular identification techniques in order to determine the long-term effects of annual burning and nitrogen enrichment on soil nematode communities. Family-level frequencies based on amplicon sequencing were not initially consistent with specimen-based counts, but correction for differences in rRNA gene copy number using a genetic algorithm improved quantitative accuracy. Multivariate analysis of corrected sequence-based abundances of nematode families was consistent with, but not identical to, analysis of specimen-based counts. In both cases, herbivores, fungivores and predator/omnivores generally were more abundant in burned than nonburned plots, while bacterivores generally were more abundant in nonburned or nitrogen-enriched plots. Discriminate analysis of sequence-based abundances identified putative indicator species representing each trophic group. We conclude that high-throughput amplicon sequencing can be a valuable method for characterizing nematode communities at high taxonomic resolution as long as rRNA gene copy number variation is accounted for and accurate sequence databases are available.

  9. Genome sequencing and annotation of Aeromonas sp. HZM

    PubMed Central

    Chua, Patric; Har, Zi Mei; Austin, Christopher M.; Yule, Catherine M.; Dykes, Gary A.; Lee, Sui Mae


    We report the draft genome sequence of Aeromonas sp. strain HZM, isolated from tropical peat swamp forest soil. The draft genome size is 4,451,364 bp with a G + C content of 61.7% and contains 10 rRNA sequences (eight copies of 5S rRNA genes, single copy of 16S and 23S rRNA each). The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. JEMQ00000000. PMID:26484220

  10. Western immunoblot analysis of Haemobartonella muris and comparison of 16S rRNA gene sequences of H. muris, H. felis, and Eperythrozoon suis.

    PubMed Central

    Rikihisa, Y; Kawahara, M; Wen, B; Kociba, G; Fuerst, P; Kawamori, F; Suto, C; Shibata, S; Futohashi, M


    Infectious agents were isolated from the spleens of three wild mice (Apodemus argenteus) by intraperitoneal inoculation of the spleen homogenate into laboratory mice. The laboratory mice developed clinical signs and splenomegaly, and three isolates were maintained by passage in mice. Tetracyclines were effective in preventing infection of mice with these agents, but streptomycin and penicillin were ineffective. The agents did not grow in bacterial growth media or chicken embryos. In smears of blood from infected mice stained by the Giemsa or the indirect immunofluorescence method, numerous organisms were found on the surfaces of erythrocytes. Electron microscopy revealed cell wall-less pleomorphic cocci of 350 to 700 nm in diameter. On the basis of these results, the isolates were identified as Haemobartonella muris. There was no antigenic cross-reactivity with Rickettsia or Ehrlichia spp. or other related organisms. Western immunoblot analysis of three strains of H. muris with mouse antisera to H. muris revealed identical major antigens of 118, 65, 53, 45, and 40 kDa. By heteroduplex analysis of the three PCR-amplified segments of the 16S rRNA genes, the three strains of H. muris were found to be identical. The 16S rRNA genes of one of the H. muris strains, four strains of H. felis, and two strains of Eperythrozoon suis were sequenced and compared. The sequences of two strains of H. felis from cats in California were identical, as were the sequences of a strain from a cat in Ohio and a strain from a cat in Florida, but the similarity of sequences between the California and the Ohio-Florida strains was only 85%. The sequence of an H. muris strain was unique and was more closely related to that of the Ohio-Florida strain of H. felis (89%) than to that of the California strain of H. felis (84%). The sequence of E. suis from a pig in Illinois was identical to that from another pig from Taiwan. The similarity of the 16S rRNA gene sequence of E. suis with those of three

  11. Diversity and distribution of subterranean bacteria in groundwater at Oklo in Gabon, Africa, as determined by 16S rRNA gene sequencing.


    Pedersen, K; Arlinger, J; Hallbeck, L; Pettersson, C


    This paper describes how ground water was sampled, DNA extracted, amplified and cloned and how information available in the ribosomal 16S rRNA gene was used for mapping diversity and distribution of subterranean bacteria in groundwater at the Bangombé site in the Oklo region. The results showed that this site was inhabited by a diversified population of bacteria. Each borehole was dominated by species that did not dominate in any of the other boreholes; a result that probably reflects documented differences in the geochemical environment. Two of the sequences obtained were identified at genus level to represent Acinetobacter and Zoogloea, but most of the 44 sequences found were only distantly related to species in the DNA database. The deepest borehole, BAX01 (105 m), had the highest number of bacteria and also total organic carbon (TOC). This borehole harboured only Proteobacteria beta group sequences while sequences related to Proteobacteria beta, gamma and delta groups and Gram-positive bacteria were found in the other four boreholes. Two of the boreholes, BAX02 (34 m) and BAX04 (10 m) had many 16S rRNA gene sequences in common and also had similar counts of bacteria, content of TOC, pH and equal conductivity, suggesting a hydraulic connection between them.

  12. Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

    EPA Science Inventory

    Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

  13. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.


    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  14. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

    PubMed Central

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  15. Novel PCR primers for the archaeal phylum Thaumarchaeota designed based on the comparative analysis of 16S rRNA gene sequences.


    Hong, Jin-Kyung; Kim, Hye-Jin; Cho, Jae-Chang


    Based on comparative phylogenetic analysis of 16S rRNA gene sequences deposited in an RDP database, we constructed a local database of thaumarchaeotal 16S rRNA gene sequences and developed a novel PCR primer specific for the archaeal phylum Thaumarchaeota. Among 9,727 quality-filtered (chimeral-checked, size >1.2 kb) archaeal sequences downloaded from the RDP database, 1,549 thaumarchaeotal sequences were identified and included in our local database. In our study, Thaumarchaeota included archaeal groups MG-I, SAGMCG-I, SCG, FSCG, RC, and HWCG-III, forming a monophyletic group in the phylogenetic tree. Cluster analysis revealed 114 phylotypes for Thaumarchaeota. The majority of the phylotypes (66.7%) belonged to the MG-I and SCG, which together contained most (93.9%) of the thaumarchaeotal sequences in our local database. A phylum-directed primer was designed from a consensus sequence of the phylotype sequences, and the primer's specificity was evaluated for coverage and tolerance both in silico and empirically. The phylum-directed primer, designated THAUM-494, showed >90% coverage for Thaumarchaeota and <1% tolerance to non-target taxa, indicating high specificity. To validate this result experimentally, PCRs were performed with THAUM-494 in combination with a universal archaeal primer (ARC917R or 1017FAR) and DNAs from five environmental samples to construct clone libraries. THAUM-494 showed a satisfactory specificity in empirical studies, as expected from the in silico results. Phylogenetic analysis of 859 cloned sequences obtained from 10 clone libraries revealed that >95% of the amplified sequences belonged to Thaumarchaeota. The most frequently sampled thaumarchaeotal subgroups in our samples were SCG, MG-I, and SAGMCG-I. To our knowledge, THAUM-494 is the first phylum-level primer for Thaumarchaeota. Furthermore, the high coverage and low tolerance of THAUM-494 will make it a potentially valuable tool in understanding the phylogenetic diversity and

  16. Internal Transcribed Spacer rRNA Gene-Based Phylogenetic Reconstruction Using Algorithms with Local and Global Sequence Alignment for Black Yeasts and Their Relatives

    PubMed Central

    Caligiorne, R. B.; Licinio, P.; Dupont, J.; de Hoog, G. S.


    Sequences of rRNA gene internal transcribed spacer (ITS) of a standard set of black yeast-like fungal pathogens were compared using two methods: local and global alignments. The latter is based on DNA-walk divergence analysis. This method has become recently available as an algorithm (DNAWD program) which converts sequences into three-dimensional walks. The walks are compared with, or fit to, each other generating global alignments. The DNA-walk geometry defines a proper metric used to create a distance matrix appropriated for phylogenetic reconstruction. In this work, the analyses were carried out for species currently classified in Capronia, Cladophialophora, Exophiala, Fonsecaea, Phialophora, and Ramichloridium. Main groups were verified by small-subunit rRNA gene data. DNAWD applied to ITS2 alone enabled species recognition as well as phylogenetic reconstruction reflecting clades discriminated in small-subunit rRNA gene phylogeny, which was not possible with any other algorithm using local alignment for the same data set. It is concluded that DNAWD provides rapid insight into broader relationships between groups using genes that otherwise would be hardly usable for this purpose. PMID:15956403

  17. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.


    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi


    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area.

  18. Comparison of Sanger and next generation sequencing performance for genotyping Cryptosporidium isolates at the 18S rRNA and actin loci.


    Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M


    Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are

  19. Resistance to macrolides, lincosamides and streptogramin type B antibiotics due to a mutation in an rRNA operon of Streptomyces ambofaciens.

    PubMed Central

    Pernodet, J L; Boccard, F; Alegre, M T; Blondelet-Rouault, M H; Guérineau, M


    Streptomyces ambofaciens produces spiramycin, a macrolide antibiotic and expresses an inducible resistance to macrolides, lincosamides and streptogramin B antibiotics (MLS). From a mutant of S.ambofaciens exhibiting a constitutive MLS resistance phenotype a resistance determinant was cloned on a low copy number vector (pIJ61) through its expression in Streptomyces lividans. Further characterization has shown that this determinant corresponded to a mutant rRNA operon with a mutation in the 23S rRNA gene. In different organisms, mutations leading to MLS resistance have been located at a position corresponding to the adenine 2058 of Escherichia coli 23S rRNA. In the 23S rRNA from S.ambofaciens a similar position for the mutation has been postulated and DNA sequencing of this region has shown an adenine to guanine transition at a position corresponding to 2058. S.ambofaciens possesses four rRNA operons which we have cloned. In Streptomyces, contrary to other bacteria, a mutation in one among several rRNA operons confers a selectable MLS resistance phenotype. Possible reasons for this difference are discussed. Images PMID:2834204

  20. 16S rRNA sequences of Bartonella bacilliformis and cat scratch disease bacillus reveal phylogenetic relationships with the alpha-2 subgroup of the class Proteobacteria.

    PubMed Central

    O'Connor, S P; Dorsch, M; Steigerwalt, A G; Brenner, D J; Stackebrandt, E


    The primary structures of 16S rRNAs of Bartonella bacilliformis, an isolate of the cat scratch disease (CSD) bacillus, and a strain phenotypically similar to the CSD bacillus were determined by reverse transcriptase sequencing. These microorganisms were found to be members of the alpha-2 subgroup of the class Proteobacteria. The sequence from B. bacilliformis was most closely related to the rRNA of Rochalimaea quintana (91.7% homology), the etiologic agent of trench fever. The sequence from the isolate of the CSD bacillus showed the greatest homology with Brucella abortus (89.7%) and, when compared with oligonucleotide catalog data, formed a cluster with Rhodopseudomonas palustris, Pseudomonas carboxidovorans, Nitrobacter species, and Bradyrhizobium species. The 16S rRNA sequence was also determined for the Cleveland Clinic isolate, which was previously shown to be phenotypically similar to and approximately 30% related, by DNA hybridization, to the CSD bacillus. The Cleveland Clinic isolate was isolated from a patient not diagnosed with CSD. The rRNAs from these bacteria exhibited 98.2% homology, confirming that this isolate is a second species in the same genus as the CSD bacillus. Our data suggest that neither B. bacilliformis nor the CSD bacillus is the etiologic agent of bacillary epithelioid angiomatosis. PMID:1719021

  1. The genetic diversity of genus Bacillus and the related genera revealed by 16s rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    PubMed Central

    Cihan, Arzu Coleri; Tekin, Nilgun; Ozcan, Birgul; Cokmus, Cumhur


    Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%), the facultative thermophiles (14%) and the mesophiles (12%). These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16), Brevibacillus (13), Paenibacillus (1) and Thermoactinomycetes (2) were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4–100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6), B. lichenformis (3), B. subtilis (3), B. agri (3), B. smithii (2), T. vulgaris (2) and finally P. barengoltzii (1). In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies. PMID:24031834

  2. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.


    Stelzl, U; Spahn, C M; Nierhaus, K H


    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  3. Investigating microbial eukaryotic diversity from a global census: insights from a comparison of pyrotag and full-length sequences of 18S rRNA genes.


    Lie, Alle A Y; Liu, Zhenfeng; Hu, Sarah K; Jones, Adriane C; Kim, Diane Y; Countway, Peter D; Amaral-Zettler, Linda A; Cary, S Craig; Sherr, Evelyn B; Sherr, Barry F; Gast, Rebecca J; Caron, David A


    Next-generation DNA sequencing (NGS) approaches are rapidly surpassing Sanger sequencing for characterizing the diversity of natural microbial communities. Despite this rapid transition, few comparisons exist between Sanger sequences and the generally much shorter reads of NGS. Operational taxonomic units (OTUs) derived from full-length (Sanger sequencing) and pyrotag (454 sequencing of the V9 hypervariable region) sequences of 18S rRNA genes from 10 global samples were analyzed in order to compare the resulting protistan community structures and species richness. Pyrotag OTUs called at 98% sequence similarity yielded numbers of OTUs that were similar overall to those for full-length sequences when the latter were called at 97% similarity. Singleton OTUs strongly influenced estimates of species richness but not the higher-level taxonomic composition of the community. The pyrotag and full-length sequence data sets had slightly different taxonomic compositions of rhizarians, stramenopiles, cryptophytes, and haptophytes, but the two data sets had similarly high compositions of alveolates. Pyrotag-based OTUs were often derived from sequences that mapped to multiple full-length OTUs at 100% similarity. Thus, pyrotags sequenced from a single hypervariable region might not be appropriate for establishing protistan species-level OTUs. However, nonmetric multidimensional scaling plots constructed with the two data sets yielded similar clusters, indicating that beta diversity analysis results were similar for the Sanger and NGS sequences. Short pyrotag sequences can provide holistic assessments of protistan communities, although care must be taken in interpreting the results. The longer reads (>500 bp) that are now becoming available through NGS should provide powerful tools for assessing the diversity of microbial eukaryotic assemblages.

  4. Restriction Profiling of 23S Microheterogenic Ribosomal Repeats for Detection and Characterizing of E. coli and Their Clonal, Pathogenic, and Phylogroups

    PubMed Central

    Jayasree Rajagopalan Nair, Parvathi


    Correlating ribosomal microheterogenicity with unique restriction profiles can prove to be an efficacious and cost-effective approach compared with sequencing for microbial identification. An attempt to peruse restriction profiling of 23S ribosomal assemblage was ventured; digestion patterns with Bfa I discriminated E. coli from its colony morphovars, while Hae III profiles assisted in establishing distinct clonal groups. Among the gene pool of 399 ribosomal sequences extrapolated from 57 E. coli genomes, varying degree of predominance (I > III > IV > II) of Hae III pattern was observed. This was also corroborated in samples collected from clinical, commensal, and environmental origin. K-12 and its descendants showed type I pattern whereas E. coli-B and its descendants exhibited type IV, both of these patterns being exclusively present in E. coli. A near-possible association between phylogroups and Hae III profiles with presumable correlation between the clonal groups and different pathovars was established. The generic nature, conservation, and barcode gap of 23S rRNA gene make it an ideal choice and substitute to 16S rRNA gene, the most preferred region for molecular diagnostics in bacteria. PMID:26885397

  5. Restriction Profiling of 23S Microheterogenic Ribosomal Repeats for Detection and Characterizing of E. coli and Their Clonal, Pathogenic, and Phylogroups.


    Jayasree Rajagopalan Nair, Parvathi; Singh, Sunita


    Correlating ribosomal microheterogenicity with unique restriction profiles can prove to be an efficacious and cost-effective approach compared with sequencing for microbial identification. An attempt to peruse restriction profiling of 23S ribosomal assemblage was ventured; digestion patterns with Bfa I discriminated E. coli from its colony morphovars, while Hae III profiles assisted in establishing distinct clonal groups. Among the gene pool of 399 ribosomal sequences extrapolated from 57 E. coli genomes, varying degree of predominance (I > III > IV > II) of Hae III pattern was observed. This was also corroborated in samples collected from clinical, commensal, and environmental origin. K-12 and its descendants showed type I pattern whereas E. coli-B and its descendants exhibited type IV, both of these patterns being exclusively present in E. coli. A near-possible association between phylogroups and Hae III profiles with presumable correlation between the clonal groups and different pathovars was established. The generic nature, conservation, and barcode gap of 23S rRNA gene make it an ideal choice and substitute to 16S rRNA gene, the most preferred region for molecular diagnostics in bacteria. PMID:26885397

  6. Fresh-water planarias and a marine planaria are relatively dissimilar in the 5S rRNA sequences.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S; Takai, M


    The nucleotide sequences from fresh-water Dugesia japonica and marine Planocera reticulata have been determined. The similarity between these two species is only 69%. The Planocera sequence reveals nearly 80% similarity (72-81%) to the sequences of multicellular animals, while the Dugesia sequences are considerably different from them (66-73%).

  7. Characterization of Hafnia alvei by biochemical tests, random amplified polymorphic DNA PCR, and partial sequencing of 16S rRNA gene.

    PubMed Central

    Ridell, J; Siitonen, A; Paulin, L; Lindroos, O; Korkeala, H; Albert, M J


    Hafnia alvei strains which possess the attachment-effacement gene (eaeA) may have clinical importance as new diarrhea-causing pathogens and should therefore be differentiated from other H. alvei strains. We characterized diarrheal H. alvei strains, which were positive in the PCR test for the eaeA gene, using biochemical tests not routinely used for identification of members of the family Enterobacteriaceae, and compared them with eaeA-negative strains isolated from different clinical and nonclinical sources to find characteristics useful for identification. Random amplified polymorphic DNA (RAPD)-PCR and partial sequencing of the 16S rRNA gene were utilized to study the genetic diversity of the isolates. The eaeA-positive strains were found to have many characteristic biochemical properties. Negative reactions in the 2-ketogluconate and histidine assimilation tests and a positive reaction in the 3-hydroxybenzoate assimilation test may be useful in routine diagnostics. Nearly identical RAPD-PCR profiles and identical 353-bp fragments of the 16S rRNA genes indicated little genetic diversity among the eaeA-positive strains. The low level of homology (92%) in the partial 16S rRNA genes of eaeA-positive and -negative H. alvei strains raises questions about the taxonomic positioning of eaeA-positive H. alvei. PMID:7494030

  8. Comparative analyses of phenotypic methods and 16S rRNA, khe, rpoB genes sequencing for identification of clinical isolates of Klebsiella pneumoniae.


    He, Yanxia; Guo, Xianguang; Xiang, Shifei; Li, Jiao; Li, Xiaoqin; Xiang, Hui; He, Jinlei; Chen, Dali; Chen, Jianping


    The present work aimed to evaluate 16S rRNA, khe and rpoB gene sequencing for the identification of Klebsiella pneumoniae in comparison with phenotypic methods. Fifteen clinical isolates were examined, which were initially identified as K. pneumoniae subsp. pneumoniae using the automated VITEK 32 system in two hospitals in Enshi City, China. Their identity was further supported by conventional phenotypic methods on the basis of morphological and biochemical characteristics. Using Bayesian phylogenetic analyses and haplotypes network reconstruction, 13 isolates were identified as K. pneumoniae, whereas the other two isolates (K19, K24) were classified as Shigella sp. and Enterobacter sp., respectively. Of the three genes, 16S rRNA and khe gene could discriminate the clinical isolates at the genus level, whereas rpoB could discriminate Klebsiella at the species and even subspecies level. Overall, the gene tree based on rpoB is more compatible with the currently accepted classification of Klebsiella than those based on 16S rRNA and khe genes, showing that rpoB can be a powerful tool for identification of K. pneumoniae isolates. Above all, our study challenges the utility of khe as a species-specific marker for identification of K. pneumoniae.

  9. Phylogenetic analysis of Histoplasma capsulatum based on partial sequence of the D1/D2 region of the 28S rRNA gene.


    Komori, Takashi; Sano, Ayako; Yarita, Kyoko; Kitagawa, Teruyuki; Kamei, Katsuhiko; Nishimura, Kazuko


    In order to confirm the phylogenetic relationships of Histoplasma capsulatum, the partial sequences of large subunit (28S) ribosomal gene (D1/D2 region) of 49 isolates were studied. The similarity values of the 49 isolates were more than 99.0% across 617 base pairs, however, the 49 isolates were divided into 9 groups. These 9 groups were independent of 3 varieties, var. capsulatum, var. farciminosum and var. duboisii. These results showed that analysis of the nucleotide sequence of the 28S rRNA gene was very effective for identification of H. capsulatum and that three varieties of H. capsulatum should be reclassified according to the phylogenetic relationship established from analysis of the D1/D2 region sequences. PMID:16282973

  10. Application of SmartGene IDNS software to partial 16S rRNA gene sequences for a diverse group of bacteria in a clinical laboratory.


    Simmon, Keith E; Croft, Ann C; Petti, Cathy A


    Laboratories often receive clinical isolates for bacterial identification that have ambiguous biochemical profiles by conventional testing. With the emergence of 16S rRNA gene sequencing as an identification tool, we evaluated the usefulness of SmartGene IDNS, a 16S rRNA sequence database and software program for microbial identification. Identification by conventional methods of a diverse group of bacterial clinical isolates was compared with gene sequences interrogated by the SmartGene and MicroSeq databases. Of 300 isolates, SmartGene identified 295 (98%) to the genus level and 262 (87%) to the species level, with 5 (2%) being inconclusive. MicroSeq identified 271 (90%) to the genus level and 223 (74%) to the species level, with 29 (10%) being inconclusive. SmartGene and MicroSeq agreed on the genus for 233 (78%) isolates and the species for 212 (71%) isolates. Conventional methods identified 291 (97%) isolates to the genus level and 208 (69%) to the species level, with 9 (3%) being inconclusive. SmartGene, MicroSeq, and conventional identifications agreed for 193 (64%) of the results. Twenty-seven microorganisms were not represented in MicroSeq, compared to only 2 not represented in SmartGene. Overall, SmartGene IDNS provides comprehensive and accurate identification of a diverse group of bacteria and has the added benefit of being a user-friendly program that can be modified to meet the unique needs of clinical laboratories.

  11. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.


    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan


    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations.

  12. Phylogenetic relationships of Blepharisma americanum and Colpoda inflata within the phylum ciliophora inferred from complete small subunit rRNA gene sequences.


    Greenwood, S J; Schlegel, M; Sogin, M L; Lynn, D H


    The complete small subunit rRNA gene sequences of the heterotrich Blepharisma americanum and the colpodid Colpoda inflata were determined to be 1719 and 1786 nucleotides respectively. The phylogeny produced by comparisons with other ciliates indicated that C. inflata is allied more closely with the nassophoreans and oligohymenophoreans than the spirotrichs. This is consistent with the placement of the colpodids in the Class Copodea. Blepharisma americanum was not grouped with the hypotrichs but instead was placed as the earliest branching ciliate. The distinct separation of B. americanum supports the elevation to class status given the heterotrichs based on morphological characters.

  13. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.


    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan


    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff.

  14. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.


    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan


    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. PMID:23205499

  15. Molecular phylogenetic analysis of the coccidian cephalopod parasites Aggregata octopiana and Aggregata eberthi (Apicomplexa: Aggregatidae) from the NE Atlantic coast using 18S rRNA sequences.


    Castellanos-Martínez, Sheila; Pérez-Losada, Marcos; Gestal, Camino


    The coccidia genus Aggregata is responsible for intestinal coccidiosis in wild and cultivated cephalopods. Two coccidia species, Aggregata octopiana, (infecting the common octopus Octopus vulgaris), and A. eberthi, (infecting the cuttlefish Sepia officinalis), are identified in European waters. Extensive investigation of their morphology resulted in a redescription of A. octopiana in octopuses from the NE Atlantic Coast (NW Spain) thus clarifying confusing descriptions recorded in the past. The present study sequenced the 18S rRNA gene in A. octopiana and A. eberthi from the NE Atlantic coast in order to assess their taxonomic and phylogenetic status. Phylogenetic analyses revealed conspecific genetic differences (2.5%) in 18S rRNA sequences between A. eberthi from the Ria of Vigo (NW Spain) and the Adriatic Sea. Larger congeneric differences (15.9%) were observed between A. octopiana samples from the same two areas, which suggest the existence of two species. Based on previous morphological evidence, host specificity data, and new molecular phylogenetic analyses, we suggest that A. octopiana from the Ria of Vigo is the valid type species.

  16. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.


    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J


    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. PMID:26454634

  17. Molecular characterisation of Mycoplasma hyorhinis isolated from pigs using pulsed-field gel electrophoresis and 16S rRNA sequencing.


    Yamaguti, Maurício; Oliveira, Rosângela C; Marques, Lucas M; Buzinhani, Melissa; Buim, Marcos R; Neto, Renata L; Guimarães, Ana Márcia S; Timenetsky, Jorge


    Economic loss in pig breeding is common due to respiratory disorders, and Mycoplasma hyopneumoniae and Mycoplasma hyorhinis, namely, are the most common infectious agents. The aim of this study is to recover these mollicutes and detect their genotypic variations by pulsed-field gel electrophoresis (PFGE) and sequencing the 16 s rRNA gene. One hundred and twenty-six swabs from tonsil and nasal mucus of pigs with respiratory disorders were analysed. A total of 78 lungs were sampled, as well as two trachea and two tonsils obtained from animals with respiratory disorder. A total of 59 isolates were obtained: 1 (1.70 per cent) of M hyopneumoniae, 2 (3.40 per cent) of Mycoplasma flocculare and 56 (94.90 per cent) of M hyorhinis. The PFGE for M hyorhinis showed 10 profiles with enzyme AvaI and 9 profiles with XhoI. A low polymorphism of the 16sRNS gene was detected in M hyorhinis isolates compared with the type strain in the GenBank. M hyorhinis isolates of different herds showed a large heterogenicity with enzymes AvaI and XhoI. The sequencing of the 16S rRNA gene allowed for analysing the interspecific and intraspecific variations of isolated mycoplasmas.

  18. Molecular characterisation of Mycoplasma hyorhinis isolated from pigs using pulsed-field gel electrophoresis and 16S rRNA sequencing

    PubMed Central

    Yamaguti, Maurício; Oliveira, Rosângela C; Marques, Lucas M; Buzinhani, Melissa; Buim, Marcos R; Neto, Renata L; Guimarães, Ana Márcia S; Timenetsky, Jorge


    Economic loss in pig breeding is common due to respiratory disorders, and Mycoplasma hyopneumoniae and Mycoplasma hyorhinis, namely, are the most common infectious agents. The aim of this study is to recover these mollicutes and detect their genotypic variations by pulsed-field gel electrophoresis (PFGE) and sequencing the 16 s rRNA gene. One hundred and twenty-six swabs from tonsil and nasal mucus of pigs with respiratory disorders were analysed. A total of 78 lungs were sampled, as well as two trachea and two tonsils obtained from animals with respiratory disorder. A total of 59 isolates were obtained: 1 (1.70 per cent) of M hyopneumoniae, 2 (3.40 per cent) of Mycoplasma flocculare and 56 (94.90 per cent) of M hyorhinis. The PFGE for M hyorhinis showed 10 profiles with enzyme AvaI and 9 profiles with XhoI. A low polymorphism of the 16sRNS gene was detected in M hyorhinis isolates compared with the type strain in the GenBank. M hyorhinis isolates of different herds showed a large heterogenicity with enzymes AvaI and XhoI. The sequencing of the 16S rRNA gene allowed for analysing the interspecific and intraspecific variations of isolated mycoplasmas. PMID:26688737

  19. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.


    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J


    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments.

  20. Soil Acidobacterial 16S rRNA Gene Sequences Reveal Subgroup Level Differences between Savanna-Like Cerrado and Atlantic Forest Brazilian Biomes

    PubMed Central

    Catão, Elisa C. P.; Lopes, Fabyano A. C.; Araújo, Janaína F.; de Castro, Alinne P.; Barreto, Cristine C.; Bustamante, Mercedes M. C.; Quirino, Betania F.; Krüger, Ricardo H.


    16S rRNA sequences from the phylum Acidobacteria have been commonly reported from soil microbial communities, including those from the Brazilian Savanna (Cerrado) and the Atlantic Forest biomes, two biomes that present contrasting characteristics of soil and vegetation. Using 16S rRNA sequences, the present work aimed to study acidobacterial diversity and distribution in soils of Cerrado savanna and two Atlantic forest sites. PCA and phylogenetic reconstruction showed that the acidobacterial communities found in “Mata de galeria” forest soil samples from the Cerrado biome have a tendency to separate from the other Cerrado vegetation microbial communities in the direction of those found in the Atlantic Forest, which is correlated with a high abundance of Acidobacteria subgroup 2 (GP2). Environmental conditions seem to promote a negative correlation between GP2 and subgroup 1 (GP1) abundance. Also GP2 is negatively correlated to pH, but positively correlated to high Al3+ concentrations. The Cerrado soil showed the lowest Acidobacteria richness and diversity indexes of OTUs at the species and subgroups levels when compared to Atlantic Forest soils. These results suggest specificity of acidobacterial subgroups to soils of different biomes and are a starting point to understand their ecological roles, a topic that needs to be further explored. PMID:25309599

  1. Identification and classification of seafood-borne pathogenic and spoilage bacteria: 16S rRNA sequencing versus MALDI-TOF MS fingerprinting.


    Böhme, Karola; Fernández-No, Inmaculada C; Pazos, Manuel; Gallardo, José M; Barros-Velázquez, Jorge; Cañas, Benito; Calo-Mata, Pilar


    The present study aims to compare two molecular technologies, 16S rRNA sequencing and MALDI-TOF MS, for bacterial species identification in seafood. With this aim, 70 reference strains from culture collections, including important seafood-borne pathogenic and spoilage bacterial species, and 50 strains isolated from commercial seafood products, were analysed by both techniques. Genomic analysis only identified the species of 50% of the isolated strains, proving to be particularly poor at identifying members of the Pseudomonas and Bacillus genera. In contrast, MALDI-TOF MS fingerprinting identified 76% of the strains at the species level. The mass spectral data were submitted to the SpectraBank database (, making this information available to other researchers. Furthermore, cluster analysis of the peak mass lists was carried out with the web application SPECLUST and the calculated groupings were consistent with results determined by a phylogenetic approach that is based on the 16S rRNA sequences. However, the MALDI-TOF MS analysis demonstrated more discriminating potential that allowed for better classification, especially for the Pseudomonas and Bacillus genera. This is of importance with respect to the varying pathogenic and spoilage character at the intragenus and intraspecies level. In this sense, MALDI-TOF MS demonstrated to be a competent bacterial typing tool that extends phenotypic and genotypic approaches, allowing a more ample classification of bacterial strains.

  2. Identification of Raoultella terrigena as a Rare Causative Agent of Subungual Abscess Based on 16S rRNA and Housekeeping Gene Sequencing

    PubMed Central

    Wang, Yu; Jiang, Xiawei; Xu, Zemin; Ying, Chaoqun; Yu, Wei; Xiao, Yonghong


    A 63-year-old-man was admitted to our hospital with severe subungual abscess. Bacteria were isolated from pus samples, and an inconsistent identification was shown by VITEK 2 system and MALDI-TOF mass spectrometry as Raoultella planticola and Raoultella terrigena, respectively. Molecular identification by 16S rRNA sequencing suggested that the isolate is R. terrigena, and this was further demonstrated by sequencing three housekeeping genes (rpoB, gyrA, and parC) with phylogenetic analysis. To our knowledge, this is the first report of subungual abscess caused by R. terrigena, a rare case of human infection due to soil bacterium. Our study highlights the technique importance on this pathogen identification. PMID:27379169

  3. Identification of Raoultella terrigena as a Rare Causative Agent of Subungual Abscess Based on 16S rRNA and Housekeeping Gene Sequencing.


    Wang, Yu; Jiang, Xiawei; Xu, Zemin; Ying, Chaoqun; Yu, Wei; Xiao, Yonghong


    A 63-year-old-man was admitted to our hospital with severe subungual abscess. Bacteria were isolated from pus samples, and an inconsistent identification was shown by VITEK 2 system and MALDI-TOF mass spectrometry as Raoultella planticola and Raoultella terrigena, respectively. Molecular identification by 16S rRNA sequencing suggested that the isolate is R. terrigena, and this was further demonstrated by sequencing three housekeeping genes (rpoB, gyrA, and parC) with phylogenetic analysis. To our knowledge, this is the first report of subungual abscess caused by R. terrigena, a rare case of human infection due to soil bacterium. Our study highlights the technique importance on this pathogen identification.

  4. 16S rRNA Amplicon Sequencing Demonstrates that Indoor-Reared Bumblebees (Bombus terrestris) Harbor a Core Subset of Bacteria Normally Associated with the Wild Host

    PubMed Central

    Meeus, Ivan; Parmentier, Laurian; Billiet, Annelies; Maebe, Kevin; Van Nieuwerburgh, Filip; Deforce, Dieter; Wäckers, Felix; Vandamme, Peter; Smagghe, Guy


    A MiSeq multiplexed 16S rRNA amplicon sequencing of the gut microbiota of wild and indoor-reared Bombus terrestris (bumblebees) confirmed the presence of a core set of bacteria, which consisted of Neisseriaceae (Snodgrassella), Orbaceae (Gilliamella), Lactobacillaceae (Lactobacillus), and Bifidobacteriaceae (Bifidobacterium). In wild B. terrestris we detected several non-core bacteria having a more variable prevalence. Although Enterobacteriaceae are unreported by non next-generation sequencing studies, it can become a dominant gut resident. Furthermore the presence of some non-core lactobacilli were associated with the relative abundance of bifidobacteria. This association was not observed in indoor-reared bumblebees lacking the non-core bacteria, but having a more standardized microbiota compared to their wild counterparts. The impact of the bottleneck microbiota of indoor-reared bumblebees when they are used in the field for pollination purpose is discussed. PMID:25923917

  5. 16S rRNA Amplicon Sequencing Demonstrates that Indoor-Reared Bumblebees (Bombus terrestris) Harbor a Core Subset of Bacteria Normally Associated with the Wild Host.


    Meeus, Ivan; Parmentier, Laurian; Billiet, Annelies; Maebe, Kevin; Van Nieuwerburgh, Filip; Deforce, Dieter; Wäckers, Felix; Vandamme, Peter; Smagghe, Guy


    A MiSeq multiplexed 16S rRNA amplicon sequencing of the gut microbiota of wild and indoor-reared Bombus terrestris (bumblebees) confirmed the presence of a core set of bacteria, which consisted of Neisseriaceae (Snodgrassella), Orbaceae (Gilliamella), Lactobacillaceae (Lactobacillus), and Bifidobacteriaceae (Bifidobacterium). In wild B. terrestris we detected several non-core bacteria having a more variable prevalence. Although Enterobacteriaceae are unreported by non next-generation sequencing studies, it can become a dominant gut resident. Furthermore the presence of some non-core lactobacilli were associated with the relative abundance of bifidobacteria. This association was not observed in indoor-reared bumblebees lacking the non-core bacteria, but having a more standardized microbiota compared to their wild counterparts. The impact of the bottleneck microbiota of indoor-reared bumblebees when they are used in the field for pollination purpose is discussed.

  6. Intracellular diversity of the V4 and V9 regions of the 18S rRNA in marine protists (radiolarians) assessed by high-throughput sequencing.


    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric


    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment.

  7. High-throughput 16S rRNA gene sequencing reveals alterations of intestinal microbiota in myalgic encephalomyelitis/chronic fatigue syndrome patients.


    Frémont, Marc; Coomans, Danny; Massart, Sebastien; De Meirleir, Kenny


    Human intestinal microbiota plays an important role in the maintenance of host health by providing energy, nutrients, and immunological protection. Intestinal dysfunction is a frequent complaint in myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) patients, and previous reports suggest that dysbiosis, i.e. the overgrowth of abnormal populations of bacteria in the gut, is linked to the pathogenesis of the disease. We used high-throughput 16S rRNA gene sequencing to investigate the presence of specific alterations in the gut microbiota of ME/CFS patients from Belgium and Norway. 43 ME/CFS patients and 36 healthy controls were included in the study. Bacterial DNA was extracted from stool samples, PCR amplification was performed on 16S rRNA gene regions, and PCR amplicons were sequenced using Roche FLX 454 sequencer. The composition of the gut microbiota was found to differ between Belgian controls and Norwegian controls: Norwegians showed higher percentages of specific Firmicutes populations (Roseburia, Holdemania) and lower proportions of most Bacteroidetes genera. A highly significant separation could be achieved between Norwegian controls and Norwegian patients: patients presented increased proportions of Lactonifactor and Alistipes, as well as a decrease in several Firmicutes populations. In Belgian subjects the patient/control separation was less pronounced, however some abnormalities observed in Norwegian patients were also found in Belgian patients. These results show that intestinal microbiota is altered in ME/CFS. High-throughput sequencing is a useful tool to diagnose dysbiosis in patients and could help designing treatments based on gut microbiota modulation (antibiotics, pre and probiotics supplementation).

  8. Intracellular Diversity of the V4 and V9 Regions of the 18S rRNA in Marine Protists (Radiolarians) Assessed by High-Throughput Sequencing

    PubMed Central

    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric


    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment. PMID:25090095

  9. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae).


    Rosser, Thomas G; Griffin, Matt J; Quiniou, Sylvie M A; Khoo, Lester H; Pote, Linda M


    In the southeastern USA, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA (SSU rRNA) gene. However, only two of these have confirmed life cycles that involve the oligochaete Dero digitata as the definitive host. During a health screening of farm-raised channel catfish, several fish presented with deformed primary lamellae. Lamellae harbored large, nodular, white pseudocysts 1.25 mm in diameter, and upon rupturing, these pseudocysts released Henneguya myxospores, with a typical lanceolate-shaped spore body, measuring 17.1 ± 1.0 μm (mean ± SD; range = 15.0-19.3 μm) in length and 4.8 ± 0.4 μm (3.7-5.6 μm) in width. Pyriform-shaped polar capsules were 5.8 ± 0.3 μm in length (5.1-6.4 μm) and 1.7 ± 0.1 μm (1.4-1.9 μm) in width. The two caudal processes were 40.0 ± 5.1 μm in length (29.5-50.0 μm) with a spore length of 57.2 ± 4.7 (46.8-66.8 μm). The contiguous SSU rRNA gene sequence obtained from myxospores of five excised cysts did not match any Henneguya sp. in GenBank. The greatest sequence homology (91% over 1,900 bp) was with Henneguya pellis, associated with blister-like lesions on the skin of blue catfish Ictalurus furcatus. Based on the unique combination of pseudocyst and myxospore morphology, tissue location, host, and SSU rRNA gene sequence data, we report this isolate to be a previously unreported species, Henneguya bulbosus sp. nov.

  10. Evidence of two lineages of the symbiont 'Candidatus Erwinia dacicola' in Italian populations of Bactrocera oleae (Rossi) based on 16S rRNA gene sequences.


    Savio, Claudia; Mazzon, Luca; Martinez-Sañudo, Isabel; Simonato, Mauro; Squartini, Andrea; Girolami, Vincenzo


    The close association between the olive fly Bactrocera oleae (Rossi) (Diptera: Tephritidae) and bacteria has been known for more than a century. Recently, the presence of a host-specific, hereditary, unculturable symbiotic bacterium, designated 'Candidatus Erwinia dacicola', has been described inside the cephalic organ of the fly, called the oesophageal bulb. In the present study, the 16S rRNA gene sequence variability of 'Ca. E. dacicola' was examined within and between 26 Italian olive fly populations sampled across areas where olive trees occur in the wild and areas where cultivated olive trees have been introduced through history. The bacterial contents of the oesophageal bulbs of 314 olive flies were analysed and a minimum of 781 bp of the 16S rRNA gene was sequenced. The corresponding host fly genotype was assessed by sequencing a 776 bp portion of the mitochondrial genome. Two 'Ca. E. dacicola' haplotypes were found (htA and htB), one being slightly more prevalent than the other (57%). The two haplotypes did not co-exist in the same individuals, as confirmed by cloning. Interestingly, the olive fly populations of the two main Italian islands, Sicily and Sardinia, appeared to be represented exclusively by the htB and htA haplotypes, respectively, while peninsular populations showed both bacterial haplotypes in different proportions. No significant correlation emerged between the two symbiont haplotypes and the 16 host fly haplotypes observed, suggesting evidence for a mixed model of vertical and horizontal transmission of the symbiont during the fly life cycle.

  11. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    PubMed Central

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future. PMID:26404329

  12. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.


    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  13. U17/snR30 is a ubiquitous snoRNA with two conserved sequence motifs essential for 18S rRNA production.


    Atzorn, Vera; Fragapane, Paola; Kiss, Tamás


    Saccharomyces cerevisiae snR30 is an essential box H/ACA small nucleolar RNA (snoRNA) required for the processing of 18S rRNA. Here, we show that the previously characterized human, reptilian, amphibian, and fish U17 snoRNAs represent the vertebrate homologues of yeast snR30. We also demonstrate that U17/snR30 is present in the fission yeast Schizosaccharomyces pombe and the unicellular ciliated protozoan Tetrahymena thermophila. Evolutionary comparison revealed that the 3'-terminal hairpins of U17/snR30 snoRNAs contain two highly conserved sequence motifs, the m1 (AUAUUCCUA) and m2 (AAACCAU) elements. Mutation analysis of yeast snR30 demonstrated that the m1 and m2 elements are essential for early cleavages of the 35S pre-rRNA and, consequently, for the production of mature 18S rRNA. The m1 and m2 motifs occupy the opposite strands of an internal loop structure, and they are located invariantly 7 nucleotides upstream from the ACA box of U17/snR30 snoRNAs. U17/snR30 is the first identified box H/ACA snoRNA that possesses an evolutionarily conserved role in the nucleolytic processing of eukaryotic pre-rRNA.

  14. Quantitative detection of previously characterized syntrophic bacteria in anaerobic wastewater treatment systems by sequence-specific rRNA cleavage method.


    Narihiro, Takashi; Terada, Takeshi; Ohashi, Akiko; Kamagata, Yoichi; Nakamura, Kazunori; Sekiguchi, Yuji


    Quantitative monitoring method of two important trophic groups of bacteria in methanogenic communities was established and applied to six different anaerobic processes. The method we employed was based upon our previous sequence-specific rRNA cleavage method that allows quantification of rRNA of target groups so that the populations reflecting in situ activity could be determined. We constructed a set of scissor probes targeting the Chloroflexi group known as 'semi-syntrophic' heterotrophic bacteria and fatty acid-oxidizing syntrophs to determine their relative abundance in the processes. By using the method, we found that several reactors harbored a large amount of organisms belonging to the phylum Chloroflexi accounting for up to 20% of the total prokaryotic populations. Propionate-oxidizing syntrophs, Syntrophobacter, Smithella and Pelotomaculum were also found to be significant comprising up to 3.9% of the total populations, but their distribution is highly dependent on the process examined. This is the first clear, non-PCR based quantitative evidence that those organisms play active roles under in situ methanogenic conditions.

  15. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGG)n sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata).


    Srikulnath, Kornsorn; Uno, Yoshinobu; Matsubara, Kazumi; Thongpan, Amara; Suputtitada, Saowanee; Apisitwanich, Somsak; Nishida, Chizuko; Matsuda, Yoichi


    Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGG)n sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGG)n sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGG)n sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  16. A molecular phylogeny of dinoflagellate protists (pyrrhophyta) inferred from the sequence of 24S rRNA divergent domains D1 and D8.


    Lenaers, G; Scholin, C; Bhaud, Y; Saint-Hilaire, D; Herzog, M


    The sequence of two divergent domains (D1 and D8) from dinoflagellate 24S large subunit rRNA was determined by primer extension using total RNA as template. Nucleotide sequence alignments over 401 bases have been analyzed in order to investigate phylogenetic relationships within this highly divergent and taxonomically controversial group of protists of the division Pyrrhophyta. Data are provided confirming that dinoflagellates represent a monophyletic group. For 11 out of the 13 investigated laboratory grown species, an additional domain (D2) could not be completely sequenced by reverse transcription because of a hidden break located near its 3'-terminus. Two sets of sequence alignments were used to infer dinoflagellate phylogeny. The first [199 nucleotides (nt)] included conservative sequences flanking the D1 and D8 divergent domains. It was used to reconstruct a broad evolutionary tree for the dinoflagellates, which was rooted using Tetrahymena thermophila as the outgroup. To confirm the tree topology, and mainly the branchings leading to closely related species, a second alignment (401 nt) was considered, which included the D1 and D8 variable sequences in addition to the more conserved flanking regions. Species that showed sequence similarities with other species lower than 60% on average (Knuc values higher than 0.550) were removed from this analysis. A coherent and convincing evolutionary pattern was obtained for the dinoflagellates, also confirmed by the position of the hidden break within the D2 domain, which appears to be group specific. The reconstructed phylogeny indicates that the early emergence of Oxyrrhis marina preceded that of most Peridiniales, a large order of thecate species, whereas the unarmored Gymnodiniales appeared more recently, along with members of the Prorocentrales characterized by two thecal plates. In addition, the emergence of heterotrophic species preceded that of photosynthetic species. These results provide new perspectives on

  17. Subfossil 16S rRNA gene sequences of green sulfur bacteria in the Black Sea and their implications for past photic zone anoxia.


    Manske, Ann K; Henssge, Uta; Glaeser, Jens; Overmann, Jörg


    The Black Sea is the largest extant anoxic water body on Earth. Its oxic-anoxic boundary is located at a depth of 100 m and is populated by a single phylotype of marine green sulfur bacteria. This organism, Chlorobium sp. strain BS-1, is extraordinarily low light adapted and can therefore serve as an indicator of deep photic zone anoxia (A. K. Manske, J. Glaeser, M. M. M. Kuypers, and J. Overmann, Appl. Environ. Microbiol. 71:8049-8060, 2005). In the present study, two sediment cores were retrieved from the bottom of the Black Sea at depths of 2,006 and 2,162 m and were analyzed for the presence of subfossil DNA sequences of BS-1 using ancient-DNA methodology. Using optimized cultivation media, viable cells of the BS-1 phylotype were detected only at the sediment surface and not in deeper layers. In contrast, green sulfur bacterial 16S rRNA gene fragments were amplified from all the sediment layers investigated, including turbidites. After separation by denaturing gradient gel electrophoresis and sequencing, 14 different sequence types were distinguished. The sequence of BS-1 represented only a minor fraction of the amplification products and was found in 6 of 22 and 4 of 26 samples from the 2,006- and 2,162-m stations, respectively. Besides the sequences of BS-1, three additional phylotypes of the marine clade of green sulfur bacteria were detected. However, the majority of sequences clustered with groups from freshwater habitats. Our results suggest that a considerable fraction of green sulfur bacterial chemofossils did not originate in a low-light marine chemocline environment and therefore were likely to have an allochthonous origin. Thus, analysis of subfossil DNA sequences permits a more differentiated interpretation and reconstruction of past environmental conditions if specific chemofossils of stenoec species, like Chlorobium sp. strain BS-1, are employed.

  18. DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure




    The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illuminamore » 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied.« less

  19. DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure

    SciTech Connect


    The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illumina 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied.

  20. Ultra-high-sensitivity stable-isotope probing of rRNA by high-throughput sequencing of isopycnic centrifugation gradients.


    Aoyagi, Tomo; Hanada, Satoshi; Itoh, Hideomi; Sato, Yuya; Ogata, Atsushi; Friedrich, Michael W; Kikuchi, Yoshitomo; Hori, Tomoyuki


    Stable isotope probing (SIP) of rRNA directly identifies microorganisms assimilating an isotopically labelled substrate. High-throughput DNA sequencing is available for label screening at high resolution and high sensitivity, yet its effectiveness and validity remain to be clarified. Here, we investigated whether the detection sensitivity of rRNA-SIP could be improved by using Illumina sequencing in place of terminal restriction fragment length polymorphism (T-RFLP) analysis. A dilution series of (13) C-labelled RNA from Escherichia coli (1-0.0001%) and unlabelled RNA from Bacillus subtilis was density separated and fractionated. Illumina sequencing of isopycnic centrifugation gradients was able to detect (13) C-labelled RNA in the heaviest fraction with a buoyant density of 1.798 g ml(-1) even at the mixing ratio of 0.001%, whereas the detection ability of T-RFLP was not lower than 0.5%. Quantitative reverse transcription polymerase chain reaction of the density-separated RNAs showed that (13) C-labelled RNAs at mixing ratios of 0.05-0.001% had definitely accumulated in the heaviest fraction. Consequently, high-throughput sequencing provided up to 500-fold higher sensitivity for screening of (13) C-labelled RNA than T-RFLP. Ultra-high-sensitivity rRNA-SIP represents a clear advance towards a more complete understanding of microbial ecosystem function, including the ecophysiology of rare microorganisms in various natural environments.

  1. A comprehensive benchmarking study of protocols and sequencing platforms for 16S rRNA community profiling


    Podar, Mircea; Shakya, Migun; D'Amore, Rosalinda; Ijaz, Umer Zeeshan; Schirmer, Melanie; Kenny, John G.; Gregory, Richard; Darby, Alistair C.; Quince, Christopher; Hall, Neil


    In the last 5 years, the rapid pace of innovations and improvements in sequencing technologies has completely changed the landscape of metagenomic and metagenetic experiments. Therefore, it is critical to benchmark the various methodologies for interrogating the composition of microbial communities, so that we can assess their strengths and limitations. Here, the most common phylogenetic marker for microbial community diversity studies is the 16S ribosomal RNA gene and in the last 10 years the field has moved from sequencing a small number of amplicons and samples to more complex studies where thousands of samples and multiple different gene regions aremore » interrogated.« less

  2. Genus Tetrastemma Ehrenberg, 1831 (Phylum Nemertea)--a natural group? Phylogenetic relationships inferred from partial 18S rRNA sequences.


    Strand, Malin; Sundberg, Per


    We investigated the monophyletic status of the hoplonemertean taxon Tetrastemma by reconstructing the phylogeny for 22 specimens assigned to this genus, together with another 25 specimens from closely related hoplonemertean genera. The phylogeny was based on partial 18S rRNA sequences using Bayesian and maximum likelihood analyses. The included Tetrastemma-species formed a well-supported clade, although the within-taxon relationships were unsettled. We conclude that the name Tetrastemma refers to a monophyletic taxon, but that it cannot be defined by morphological synapomorphies, and our results do not imply that all the over 100 species assigned to this genus belong to it. The results furthermore indicate that the genera Amphiporus and Emplectonema are non-monophyletic.

  3. Complete Sequences of Multidrug Resistance Plasmids Bearing rmtD1 and rmtD2 16S rRNA Methyltransferase Genes.


    Bueno, Maria Fernanda C; Francisco, Gabriela R; de Oliveira Garcia, Doroti; Doi, Yohei


    Complete nucleotide sequences were determined for two plasmids bearing rmtD group 16S rRNA methyltransferase genes. pKp64/11 was 78 kb in size, belonged to the IncL/M group, and harbored blaTEM-1b, sul1, qacEΔ1, dfrA22, and rmtD1 across two multidrug resistance regions (MRRs). pKp368/10 was 170 kb in size, belonged to the IncA/C group, and harbored acrB, sul1, qacEΔ1, ant(3″)-Ia, aac(6')-Ib, cat, rmtD2, and blaCTX-M-8 across three MRRs. The rmtD-containing regions shared a conserved motif, suggesting a common origin for the two rmtD alleles.

  4. Complete Sequences of Multidrug Resistance Plasmids Bearing rmtD1 and rmtD2 16S rRNA Methyltransferase Genes

    PubMed Central

    Bueno, Maria Fernanda C.; Francisco, Gabriela R.; de Oliveira Garcia, Doroti


    Complete nucleotide sequences were determined for two plasmids bearing rmtD group 16S rRNA methyltransferase genes. pKp64/11 was 78 kb in size, belonged to the IncL/M group, and harbored blaTEM-1b, sul1, qacEΔ1, dfrA22, and rmtD1 across two multidrug resistance regions (MRRs). pKp368/10 was 170 kb in size, belonged to the IncA/C group, and harbored acrB, sul1, qacEΔ1, ant(3″)-Ia, aac(6′)-Ib, cat, rmtD2, and blaCTX-M-8 across three MRRs. The rmtD-containing regions shared a conserved motif, suggesting a common origin for the two rmtD alleles. PMID:26729503

  5. Disseminated neoplastic cells in Mytilus trossulus: verification of host species origin by (16S-like) rRNA sequence comparison.


    Gee, A; Specht, J M; Kerk, D; Moore, J D; Drum, A S; Elston, R A


    Disseminated neoplasia is a leukemia-like disease that occurs in many species of bivalve molluscs worldwide, including the bay mussel (Mytilus trossulus). The etiology of the disease is undetermined, but an early report proposed that the anomalous bivalve cells were actually an invasive parasite rather than cancerous cells of host origin. Comparison of partial sequences of small subunit rRNA from normal and putative cancer cells was performed to resolve this issue. These studies showed a close phylogenetic relationship of the different forms of cancer cells to each other (similarity coefficient, 0.982), to the normal hemocytes (similarity coefficient, 0.990, 0.992), and to the oyster, Crassostrea virginica (similarity coefficient, 0.895-0.927). A large phylogenetic distance separates all 3 mussel hemocyte types from several representative protists (similarity coefficient, 0.702-0.761). These results indicate that the disseminated neoplastic cells in mussels are indeed proliferative host cells and not unicellular parasites.

  6. Diversity of endophytic bacteria in Malaysian plants as revealed by 16S rRNA encoding gene sequence based method of bacterial identification☆

    PubMed Central

    Loh, Chye Ying; Tan, Yin Yin; Rohani, Rahim; Weber, Jean-Frédéric F.; Bhore, Subhash Janardhan


    Bacterial endophytes do have several potential applications in pharmacy, medicine and agricultural biotech industry. The main objective of this study was to understand types of bacterial endophytes associated with dicotyledonous (dicot) and monocotyledonous (monocot) plant species. Isolation of the endophytic bacteria was performed using surface-sterilized various tissue samples, and identification of the endophytic bacterial isolates (EBIs) was completed using 16S rRNA encoding gene sequence similarity based method. In total, 996 EBIs were isolated and identified from 1055 samples of 31 monocot and 65 dicot plant species from Peninsular Malaysia. The 996 EBIs represented 71 different types of bacterial species. Twelve (12) out of 71 species are reported as endophytes for the first time. We conclude that diverse types of bacterial endophytes are associated with dicot and monocot plants, and could be useful in pharmacy, medicine and agricultural biotechnology for various potential applications. PMID:24396249

  7. Evaluation of composition and individual variability of rumen microbiota in yaks by 16S rRNA high-throughput sequencing technology.


    Guo, Wei; Li, Ying; Wang, Lizhi; Wang, Jiwen; Xu, Qin; Yan, Tianhai; Xue, Bai


    The Yak (Bos grunniens) is a unique species of ruminant animals that is important to agriculture of the Tibetan plateau, and has a complex intestinal microbial community. The objective of the present study was to characterize the composition and individual variability of microbiota in the rumen of yaks using 16S rRNA gene high-throughput sequencing technique. Rumen samples used in the present study were obtained from grazing adult male yaks (n = 6) in a commercial farm in Ganzi Autonomous Prefecture of Sichuan Province, China. Universal prokaryote primers were used to target the V4-V5 hypervariable region of 16S rRNA gene. A total of 7200 operational taxonomic units (OTUs) were obtained after sequence filtering and chimera removal. Within these OTUs, 0.56% belonged to Archaea (40 OTUs), 7.19% to unassigned species (518 OTUs), and the remaining OTUs (6642) in all samples were of bacterial origin. When examining the community structure of bacteria, we identified 23 phyla within 159 families after taxonomic summarization. Bacteroidetes and Firmicutes were the predominant phyla accounting for 39.68% (SD = 0.05) and 45.90% (SD = 0.06), respectively. Moreover, 3764 OTUs were identified as shared OTUs (i.e. represented in all yaks) and belonged to 35 genera, exhibiting highly variable abundance across individual samples. Phylogenetic placement of these genera across individual samples was examined. In addition, we evaluated the distance among the 6 rumen samples by adding taxon phylogeny using UniFrac, representing 24.1% of average distance. In summary, the current study reveals a shared rumen microbiome and phylogenetic lineage and presents novel information on composition and individual variability of the bacterial community in the rumen of yaks. PMID:25911445

  8. Microdiversity of deep-sea Bacillales isolated from Tyrrhenian sea sediments as revealed by ARISA, 16S rRNA gene sequencing and BOX-PCR fingerprinting.


    Ettoumi, Besma; Guesmi, Amel; Brusetti, Lorenzo; Borin, Sara; Najjari, Afef; Boudabous, Abdellatif; Cherif, Ameur


    With respect to their terrestrial relatives, marine Bacillales have not been sufficiently investigated. In this report, the diversity of deep-sea Bacillales, isolated from seamount and non-seamount stations at 3,425 to 3,580 m depth in the Tyrrhenian Sea, was investigated using PCR fingerprinting and 16S rRNA sequence analysis. The isolate collection (n=120) was de-replicated by automated ribosomal intergenic spacer analysis (ARISA), and phylogenetic diversity was analyzed by 16S rRNA gene sequencing of representatives of each ARISA haplotype (n=37). Phylogenetic analysis of isolates showed their affiliation to six different genera of low G+C% content Gram-positive Bacillales: Bacillus, Staphylococcus, Exiguobacterium, Paenibacillus, Lysinibacillus and Terribacillus. Bacillus was the dominant genus represented by the species B. licheniformis, B. pumilus, B. subtilis, B. amyloliquefaciens and B. firmus, typically isolated from marine sediments. The most abundant species in the collection was B. licheniformis (n=85), which showed seven distinct ARISA haplotypes with haplotype H8 being the most dominant since it was identified by 63 isolates. The application of BOX-PCR fingerprinting to the B. licheniformis sub-collection allowed their separation into five distinct BOX genotypes, suggesting a high level of intraspecies diversity among marine B. licheniformis strains. This species also exhibited distinct strain distribution between seamount and non-seamount stations and was shown to be highly prevalent in non-seamount stations. This study revealed the great microdiversity of marine Bacillales and contributes to understanding the biogeographic distribution of marine bacteria in deep-sea sediments.

  9. Phylogenetic relationships of Sarcocystis neurona of horses and opossums to other cyst-forming coccidia deduced from SSU rRNA gene sequences.


    Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S


    Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.

  10. Evaluation of four methods of assigning species and genus to medically important bacteria using 16S rRNA gene sequence analysis.


    Park, Geon; Jin, Won-Young; Jang, Sook-Jin; Kook, Joong-Ki; Choi, Ji Ae; Park, Gyun Cheol; Lee, Min-Jung; Park, Soon-Nang; Li, Xue Min; Cho, Seong-Sig; Jang, Chul Ho; Kang, Seong-Ho; Moon, Dae-Soo


    The four methods for assigning bacterial species are the Clinical and Laboratory Standards Institute (CLSI), modified CLSI (mCLSI), phylogenetic analysis (PA) and closest match (CM) methods, these are used to identify the genus and species using 16S rRNA gene sequence results. In this study, the results of identification by these four methods of 37 aerobic reference strains, 30 anaerobic reference strains, 15 Acinetobacter reference strains and 167 Acinetobacter clinical strains were compared. The rates of accurate identification to the species level using the CLSI, mCLSI, PA and CM methods were as follows: 24.3, 86.5, 86.5 and 89.2%, respectively, for the 37 aerobic reference strains; 73.3%, 96.7%, 90.0% and 93.3%, respectively, for the 30 anaerobic reference strains; 40.0%, 93.3%, 100% and 93.3%, respectively, for the 15 Acinetobacter reference strains; and 53.9%, 90.4%, 95.8% and 90.4%, respectively, for the 167 Acinetobacter clinical strains. The rates of accurate identification to the genus level using the CLSI, mCLSI, PA, and CM methods were as follows: 91.9%, 91.9%, 94.6% and 91.9%, respectively, for the 37 aerobic reference strains; 100%, 100%, 100% and 100%, respectively, for all of the 30 anaerobic reference strains, 15 Acinetobacter reference strains and the 167 Acinetobacter clinical strains. The mCLSI is the most practical and pragmatic method for identification of species based on 16S rRNA sequences for hospital, research or industry laboratories because it performs well and involves a simple procedure.

  11. Microdiversity of deep-sea Bacillales isolated from Tyrrhenian sea sediments as revealed by ARISA, 16S rRNA gene sequencing and BOX-PCR fingerprinting.


    Ettoumi, Besma; Guesmi, Amel; Brusetti, Lorenzo; Borin, Sara; Najjari, Afef; Boudabous, Abdellatif; Cherif, Ameur


    With respect to their terrestrial relatives, marine Bacillales have not been sufficiently investigated. In this report, the diversity of deep-sea Bacillales, isolated from seamount and non-seamount stations at 3,425 to 3,580 m depth in the Tyrrhenian Sea, was investigated using PCR fingerprinting and 16S rRNA sequence analysis. The isolate collection (n=120) was de-replicated by automated ribosomal intergenic spacer analysis (ARISA), and phylogenetic diversity was analyzed by 16S rRNA gene sequencing of representatives of each ARISA haplotype (n=37). Phylogenetic analysis of isolates showed their affiliation to six different genera of low G+C% content Gram-positive Bacillales: Bacillus, Staphylococcus, Exiguobacterium, Paenibacillus, Lysinibacillus and Terribacillus. Bacillus was the dominant genus represented by the species B. licheniformis, B. pumilus, B. subtilis, B. amyloliquefaciens and B. firmus, typically isolated from marine sediments. The most abundant species in the collection was B. licheniformis (n=85), which showed seven distinct ARISA haplotypes with haplotype H8 being the most dominant since it was identified by 63 isolates. The application of BOX-PCR fingerprinting to the B. licheniformis sub-collection allowed their separation into five distinct BOX genotypes, suggesting a high level of intraspecies diversity among marine B. licheniformis strains. This species also exhibited distinct strain distribution between seamount and non-seamount stations and was shown to be highly prevalent in non-seamount stations. This study revealed the great microdiversity of marine Bacillales and contributes to understanding the biogeographic distribution of marine bacteria in deep-sea sediments. PMID:24005887

  12. Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification

    PubMed Central

    Zucol, Franziska; Ammann, Roland A.; Berger, Christoph; Aebi, Christoph; Altwegg, Martin; Niggli, Felix K.; Nadal, David


    Here we determined the analytical sensitivities of broad-range real-time PCR-based assays employing one of three different genomic DNA extraction protocols in combination with one of three different primer pairs targeting the 16S rRNA gene to detect a panel of 22 bacterial species. DNA extraction protocol III, using lysozyme, lysostaphin, and proteinase K, followed by PCR with the primer pair Bak11W/Bak2, giving amplicons of 796 bp in length, showed the best overall sensitivity, detecting DNA of 82% of the strains investigated at concentrations of ≤102 CFU in water per reaction. DNA extraction protocols I and II, using less enzyme treatment, combined with other primer pairs giving shorter amplicons of 466 bp and 342 or 346 bp, respectively, were slightly more sensitive for the detection of gram-negative but less sensitive for the detection of gram-positive bacteria. The obstacle of detecting background DNA in blood samples spiked with bacteria was circumvented by introducing a broad-range hybridization probe, and this preserved the minimal detection limits observed in samples devoid of blood. Finally, sequencing of the amplicons generated using the primer pair Bak11W/Bak2 allowed species identification of the detected bacterial DNA. Thus, broad-spectrum PCR targeting the 16S rRNA gene in the quantitative real-time format can achieve an analytical sensitivity of 1 to 10 CFU per reaction in water, avoid detection of background DNA with the introduction of a broad-range probe, and generate amplicons that allow species identification of the detected bacterial DNA by sequencing. These prerequisites are important for its application to blood-containing patient samples. PMID:16891488

  13. The small subunit rRNA gene sequence of the chonotrich Chilodochona carcini Jankowski, 1973 confirms chonotrichs as a dysteriid-derived clade (Phyllopharyngea, Ciliophora).


    Lynn, Denis H


    The chonotrichs are sessile ciliated protozoa that are ectosymbiotic on the body parts of a variety of crustaceans. They have long been considered a separate group because their sessile habit has resulted in the evolution of a very divergent body form and reproductive strategy compared to free-living ciliates. In the mid-20th Century, the free-living dysteriid cyrtophorian ciliates were proposed as a potential sister clade because the chonotrich bud or daughter cell showed similarities during division morphogenesis (i.e. ontogeny) to these free-living dysteriids. A single small subunit (SSU) rRNA gene sequence is available for the chonotrich Isochona sp. However, its authenticity has recently been questioned, and the placement of this sequence within the dysteriid clade has added to this controversy. In this report, the SSUrRNA gene sequence of the chonotrich Chilodochona carcini, ectosymbiotic on the green crab Carcinus maenas, is provided. Topology testing of the SSUrRNA gene phylogeny, constructed by Bayesian Inference, robustly supports the sister-group relationship of Isochona sp. and Chilodochona carcini, the monophyly of these two chonotrichs, and the divergence of the chonotrich clade within the dysteriid clade.

  14. bioOTU: An Improved Method for Simultaneous Taxonomic Assignments and Operational Taxonomic Units Clustering of 16s rRNA Gene Sequences.


    Chen, Shi-Yi; Deng, Feilong; Huang, Ying; Jia, Xianbo; Liu, Yi-Ping; Lai, Song-Jia


    Clustering of 16s rRNA amplicon sequences into operational taxonomic units (OTUs) is the most common bioinformatics pipeline for investigating microbial community by high-throughput sequencing technologies. However, the existing algorithms of OTUs clustering still remain to be improved at reliability. Here we propose an improved method (bioOTU) that first assigns taxonomy to unique tags at genus level for separating the error-free sequences of known species in reference database from artifacts, and then cluster them into OTUs by different strategies. The remaining tags, which fail to be clustered in the previous step, are further subjected to independent OTUs clustering by the optimized algorithm of heuristic clustering. The performance tests on both mock and real communities revealed that bioOTU is powerful for recovering the underlying profiles at both microbial composition and abundance, and it also produces comparable or less number of OTUs in comparison with the prevailing tools of Mothur and UPARSE. The bioOTU is implemented in C and Python languages with source codes freely available on the GitHub repository.

  15. Sequence Diversity of the Intergenic Spacer Region of the rRNA Gene of Malassezia globosa Colonizing the Skin of Patients with Atopic Dermatitis and Healthy Individuals

    PubMed Central

    Sugita, Takashi; Kodama, Minako; Saito, Masuyoshi; Ito, Tomonobu; Kato, Yukihiko; Tsuboi, Ryoji; Nishikawa, Akemi


    The lipophilic yeast Malassezia globosa is one of the major constituents of the mycoflora of the skin of patients with atopic dermatitis (AD). We compared the genotypes of M. globosa colonizing the skin surface of 32 AD patients and 20 healthy individuals for polymorphism of the intergenic spacer (IGS) 1 region of the rRNA gene. Sequence analysis demonstrated that M. globosa was divided into four major groups, which corresponded to the sources of the samples, on the phylogenetic tree. Of the four groups, two were from AD patients and one was from healthy subjects. The remaining group included samples from both AD patients and healthy subjects. In addition, the IGS 1 region of M. globosa contained short sequence repeats: (CT)n, and (GT)n. The number of sequence repeats also differed between the IGS 1 of M. globosa from AD patients and that from healthy subjects. These findings suggest that a specific genotype of M. globosa may play a significant role in AD, although M. globosa commonly colonizes both AD patients and healthy subjects. PMID:12843037

  16. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.


    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  17. The small subunit rRNA gene sequence of the chonotrich Chilodochona carcini Jankowski, 1973 confirms chonotrichs as a dysteriid-derived clade (Phyllopharyngea, Ciliophora).


    Lynn, Denis H


    The chonotrichs are sessile ciliated protozoa that are ectosymbiotic on the body parts of a variety of crustaceans. They have long been considered a separate group because their sessile habit has resulted in the evolution of a very divergent body form and reproductive strategy compared to free-living ciliates. In the mid-20th Century, the free-living dysteriid cyrtophorian ciliates were proposed as a potential sister clade because the chonotrich bud or daughter cell showed similarities during division morphogenesis (i.e. ontogeny) to these free-living dysteriids. A single small subunit (SSU) rRNA gene sequence is available for the chonotrich Isochona sp. However, its authenticity has recently been questioned, and the placement of this sequence within the dysteriid clade has added to this controversy. In this report, the SSUrRNA gene sequence of the chonotrich Chilodochona carcini, ectosymbiotic on the green crab Carcinus maenas, is provided. Topology testing of the SSUrRNA gene phylogeny, constructed by Bayesian Inference, robustly supports the sister-group relationship of Isochona sp. and Chilodochona carcini, the monophyly of these two chonotrichs, and the divergence of the chonotrich clade within the dysteriid clade. PMID:27151876

  18. bioOTU: An Improved Method for Simultaneous Taxonomic Assignments and Operational Taxonomic Units Clustering of 16s rRNA Gene Sequences.


    Chen, Shi-Yi; Deng, Feilong; Huang, Ying; Jia, Xianbo; Liu, Yi-Ping; Lai, Song-Jia


    Clustering of 16s rRNA amplicon sequences into operational taxonomic units (OTUs) is the most common bioinformatics pipeline for investigating microbial community by high-throughput sequencing technologies. However, the existing algorithms of OTUs clustering still remain to be improved at reliability. Here we propose an improved method (bioOTU) that first assigns taxonomy to unique tags at genus level for separating the error-free sequences of known species in reference database from artifacts, and then cluster them into OTUs by different strategies. The remaining tags, which fail to be clustered in the previous step, are further subjected to independent OTUs clustering by the optimized algorithm of heuristic clustering. The performance tests on both mock and real communities revealed that bioOTU is powerful for recovering the underlying profiles at both microbial composition and abundance, and it also produces comparable or less number of OTUs in comparison with the prevailing tools of Mothur and UPARSE. The bioOTU is implemented in C and Python languages with source codes freely available on the GitHub repository. PMID:26950196

  19. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.


    Ishaq, Suzanne L; Wright, André-Denis G


    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen.

  20. Phylogenetic position of phylum Nemertini, inferred from 18S rRNA sequences: molecular data as a test of morphological character homology.


    Turbeville, J M; Field, K G; Raff, R A


    Partial 18S rRNA sequence of the nemertine Cerebratulus lacteus was obtained and compared with those of coelomate metazoans and acoelomate platyhelminths to test whether nemertines share a most recent common ancestor with the platyhelminths, as traditionally has been implied, or whether nemertines lie within a protostome coelomate clade, as suggested by more recent morphological analyses. Maximum-parsimony analysis supports the inclusion of the nemertine within a protostome-coelomate clade that falls within a more inclusive coelomate clade. Bootstrap analysis indicates strong support for a monophyletic Coelomata composed of a deuterostome and protostome-coelomate clade. Support for a monophyletic protostome Coelomata is weak. Inference by distance analysis is consistent with that of maximum parsimony. Analysis of down-weighted paired sites by maximum parsimony reveals variation in topology only within the protostome-coelomate clade. The relationships among the protostome coelomates cannot be reliably inferred from the partial sequences, suggesting that coelomate protostomes diversified rapidly. Results with evolutionary parsimony are consistent with the inclusion of the nemertine in a coelomate clade. The molecular inference corroborates recent morphological character analyses that reveal no synapomorphies of nemertines and flatworms but instead suggest that the circulatory system and rhynchocoel of nemertines are homologous to coelomic cavities of protostome coelomates, thus supporting the corresponding hypothesis that nemertines belong within a protostome-coelomate clade. The sequence data provide an independent test of morphological character homology.

  1. Identification of Sarcocystis hominis-like (Protozoa: Sarcocystidae) cyst in water buffalo (Bubalus bubalis) based on 18S rRNA gene sequences.


    Yang, Z Q; Zuo, Y X; Ding, B; Chen, X W; Luo, J; Zhang, Y P


    DNA templates were extracted from isolates of Sarcocystis hominis-like cysts collected from cattle and water buffalo, as well as from Sarcocystis fusiformis cysts and Sarcocystis suihominis cysts. The 18S rRNA genes were amplified using DNA from a single cyst as the templates. Approximately 1,367-1,440 bp sequences were obtained. The sequence difference in isolates of Sarcocystis hominis-like cysts from water buffaloes, and isolates of S. hominis cysts from cattle were very low, only about 0.1%, much lower than the lowest value (1.7%) among different species. Combined with their morphological structure, these sequence data indicate that the 4 isolates from cattle and water buffalo might be the same species, i.e., S. hominis, suggesting that both cattle and water buffalo may serve as the intermediate hosts for this parasite. Apparently, this is the first report using a single cyst to do such work and is a useful way to distinguish the Sarcocystis cyst in an intermediate host that may be simultaneously infected by several different Sarcocystis species.

  2. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.


    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M


    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  3. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    SciTech Connect

    Medina, Monica; Collins, Allen G.; Silberman, Jeffrey; Sogin, Mitchell L.


    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny.

  4. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA.


    Medina, M; Collins, A G; Silberman, J D; Sogin, M L


    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of a monophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny.

  5. Anterior Foregut Microbiota of the Glassy-Winged Sharpshooter Explored Using Deep 16S rRNA Gene Sequencing from Individual Insects

    PubMed Central

    Rogers, Elizabeth E.; Backus, Elaine A.


    The glassy-winged sharpshooter (GWSS) is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium) of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony), were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia) and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas). Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the cibarium and

  6. Fluorescent Oligonucleotide Probes for Clinical and Environmental Detection of Acanthamoeba and the T4 18S rRNA Gene Sequence Type

    PubMed Central

    Stothard, Diane R.; Hay, John; Schroeder-Diedrich, Jill M.; Seal, David V.; Byers, Thomas J.


    The first genus- and subgenus-specific fluorescent oligonucleotide probes for in situ staining of Acanthamoeba are described. Sequences of these phylogeny-based probes complement the 18S rRNA and the gene encoding it (18S rDNA). The genus-specific probe (GSP) is a fluorescein-labeled 22-mer specific for Acanthamoeba as shown here by its hybridization to growing trophozoites of all 12 known Acanthamoeba 18S rDNA sequence types and by its failure to hybridize with amoebae of two other genera (Hartmannella vermiformis and Balamuthia mandrillaris), two human cell lines, and two bacteria (Pseudomonas aeruginosa and Escherichia coli). The sequence type T4-specific probe (ST4P) is a rhodamine-labeled 30-mer specific for Acanthamoeba 18S rDNA sequence type T4, as shown here in hybridization tests with trophozoites of all 12 sequence types. T4 is the subgenus group associated most closely with Acanthamoeba keratitis (AK). GSP also was tested with corneal scrapings from 17 patients with a high index of clinical suspicion of AK plus 5 patient controls. GSP stained both trophozoites and cysts, although nonspecific cyst wall autofluorescence also was observed. Results could be obtained with GSP in 1 to 2 days, and based on results from cell culture tests, the probe correctly detected the presence or absence of Acanthamoeba in 21 of 24 specimens from the 22 patients. The use of GSP with cultured trophozoites and cysts from corneal scrapings has illustrated the suitability of using fluorescent oligonucleotide probes for identification of the genus Acanthamoeba in both environmental and clinical samples. In addition, the use of ST4P with cultured amoebae has indicated the potential of oligonucleotide probes for use in subgenus classification. PMID:10405422

  7. Anterior foregut microbiota of the glassy-winged sharpshooter explored using deep 16S rRNA gene sequencing from individual insects.


    Rogers, Elizabeth E; Backus, Elaine A


    The glassy-winged sharpshooter (GWSS) is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium) of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony), were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia) and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas). Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the cibarium and

  8. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.


    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A


    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene.

  9. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.


    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A


    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. PMID:27084674

  10. RRNA and dnaK relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legume trees in Costa Rica.


    Parker, Matthew A


    Enzyme electrophoresis and sequencing of rRNA and dnaK genes revealed high genetic diversity among root nodule bacteria from the Costa Rican trees Andira inermis, Dalbergia retusa, Platymiscium pinnatum (Papilionoideae tribe Dalbergieae) and Lonchocarpus atropurpureus (Papilionoideae tribe Millettieae). A total of 21 distinct multilocus genotypes [ETs (electrophoretic types)] was found among the 36 isolates analyzed, and no ETs were shared in common by isolates from different legume hosts. However, three of the ETs from D. retusa were identical to Bradyrhizobium sp. isolates detected in prior studies of several other legume genera in both Costa Rica and Panama. Nearly full-length 16S rRNA sequences and partial 23S rRNA sequences confirmed that two isolates from D. retusa were highly similar or identical to Bradyrhizobium strains isolated from the legumes Erythrina and Clitoria (Papilionoideae tribe Phaseoleae) in Panama. rRNA sequences for five isolates from L. atropurpureus, P. pinnatum and A. inermis were not closely related to any currently known strains from Central America or elsewhere, but had affinities to the reference strains Bradyrhizobium japonicum USDA 110 (three isolates) or to B. elkanii USDA 76 (two isolates). A phylogenetic tree for 21 Bradyrhizobium strains based on 603 bp of the dnaK gene showed several significant conflicts with the rRNA tree, suggesting that genealogical relationships may have been altered by lateral gene transfer events. PMID:15214639

  11. Rumen bacterial diversity of 80 to 110-day-old goats using 16S rRNA sequencing.


    Han, Xufeng; Yang, Yuxin; Yan, Hailong; Wang, Xiaolong; Qu, Lei; Chen, Yulin


    The ability of rumen microorganisms to use fibrous plant matter plays an important role in ruminant animals; however, little information about rumen colonization by microbial populations after weaning has been reported. In this study, high-throughput sequencing was used to investigate the establishment of this microbial population in 80 to 110-day-old goats. Illumina sequencing of goat rumen samples yielded 101,356,610 nucleotides that were assembled into 256,868 reads with an average read length of 394 nucleotides. Taxonomic analysis of metagenomic reads indicated that the predominant phyla were distinct at different growth stages. The phyla Firmicutes and Synergistetes were predominant in samples taken from 80 to 100-day-old goats, but Bacteroidetes and Firmicutes became the most abundant phyla in samples from 110-day-old animals. There was a remarkable variation in the microbial populations with age; Firmicutes and Synergistetes decreased after weaning, but Bacteroidetes and Proteobacteria increased from 80 to 110 day of age. These findings suggested that colonization of the rumen by microorganisms is related to their function in the rumen digestive system. These results give a better understanding of the role of rumen microbes and the establishment of the microbial population, which help to maintain the host's health and improve animal performance.

  12. Rumen bacterial diversity of 80 to 110-day-old goats using 16S rRNA sequencing.


    Han, Xufeng; Yang, Yuxin; Yan, Hailong; Wang, Xiaolong; Qu, Lei; Chen, Yulin


    The ability of rumen microorganisms to use fibrous plant matter plays an important role in ruminant animals; however, little information about rumen colonization by microbial populations after weaning has been reported. In this study, high-throughput sequencing was used to investigate the establishment of this microbial population in 80 to 110-day-old goats. Illumina sequencing of goat rumen samples yielded 101,356,610 nucleotides that were assembled into 256,868 reads with an average read length of 394 nucleotides. Taxonomic analysis of metagenomic reads indicated that the predominant phyla were distinct at different growth stages. The phyla Firmicutes and Synergistetes were predominant in samples taken from 80 to 100-day-old goats, but Bacteroidetes and Firmicutes became the most abundant phyla in samples from 110-day-old animals. There was a remarkable variation in the microbial populations with age; Firmicutes and Synergistetes decreased after weaning, but Bacteroidetes and Proteobacteria increased from 80 to 110 day of age. These findings suggested that colonization of the rumen by microorganisms is related to their function in the rumen digestive system. These results give a better understanding of the role of rumen microbes and the establishment of the microbial population, which help to maintain the host's health and improve animal performance. PMID:25700157

  13. Comparison of restriction enzyme pattern analysis and full gene sequencing of 16S rRNA gene for Nocardia species identification, the first report of Nocardia transvalensis isolated of sputum from Iran, and review of the literature.


    Fatahi-Bafghi, Mehdi; Heidarieh, Parvin; Rasouli-Nasab, Masoumeh; Habibnia, Shadi; Hashemi-Shahraki, Abdorazagh; Eshraghi, Seyyed Saeed


    Nocardial infections occur in different organs of the body and are common in immune disorder diseases of individuals. The aim of this study was to assess Nocardia species identification by phenotypic tests and molecular techniques applied to nocardiosis in Iranian patients. In the current study, various clinical samples were collected and cultured on conventional media and using the paraffin baiting method. Various phenotypic tests were performed. For accurate identification at the species level, restriction fragment length polymorphisms (RFLP) in the hsp65 and partial 16S rRNA genes and full gene sequencing of the 16S rRNA gene were used. Twenty-seven Nocardia spp. were isolated and analysis of phenotypic tests results showed Nocardia asteroides complex, Nocardia otitidiscaviarum, Nocardia nova, and Nocardia spp. New RFLP patterns of Nocardia strains with hsp65 and partial 16S rRNA genes were obtained. Full gene sequencing of the 16S rRNA gene identified Nocardia cyriacigeorgica, N. otitidiscaviarum, Nocardia farcinica, Nocardia transvalensis, and N. nova. Nocardia infections are rarely reported and this genus is the cause of various illnesses. Accurate identification of Nocardia spp. is important for epidemiology studies and treatment. It should also be noted that some species may have similar RFLP patterns; therefore, full gene sequencing of the 16S rRNA gene is necessary for confirmation.

  14. Comparison of restriction enzyme pattern analysis and full gene sequencing of 16S rRNA gene for Nocardia species identification, the first report of Nocardia transvalensis isolated of sputum from Iran, and review of the literature.


    Fatahi-Bafghi, Mehdi; Heidarieh, Parvin; Rasouli-Nasab, Masoumeh; Habibnia, Shadi; Hashemi-Shahraki, Abdorazagh; Eshraghi, Seyyed Saeed


    Nocardial infections occur in different organs of the body and are common in immune disorder diseases of individuals. The aim of this study was to assess Nocardia species identification by phenotypic tests and molecular techniques applied to nocardiosis in Iranian patients. In the current study, various clinical samples were collected and cultured on conventional media and using the paraffin baiting method. Various phenotypic tests were performed. For accurate identification at the species level, restriction fragment length polymorphisms (RFLP) in the hsp65 and partial 16S rRNA genes and full gene sequencing of the 16S rRNA gene were used. Twenty-seven Nocardia spp. were isolated and analysis of phenotypic tests results showed Nocardia asteroides complex, Nocardia otitidiscaviarum, Nocardia nova, and Nocardia spp. New RFLP patterns of Nocardia strains with hsp65 and partial 16S rRNA genes were obtained. Full gene sequencing of the 16S rRNA gene identified Nocardia cyriacigeorgica, N. otitidiscaviarum, Nocardia farcinica, Nocardia transvalensis, and N. nova. Nocardia infections are rarely reported and this genus is the cause of various illnesses. Accurate identification of Nocardia spp. is important for epidemiology studies and treatment. It should also be noted that some species may have similar RFLP patterns; therefore, full gene sequencing of the 16S rRNA gene is necessary for confirmation. PMID:27613736

  15. Sulfur-inhibited Thermosphaera aggregans sp. nov., a new genus of hyperthermophilic archaea isolated after its prediction from environmentally derived 16S rRNA sequences.


    Huber, R; Dyba, D; Huber, H; Burggraf, S; Rachel, R


    Recently, a new procedure was developed which allowed for the first time the isolation of a hyperthermophilic archaeum tracked by 165 rRNA analysis from a terrestrial hot solfataric spring ('Obsidian Pool', Yellowstone National Park, WY, USA). This novel isolate is characterized here. Cells are round cocci with a diameter of 0.2-0.8 micron, occurring singly, in pairs, short chains and in grape-like aggregates. The aggregates exhibit a weak bluish-green fluorescence under UV radiation at 420 nm. The new isolate is an anaerobic obligate heterotroph, using preferentially yeast extract for growth. The metabolic products include CO2, H2, acetate and isovalerate. Growth is observed between 65 and 90 degrees C (optimum: 85 degrees C), from pH 5.0 to 7.0 (optimum: 6.5) and up to 0.7% NaCl. The apparent activation energy for growth is about 149 kJ mol-1. Elemental sulfur or hydrogen inhibits growth. The core lipids consist mainly of acyclic and cyclic glycerol diphytanyl tetraethers. The cell envelope contains a cytoplasmic membrane covered by an amorphous layer of unknown composition; there is no evidence for a regularly arrayed surface-layer protein. The G + C content is 46 mol%. On the basis of 165 rRNA sequence comparisons in combination with morphological, physiological and biochemical properties, the isolate represents a new genus within the Desulfurococcaceae, which has been named Thermosphaera. The type species is Thermosphaera aggregans, the type strain is isolate M11TLT (= DSM 11486T). PMID:9542073

  16. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua


    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  17. Sulfur-inhibited Thermosphaera aggregans sp. nov., a new genus of hyperthermophilic archaea isolated after its prediction from environmentally derived 16S rRNA sequences.


    Huber, R; Dyba, D; Huber, H; Burggraf, S; Rachel, R


    Recently, a new procedure was developed which allowed for the first time the isolation of a hyperthermophilic archaeum tracked by 165 rRNA analysis from a terrestrial hot solfataric spring ('Obsidian Pool', Yellowstone National Park, WY, USA). This novel isolate is characterized here. Cells are round cocci with a diameter of 0.2-0.8 micron, occurring singly, in pairs, short chains and in grape-like aggregates. The aggregates exhibit a weak bluish-green fluorescence under UV radiation at 420 nm. The new isolate is an anaerobic obligate heterotroph, using preferentially yeast extract for growth. The metabolic products include CO2, H2, acetate and isovalerate. Growth is observed between 65 and 90 degrees C (optimum: 85 degrees C), from pH 5.0 to 7.0 (optimum: 6.5) and up to 0.7% NaCl. The apparent activation energy for growth is about 149 kJ mol-1. Elemental sulfur or hydrogen inhibits growth. The core lipids consist mainly of acyclic and cyclic glycerol diphytanyl tetraethers. The cell envelope contains a cytoplasmic membrane covered by an amorphous layer of unknown composition; there is no evidence for a regularly arrayed surface-layer protein. The G + C content is 46 mol%. On the basis of 165 rRNA sequence comparisons in combination with morphological, physiological and biochemical properties, the isolate represents a new genus within the Desulfurococcaceae, which has been named Thermosphaera. The type species is Thermosphaera aggregans, the type strain is isolate M11TLT (= DSM 11486T).

  18. Phylogeny of 54 representative strains of species in the family Pasteurellaceae as determined by comparison of 16S rRNA sequences.

    PubMed Central

    Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J


    Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving

  19. Assignment of fatty acid-beta-oxidizing syntrophic bacteria to Syntrophomonadaceae fam. nov. on the basis of 16S rRNA sequence analyses

    NASA Technical Reports Server (NTRS)

    Zhao, H.; Yang, D.; Woese, C. R.; Bryant, M. P.


    After enrichment from Chinese rural anaerobic digestor sludge, anaerobic, sporing and nonsporing, saturated fatty acid-beta-oxidizing syntrophic bacteria were isolated as cocultures with H2- and formate-utilizing Methanospirillum hungatei or Desulfovibrio sp. strain G-11. The syntrophs degraded C4 to C8 saturated fatty acids, including isobutyrate and 2-methylbutyrate. They were adapted to grow on crotonate and were isolated as pure cultures. The crotonate-grown pure cultures alone did not grow on butyrate in either the presence or the absence of some common electron acceptors. However, when they were reconstituted with M. hungatei, growth on butyrate again occurred. In contrast, crotonate-grown Clostridium kluyveri and Clostridium sticklandii, as well as Clostridium sporogenes, failed to grow on butyrate when these organisms were cocultured with M. hungatei. The crotonate-grown pure subcultures of the syntrophs described above were subjected to 16S rRNA sequence analysis. Several previously documented fatty acid-beta-oxidizing syntrophs grown in pure cultures with crotonate were also subjected to comparative sequence analyses. The sequence analyses revealed that the new sporing and nonsporing isolates and other syntrophs that we sequenced, which had either gram-negative or gram-positive cell wall ultrastructure, all belonged to the phylogenetically gram-positive phylum. They were not closely related to any of the previously known subdivisions in the gram-positive phylum with which they were compared, but were closely related to each other, forming a new subdivision in the phylum. We recommend that this group be designated Syntrophomonadaceae fam. nov.; a description is given.

  20. Comparative Phylogenetic Assignment of Environmental Sequences of Genes Encoding 16S rRNA and Numerically Abundant Culturable Bacteria from an Anoxic Rice Paddy Soil

    PubMed Central

    Hengstmann, Ulf; Chin, Kuk-Jeong; Janssen, Peter H.; Liesack, Werner


    We used both cultivation and direct recovery of bacterial 16S rRNA gene (rDNA) sequences to investigate the structure of the bacterial community in anoxic rice paddy soil. Isolation and phenotypic characterization of 19 saccharolytic and cellulolytic strains are described in the accompanying paper (K.-J. Chin, D. Hahn, U. Hengstmann, W. Liesack, and P. H. Janssen, Appl. Environ. Microbiol. 65:5042–5049, 1999). Here we describe the phylogenetic positions of these strains in relation to 57 environmental 16S rDNA clone sequences. Close matches between the two data sets were obtained for isolates from the culturable populations determined by the most-probable-number counting method to be large (3 × 107 to 2.5 × 108 cells per g [dry weight] of soil). This included matches with 16S rDNA similarity values greater than 98% within distinct lineages of the division Verrucomicrobia (strain PB90-1) and the Cytophaga-Flavobacterium-Bacteroides group (strains XB45 and PB90-2), as well as matches with similarity values greater than 95% within distinct lines of descent of clostridial cluster XIVa (strain XB90) and the family Bacillaceae (strain SB45). In addition, close matches with similarity values greater than 95% were obtained for cloned 16S rDNA sequences and bacteria (strains DR1/8 and RPec1) isolated from the same type of rice paddy soil during previous investigations. The correspondence between culture methods and direct recovery of environmental 16S rDNA suggests that the isolates obtained are representative geno- and phenotypes of predominant bacterial groups which account for 5 to 52% of the total cells in the anoxic rice paddy soil. Furthermore, our findings clearly indicate that a dual approach results in a more objective view of the structural and functional composition of a soil bacterial community than either cultivation or direct recovery of 16S rDNA sequences alone. PMID:10543822

  1. Ultradeep 16S rRNA Sequencing Analysis of Geographically Similar but Diverse Unexplored Marine Samples Reveal Varied Bacterial Community Composition

    PubMed Central

    Karutha Pandian, Shunmugiah


    Background Bacterial community composition in the marine environment differs from one geographical location to another. Reports that delineate the bacterial diversity of different marine samples from geographically similar location are limited. The present study aims to understand whether the bacterial community compositions from different marine samples harbour similar bacterial diversity since these are geographically related to each other. Methods and Principal Findings In the present study, 16S rRNA deep sequencing analysis targeting V3 region was performed using Illumina bar coded sequencing. A total of 22.44 million paired end reads were obtained from the metagenomic DNA of Marine sediment, Rhizosphere sediment, Seawater and the epibacterial DNA of Seaweed and Seagrass. Diversity index analysis revealed that Marine sediment has the highest bacterial diversity and the least bacterial diversity was observed in Rhizosphere sediment. Proteobacteria, Actinobacteria and Bacteroidetes were the dominant taxa present in all the marine samples. Nearly 62–71% of rare species were identified in all the samples and most of these rare species were unique to a particular sample. Further taxonomic assignment at the phylum and genus level revealed that the bacterial community compositions differ among the samples. Conclusion This is the first report that supports the fact that, bacterial community composition is specific for specific samples irrespective of its similar geographical location. Existence of specific bacterial community for each sample may drive overall difference in bacterial structural composition of each sample. Further studies like whole metagenomic sequencing will throw more insights to the key stone players and its interconnecting metabolic pathways. In addition, this is one of the very few reports that depicts the unexplored bacterial diversity of marine samples (Marine sediment, Rhizosphere sediment, Seawater) and the host associated marine samples

  2. Fast evolving 18S rRNA sequences from Solenogastres (Mollusca) resist standard PCR amplification and give new insights into mollusk substitution rate heterogeneity

    PubMed Central


    Background The 18S rRNA gene is one of the most important molecular markers, used in diverse applications such as molecular phylogenetic analyses and biodiversity screening. The Mollusca is the second largest phylum within the animal kingdom and mollusks show an outstanding high diversity in body plans and ecological adaptations. Although an enormous amount of 18S data is available for higher mollusks, data on some early branching lineages are still limited. Despite of some partial success in obtaining these data from Solenogastres, by some regarded to be the most "basal" mollusks, this taxon still remained problematic due to contamination with food organisms and general amplification difficulties. Results We report here the first authentic 18S genes of three Solenogastres species (Mollusca), each possessing a unique sequence composition with regions conspicuously rich in guanine and cytosine. For these GC-rich regions we calculated strong secondary structures. The observed high intra-molecular forces hamper standard amplification and appear to increase formation of chimerical sequences caused by contaminating foreign DNAs from potential prey organisms. In our analyses, contamination was avoided by using RNA as a template. Indication for contamination of previously published Solenogastres sequences is presented. Detailed phylogenetic analyses were conducted using RNA specific models that account for compensatory substitutions in stem regions. Conclusions The extreme morphological diversity of mollusks is mirrored in the molecular 18S data and shows elevated substitution rates mainly in three higher taxa: true limpets (Patellogastropoda), Cephalopoda and Solenogastres. Our phylogenetic tree based on 123 species, including representatives of all mollusk classes, shows limited resolution at the class level but illustrates the pitfalls of artificial groupings formed due to shared biased sequence composition. PMID:20214780

  3. Phylogenetic analysis of Pasteurella multocida subspecies and molecular identification of feline P. multocida subsp. septica by 16S rRNA gene sequencing.


    Kuhnert, P; Boerlin, P; Emler, S; Krawinkler, M; Frey, J


    Pasteurella multocida is commonly found in the oral cavity of cats and dogs. In humans it is known as an opportunistic pathogen after bites from these animals. Phenotypic identification of P. multocida based on biochemical reactions is often limited and usually only done on a species level, even though 3 subspecies are described. For molecular taxonomy and diagnostic purposes a phylogenetic analysis of the three subspecies of P. multocida based on their 16S rRNA (rrs) gene sequence was therefore carried out. We found P. multocida subsp. septica on a distinguished branch on the phylogenetic tree of Pasteurellaceae, due to a 1.5% divergence of its rrs gene compared to the two other, more closely related subspecies multocida and gallicida. This phylogenetic divergence can be used for the identification of P. multocida subsp. septica by rrs gene determination since they form a phylogenetically well isolated and defined group as shown with a set of feline isolates. Comparison to routine phenotypic identification shows the advantage of the sequence-based identification over conventional methods. It is therefore helpful for future unambiguous identification and molecular taxonomy of P. multocida as well as for epidemiological investigations.

  4. Ancient specimens and DNA contamination: a case study from the 12S rRNA gene sequence of the "Linh Duong" bovid ( Pseudonovibos spiralis)

    NASA Astrophysics Data System (ADS)

    Hassanin, Alexandre


    In 1993, several unusual horn sheaths, collected in the South of Vietnam, were regarded as evidence for a new mammal species, Pseudonovibos spiralis. However, the taxonomic status of P. spiralis remains a highly controversial subject: firstly, it has been related to three different groups of the family Bovidae: Antilopini (gazelles), Bovini (oxen, bisons, and buffaloes), and Caprini sensu lato (goats, sheep and allies). Secondly, certain horns have been shown to be faked. Most recently, it has been suggested, on the basis of 12S rRNA gene sequences, that P. spiralis was a new species of buffalo. I demonstrate here that this conclusion was inaccurate, and base this on the grounds that: (1) the putative sequence of P. spiralis is shown to be a chimera obtained from three different species: Bos taurus, Bubalus bubalis and Saiga tatarica, and (2) several factors indicate that the specimen used was not authentic. This new study confirms earlier suggestions that the horns used to formally describe P. spiralis were bogus and were in fact derived from the horns of domesticated cattle ( Bos taurus). The data suggest that P. spiralis never existed.

  5. A heritability-based comparison of methods used to cluster 16S rRNA gene sequences into operational taxonomic units.


    Jackson, Matthew A; Bell, Jordana T; Spector, Tim D; Steves, Claire J


    A variety of methods are available to collapse 16S rRNA gene sequencing reads to the operational taxonomic units (OTUs) used in microbiome analyses. A number of studies have aimed to compare the quality of the resulting OTUs. However, in the absence of a standard method to define and enumerate the different taxa within a microbial community, existing comparisons have been unable to compare the ability of clustering methods to generate units that accurately represent functional taxonomic segregation. We have previously demonstrated heritability of the microbiome and we propose this as a measure of each methods' ability to generate OTUs representing biologically relevant units. Our approach assumes that OTUs that best represent the functional units interacting with the hosts' properties will produce the highest heritability estimates. Using 1,750 unselected individuals from the TwinsUK cohort, we compared 11 approaches to OTU clustering in heritability analyses. We find that de novo clustering methods produce more heritable OTUs than reference based approaches, with VSEARCH and SUMACLUST performing well. We also show that differences resulting from each clustering method are minimal once reads are collapsed by taxonomic assignment, although sample diversity estimates are clearly influenced by OTU clustering approach. These results should help the selection of sequence clustering methods in future microbiome studies, particularly for studies of human host-microbiome interactions. PMID:27635321

  6. Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing.


    Díez, B; Pedrós-Alió, C; Massana, R


    Very small eukaryotic organisms (picoeukaryotes) are fundamental components of marine planktonic systems, often accounting for a significant fraction of the biomass and activity in a system. Their identity, however, has remained elusive, since the small cells lack morphological features for identification. We determined the diversity of marine picoeukaryotes by sequencing cloned 18S rRNA genes in five genetic libraries from North Atlantic, Southern Ocean, and Mediterranean Sea surface waters. Picoplankton were obtained by filter size fractionation, a step that excluded most large eukaryotes and recovered most picoeukaryotes. Genetic libraries of eukaryotic ribosomal DNA were screened by restriction fragment length polymorphism analysis, and at least one clone of each operational taxonomic unit (OTU) was partially sequenced. In general, the phylogenetic diversity in each library was rather great, and each library included many different OTUs and members of very distantly related phylogenetic groups. Of 225 eukaryotic clones, 126 were affiliated with algal classes, especially the Prasinophyceae, the Prymnesiophyceae, the Bacillariophyceae, and the Dinophyceae. A minor fraction (27 clones) was affiliated with clearly heterotrophic organisms, such as ciliates, the chrysomonad Paraphysomonas, cercomonads, and fungi. There were two relatively abundant novel lineages, novel stramenopiles (53 clones) and novel alveolates (19 clones). These lineages are very different from any organism that has been isolated, suggesting that there are previously unknown picoeukaryotes. Prasinophytes and novel stramenopile clones were very abundant in all of the libraries analyzed. These findings underscore the importance of attempts to grow the small eukaryotic plankton in pure culture.

  7. Comparison of eukaryotic phytobenthic community composition in a polluted river by partial 18S rRNA gene cloning and sequencing.


    Dorigo, U; Bérard, A; Humbert, J F


    We compared the species composition in phytobenthic communities at different sampling sites in a small French river presenting polluted and unpolluted areas. For each sampling point, the total DNA was extracted and used to construct an 18S rRNA gene clone library after PCR amplification of a ca 400 bp fragment. Phytobenthic community composition was estimated by random sequencing of several clones per library. Most of the sequences corresponded to the Bacillariophyceae and Chlorophyceae groups. By combining phylogenetic and correspondence analyses, we showed that our molecular approach is able to estimate and compare the species composition at different sampling sites in order to assess the environmental impact of xenobiotics on phytobenthic communities. Changes in species composition of these communities were found, but no evident decrease in the diversity. We discuss the significance of these changes with regard to the existing level of pollution and their impact on the functionality of the ecosystem. Our findings suggest that it is now possible to use faster molecular methods (DGGE, ARISA.) to test large numbers of samples in the context of ecotoxicological studies, and thus to assess the impact of pollution in an aquatic ecosystem.

  8. Comparison of direct boiling method with commercial kits for extracting fecal microbiome DNA by Illumina sequencing of 16S rRNA tags.


    Peng, Xin; Yu, Ke-Qiang; Deng, Guan-Hua; Jiang, Yun-Xia; Wang, Yu; Zhang, Guo-Xia; Zhou, Hong-Wei


    Low cost and high throughput capacity are major advantages of using next generation sequencing (NGS) techniques to determine metagenomic 16S rRNA tag sequences. These methods have significantly changed our view of microorganisms in the fields of human health and environmental science. However, DNA extraction using commercial kits has shortcomings of high cost and time constraint. In the present study, we evaluated the determination of fecal microbiomes using a direct boiling method compared with 5 different commercial extraction methods, e.g., Qiagen and MO BIO kits. Principal coordinate analysis (PCoA) using UniFrac distances and clustering showed that direct boiling of a wide range of feces concentrations gave a similar pattern of bacterial communities as those obtained from most of the commercial kits, with the exception of the MO BIO method. Fecal concentration by boiling method affected the estimation of α-diversity indices, otherwise results were generally comparable between boiling and commercial methods. The operational taxonomic units (OTUs) determined through direct boiling showed highly consistent frequencies with those determined through most of the commercial methods. Even those for the MO BIO kit were also obtained by the direct boiling method with high confidence. The present study suggested that direct boiling could be used to determine the fecal microbiome and using this method would significantly reduce the cost and improve the efficiency of the sample preparation for studying gut microbiome diversity.

  9. A heritability-based comparison of methods used to cluster 16S rRNA gene sequences into operational taxonomic units

    PubMed Central

    Bell, Jordana T.; Spector, Tim D.; Steves, Claire J.


    A variety of methods are available to collapse 16S rRNA gene sequencing reads to the operational taxonomic units (OTUs) used in microbiome analyses. A number of studies have aimed to compare the quality of the resulting OTUs. However, in the absence of a standard method to define and enumerate the different taxa within a microbial community, existing comparisons have been unable to compare the ability of clustering methods to generate units that accurately represent functional taxonomic segregation. We have previously demonstrated heritability of the microbiome and we propose this as a measure of each methods’ ability to generate OTUs representing biologically relevant units. Our approach assumes that OTUs that best represent the functional units interacting with the hosts’ properties will produce the highest heritability estimates. Using 1,750 unselected individuals from the TwinsUK cohort, we compared 11 approaches to OTU clustering in heritability analyses. We find that de novo clustering methods produce more heritable OTUs than reference based approaches, with VSEARCH and SUMACLUST performing well. We also show that differences resulting from each clustering method are minimal once reads are collapsed by taxonomic assignment, although sample diversity estimates are clearly influenced by OTU clustering approach. These results should help the selection of sequence clustering methods in future microbiome studies, particularly for studies of human host-microbiome interactions. PMID:27635321

  10. Dynamic changes in the composition of photosynthetic picoeukaryotes in the northwestern Pacific Ocean revealed by high-throughput tag sequencing of plastid 16S rRNA genes.


    Choi, Dong H; An, Sung M; Chun, Sungjun; Yang, Eun C; Selph, Karen E; Lee, Charity M; Noh, Jae H


    Photosynthetic picoeukaryotes (PPEs) are major oceanic primary producers. However, the diversity of such communities remains poorly understood, especially in the northwestern (NW) Pacific. We investigated the abundance and diversity of PPEs, and recorded environmental variables, along a transect from the coast to the open Pacific Ocean. High-throughput tag sequencing (using the MiSeq system) revealed the diversity of plastid 16S rRNA genes. The dominant PPEs changed at the class level along the transect. Prymnesiophyceae were the only dominant PPEs in the warm pool of the NW Pacific, but Mamiellophyceae dominated in coastal waters of the East China Sea. Phylogenetically, most Prymnesiophyceae sequences could not be resolved at lower taxonomic levels because no close relatives have been cultured. Within the Mamiellophyceae, the genera Micromonas and Ostreococcus dominated in marginal coastal areas affected by open water, whereas Bathycoccus dominated in the lower euphotic depths of oligotrophic open waters. Cryptophyceae and Phaeocystis (of the Prymnesiophyceae) dominated in areas affected principally by coastal water. We also defined the biogeographical distributions of Chrysophyceae, prasinophytes, Bacillariophyceaea and Pelagophyceae. These distributions were influenced by temperature, salinity and chlorophyll a and nutrient concentrations. PMID:26712350

  11. A heritability-based comparison of methods used to cluster 16S rRNA gene sequences into operational taxonomic units

    PubMed Central

    Bell, Jordana T.; Spector, Tim D.; Steves, Claire J.


    A variety of methods are available to collapse 16S rRNA gene sequencing reads to the operational taxonomic units (OTUs) used in microbiome analyses. A number of studies have aimed to compare the quality of the resulting OTUs. However, in the absence of a standard method to define and enumerate the different taxa within a microbial community, existing comparisons have been unable to compare the ability of clustering methods to generate units that accurately represent functional taxonomic segregation. We have previously demonstrated heritability of the microbiome and we propose this as a measure of each methods’ ability to generate OTUs representing biologically relevant units. Our approach assumes that OTUs that best represent the functional units interacting with the hosts’ properties will produce the highest heritability estimates. Using 1,750 unselected individuals from the TwinsUK cohort, we compared 11 approaches to OTU clustering in heritability analyses. We find that de novo clustering methods produce more heritable OTUs than reference based approaches, with VSEARCH and SUMACLUST performing well. We also show that differences resulting from each clustering method are minimal once reads are collapsed by taxonomic assignment, although sample diversity estimates are clearly influenced by OTU clustering approach. These results should help the selection of sequence clustering methods in future microbiome studies, particularly for studies of human host-microbiome interactions.

  12. Ancient specimens and DNA contamination: a case study from the 12S rRNA gene sequence of the "Linh Duong" bovid (Pseudonovibos spiralis).


    Hassanin, Alexandre


    In 1993, several unusual horn sheaths, collected in the South of Vietnam, were regarded as evidence for a new mammal species, Pseudonovibos spiralis. However, the taxonomic status of P. spiralis remains a highly controversial subject: firstly, it has been related to three different groups of the family Bovidae: Antilopini (gazelles), Bovini (oxen, bisons, and buffaloes), and Caprini sensu lato (goats, sheep and allies). Secondly, certain horns have been shown to be faked. Most recently, it has been suggested, on the basis of 12S rRNA gene sequences, that P. spiralis was a new species of buffalo. I demonstrate here that this conclusion was inaccurate, and base this on the grounds that: (1) the putative sequence of P. spiralis is shown to be a chimera obtained from three different species: Bos taurus, Bubalus bubalis and Saiga tatarica, and (2) several factors indicate that the specimen used was not authentic. This new study confirms earlier suggestions that the horns used to formally describe P. spiralis were bogus and were in fact derived from the horns of domesticated cattle (Bos taurus). The data suggest that P. spiralis never existed. PMID:12046628

  13. Dynamic changes in the composition of photosynthetic picoeukaryotes in the northwestern Pacific Ocean revealed by high-throughput tag sequencing of plastid 16S rRNA genes.


    Choi, Dong H; An, Sung M; Chun, Sungjun; Yang, Eun C; Selph, Karen E; Lee, Charity M; Noh, Jae H


    Photosynthetic picoeukaryotes (PPEs) are major oceanic primary producers. However, the diversity of such communities remains poorly understood, especially in the northwestern (NW) Pacific. We investigated the abundance and diversity of PPEs, and recorded environmental variables, along a transect from the coast to the open Pacific Ocean. High-throughput tag sequencing (using the MiSeq system) revealed the diversity of plastid 16S rRNA genes. The dominant PPEs changed at the class level along the transect. Prymnesiophyceae were the only dominant PPEs in the warm pool of the NW Pacific, but Mamiellophyceae dominated in coastal waters of the East China Sea. Phylogenetically, most Prymnesiophyceae sequences could not be resolved at lower taxonomic levels because no close relatives have been cultured. Within the Mamiellophyceae, the genera Micromonas and Ostreococcus dominated in marginal coastal areas affected by open water, whereas Bathycoccus dominated in the lower euphotic depths of oligotrophic open waters. Cryptophyceae and Phaeocystis (of the Prymnesiophyceae) dominated in areas affected principally by coastal water. We also defined the biogeographical distributions of Chrysophyceae, prasinophytes, Bacillariophyceaea and Pelagophyceae. These distributions were influenced by temperature, salinity and chlorophyll a and nutrient concentrations.

  14. Morphology, morphogenesis and small subunit rRNA gene sequence of a soil hypotrichous ciliate, Perisincirra paucicirrata (Ciliophora, Kahliellidae), from the shoreline of the Yellow River, North China.


    Li, Fengchao; Xing, Yi; Li, Jiamei; Al-Rasheid, Khaled A S; He, Songke; Shao, Chen


    The morphology, morphogenesis, and 18S rRNA gene sequence of a soil hypotrichous ciliate Perisincirra paucicirrata, isolated from north China, were investigated. Perisincirra paucicirrata differs from its congeners in: (1) having a body length to width ratio in vivo of 4:1, (2) its adoral zone occupying between 15% and 25% of the total body length, and (3) the presence of two parabuccal cirri, three left (with 10-16 cirri each) and two right marginal rows (with 14-24 cirri each), and three dorsal kineties. Our study offers a first attempt to begin to map the morphogenetic processes of the genus, which are mainly characterised by the following: the formation of four frontal ventral transverse anlagens for each daughter cell, with the proter's anlage I originating from the reorganised anterior part of the parental paroral; the paroral and endoral anlage developed from the reorganised old endoral and do not contribute the first frontal cirrus; the frontoventral transverse anlage I contributing the left frontal cirrus; anlage II generating the middle frontal and the buccal cirri; anlage III developing the right frontal cirrus and the anterior parabuccal cirrus; and anlage IV contributing the posterior parabuccal cirrus. As an additional contribution, we judge that the inner one or the two right rows of P. kahli and P. longicirrata are marginal rows. Phylogenetic analysis based on SSU rDNA sequences suggests that Perisincirra is related to sporadotrichids, but provides no credible evidence for its taxonomic position.

  15. Peptide inhibitors of peptidyltransferase alter the conformation of domains IV and V of large subunit rRNA: a model for nascent peptide control of translation.

    PubMed Central

    Harrod, R; Lovett, P S


    Peptides of 5 and 8 residues encoded by the leaders of attenuation regulated chloramphenicol-resistance genes inhibit the peptidyltransferase of microorganisms from the three kingdoms. Therefore, the ribosomal target for the peptides is likely to be a conserved structure and/or sequence. The inhibitor peptides "footprint" to nucleotides of domain V in large subunit rRNA when peptide-ribosome complexes are probed with dimethyl sulfate. Accordingly, rRNA was examined as a candidate for the site of peptide binding. Inhibitor peptides MVKTD and MSTSKNAD were mixed with rRNA phenol-extracted from Escherichia coli ribosomes. The conformation of the RNA was then probed by limited digestion with nucleases that cleave at single-stranded (T1 endonuclease) and double-stranded (V1 endonuclease) sites. Both peptides selectively altered the susceptibility of domains IV and V of 23S rRNA to digestion by T1 endonuclease. Peptide effects on cleavage by V1 nuclease were observed only in domain V. The T1 nuclease susceptibility of domain V of in vitro-transcribed 23S rRNA was also altered by the peptides, demonstrating that peptide binding to the rRNA is independent of ribosomal protein. We propose the peptides MVKTD and MSTSKNAD perturb peptidyltransferase center catalytic activities by altering the conformation of domains IV and V of 23S rRNA. These findings provide a general mechanism through which nascent peptides may cis-regulate the catalytic activities of translating ribosomes. Images Fig. 1 Fig. 2 Fig. 4 PMID:7567991

  16. Effects of Cr(III) and CR(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments

    EPA Science Inventory

    The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...

  17. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.


    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik


    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from PMID:25732605


    NASA Astrophysics Data System (ADS)

    Carr, S. A.; Glossner, A. W.; Dunbar, R. B.; Vogel, S. W.; Brandes, J.; Sahl, J. W.; Pepe-Ranney, C.; Spear, J. R.; Naish, T.; Powell, R. D.; Mandernack, K. W.


    heterotrophic organisms dominate these sediments, with the implication that primary productivity is derived from above. Integrating structural analyses and δ13C values of phospholipids, porewater chemistry, δ13CDIC and δ13CDIC values with 16S rRNA gene sequences provides a more comprehensive understanding of the biogeochemical influences of microbial carbon cycling that occur beneath marine sediments of Antarctica and elsewhere.

  19. Ribosomal cistrons in higher plant cells. II. Sequence homology between the two mature rRNAs of sycamore cells and intracistronic reiteration. A DNA - rRNA hybridization study.


    Miassod, R; Cecchini, J P


    1. Uniformly labelled rRNA of sycamore cells has been annealed with homologous DNA. The fractions of DNA complementary to the 17S, or 26S, or 17S + 26S rRNAs are found to be 0.19%, 0.15% and 0.23%. They are not in the ratio of the molecular weight values (0.8, 1.2 and 2 - 10(6), respectively for the 17S, 26S and 17S + 26S rRNAs). This result is compatible with the large hybridization competition observed between the two rRNAs (53 and 72%) and with the shift-down of saturation curves when DNA is presaturated with unlabelled rRNA before the incubation with the other labelled rRNA. 2. Under the selected experimental procedure, the DNA - rRNA hybrids formed appear to be specific. Since there is an equal number of structural genes for the 17S and 26S rRNAs, these results mean the occurrence of a great sequence homology, strictly restricted to the two rRNAs. Homologous and specific sequences have been estimated to 0.1 and 0.7, or 0.85 and 0.35 million daltons, respectively in the 17S or 26S structural genes. 3. From the calculated lengths of homologous sequences, an intracistronic reiteration of some ribosomal sequences can be deduced. This internal reiteration is directly evidenced by the complex pattern of DNA - rRNA annealing curves. As demonstrated by base-composition analysis, the internal reiteration is heterogeneous and concerns both the homologous and specific sequences. In addition, the DNA saturation values allow the calculation of 4000 copies for the ribosomal cistron in the whole sycamore genome.

  20. Draft Genome Sequence of New Bacillus cereus Strain tsu1.


    Li, Hui; Zhou, Suping; Johnson, Terrance; Vercruysse, Koen; Ropelewski, Alexander J; Thannhauser, Theodore W


    This paper reports the draft genome sequence of new Bacillus cereus strain tsu1, isolated on an agar-cellulose plate. The draft genome sequence is 5.81 Mb, revealing 5,673 coding sequences. It contains genes for cellulose-degradation and biosynthesis pathways of polyhydroxybutyrate (PHB) and 8 rRNA genes (5S, 16S, and 23S).

  1. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons

    PubMed Central

    Penton, C. Ryan; Gupta, Vadakattu V. S. R.; Yu, Julian; Tiedje, James M.


    We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5, and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI) were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungal community structure, replicate dispersion and the number of operational taxonomic units (OTUs) retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation. PMID:27313569

  2. High protists diversity in the plankton of sulfurous lakes and lagoons examined by 18s rRNA gene sequence analyses.


    Triadó-Margarit, Xavier; Casamayor, Emilio O


    Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities. PMID:26224512

  3. Morphology, morphogenesis and small-subunit rRNA gene sequence of the novel brackish-water ciliate Strongylidium orientale sp. nov. (Ciliophora, Hypotrichia).


    Chen, Xumiao; Miao, Miao; Ma, Honggang; Shao, Chen; Al-Rasheid, Khaled A S


    A novel stichotrich ciliate, Strongylidium orientale sp. nov., was discovered from a mangrove river in Hong Kong, southern China, and its morphology was investigated through observations in vivo and after protargol impregnation. Cells are 80-120 × 35-50 µm in vivo and fusiform in shape, with rounded anterior and tapered posterior ends. It is characterized by its brackish habitat and by the presence of two types of cortical granules arranged irregularly throughout the cortex. Morphogenetic events of cell division and physiological reorganization are described. The main ontogenetic features were: (i) only the posterior portion of the parental adoral zone of membranelles was renewed by dedifferentiation of the old structures; (ii) the oral primordium in the opisthe occurred apokinetally; (iii) the left and right ventral rows originated intrakinetally and the final left ventral row was spliced from two cirri from the frontoventral cirral anlage, a short cirral row from the anlage for the right ventral row and a long cirral row which was formed from the whole anlage of the left ventral row; (iv) the marginal rows developed intrakinetally; (v) the dorsal kineties replicated entirely de novo and did not fragment; and (vi) the two macronuclear nodules fused into a mass and then divided. Based on small-subunit rRNA gene sequences, phylogenetic analyses showed a close relationship with its congener Strongylidium pseudocrassum and with the genus Pseudouroleptus. PMID:23378115

  4. Use of 16S rRNA sequencing and quantitative PCR to correlate venous leg ulcer bacterial bioburden dynamics with wound expansion, antibiotic therapy, and healing

    PubMed Central

    Sprockett, Daniel D.; Ammons, Christine G.; Tuttle, Marie S.


    Clinical diagnosis of infection in chronic wounds is currently limited to subjective clinical signs and culture-based methods that underestimate the complexity of wound microbial bioburden as revealed by DNA-based microbial identification methods. Here, we use 16S rRNA next generation sequencing and quantitative polymerase chain reaction to characterize weekly changes in bacterial load, community structure, and diversity associated with a chronic venous leg ulcer over the 15-week course of treatment and healing. Our DNA-based methods and detailed sampling scheme reveal that the bacterial bioburden of the wound is unexpectedly dynamic, including changes in the bacterial load and community structure that correlate with wound expansion, antibiotic therapy, and healing. We demonstrate that these multidimensional changes in bacterial bioburden can be summarized using swabs taken prior to debridement, and therefore, can be more easily collected serially than debridement or biopsy samples. Overall, this case illustrates the importance of detailed clinical indicators and longitudinal sampling to determine the pathogenic significance of chronic wound microbial dynamics and guide best use of antimicrobials for improvement of healing outcomes. PMID:25902876

  5. Evaluation of Commercial Universal rRNA Gene PCR plus Sequencing Tests for Identification of Bacteria and Fungi Associated with Infectious Endocarditis▿

    PubMed Central

    Kühn, Christian; Disqué, Claudia; Mühl, Helge; Orszag, Peter; Stiesch, Meike; Haverich, Axel


    Two new commercially available universal rRNA gene PCR plus sequencing tests, SepsiTest and universal microbe detection (UMD; Molzym, Bremen, Germany), were evaluated using blood specimens and heart valves from 30 patients with suspected infectious endocarditis (IE). The sensitivity of PCR (85%) was nearly twice as high as that of culture (45%), which in 10/20 IE cases presumably stayed negative as a consequence of growth inhibition of the pathogens by antibiotics. Further, PCR provided the basis for reclassification of 5/10 non-IE cases into IE cases. Culture-negative infections were identified by PCR, including single infections due to streptococci and Gram-negative bacteria (Escherichia coli, Haemophilus parainfluenzae) and mixed infections involving two Gram-positive bacteria or Candida spp. with Gram-positive bacteria. The new commercial tests proved to be of value for the rapid diagnosis of IE, particularly in cases of culture-negative infections. Issues regarding the feasibility of these tests for routine use are discussed. PMID:21715592

  6. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons


    Penton, C. Ryan; Gupta, Vadakattu V. S. R.; Yu, Julian; Tiedje, James M.


    We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5, and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI) were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungalmore » community structure, replicate dispersion and the number of operational taxonomic units (OTUs) retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation.« less

  7. Differentiation of Shewanella putrefaciens and Shewanella alga on the basis of whole-cell protein profiles, ribotyping, phenotypic characterization, and 16S rRNA gene sequence analysis.

    PubMed Central

    Vogel, B F; Jørgensen, K; Christensen, H; Olsen, J E; Gram, L


    Seventy-six presumed Shewanella putrefaciens isolates from fish, oil drillings, and clinical specimens, the type strain of Shewanella putrefaciens (ATCC 8071), the type strain of Shewanella alga (IAM 14159), and the type strain of Shewanella hanedai (ATCC 33224) were compared by several typing methods. Numerical analysis of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell protein and ribotyping patterns showed that the strains were separated into two distinct clusters with 56% +/- 10% and 40% +/- 14% similarity for whole-cell protein profiling and ribotyping, respectively. One cluster consisted of 26 isolates with 52 to 55 mol% G + C and included 15 human isolates, mostly clinical specimens, 8 isolates from marine waters, and the type strain of S. alga. This homogeneous cluster of mesophilic, halotolerant strains was by all analyses identical to the recently defined species S. alga (U. Simidu et al., Int. J. Syst. Bacteriol, 40:331-336, 1990). Fifty-two typically psychrotolerant strains formed the other, more heterogeneous major cluster, with 43 to 47 mol% G + C. The type strain of S. putrefaciens was included in this group. The two groups were confirmed by 16S rRNA gene sequence analysis. It is concluded that the isolates must be considered two different species, S. alga and S. putrefaciens, and that most mesophilic isolates formerly identified as S. putrefaciens belong to S. alga. The ecological role and potential pathogenicity of S. alga can be evaluated only if the organism is correctly identified. PMID:9172338

  8. Phylogenetic analysis based on 18S rRNA gene sequences of Schellackia parasites (Apicomplexa: Lankesterellidae) reveals their close relationship to the genus Eimeria.


    Megía-Palma, R; Martínez, J; Merino, S


    In the present study we detected Schellackia haemoparasites infecting the blood cells of Lacerta schreiberi and Podarcis hispanica, two species of lacertid lizards from central Spain. The parasite morphometry, the presence of a refractile body, the type of infected blood cells, the kind of host species, and the lack of oocysts in the fecal samples clearly indicated these blood parasites belong to the genus Schellackia. Until now, the species of this genus have never been genetically characterized and its taxonomic position under the Lankesterellidae family is based on the lack of the exogenous oocyst stage. However, the phylogenetic analysis performed on the basis of the 18S rRNA gene sequence revealed that species of the genus Schellackia are clustered with Eimeria species isolated from a snake and an amphibian species but not with Lankesterella species. The phylogenetic analysis rejects that both genera share a recent common ancestor. Based on these results we suggest a revision of the taxonomic status of the family Lankesterellidae. PMID:23731491

  9. Isolation and identification of lactic acid bacteria from Tarag in Eastern Inner Mongolia of China by 16S rRNA sequences and DGGE analysis.


    Liu, Wenjun; Bao, Qiuhua; Jirimutu; Qing, Manjun; Siriguleng; Chen, Xia; Sun, Ting; Li, Meihua; Zhang, Jiachao; Yu, Jie; Bilige, Menghe; Sun, Tiansong; Zhang, Heping


    Tarag is a characteristic fermented dairy product with rich microflora (especially lactic acid bacteria), developed by the people of Mongolian nationality in Inner Mongolia of China and Mongolia throughout history. One hundred and ninety-eight samples of Tarag were collected from scattered households in Eastern Inner Mongolia, and total of 790 isolates of lactic acid bacteria (LAB) were isolated by traditional pure culture method. To identify these isolates and analyze their biodiversity, 16S rRNA gene sequences analysis and PCR-DGGE were performed respectively. The results showed that 790 isolates could be classified as 31 species and subspecies. Among these isolates, Lactobacillus helveticus (153 strains, about 19.4%), Lactococcus lactis subsp. lactis (132 strains, about 16.7%) and Lactobacillus casei (106 strains, about 11.0%) were considered as the predominated species in the traditional fermented dairy products (Tarag) in Eastern Inner Mongolia. It was shown that the biodiversity of LAB in Tarag in Inner Mongolia was very abundant, and this traditional fermented dairy product could be considered as valuable resources for LAB isolation and probiotic selection. PMID:21689912

  10. High protists diversity in the plankton of sulfurous lakes and lagoons examined by 18s rRNA gene sequence analyses.


    Triadó-Margarit, Xavier; Casamayor, Emilio O


    Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities.

  11. Characterization and potential of three temperature ranges for hydrogen fermentation of cellulose by means of activity test and 16s rRNA sequence analysis.


    Gadow, Samir I; Jiang, Hongyu; Li, Yu-You


    A series of standardized activity experiments were performed to characterize three different temperature ranges of hydrogen fermentation from different carbon sources. 16S rRNA sequences analysis showed that the bacteria were close to Enterobacter genus in the mesophilic mixed culture (MMC) and Thermoanaerobacterium genus in the thermophilic and hyper-thermophilic mixed cultures (TMC and HMC). The MMC was able to utilize the glucose and cellulose to produce methane gas within a temperature range between 25 and 45 °C and hydrogen gas from 35 to 60°C. While, the TMC and HMC produced only hydrogen gas at all temperature ranges and the highest activity of 521.4mlH2/gVSSd was obtained by TMC. The thermodynamic analysis showed that more energy is consumed by hydrogen production from cellulose than from glucose. The experimental results could help to improve the economic feasibility of cellulosic biomass energy using three-phase technology to produce hythane.

  12. Systematic use of universal 16S rRNA gene polymerase chain reaction (PCR) and sequencing for processing pleural effusions improves conventional culture techniques.


    Insa, Rosario; Marín, Mercedes; Martín, Adoración; Martín-Rabadán, Pablo; Alcalá, Luís; Cercenado, Emilia; Calatayud, Laura; Liñares, Josefina; Bouza, Emilio


    Conventional culture of pleural fluid samples frequently provides false-negative results. Universal polymerase chain reaction (PCR) of the 16S ribosomal ribonucleic acid (rRNA) gene (16S PCR) has proven useful in the diagnosis of various bacterial infections. We conducted a prospective study to assess the value of 16S PCR in the etiologic diagnosis of pleural effusion. All pleural fluid samples received for culture were also studied using 16S PCR. Positive samples were sequenced for identification. Clinical records and conventional culture results were analyzed to classify pleural fluid samples as infected or not infected. We studied 723 samples. We excluded 188 samples because they were obtained from a long-term chest tube, there was a diagnosis of mycobacterial infection, or there were insufficient data to classify the episode. Finally, 535 pleural fluid samples were analyzed. According to our criteria, 82 (15.3%) were infected and 453 (84.7%) were not infected. In the infected samples, 16S PCR was positive in 67 samples (81.7%) while conventional culture was positive in 45 (54.9%). There were 4 false positives with 16S PCR (0.9%) and 12 with culture (2.6%). The values for the etiologic diagnosis of bacterial pleural effusion of conventional culture compared with 16S PCR were as follows: sensitivity, 54.9%/81.7%; specificity, 97.4%/99.1%; positive predictive value, 76.3%/94.4%; negative predictive value, 92.6%/96.8%; and accuracy, 90.8%/96.5%.When compared with conventional culture, 16S PCR plus sequencing substantially improves the etiologic diagnosis of infectious pleural effusion. In our opinion, this technique should be added to the routine diagnostic armamentarium of clinical microbiology laboratories.

  13. Comparison of Fecal Microbiota of Mongolian and Thoroughbred Horses by High-throughput Sequencing of the V4 Region of the 16S rRNA Gene

    PubMed Central

    Zhao, Yiping; Li, Bei; Bai, Dongyi; Huang, Jinlong; Shiraigo, Wunierfu; Yang, Lihua; Zhao, Qinan; Ren, Xiujuan; Wu, Jing; Bao, Wuyundalai; Dugarjaviin, Manglai


    The hindgut of horses is an anaerobic fermentative chamber for a complex and dynamic microbial population, which plays a critical role in health and energy requirements. Research on the gut microbiota of Mongolian horses has not been reported until now as far as we know. Mongolian horse is a major local breed in China. We performed high-throughput sequencing of the 16S rRNA genes V4 hypervariable regions from gut fecal material to characterize the gut microbiota of Mongolian horses and compare them to the microbiota in Thoroughbred horses. Fourteen Mongolian and 19 Thoroughbred horses were used in the study. A total of 593,678 sequence reads were obtained from 33 samples analyzed, which were found to belong to 16 phyla and 75 genera. The bacterial community compositions were similar for the two breeds. Firmicutes (56% in Mongolian horses and 53% in Thoroughbred horses) and Bacteroidetes (33% and 32% respectively) were the most abundant and predominant phyla followed by Spirochaete, Verrucomicrobia, Proteobacteria, and Fibrobacteres. Of these 16 phyla, five (Synergistetes, Planctomycetes, Proteobacteria, TM7, and Chloroflexi) were significantly different (p<0.05) between the two breeds. At the genus level, Treponema was the most abundant genus (43% in Mongolian horses vs 29% in Thoroughbred horses), followed by Ruminococcus, Roseburia, Pseudobutyrivibrio, and Anaeroplasma, which were detected in higher distribution proportion in Mongolian horses than in Thoroughbred horses. In contrast, Oscillibacter, Fibrobacter, Methanocorpusculum, and Succinivibrio levels were lower in Mongolian horses. Among 75 genera, 30 genera were significantly different (p<0.05) between the two breeds. We found that the environment was one of very important factors that influenced horse gut microbiota. These findings provide novel information about the gut microbiota of Mongolian horses and a foundation for future investigations of gut bacterial factors that may influence the development and

  14. Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia, Mytilidae)

    PubMed Central


    Background Chromosome rearrangements are an important part of the speciation process in many taxa. The study of chromosome evolution in bivalves is hampered by the absence of clear chromosomal banding patterns and the similarity in both chromosome size and morphology. For this reason, obtaining good chromosome markers is essential for reliable karyotypic comparisons. To begin this task, the chromosomes of the mussels Brachidontes puniceus and B. rodriguezi were studied by means of fluorochrome staining and fluorescent in situ hybridization (FISH). Results Brachidontes puniceus and B. rodriguezi both have 2n = 32 chromosomes but differing karyotype composition. Vertebrate-type telomeric sequences appear at both ends of every single chromosome. B. puniceus presents a single terminal major rRNA gene cluster on a chromosome pair while B. rodriguezi shows two. Both mussels present two 5S rDNA and two core histone gene clusters intercalary located on the long arms of two chromosome pairs. Double and triple-FISH experiments demonstrated that one of the 5S rDNA and one of the major rDNA clusters appear on the same chromosome pair in B. rodriguezi but not in B. puniceus. On the other hand, the second 5S rDNA cluster is located in one of the chromosome pairs also bearing one of the core histone gene clusters in the two mussel species. Conclusion Knowledge of the chromosomal distribution of these sequences in the two species of Brachidontes is a first step in the understanding of the role of chromosome changes on bivalve evolution. PMID:21143946

  15. Comparison of Fecal Microbiota of Mongolian and Thoroughbred Horses by High-throughput Sequencing of the V4 Region of the 16S rRNA Gene.


    Zhao, Yiping; Li, Bei; Bai, Dongyi; Huang, Jinlong; Shiraigo, Wunierfu; Yang, Lihua; Zhao, Qinan; Ren, Xiujuan; Wu, Jing; Bao, Wuyundalai; Dugarjaviin, Manglai


    The hindgut of horses is an anaerobic fermentative chamber for a complex and dynamic microbial population, which plays a critical role in health and energy requirements. Research on the gut microbiota of Mongolian horses has not been reported until now as far as we know. Mongolian horse is a major local breed in China. We performed high-throughput sequencing of the 16S rRNA genes V4 hypervariable regions from gut fecal material to characterize the gut microbiota of Mongolian horses and compare them to the microbiota in Thoroughbred horses. Fourteen Mongolian and 19 Thoroughbred horses were used in the study. A total of 593,678 sequence reads were obtained from 33 samples analyzed, which were found to belong to 16 phyla and 75 genera. The bacterial community compositions were similar for the two breeds. Firmicutes (56% in Mongolian horses and 53% in Thoroughbred horses) and Bacteroidetes (33% and 32% respectively) were the most abundant and predominant phyla followed by Spirochaete, Verrucomicrobia, Proteobacteria, and Fibrobacteres. Of these 16 phyla, five (Synergistetes, Planctomycetes, Proteobacteria, TM7, and Chloroflexi) were significantly different (p<0.05) between the two breeds. At the genus level, Treponema was the most abundant genus (43% in Mongolian horses vs 29% in Thoroughbred horses), followed by Ruminococcus, Roseburia, Pseudobutyrivibrio, and Anaeroplasma, which were detected in higher distribution proportion in Mongolian horses than in Thoroughbred horses. In contrast, Oscillibacter, Fibrobacter, Methanocorpusculum, and Succinivibrio levels were lower in Mongolian horses. Among 75 genera, 30 genera were significantly different (p<0.05) between the two breeds. We found that the environment was one of very important factors that influenced horse gut microbiota. These findings provide novel information about the gut microbiota of Mongolian horses and a foundation for future investigations of gut bacterial factors that may influence the development and

  16. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.


    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B


    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  17. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.


    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek


    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied.

  18. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.


    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek


    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. PMID:24071560

  19. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.


    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  20. Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene.


    Lynch, T; Gregson, D; Church, D L


    Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized.

  1. Inter- and intraspecific genomic variability of the 16S-23S intergenic spacer regions (ISR) in representatives of Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans.


    Ni, Yong-Qing; Yang, Yuan; Bao, Jing-Ting; He, Kai-Yu; Li, Hong-Yu


    The complete sequences of 32 intergenic spacer regions (ISR) from Acidithiobacillus strains, including 29 field strains isolated from coal, copper, molybdenum mine wastes or sediment of different geoclimatic regions in China, reference strain ATCC19859 and the type strains of the two species were determined. These data, together with other sequences available in the GenBank database, were used to carry out the first detailed assessment of the inter- and intraspecific genomic variability of the ISR sequences and to infer phylogenetic relationships within the genus. The total length of the 16S-23S rRNA intergenic spacer regions of the Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans strains ranged from 451 to 490 bp, and from 434 to 456 bp, respectively. The degree of intrageneric ISR sequence similarity was higher than the degree of intergeneric similarity, and the overall similarity values of the ISRs varied from 60.49% to 84.71% between representatives of different species of the genus Acidithiobacillus. Sequences from the spacer of the A. thiooxidans and A. ferrooxidans strains ranged from 86.71% to 99.56% and 92.36% to 100% similarity, respectively. All Acidithiobacillus strains were separated into three phylogenetic major clusters and seven phylogenetic groups. ISR may be a potential target for the development of in situ hybridization probe aimed at accurately detecting acidithiobacilli in the various acidic environments.

  2. Shift in prokaryotic diversity in Arctic sediment along a continuum Glacier -River - Fjord using massive 16S rRNA gene tag sequencing

    NASA Astrophysics Data System (ADS)

    Laghdass, M.; Deloffre, J.; Lafite, R.; Hänni, C.; Gillet, B.; Cecillon, S.; Simonet, P.; Petit, F.


    In Arctic environment, one of indirect consequences of the global climate warming is the significant amplification of the amount of inland water during the spring thaw resulting from the snow cover and permafrost melting. These freshwater transfers to the coast cause sedimentary transfers. The Arctic fjords that represent deep glacial valleys of the sea are particularly vulnerable systems. Although the previous studies have highlighted potentially the high bacterial diversity in Arctic environment by the pyrosequencing, a new-generation sequencing and high throughput method, does not escape the same bias as the one of classical molecular biology techniques involved at different stages of the analysis. In this context, our objective was to characterize the prokaryotic diversity associated to the sediment transfer along a gradient from the head of the glacier to mud patch sediment in the Goule river streaming in Kongsfjorden (Svalbard) during an active thaw. The prokaryotic diversity in sediment was characterized by combining a massive of 16S rRNA gene tag sequencing with a specific and original approach in order to overcome the bias associated to the sampling and extraction. The sediment was extracted by three different methods. One method was done in duplicate. Negative controls performed at extraction and PCR stages were also sequenced. The phylogenetic analysis of the environmental samples below phylum level revealed significantly changes in the diversity and the function of the prokaryotic community along the gradient. The subglacial Goule river sediment is characterized by bacteria with specific functions methylotroph bacteria, aerobic chemoautolithotrophic bacteria (Alphaproteobacteria with Methylobacteriaceae) whereas the mouth of the river Goule and the freshwater part of the Goule River was dominated by sulphate-reducing-bacteria, anaerobic chemooorganotroph (Deltaprotobacteria with the Desulfobulbaceae and Desulfuromonadaceae) and by

  3. Application of qualitative and quantitative real-time PCR, direct sequencing, and terminal restriction fragment length polymorphism analysis for detection and identification of polymicrobial 16S rRNA genes in ascites.


    Krohn, Sandra; Böhm, Stephan; Engelmann, Cornelius; Hartmann, Jan; Brodzinski, Annika; Chatzinotas, Antonis; Zeller, Katharina; Prywerek, Delia; Fetzer, Ingo; Berg, Thomas


    Qualitative and quantitative 16S rRNA gene-based real-time PCR and direct sequencing were applied for rapid detection and identification of bacterial DNA (bactDNA) in 356 ascites samples. bactDNA was detected in 35% of samples, with a mean of 3.24 log copies ml(-1). Direct sequencing of PCR products revealed 62% mixed chromatograms predominantly belonging to Gram-positive bacteria. Terminal restriction fragment length polymorphism (T-RFLP) results of a sample subset confirmed sequence data showing polymicrobial DNA contents in 67% of bactDNA-positive ascites samples.

  4. Free-living protozoa in two unchlorinated drinking water supplies, identified by phylogenic analysis of 18S rRNA gene sequences.


    Valster, Rinske M; Wullings, Bart A; Bakker, Geo; Smidt, Hauke; van der Kooij, Dick


    Free-living protozoan communities in water supplies may include hosts for Legionella pneumophila and other undesired bacteria, as well as pathogens. This study aimed at identifying free-living protozoa in two unchlorinated groundwater supplies, using cultivation-independent molecular approaches. For this purpose, samples (<20 degrees C) of treated water, distributed water, and distribution system biofilms were collected from supply A, with a low concentration of natural organic matter (NOM) (<0.5 ppm of C), and from supply B, with a high NOM concentration (7.9 ppm of C). Eukaryotic communities were studied using terminal restriction fragment length polymorphism and clone library analyses of partial 18S rRNA gene fragments and a Hartmannella vermiformis-specific quantitative PCR (qPCR). In both supplies, highly diverse eukaryotic communities were observed, including free-living protozoa, fungi, and metazoa. Sequences of protozoa clustered with Amoebozoa (10 operational taxonomic units [OTUs]), Cercozoa (39 OTUs), Choanozoa (26 OTUs), Ciliophora (29 OTUs), Euglenozoa (13 OTUs), Myzozoa (5 OTUs), and Stramenopiles (5 OTUs). A large variety of protozoa were present in both supplies, but the estimated values for protozoan richness did not differ significantly. H. vermiformis was observed in both supplies but was not a predominant protozoan. One OTU with the highest similarity to Acanthamoeba polyphaga, an opportunistic human pathogen and a host for undesired bacteria, was observed in supply A. The high level of NOM in supply B corresponded with an elevated level of active biomass and with elevated concentrations of H. vermiformis in distributed water. Hence, the application of qPCR may be promising in elucidating the relationship between drinking water quality and the presence of specific protozoa.

  5. Noma Affected Children from Niger Have Distinct Oral Microbial Communities Based on High-Throughput Sequencing of 16S rRNA Gene Fragments

    PubMed Central

    Whiteson, Katrine L.; Lazarevic, Vladimir; Tangomo-Bento, Manuela; Girard, Myriam; Maughan, Heather; Pittet, Didier; Francois, Patrice; Schrenzel, Jacques


    We aim to understand the microbial ecology of noma (cancrum oris), a devastating ancient illness which causes severe facial disfigurement in>140,000 malnourished children every year. The cause of noma is still elusive. A chaotic mix of microbial infection, oral hygiene and weakened immune system likely contribute to the development of oral lesions. These lesions are a plausible entry point for unidentified microorganisms that trigger gangrenous facial infections. To catalog bacteria present in noma lesions and identify candidate noma-triggering organisms, we performed a cross-sectional sequencing study of 16S rRNA gene amplicons from sixty samples of gingival fluid from twelve healthy children, twelve children suffering from noma (lesion and healthy sites), and twelve children suffering from Acute Necrotizing Gingivitis (ANG) (lesion and healthy sites). Relative to healthy individuals, samples taken from lesions in diseased mouths were enriched with Spirochaetes and depleted for Proteobacteria. Samples taken from healthy sites of diseased mouths had proportions of Spirochaetes and Proteobacteria that were similar to healthy control individuals. Samples from noma mouths did not have a higher abundance of Fusobacterium, casting doubt on its role as a causative agent of noma. Microbial communities sampled from noma and ANG lesions were dominated by the same Prevotella intermedia OTU, which was much less abundant in healthy sites sampled from the same mouths. Multivariate analysis confirmed that bacterial communities in healthy and lesion sites were significantly different. Several OTUs in the Orders Erysipelotrichales, Clostridiales, Bacteroidales, and Spirochaetales were identified as indicators of noma, suggesting that one or more microbes within these Orders is associated with the development of noma lesions. Future studies should include longitudinal sampling of viral and microbial components of this community, before and early in noma lesion development. PMID

  6. Isolation and identification by 16S rRNA sequence analysis of plant growth-promoting azospirilla from the rhizosphere of wheat.


    Ayyaz, Khadija; Zaheer, Ahmad; Rasul, Ghulam; Mirza, Muhammad Sajjad


    The main objective of the present study was to isolate phytohormone-producing, phosphate-solubilizing strains of Azospirillum from wheat to be used as inoculants for plant growth promotion. Five Azospirillum strains were isolated from the rhizosphere of field-grown wheat (Triticum aestivum L.), and it was confirmed by BOX-polymerase chain reaction (PCR) that the isolates were different and not re-isolates of the same strain. Sequence analysis of the PCR-amplified 16S rRNA gene indicated that four isolates showed maximum similarity to Azospirillum brasilense and one isolate showed maximum similarity to Azospirillum zeae. This is the first report indicating the presence of an A. zeae like isolate in the wheat rhizosphere in Pakistan. The bacterial isolates were characterized for their plant growth-promoting traits, phosphate solubilization, and indole-3-acetic acid (IAA) production. None of the isolates showed phosphate solubilization activity in the commonly used Pikovskaya medium. However, all strains (except AzoK4) exhibited ability to solubilize tricalcium phosphate (TCP) in modified Pikovskaya medium in which sucrose was replaced by Na-malate, as well as in TCP-supplemented Luria-Bertani (LB) medium. Organic acids, such as acetic, citric, lactic, malic, and succinic acids, were detected in culture supernatants of the tested Azospirillum strains. All strains exhibited ability to produce IAA in the growth medium, except Azospirillum sp. AzoK1. Among the strains tested, the maximum IAA production (30.49±1.04mgL(-1)) and phosphate solubilization (105.50±4.93mgL(-1)) were shown by a pure culture of Azospirillum sp. AzoK2. In pot experiments, single-strain inocula of Azospirillum sp. AzoK1 and AzoK2 improved wheat plant growth. PMID:27133558

  7. Noma affected children from Niger have distinct oral microbial communities based on high-throughput sequencing of 16S rRNA gene fragments.


    Whiteson, Katrine L; Lazarevic, Vladimir; Tangomo-Bento, Manuela; Girard, Myriam; Maughan, Heather; Pittet, Didier; Francois, Patrice; Schrenzel, Jacques


    We aim to understand the microbial ecology of noma (cancrum oris), a devastating ancient illness which causes severe facial disfigurement in>140,000 malnourished children every year. The cause of noma is still elusive. A chaotic mix of microbial infection, oral hygiene and weakened immune system likely contribute to the development of oral lesions. These lesions are a plausible entry point for unidentified microorganisms that trigger gangrenous facial infections. To catalog bacteria present in noma lesions and identify candidate noma-triggering organisms, we performed a cross-sectional sequencing study of 16S rRNA gene amplicons from sixty samples of gingival fluid from twelve healthy children, twelve children suffering from noma (lesion and healthy sites), and twelve children suffering from Acute Necrotizing Gingivitis (ANG) (lesion and healthy sites). Relative to healthy individuals, samples taken from lesions in diseased mouths were enriched with Spirochaetes and depleted for Proteobacteria. Samples taken from healthy sites of diseased mouths had proportions of Spirochaetes and Proteobacteria that were similar to healthy control individuals. Samples from noma mouths did not have a higher abundance of Fusobacterium, casting doubt on its role as a causative agent of noma. Microbial communities sampled from noma and ANG lesions were dominated by the same Prevotella intermedia OTU, which was much less abundant in healthy sites sampled from the same mouths. Multivariate analysis confirmed that bacterial communities in healthy and lesion sites were significantly different. Several OTUs in the Orders Erysipelotrichales, Clostridiales, Bacteroidales, and Spirochaetales were identified as indicators of noma, suggesting that one or more microbes within these Orders is associated with the development of noma lesions. Future studies should include longitudinal sampling of viral and microbial components of this community, before and early in noma lesion development.

  8. Isolation and identification by 16S rRNA sequence analysis of plant growth-promoting azospirilla from the rhizosphere of wheat.


    Ayyaz, Khadija; Zaheer, Ahmad; Rasul, Ghulam; Mirza, Muhammad Sajjad


    The main objective of the present study was to isolate phytohormone-producing, phosphate-solubilizing strains of Azospirillum from wheat to be used as inoculants for plant growth promotion. Five Azospirillum strains were isolated from the rhizosphere of field-grown wheat (Triticum aestivum L.), and it was confirmed by BOX-polymerase chain reaction (PCR) that the isolates were different and not re-isolates of the same strain. Sequence analysis of the PCR-amplified 16S rRNA gene indicated that four isolates showed maximum similarity to Azospirillum brasilense and one isolate showed maximum similarity to Azospirillum zeae. This is the first report indicating the presence of an A. zeae like isolate in the wheat rhizosphere in Pakistan. The bacterial isolates were characterized for their plant growth-promoting traits, phosphate solubilization, and indole-3-acetic acid (IAA) production. None of the isolates showed phosphate solubilization activity in the commonly used Pikovskaya medium. However, all strains (except AzoK4) exhibited ability to solubilize tricalcium phosphate (TCP) in modified Pikovskaya medium in which sucrose was replaced by Na-malate, as well as in TCP-supplemented Luria-Bertani (LB) medium. Organic acids, such as acetic, citric, lactic, malic, and succinic acids, were detected in culture supernatants of the tested Azospirillum strains. All strains exhibited ability to produce IAA in the growth medium, except Azospirillum sp. AzoK1. Among the strains tested, the maximum IAA production (30.49±1.04mgL(-1)) and phosphate solubilization (105.50±4.93mgL(-1)) were shown by a pure culture of Azospirillum sp. AzoK2. In pot experiments, single-strain inocula of Azospirillum sp. AzoK1 and AzoK2 improved wheat plant growth.

  9. The Intervening Sequence of Coxiella burnetii: Characterization and Evolution

    PubMed Central

    Warrier, Indu; Walter, Mathias C.; Frangoulidis, Dimitrios; Raghavan, Rahul; Hicks, Linda D.; Minnick, Michael F.


    The intervening sequence (IVS) of Coxiella burnetii, the agent of Q fever, is a 428-nt selfish genetic element located in helix 45 of the precursor 23S rRNA. The IVS element, in turn, contains an ORF that encodes a hypothetical ribosomal S23 protein (S23p). Although S23p can be synthesized in vitro in the presence of an engineered E. coli promoter and ribosome binding site, results suggest that the protein is not synthesized in vivo. In spite of a high degree of IVS conservation among different strains of C. burnetii, the region immediately upstream of the S23p start codon is prone to change, and the S23p-encoding ORF is evidently undergoing reductive evolution. We determined that IVS excision from 23S rRNA was mediated by RNase III, and IVS RNA was rapidly degraded, thereafter. Levels of the resulting 23S rRNA fragments that flank the IVS, F1 (~1.2 kb) and F2 (~1.7 kb), were quantified over C. burnetii's logarithmic growth phase (1–5 d). Results showed that 23S F1 quantities were consistently higher than those of F2 and 16S rRNA. The disparity between levels of the two 23S rRNA fragments following excision of IVS is an interesting phenomenon of unknown significance. Based upon phylogenetic analyses, IVS was acquired through horizontal transfer after C. burnetii's divergence from an ancestral bacterium and has been subsequently maintained by vertical transfer. The widespread occurrence, maintenance and conservation of the IVS in C. burnetii imply that it plays an adaptive role or has a neutral effect on fitness.

  10. The Intervening Sequence of Coxiella burnetii: Characterization and Evolution.


    Warrier, Indu; Walter, Mathias C; Frangoulidis, Dimitrios; Raghavan, Rahul; Hicks, Linda D; Minnick, Michael F


    The intervening sequence (IVS) of Coxiella burnetii, the agent of Q fever, is a 428-nt selfish genetic element located in helix 45 of the precursor 23S rRNA. The IVS element, in turn, contains an ORF that encodes a hypothetical ribosomal S23 protein (S23p). Although S23p can be synthesized in vitro in the presence of an engineered E. coli promoter and ribosome binding site, results suggest that the protein is not synthesized in vivo. In spite of a high degree of IVS conservation among different strains of C. burnetii, the region immediately upstream of the S23p start codon is prone to change, and the S23p-encoding ORF is evidently undergoing reductive evolution. We determined that IVS excision from 23S rRNA was mediated by RNase III, and IVS RNA was rapidly degraded, thereafter. Levels of the resulting 23S rRNA fragments that flank the IVS, F1 (~1.2 kb) and F2 (~1.7 kb), were quantified over C. burnetii's logarithmic growth phase (1-5 d). Results showed that 23S F1 quantities were consistently higher than those of F2 and 16S rRNA. The disparity between levels of the two 23S rRNA fragments following excision of IVS is an interesting phenomenon of unknown significance. Based upon phylogenetic analyses, IVS was acquired through horizontal transfer after C. burnetii's divergence from an ancestral bacterium and has been subsequently maintained by vertical transfer. The widespread occurrence, maintenance and conservation of the IVS in C. burnetii imply that it plays an adaptive role or has a neutral effect on fitness. PMID:27595093

  11. The Intervening Sequence of Coxiella burnetii: Characterization and Evolution

    PubMed Central

    Warrier, Indu; Walter, Mathias C.; Frangoulidis, Dimitrios; Raghavan, Rahul; Hicks, Linda D.; Minnick, Michael F.


    The intervening sequence (IVS) of Coxiella burnetii, the agent of Q fever, is a 428-nt selfish genetic element located in helix 45 of the precursor 23S rRNA. The IVS element, in turn, contains an ORF that encodes a hypothetical ribosomal S23 protein (S23p). Although S23p can be synthesized in vitro in the presence of an engineered E. coli promoter and ribosome binding site, results suggest that the protein is not synthesized in vivo. In spite of a high degree of IVS conservation among different strains of C. burnetii, the region immediately upstream of the S23p start codon is prone to change, and the S23p-encoding ORF is evidently undergoing reductive evolution. We determined that IVS excision from 23S rRNA was mediated by RNase III, and IVS RNA was rapidly degraded, thereafter. Levels of the resulting 23S rRNA fragments that flank the IVS, F1 (~1.2 kb) and F2 (~1.7 kb), were quantified over C. burnetii's logarithmic growth phase (1–5 d). Results showed that 23S F1 quantities were consistently higher than those of F2 and 16S rRNA. The disparity between levels of the two 23S rRNA fragments following excision of IVS is an interesting phenomenon of unknown significance. Based upon phylogenetic analyses, IVS was acquired through horizontal transfer after C. burnetii's divergence from an ancestral bacterium and has been subsequently maintained by vertical transfer. The widespread occurrence, maintenance and conservation of the IVS in C. burnetii imply that it plays an adaptive role or has a neutral effect on fitness. PMID:27595093

  12. Phylogenetic Relationships among the Cryptophyta: Analyses of Nuclear-Encoded SSU rRNA Sequences Support the Monophyly of Extant Plastid-Containing Lineages.


    Marin, B; Klingberg, M; Melkonian, M


    The Cryptophyta comprise photoautotrophic protists with complex plastids which harbor a remnant eukaryotic nucleus (nucleomorph) and a few heterotrophic taxa which either lack a plastid (Goniomonas) or contain a complex plastid devoid of pigments (Ieucoplast; Chilomonas). To resolve the phylogenetic relationships between photosynthetic, leucoplast-containing and aplastidial taxa, we determined complete nuclear-encoded SSU rRNA-sequences from 12 cryptophyte taxa representing the genera Cryptomonas, Chilomonas, Rhodomonas, Chroomonas, Hemiselmis, Proteomonas and Teleaulax and, as an outgroup taxon, Cyanoptyche gloeocystis (Glaucocystophyta). Phylogenetic analyses of SSU rRNA sequences from a total of 24 cryptophyte taxa rooted with 4 glaucocystophyte taxa using distance, parsimony and likelihood methods as well as LogDet transformations invariably position the aplastidial genus Goniomonas as a sister taxon to a monophyletic lineage consisting of all plastid containing cryptophytes including Chilomonas. Among the plastid-containing taxa, we identify six major clades each supported by high bootstrap values: clade I (Cryptomonas and Chilomonas), clade II (Rhodomonas, Pyrenomonas, Rhinomonas and Storeatula), clade III (Guillardia and the 'unidentified cryptophyte' strain CCMP 325), clade IV (Teleaulax and Geminigera), clade V (Proteomonas) and clade VI (Hemiselmis, Chroomonas and Komma). Clade I (Cryptomonas and Chilomonas) represents a sister group to clades II-VI which together form a monophyletic lineage; the phylogenetic relationships between clades II-VI remain largely unresolved. Chilomonas is positioned within the Cryptomonas clade and thus presumably evolved from a photosynthetic taxon of this genus. In our analysis the characters blue and red pigmentation do not correspond with a basal subdivision of the phylum, thus rejecting this character for higher-level classification of cryptophytes. However, different spectroscopic subtypes of phycoerythrin (PE I-III) and

  13. Phylogenetic Relationships among the Cryptophyta: Analyses of Nuclear-Encoded SSU rRNA Sequences Support the Monophyly of Extant Plastid-Containing Lineages.


    Marin, B; Klingberg, M; Melkonian, M


    The Cryptophyta comprise photoautotrophic protists with complex plastids which harbor a remnant eukaryotic nucleus (nucleomorph) and a few heterotrophic taxa which either lack a plastid (Goniomonas) or contain a complex plastid devoid of pigments (Ieucoplast; Chilomonas). To resolve the phylogenetic relationships between photosynthetic, leucoplast-containing and aplastidial taxa, we determined complete nuclear-encoded SSU rRNA-sequences from 12 cryptophyte taxa representing the genera Cryptomonas, Chilomonas, Rhodomonas, Chroomonas, Hemiselmis, Proteomonas and Teleaulax and, as an outgroup taxon, Cyanoptyche gloeocystis (Glaucocystophyta). Phylogenetic analyses of SSU rRNA sequences from a total of 24 cryptophyte taxa rooted with 4 glaucocystophyte taxa using distance, parsimony and likelihood methods as well as LogDet transformations invariably position the aplastidial genus Goniomonas as a sister taxon to a monophyletic lineage consisting of all plastid containing cryptophytes including Chilomonas. Among the plastid-containing taxa, we identify six major clades each supported by high bootstrap values: clade I (Cryptomonas and Chilomonas), clade II (Rhodomonas, Pyrenomonas, Rhinomonas and Storeatula), clade III (Guillardia and the 'unidentified cryptophyte' strain CCMP 325), clade IV (Teleaulax and Geminigera), clade V (Proteomonas) and clade VI (Hemiselmis, Chroomonas and Komma). Clade I (Cryptomonas and Chilomonas) represents a sister group to clades II-VI which together form a monophyletic lineage; the phylogenetic relationships between clades II-VI remain largely unresolved. Chilomonas is positioned within the Cryptomonas clade and thus presumably evolved from a photosynthetic taxon of this genus. In our analysis the characters blue and red pigmentation do not correspond with a basal subdivision of the phylum, thus rejecting this character for higher-level classification of cryptophytes. However, different spectroscopic subtypes of phycoerythrin (PE I-III) and

  14. Worldwide distribution of Nitrosococcus oceani, a marine ammonia-oxidizing gamma-proteobacterium, detected by PCR and sequencing of 16S rRNA and amoA genes.


    Ward, Bess B; O'Mullan, Gregory D


    Diversity of cultured ammonia-oxidizing bacteria in the gamma-subdivision of the Proteobacteria was investigated by using strains isolated from various parts of the world ocean. All the strains were very similar to each other on the basis of the sequences of both the 16S rRNA and ammonia monooxygenase genes and could be characterized as a single species. Sequences were also cloned directly from environmental DNA from coastal Pacific and Atlantic sites, and these sequences represented the first Nitrosococcus oceani-like sequences obtained directly from the ocean. Most of the environmental sequences clustered tightly with those of the cultivated strains, but some sequences could represent new species of NITROSOCOCCUS: These findings imply that organisms similar to the cultivated N. oceani strains have a worldwide distribution. PMID:12147525

  15. A second function for pseudouridine synthases: A point mutant of RluD unable to form pseudouridines 1911, 1915, and 1917 in Escherichia coli 23S ribosomal RNA restores normal growth to an RluD-minus strain.


    Gutgsell, N S; Del Campo, M; Raychaudhuri, S; Ofengand, J


    This laboratory previously showed that truncation of the gene for RluD, the Escherichia coli pseudouridine synthase responsible for synthesis of 23S rRNA pseudouridines 1911, 1915, and 1917, blocks pseudouridine formation and inhibits growth. We now show that RluD mutants at the essential aspartate 139 allow these two functions of RluD to be separated. In vitro, RluD with aspartate 139 replaced by threonine or asparagine is completely inactive. In vivo, the growth defect could be completely restored by transformation of an RluD-inactive strain with plasmids carrying genes for RluD with aspartate 139 replaced by threonine or asparagine. Pseudouridine sequencing of the 23S rRNA from these transformed strains demonstrated the lack of these pseudouridines. Pseudoreversion, which has previously been shown to restore growth without pseudouridine formation by mutation at a distant position on the chromosome, was not responsible because transformation with empty vector under identical conditions did not alter the growth rate.

  16. Clinical and microbiological features of a cystic fibrosis patient chronically colonized with Pandoraea sputorum identified by combining 16S rRNA sequencing and matrix-assisted laser desorption ionization-time of flight mass spectrometry.


    Fernández-Olmos, A; Morosini, M I; Lamas, A; García-Castillo, M; García-García, L; Cantón, R; Máiz, L


    Clonal isolates identified as various nonfermentative Gram-negative bacilli over a 5-year period from sputum cultures of a 30-year-old cystic fibrosis patient were successfully reidentified as Pandoraea sputorum by combining 16S rRNA sequencing and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). Decreased lung function improved after 1 year of azithromycin and inhaled 7%-hypertonic saline treatment. PMID:22170922

  17. Clinical and microbiological features of a cystic fibrosis patient chronically colonized with Pandoraea sputorum identified by combining 16S rRNA sequencing and matrix-assisted laser desorption ionization-time of flight mass spectrometry.


    Fernández-Olmos, A; Morosini, M I; Lamas, A; García-Castillo, M; García-García, L; Cantón, R; Máiz, L


    Clonal isolates identified as various nonfermentative Gram-negative bacilli over a 5-year period from sputum cultures of a 30-year-old cystic fibrosis patient were successfully reidentified as Pandoraea sputorum by combining 16S rRNA sequencing and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). Decreased lung function improved after 1 year of azithromycin and inhaled 7%-hypertonic saline treatment.

  18. Clinical and Microbiological Features of a Cystic Fibrosis Patient Chronically Colonized with Pandoraea sputorum Identified by Combining 16S rRNA Sequencing and Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry

    PubMed Central

    Fernández-Olmos, A.; Morosini, M. I.; Lamas, A.; García-Castillo, M.; García-García, L.; Máiz, L.


    Clonal isolates identified as various nonfermentative Gram-negative bacilli over a 5-year period from sputum cultures of a 30-year-old cystic fibrosis patient were successfully reidentified as Pandoraea sputorum by combining 16S rRNA sequencing and matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS). Decreased lung function improved after 1 year of azithromycin and inhaled 7%-hypertonic saline treatment. PMID:22170922

  19. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    NASA Technical Reports Server (NTRS)

    Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)


    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided a