Science.gov

Sample records for 24-bp consensus sequence

  1. SSCP analysis and sequencing of the human prion protein gene (PRNP) detects two different 24 bp deletions in an atypical Alzheimer`s disease family

    SciTech Connect

    Perry, R.T.; Go, R.C.P.; Harrell, L.E.; Acton, R.T.

    1995-02-27

    Alzheimer`s disease (AD) is a progressive, degenerative neurological disorder of the central nervous system. AD is the fourth leading cause of death in elderly persons 65 years or older in Western industrialized societies. The etiology of AD is unknown, but clinical, pathological, epidemiological, and molecular investigations suggest it is etiologically heterogeneous. Mutations in the amyloid protein are rare and segregate with the disease in a few early-onset familial AD (FAD) families. Similarities between AD and the unconventional viral (UCV) diseases, and between the amyloid and prion proteins, implicate the human prion protein gene (PRNP) as another candidate gene. Single strand conformation polymorphism (SSCP) analysis was used to screen for mutations at this locus in 82 AD patients from 54 families (30 FAD), vs. 39 age-matched controls. A 24-bp deletion around codon 68 that codes for one of five Gly-Pro rich octarepeats was identified in two affected sibs and one offspring of one late-onset FAD family. Two other affected sibs, three unaffected sibs, and three offspring from this family, in addition to one sporadic AD patient and three age-matched controls, were heterozygous for another octarepeat deletion located around codon 82. Two of the four affected sibs had features of PD, including one who was autopsy-verified AD and PD. Although these deletions were found infrequently in other AD patients and controls, they appear to be a rare polymorphism that is segregating in this FAD family. It does not appear that mutations at the PRNP locus are frequently associated with AD in this population. 54 refs., 4 figs.

  2. A consensus sequence for binding of Lrp to DNA.

    PubMed Central

    Cui, Y; Wang, Q; Stormo, G D; Calvo, J M

    1995-01-01

    Lrp (leucine-responsive regulatory protein) is a major regulatory protein involved in the expression of numerous operons in Escherichia coli. For ilvIH, one of the operons positively regulated by Lrp, Lrp binds to multiple sites upstream of the transcriptional start site and activates transcription. An alignment of 12 Lrp binding sites within ilvIH DNA from two different organisms revealed a tentative consensus sequence AGAAT TTTATTCT (Q. Wang, M. Sacco, E. Ricca, C.T. Lago, M. DeFelice, and J.M. Calvo, Mol. Microbiol. 7:883-891, 1993). To further characterize the binding specificity of Lrp, we used a variation of the Selex procedure of C. Tuerk and L. Gold (Science 249:505-510, 1990) to identify sequences that bound Lrp out of a pool of 10(12) different DNA molecules. We identified 63 related DNA sequences that bound Lrp and estimated their relative binding affinities for Lrp. A consensus sequence derived from analysis of these sequences, YAGHAWATTWT DCTR, where Y = C or T, H = not G, W = A or T, D = not C, and R = A or G, contains clear dyad symmetry and is very similar to the one defined earlier. To test the idea that Lrp in the presence of leucine might bind to a different subset of DNA sequences, we carried out a second selection experiment with leucine present during the binding reactions. DNA sequences selected in the presence or absence of leucine were similar, and leucine did not stimulate binding to any of the sequences that were selected in the presence of leucine. Therefore, it is unlikely that leucine changes the specificity of Lrp binding. PMID:7665463

  3. Optimal treatment sequence in COPD: Can a consensus be found?

    PubMed

    Ferreira, J; Drummond, M; Pires, N; Reis, G; Alves, C; Robalo-Cordeiro, C

    2016-01-01

    There is currently no consensus on the treatment sequence in chronic obstructive pulmonary disease (COPD), although it is recognized that early diagnosis is of paramount importance to start treatment in the early stages of the disease. Although it is fairly consensual that initial treatment should be with an inhaled short-acting beta agonist, a short-acting muscarinic antagonist, a long-acting beta-agonist or a long-acting muscarinic antagonist. As the disease progresses, several therapeutic options are available, and which to choose at each disease stage remains controversial. When and in which patients to use dual bronchodilation? When to use inhaled corticosteroids? And triple therapy? Are the existing non-inhaled therapies, such as mucolytic agents, antibiotics, phosphodiesterase-4 inhibitors, methylxanthines and immunostimulating agents, useful? If so, which patients would benefit? Should co-morbidities be taken into account when choosing COPD therapy for a patient? This paper reviews current guidelines and available evidence and proposes a therapeutic scheme for COPD patients. We also propose a treatment algorithm in the hope that it will help physicians to decide the best approach for their patients. The authors conclude that, at present, a full consensus on optimal treatment sequence in COPD cannot be found, mainly due to disease heterogeneity and lack of biomarkers to guide treatment. For the time being, and although some therapeutic approaches are consensual, treatment of COPD should be patient-oriented. PMID:26655798

  4. Sparc: a sparsity-based consensus algorithm for long erroneous sequencing reads

    PubMed Central

    2016-01-01

    Motivation. The third generation sequencing (3GS) technology generates long sequences of thousands of bases. However, its current error rates are estimated in the range of 15–40%, significantly higher than those of the prevalent next generation sequencing (NGS) technologies (less than 1%). Fundamental bioinformatics tasks such as de novo genome assembly and variant calling require high-quality sequences that need to be extracted from these long but erroneous 3GS sequences. Results. We describe a versatile and efficient linear complexity consensus algorithm Sparc to facilitate de novo genome assembly. Sparc builds a sparse k-mer graph using a collection of sequences from a targeted genomic region. The heaviest path which approximates the most likely genome sequence is searched through a sparsity-induced reweighted graph as the consensus sequence. Sparc supports using NGS and 3GS data together, which leads to significant improvements in both cost efficiency and computational efficiency. Experiments with Sparc show that our algorithm can efficiently provide high-quality consensus sequences using both PacBio and Oxford Nanopore sequencing technologies. With only 30× PacBio data, Sparc can reach a consensus with error rate <0.5%. With the more challenging Oxford Nanopore data, Sparc can also achieve similar error rate when combined with NGS data. Compared with the existing approaches, Sparc calculates the consensus with higher accuracy, and uses approximately 80% less memory and time. Availability. The source code is available for download at https://github.com/yechengxi/Sparc. PMID:27330851

  5. Physicochemical property consensus sequences for functional analysis, design of multivalent antigens and targeted antivirals

    PubMed Central

    2012-01-01

    Background Analysis of large sets of biological sequence data from related strains or organisms is complicated by superficial redundancy in the set, which may contain many members that are identical except at one or two positions. Thus a new method, based on deriving physicochemical property (PCP)-consensus sequences, was tested for its ability to generate reference sequences and distinguish functionally significant changes from background variability. Methods The PCP consensus program was used to automatically derive consensus sequences starting from sequence alignments of proteins from Flaviviruses (from the Flavitrack database) and human enteroviruses, using a five dimensional set of Eigenvectors that summarize over 200 different scalar values for the PCPs of the amino acids. A PCP-consensus protein of a Dengue virus envelope protein was produced recombinantly and tested for its ability to bind antibodies to strains using ELISA. Results PCP-consensus sequences of the flavivirus family could be used to classify them into five discrete groups and distinguish areas of the envelope proteins that correlate with host specificity and disease type. A multivalent Dengue virus antigen was designed and shown to bind antibodies against all four DENV types. A consensus enteroviral VPg protein had the same distinctive high pKa as wild type proteins and was recognized by two different polymerases. Conclusions The process for deriving PCP-consensus sequences for any group of aligned similar sequences, has been validated for sequences with up to 50% diversity. Ongoing projects have shown that the method identifies residues that significantly alter PCPs at a given position, and might thus cause changes in function or immunogenicity. Other potential applications include deriving target proteins for drug design and diagnostic kits. PMID:23320474

  6. Reconstruction and applications of consensus yeast metabolic network based on RNA sequencing.

    PubMed

    Zhao, Yuqi; Wang, Yanjie; Zou, Lei; Huang, Jingfei

    2016-04-01

    One practical application of genome-scale metabolic reconstructions is to interrogate multispecies relationships. Here, we report a consensus metabolic model in four yeast species (Saccharomyces cerevisiae, S. paradoxus, S. mikatae, and S. bayanus) by integrating metabolic network simulations with RNA sequencing (RNA-seq) datasets. We generated high-resolution transcriptome maps of four yeast species through de novo assembly and genome-guided approaches. The transcriptomes were annotated and applied to build the consensus metabolic network, which was verified using independent RNA-seq experiments. The expression profiles reveal that the genes involved in amino acid and lipid metabolism are highly coexpressed. The diverse phenotypic characteristics, such as cellular growth and gene deletions, can be simulated using the metabolic model. We also explored the applications of the consensus model in metabolic engineering using yeast-specific reactions and biofuel production as examples. Similar strategies will benefit communities studying genome-scale metabolic networks of other organisms. PMID:27239440

  7. The consensus sequence for self-catalyzed site-specific G residue depurination in DNA.

    PubMed

    Amosova, Olga; Smith, Alexander; Fresco, Jacques R

    2011-10-21

    The sequence variation tolerated within the stem-loop-forming genomic consensus sequence for self-catalyzed site-specific depurination of G residues is explored. The variation in self-depurination kinetics with sequence changes in the loop residues and stem base pairs, as well as with pH, provides insights into the self-catalytic mechanism. The observations suggest that self-catalyzed depurination of the 5' G residue of the loop consensus sequence 5'-G(T/A)GG-3' probably involves formation of some intraloop hydrogen-bonded base pair with the 3'-terminal G residue; although the electronic structure of both these G residues is retained, their 2-amino substituents are not critical for that interaction. The strong dependence of the self-depurination kinetics on stem stability suggests that the lifetime of some strained form of the loop is controlled by the integrity of the stem. In addition to the effects of length and base pair sequence on stem stability, there is a base pair requirement at the base of the loop: self-depurination is suppressed by 5'-C·G-3', 5'-A·T-3', or a mismatch but is most favored by 5'T·A3' and less so by 5'-G·C-3'. The occurrence in T and G of a similarly located carbonyl capable of hydrogen-bonding to the water molecule required for glycosyl bond hydrolysis may explain this sequence requirement. In toto, the more complete definition of the consensus sequence provided by this investigation enables a more accurate estimation of their number in the human genome and their distribution among different genes.

  8. The iceLogo web server and SOAP service for determining protein consensus sequences.

    PubMed

    Maddelein, Davy; Colaert, Niklaas; Buchanan, Iain; Hulstaert, Niels; Gevaert, Kris; Martens, Lennart

    2015-07-01

    The iceLogo web server and SOAP service implement the previously published iceLogo algorithm. iceLogo builds on probability theory to visualize protein consensus sequences in a format resembling sequence logos. Peptide sequences are compared against a reference sequence set that can be tailored to the studied system and the used protocol. As such, not only over- but also underrepresented residues can be visualized in a statistically sound manner, which further allows the user to easily analyse and interpret conserved sequence patterns in proteins. The web application and SOAP service can be found free and open to all users without the need for a login on http://iomics.ugent.be/icelogoserver/main.html.

  9. Mutation of putative branchpoint consensus sequences in plant introns reduces splicing efficiency.

    PubMed

    Simpson, C G; Clark, G; Davidson, D; Smith, P; Brown, J W

    1996-03-01

    Intron lariat formation between the 5' end of an intron and a branchpoint adenosine is a fundamental aspect of the first step in animal and yeast nuclear pre-mRNA splicing. Despite similarities in intron sequence requirements and the components of splicing, differences exist between the splicing of plant and vertebrate introns. The identification of AU-rich sequences as major functional elements in plant introns and the demonstration that a branchpoint consensus sequence was not required for splicing have led to the suggestion that the transition from AU-rich intron to GC-rich exon is a major potential signal by which plant pre-mRNA splice sites are recognized. The role of putative branchpoint sequences as an internal signal in plant intron recognition/definition has been re-examined. Single nucleotide mutations in putative branchpoint adenosines contained within CUNAN sequences in four different plant introns all significantly reduced splicing efficiency. These results provide the most direct evidence to date for preferred branchpoint sequences being required for the efficient splicing of at least some plant introns in addition to the important role played by AU sequences in dicot intron recognition. The observed patterns of 3' splice site selection in the introns studied are consistent with the scanning model described for animal intron 3' splice site selection. It is suggested that, despite the clear importance of AU sequences for plant intron splicing, the fundamental processes of splice site selection and splicing in plants are similar to those in animals.

  10. dnaMATE: a consensus melting temperature prediction server for short DNA sequences.

    PubMed

    Panjkovich, Alejandro; Norambuena, Tomás; Melo, Francisco

    2005-07-01

    An accurate and robust large-scale melting temperature prediction server for short DNA sequences is dispatched. The server calculates a consensus melting temperature value using the nearest-neighbor model based on three independent thermodynamic data tables. The consensus method gives an accurate prediction of melting temperature, as it has been recently demonstrated in a benchmark performed using all available experimental data for DNA sequences within the length range of 16-30 nt. This constitutes the first web server that has been implemented to perform a large-scale calculation of melting temperatures in real time (up to 5000 DNA sequences can be submitted in a single run). The expected accuracy of calculations carried out by this server in the range of 50-600 mM monovalent salt concentration is that 89% of the melting temperature predictions will have an error or deviation of <5 degrees C from experimental data. The server can be freely accessed at http://dna.bio.puc.cl/tm.html. The standalone executable versions of this software for LINUX, Macintosh and Windows platforms are also freely available at the same web site. Detailed further information supporting this server is available at the same web site referenced above.

  11. Identification of Phosphorylation Consensus Sequences and Endogenous Neuronal Substrates of the Psychiatric Risk Kinase TNIK.

    PubMed

    Wang, Qi; Amato, Stephen P; Rubitski, David M; Hayward, Matthew M; Kormos, Bethany L; Verhoest, Patrick R; Xu, Lan; Brandon, Nicholas J; Ehlers, Michael D

    2016-02-01

    Traf2- and Nck-interacting kinase (TNIK) is a serine/threonine kinase highly expressed in the brain and enriched in the postsynaptic density of glutamatergic synapses in the mammalian brain. Accumulating genetic evidence and functional data have implicated TNIK as a risk factor for psychiatric disorders. However, the endogenous substrates of TNIK in neurons are unknown. Here, we describe a novel selective small molecule inhibitor of the TNIK kinase family. Using this inhibitor, we report the identification of endogenous neuronal TNIK substrates by immunoprecipitation with a phosphomotif antibody followed by mass spectrometry. Phosphorylation consensus sequences were defined by phosphopeptide sequence analysis. Among the identified substrates were members of the delta-catenin family including p120-catenin, δ-catenin, and armadillo repeat gene deleted in velo-cardio-facial syndrome (ARVCF), each of which is linked to psychiatric or neurologic disorders. Using p120-catenin as a representative substrate, we show TNIK-induced p120-catenin phosphorylation in cells requires intact kinase activity and phosphorylation of TNIK at T181 and T187 in the activation loop. Addition of the small molecule TNIK inhibitor or knocking down TNIK by two shRNAs reduced endogenous p120-catenin phosphorylation in cells. Together, using a TNIK inhibitor and phosphomotif antibody, we identify endogenous substrates of TNIK in neurons, define consensus sequences for TNIK, and suggest signaling pathways by which TNIK influences synaptic development and function linked to psychiatric and neurologic disorders. PMID:26645429

  12. A plant viral coat protein RNA binding consensus sequence contains a crucial arginine.

    PubMed Central

    Ansel-McKinney, P; Scott, S W; Swanson, M; Ge, X; Gehrke, L

    1996-01-01

    A defining feature of alfalfa mosaic virus (AMV) and ilarviruses [type virus: tobacco streak virus (TSV)] is that, in addition to genomic RNAs, viral coat protein is required to establish infection in plants. AMV and TSV coat proteins, which share little primary amino acid sequence identity, are functionally interchangeable in RNA binding and initiation of infection. The lysine-rich amino-terminal RNA binding domain of the AMV coat protein lacks previously identified RNA binding motifs. Here, the AMV coat protein RNA binding domain is shown to contain a single arginine whose specific side chain and position are crucial for RNA binding. In addition, the putative RNA binding domain of two ilarvirus coat proteins, TSV and citrus variegation virus, is identified and also shown to contain a crucial arginine. AMV and ilarvirus coat protein sequence alignment centering on the key arginine revealed a new RNA binding consensus sequence. This consensus may explain in part why heterologous viral RNA-coat protein mixtures are infectious. Images PMID:8890181

  13. PDP-CON: prediction of domain/linker residues in protein sequences using a consensus approach.

    PubMed

    Chatterjee, Piyali; Basu, Subhadip; Zubek, Julian; Kundu, Mahantapas; Nasipuri, Mita; Plewczynski, Dariusz

    2016-04-01

    The prediction of domain/linker residues in protein sequences is a crucial task in the functional classification of proteins, homology-based protein structure prediction, and high-throughput structural genomics. In this work, a novel consensus-based machine-learning technique was applied for residue-level prediction of the domain/linker annotations in protein sequences using ordered/disordered regions along protein chains and a set of physicochemical properties. Six different classifiers-decision tree, Gaussian naïve Bayes, linear discriminant analysis, support vector machine, random forest, and multilayer perceptron-were exhaustively explored for the residue-level prediction of domain/linker regions. The protein sequences from the curated CATH database were used for training and cross-validation experiments. Test results obtained by applying the developed PDP-CON tool to the mutually exclusive, independent proteins of the CASP-8, CASP-9, and CASP-10 databases are reported. An n-star quality consensus approach was used to combine the results yielded by different classifiers. The average PDP-CON accuracy and F-measure values for the CASP targets were found to be 0.86 and 0.91, respectively. The dataset, source code, and all supplementary materials for this work are available at https://cmaterju.org/cmaterbioinfo/ for noncommercial use.

  14. Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences.

    PubMed

    Rose, T M; Schultz, E R; Henikoff, J G; Pietrokovski, S; McCallum, C M; Henikoff, S

    1998-04-01

    We describe a new primer design strategy for PCR amplification of unknown targets that are related to multiply-aligned protein sequences. Each primer consists of a short 3' degenerate core region and a longer 5' consensus clamp region. Only 3-4 highly conserved amino acid residues are necessary for design of the core, which is stabilized by the clamp during annealing to template molecules. During later rounds of amplification, the non-degenerate clamp permits stable annealing to product molecules. We demonstrate the practical utility of this hybrid primer method by detection of diverse reverse transcriptase-like genes in a human genome, and by detection of C5DNA methyltransferase homologs in various plant DNAs. In each case, amplified products were sufficiently pure to be cloned without gel fractionation. This COnsensus-DEgenerate Hybrid Oligonucleotide Primer (CODEHOP) strategy has been implemented as a computer program that is accessible over the World Wide Web (http://blocks.fhcrc.org/codehop.html) and is directly linked from the BlockMaker multiple sequence alignment site for hybrid primer prediction beginning with a set of related protein sequences.

  15. Application of circular consensus sequencing and network analysis to characterize the bovine IgG repertoire

    PubMed Central

    2012-01-01

    Background Vertebrate immune systems generate diverse repertoires of antibodies capable of mediating response to a variety of antigens. Next generation sequencing methods provide unique approaches to a number of immuno-based research areas including antibody discovery and engineering, disease surveillance, and host immune response to vaccines. In particular, single-molecule circular consensus sequencing permits the sequencing of antibody repertoires at previously unattainable depths of coverage and accuracy. We approached the bovine immunoglobulin G (IgG) repertoire with the objective of characterizing diversity of expressed IgG transcripts. Here we present single-molecule real-time sequencing data of expressed IgG heavy-chain repertoires of four individual cattle. We describe the diversity observed within antigen binding regions and visualize this diversity using a network-based approach. Results We generated 49,945 high quality cDNA sequences, each spanning the entire IgG variable region from four Bos taurus calves. From these sequences we identified 49,521 antigen binding regions using the automated Paratome web server. Approximately 9% of all unique complementarity determining 2 (CDR2) sequences were of variable lengths. A bimodal distribution of unique CDR3 sequence lengths was observed, with common lengths of 5–6 and 21–25 amino acids. The average number of cysteine residues in CDR3s increased with CDR3 length and we observed that cysteine residues were centrally located in CDR3s. We identified 19 extremely long CDR3 sequences (up to 62 amino acids in length) within IgG transcripts. Network analyses revealed distinct patterns among the expressed IgG antigen binding repertoires of the examined individuals. Conclusions We utilized circular consensus sequencing technology to provide baseline data of the expressed bovine IgG repertoire that can be used for future studies important to livestock research. Somatic mutation resulting in base insertions and

  16. Consensus Genotyper for Exome Sequencing (CGES): improving the quality of exome variant genotypes

    PubMed Central

    Trubetskoy, Vassily; Rodriguez, Alex; Dave, Uptal; Campbell, Nicholas; Crawford, Emily L.; Cook, Edwin H.; Sutcliffe, James S.; Foster, Ian; Madduri, Ravi; Cox, Nancy J.; Davis, Lea K.

    2015-01-01

    Motivation: The development of cost-effective next-generation sequencing methods has spurred the development of high-throughput bioinformatics tools for detection of sequence variation. With many disparate variant-calling algorithms available, investigators must ask, ‘Which method is best for my data?’ Machine learning research has shown that so-called ensemble methods that combine the output of multiple models can dramatically improve classifier performance. Here we describe a novel variant-calling approach based on an ensemble of variant-calling algorithms, which we term the Consensus Genotyper for Exome Sequencing (CGES). CGES uses a two-stage voting scheme among four algorithm implementations. While our ensemble method can accept variants generated by any variant-calling algorithm, we used GATK2.8, SAMtools, FreeBayes and Atlas-SNP2 in building CGES because of their performance, widespread adoption and diverse but complementary algorithms. Results: We apply CGES to 132 samples sequenced at the Hudson Alpha Institute for Biotechnology (HAIB, Huntsville, AL) using the Nimblegen Exome Capture and Illumina sequencing technology. Our sample set consisted of 40 complete trios, two families of four, one parent–child duo and two unrelated individuals. CGES yielded the fewest total variant calls (NCGES=139°897), the highest Ts/Tv ratio (3.02), the lowest Mendelian error rate across all genotypes (0.028%), the highest rediscovery rate from the Exome Variant Server (EVS; 89.3%) and 1000 Genomes (1KG; 84.1%) and the highest positive predictive value (PPV; 96.1%) for a random sample of previously validated de novo variants. We describe these and other quality control (QC) metrics from consensus data and explain how the CGES pipeline can be used to generate call sets of varying quality stringency, including consensus calls present across all four algorithms, calls that are consistent across any three out of four algorithms, calls that are consistent across any two out

  17. Dup-24 bp in the CHIT1 Gene in Six Mexican Amerindian Populations.

    PubMed

    Da Silva-José, T D; Juárez-Rendón, K J; Juárez-Osuna, J A; Porras-Dorantes, A; Valladares-Salgado, A; Cruz, M; Gonzalez-Ibarra, M; Soto, A G; Magaña-Torres, M T; Sandoval-Ramírez, L; García-Ortiz, José Elías

    2015-01-01

    Chitotriosidase (CHIT, EC 3.2.1.14) is an enzyme secreted by activated macrophages with the ability to hydrolyze the chitin of pathogens. The high activity of this enzyme has been used as a secondary biomarker of response to treatment in patients with Gaucher disease (OMIM 230800). Within the world's population, approximately 6% is homozygous and 35% is heterozygous for the most common polymorphism in the CHIT1 gene, a 24-bp duplication (dup-24 bp), with homozygosity of this duplication causing inactivation of the enzyme but without major consequences for health. To determine the frequency of the dup-24 bp CHIT1 gene in indigenous populations from Mexico, 692 samples were analyzed: Purepecha (49), Tarahumara (97), Huichol (97), Mayan (139), Tenek (97), and Nahua (213). We found that the groups were in Hardy-Weinberg equilibrium. The dup-24 bp allele frequency was found to be (in order of highest to lowest) 37% (Mayan), 34% (Huichol and Nahua), 33% (Purepecha), 31% (Tenek), and 29% (Tarahumara).

  18. AMS 4.0: consensus prediction of post-translational modifications in protein sequences.

    PubMed

    Plewczynski, Dariusz; Basu, Subhadip; Saha, Indrajit

    2012-08-01

    We present here the 2011 update of the AutoMotif Service (AMS 4.0) that predicts the wide selection of 88 different types of the single amino acid post-translational modifications (PTM) in protein sequences. The selection of experimentally confirmed modifications is acquired from the latest UniProt and Phospho.ELM databases for training. The sequence vicinity of each modified residue is represented using amino acids physico-chemical features encoded using high quality indices (HQI) obtaining by automatic clustering of known indices extracted from AAindex database. For each type of the numerical representation, the method builds the ensemble of Multi-Layer Perceptron (MLP) pattern classifiers, each optimising different objectives during the training (for example the recall, precision or area under the ROC curve (AUC)). The consensus is built using brainstorming technology, which combines multi-objective instances of machine learning algorithm, and the data fusion of different training objects representations, in order to boost the overall prediction accuracy of conserved short sequence motifs. The performance of AMS 4.0 is compared with the accuracy of previous versions, which were constructed using single machine learning methods (artificial neural networks, support vector machine). Our software improves the average AUC score of the earlier version by close to 7 % as calculated on the test datasets of all 88 PTM types. Moreover, for the selected most-difficult sequence motifs types it is able to improve the prediction performance by almost 32 %, when compared with previously used single machine learning methods. Summarising, the brainstorming consensus meta-learning methodology on the average boosts the AUC score up to around 89 %, averaged over all 88 PTM types. Detailed results for single machine learning methods and the consensus methodology are also provided, together with the comparison to previously published methods and state-of-the-art software tools. The

  19. Consensus Sequence of 27 African Horse Sickness Virus Genomes from Viruses Collected over a 76-Year Period (1933 to 2009)

    PubMed Central

    Wright, Isabella M.; van Dijk, Alberdina A.

    2015-01-01

    We announce the complete consensus genome sequence of 27 African horse sickness viruses, representing all nine African horse sickness virus (AHSV) serotypes from historical and recent isolates collected over a 76-year period (1933 to 2009). The data set includes the sequence of the virulent Office International des Epizooties AHSV reference strains which are not adapted to cell culture. PMID:26358586

  20. Context based computational analysis and characterization of ARS consensus sequences (ACS) of Saccharomyces cerevisiae genome.

    PubMed

    Singh, Vinod Kumar; Krishnamachari, Annangarachari

    2016-09-01

    Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS) requires an essential consensus sequence (ACS) for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC) denoted as ORC-ACS and non-replicating ACS sequences (nrACS), that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme. PMID:27508123

  1. A High Quality Draft Consensus Sequence of the Genome of a Heterozygous Grapevine Variety

    PubMed Central

    Cartwright, Dustin A.; Cestaro, Alessandro; Pruss, Dmitry; Pindo, Massimo; FitzGerald, Lisa M.; Vezzulli, Silvia; Reid, Julia; Malacarne, Giulia; Iliev, Diana; Coppola, Giuseppina; Wardell, Bryan; Micheletti, Diego; Macalma, Teresita; Facci, Marco; Mitchell, Jeff T.; Perazzolli, Michele; Eldredge, Glenn; Gatto, Pamela; Oyzerski, Rozan; Moretto, Marco; Gutin, Natalia; Stefanini, Marco; Chen, Yang; Segala, Cinzia; Davenport, Christine; Demattè, Lorenzo; Mraz, Amy; Battilana, Juri; Stormo, Keith; Costa, Fabrizio; Tao, Quanzhou; Si-Ammour, Azeddine; Harkins, Tim; Lackey, Angie; Perbost, Clotilde; Taillon, Bruce; Stella, Alessandra; Solovyev, Victor; Fawcett, Jeffrey A.; Sterck, Lieven; Vandepoele, Klaas; Grando, Stella M.; Toppo, Stefano; Moser, Claudio; Lanchbury, Jerry; Bogden, Robert; Skolnick, Mark; Sgaramella, Vittorio; Bhatnagar, Satish K.; Fontana, Paolo; Gutin, Alexander; Van de Peer, Yves; Salamini, Francesco; Viola, Roberto

    2007-01-01

    Background Worldwide, grapes and their derived products have a large market. The cultivated grape species Vitis vinifera has potential to become a model for fruit trees genetics. Like many plant species, it is highly heterozygous, which is an additional challenge to modern whole genome shotgun sequencing. In this paper a high quality draft genome sequence of a cultivated clone of V. vinifera Pinot Noir is presented. Principal Findings We estimate the genome size of V. vinifera to be 504.6 Mb. Genomic sequences corresponding to 477.1 Mb were assembled in 2,093 metacontigs and 435.1 Mb were anchored to the 19 linkage groups (LGs). The number of predicted genes is 29,585, of which 96.1% were assigned to LGs. This assembly of the grape genome provides candidate genes implicated in traits relevant to grapevine cultivation, such as those influencing wine quality, via secondary metabolites, and those connected with the extreme susceptibility of grape to pathogens. Single nucleotide polymorphism (SNP) distribution was consistent with a diffuse haplotype structure across the genome. Of around 2,000,000 SNPs, 1,751,176 were mapped to chromosomes and one or more of them were identified in 86.7% of anchored genes. The relative age of grape duplicated genes was estimated and this made possible to reveal a relatively recent Vitis-specific large scale duplication event concerning at least 10 chromosomes (duplication not reported before). Conclusions Sanger shotgun sequencing and highly efficient sequencing by synthesis (SBS), together with dedicated assembly programs, resolved a complex heterozygous genome. A consensus sequence of the genome and a set of mapped marker loci were generated. Homologous chromosomes of Pinot Noir differ by 11.2% of their DNA (hemizygous DNA plus chromosomal gaps). SNP markers are offered as a tool with the potential of introducing a new era in the molecular breeding of grape. PMID:18094749

  2. Structure elucidation of the Pribnow box consensus promoter sequence by racemic DNA crystallography

    PubMed Central

    Mandal, Pradeep K.; Collie, Gavin W.; Srivastava, Suresh C.; Kauffmann, Brice; Huc, Ivan

    2016-01-01

    It has previously been shown that the use of racemic mixtures of naturally chiral macromolecules such as protein and DNA can significantly aid the crystallogenesis process, thereby addressing one of the major bottlenecks to structure determination by X-ray crystallographic methods—that of crystal growth. Although previous studies have provided convincing evidence of the applicability of the racemic crystallization technique to DNA through the study of well-characterized DNA structures, we sought to apply this method to a historically challenging DNA sequence. For this purpose we chose a non-self-complementary DNA duplex containing the biologically-relevant Pribnow box consensus sequence ‘TATAAT’. Four racemic crystal structures of this previously un-crystallizable DNA target are reported (with resolutions in the range of 1.65–2.3 Å), with further crystallographic studies and structural analysis providing insight into the racemic crystallization process as well as structural details of this highly pertinent DNA sequence. PMID:27137886

  3. Enterobacterial Repetitive Intergenic Consensus Sequence Repeats in Yersiniae: Genomic Organization and Functional Properties

    PubMed Central

    De Gregorio, Eliana; Silvestro, Giustina; Petrillo, Mauro; Carlomagno, Maria Stella; Di Nocera, Pier Paolo

    2005-01-01

    Genome-wide analyses carried out in silico revealed that the DNA repeats called enterobacterial repetitive intergenic consensus sequences (ERICs), which are present in several Enterobacteriaceae, are overrepresented in yersiniae. From the alignment of DNA regions from the wholly sequenced Yersinia enterocolitica 8081 and Yersinia pestis CO92 strains, we could establish that ERICs are miniature mobile elements whose insertion leads to duplication of the dinucleotide TA. ERICs feature long terminal inverted repeats (TIRs) and can fold as RNA into hairpin structures. The proximity to coding regions suggests that most Y. enterocolitica ERICs are cotranscribed with flanking genes. Elements which either overlap or are located next to stop codons are preferentially inserted in the same (or B) orientation. In contrast, ERICs located far apart from open reading frames are inserted in the opposite (or A) orientation. The expression of genes cotranscribed with A- and B-oriented ERICs has been monitored in vivo. In mRNAs spanning B-oriented ERICs, upstream gene transcripts accumulated at lower levels than downstream gene transcripts. This difference was abolished by treating cells with chloramphenicol. We hypothesize that folding of B-oriented elements is impeded by translating ribosomes. Consequently, upstream RNA degradation is triggered by the unmasking of a site for the RNase E located in the right-hand TIR of ERIC. A-oriented ERICs may act in contrast as upstream RNA stabilizers or may have other functions. The hypothesis that ERICs act as regulatory RNA elements is supported by analyses carried out in Yersinia strains which either lack ERIC sequences or carry alternatively oriented ERICs at specific loci. PMID:16291667

  4. Improved metagenome assemblies and taxonomic binning using long-read circular consensus sequence data.

    PubMed

    Frank, J A; Pan, Y; Tooming-Klunderud, A; Eijsink, V G H; McHardy, A C; Nederbragt, A J; Pope, P B

    2016-01-01

    DNA assembly is a core methodological step in metagenomic pipelines used to study the structure and function within microbial communities. Here we investigate the utility of Pacific Biosciences long and high accuracy circular consensus sequencing (CCS) reads for metagenomic projects. We compared the application and performance of both PacBio CCS and Illumina HiSeq data with assembly and taxonomic binning algorithms using metagenomic samples representing a complex microbial community. Eight SMRT cells produced approximately 94 Mb of CCS reads from a biogas reactor microbiome sample that averaged 1319 nt in length and 99.7% accuracy. CCS data assembly generated a comparative number of large contigs greater than 1 kb, to those assembled from a ~190x larger HiSeq dataset (~18 Gb) produced from the same sample (i.e approximately 62% of total contigs). Hybrid assemblies using PacBio CCS and HiSeq contigs produced improvements in assembly statistics, including an increase in the average contig length and number of large contigs. The incorporation of CCS data produced significant enhancements in taxonomic binning and genome reconstruction of two dominant phylotypes, which assembled and binned poorly using HiSeq data alone. Collectively these results illustrate the value of PacBio CCS reads in certain metagenomics applications. PMID:27156482

  5. Improved metagenome assemblies and taxonomic binning using long-read circular consensus sequence data

    PubMed Central

    Frank, J. A.; Pan, Y.; Tooming-Klunderud, A.; Eijsink, V. G. H.; McHardy, A. C.; Nederbragt, A. J.; Pope, P. B.

    2016-01-01

    DNA assembly is a core methodological step in metagenomic pipelines used to study the structure and function within microbial communities. Here we investigate the utility of Pacific Biosciences long and high accuracy circular consensus sequencing (CCS) reads for metagenomic projects. We compared the application and performance of both PacBio CCS and Illumina HiSeq data with assembly and taxonomic binning algorithms using metagenomic samples representing a complex microbial community. Eight SMRT cells produced approximately 94 Mb of CCS reads from a biogas reactor microbiome sample that averaged 1319 nt in length and 99.7% accuracy. CCS data assembly generated a comparative number of large contigs greater than 1 kb, to those assembled from a ~190x larger HiSeq dataset (~18 Gb) produced from the same sample (i.e approximately 62% of total contigs). Hybrid assemblies using PacBio CCS and HiSeq contigs produced improvements in assembly statistics, including an increase in the average contig length and number of large contigs. The incorporation of CCS data produced significant enhancements in taxonomic binning and genome reconstruction of two dominant phylotypes, which assembled and binned poorly using HiSeq data alone. Collectively these results illustrate the value of PacBio CCS reads in certain metagenomics applications. PMID:27156482

  6. Current status and new features of the Consensus Coding Sequence database

    PubMed Central

    Farrell, Catherine M.; O’Leary, Nuala A.; Harte, Rachel A.; Loveland, Jane E.; Wilming, Laurens G.; Wallin, Craig; Diekhans, Mark; Barrell, Daniel; Searle, Stephen M. J.; Aken, Bronwen; Hiatt, Susan M.; Frankish, Adam; Suner, Marie-Marthe; Rajput, Bhanu; Steward, Charles A.; Brown, Garth R.; Bennett, Ruth; Murphy, Michael; Wu, Wendy; Kay, Mike P.; Hart, Jennifer; Rajan, Jeena; Weber, Janet; Snow, Catherine; Riddick, Lillian D.; Hunt, Toby; Webb, David; Thomas, Mark; Tamez, Pamela; Rangwala, Sanjida H.; McGarvey, Kelly M.; Pujar, Shashikant; Shkeda, Andrei; Mudge, Jonathan M.; Gonzalez, Jose M.; Gilbert, James G. R.; Trevanion, Stephen J.; Baertsch, Robert; Harrow, Jennifer L.; Hubbard, Tim; Ostell, James M.; Haussler, David; Pruitt, Kim D.

    2014-01-01

    The Consensus Coding Sequence (CCDS) project (http://www.ncbi.nlm.nih.gov/CCDS/) is a collaborative effort to maintain a dataset of protein-coding regions that are identically annotated on the human and mouse reference genome assemblies by the National Center for Biotechnology Information (NCBI) and Ensembl genome annotation pipelines. Identical annotations that pass quality assurance tests are tracked with a stable identifier (CCDS ID). Members of the collaboration, who are from NCBI, the Wellcome Trust Sanger Institute and the University of California Santa Cruz, provide coordinated and continuous review of the dataset to ensure high-quality CCDS representations. We describe here the current status and recent growth in the CCDS dataset, as well as recent changes to the CCDS web and FTP sites. These changes include more explicit reporting about the NCBI and Ensembl annotation releases being compared, new search and display options, the addition of biologically descriptive information and our approach to representing genes for which support evidence is incomplete. We also present a summary of recent and future curation targets. PMID:24217909

  7. Improved metagenome assemblies and taxonomic binning using long-read circular consensus sequence data.

    PubMed

    Frank, J A; Pan, Y; Tooming-Klunderud, A; Eijsink, V G H; McHardy, A C; Nederbragt, A J; Pope, P B

    2016-05-09

    DNA assembly is a core methodological step in metagenomic pipelines used to study the structure and function within microbial communities. Here we investigate the utility of Pacific Biosciences long and high accuracy circular consensus sequencing (CCS) reads for metagenomic projects. We compared the application and performance of both PacBio CCS and Illumina HiSeq data with assembly and taxonomic binning algorithms using metagenomic samples representing a complex microbial community. Eight SMRT cells produced approximately 94 Mb of CCS reads from a biogas reactor microbiome sample that averaged 1319 nt in length and 99.7% accuracy. CCS data assembly generated a comparative number of large contigs greater than 1 kb, to those assembled from a ~190x larger HiSeq dataset (~18 Gb) produced from the same sample (i.e approximately 62% of total contigs). Hybrid assemblies using PacBio CCS and HiSeq contigs produced improvements in assembly statistics, including an increase in the average contig length and number of large contigs. The incorporation of CCS data produced significant enhancements in taxonomic binning and genome reconstruction of two dominant phylotypes, which assembled and binned poorly using HiSeq data alone. Collectively these results illustrate the value of PacBio CCS reads in certain metagenomics applications.

  8. Eliciting neutralizing antibodies with gp120 outer domain constructs based on M-group consensus sequence.

    PubMed

    Qin, Yali; Banasik, Marisa; Kim, SoonJeung; Penn-Nicholson, Adam; Habte, Habtom H; LaBranche, Celia; Montefiori, David C; Wang, Chong; Cho, Michael W

    2014-08-01

    One strategy being evaluated for HIV-1 vaccine development is focusing immune responses towards neutralizing epitopes on the gp120 outer domain (OD) by removing the immunodominant, but non-neutralizing, inner domain. Previous OD constructs have not elicited strong neutralizing antibodies (nAbs). We constructed two immunogens, a monomeric gp120-OD and a trimeric gp120-OD×3, based on an M group consensus sequence (MCON6). Their biochemical and immunological properties were compared with intact gp120. Results indicated better preservation of critical neutralizing epitopes on gp120-OD×3. In contrast to previous studies, our immunogens induced potent, cross-reactive nAbs in rabbits. Although nAbs primarily targeted Tier 1 viruses, they exhibited significant breadth. Epitope mapping analyses indicated that nAbs primarily targeted conserved V3 loop elements. Although the potency and breadth of nAbs were similar for all three immunogens, nAb induction kinetics indicated that gp120-OD×3 was superior to gp120-OD, suggesting that gp120-OD×3 is a promising prototype for further gp120 OD-based immunogen development. PMID:25046154

  9. Eliciting Neutralizing Antibodies with gp120 Outer Domain Constructs Based on M-Group Consensus Sequence

    PubMed Central

    Qin, Yali; Banasik, Marisa; Kim, SoonJeung; Penn-Nicholson, Adam; Habte, Habtom H; Labranche, Celia; Montefiori, David C; Wang, Chong; Cho, Michael W

    2014-01-01

    One strategy being evaluated for HIV-1 vaccine development is focusing immune responses towards neutralizing epitopes on the gp120 outer domain (OD) by removing the immunodominant, but non-neutralizing, inner domain. Previous OD constructs have not elicited strong neutralizing antibodies (nAbs). We constructed two immunogens, a monomeric gp120-OD and a trimeric gp120-OD×3, based on an M group consensus sequence (MCON6). Their biochemical and immunological properties were compared with intact gp120. Results indicated better preservation of critical neutralizing epitopes on gp120-OD×3. In contrast to previous studies, our immunogens induced potent, cross-reactive nAbs in rabbits. Although nAbs primarily targeted Tier 1 viruses, they exhibited significant breadth. Epitope mapping analyses indicated that nAbs primarily targeted conserved V3 loop elements. Although the potency and breadth of nAbs were similar for all three immunogens, nAb induction kinetics indicated that gp120-OD×3 was superior to gp120-OD, suggesting that gp120-OD×3 is a promising prototype for further gp120 OD-based immunogen development. PMID:25046154

  10. Does 24bp Duplication of Human CHIT1 Gene (Chitotriosidase1) Predispose to Filarial Chyluria? A Case-Control Study

    PubMed Central

    Pant, Shriya; Agarwal, Jyotsna; Gangwar, Pravin K; Waseem, Mohammad; Gupta, Prashant; Sankhwar, Satya N; Purkait, Bimalesh

    2016-01-01

    Introduction Chyluria which is endemic in many parts of the world is mainly caused by Wuchereria bancrofti. CHIT1 (chitotriosidase) is produced by macrophages and plays an important role in the defense against chitin containing pathogen such as filarial parasite. Variation in the coding region with 24 bp duplication allele results in reduced CHIT1 activity that enhance the survival of parasite which may play a role in the occurrence of disease. Aim To examine the role of 24bp duplication of CHIT1 gene in patients of filarial chyluria (FC). Materials and Methods A case-control study was carried out where 155 confirmed FC patients and equal number of age-, sex- and residence-matched controls without any symptoms or signs of lymphatic filariasis, confirmed by negative immunochromatographic card test (ICT) and IgG/IgM combo rapid antibody test, from a hospital-based population were enrolled. Filarial aetiology was confirmed on the basis of DEC-provocative test (Giemsa staining), ICT and IgG/IgM- antifiarial antibody test. The patients positive by either of these tests were enrolled as FC cases. 24bp duplication in CHIT1 gene in FC was detected by the product size 99bp of amplified gene using polymerase chain reaction. Results The mean ages of patients and controls were 38.25±12.09 and 35.45±12.53 years, respectively while male: female ratio was 2.4:1. The mean duration of illness in chyluria patients was 62.81±60.83 months and mean number of episodes was 2.54±1.11. Homozygous wild type, heterozygous and homozygous mutant frequencies were 10.3%, 81.3% and 8.4% in FC patients and 18.7%, 75.5%, and 5.8% in controls, respectively. The 24bp duplication in CHIT1 gene showed a significant association in Heterozygous (HT) genotype with Odd Ratio (OR) of 1.95, 95% Confidence Interval (CI) (1.01-3.77); p=0.04. However, the homozygous mutant genotype (TT) was found to be non-significant with OR of 2.61, 95% CI (0.91-7.45); p=0.07. The combination of both HT+TT was also found

  11. Energy-based RNA consensus secondary structure prediction in multiple sequence alignments.

    PubMed

    Washietl, Stefan; Bernhart, Stephan H; Kellis, Manolis

    2014-01-01

    Many biologically important RNA structures are conserved in evolution leading to characteristic mutational patterns. RNAalifold is a widely used program to predict consensus secondary structures in multiple alignments by combining evolutionary information with traditional energy-based RNA folding algorithms. Here we describe the theory and applications of the RNAalifold algorithm. Consensus secondary structure prediction not only leads to significantly more accurate structure models, but it also allows to study structural conservation of functional RNAs. PMID:24639158

  12. Energy-based RNA consensus secondary structure prediction in multiple sequence alignments.

    PubMed

    Washietl, Stefan; Bernhart, Stephan H; Kellis, Manolis

    2014-01-01

    Many biologically important RNA structures are conserved in evolution leading to characteristic mutational patterns. RNAalifold is a widely used program to predict consensus secondary structures in multiple alignments by combining evolutionary information with traditional energy-based RNA folding algorithms. Here we describe the theory and applications of the RNAalifold algorithm. Consensus secondary structure prediction not only leads to significantly more accurate structure models, but it also allows to study structural conservation of functional RNAs.

  13. A consensus linkage map for sugi (Cryptomeria japonica) from two pedigrees, based on microsatellites and expressed sequence tags.

    PubMed Central

    Tani, Naoki; Takahashi, Tomokazu; Iwata, Hiroyoshi; Mukai, Yuzuru; Ujino-Ihara, Tokuko; Matsumoto, Asako; Yoshimura, Kensuke; Yoshimaru, Hiroshi; Murai, Masafumi; Nagasaka, Kazutoshi; Tsumura, Yoshihiko

    2003-01-01

    A consensus map for sugi (Cryptomeria japonica) was constructed by integrating linkage data from two unrelated third-generation pedigrees, one derived from a full-sib cross and the other by self-pollination of F1 individuals. The progeny segregation data of the first pedigree were derived from cleaved amplified polymorphic sequences, microsatellites, restriction fragment length polymorphisms, and single nucleotide polymorphisms. The data of the second pedigree were derived from cleaved amplified polymorphic sequences, isozyme markers, morphological traits, random amplified polymorphic DNA markers, and restriction fragment length polymorphisms. Linkage analyses were done for the first pedigree with JoinMap 3.0, using its parameter set for progeny derived by cross-pollination, and for the second pedigree with the parameter set for progeny derived from selfing of F1 individuals. The 11 chromosomes of C. japonica are represented in the consensus map. A total of 438 markers were assigned to 11 large linkage groups, 1 small linkage group, and 1 nonintegrated linkage group from the second pedigree; their total length was 1372.2 cM. On average, the consensus map showed 1 marker every 3.0 cM. PCR-based codominant DNA markers such as cleaved amplified polymorphic sequences and microsatellite markers were distributed in all linkage groups and occupied about half of mapped loci. These markers are very useful for integration of different linkage maps, QTL mapping, and comparative mapping for evolutional study, especially for species with a large genome size such as conifers. PMID:14668402

  14. Identification and Tracing of Bifidobacterium Species by Use of Enterobacterial Repetitive Intergenic Consensus Sequences

    PubMed Central

    Ventura, Marco; Meylan, Valerie; Zink, Ralf

    2003-01-01

    Eighty-nine Bifidobacterium strains from 26 species were identified and classified to the species level with an enterobacterial repetitive intergenic consensus (ERIC)-PCR approach. We demonstrated that ERIC-PCR is useful for a phylogenetic and taxonomical analysis but as well as for a species composition analysis of mixed bifidobacterial cultures isolated from dairy products and other environments. PMID:12839818

  15. Defining a Conformational Consensus Motif in Cotransin-Sensitive Signal Sequences: A Proteomic and Site-Directed Mutagenesis Study

    PubMed Central

    Klein, Wolfgang; Westendorf, Carolin; Schmidt, Antje; Conill-Cortés, Mercè; Rutz, Claudia; Blohs, Marcus; Beyermann, Michael; Protze, Jonas; Krause, Gerd; Krause, Eberhard; Schülein, Ralf

    2015-01-01

    The cyclodepsipeptide cotransin was described to inhibit the biosynthesis of a small subset of proteins by a signal sequence-discriminatory mechanism at the Sec61 protein-conducting channel. However, it was not clear how selective cotransin is, i.e. how many proteins are sensitive. Moreover, a consensus motif in signal sequences mediating cotransin sensitivity has yet not been described. To address these questions, we performed a proteomic study using cotransin-treated human hepatocellular carcinoma cells and the stable isotope labelling by amino acids in cell culture technique in combination with quantitative mass spectrometry. We used a saturating concentration of cotransin (30 micromolar) to identify also less-sensitive proteins and to discriminate the latter from completely resistant proteins. We found that the biosynthesis of almost all secreted proteins was cotransin-sensitive under these conditions. In contrast, biosynthesis of the majority of the integral membrane proteins was cotransin-resistant. Cotransin sensitivity of signal sequences was neither related to their length nor to their hydrophobicity. Instead, in the case of signal anchor sequences, we identified for the first time a conformational consensus motif mediating cotransin sensitivity. PMID:25806945

  16. Defining a conformational consensus motif in cotransin-sensitive signal sequences: a proteomic and site-directed mutagenesis study.

    PubMed

    Klein, Wolfgang; Westendorf, Carolin; Schmidt, Antje; Conill-Cortés, Mercè; Rutz, Claudia; Blohs, Marcus; Beyermann, Michael; Protze, Jonas; Krause, Gerd; Krause, Eberhard; Schülein, Ralf

    2015-01-01

    The cyclodepsipeptide cotransin was described to inhibit the biosynthesis of a small subset of proteins by a signal sequence-discriminatory mechanism at the Sec61 protein-conducting channel. However, it was not clear how selective cotransin is, i.e. how many proteins are sensitive. Moreover, a consensus motif in signal sequences mediating cotransin sensitivity has yet not been described. To address these questions, we performed a proteomic study using cotransin-treated human hepatocellular carcinoma cells and the stable isotope labelling by amino acids in cell culture technique in combination with quantitative mass spectrometry. We used a saturating concentration of cotransin (30 micromolar) to identify also less-sensitive proteins and to discriminate the latter from completely resistant proteins. We found that the biosynthesis of almost all secreted proteins was cotransin-sensitive under these conditions. In contrast, biosynthesis of the majority of the integral membrane proteins was cotransin-resistant. Cotransin sensitivity of signal sequences was neither related to their length nor to their hydrophobicity. Instead, in the case of signal anchor sequences, we identified for the first time a conformational consensus motif mediating cotransin sensitivity.

  17. Development of amplified consensus genetic markers (ACGM) in Brassica napus from Arabidopsis thaliana sequences of known biological function.

    PubMed

    Brunel, D; Froger, N; Pelletier, G

    1999-06-01

    A method for the development of consensus genetic markers between species of the same taxonomic family is described in this paper. It is based on the conservation of the peptide sequences and on the potential polymorphism within non-coding sequences. Six loci sequenced from Arabidopsis thaliana, AG, LFY3, AP3, FAD7, FAD3, and ADH, were analysed for one ecotype of A. thaliana, four lines of Brassica napus, and one line for each parental species, Brassica oleracea and Brassica rapa. Positive amplifications with the degenerate primers showed one band for A. thaliana, two to four bands in rapeseed, and one to two bands in the parental species. Direct sequencing of the PCR products confirms their peptide similarity with the "mother" sequence. By comparison of intron sequences, the correspondence between each rapeseed gene and its homologue in one of the parental species can be determined without ambiguity. Another important result is the presence of a polymorphism inside these fragments between the rapeseed lines. This variability could generally be detected by differences of electrophoretic migration on long non-denaturing polyacrylamide gels. This method enables a quick and easy shuttle between A. thaliana and Brassica species without cloning.

  18. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  19. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  20. Binding of nuclear factors to the 5 prime -interferon consensus sequence of the HLA-A2 class I gene

    SciTech Connect

    Le Bouteiller, P.; Bogarad, L.D.; Roberts, M.R.; Ruddle, F.H. ); Barbosa, J.A. )

    1990-02-01

    To investigate the regulatory role of the conserved interferon consensus sequence (ICS) found in the 5{prime} flanking region of HLA class I genes, the authors studied the binding of nuclear proteins to the ICS of HLA-A2 gene (ICS-A2) by the gel shift assay. Nuclear extracts from several human cell lines expressing different levels of surface class I molecules reveal an ICS-A2-protein complex of similar mobility, the amount of which varies in a cell-type=dependent manner. In some cell lines, interferon-{gamma} treatment decreased the level of this complex. The overlapping enhancer A element also competes for the formation of this ICS-A2-protein complex. Footprinting and methylation interference analyses demonstrate that nuclear protein(s) protect specific sequences within the ICS-A2 element, suggesting that these protein(s) may represent interferon-sensitive transcription factors.

  1. Use of NS3 consensus primers for the polymerase chain reaction amplification and sequencing of dengue viruses and other flaviviruses.

    PubMed

    Chow, V T; Seah, C L; Chan, Y C

    1993-01-01

    Consensus primers for the polymerase chain reaction were designed based on conserved motifs within the serine protease and RNA helicase domains encoded by the NS 3 genes of dengue and other flaviviruses. Target fragments of 470 bp were amplified on cDNA templates synthesized from RNAs of dengue types 1, 2, 3, and 4, Japanese encephalitis, Kunjin, and yellow fever viruses using random or specific downstream primers. PCR of oligo(dT)-primed cDNAs from Japanese encephalitis and Kunjin viral RNAs did not yield target bands. As few as 10(3) copies of dengue viral RNA could be detected. Direct DNA sequencing of PCR products of reference strains of dengue 2 (NGC), Kunjin (MRM 61C) and yellow fever (17 D) viruses demonstrated complete concurrence with published data. However, 2 nucleotide differences were observed between our data for dengue 3 H87 strain and the published sequence, resulting in a single amino acid disparity. Differences at 21, 16, and 11 nucleotide positions were noted between dengue 1 Hawaii and S 275/90; dengue 4 H 241 and 814669; Japanese encephalitis Nakayama and JaOArS 982 viral strains, culminating in only 4, 1 and 1 amino acid residue differences, respectively. These amino acid disparities occurred outside putative active sites of the enzymatic domains, emphasizing the important role of the NS3 protein in flaviviral replication. This RNA-PCR consensus primer strategy coupled with DNA sequencing represents a valuable tool for the molecular diagnosis and epidemiology of dengue and other flaviviral infections.

  2. Evolution of the human immunodeficiency virus type 1 subtype-specific V3 domain is confined to a sequence space with a fixed distance to the subtype consensus.

    PubMed Central

    Lukashov, V V; Goudsmit, J

    1997-01-01

    Human immunodeficiency virus type 1 (HIV-1) strains can be separated into genetic subtypes based on phylogenetic analysis of the envelope gene. Once it had been shown that population-wide intrasubtype genetic variation of HIV-1 strains increases in the course of the AIDS epidemic, it remained uncertain whether HIV-1 subtypes are phenotypic entities spreading as distinct virus populations. To examine this, we applied Eigen's concepts of sequence geometry and fitness topography to the analysis of intrasubtype evolution of the gp120 V3 domain of HIV-1 subtypes A, B, C, and D in the course of the global AIDS epidemic. We observed that despite the high evolution rate of HIV-1, the nonsynonymous distances to the subtype consensus of sequences obtained early in the epidemic are similar to those obtained more than 10 years later, in contrast to the synonymous distances, which increased steadily over time. For HIV-1 subtype B, we observed that the evolution rate of the individual sequences is independent of their distance from the subtype B consensus, but for the individual sequences most distant from the consensus evolution away from the consensus is constrained. As a result, individual HIV-1 genomes fluctuate within a sequence space with fixed distance to the subtype consensus. Our findings suggest that the evolution of the V3 domain of HIV-1 subtypes A, B, C, and D is confined to an area in sequence space within a fixed distance to the consensus of a respective subtype. This in turn indicates that each HIV-1 subtype is a distinct viral quasispecies that is well adapted to the present environment, able to maintain its identity in the V3 region over time, and unlikely to merge during progression of the AIDS epidemic. PMID:9261350

  3. Structural analysis of the N- and C-termini in a peptide with consensus sequence.

    PubMed Central

    Gong, Y.; Zhou, H. X.; Guo, M.; Kallenbach, N. R.

    1995-01-01

    We present a structural analysis of a peptide, the sequence of which includes amino acids that show preferences for specific positions near the N- and C-termini in protein helices. This peptide has the sequence ac-YMSEDELKAAEAAFKRHGVP-amide, which includes a strong version of an N-terminal Harper-Rose capping box structure as well as a Gly located close to the C-terminus designed to elucidate its role in C-terminal capping. The sequence of five residues at the middle is inserted to separate effects at the two ends via a helix-stabilizing linker. Application of a simulated annealing procedure using interproton distance constraints derived from 1H NOESY experiments in water reveals the presence of a C-terminal structure in this model. The C-terminus forms a folded back structure in a significant fraction of structures generated by the annealing, in most of which Gly assumes an alpha L conformation. This structure occurs within a highly flexible region of the molecule and hence is occupied only a fraction of the time. PMID:8520470

  4. Regulation of the germinal center gene program by interferon (IFN) regulatory factor 8/IFN consensus sequence-binding protein

    PubMed Central

    Lee, Chang Hoon; Melchers, Mark; Wang, Hongsheng; Torrey, Ted A.; Slota, Rebecca; Qi, Chen-Feng; Kim, Ji Young; Lugar, Patricia; Kong, Hee Jeong; Farrington, Lila; van der Zouwen, Boris; Zhou, Jeff X.; Lougaris, Vassilios; Lipsky, Peter E.; Grammer, Amrie C.; Morse, Herbert C.

    2006-01-01

    Interferon (IFN) consensus sequence-binding protein/IFN regulatory factor 8 (IRF8) is a transcription factor that regulates the differentiation and function of macrophages, granulocytes, and dendritic cells through activation or repression of target genes. Although IRF8 is also expressed in lymphocytes, its roles in B cell and T cell maturation or function are ill defined, and few transcriptional targets are known. Gene expression profiling of human tonsillar B cells and mouse B cell lymphomas showed that IRF8 transcripts were expressed at highest levels in centroblasts, either from secondary lymphoid tissue or transformed cells. In addition, staining for IRF8 was most intense in tonsillar germinal center (GC) dark-zone centroblasts. To discover B cell genes regulated by IRF8, we transfected purified primary tonsillar B cells with enhanced green fluorescent protein–tagged IRF8, generated small interfering RNA knockdowns of IRF8 expression in a mouse B cell lymphoma cell line, and examined the effects of a null mutation of IRF8 on B cells. Each approach identified activation-induced cytidine deaminase (AICDA) and BCL6 as targets of transcriptional activation. Chromatin immunoprecipitation studies demonstrated in vivo occupancy of 5′ sequences of both genes by IRF8 protein. These results suggest previously unappreciated roles for IRF8 in the transcriptional regulation of B cell GC reactions that include direct regulation of AICDA and BCL6. PMID:16380510

  5. Regulation of the germinal center gene program by interferon (IFN) regulatory factor 8/IFN consensus sequence-binding protein.

    PubMed

    Lee, Chang Hoon; Melchers, Mark; Wang, Hongsheng; Torrey, Ted A; Slota, Rebecca; Qi, Chen-Feng; Kim, Ji Young; Lugar, Patricia; Kong, Hee Jeong; Farrington, Lila; van der Zouwen, Boris; Zhou, Jeff X; Lougaris, Vassilios; Lipsky, Peter E; Grammer, Amrie C; Morse, Herbert C

    2006-01-23

    Interferon (IFN) consensus sequence-binding protein/IFN regulatory factor 8 (IRF8) is a transcription factor that regulates the differentiation and function of macrophages, granulocytes, and dendritic cells through activation or repression of target genes. Although IRF8 is also expressed in lymphocytes, its roles in B cell and T cell maturation or function are ill defined, and few transcriptional targets are known. Gene expression profiling of human tonsillar B cells and mouse B cell lymphomas showed that IRF8 transcripts were expressed at highest levels in centroblasts, either from secondary lymphoid tissue or transformed cells. In addition, staining for IRF8 was most intense in tonsillar germinal center (GC) dark-zone centroblasts. To discover B cell genes regulated by IRF8, we transfected purified primary tonsillar B cells with enhanced green fluorescent protein-tagged IRF8, generated small interfering RNA knockdowns of IRF8 expression in a mouse B cell lymphoma cell line, and examined the effects of a null mutation of IRF8 on B cells. Each approach identified activation-induced cytidine deaminase (AICDA) and BCL6 as targets of transcriptional activation. Chromatin immunoprecipitation studies demonstrated in vivo occupancy of 5' sequences of both genes by IRF8 protein. These results suggest previously unappreciated roles for IRF8 in the transcriptional regulation of B cell GC reactions that include direct regulation of AICDA and BCL6.

  6. Characterization of Synthetic Chikungunya Viruses Based on the Consensus Sequence of Recent E1-226V Isolates

    PubMed Central

    Scholte, Florine E. M.; Tas, Ali; Martina, Byron E. E.; Cordioli, Paolo; Narayanan, Krishna; Makino, Shinji; Snijder, Eric J.; van Hemert, Martijn J.

    2013-01-01

    Chikungunya virus (CHIKV) is a mosquito-borne alphavirus that re-emerged in 2004 and has caused massive outbreaks in recent years. The lack of a licensed vaccine or treatment options emphasize the need to obtain more insight into the viral life cycle and CHIKV-host interactions. Infectious cDNA clones are important tools for such studies, and for mechanism of action studies on antiviral compounds. Existing CHIKV cDNA clones are based on a single genome from an individual clinical isolate, which is expected to have evolved specific characteristics in response to the host environment, and possibly also during subsequent cell culture passaging. To obtain a virus expected to have the general characteristics of the recent E1-226V CHIKV isolates, we have constructed a new CHIKV full-length cDNA clone, CHIKV LS3, based on the consensus sequence of their aligned genomes. Here we report the characterization of this synthetic virus and a green fluorescent protein-expressing variant (CHIKV LS3-GFP). Their characteristics were compared to those of natural strain ITA07-RA1, which was isolated during the 2007 outbreak in Italy. In cell culture the synthetic viruses displayed phenotypes comparable to the natural isolate, and in a mouse model they caused lethal infections that were indistinguishable from infections with a natural strain. Compared to ITA07-RA1 and clinical isolate NL10/152, the synthetic viruses displayed similar sensitivities to several antiviral compounds. 3-deaza-adenosine was identified as a new inhibitor of CHIKV replication. Cyclosporin A had no effect on CHIKV replication, suggesting that cyclophilins -opposite to what was found for other +RNA viruses- do not play an essential role in CHIKV replication. The characterization of the consensus sequence-based synthetic viruses and their comparison to natural isolates demonstrated that CHIKV LS3 and LS3-GFP are suitable and representative tools to study CHIKV-host interactions, screen for antiviral compounds and

  7. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome.

    PubMed

    Kumar, Ashutosh; Singh, Himanshu N; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)-microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker "retinoic acid" in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5'-AGGTCA-3') in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and embryological

  8. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome.

    PubMed

    Kumar, Ashutosh; Singh, Himanshu N; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)-microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker "retinoic acid" in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5'-AGGTCA-3') in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and embryological

  9. Deduced consensus sequence of Sindbis virus strain AR339: mutations contained in laboratory strains which affect cell culture and in vivo phenotypes.

    PubMed Central

    McKnight, K L; Simpson, D A; Lin, S C; Knott, T A; Polo, J M; Pence, D F; Johannsen, D B; Heidner, H W; Davis, N L; Johnston, R E

    1996-01-01

    The consensus sequence of the Sindbis virus AR339 isolate, the prototype alphavirus, has been deduced. THe results presented here suggest (i) that a substantial proportion of the sequence divergence evident between the consensus sequence and sequences of laboratory strains of AR339 has resulted from selection for efficient growth in cell culture, (ii) that many of these changes affect the virulence of the virus in animal models, and (iii) that such modified genetic backgrounds present in laboratory strains can exert a significant influence on genetic studies of virus pathogenesis and host range. A laboratory strain of Sindbis virus AR339 was sequenced and cloned as a cDNA (pTRSB) from which infectious virus (TRSB) could be derived. The consensus sequence was deduced from the complete sequences of pTRSB and HRsp (E. G. Strauss, C. M. Rice, and J. H. Strauss, Virology 133:92-110, 1984), from partial sequences of the glycoprotein genes of three other AR339 laboratory strains, and by comparison with the sequences of the glycoprotein genes of three other AR339 sequence. HRsp differed form the consensus sequence by eight coding changes, and TRSB differed by three coding changes. In the 5' untranslated region, HRsp differed from the consensus sequence at nucleotide (nt) 5. These differences were likely the result of cell culture passage of the original AR339 isolate. At three of the difference loci (one in TRSB and two in HRsp), selection of cell-culture-adaptive mutations was documented with Sindbis virus or other alphaviruses. Selection in cell culture often results in attenuation of virulence in animals. Considering the TRSB and HRsp sequences together, one noncoding difference from the consensus (an A-for-G substitution in the 5' untranslated region at nt 5) and six coding differences in the glycoprotein genes (at E2 amino acids 1, 3, 70, and 172 and at E1 amino acids 72 and 237) were at loci which, either individually or in combination, significantly affected

  10. Genomic Variability of Haemophilus influenzae Isolated from Mexican Children Determined by Using Enterobacterial Repetitive Intergenic Consensus Sequences and PCR

    PubMed Central

    Gomez-De-Leon, Patricia; Santos, Jose I.; Caballero, Javier; Gomez, Demostenes; Espinosa, Luz E.; Moreno, Isabel; Piñero, Daniel; Cravioto, Alejandro

    2000-01-01

    Genomic fingerprints from 92 capsulated and noncapsulated strains of Haemophilus influenzae from Mexican children with different diseases and healthy carriers were generated by PCR using the enterobacterial repetitive intergenic consensus (ERIC) sequences. A cluster analysis by the unweighted pair-group method with arithmetic averages based on the overall similarity as estimated from the characteristics of the genomic fingerprints, was conducted to group the strains. A total of 69 fingerprint patterns were detected in the H. influenzae strains. Isolates from patients with different diseases were represented by a variety of patterns, which clustered into two major groups. Of the 37 strains isolated from cases of meningitis, 24 shared patterns and were clustered into five groups within a similarity level of 1.0. One fragment of 1.25 kb was common to all meningitis strains. H. influenzae strains from healthy carriers presented fingerprint patterns different from those found in strains from sick children. Isolates from healthy individuals were more variable and were distributed differently from those from patients. The results show that ERIC-PCR provides a powerful tool for the determination of the distinctive pathogenicity potentials of H. influenzae strains and encourage its use for molecular epidemiology investigations. PMID:10878033

  11. Rice MEL2, the RNA recognition motif (RRM) protein, binds in vitro to meiosis-expressed genes containing U-rich RNA consensus sequences in the 3'-UTR.

    PubMed

    Miyazaki, Saori; Sato, Yutaka; Asano, Tomoya; Nagamura, Yoshiaki; Nonomura, Ken-Ichi

    2015-10-01

    Post-transcriptional gene regulation by RNA recognition motif (RRM) proteins through binding to cis-elements in the 3'-untranslated region (3'-UTR) is widely used in eukaryotes to complete various biological processes. Rice MEIOSIS ARRESTED AT LEPTOTENE2 (MEL2) is the RRM protein that functions in the transition to meiosis in proper timing. The MEL2 RRM preferentially associated with the U-rich RNA consensus, UUAGUU[U/A][U/G][A/U/G]U, dependently on sequences and proportionally to MEL2 protein amounts in vitro. The consensus sequences were located in the putative looped structures of the RNA ligand. A genome-wide survey revealed a tendency of MEL2-binding consensus appearing in 3'-UTR of rice genes. Of 249 genes that conserved the consensus in their 3'-UTR, 13 genes spatiotemporally co-expressed with MEL2 in meiotic flowers, and included several genes whose function was supposed in meiosis; such as Replication protein A and OsMADS3. The proteome analysis revealed that the amounts of small ubiquitin-related modifier-like protein and eukaryotic translation initiation factor3-like protein were dramatically altered in mel2 mutant anthers. Taken together with transcriptome and gene ontology results, we propose that the rice MEL2 is involved in the translational regulation of key meiotic genes on 3'-UTRs to achieve the faithful transition of germ cells to meiosis.

  12. A highly conserved G-rich consensus sequence in hepatitis C virus core gene represents a new anti–hepatitis C target

    PubMed Central

    Wang, Shao-Ru; Min, Yuan-Qin; Wang, Jia-Qi; Liu, Chao-Xing; Fu, Bo-Shi; Wu, Fan; Wu, Ling-Yu; Qiao, Zhi-Xian; Song, Yan-Yan; Xu, Guo-Hua; Wu, Zhi-Guo; Huang, Gai; Peng, Nan-Fang; Huang, Rong; Mao, Wu-Xiang; Peng, Shuang; Chen, Yu-Qi; Zhu, Ying; Tian, Tian; Zhang, Xiao-Lian; Zhou, Xiang

    2016-01-01

    G-quadruplex (G4) is one of the most important secondary structures in nucleic acids. Until recently, G4 RNAs have not been reported in any ribovirus, such as the hepatitis C virus. Our bioinformatics analysis reveals highly conserved guanine-rich consensus sequences within the core gene of hepatitis C despite the high genetic variability of this ribovirus; we further show using various methods that such consensus sequences can fold into unimolecular G4 RNA structures, both in vitro and under physiological conditions. Furthermore, we provide direct evidences that small molecules specifically targeting G4 can stabilize this structure to reduce RNA replication and inhibit protein translation of intracellular hepatitis C. Ultimately, the stabilization of G4 RNA in the genome of hepatitis C represents a promising new strategy for anti–hepatitis C drug development. PMID:27051880

  13. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome

    PubMed Central

    Kumar, Ashutosh; Singh, Himanshu N.; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A.

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)—microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker “retinoic acid” in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and

  14. Predicting the functional consequences of non-synonymous DNA sequence variants--evaluation of bioinformatics tools and development of a consensus strategy.

    PubMed

    Frousios, Kimon; Iliopoulos, Costas S; Schlitt, Thomas; Simpson, Michael A

    2013-10-01

    The study of DNA sequence variation has been transformed by recent advances in DNA sequencing technologies. Determination of the functional consequences of sequence variant alleles offers potential insight as to how genotype may influence phenotype. Even within protein coding regions of the genome, establishing the consequences of variation on gene and protein function is challenging and requires substantial laboratory investigation. However, a series of bioinformatics tools have been developed to predict whether non-synonymous variants are neutral or disease-causing. In this study we evaluate the performance of nine such methods (SIFT, PolyPhen2, SNPs&GO, PhD-SNP, PANTHER, Mutation Assessor, MutPred, Condel and CAROL) and developed CoVEC (Consensus Variant Effect Classification), a tool that integrates the prediction results from four of these methods. We demonstrate that the CoVEC approach outperforms most individual methods and highlights the benefit of combining results from multiple tools. PMID:23831115

  15. Consensus protein design

    PubMed Central

    Porebski, Benjamin T.; Buckle, Ashley M.

    2016-01-01

    A popular and successful strategy in semi-rational design of protein stability is the use of evolutionary information encapsulated in homologous protein sequences. Consensus design is based on the hypothesis that at a given position, the respective consensus amino acid contributes more than average to the stability of the protein than non-conserved amino acids. Here, we review the consensus design approach, its theoretical underpinnings, successes, limitations and challenges, as well as providing a detailed guide to its application in protein engineering. PMID:27274091

  16. Animal Protection and Structural Studies of a Consensus Sequence Vaccine Targeting the Receptor Binding Domain of the Type IV Pilus of Pseudomonas aeruginosa

    SciTech Connect

    Kao, Daniel J.; Churchill, Mair E.A.; Irvin, Randall T.; Hodges, Robert S.

    2008-09-23

    One of the main obstacles in the development of a vaccine against Pseudomonas aeruginosa is the requirement that it is protective against a wide range of virulent strains. We have developed a synthetic-peptide consensus-sequence vaccine (Cs1) that targets the host receptor-binding domain (RBD) of the type IV pilus of P. aeruginosa. Here, we show that this vaccine provides increased protection against challenge by the four piliated strains that we have examined (PAK, PAO, KB7 and P1) in the A.BY/SnJ mouse model of acute P. aeruginosa infection. To further characterize the consensus sequence, we engineered Cs1 into the PAK monomeric pilin protein and determined the crystal structure of the chimeric Cs1 pilin to 1.35 {angstrom} resolution. The substitutions (T130K and E135P) used to create Cs1 do not disrupt the conserved backbone conformation of the pilin RBD. In fact, based on the Cs1 pilin structure, we hypothesize that the E135P substitution bolsters the conserved backbone conformation and may partially explain the immunological activity of Cs1. Structural analysis of Cs1, PAK and K122-4 pilins reveal substitutions of non-conserved residues in the RBD are compensated for by complementary changes in the rest of the pilin monomer. Thus, the interactions between the RBD and the rest of the pilin can either be mediated by polar interactions of a hydrogen bond network in some strains or by hydrophobic interactions in others. Both configurations maintain a conserved backbone conformation of the RBD. Thus, the backbone conformation is critical in our consensus-sequence vaccine design and that cross-reactivity of the antibody response may be modulated by the composition of exposed side-chains on the surface of the RBD. This structure will guide our future vaccine design by focusing our investigation on the four variable residue positions that are exposed on the RBD surface.

  17. Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification.

    PubMed

    Pathak, Deepali; Srivastava, Jyoti; Samad, Rana; Parwez, Iqbal; Kumar, Sudhir; Ali, Sher

    2010-06-01

    Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

  18. easyPAC: A Tool for Fast Prediction, Testing and Reference Mapping of Degenerate PCR Primers from Alignments or Consensus Sequences

    PubMed Central

    Rosenkranz, David

    2012-01-01

    The PCR-amplification of unknown homologous or paralogous genes generally relies on PCR primers predicted from multi sequence alignments. But increasing sequence divergence can induce the need to use degenerate primers which entails the problem of testing the characteristics, unwanted interactions and potential mispriming of degenerate primers. Here I introduce easyPAC, a new software for the prediction of degenerate primers from multi sequence alignments or single consensus sequences. As a major innovation, easyPAC allows to apply all customary primer test procedures to degenerate primer sequences including fast mapping to reference files. Thus, easyPAC simplifies and expedites the designing of specific degenerate primers enormously. Degenerate primers suggested by easyPAC were used in PCR amplification with subsequent de novo sequencing of TDRD1 exon 11 homologs from several representatives of the haplorrhine primate phylogeny. The results demonstrate the efficient performance of the suggested primers and therefore show that easyPAC can advance upcoming comparative genetic studies.

  19. A new natural hGH variant--17.5 kd--produced by alternative splicing. An additional consensus sequence which might play a role in branchpoint selection.

    PubMed Central

    Lecomte, C M; Renard, A; Martial, J A

    1987-01-01

    From a human pituitary cDNA library, we have cloned 3 distinct human growth hormone (hGH) cDNAs, coding respectively for the 22 K hGH, the 20 K variant, and a yet unknown 17.5 K variant. S1 mapping analysis using human pituitary RNA confirms the existence of at least four distinct hGH mRNAs originating from alternative acceptor sites at the second intron of the primary transcript. We have analysed the hGH gene sequence to explain the high frequency of alternative splicings which occur only at this location. In this study we propose CTTGNNPyPyPy as an additional consensus sequence guiding the selection of the branched nucleotide. Images PMID:3627992

  20. beta-Cyclodextrin derivatives as carriers to enhance the antiviral activity of an antisense oligonucleotide directed toward a coronavirus intergenic consensus sequence.

    PubMed

    Abdou, S; Collomb, J; Sallas, F; Marsura, A; Finance, C

    1997-01-01

    The ability of cyclodextrins to enhance the antiviral activity of a phosphodiester oligodeoxynucleotide has been investigated. A 18-mer oligodeoxynucleotide complementary to the initiation region of the mRNA coding for the spike protein and containing the intergenic consensus sequence of an enteric coronavirus has been tested for antiviral action against virus growth in human adenocarcinoma cells. The phosphodiester oligodeoxynucleotide only showed a limited effect on virus growth rate (from 12 to 34% viral inhibition in cells treated with 7.5 to 25 microM oligodeoxynucleotide, respectively, at a multiplicity of infection of 0.1 infectious particle per cell). In the same conditions, the phosphorothioate analogue exhibited stronger antiviral activity, the inhibition increased from 56 to 90%. The inhibitory effect of this analogue was antisense and sequence-specific. Northern blot analysis showed that the sequence-dependent mechanism of action appears to be the inhibition of mRNA transcription. We conclude that the coronavirus intergenic consensus sequence is a good target for an antisense oligonucleotide antiviral action. The properties of the phosphodiester oligonucleotide was improved after its complexation with cyclodextrins. The most important increase of the antiviral activity (90% inhibition) was obtained with only 7.5 microM oligonucleotide complexed to a cyclodextrin derivative, 6-deoxy-6-S-beta-D-galactopyranosyl-6-thio-cyclomalto-heptaose+ ++ in a molar ratio of 1:100. These studies suggest that the use of cyclodextrin derivatives as carrier for phosphodiester oligonucleotides delivery may be an effective method for increasing the therapeutic potential of these compounds in viral infections. PMID:9672621

  1. Molecular characterization of flavanone 3 beta-hydroxylases. Consensus sequence, comparison with related enzymes and the role of conserved histidine residues.

    PubMed

    Britsch, L; Dedio, J; Saedler, H; Forkmann, G

    1993-10-15

    A heterologous cDNA probe from Petunia hybrida was used to isolate flavanone-3 beta-hydroxylase-encoding cDNA clones from carnation (Dianthus caryophyllus), china aster (Callistephus chinensis) and stock (Matthiola incana). The deduced protein sequences together with the known sequences of the enzyme from P. hybrida, barley (Hordeum vulgare) and snapdragon (Antirrhinum majus) enabled the determination of a consensus sequence which revealed an overall 84% similarity (53% identity) of flavanone 3 beta-hydroxylases from the different sources. Alignment with the sequences of other known enzymes of the same class and to related non-heme iron-(II) enzymes demonstrated the strict genetic conservation of 14 amino acids, in particular, of three histidines and an aspartic acid. The conservation of the histidine motifs provides strong support for the possible conservation of structurally similar iron-binding sites in these enzymes. The putative role of histidines as chelators of ferrous ions in the active site of flavanone 3 beta-hydroxylases was corroborated by diethyl-pyrocarbonate modification of the partially purified recombinant Petunia enzyme.

  2. Towards a consensus Y-chromosomal phylogeny and Y-SNP set in forensics in the next-generation sequencing era.

    PubMed

    Larmuseau, Maarten H D; Van Geystelen, Anneleen; Kayser, Manfred; van Oven, Mannis; Decorte, Ronny

    2015-03-01

    Currently, several different Y-chromosomal phylogenies and haplogroup nomenclatures are presented in scientific literature and at conferences demonstrating the present diversity in Y-chromosomal phylogenetic trees and Y-SNP sets used within forensic and anthropological research. This situation can be ascribed to the exponential growth of the number of Y-SNPs discovered due to mostly next-generation sequencing (NGS) studies. As Y-SNPs and their respective phylogenetic positions are important in forensics, such as for male lineage characterization and paternal bio-geographic ancestry inference, there is a need for forensic geneticists to know how to deal with these newly identified Y-SNPs and phylogenies, especially since these phylogenies are often created with other aims than to carry out forensic genetic research. Therefore, we give here an overview of four categories of currently used Y-chromosomal phylogenies and the associated Y-SNP sets in scientific research in the current NGS era. We compare these categories based on the construction method, their advantages and disadvantages, the disciplines wherein the phylogenetic tree can be used, and their specific relevance for forensic geneticists. Based on this overview, it is clear that an up-to-date reduced tree with a consensus Y-SNP set and a stable nomenclature will be the most appropriate reference resource for forensic research. Initiatives to reach such an international consensus are therefore highly recommended.

  3. A Screen for Dominant Negative Mutants of SEC18 Reveals a Role for the AAA Protein Consensus Sequence in ATP Hydrolysis

    PubMed Central

    Steel, Gregor J.; Harley, Carol; Boyd, Alan; Morgan, Alan

    2000-01-01

    An evolutionarily ancient mechanism is used for intracellular membrane fusion events ranging from endoplasmic reticulum–Golgi traffic in yeast to synaptic vesicle exocytosis in the human brain. At the heart of this mechanism is the core complex of N-ethylmaleimide-sensitive fusion protein (NSF), soluble NSF attachment proteins (SNAPs), and SNAP receptors (SNAREs). Although these proteins are accepted as key players in vesicular traffic, their molecular mechanisms of action remain unclear. To illuminate important structure–function relationships in NSF, a screen for dominant negative mutants of yeast NSF (Sec18p) was undertaken. This involved random mutagenesis of a GAL1-regulated SEC18 yeast expression plasmid. Several dominant negative alleles were identified on the basis of galactose-inducible growth arrest, of which one, sec18-109, was characterized in detail. The sec18-109 phenotype (abnormal membrane trafficking through the biosynthetic pathway, accumulation of a membranous tubular network, growth suppression, increased cell density) is due to a single A-G substitution in SEC18 resulting in a missense mutation in Sec18p (Thr394→Pro). Thr394 is conserved in most AAA proteins and indeed forms part of the minimal AAA consensus sequence that serves as a signature of this large protein family. Analysis of recombinant Sec18-109p indicates that the mutation does not prevent hexamerization or interaction with yeast α-SNAP (Sec17p), but instead results in undetectable ATPase activity that cannot be stimulated by Sec17p. This suggests a role for the AAA protein consensus sequence in regulating ATP hydrolysis. Furthermore, this approach of screening for dominant negative mutants in yeast can be applied to other conserved proteins so as to highlight important functional domains in their mammalian counterparts. PMID:10749934

  4. Consensus sequence determination and elucidation of the evolutionary history of a rotavirus Wa variant reveal a close relationship to various Wa variants derived from the original Wa strain.

    PubMed

    Wentzel, Johannes F; Yuan, Lijuan; Rao, Shujing; van Dijk, Alberdina A; O'Neill, Hester G

    2013-12-01

    The consensus nucleotide sequence of a human rotavirus Wa strain, with only a partially known passage history, was determined with sequence-independent amplification and next generation 454® pyrosequencing. This rotavirus Wa strain had the expected genome constellation of G1-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1 and was designated RVA/Human-tc/USA/WaCS/1974/G1P[8]. Phylogenetic analyses revealed a close relationship to four human rotavirus Wa variants (Wag5re, Wag7/8re, ParWa and VirWa) derived from the original 1974 human isolate. There were rearrangements in the Wag5re- and Wag7/8re variants in genome segments 5 (Wag5re) and 7 and 8 (Wag7/8re), which were not present in WaCS. Pairwise comparisons and a combined molecular clock for the Wa rotavirus genome indicated a close relationship between WaCS and ParWa and VirWa. These results suggest that WaCS is most probably an early cell culture adapted variant from the initial gnotobiotic pig passaged Wa isolate. Evolutionary pressure analysis identified a possible negative selected amino acid site in VP1 (genome segment 1) and a likely positive selected site in VP4 (genome segment 4). The WaCS may be more appropriate as a rotavirus Wa reference sequence than the current composite Wa reference genome.

  5. [Creation of DNA vaccine vector based on codon-optimized gene of rabies virus glycoprotein (G protein) with consensus amino acid sequence].

    PubMed

    Starodubova, E S; Kuzmenko, Y V; Latanova, A A; Preobrazhenskaya, O V; Karpov, V L

    2016-01-01

    An optimized design of the rabies virus glycoprotein (G protein) for use within DNA vaccines has been suggested. The design represents a territorially adapted antigen constructed taking into account glycoprotein amino acid sequences of the rabies viruses registered in the Russian Federation and the vaccine Vnukovo-32 strain. Based on the created consensus amino acid sequence, the nucleotide codon-optimized sequence of this modified glycoprotein was obtained and cloned into the pVAX1 plasmid (a vector of the last generation used in the creation of DNA vaccines). A twofold increase in this gene expression compared to the expression of the Vnukovo-32 strain viral glycoprotein gene in a similar vector was registered in the transfected cell culture. It has been demonstrated that the accumulation of modified G protein exceeds the number of the control protein synthesized using the plasmid with the Vnukovo-32 strain viral glycoprotein gene by 20 times. Thus, the obtained modified rabies virus glycoprotein can be considered to be a promising DNA vaccine antigen.

  6. [Creation of DNA vaccine vector based on codon-optimized gene of rabies virus glycoprotein (G protein) with consensus amino acid sequence].

    PubMed

    Starodubova, E S; Kuzmenko, Y V; Latanova, A A; Preobrazhenskaya, O V; Karpov, V L

    2016-01-01

    An optimized design of the rabies virus glycoprotein (G protein) for use within DNA vaccines has been suggested. The design represents a territorially adapted antigen constructed taking into account glycoprotein amino acid sequences of the rabies viruses registered in the Russian Federation and the vaccine Vnukovo-32 strain. Based on the created consensus amino acid sequence, the nucleotide codon-optimized sequence of this modified glycoprotein was obtained and cloned into the pVAX1 plasmid (a vector of the last generation used in the creation of DNA vaccines). A twofold increase in this gene expression compared to the expression of the Vnukovo-32 strain viral glycoprotein gene in a similar vector was registered in the transfected cell culture. It has been demonstrated that the accumulation of modified G protein exceeds the number of the control protein synthesized using the plasmid with the Vnukovo-32 strain viral glycoprotein gene by 20 times. Thus, the obtained modified rabies virus glycoprotein can be considered to be a promising DNA vaccine antigen. PMID:27239860

  7. Minimization of genetic distances by the consensus, ancestral, and center-of-tree (COT) sequences for HIV-1 variants within an infected individual and the design of reagents to test immune reactivity.

    PubMed

    Kesturu, Girish S; Colleton, Bonnie A; Liu, Yi; Heath, Laura; Shaikh, Obaid Shakil; Rinaldo, Charles R; Shankarappa, Raj

    2006-05-10

    Eliciting maximal immune responses to highly divergent viruses is a challenge and a focus in AIDS vaccine development. Another challenge is to identify the immune correlates of protective immunity. Recent AIDS vaccine design approaches attempt to use reconstructed centralized viral sequences that minimize genetic differences to circulating viruses. Using these approaches, we derive and analyze consensus (CON), ancestral (ANC), and center-of-tree (COT) sequences to represent intra-individual HIV-1 env variants encoding a range of diversities and phylogenetic structures. Each reconstructed sequence significantly minimized genetic distances to extant sequences throughout the first 5 years of infection of an individual. Interestingly, ANC sequences diverged and were not significantly better than extant sequences in minimizing genetic distances at later stages of infection and disease, likely due to the development of a substantially asymmetric phylogeny. COT or CON sequences derived from autologous virus samplings may be useful for increasing the sensitivity of assessments of immune reactivity against HIV.

  8. Expression and purification of an immunogenic dengue virus epitope using a synthetic consensus sequence of envelope domain III and Saccharomyces cerevisiae.

    PubMed

    Nguyen, Ngoc-Luong; Kim, Jung-Mi; Park, Jin-Ah; Park, Seung-Moon; Jang, Yong-Suk; Yang, Moon-Sik; Kim, Dae-Hyuk

    2013-04-01

    A synthetic consensus gene was designed based on residues of the amino acid sequences of dengue envelope domain III (scEDIII) from all four serotypes, and codon optimization for expression was conducted using baker's yeast, Saccharomyces cerevisiae. The synthetic gene was cloned into a yeast episomal expression vector, pYEGPD-TER, which was designed to direct cloned gene expression using the glyceraldehyde-3-phosphate dehydrogenase (GPD) promoter, a functional signal peptide of the amylase 1A protein from rice, and the GAL7 terminator. PCR and back-transformation into Escherichia coli confirmed the presence of the scEDIII gene-containing plasmid in the transformants. Northern blot analysis showed the presence of the scEDIII-specific transcript. Western blot analysis indicated that expressed scEDIII, with mobility similar to purified EDIII from E. coli, was successfully secreted into the culture media. Quantitative ELISA revealed that the recombinant scEDIII comprised approximately 0.1-0.6% of cell-free extract. In addition, 0.1-0.6 mg of scEDIII protein per liter of culture filtrate was detected on day 1 and peaked on day 3 after cultivation. The secreted scEDIII protein can be purified to ≥90% purity with 85% recovery using a simple ion-exchange FPLC followed by molecular weight cut-off. Upon administration of the purified protein to mice, mouse sera contained antibodies that were specific to all four serotypes of dengue virus. Moreover, a balanced immune response against all four serotypes was observed, suggesting that it may be possible to develop an effective tetravalent dengue vaccine using S. cerevisiae. PMID:23376461

  9. Expression and purification of an immunogenic dengue virus epitope using a synthetic consensus sequence of envelope domain III and Saccharomyces cerevisiae.

    PubMed

    Nguyen, Ngoc-Luong; Kim, Jung-Mi; Park, Jin-Ah; Park, Seung-Moon; Jang, Yong-Suk; Yang, Moon-Sik; Kim, Dae-Hyuk

    2013-04-01

    A synthetic consensus gene was designed based on residues of the amino acid sequences of dengue envelope domain III (scEDIII) from all four serotypes, and codon optimization for expression was conducted using baker's yeast, Saccharomyces cerevisiae. The synthetic gene was cloned into a yeast episomal expression vector, pYEGPD-TER, which was designed to direct cloned gene expression using the glyceraldehyde-3-phosphate dehydrogenase (GPD) promoter, a functional signal peptide of the amylase 1A protein from rice, and the GAL7 terminator. PCR and back-transformation into Escherichia coli confirmed the presence of the scEDIII gene-containing plasmid in the transformants. Northern blot analysis showed the presence of the scEDIII-specific transcript. Western blot analysis indicated that expressed scEDIII, with mobility similar to purified EDIII from E. coli, was successfully secreted into the culture media. Quantitative ELISA revealed that the recombinant scEDIII comprised approximately 0.1-0.6% of cell-free extract. In addition, 0.1-0.6 mg of scEDIII protein per liter of culture filtrate was detected on day 1 and peaked on day 3 after cultivation. The secreted scEDIII protein can be purified to ≥90% purity with 85% recovery using a simple ion-exchange FPLC followed by molecular weight cut-off. Upon administration of the purified protein to mice, mouse sera contained antibodies that were specific to all four serotypes of dengue virus. Moreover, a balanced immune response against all four serotypes was observed, suggesting that it may be possible to develop an effective tetravalent dengue vaccine using S. cerevisiae.

  10. A Research and Discussion Note: The Macrostructure of Consensus Statements

    ERIC Educational Resources Information Center

    Mungra, Philippa

    2007-01-01

    This research note presents a preliminary study of the structure of consensus statements (CSs). The consensus statement is released by a medical association after calling a consensus development conference on a pertinent medical issue. Using a very small corpus, this note attempts to characterize consensus statements by identifying the sequence of…

  11. Suppression Analysis Reveals a Functional Difference between the Serines in Positions Two and Five in the Consensus Sequence of the C-Terminal Domain of Yeast RNA Polymerase II

    PubMed Central

    Yuryev, A.; Corden, J. L.

    1996-01-01

    The largest subunit of RNA polymerase II contains a repetitive C-terminal domain (CTD) consisting of tandem repeats of the consensus sequence Tyr(1)Ser(2)Pro(3)Thr(4) Ser(5)Pro(6) Ser(7). Substitution of nonphosphorylatable amino acids at positions two or five of the Saccharomyces cerevisiae CTD is lethal. We developed a selection ssytem for isolating suppressors of this lethal phenotype and cloned a gene, SCA1 (suppressor of CTD alanine), which complements recessive suppressors of lethal multiple-substitution mutations. A partial deletion of SCA1 (sca1Δ::hisG) suppresses alanine or glutamate substitutions at position two of the consensus CTD sequence, and a lethal CTD truncation mutation, but SCA1 deletion does not suppress alanine or glutamate substitutions at position five. SCA1 is identical to SRB9, a suppressor of a cold-sensitive CTD truncation mutation. Strains carrying dominant SRB mutations have the same suppression properties as a sca1Δ::hisG strain. These results reveal a functional difference between positions two and five of the consensus CTD heptapeptide repeat. The ability of SCA1 and SRB mutant alleles to suppress CTD truncation mutations suggest that substitutions at position two, but not at position five, cause a defect in RNA polymerase II function similar to that introduced by CTD truncation. PMID:8725217

  12. Characterization of the DNA-binding properties of the myeloid zinc finger protein MZF1: two independent DNA-binding domains recognize two DNA consensus sequences with a common G-rich core.

    PubMed Central

    Morris, J F; Hromas, R; Rauscher, F J

    1994-01-01

    The myeloid zinc finger gene 1, MZF1, encodes a transcription factor which is expressed in hematopoietic progenitor cells that are committed to myeloid lineage differentiation. MZF1 contains 13 C2H2 zinc fingers arranged in two domains which are separated by a short glycine- and proline-rich sequence. The first domain consists of zinc fingers 1 to 4, and the second domain is formed by zinc fingers 5 to 13. We have determined that both sets of zinc finger domains bind DNA. Purified, recombinant MZF1 proteins containing either the first set of zinc fingers or the second set were prepared and used to affinity select DNA sequences from a library of degenerate oligonucleotides by using successive rounds of gel shift followed by PCR amplification. Surprisingly, both DNA-binding domains of MZF1 selected similar DNA-binding consensus sequences containing a core of four or five guanine residues, reminiscent of an NF-kappa B half-site: 1-4, 5'-AGTGGGGA-3'; 5-13, 5'-CGGGnGAGGGGGAA-3'. The full-length MZF1 protein containing both sets of zinc finger DNA-binding domains recognizes synthetic oligonucleotides containing either the 1-4 or 5-13 consensus binding sites in gel shift assays. Thus, we have identified the core DNA consensus binding sites for each of the two DNA-binding domains of a myeloid-specific zinc finger transcription factor. Identification of these DNA-binding sites will allow us to identify target genes regulated by MZF1 and to assess the role of MZF1 as a transcriptional regulator of hematopoiesis. Images PMID:8114711

  13. The p120ctn-binding partner Kaiso is a bi-modal DNA-binding protein that recognizes both a sequence-specific consensus and methylated CpG dinucleotides

    PubMed Central

    Daniel, Juliet M.; Spring, Christopher M.; Crawford, Howard C.; Reynolds, Albert B.; Baig, Akeel

    2002-01-01

    The p120ctn-binding partner Kaiso is a new member of the POZ-zinc finger family of transcription factors implicated in development and cancer. To understand the role of Kaiso in gene regulation and p120ctn-mediated signaling and adhesion, we sought to identify Kaiso-specific DNA binding sequences and potential target genes. Here we demonstrate that Kaiso is a dual specificity DNA-binding protein that recognizes the specific consensus sequence TCCTGCNA as well as methyl-CpG dinucleotides. A minimal core sequence CTGCNA was identified as sufficient for Kaiso binding. Two copies of the Kaiso-binding site are present in the human and murine matrilysin promoters, implicating matrilysin as a candidate target gene for Kaiso. In electrophoretic mobility shift assays, matrilysin promoter-derived oligonucleotide probes formed a complex with GST–Kaiso fusion proteins possessing the zinc finger domain but not with fusion proteins lacking the zinc fingers. We further determined that only Kaiso zinc fingers 2 and 3 were necessary and sufficient for sequence-specific DNA binding. Interestingly, Kaiso also possesses a methyl-CpG-dependent DNA-binding activity distinct from its sequence-specific DNA binding. However, Kaiso has a higher affinity for the TCCTGCNA consensus than for the methyl-CpG sites. Furthermore, the DNA-binding ability of Kaiso with either recognition site was inhibited by p120ctn. Kaiso thus appears to have two modes of DNA binding and transcriptional repression, both of which may be modulated by its interaction with the adhesion cofactor p120ctn. PMID:12087177

  14. Initiation of mammalian O-mannosylation in vivo is independent of a consensus sequence and controlled by peptide regions within and upstream of the alpha-dystroglycan mucin domain.

    PubMed

    Breloy, Isabelle; Schwientek, Tilo; Gries, Barbara; Razawi, Hanieh; Macht, Marcus; Albers, Christian; Hanisch, Franz-Georg

    2008-07-01

    To reveal insight into the initiation of mammalian O-mannosylation in vivo, recombinant glycosylation probes containing sections of human alpha-dystroglycan (hDG) were expressed in epithelial cell lines. We demonstrate that O-mannosylation within the mucin domain of hDG occurs preferentially at Thr/Ser residues that are flanked by basic amino acids. Protein O-mannosylation is independent of a consensus sequence, but strictly dependent on a peptide region located upstream of the mucin domain. This peptide region cannot be replaced by other N-terminal peptides, however, it is not sufficient to induce O-mannosylation on a structurally distinct mucin domain in hybrid constructs. The presented in vivo evidence for a more complex regulation of mammalian O-mannosylation contrasts with a recent in vitro study of O-mannosylation in human alpha-dystroglycan peptides indicating the existence of an 18-meric consensus sequence. We demonstrate in vivo that the entire region p377-417 is necessary and sufficient for O-mannosylation initiation of hDG, but not of MUC1 tandem repeats. The feature of a doubly controlled initiation process distinguishes mammalian O-mannosylation from other types of O-glycosylation, which are largely controlled by structural properties of the substrate positions and their local peptide environment.

  15. Achieving True Consensus.

    ERIC Educational Resources Information Center

    Napier, Rod; Sanaghan, Patrick

    2002-01-01

    Uses the example of Vermont's Middlebury College to explore the challenges and possibilities of achieving consensus about institutional change. Discusses why, unlike in this example, consensus usually fails, and presents four demands of an effective consensus process. Includes a list of "test" questions on successful collaboration. (EV)

  16. The Limits of Consensus.

    ERIC Educational Resources Information Center

    Poster, John B.

    Dynamics in the education policy arena suggest that, despite two generations of researchers extolling democratic leadership styles and consensus building over autocratic techniques, wide participation in policymaking and the broadest possible consensus are not always productive: American society has not yet agreed on what schools should…

  17. Working toward Consensus.

    ERIC Educational Resources Information Center

    Brown, Harold

    1998-01-01

    A California high school English teacher uses, with students, a culturally sensitive process of facilitating classroom decision making through consensus. He correlates communication and language skills with consensus building, the facilitation of which is a slow process implemented in small portions over the school year. Sidebar provides a…

  18. Stimulation of Agrobacterium tumefaciens T-DNA transfer by overdrive depends on a flanking sequence but not on helical position with respect to the border repeat.

    PubMed Central

    Shurvinton, C E; Ream, W

    1991-01-01

    T-DNA transfer by Agrobacterium tumefaciens depends on the right border repeat of the T-DNA and is greatly stimulated by overdrive, an adjacent sequence. We report that the function of overdrive does not depend on helical position with respect to the border repeat. A synthetic 24-bp overdrive and a 12-bp region containing a fully conserved 8-bp core overdrive sequence stimulated virulence equally, but full function required additional bases to the left of the 24-bp sequence. Images PMID:1885533

  19. Transcriptional status of known and novel genes tagged with consensus of 33.15 repeat loci employing minisatellite-associated sequence amplification (MASA) and real-time PCR in water buffalo, Bubalus bubalis.

    PubMed

    Srivastava, Jyoti; Premi, Sanjay; Pathak, Deepali; Ahsan, Zaid; Tiwari, Madhulika; Garg, Lalit C; Ali, Sher

    2006-01-01

    We conducted minisatellite-associated sequence amplification (MASA) with an oligo (5' CACCTCTCCACCTGCC 3') based on consensus of 33.15 repeat loci using cDNA from the testis, ovary, spleen, kidney, heart, liver, and lung of water buffalo Bubalus bubalis and uncovered 25 amplicons of six different sizes (1,263, 846/847, 602, 576, 487, and 324 base pairs). These fragments, cloned and sequenced, were found to represent several functional, regulatory, and structural genes. Blast search of all the 25 amplicons showed homologies with 43 transcribing genes across the species. Of these, the 846/847-bp fragment, having homology with the adenylate kinase gene, showed nucleotide changes at six identical places in the ovary and testis. The 1,263; 324; and 487-bp fragments showed homology with the secreted modular calcium binding protein (SMOC-1), leucine-rich repeat neuronal 6A (LRRN6A) mRNA, and human TTTY5 mRNA, respectively. Real-time PCR showed maximum expression of AKL, LRRN6A, and T-cell receptor gamma (TCR-gamma)-like genes in the testis, SMOC-1 in the liver, and the T-cell receptor-like (TCRL) gene in the spleen compared to those used as endogenous control. We construe that these genes have evolved from a common progenitor and conformed to various biological functions during the course of evolution. MASA approach coupled with real-time PCR has potentials to uncover accurate expression of a large number of genes within and across the species circumventing the screening of cDNA library.

  20. Practical Techniques for Achieving Consensus.

    ERIC Educational Resources Information Center

    Kline, John A.

    Consensus is important in the making of a policy decision. If a decision is reached without consensus, morale and unit satisfaction may both suffer. With genuine consensus, a unit tends to willingly support and implement the new policy. After analyzing how observed small groups had actually reached consensus, the following ten techniques were…

  1. Phosphorylation of Simian Cytomegalovirus Assembly Protein Precursor (pAPNG.5) and Proteinase Precursor (pAPNG1): Multiple Attachment Sites Identified, Including Two Adjacent Serines in a Casein Kinase II Consensus Sequence

    PubMed Central

    Plafker, Scott M.; Woods, Amina S.; Gibson, Wade

    1999-01-01

    The assembly protein precursor (pAP) of cytomegalovirus (CMV), and its homologs in other herpesviruses, functions at several key steps during the process of capsid formation. This protein, and the genetically related maturational proteinase, is distinguished from the other capsid proteins by posttranslational modifications, including phosphorylation. The objective of this study was to identify sites at which pAP is phosphorylated so that the functional significance of this modification and the enzyme(s) responsible for it can be determined. In the work reported here, we used peptide mapping, mass spectrometry, and site-directed mutagenesis to identify two sets of pAP phosphorylation sites. One is a casein kinase II (CKII) consensus sequence that contains two adjacent serines, both of which are phosphorylated. The other site(s) is in a different domain of the protein, is phosphorylated less frequently than the CKII site, does not require preceding CKII-site phosphorylation, and causes an electrophoretic mobility shift when phosphorylated. Transfection/expression assays for proteolytic activity showed no gross effect of CKII-site phosphorylation on the enzymatic activity of the proteinase or on the substrate behavior of pAP. Evidence is presented that both the CKII sites and the secondary sites are phosphorylated in virus-infected cells and plasmid-transfected cells, indicating that these modifications can be made by a cellular enzyme(s). Apparent compartmental differences in phosphorylation of the CKII-site (cytoplasmic) and secondary-site (nuclear) serines suggest the involvement of more that one enzyme in these modifications. PMID:10516011

  2. CONSENSUS AND CONFORMITY.

    ERIC Educational Resources Information Center

    ALLEN, VERNON L.; LEVINE, JOHN M.

    IN THIS STUDY, PROFESSOR ALLEN EMPLOYS TWO METHODS OF BREAKING GROUP CONSENSUS, AND HE MEASURES THE EFFECTS ON THE RESPONSES OF COLLEGE SUBJECTS TO BOTH OBJECTIVE AND SUBJECTIVE STIMULI. THE RESULTS SUGGEST THE NEED FOR MODIFICATION OF EXISTING THEORIES OF CONFORMITY BEHAVIOR. IN ADDITION, THESE RESULTS EMPHASIZE THE DIFFERENCES IN CONFORMITY OF…

  3. Critique, Contextualism and Consensus

    ERIC Educational Resources Information Center

    Green, Jane

    2004-01-01

    In an epistemology of contextualism, how robust does consensus need to be for critique to be practically effective? In 'Relativism and the Critical Potential of Philosophy of Education,' Frieda Heyting proposes a form of contextualism, but her argument raises a number of problems. The kinds of criteria that her version of contextualism will…

  4. Spanish Consensus Statement

    PubMed Central

    Rey, Guillermo Álvarez; Cuesta, Jordi Ardevol; Loureda, Rafael Arriaza; España, Fernando Ávila; Matas, Ramón Balius; Pazos, Fernando Baró; de Dios Beas Jiménez, Juan; Rosell, Jorge Candel; Fernandez, César Cobián; Ros, Francisco Esparza; Colmenero, Josefina Espejo; de Prado, Jorge Fernández; Cota, Juan José García; González, Jose Ignacio Garrido; Santander, Manuela González; Munilla, Miguel Ángel Herrador; Ruiz, Francisco Ivorra; Díaz, Fernando Jiménez; Marqueta, Pedro Manonelles; Fernandez, Antonio Maestro; Benito, Juan José Muñoz; Vilás, Ramón Olivé; Teres, Xavier Peirau; Amaro, José Peña; Roque, Juan Pérez San; Parenteu, Christophe Ramírez; Serna, Juan Ribas; Álvarez, Mikel Sánchez; Marchori, Carlos Sanchez; Soto, Miguel del Valle; Alonso, José María Villalón; García, Pedro Guillen; de la Iglesia, Nicolas Hugo; Alcorocho, Juan Manuel Lopez

    2016-01-01

    On the 21st of March, 2015, experts met at Clínica CEMTRO in Madrid, Spain, under the patronage of The Spanish Society for Sports Traumatology (SETRADE), The Spanish Federation of Sports Medicine (FEMEDE), The Spanish Association of Medical Services for Football Clubs (AEMEF), and The Spanish Association of Medical Services for Basketball Clubs (AEMB) with the aim of establishing a round table that would allow specialists to consider the most appropriate current general actions to be taken when treating muscle tears in sport, based on proven scientific data described in the medical literature. Each expert received a questionnaire prior to the aforementioned meeting comprising a set of questions concerning therapeutic indications generally applied in the different stages present during muscle repair. The present Consensus Document is the result of the answers to the questionnaire and resulting discussion and consensus over which are the best current indications in the treatment of muscle tears in sport. Avoiding immobilization, not taking nonsteroidal anti-inflammatory drugs (NSAIDs) randomly, fostering early mobilization, increasing vascularization of injured, site and regulating inflammatory mechanisms—without inhibiting these from the early stages of the recovery period—all stood out as main points of the Consensus Document. Additionally, there is controversy concerning cell stimulation techniques and the use of growth factors or cell inhibitors. The decision concerning discharge was unanimous, as was the criteria considered when it came to performing sport techniques without pain. PMID:27213161

  5. Towards Consensus Gene Ages.

    PubMed

    Liebeskind, Benjamin J; McWhite, Claire D; Marcotte, Edward M

    2016-01-01

    Correctly estimating the age of a gene or gene family is important for a variety of fields, including molecular evolution, comparative genomics, and phylogenetics, and increasingly for systems biology and disease genetics. However, most studies use only a point estimate of a gene's age, neglecting the substantial uncertainty involved in this estimation. Here, we characterize this uncertainty by investigating the effect of algorithm choice on gene-age inference and calculate consensus gene ages with attendant error distributions for a variety of model eukaryotes. We use 13 orthology inference algorithms to create gene-age datasets and then characterize the error around each age-call on a per-gene and per-algorithm basis. Systematic error was found to be a large factor in estimating gene age, suggesting that simple consensus algorithms are not enough to give a reliable point estimate. We also found that different sources of error can affect downstream analyses, such as gene ontology enrichment. Our consensus gene-age datasets, with associated error terms, are made fully available at so that researchers can propagate this uncertainty through their analyses (geneages.org). PMID:27259914

  6. Towards Consensus Gene Ages

    PubMed Central

    Liebeskind, Benjamin J.; McWhite, Claire D.; Marcotte, Edward M.

    2016-01-01

    Correctly estimating the age of a gene or gene family is important for a variety of fields, including molecular evolution, comparative genomics, and phylogenetics, and increasingly for systems biology and disease genetics. However, most studies use only a point estimate of a gene’s age, neglecting the substantial uncertainty involved in this estimation. Here, we characterize this uncertainty by investigating the effect of algorithm choice on gene-age inference and calculate consensus gene ages with attendant error distributions for a variety of model eukaryotes. We use 13 orthology inference algorithms to create gene-age datasets and then characterize the error around each age-call on a per-gene and per-algorithm basis. Systematic error was found to be a large factor in estimating gene age, suggesting that simple consensus algorithms are not enough to give a reliable point estimate. We also found that different sources of error can affect downstream analyses, such as gene ontology enrichment. Our consensus gene-age datasets, with associated error terms, are made fully available at so that researchers can propagate this uncertainty through their analyses (geneages.org). PMID:27259914

  7. Achieving consensus in environmental programs

    SciTech Connect

    Kurstedt, Jr., H. A.; Jones, R. M.; Walker, J. A.; Middleman, L. I.

    1989-01-01

    In this paper, we describe a new research effort on consensus tied to the Environmental Restoration Program (ERP) within the US Department of Energy's Office of Defense Waste and Transportation Management (DWTM). We define consensus and explain why consensus decisions are not merely desirable but necessary in furthering ERP activities. As examples of our planned applied research, we first discuss Nominal Group Technique as a representative consensus-generating tool, and we conclude by describing the consensus-related mission of the Waste Management Review Group, established at Virginia Tech to conduct independent, third-party review of DWTM/ERP plans and activities. 10 refs.

  8. Microscopic enteritis: Bucharest consensus.

    PubMed

    Rostami, Kamran; Aldulaimi, David; Holmes, Geoffrey; Johnson, Matt W; Robert, Marie; Srivastava, Amitabh; Fléjou, Jean-François; Sanders, David S; Volta, Umberto; Derakhshan, Mohammad H; Going, James J; Becheanu, Gabriel; Catassi, Carlo; Danciu, Mihai; Materacki, Luke; Ghafarzadegan, Kamran; Ishaq, Sauid; Rostami-Nejad, Mohammad; Peña, A Salvador; Bassotti, Gabrio; Marsh, Michael N; Villanacci, Vincenzo

    2015-03-01

    Microscopic enteritis (ME) is an inflammatory condition of the small bowel that leads to gastrointestinal symptoms, nutrient and micronutrient deficiency. It is characterised by microscopic or sub-microscopic abnormalities such as microvillus changes and enterocytic alterations in the absence of definite macroscopic changes using standard modern endoscopy. This work recognises a need to characterize disorders with microscopic and submicroscopic features, currently regarded as functional or non-specific entities, to obtain further understanding of their clinical relevance. The consensus working party reviewed statements about the aetiology, diagnosis and symptoms associated with ME and proposes an algorithm for its investigation and treatment. Following the 5(th) International Course in Digestive Pathology in Bucharest in November 2012, an international group of 21 interested pathologists and gastroenterologists formed a working party with a view to formulating a consensus statement on ME. A five-step agreement scale (from strong agreement to strong disagreement) was used to score 21 statements, independently. There was strong agreement on all statements about ME histology (95%-100%). Statements concerning diagnosis achieved 85% to 100% agreement. A statement on the management of ME elicited agreement from the lowest rate (60%) up to 100%. The remaining two categories showed general agreement between experts on clinical presentation (75%-95%) and pathogenesis (80%-90%) of ME. There was strong agreement on the histological definition of ME. Weaker agreement on management indicates a need for further investigations, better definitions and clinical trials to produce quality guidelines for management. This ME consensus is a step toward greater recognition of a significant entity affecting symptomatic patients previously labelled as non-specific or functional enteropathy. PMID:25759526

  9. Microscopic enteritis: Bucharest consensus

    PubMed Central

    Rostami, Kamran; Aldulaimi, David; Holmes, Geoffrey; Johnson, Matt W; Robert, Marie; Srivastava, Amitabh; Fléjou, Jean-François; Sanders, David S; Volta, Umberto; Derakhshan, Mohammad H; Going, James J; Becheanu, Gabriel; Catassi, Carlo; Danciu, Mihai; Materacki, Luke; Ghafarzadegan, Kamran; Ishaq, Sauid; Rostami-Nejad, Mohammad; Peña, A Salvador; Bassotti, Gabrio; Marsh, Michael N; Villanacci, Vincenzo

    2015-01-01

    Microscopic enteritis (ME) is an inflammatory condition of the small bowel that leads to gastrointestinal symptoms, nutrient and micronutrient deficiency. It is characterised by microscopic or sub-microscopic abnormalities such as microvillus changes and enterocytic alterations in the absence of definite macroscopic changes using standard modern endoscopy. This work recognises a need to characterize disorders with microscopic and submicroscopic features, currently regarded as functional or non-specific entities, to obtain further understanding of their clinical relevance. The consensus working party reviewed statements about the aetiology, diagnosis and symptoms associated with ME and proposes an algorithm for its investigation and treatment. Following the 5th International Course in Digestive Pathology in Bucharest in November 2012, an international group of 21 interested pathologists and gastroenterologists formed a working party with a view to formulating a consensus statement on ME. A five-step agreement scale (from strong agreement to strong disagreement) was used to score 21 statements, independently. There was strong agreement on all statements about ME histology (95%-100%). Statements concerning diagnosis achieved 85% to 100% agreement. A statement on the management of ME elicited agreement from the lowest rate (60%) up to 100%. The remaining two categories showed general agreement between experts on clinical presentation (75%-95%) and pathogenesis (80%-90%) of ME. There was strong agreement on the histological definition of ME. Weaker agreement on management indicates a need for further investigations, better definitions and clinical trials to produce quality guidelines for management. This ME consensus is a step toward greater recognition of a significant entity affecting symptomatic patients previously labelled as non-specific or functional enteropathy. PMID:25759526

  10. Microscopic enteritis: Bucharest consensus.

    PubMed

    Rostami, Kamran; Aldulaimi, David; Holmes, Geoffrey; Johnson, Matt W; Robert, Marie; Srivastava, Amitabh; Fléjou, Jean-François; Sanders, David S; Volta, Umberto; Derakhshan, Mohammad H; Going, James J; Becheanu, Gabriel; Catassi, Carlo; Danciu, Mihai; Materacki, Luke; Ghafarzadegan, Kamran; Ishaq, Sauid; Rostami-Nejad, Mohammad; Peña, A Salvador; Bassotti, Gabrio; Marsh, Michael N; Villanacci, Vincenzo

    2015-03-01

    Microscopic enteritis (ME) is an inflammatory condition of the small bowel that leads to gastrointestinal symptoms, nutrient and micronutrient deficiency. It is characterised by microscopic or sub-microscopic abnormalities such as microvillus changes and enterocytic alterations in the absence of definite macroscopic changes using standard modern endoscopy. This work recognises a need to characterize disorders with microscopic and submicroscopic features, currently regarded as functional or non-specific entities, to obtain further understanding of their clinical relevance. The consensus working party reviewed statements about the aetiology, diagnosis and symptoms associated with ME and proposes an algorithm for its investigation and treatment. Following the 5(th) International Course in Digestive Pathology in Bucharest in November 2012, an international group of 21 interested pathologists and gastroenterologists formed a working party with a view to formulating a consensus statement on ME. A five-step agreement scale (from strong agreement to strong disagreement) was used to score 21 statements, independently. There was strong agreement on all statements about ME histology (95%-100%). Statements concerning diagnosis achieved 85% to 100% agreement. A statement on the management of ME elicited agreement from the lowest rate (60%) up to 100%. The remaining two categories showed general agreement between experts on clinical presentation (75%-95%) and pathogenesis (80%-90%) of ME. There was strong agreement on the histological definition of ME. Weaker agreement on management indicates a need for further investigations, better definitions and clinical trials to produce quality guidelines for management. This ME consensus is a step toward greater recognition of a significant entity affecting symptomatic patients previously labelled as non-specific or functional enteropathy.

  11. [Consensus statement haemorrhoidal disease].

    PubMed

    Aigner, Felix; Conrad, Friedrich; Haunold, Ingrid; Pfeifer, Johann; Salat, Andreas; Wunderlich, Max; Fortelny, Rene; Fritsch, Helga; Glöckler, Markus; Hauser, Hubert; Heuberger, Andreas; Karner-Hanusch, Judith; Kopf, Christoph; Lechner, Peter; Riss, Stefan; Roka, Sebastian; Scheyer, Matthias

    2012-03-01

    Haemorrhoidal disease belongs to the most common benign disorders in the lower gastrointestinal tract. Treatment options comprise conservative as well as surgical therapy still being applied arbitrarily in accordance with the surgeon's expertise. The aim of this consensus statement was therefore to assess a stage-dependent approach for treatment of haemorrhoidal disease to derive evidence-based recommendations for clinical routine. The most common methods are discussed with respect of haemorrhoidal disease in extraordinary conditions like pregnancy or inflammatory bowel disease and recurrent haemorrhoids. Tailored haemorrhoidectomy is preferable for individualized treatment with regard to the shortcomings of the traditional Goligher classification in solitary or circular haemorrhoidal prolapses.

  12. Sequence of the cDNA and 5'-flanking region for human acid alpha-glucosidase, detection of an intron in the 5' untranslated leader sequence, definition of 18-bp polymorphisms, and differences with previous cDNA and amino acid sequences.

    PubMed

    Martiniuk, F; Mehler, M; Tzall, S; Meredith, G; Hirschhorn, R

    1990-03-01

    Acid maltase or acid alpha-glucosidase (GAA) is a lysosomal enzyme that hydrolyzes glycogen to glucose and is deficient in glycogen storage disease type II. Previously, we isolated a partial cDNA (1.9 kb) for human GAA; we have now used this cDNA to isolate and determine sequence in longer cDNAs from four additional independent cDNA libraries. Primer extension studies indicated that the mRNA extended approximately 200 bp 5' of the cDNA sequence obtained. Therefore, we isolated a genomic fragment containing 5' cDNA sequences that overlapped the previous cDNA sequence and extended an additional 24 bp to an initiation codon within a Kozak consensus sequence. The sequence of the genomic clone revealed an intron-exon junction 32 bp 5' to the ATG, indicating that the 5' leader sequence was interrupted by an intron. The remaining 186 bp of 5' untranslated sequence was identified approximately 3 kb upstream. The promoter region upstream from the start site of transcription was GC rich and contained areas of homology to Sp1 binding sites but no identifiable CAAT or TATA box. The combined data gave a nucleotide sequence of 2,856 bp for the coding region from the ATG to a stop codon, predicting a protein of 952 amino acids. The 3' untranslated region contained 555 bp with a polyadenylation signal at 3,385 bp followed by 16 bp prior to a poly(A) tail. This sequence of the GAA coding region differs from that reported by Hoefsloot et al. (1988) in three areas that change a total of 42 amino acids. Direct determination of the amino acid sequence in one of these areas confirmed the nucleotide sequence reported here but also disagreed with the directly determined amino acid sequence reported by Hoefsloot et al. (1988). At two other areas, changes in base pairs predicted new restriction sites that were identified in cDNAs from several independent libraries. The amino acid changes in all three ares increased the homology to rabbit-human isomaltase. Therefore, we believe that our

  13. Surface Hopping by Consensus.

    PubMed

    Martens, Craig C

    2016-07-01

    We present a new stochastic surface hopping method for modeling molecular dynamics with electronic transitions. The approach, consensus surface hopping (CSH), is a numerical framework for solving the semiclassical limit Liouville equation describing nuclear dynamics on coupled electronic surfaces using ensembles of trajectories. In contrast to existing techniques based on propagating independent classical trajectories that undergo stochastic hops between the electronic states, the present method determines the probabilities of transition of each trajectory collectively with input from the entire ensemble. The full coherent dynamics of the coupled system arise naturally at the ensemble level and ad hoc corrections, such as momentum rescaling to impose strict trajectory energy conservation and artificial decoherence to avoid the overcoherence of the quantum states associated with independent trajectories, are avoided. PMID:27345103

  14. Between consensus and contestation.

    PubMed

    Weale, Albert

    2016-08-15

    Purpose - Noting that discussions of public participation and priority setting typically presuppose certain political theories of democracy, the purpose of this paper is to discuss two theories: the consensual and the agonistic. The distinction is illuminating when considering the difference between institutionalized public participation and contestatory participation. Design/methodology/approach - The approach is a theoretical reconstruction of two ways of thinking about public participation in relation to priority setting in health care, drawing on the work of Habermas, a deliberative theorist, and Mouffe, a theorist of agonism. Findings - The different theoretical approaches can be associated with different ways of understanding priority setting. In particular, agonistic democratic theory would understand priority setting as system of inclusions and exclusions rather than the determination of a consensus of social values, which is the typical deliberative way of thinking about the issues. Originality/value - The paper shows the value of drawing out explicitly the tacit assumptions of practices of political participation in order to reveal their scope and limitations. It suggests that making such theoretical presuppositions explicit has value for health services management in recognizing these implicit choices. PMID:27468774

  15. Between consensus and contestation.

    PubMed

    Weale, Albert

    2016-08-15

    Purpose - Noting that discussions of public participation and priority setting typically presuppose certain political theories of democracy, the purpose of this paper is to discuss two theories: the consensual and the agonistic. The distinction is illuminating when considering the difference between institutionalized public participation and contestatory participation. Design/methodology/approach - The approach is a theoretical reconstruction of two ways of thinking about public participation in relation to priority setting in health care, drawing on the work of Habermas, a deliberative theorist, and Mouffe, a theorist of agonism. Findings - The different theoretical approaches can be associated with different ways of understanding priority setting. In particular, agonistic democratic theory would understand priority setting as system of inclusions and exclusions rather than the determination of a consensus of social values, which is the typical deliberative way of thinking about the issues. Originality/value - The paper shows the value of drawing out explicitly the tacit assumptions of practices of political participation in order to reveal their scope and limitations. It suggests that making such theoretical presuppositions explicit has value for health services management in recognizing these implicit choices.

  16. Brazilian Consensus on Photoprotection

    PubMed Central

    Schalka, Sérgio; Steiner, Denise; Ravelli, Flávia Naranjo; Steiner, Tatiana; Terena, Aripuanã Cobério; Marçon, Carolina Reato; Ayres, Eloisa Leis; Addor, Flávia Alvim Sant'anna; Miot, Helio Amante; Ponzio, Humberto; Duarte, Ida; Neffá, Jane; da Cunha, José Antônio Jabur; Boza, Juliana Catucci; Samorano, Luciana de Paula; Corrêa, Marcelo de Paula; Maia, Marcus; Nasser, Nilton; Leite, Olga Maria Rodrigues Ribeiro; Lopes, Otávio Sergio; Oliveira, Pedro Dantas; Meyer, Renata Leal Bregunci; Cestari, Tânia; dos Reis, Vitor Manoel Silva; Rego, Vitória Regina Pedreira de Almeida

    2014-01-01

    Brazil is a country of continental dimensions with a large heterogeneity of climates and massive mixing of the population. Almost the entire national territory is located between the Equator and the Tropic of Capricorn, and the Earth axial tilt to the south certainly makes Brazil one of the countries of the world with greater extent of land in proximity to the sun. The Brazilian coastline, where most of its population lives, is more than 8,500 km long. Due to geographic characteristics and cultural trends, Brazilians are among the peoples with the highest annual exposure to the sun. Epidemiological data show a continuing increase in the incidence of non-melanoma and melanoma skin cancers. Photoprotection can be understood as a set of measures aimed at reducing sun exposure and at preventing the development of acute and chronic actinic damage. Due to the peculiarities of Brazilian territory and culture, it would not be advisable to replicate the concepts of photoprotection from other developed countries, places with completely different climates and populations. Thus the Brazilian Society of Dermatology has developed the Brazilian Consensus on Photoprotection, the first official document on photoprotection developed in Brazil for Brazilians, with recommendations on matters involving photoprotection. PMID:25761256

  17. Consensus on consensus: a synthesis of consensus estimates on human-caused global warming

    NASA Astrophysics Data System (ADS)

    Cook, John; Oreskes, Naomi; Doran, Peter T.; Anderegg, William R. L.; Verheggen, Bart; Maibach, Ed W.; Carlton, J. Stuart; Lewandowsky, Stephan; Skuce, Andrew G.; Green, Sarah A.; Nuccitelli, Dana; Jacobs, Peter; Richardson, Mark; Winkler, Bärbel; Painting, Rob; Rice, Ken

    2016-04-01

    The consensus that humans are causing recent global warming is shared by 90%-100% of publishing climate scientists according to six independent studies by co-authors of this paper. Those results are consistent with the 97% consensus reported by Cook et al (Environ. Res. Lett. 8 024024) based on 11 944 abstracts of research papers, of which 4014 took a position on the cause of recent global warming. A survey of authors of those papers (N = 2412 papers) also supported a 97% consensus. Tol (2016 Environ. Res. Lett. 11 048001) comes to a different conclusion using results from surveys of non-experts such as economic geologists and a self-selected group of those who reject the consensus. We demonstrate that this outcome is not unexpected because the level of consensus correlates with expertise in climate science. At one point, Tol also reduces the apparent consensus by assuming that abstracts that do not explicitly state the cause of global warming (‘no position’) represent non-endorsement, an approach that if applied elsewhere would reject consensus on well-established theories such as plate tectonics. We examine the available studies and conclude that the finding of 97% consensus in published climate research is robust and consistent with other surveys of climate scientists and peer-reviewed studies.

  18. Consensus on consensus: a synthesis of consensus estimates on human-caused global warming

    NASA Astrophysics Data System (ADS)

    Cook, John; Oreskes, Naomi; Doran, Peter T.; Anderegg, William R. L.; Verheggen, Bart; Maibach, Ed W.; Carlton, J. Stuart; Lewandowsky, Stephan; Skuce, Andrew G.; Green, Sarah A.; Nuccitelli, Dana; Jacobs, Peter; Richardson, Mark; Winkler, Bärbel; Painting, Rob; Rice, Ken

    2016-04-01

    The consensus that humans are causing recent global warming is shared by 90%–100% of publishing climate scientists according to six independent studies by co-authors of this paper. Those results are consistent with the 97% consensus reported by Cook et al (Environ. Res. Lett. 8 024024) based on 11 944 abstracts of research papers, of which 4014 took a position on the cause of recent global warming. A survey of authors of those papers (N = 2412 papers) also supported a 97% consensus. Tol (2016 Environ. Res. Lett. 11 048001) comes to a different conclusion using results from surveys of non-experts such as economic geologists and a self-selected group of those who reject the consensus. We demonstrate that this outcome is not unexpected because the level of consensus correlates with expertise in climate science. At one point, Tol also reduces the apparent consensus by assuming that abstracts that do not explicitly state the cause of global warming (‘no position’) represent non-endorsement, an approach that if applied elsewhere would reject consensus on well-established theories such as plate tectonics. We examine the available studies and conclude that the finding of 97% consensus in published climate research is robust and consistent with other surveys of climate scientists and peer-reviewed studies.

  19. ncRNA consensus secondary structure derivation using grammar strings.

    PubMed

    Achawanantakun, Rujira; Sun, Yanni; Takyar, Seyedeh Shohreh

    2011-04-01

    Many noncoding RNAs (ncRNAs) function through both their sequences and secondary structures. Thus, secondary structure derivation is an important issue in today's RNA research. The state-of-the-art structure annotation tools are based on comparative analysis, which derives consensus structure of homologous ncRNAs. Despite promising results from existing ncRNA aligning and consensus structure derivation tools, there is a need for more efficient and accurate ncRNA secondary structure modeling and alignment methods. In this work, we introduce a consensus structure derivation approach based on grammar string, a novel ncRNA secondary structure representation that encodes an ncRNA's sequence and secondary structure in the parameter space of a context-free grammar (CFG) and a full RNA grammar including pseudoknots. Being a string defined on a special alphabet constructed from a grammar, grammar string converts ncRNA alignment into sequence alignment. We derive consensus secondary structures from hundreds of ncRNA families from BraliBase 2.1 and 25 families containing pseudoknots using grammar string alignment. Our experiments have shown that grammar string-based structure derivation competes favorably in consensus structure quality with Murlet and RNASampler. Source code and experimental data are available at http://www.cse.msu.edu/~yannisun/grammar-string. PMID:21523935

  20. ncRNA consensus secondary structure derivation using grammar strings.

    PubMed

    Achawanantakun, Rujira; Sun, Yanni; Takyar, Seyedeh Shohreh

    2011-04-01

    Many noncoding RNAs (ncRNAs) function through both their sequences and secondary structures. Thus, secondary structure derivation is an important issue in today's RNA research. The state-of-the-art structure annotation tools are based on comparative analysis, which derives consensus structure of homologous ncRNAs. Despite promising results from existing ncRNA aligning and consensus structure derivation tools, there is a need for more efficient and accurate ncRNA secondary structure modeling and alignment methods. In this work, we introduce a consensus structure derivation approach based on grammar string, a novel ncRNA secondary structure representation that encodes an ncRNA's sequence and secondary structure in the parameter space of a context-free grammar (CFG) and a full RNA grammar including pseudoknots. Being a string defined on a special alphabet constructed from a grammar, grammar string converts ncRNA alignment into sequence alignment. We derive consensus secondary structures from hundreds of ncRNA families from BraliBase 2.1 and 25 families containing pseudoknots using grammar string alignment. Our experiments have shown that grammar string-based structure derivation competes favorably in consensus structure quality with Murlet and RNASampler. Source code and experimental data are available at http://www.cse.msu.edu/~yannisun/grammar-string.

  1. Is There a Consensus on Consensus Methodology? Descriptions and Recommendations for Future Consensus Research.

    PubMed

    Waggoner, Jane; Carline, Jan D; Durning, Steven J

    2016-05-01

    The authors of this article reviewed the methodology of three common consensus methods: nominal group process, consensus development panels, and the Delphi technique. The authors set out to determine how a majority of researchers are conducting these studies, how they are analyzing results, and subsequently the manner in which they are reporting their findings. The authors conclude with a set of guidelines and suggestions designed to aid researchers who choose to use the consensus methodology in their work.Overall, researchers need to describe their inclusion criteria. In addition to this, on the basis of the current literature the authors found that a panel size of 5 to 11 members was most beneficial across all consensus methods described. Lastly, the authors agreed that the statistical analyses done in consensus method studies should be as rigorous as possible and that the predetermined definition of consensus must be included in the ultimate manuscript. More specific recommendations are given for each of the three consensus methods described in the article.

  2. Consensus conference. Electroconvulsive therapy.

    PubMed

    1985-10-18

    mechanism of action, clarify the extent of adverse effects, and determine optimum treatment technique. Despite recent research effort yielding substantial information, permitting professional and public evaluation of the safety and efficacy of ECT, the investigation of ECT has not generally been in the mainstream of mental health research. To help resolve questions surrounding these issues, the National Institutes of Health in conjunction with the National Institute of Mental Health convened a Consensus Development Conference on Electroconvulsive Therapy from June 10 to 12, 1985.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:4046138

  3. Winning consensus on social networks

    NASA Astrophysics Data System (ADS)

    Sreenivasan, Sameet; Xie, J.; Korniss, G.; Szymanski, Boleslaw

    2011-03-01

    The adoption of a specific behavior (opinion) by a population of individuals is influenced dramatically by the social network through which the individuals interact. Here, we show the conditions under which a randomly distributed sub-population of committed agents -- nodes on the network that consistently profess a unique opinion and are not influenceable to change -- can win over an entire population of individuals initially opposed to that opinion. We model the opinion dynamics by a variant of the Naming Game (Baronchelli et al. (2006)), which effectively captures the persistence of dominant opinions. Given this model, we demonstrate that in the asymptotic network size limit, there exists a critical value p c of the fraction of committed agents, above which the network-state attains consensus, and below which the network-state converges to a non-consensus fixed point. We also discuss finite size corrections to p c and the scaling of consensus times for finite networks. Support by ARL, ONR.

  4. C3 glomerulopathy: consensus report

    PubMed Central

    Pickering, Matthew C; D'Agati, Vivette D; Nester, Carla M; Smith, Richard J; Haas, Mark; Appel, Gerald B; Alpers, Charles E; Bajema, Ingeborg M; Bedrosian, Camille; Braun, Michael; Doyle, Mittie; Fakhouri, Fadi; Fervenza, Fernando C; Fogo, Agnes B; Frémeaux-Bacchi, Véronique; Gale, Daniel P; Goicoechea de Jorge, Elena; Griffin, Gene; Harris, Claire L; Holers, V Michael; Johnson, Sally; Lavin, Peter J; Medjeral-Thomas, Nicholas; Paul Morgan, B; Nast, Cynthia C; Noel, Laure-Hélène; Peters, D Keith; Rodríguez de Córdoba, Santiago; Servais, Aude; Sethi, Sanjeev; Song, Wen-Chao; Tamburini, Paul; Thurman, Joshua M; Zavros, Michael; Cook, H Terence

    2013-01-01

    C3 glomerulopathy is a recently introduced pathological entity whose original definition was glomerular pathology characterized by C3 accumulation with absent or scanty immunoglobulin deposition. In August 2012, an invited group of experts (comprising the authors of this document) in renal pathology, nephrology, complement biology, and complement therapeutics met to discuss C3 glomerulopathy in the first C3 Glomerulopathy Meeting. The objectives were to reach a consensus on: the definition of C3 glomerulopathy, appropriate complement investigations that should be performed in these patients, and how complement therapeutics should be explored in the condition. This meeting report represents the current consensus view of the group. PMID:24172683

  5. Evolutionary origin of asymptotically stable consensus.

    PubMed

    Tang, Chang-Bing; Wu, Bin; Wang, Jian-Bo; Li, Xiang

    2014-01-01

    Consensus is widely observed in nature as well as in society. Up to now, many works have focused on what kind of (and how) isolated single structures lead to consensus, while the dynamics of consensus in interdependent populations remains unclear, although interactive structures are everywhere. For such consensus in interdependent populations, we refer that the fraction of population adopting a specified strategy is the same across different interactive structures. A two-strategy game as a conflict is adopted to explore how natural selection affects the consensus in such interdependent populations. It is shown that when selection is absent, all the consensus states are stable, but none are evolutionarily stable. In other words, the final consensus state can go back and forth from one to another. When selection is present, there is only a small number of stable consensus state which are evolutionarily stable. Our study highlights the importance of evolution on stabilizing consensus in interdependent populations. PMID:24699444

  6. International consensus on allergy immunotherapy.

    PubMed

    Jutel, Marek; Agache, Ioana; Bonini, Sergio; Burks, A Wesley; Calderon, Moises; Canonica, Walter; Cox, Linda; Demoly, Pascal; Frew, Antony J; O'Hehir, Robin; Kleine-Tebbe, Jörg; Muraro, Antonella; Lack, Gideon; Larenas, Désirée; Levin, Michael; Nelson, Harald; Pawankar, Ruby; Pfaar, Oliver; van Ree, Ronald; Sampson, Hugh; Santos, Alexandra F; Du Toit, George; Werfel, Thomas; Gerth van Wijk, Roy; Zhang, Luo; Akdis, Cezmi A

    2015-09-01

    Allergen immunotherapy (AIT) has been used to treat allergic disease since the early 1900s. Despite numerous clinical trials and meta-analyses proving AIT efficacious, it remains underused and is estimated to be used in less than 10% of patients with allergic rhinitis or asthma worldwide. In addition, there are large differences between regions, which are not only due to socioeconomic status. There is practically no controversy about the use of AIT in the treatment of allergic rhinitis and allergic asthma, but for atopic dermatitis or food allergy, the indications for AIT are not well defined. The elaboration of a wider consensus is of utmost importance because AIT is the only treatment that can change the course of allergic disease by preventing the development of asthma and new allergen sensitizations and by inducing allergen-specific immune tolerance. Safer and more effective AIT strategies are being continuously developed both through elaboration of new allergen preparations and adjuvants and alternate routes of administration. A number of guidelines, consensus documents, or both are available on both the international and national levels. The international community of allergy specialists recognizes the need to develop a comprehensive consensus report to harmonize, disseminate, and implement the best AIT practice. Consequently, the International Collaboration in Asthma, Allergy and Immunology, formed by the European Academy of Allergy and Clinical Immunology; the American Academy of Allergy, Asthma & Immunology; the American College of Allergy, Asthma & Immunology; and the World Allergy Organization, has decided to issue an international consensus on AIT.

  7. Phenotypic comparisons of consensus variants versus laboratory resurrections of Precambrian proteins.

    PubMed

    Risso, Valeria A; Gavira, Jose A; Gaucher, Eric A; Sanchez-Ruiz, Jose M

    2014-06-01

    Consensus-sequence engineering has generated protein variants with enhanced stability, and sometimes, with modulated biological function. Consensus mutations are often interpreted as the introduction of ancestral amino acid residues. However, the precise relationship between consensus engineering and ancestral protein resurrection is not fully understood. Here, we report the properties of proteins encoded by consensus sequences derived from a multiple sequence alignment of extant, class A β-lactamases, as compared with the properties of ancient Precambrian β-lactamases resurrected in the laboratory. These comparisons considered primary sequence, secondary, and tertiary structure, as well as stability and catalysis against different antibiotics. Out of the three consensus variants generated, one could not be expressed and purified (likely due to misfolding and/or low stability) and only one displayed substantial stability having substrate promiscuity, although to a lower extent than ancient β-lactamases. These results: (i) highlight the phenotypic differences between consensus variants and laboratory resurrections of ancestral proteins; (ii) question interpretations of consensus proteins as phenotypic proxies of ancestral proteins; and (iii) support the notion that ancient proteins provide a robust approach toward the preparation of protein variants having large numbers of mutational changes while possessing unique biomolecular properties.

  8. Phenotypic comparisons of consensus variants versus laboratory resurrections of Precambrian proteins.

    PubMed

    Risso, Valeria A; Gavira, Jose A; Gaucher, Eric A; Sanchez-Ruiz, Jose M

    2014-06-01

    Consensus-sequence engineering has generated protein variants with enhanced stability, and sometimes, with modulated biological function. Consensus mutations are often interpreted as the introduction of ancestral amino acid residues. However, the precise relationship between consensus engineering and ancestral protein resurrection is not fully understood. Here, we report the properties of proteins encoded by consensus sequences derived from a multiple sequence alignment of extant, class A β-lactamases, as compared with the properties of ancient Precambrian β-lactamases resurrected in the laboratory. These comparisons considered primary sequence, secondary, and tertiary structure, as well as stability and catalysis against different antibiotics. Out of the three consensus variants generated, one could not be expressed and purified (likely due to misfolding and/or low stability) and only one displayed substantial stability having substrate promiscuity, although to a lower extent than ancient β-lactamases. These results: (i) highlight the phenotypic differences between consensus variants and laboratory resurrections of ancestral proteins; (ii) question interpretations of consensus proteins as phenotypic proxies of ancestral proteins; and (iii) support the notion that ancient proteins provide a robust approach toward the preparation of protein variants having large numbers of mutational changes while possessing unique biomolecular properties. PMID:24710963

  9. Models for Policy Design. Public Consensus Model. Professional Consensus Model. Public/Professional Consensus Model.

    ERIC Educational Resources Information Center

    Policy Studies in Education, New York, NY.

    This publication discusses the need for feasible alternative methods of reaching consensus about major educational issues and identifies several methods that reflect the pluralistic nature of education and yet can produce unified policy directions for education at the national, state, and local levels. Section 1 focuses on the need for and nature…

  10. Energy strategy: Roadmap to consensus

    SciTech Connect

    Not Available

    1990-11-01

    The United States lacks a comprehensive approach to policy-making in the energy realm. Today, as in the past, individual constituency groups tend to focus on their particular aspect of the energy challenge. Many employ a decide-announce-defend'' approach to policy-making, setting out to secure a unilateral advantage for themselves. By so doing, they inevitably pit interest against interest. The result is a polarization of constituencies, and shortsighted policies designed to address the issue of the moment. The American Energy Assurance Council (AEAC) is a non-profit organization founded in 1987 for the sole purpose of facilitating progress toward a fair efficient wise, stable, and consensus-based national energy strategy. AEAC does not have a substantive policy agencies. Rather, we are committed to supporting a process whereby the many stakeholders and policy makers concerned with energy-related issues can come together in productive discourse, thereby overcoming ignorance of each other's positions. The Council seeks to act as a facilitative body, providing a safe'' context for inventive and creative thinking. We attempt to build a store of common knowledge, and to build on that store according to mutually agreed-upon groundrules, and employing sophisticated approaches to facilitation and mediation. This report, the National Energy Consensus Experiment (NECE), was an ambitious experiment in consensus-building. We learned a great deal from it, both in terms of substance and process, and we are convinced that it holds important lessons for others who may seek to build consensus in the public policy realm.

  11. Energy strategy: Roadmap to consensus

    SciTech Connect

    Not Available

    1990-11-01

    The United States lacks a comprehensive approach to policy-making in the energy realm. Today, as in the past, individual constituency groups tend to focus on their particular aspect of the energy challenge. Many employ a ``decide-announce-defend`` approach to policy-making, setting out to secure a unilateral advantage for themselves. By so doing, they inevitably pit interest against interest. The result is a polarization of constituencies, and shortsighted policies designed to address the issue of the moment. The American Energy Assurance Council (AEAC) is a non-profit organization founded in 1987 for the sole purpose of facilitating progress toward a fair efficient wise, stable, and consensus-based national energy strategy. AEAC does not have a substantive policy agencies. Rather, we are committed to supporting a process whereby the many stakeholders and policy makers concerned with energy-related issues can come together in productive discourse, thereby overcoming ignorance of each other`s positions. The Council seeks to act as a facilitative body, providing a ``safe`` context for inventive and creative thinking. We attempt to build a store of common knowledge, and to build on that store according to mutually agreed-upon groundrules, and employing sophisticated approaches to facilitation and mediation. This report, the National Energy Consensus Experiment (NECE), was an ambitious experiment in consensus-building. We learned a great deal from it, both in terms of substance and process, and we are convinced that it holds important lessons for others who may seek to build consensus in the public policy realm.

  12. Liberal Education: An Overlapping Pragmatic Consensus.

    ERIC Educational Resources Information Center

    Paris, David C.; Kimball, Bruce A.

    2000-01-01

    Suggests in Bruce Kimball's thesis that a pragmatic consensus was emerging about the understanding of liberal education offers that it might be best understood by comparing it to J. Rawl's idea of an "overlapping consensus." States that by comparing and contrasting these ideas that the emerging consensus is pragmatic in nature. (CMK)

  13. Attitude Importance and the False Consensus Effect.

    ERIC Educational Resources Information Center

    Fabrigar, Leandre R.; Krosnick, Jon A.

    1995-01-01

    Explores the possibility that importance may regulate the magnitude of the false consensus effect. Analysis revealed a strong false consensus effect but no reliable relation between its magnitude and attitude importance. Results contradict assumptions that the false consensus effect arises from attitudes that directly or indirectly influence…

  14. Consensus report. Drug concentrations and driving impairment. Consensus Development Panel.

    PubMed

    1985-11-01

    Most drugs that affect the central nervous system have the potential to impair driving ability. For many years, alcohol (ethanol) has been the drug of greatest concern, since it is, by far, the most frequently recognized cause of drug-impaired driving. Yet as more therapeutic agents, such as benzodiazepines, are introduced and widely used, and as social use of unsanctioned drugs such as cannabis (marijuana) increases, attention must be directed toward other drugs. The National Institute on Drug Abuse sponsored a conference on drugs and driving in Durham, NC, in October 1983. The objective was to reach a consensus on several key issues associated with the current state of knowledge about the relationship between body fluid concentrations of drugs and their pharmacologically active metabolites and degree of driving impairment. It was also of interest to ascertain whether a sufficient body of knowledge exists for an expert to form an opinion, which will meet the applicable standards of proof for legal proceedings, that a person's driving ability was impaired based on body fluid concentrations of a drug. The consensus panel, representing the disciplines of clinical pharmacology, analytical and forensic toxicology, law, and forensic medicine agreed on answers to the following questions: Is ethanol a good model for other drugs? What drugs might have a potential for impairing a driver? How is driving impairment measured? What is known about correlations between driving impairment and drug concentrations? Could "per se" concentrations be established for drugs other than alcohol? Can impairment be established from body fluid concentrations?

  15. Disagreement, consensus, and moral integrity.

    PubMed

    Macklin, Ruth

    1996-09-01

    The Advisory Committee on Human Radiation Experiments experienced some disagreements among its members in the course of its work. An epistemological controversy over the nature and degree of evidence required to draw ethical conclusions pervaded the Committee's deliberations. Other disagreements involved the proper role of a governmental advisory committee and the question of when it is appropriate to notify people that they were unknowing subjects of radiation experiments. In the end, the Committee was able to reach consensus on almost all of its findings and recommendations through a process that preserved the integrity of its members.

  16. Preserving sequence annotations across reference sequences

    PubMed Central

    2014-01-01

    Background Matching and comparing sequence annotations of different reference sequences is vital to genomics research, yet many annotation formats do not specify the reference sequence types or versions used. This makes the integration of annotations from different sources difficult and error prone. Results As part of our effort to create linked data for interoperable sequence annotations, we present an RDF data model for sequence annotation using the ontological framework established by the OBO Foundry ontologies and the Basic Formal Ontology (BFO). We defined reference sequences as the common domain of integration for sequence annotations, and identified three semantic relationships between sequence annotations. In doing so, we created the Reference Sequence Annotation to compensate for gaps in the SO and in its mapping to BFO, particularly for annotations that refer to versions of consensus reference sequences. Moreover, we present three integration models for sequence annotations using different reference assemblies. Conclusions We demonstrated a working example of a sequence annotation instance, and how this instance can be linked to other annotations on different reference sequences. Sequence annotations in this format are semantically rich and can be integrated easily with different assemblies. We also identify other challenges of modeling reference sequences with the BFO. PMID:25093075

  17. Canadian asthma consensus report, 1999

    PubMed Central

    Boulet, L P; Becker, A; Bérubé, D; Beveridge, R; Ernst, P

    1999-01-01

    OBJECTIVES: To provide physicians with current guidelines for the diagnosis and optimal management of asthma in children and adults, including pregnant women and the elderly, in office, emergency department, hospital and clinic settings. OPTIONS: The consensus group considered the roles of education, avoidance of provocative environmental and other factors, diverse pharmacotherapies, delivery devices and emergency and in-hospital management of asthma. OUTCOMES: Provision of the best control of asthma by confirmation of the diagnosis using objective measures, rapid achievement and maintenance of control and regular follow-up. EVIDENCE: The key diagnostic and therapeutic recommendations are based on the 1995 Canadian guidelines and a critical review of the literature by small groups before a full meeting of the consensus group. Recommendations are graded according to 5 levels of evidence. Differences of opinion were resolved by consensus following discussion. VALUES: Respirologists, immunoallergists, pediatricians and emergency and family physicians gave prime consideration to the achievement and maintenance of optimal control of asthma through avoidance of environmental inciters, education of patients and the lowest effective regime of pharmacotherapy to reduce morbidity and mortality. BENEFITS, HARMS AND COSTS: Adherence to the guidelines should be accompanied by significant reduction in patients' symptoms, reduced morbidity and mortality, fewer emergency and hospital admissions, fewer adverse side-effects from medications, better quality of life for patients and reduced costs. RECOMMENDATIONS: Recommendations are included in each section of the report. In summary, after a diagnosis of asthma is made based on clinical evaluation, including demonstration of variable airflow obstruction, and contributing factors are identified, a treatment plan is established to obtain and maintain optimal asthma control. The main components of treatment are patient education

  18. Theories about consensus-based conservation.

    PubMed

    Leach, William D

    2006-04-01

    "Conservation and the Myth of Consensus" (Peterson et al. 2005) levels several serious indictments against consensus-based approaches to environmental decision making. Namely, the authors argue that consensus processes (1) reinforce apathy and ignorance of conservation issues; (2) legitimize damage to the environment; (3) quash public debate about conservation; (4) solidify the existing balance of power in favor of prodevelopment forces; and (5) block progress toward an ecologically sustainable future. Careful scrutiny of consensus-based approaches is important, especially considering their surging use in conservation policy. In the spirit of advancing the debate further, I review some of the limitations of the essay and its modes of inquiry.

  19. Learning consensus in adversarial environments

    NASA Astrophysics Data System (ADS)

    Vamvoudakis, Kyriakos G.; García Carrillo, Luis R.; Hespanha, João. P.

    2013-05-01

    This work presents a game theory-based consensus problem for leaderless multi-agent systems in the presence of adversarial inputs that are introducing disturbance to the dynamics. Given the presence of enemy components and the possibility of malicious cyber attacks compromising the security of networked teams, a position agreement must be reached by the networked mobile team based on environmental changes. The problem is addressed under a distributed decision making framework that is robust to possible cyber attacks, which has an advantage over centralized decision making in the sense that a decision maker is not required to access information from all the other decision makers. The proposed framework derives three tuning laws for every agent; one associated with the cost, one associated with the controller, and one with the adversarial input.

  20. Data publication consensus and controversies

    PubMed Central

    Kratz, John; Strasser, Carly

    2014-01-01

    The movement to bring datasets into the scholarly record as first class research products (validated, preserved, cited, and credited) has been inching forward for some time, but now the pace is quickening. As data publication venues proliferate, significant debate continues over formats, processes, and terminology. Here, we present an overview of data publication initiatives underway and the current conversation, highlighting points of consensus and issues still in contention. Data publication implementations differ in a variety of factors, including the kind of documentation, the location of the documentation relative to the data, and how the data is validated. Publishers may present data as supplemental material to a journal article, with a descriptive “data paper,” or independently. Complicating the situation, different initiatives and communities use the same terms to refer to distinct but overlapping concepts. For instance, the term published means that the data is publicly available and citable to virtually everyone, but it may or may not imply that the data has been peer-reviewed. In turn, what is meant by data peer review is far from defined; standards and processes encompass the full range employed in reviewing the literature, plus some novel variations. Basic data citation is a point of consensus, but the general agreement on the core elements of a dataset citation frays if the data is dynamic or part of a larger set. Even as data publication is being defined, some are looking past publication to other metaphors, notably “data as software,” for solutions to the more stubborn problems. PMID:25075301

  1. Hilar Cholangiocarcinoma: expert consensus statement

    PubMed Central

    Mansour, John C; Aloia, Thomas A; Crane, Christopher H; Heimbach, Julie K; Nagino, Masato; Vauthey, Jean-Nicolas

    2015-01-01

    An American Hepato-Pancreato-Biliary Association (AHPBA)-sponsored consensus meeting of expert panellists met on 15 January 2014 to review current evidence on the management of hilar cholangiocarcinoma in order to establish practice guidelines and to agree consensus statements. It was established that the treatment of patients with hilar cholangiocarcinoma requires a coordinated, multidisciplinary approach to optimize the chances for both durable survival and effective palliation. An adequate diagnostic and staging work-up includes high-quality cross-sectional imaging; however, pathologic confirmation is not required prior to resection or initiation of a liver transplant trimodal treatment protocol. The ideal treatment for suitable patients with resectable hilar malignancy is resection of the intra- and extrahepatic bile ducts, as well as resection of the involved ipsilateral liver. Preoperative biliary drainage is best achieved with percutaneous transhepatic approaches and may be indicated for patients with cholangitis, malnutrition or hepatic insufficiency. Portal vein embolization is a safe and effective strategy for increasing the future liver remnant (FLR) and is particularly useful for patients with an FLR of <30%. Selected patients with unresectable hilar cholangiocarcinoma should be evaluated for a standard trimodal protocol incorporating external beam and endoluminal radiation therapy, systemic chemotherapy and liver transplantation. Post-resection chemoradiation should be offered to patients who show high-risk features on surgical pathology. Chemoradiation is also recommended for patients with locally advanced, unresectable hilar cancers. For patients with locally recurrent or metastatic hilar cholangiocarcinoma, first-line chemotherapy with gemcitabine and cisplatin is recommended based on multiple Phase II trials and a large randomized controlled trial including a heterogeneous population of patients with biliary cancers. PMID:26172136

  2. Intrahepatic Cholangiocarcinoma: expert consensus statement

    PubMed Central

    Weber, Sharon M; Ribero, Dario; O=Reilly, Eileen M; Kokudo, Norihiro; Miyazaki, Masaru; Pawlik, Timothy M

    2015-01-01

    An American Hepato-Pancreato-Biliary Association (AHPBA)-sponsored consensus meeting of expert panellists met on 15 January 2014 to review current evidence on the management of intrahepatic cholangiocarcinoma (ICC) in order to establish practice guidelines and to agree on consensus statements. The treatment of ICC requires a coordinated, multidisciplinary approach to optimize survival. Biopsy is not necessary if the surgeon suspects ICC and is planning curative resection, although biopsy should be obtained before systemic or locoregional therapies are initiated. Assessment of resectability is best accomplished using cross-sectional imaging [computed tomography (CT) or magnetic resonance imaging (MRI)], but the role of positron emission tomography (PET) is unclear. Resectability in ICC is defined by the ability to completely remove the disease while leaving an adequate liver remnant. Extrahepatic disease, multiple bilobar or multicentric tumours, and lymph node metastases beyond the primary echelon are contraindications to resection. Regional lymphadenectomy should be considered a standard part of surgical therapy. In patients with high-risk features, the routine use of diagnostic laparoscopy is recommended. The preoperative diagnosis of combined hepatocellular carcinoma and cholangiocarcinoma (cHCC–CC) by imaging studies is extremely difficult. Surgical resection remains the mainstay of treatment, but survival is worse than in HCC alone. There are no adequately powered, randomized Phase III trials that can provide definitive recommendations for adjuvant therapy for ICC. Patients with high-risk features (lymphovascular invasion, multicentricity or satellitosis, large tumours) should be encouraged to enrol in clinical trials and to consider adjuvant therapy. Cisplatin plus gemcitabine represents the standard-of-care, front-line systemic therapy for metastatic ICC. Genomic analyses of biliary cancers support the development of targeted therapeutic interventions

  3. Eastern Canadian Gastrointestinal Cancer Consensus Conference 2014

    PubMed Central

    Tsvetkova, E.; Sud, S.; Aucoin, N.; Biagi, J.; Burkes, R.; Samson, B.; Brule, S.; Cripps, C.; Colwell, B.; Falkson, C.; Dorreen, M.; Goel, R.; Halwani, F.; Maroun, J.; Michaud, N.; Tehfe, M.; Thirlwell, M.; Vickers, M.; Asmis, T.

    2015-01-01

    The annual Eastern Canadian Colorectal Cancer Consensus Conference was held in Montreal, Quebec, 23–25 October 2014. Expert radiation, medical, and surgical oncologists and pathologists involved in the management of patients with gastrointestinal malignancies participated in presentations and discussions resulting in consensus statements on such hot topics as management of neuroendocrine tumours, advanced and metastatic pancreatic cancer, and metastatic colorectal cancer. PMID:26300681

  4. A Matter of Consensus. Working Paper.

    ERIC Educational Resources Information Center

    Datta, Lois-ellin

    In response to a recommendation that the Office of Educational Research and Development (OERI) adopt consensus panels such as those used by the National Institutes of Health and the Food and Drug Administration, this paper tries to represent the range of consensus panel applications and to identify the major considerations for OERI application. A…

  5. Posterior Probabilities for a Consensus Ordering.

    ERIC Educational Resources Information Center

    Fligner, Michael A.; Verducci, Joseph S.

    1990-01-01

    The concept of consensus ordering is defined, and formulas for exact and approximate posterior probabilities for consensus ordering are developed under the assumption of a generalized Mallows' model with a diffuse conjugate prior. These methods are applied to a data set concerning 98 college students. (SLD)

  6. Myalgic encephalomyelitis: International Consensus Criteria

    PubMed Central

    Carruthers, B M; van de Sande, M I; De Meirleir, K L; Klimas, N G; Broderick, G; Mitchell, T; Staines, D; Powles, A C P; Speight, N; Vallings, R; Bateman, L; Baumgarten-Austrheim, B; Bell, D S; Carlo-Stella, N; Chia, J; Darragh, A; Jo, D; Lewis, D; Light, A R; Marshall-Gradisbik, S; Mena, I; Mikovits, J A; Miwa, K; Murovska, M; Pall, M L; Stevens, S

    2011-01-01

    , Japan; A. Kirchenstein Institute of Microbiology and Virology, Riga Stradins University, Riga, Latvia; Department of Biochemistry & Basic Medical Sciences, Washington State University, Portland, OR; Department of Sports Sciences, University of the Pacific, Stockton, CA USA). Myalgic encephalomyelitis: International Consensus Criteria (Review). J Intern Med 2011; 270: 327–338. The label ‘chronic fatigue syndrome’ (CFS) has persisted for many years because of the lack of knowledge of the aetiological agents and the disease process. In view of more recent research and clinical experience that strongly point to widespread inflammation and multisystemic neuropathology, it is more appropriate and correct to use the term ‘myalgic encephalomyelitis’ (ME) because it indicates an underlying pathophysiology. It is also consistent with the neurological classification of ME in the World Health Organization’s International Classification of Diseases (ICD G93.3). Consequently, an International Consensus Panel consisting of clinicians, researchers, teaching faculty and an independent patient advocate was formed with the purpose of developing criteria based on current knowledge. Thirteen countries and a wide range of specialties were represented. Collectively, members have approximately 400 years of both clinical and teaching experience, authored hundreds of peer-reviewed publications, diagnosed or treated approximately 50 000 patients with ME, and several members coauthored previous criteria. The expertise and experience of the panel members as well as PubMed and other medical sources were utilized in a progression of suggestions/drafts/reviews/revisions. The authors, free of any sponsoring organization, achieved 100% consensus through a Delphi-type process. The scope of this paper is limited to criteria of ME and their application. Accordingly, the criteria reflect the complex symptomatology. Operational notes enhance clarity and specificity by providing guidance in the

  7. Myalgic encephalomyelitis: International Consensus Criteria

    PubMed Central

    Carruthers, B M; van de Sande, M I; De Meirleir, K L; Klimas, N G; Broderick, G; Mitchell, T; Staines, D; Powles, A C P; Speight, N; Vallings, R; Bateman, L; Baumgarten-Austrheim, B; Bell, D S; Carlo-Stella, N; Chia, J; Darragh, A; Jo, D; Lewis, D; Light, A R; Marshall-Gradisbik, S; Mena, I; Mikovits, J A; Miwa, K; Murovska, M; Pall, M L; Stevens, S

    2011-01-01

    , Japan; A. Kirchenstein Institute of Microbiology and Virology, Riga Stradins University, Riga, Latvia; Department of Biochemistry & Basic Medical Sciences, Washington State University, Portland, OR; Department of Sports Sciences, University of the Pacific, Stockton, CA USA). Myalgic encephalomyelitis: International Consensus Criteria (Review). J Intern Med 2011; 270: 327–338. The label ‘chronic fatigue syndrome’ (CFS) has persisted for many years because of the lack of knowledge of the aetiological agents and the disease process. In view of more recent research and clinical experience that strongly point to widespread inflammation and multisystemic neuropathology, it is more appropriate and correct to use the term ‘myalgic encephalomyelitis’ (ME) because it indicates an underlying pathophysiology. It is also consistent with the neurological classification of ME in the World Health Organization’s International Classification of Diseases (ICD G93.3). Consequently, an International Consensus Panel consisting of clinicians, researchers, teaching faculty and an independent patient advocate was formed with the purpose of developing criteria based on current knowledge. Thirteen countries and a wide range of specialties were represented. Collectively, members have approximately 400 years of both clinical and teaching experience, authored hundreds of peer-reviewed publications, diagnosed or treated approximately 50 000 patients with ME, and several members coauthored previous criteria. The expertise and experience of the panel members as well as PubMed and other medical sources were utilized in a progression of suggestions/drafts/reviews/revisions. The authors, free of any sponsoring organization, achieved 100% consensus through a Delphi-type process. The scope of this paper is limited to criteria of ME and their application. Accordingly, the criteria reflect the complex symptomatology. Operational notes enhance clarity and specificity by providing guidance in the

  8. [GEITDAH consensus on attention deficit hyperactivity disorder].

    PubMed

    Montañés-Rada, F; Gastaminza-Pérez, X; Catalá, M A; Ruiz-Sanz, F; Ruiz-Lázaro, P M; Herreros-Rodríguez, O; García-Giral, M; Ortiz-Guerra, J; Alda-Díez, J A; Mojarro-Práxedes, D; Cantó-Díez, T; Mardomingo-Sanz, M J; Sasot-Llevadot, J; Pàmias, M; Rey-Sánchez, F

    2010-11-16

    In this article, the GEITDAH -the Spanish abbreviation of the Special Interest Group on Attention Deficit Hyper-activity Disorder (ADHD)- presents a consensus reached by experts in the management of ADHD from all over Spain. The consensus concerns fundamental aspects that should be the starting point for future local or regional consensus guides. Another aim of this consensus is also to reduce the amount of variability that occurs in the health care offered to patients with ADHD in our country, as well as to act as a stimulus in educational matters. That fact that it is not very long will make it more popular among greater numbers of people and this will allow these goals to be reached more effectively. The conclusions in the consensus guide have been constructed around an introduction dealing with basic aspects and recommendations for diagnosis, treatment (both pharmacological and psychotherapeutic), patient flow and organisational aspects.

  9. [GEITDAH consensus on attention deficit hyperactivity disorder].

    PubMed

    Montañés-Rada, F; Gastaminza-Pérez, X; Catalá, M A; Ruiz-Sanz, F; Ruiz-Lázaro, P M; Herreros-Rodríguez, O; García-Giral, M; Ortiz-Guerra, J; Alda-Díez, J A; Mojarro-Práxedes, D; Cantó-Díez, T; Mardomingo-Sanz, M J; Sasot-Llevadot, J; Pàmias, M; Rey-Sánchez, F

    2010-11-16

    In this article, the GEITDAH -the Spanish abbreviation of the Special Interest Group on Attention Deficit Hyper-activity Disorder (ADHD)- presents a consensus reached by experts in the management of ADHD from all over Spain. The consensus concerns fundamental aspects that should be the starting point for future local or regional consensus guides. Another aim of this consensus is also to reduce the amount of variability that occurs in the health care offered to patients with ADHD in our country, as well as to act as a stimulus in educational matters. That fact that it is not very long will make it more popular among greater numbers of people and this will allow these goals to be reached more effectively. The conclusions in the consensus guide have been constructed around an introduction dealing with basic aspects and recommendations for diagnosis, treatment (both pharmacological and psychotherapeutic), patient flow and organisational aspects. PMID:21069642

  10. Sampled-Data Consensus Over Random Networks

    NASA Astrophysics Data System (ADS)

    Wu, Junfeng; Meng, Ziyang; Yang, Tao; Shi, Guodong; Johansson, Karl Henrik

    2016-09-01

    This paper considers the consensus problem for a network of nodes with random interactions and sampled-data control actions. We first show that consensus in expectation, in mean square, and almost surely are equivalent for a general random network model when the inter-sampling interval and network size satisfy a simple relation. The three types of consensus are shown to be simultaneously achieved over an independent or a Markovian random network defined on an underlying graph with a directed spanning tree. For both independent and Markovian random network models, necessary and sufficient conditions for mean-square consensus are derived in terms of the spectral radius of the corresponding state transition matrix. These conditions are then interpreted as the existence of critical value on the inter-sampling interval, below which global mean-square consensus is achieved and above which the system diverges in mean-square sense for some initial states. Finally, we establish an upper bound on the inter-sampling interval below which almost sure consensus is reached, and a lower bound on the inter-sampling interval above which almost sure divergence is reached. Some numerical simulations are given to validate the theoretical results and some discussions on the critical value of the inter-sampling intervals for the mean-square consensus are provided.

  11. Analysis of a consensus fragment in ERIC-PCR fingerprinting of Enterobacter sakazakii.

    PubMed

    Ye, Yingwang; Wu, Qingping; Yao, Lin; Dong, Xiaohui; Wu, Kui; Zhang, Jumei

    2009-06-30

    Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR was employed to generate ERIC-PCR fingerprints of 23 strains of E. sakazakii. A consensus fragment was observed in all 23 strains and was purified, cloned and sequenced from type strain ATCC29544. A comparison of the nucleotide acid with other sequences available in the GenBank revealed 98% of identity with E. sakazakii ATCC BAA-894 and 71%-75% identity with oligopeptidase gene or protease II gene of some species from the Enterobacteriaceae family. The consensus fragment from ATCC29544 was used to synthesize probes using DIG-labeling by PCR for dot hybridization. The consensus fragment was found to be highly conserved. Diversity analysis based on the consensus fragment sequencing showed a high heterogeneity between E. sakazakii strains and other related strains. In addition, 24 E. sakazakii strains could be distributed into two groups, while E. sakazakii ATCC51329 formed a separate branch. Genetic diversity and potential taxonomic complexity were evident within the E. sakazakii strains.

  12. Polyphasic taxonomy, a consensus approach to bacterial systematics.

    PubMed Central

    Vandamme, P; Pot, B; Gillis, M; de Vos, P; Kersters, K; Swings, J

    1996-01-01

    Over the last 25 years, a much broader range of taxonomic studies of bacteria has gradually replaced the former reliance upon morphological, physiological, and biochemical characterization. This polyphasic taxonomy takes into account all available phenotypic and genotypic data and integrates them in a consensus type of classification, framed in a general phylogeny derived from 16S rRNA sequence analysis. In some cases, the consensus classification is a compromise containing a minimum of contradictions. It is thought that the more parameters that will become available in the future, the more polyphasic classification will gain stability. In this review, the practice of polyphasic taxonomy is discussed for four groups of bacteria chosen for their relevance, complexity, or both: the genera Xanthomonas and Campylobacter, the lactic acid bacteria, and the family Comamonadaceae. An evaluation of our present insights, the conclusions derived from it, and the perspectives of polyphasic taxonomy are discussed, emphasizing the keystone role of the species. Taxonomists did not succeed in standardizing species delimitation by using percent DNA hybridization values. Together with the absence of another "gold standard" for species definition, this has an enormous repercussion on bacterial taxonomy. This problem is faced in polyphasic taxonomy, which does not depend on a theory, a hypothesis, or a set of rules, presenting a pragmatic approach to a consensus type of taxonomy, integrating all available data maximally. In the future, polyphasic taxonomy will have to cope with (i) enormous amounts of data, (ii) large numbers of strains, and (iii) data fusion (data aggregation), which will demand efficient and centralized data storage. In the future, taxonomic studies will require collaborative efforts by specialized laboratories even more than now is the case. Whether these future developments will guarantee a more stable consensus classification remains an open question. PMID

  13. Improve consensus via decentralized predictive mechanisms

    NASA Astrophysics Data System (ADS)

    Zhang, H.-T.; Chen, M. Z. Q.; Zhou, T.

    2009-05-01

    For biogroups and groups of self-driven agents, making decisions often depends on interactions among group members. In this paper, we seek to understand the fundamental predictive mechanisms used by group members in order to perform such coordinated behaviors. In particular, we show that the future dynamics of each node in the network can be predicted solely using local information provided by its neighbors. Using this predicted future dynamics information, we propose a decentralized predictive consensus protocol, which yields drastic improvements in terms of both consensus speed and internal communication cost. In natural science, this study provides an evidence for the idea that some decentralized predictive mechanisms may exist in widely-spread biological swarms/flocks. From the industrial point of view, incorporation of a decentralized predictive mechanism allows for not only a significant increase in the speed of convergence towards consensus but also a reduction in the communication energy required to achieve a predefined consensus performance.

  14. Comparing and Contrasting Consensus versus Empirical Domains

    PubMed Central

    Jason, Leonard A.; Kot, Bobby; Sunnquist, Madison; Brown, Abigail; Reed, Jordan; Furst, Jacob; Newton, Julia L.; Strand, Elin Bolle; Vernon, Suzanne D.

    2015-01-01

    Background Since the publication of the CFS case definition [1], there have been a number of other criteria proposed including the Canadian Consensus Criteria [2] and the Myalgic Encephalomyelitis: International Consensus Criteria. [3] Purpose The current study compared these domains that were developed through consensus methods to one obtained through more empirical approaches using factor analysis. Methods Using data mining, we compared and contrasted fundamental features of consensus-based criteria versus empirical latent factors. In general, these approaches found the domain of Fatigue/Post-exertional malaise as best differentiating patients from controls. Results Findings indicated that the Fukuda et al. criteria had the worst sensitivity and specificity. Conclusions These outcomes might help both theorists and researchers better determine which fundamental domains to be used for the case definition. PMID:26977374

  15. Why we need a new consensus

    SciTech Connect

    King, L.

    1982-10-26

    The consensus that the world must develop all energy sources to survive permanent energy shortages may no longer be valid. Experts have institutionalized the concept of an energy crisis, but the market and political events suggest otherwise. A new consensus should reconcile this market response with the demand for energy at any price. The author feels that we must re-evaluate stockpiling, price control, the conservation ethic, research and development, and other policies in light of 1982 realities. (DCK)

  16. Population conference: consensus and conflict.

    PubMed

    Willson, P D

    1984-01-01

    The United Nations-sponsored International Conference on Population held in Mexico City was both a rejection and an affirmation of a new policy of the Reagan administration. The policy denies international family planning funds to nongovernmental organizations that perform or actively promote abortion as a family planning method in other nations. A compromise statement was accepted urging governments to take appropriate measures to discourage abortion as a family planning method and when possible to provide for the humane treatment and counseling of women ho resorted to abortion. The statement on abortion was 1 of 88 reccomendations approved by the conference. The commitment expressed in the 10-year-old World Population Plan of Action to the rights and responsiblity to all people as reaffirmed. The conference also endorsed family life education and sex education as well as suitable family planning, information and services for adolescents, with due consideration given to the role, rights and obligations of parents. Increased support for international population and family planning programs was urged and World Bank President, Clausen, urged a 4-fold increase in international funding by the year 2000. Most of the conference's recommendations re devoted to the broad range of population policy issues, including morbidity and mortality, international and internal migration, the relationship between population and economic development and the status of women. The purpose of the recommendations is to increase the momentum of international support. The Mexico City conference was characterized by a remarkable degree of consensus about population policies with respect to integration with economic development, the need to respect individual rights and the recognition that all nations have sovereign rights to develop and implement their own population policies. Conflict and controversy arose in the areas of the arms race and the Middle East. The US position on abortion funding

  17. High-affinity consensus binding of target RNAs by the STAR/GSG proteins GLD-1, STAR-2 and Quaking

    PubMed Central

    2010-01-01

    Background STAR/GSG proteins regulate gene expression in metazoans by binding consensus sites in the 5' or 3' UTRs of target mRNA transcripts. Owing to the high degree of homology across the STAR domain, most STAR proteins recognize similar RNA consensus sequences. Previously, the consensus for a number of well-characterized STAR proteins was defined as a hexameric sequence, referred to as the SBE, for STAR protein binding element. C. elegans GLD-1 and mouse Quaking (Qk-1) are two representative STAR proteins that bind similar consensus hexamers, which differ only in the preferred nucleotide identities at certain positions. Earlier reports also identified partial consensus elements located upstream or downstream of a canonical consensus hexamer in target RNAs, although the relative contribution of these sequences to the overall binding energy remains less well understood. Additionally, a recently identified STAR protein called STAR-2 from C. elegans is thought to bind target RNA consensus sites similar to that of GLD-1 and Qk-1. Results Here, a combination of fluorescence-polarization and gel mobility shift assays was used to demonstrate that STAR-2 binds to a similar RNA consensus as GLD-1 and Qk-1. These assays were also used to further delineate the contributions of each hexamer consensus nucleotide to high-affinity binding by GLD-1, Qk-1 and STAR-2 in a variety of RNA contexts. In addition, the effects of inserting additional full or partial consensus elements upstream or downstream of a canonical hexamer in target RNAs were also measured to better define the sequence elements and RNA architecture recognized by different STAR proteins. Conclusions The results presented here indicate that a single hexameric consensus is sufficient for high-affinity RNA binding by STAR proteins, and that upstream or downstream partial consensus elements may alter binding affinities depending on the sequence and spacing. The general requirements determined for high-affinity RNA

  18. Asian Consensus Report on Functional Dyspepsia

    PubMed Central

    Miwa, Hiroto; Ghoshal, Uday C; Gonlachanvit, Sutep; Gwee, Kok-Ann; Ang, Tiing-Leong; Chang, Full-Young; Fock, Kwong Ming; Hongo, Michio; Hou, Xiaohua; Kachintorn, Udom; Ke, Meiyun; Lai, Kwok-Hung; Lee, Kwang Jae; Lu, Ching-Liang; Mahadeva, Sanjiv; Miura, Soichiro; Park, Hyojin; Rhee, Poong-Lyul; Sugano, Kentaro; Vilaichone, Ratha-korn; Wong, Benjamin CY

    2012-01-01

    Background/Aims Environmental factors such as food, lifestyle and prevalence of Helicobacter pylori infection are widely different in Asian countries compared to the West, and physiological functions and genetic factors of Asians may also be different from those of Westerners. Establishing an Asian consensus for functional dyspepsia is crucial in order to attract attention to such data from Asian countries, to articulate the experience and views of Asian experts, and to provide a relevant guide on management of functional dyspepsia for primary care physicians working in Asia. Methods Consensus team members were selected from Asian experts and consensus development was carried out using a modified Delphi method. Consensus teams collected published papers on functional dyspepsia especially from Asia and developed candidate consensus statements based on the generated clinical questions. At the first face-to-face meeting, each statement was reviewed and e-mail voting was done twice. At the second face-to-face meeting, final voting on each statement was done using keypad voting system. A grade of evidence and a strength of recommendation were applied to each statement according to the method of the GRADE Working Group. Results Twenty-nine consensus statements were finalized, including 7 for definition and diagnosis, 5 for epidemiology, 9 for pathophysiology and 8 for management. Algorithms for diagnosis and management of functional dyspepsia were added. Conclusions This consensus developed by Asian experts shows distinctive features of functional dyspepsia in Asia and will provide a guide to the diagnosis and management of functional dyspepsia for Asian primary care physicians. PMID:22523724

  19. R2R - software to speed the depiction of aesthetic consensus RNA secondary structures

    PubMed Central

    2011-01-01

    Background With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. Results We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. Conclusions R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file. PMID:21205310

  20. Event-triggered consensus tracking of multi-agent systems with Lur'e nonlinear dynamics

    NASA Astrophysics Data System (ADS)

    Huang, Na; Duan, Zhisheng; Wen, Guanghui; Zhao, Yu

    2016-05-01

    In this paper, distributed consensus tracking problem for networked Lur'e systems is investigated based on event-triggered information interactions. An event-triggered control algorithm is designed with the advantages of reducing controller update frequency and sensor energy consumption. By using tools of ?-procedure and Lyapunov functional method, some sufficient conditions are derived to guarantee that consensus tracking is achieved under a directed communication topology. Meanwhile, it is shown that Zeno behaviour of triggering time sequences is excluded for the proposed event-triggered rule. Finally, some numerical simulations on coupled Chua's circuits are performed to illustrate the effectiveness of the theoretical algorithms.

  1. [SECOT consensus on medial femorotibial osteoarthritis].

    PubMed

    Moreno, A; Silvestre, A; Carpintero, P

    2013-01-01

    A consensus, prepared by SECOT, is presented on the management of medial knee compartment osteoarthritis, in order to establish clinical criteria and recommendations directed at unifying the criteria in its management, dealing with the factors involved in the pathogenesis of medial femorotibial knee osteoarthritis, the usefulness of diagnostic imaging techniques, and the usefulness of arthroscopy. Conservative and surgical treatments are also analysed. The experts consulted showed a consensus (agreed or disagreed) in 65.8% of the items considered, leaving 14items where no consensus was found, which included the aetiopathogenesis of the osteoarthritis, the value of NMR in degenerative disease, the usefulness of COX-2 and the chondroprotective drugs, as well as on the ideal valgus tibial osteotomy technique.

  2. [SECOT consensus on medial femorotibial osteoarthritis].

    PubMed

    Moreno, A; Silvestre, A; Carpintero, P

    2013-01-01

    A consensus, prepared by SECOT, is presented on the management of medial knee compartment osteoarthritis, in order to establish clinical criteria and recommendations directed at unifying the criteria in its management, dealing with the factors involved in the pathogenesis of medial femorotibial knee osteoarthritis, the usefulness of diagnostic imaging techniques, and the usefulness of arthroscopy. Conservative and surgical treatments are also analysed. The experts consulted showed a consensus (agreed or disagreed) in 65.8% of the items considered, leaving 14items where no consensus was found, which included the aetiopathogenesis of the osteoarthritis, the value of NMR in degenerative disease, the usefulness of COX-2 and the chondroprotective drugs, as well as on the ideal valgus tibial osteotomy technique. PMID:24169227

  3. Reaching Consensus by Allowing Moments of Indecision

    NASA Astrophysics Data System (ADS)

    Svenkeson, A.; Swami, A.

    2015-10-01

    Group decision-making processes often turn into a drawn out and costly battle between two opposing subgroups. Using analytical arguments based on a master equation description of the opinion dynamics occurring in a three-state model of cooperatively interacting units, we show how the capability of a social group to reach consensus can be enhanced when there is an intermediate state for indecisive individuals to pass through. The time spent in the intermediate state must be relatively short compared to that of the two polar states in order to create the beneficial effect. Furthermore, the cooperation between individuals must not be too low, as the benefit to consensus is possible only when the cooperation level exceeds a specific threshold. We also discuss how zealots, agents that remain in one state forever, can affect the consensus among the rest of the population by counteracting the benefit of the intermediate state or making it virtually impossible for an opposition to form.

  4. Consensus in personality judgments at zero acquaintance.

    PubMed

    Albright, L; Kenny, D A; Malloy, T E

    1988-09-01

    This research focused on the target effect on a perceiver's judgments of personality when the perceiver and the target are unacquainted. The perceiver was given no opportunity to interact with the target, a condition we refer to as zero acquaintance. We reasoned that in order to make personality judgments, perceivers would use the information available to them (physical appearance). Consensus in personality judgments would result, then, from shared stereotypes about particular physical appearance characteristics. Results from three separate studies with 259 subjects supported this hypothesis. On two of the five dimensions (extraversion and conscientiousness) on which subjects rated each other, a significant proportion of variance was due to the stimulus target. Consensus on judgments of extraversion appears to have been largely mediated by judgments of physical attractiveness. Across the three studies there was also evidence that the consensus in judgments on these two dimensions had some validity, in that they correlated with self-judgments on those two dimensions. PMID:3171912

  5. Consensus dynamics on random rectangular graphs

    NASA Astrophysics Data System (ADS)

    Estrada, Ernesto; Sheerin, Matthew

    2016-06-01

    A random rectangular graph (RRG) is a generalization of the random geometric graph (RGG) in which the nodes are embedded into a rectangle with side lengths a and b = 1 / a, instead of on a unit square [ 0 , 1 ] 2. Two nodes are then connected if and only if they are separated at a Euclidean distance smaller than or equal to a certain threshold radius r. When a = 1 the RRG is identical to the RGG. Here we apply the consensus dynamics model to the RRG. Our main result is a lower bound for the time of consensus, i.e., the time at which the network reaches a global consensus state. To prove this result we need first to find an upper bound for the algebraic connectivity of the RRG, i.e., the second smallest eigenvalue of the combinatorial Laplacian of the graph. This bound is based on a tight lower bound found for the graph diameter. Our results prove that as the rectangle in which the nodes are embedded becomes more elongated, the RRG becomes a 'large-world', i.e., the diameter grows to infinity, and a poorly-connected graph, i.e., the algebraic connectivity decays to zero. The main consequence of these findings is the proof that the time of consensus in RRGs grows to infinity as the rectangle becomes more elongated. In closing, consensus dynamics in RRGs strongly depend on the geometric characteristics of the embedding space, and reaching the consensus state becomes more difficult as the rectangle is more elongated.

  6. Consensus statement: medical management of acromegaly.

    PubMed

    Melmed, S; Casanueva, F; Cavagnini, F; Chanson, P; Frohman, L A; Gaillard, R; Ghigo, E; Ho, K; Jaquet, P; Kleinberg, D; Lamberts, S; Laws, E; Lombardi, G; Sheppard, M C; Thorner, M; Vance, M L; Wass, J A H; Giustina, A

    2005-12-01

    In November 2003, the Pituitary Society and the European Neuroendocrine Association sponsored a consensus workshop in Seville to address challenging issues in the medical management of acromegaly. Participants comprised 70 endocrinologists and neurosurgeons with international expertise in managing patients with acromegaly. All participants participated in the workshop proceedings, and the final document written by the scientific committee reflects the consensus opinion of the interactive deliberations. The meeting was supported by an unrestricted educational grant from Ipsen. No pharmaceutical representatives participated in the program planning or in the scientific deliberations.

  7. European expert consensus on rotational atherectomy.

    PubMed

    Barbato, Emanuele; Carrié, Didier; Dardas, Petros; Fajadet, Jean; Gaul, Georg; Haude, Michael; Khashaba, Ahmed; Koch, Karel; Meyer-Gessner, Markus; Palazuelos, Jorge; Reczuch, Krzysztof; Ribichini, Flavio L; Sharma, Samin; Sipötz, Johann; Sjögren, Iwar; Suetsch, Gabor; Szabó, György; Valdés-Chávarri, Mariano; Vaquerizo, Beatriz; Wijns, William; Windecker, Stephan; de Belder, Adam; Valgimigli, Marco; Byrne, Robert A; Colombo, Antonio; Di Mario, Carlo; Latib, Azeem; Hamm, Christian

    2015-05-01

    The interest in rotational atherectomy (RA) has increased over the past decade as a consequence of more complex and calcified coronary stenoses being attempted with percutaneous coronary interventions. Yet adoption of RA is hampered by several factors: amongst others, by the lack of a standardised protocol. This European expert consensus document stems from the awareness of the large heterogeneity in the protocols adopted to perform rotational atherectomy. The objective of the present document is to provide some points of consensus among highly experienced operators on the most controversial steps of RA in an attempt to build the basis of a standardised and universally accepted protocol.

  8. Report on the Consensus Workshop on Formaldehyde.

    PubMed Central

    1984-01-01

    The Consensus Workshop on Formaldehyde consisted of bringing together scientists from academia, government, industry and public interest groups to address some important toxicological questions concerning the health effects of formaldehyde. The participants in the workshop, the Executive Panel which coordinated the meeting, and the questions posed, all were chosen through a broadly based nomination process in order to achieve as comprehensive a consensus as possible. The subcommittees considered the toxicological problems associated with formaldehyde in the areas of exposure, epidemiology, carcinogenicity/histology/genotoxicity, immunology/sensitization/irritation, structure activity/biochemistry/metabolism, reproduction/teratology, behavior/neurotoxicity/psychology and risk estimation. Some questions considered included the possible human carcinogenicity of formaldehyde, as well as other human health effects, and the interpretation of pathology induced by formaldehyde. These reports, plus introductory material on the procedures used in setting up the Consensus Workshop are presented here. Additionally, there is included a listing of the data base that was made available to the panel chairmen prior to the meeting and was readily accessible to the participants during their deliberations in the meeting. This data base, since it was computerized, was also capable of being searched for important terms. These materials were supplemented by information brought by the panelists. The workshop has defined the consensus concerning a number of major points in formaldehyde toxicology and has identified a number of major deficits in understanding which are important guides to future research. PMID:6525992

  9. Teaching Persuasion as Consensus in Business Communication.

    ERIC Educational Resources Information Center

    Blyler, Nancy Roundy

    1993-01-01

    Suggests that understanding the "tools of rhetorical analysis" in relation to persuasion can help business communication teachers better incorporate the concept of consensus building into their courses. Discusses incorporating rhetorical techniques (using metaphors, calling on readers' schemata, and using narratives) into a business communication…

  10. Consensus among Economists--An Update

    ERIC Educational Resources Information Center

    Fuller, Dan; Geide-Stevenson, Doris

    2014-01-01

    In this article, the authors explore consensus among economists on specific propositions based on a fall 2011 survey of American Economic Association members. Results are based on 568 responses and provide evidence of changes in opinion over time by including propositions from earlier studies in 2000 (Fuller and Geide-Stevenson 2003) and 1992…

  11. Consensus among Economics Teachers from Transition Economies

    ERIC Educational Resources Information Center

    Leet, Don R.; Lang, Nancy A.

    2010-01-01

    The authors analyze the economic opinions of teachers and economists from the former Soviet Union who participated in economic education programs sponsored by the U.S. Department of Education under the auspices of the National Council on Economic Education from 1995-2001. They sought to determine the level of consensus on economic topics among the…

  12. The Future of Education's Liberal Consensus.

    ERIC Educational Resources Information Center

    Finn, Chester E., Jr.

    1980-01-01

    The liberal consensus that has shaped national education policy is seen as succumbing to dubious ideas and undesirable practices. Issues discussed include: educational equity, equality and quality; measures of educational achievement; accountability; "need" and ability; statism and monoply, pluralism and diversity; federal role; and quota systems…

  13. Epistemic Iterations and Consensus Definitions of Validity

    ERIC Educational Resources Information Center

    Engelhard, George, Jr.; Behizadeh, Nadia

    2012-01-01

    In his article, Paul E. Newton has conducted a review of selected perspectives on validity theory with the goal of disambiguating the definition of validity and describing a consensus definition of validity. Newton provides a nuanced discussion of the evolution of the concept of validity over the years. His Focus article has two major goals: (1)…

  14. Multi-Attribute Consensus Building Tool

    ERIC Educational Resources Information Center

    Shyyan, Vitaliy; Christensen, Laurene; Thurlow, Martha; Lazarus, Sheryl

    2013-01-01

    The Multi-Attribute Consensus Building (MACB) method is a quantitative approach for determining a group's opinion about the importance of each item (strategy, decision, recommendation, policy, priority, etc.) on a list (Vanderwood, & Erickson, 1994). This process enables a small or large group of participants to generate and discuss a set…

  15. New Directions in Play: Consensus or Collision?

    ERIC Educational Resources Information Center

    Wood, Elizabeth

    2007-01-01

    The aims of this article are to explore contemporary challenges to developing play in early childhood settings, and to identify areas of consensus and collision in policy and practice. Contemporary research highlights the effectiveness of mixed pedagogical approaches, including child- and adult-initiated play. Whilst early childhood specialists…

  16. Health Promoting Schools: Consensus, Strategies, and Potential

    ERIC Educational Resources Information Center

    Macnab, Andrew J.; Gagnon, Faith A.; Stewart, Donald

    2014-01-01

    Purpose: The purpose of this paper is to summarize a consensus statement generated on the current challenges, strategies, and potential of health promoting schools (HPS) at a 2011 colloquium at the Stellenbosch Institute for Advanced Study where 40 people from five continents came together to share their global and regional experience surrounding…

  17. Teacher Effectiveness in Physical Education--Consensus?

    ERIC Educational Resources Information Center

    Rink, Judith

    2014-01-01

    This article synthesizes the series of manuscripts on teacher effectiveness in physical education recently published by the "Research Quarterly for Exercise and Sport" and highlights both the consensus and points of disagreement. Although there is much agreement as to the mission to develop a physically active lifestyle, there is a great…

  18. Adaptive bipartite consensus on coopetition networks

    NASA Astrophysics Data System (ADS)

    Hu, Jiangping; Zhu, Hong

    2015-07-01

    In this paper, a bipartite consensus tracking problem is considered for a group of autonomous agents on a coopetition network, on which the agents interact cooperatively and competitively simultaneously. The coopetition network involves positive and negative edges and is conveniently modeled by a signed graph. Additionally, the dynamics of all the agents are subjected to unknown disturbances, which are represented by linearly parameterized models. An adaptive estimation scheme is designed for each agent by virtue of the relative position measurements and the relative velocity measurements from its neighbors. Then a consensus tracking law is proposed for a new distributed system, which uses the relative measurements as the new state variables. The convergence of the consensus tracking error and the parameter estimation are analyzed even when the coopetition network is time-varying and no more global information about the bounds of the unknown disturbances is available to all the agents. Finally, some simulation results are provided to demonstrate the formation of the bipartite consensus on the coopetition network.

  19. 3rd Brazilian Consensus on Helicobacter pylori.

    PubMed

    Coelho, Luiz Gonzaga; Maguinilk, Ismael; Zaterka, Schlioma; Parente, José Miguel; do Carmo Friche Passos, Maria; Moraes-Filho, Joaquim Prado P

    2013-04-01

    Signicant progress has been obtained since the Second Brazilian Consensus Conference on Helicobacter pylori Infection held in 2004, in São Paulo, SP, Brazil, and justify a third meeting to establish updated guidelines on the current management of H. pylori infection. The Third Brazilian Consensus Conference on H pylori Infection was organized by the Brazilian Nucleus for the Study of Helicobacter, a Department of the Brazilian Federation of Gastroenterology and took place on April 12-15, 2011, in Bento Gonçalves, RS, Brazil. Thirty-one delegates coming from the five Brazilian regions and one international guest, including gastroenterologists, pathologists, epidemiologists, and pediatricians undertook the meeting. The participants were allocated in one of the five main topics of the meeting: H pylori, functional dyspepsia and diagnosis; H pylori and gastric cancer; H pylori and other associated disorders; H pylori treatment and retreatment; and, epidemiology of H pylori infection in Brazil. The results of each subgroup were submitted to a final consensus voting to all participants. Relevant data were presented, and the quality of evidence, strength of recommendation, and level of consensus were graded. Seventy per cent and more votes were considered as acceptance for the final statement. This article presents the main recommendations and conclusions to guide Brazilian doctors involved in the management of H pylori infection.

  20. Genome Sequence Databases (Overview): Sequencing and Assembly

    SciTech Connect

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  1. [Argentine consensus on the treatment of bipolar disorders].

    PubMed

    Vázquez, Gustavo Héctor; Strejilevich, Sergio; García Bonetto, Gerardo; Cetkovich-Bakmas, Marcelo; Zaratiegui, Rodolfo; Lagomarsino, Alejandro; Goldchluk, Aníbal; Kalina, Eduardo; Herbst, Luis; Gutiérrez, Benigno

    2005-01-01

    The consensus guidelines of argentine experts in the treatment of bipolar disorders are the result of three days of work of the 10 main local experts under the organization of the Argentine Association of Biological Psychiatry (AAPB). It was adopted a mixed criterion for its preparation: all the recent data of the evidence medicine based published until now were discussed and were balanced with the knowledge acquired from clinical experience of the local experts on the bipolar field. It presents general recommendations and suggested therapeutic sequences for the phase of maintenance, the manic/hypomanic or mixed episode and the depressive episode. These have been divided according to the classification in type I and II; with or without rapid cycling. Since the group of experts identified the delay and miss-diagnoses like the most important barrier for a suitable treatment enclosed a series of recommendations for differential diagnosis of bipolar disorders.

  2. Expert consensus document: A consensus on the medical treatment of acromegaly.

    PubMed

    Giustina, Andrea; Chanson, Philippe; Kleinberg, David; Bronstein, Marcello D; Clemmons, David R; Klibanski, Anne; van der Lely, Aart J; Strasburger, Christian J; Lamberts, Steven W; Ho, Ken K Y; Casanueva, Felipe F; Melmed, Shlomo

    2014-04-01

    In March 2013, the Acromegaly Consensus Group met to revise and update guidelines for the medical treatment of acromegaly. The meeting comprised experts skilled in the medical management of acromegaly. The group considered treatment goals covering biochemical, clinical and tumour volume outcomes, and the place in guidelines of somatostatin receptor ligands, growth hormone receptor antagonists and dopamine agonists, and alternative modalities for treatment including combination therapy and novel treatments. This document represents the conclusions of the workshop consensus.

  3. Multi-alphabet consensus algorithm for identification of low specificity protein-DNA interactions.

    PubMed Central

    Ulyanov, A V; Stormo, G D

    1995-01-01

    A method for the identification and characterization of protein-DNA interactions is presented. We have developed an approach for finding unknown multiple patterns that occur imperfectly in a set of several sequences. The pattern may contain letters from the nucleotide alphabet (A, C, G and T) including ambiguous characters (A/C, A/G, A/T; A/C/G, etc.). This method reveals weak DNA signals on an unaligned set of DNA fragments known to be functionally related and assumes no prior information on the sequences' alignment. It determines the locations of the signals from only the information intrinsic to the sequences themselves. We have applied this method to analyze the binding sites of cAMP receptor protein (CRP). The consensus based on these data are discussed and a comparison of the consensus with the crystal structure of CAP-DNA complex is presented. We further show that in a mixture of DNA sequences, containing binding sites for two different proteins, both classes of binding sites can be discovered simultaneously by this method. The DNA sequences of nucleosome cores from chicken erythrocyte and a set of the other known nucleosomal sequences show existence of symmetrical features in nucleosome-binding DNA sequences. We also show multi-alphabet patterns that can play a role in the phasing signal on the nucleosome DNA molecule and have compared the results with existing models of nucleosome positioning. PMID:7753637

  4. The Temporal Structure of Scientific Consensus Formation.

    PubMed

    Shwed, Uri; Bearman, Peter S

    2010-12-01

    This article engages with problems that are usually opaque: What trajectories do scientific debates assume, when does a scientific community consider a proposition to be a fact, and how can we know that? We develop a strategy for evaluating the state of scientific contestation on issues. The analysis builds from Latour's black box imagery, which we observe in scientific citation networks. We show that as consensus forms, the importance of internal divisions to the overall network structure declines. We consider substantive cases that are now considered facts, such as the carcinogenicity of smoking and the non-carcinogenicity of coffee. We then employ the same analysis to currently contested cases: the suspected carcinogenicity of cellular phones, and the relationship between vaccines and autism. Extracting meaning from the internal structure of scientific knowledge carves a niche for renewed sociological commentary on science, revealing a typology of trajectories that scientific propositions may experience en route to consensus. PMID:21886269

  5. [Consensus on safe infant's furniture: brief version].

    PubMed

    2016-04-01

    Several products that are used for support, transportation or recreation in infants and children can cause non intentional injuries. This consensus tries to provide pediatricians and families with the necessary elements to recognize and choose safe infant's furniture. A group of 24 experts developed a consensus according to Delphi's method, which consists in successiverounds of questions. Recommendations are supported with bibliography. Infant walkers are not recommended, as they are considered useless and dangerous. Guidelines are given to choose appropriate child restraint systems, when and how to use them, and how to install them in a safe way. Injuries and prevention measures related to strollers, high chairs, cribs and bunk beds are described. Risks and the way to avoid them are diagrammed in figures that can be used to transmit recommendations to families. PMID:27079398

  6. [Consensus on safe infant's furniture: brief version].

    PubMed

    2016-04-01

    Several products that are used for support, transportation or recreation in infants and children can cause non intentional injuries. This consensus tries to provide pediatricians and families with the necessary elements to recognize and choose safe infant's furniture. A group of 24 experts developed a consensus according to Delphi's method, which consists in successiverounds of questions. Recommendations are supported with bibliography. Infant walkers are not recommended, as they are considered useless and dangerous. Guidelines are given to choose appropriate child restraint systems, when and how to use them, and how to install them in a safe way. Injuries and prevention measures related to strollers, high chairs, cribs and bunk beds are described. Risks and the way to avoid them are diagrammed in figures that can be used to transmit recommendations to families.

  7. The Temporal Structure of Scientific Consensus Formation

    PubMed Central

    Shwed, Uri; Bearman, Peter S.

    2011-01-01

    This article engages with problems that are usually opaque: What trajectories do scientific debates assume, when does a scientific community consider a proposition to be a fact, and how can we know that? We develop a strategy for evaluating the state of scientific contestation on issues. The analysis builds from Latour’s black box imagery, which we observe in scientific citation networks. We show that as consensus forms, the importance of internal divisions to the overall network structure declines. We consider substantive cases that are now considered facts, such as the carcinogenicity of smoking and the non-carcinogenicity of coffee. We then employ the same analysis to currently contested cases: the suspected carcinogenicity of cellular phones, and the relationship between vaccines and autism. Extracting meaning from the internal structure of scientific knowledge carves a niche for renewed sociological commentary on science, revealing a typology of trajectories that scientific propositions may experience en route to consensus. PMID:21886269

  8. An optical consensus correlator for cluttered targets

    NASA Astrophysics Data System (ADS)

    Putnam, Roger S.

    1992-08-01

    The phase-only Consensus Correlator improves the probability of detection of targets obscured by other objects such as a stand of trees. The technique involves masking out most of the input scene and using a standard correlator to search for small pieces of the expected target shape. The areas of the input scene that are found to contain pieces of the target are combined in a final correlation. The Consensus Correlator reduces the transfer of noise that is interspersed with pieces of the target in the input scene to the vicinity of the correlation spike in the correlation plane. A preliminary investigation of an appropriate figure of merit for comparing correlation spikes produced by different inputs and phase-only filters is also presented.

  9. After seven years, where's the consensus

    SciTech Connect

    Norman, M.R.

    1993-04-01

    It has been 7 years since the discovery of copper oxide superconductors, yet there is no consensus on the correct theory for this phenomenon. The theory can be divided into 3 groups: ordinary (phonons), exotic (AF spin fluctuations, nested Fermi liquid, excitons, spin bags, odd frequency pairing), and revolutionary (Luttinger liquid, spin-charge separation, gauge theories, anyons, marginal Fermi liquid). C-axis dispersion, dHvA, and magneto-oscillations are also discussed.

  10. A Self-Categorization Explanation for Opinion Consensus Perceptions

    ERIC Educational Resources Information Center

    Zhang, Jinguang; Reid, Scott A.

    2013-01-01

    The public expression of opinions (and related communicative activities) hinges upon the perception of opinion consensus. Current explanations for opinion consensus perceptions typically focus on egocentric and other biases, rather than functional cognitions. Using self-categorization theory we showed that opinion consensus perceptions flow from…

  11. International consensus on ANA patterns (ICAP): the bumpy road towards a consensus on reporting ANA results.

    PubMed

    Damoiseaux, Jan; von Mühlen, Carlos A; Garcia-De La Torre, Ignacio; Carballo, Orlando Gabriel; de Melo Cruvinel, Wilson; Francescantonio, Paulo Luiz Carvalho; Fritzler, Marvin J; Herold, Manfred; Mimori, Tsuneyo; Satoh, Minoru; Andrade, Luis E C; Chan, Edward K L; Conrad, Karsten

    2016-12-01

    The International Consensus on ANA Patterns (ICAP) was initiated as a workshop aiming to thoroughly discuss and achieve consensus regarding the morphological patterns observed in the indirect immunofluorescence assay on HEp-2 cells. One of the topics discussed at the second ICAP workshop, and addressed in this paper, was the harmonization of reporting ANA test results. This discussion centered on the issue if cytoplasmic and mitotic patterns should be reported as positive or negative. This report outlines the issues that impact on two major different reporting methods. Although it was appreciated by all participants that cytoplasmic and mitotic patterns are clinically relevant, implications for existing diagnostic/classification criteria for ANA-associated diseases in particular hampered a final consensus on this topic. Evidently, a more concerted action of all relevant stakeholders is required. Future ICAP workshops may help to facilitate this action.

  12. Developing consensus criteria for sarcopenia: an update.

    PubMed

    McLean, Robert R; Kiel, Douglas P

    2015-04-01

    Sarcopenia, the age-related loss of muscle mass and strength, is a major cause of impaired physical function, which contributes to mobility disability, falls and hospitalizations in older adults. Lower muscle mass and strength are also associated with lower bone mineral density and greater risk for osteoporotic fractures. Thus, identification of sarcopenia could be important for fracture prevention as it may help improve fracture risk assessment, and muscle mass and strength can be improved with exercise, even among the frailest older adults. Unfortunately, there are no consensus diagnostic criteria for sarcopenia. Consequently there is no guidance to help clinicians identify older adults with clinically meaningful low muscle mass or weakness. Further, development of novel sarcopenia therapies is hindered not only due to the difficulty in identifying participants for clinical trials, and but also because there are no validated, clinically appropriate endpoints for assessment of treatment efficacy. There is currently a major push to establish a consensus definition of sarcopenia, and recent work holds promise that this goal may be within reach. This article discusses the evolution of the definition of sarcopenia, and focuses on the latest recommended diagnostic criteria proposed by the Foundation for the National Institutes of Health (FNIH) Sarcopenia Project. While these empirically-based cut-points for clinically important low muscle mass and weakness are a significant step forward for the sarcopenia field, important questions remain to be answered before consensus diagnostic criteria can be definitively established. Ongoing work to refine sarcopenia criteria will further advance the field and bring this important contributor to falls, fractures and disability into the mainstream of clinical care and ultimately lead to better quality of life with aging.

  13. Consensus guidelines on severe acute pancreatitis.

    PubMed

    Pezzilli, Raffaele; Zerbi, Alessandro; Campra, Donata; Capurso, Gabriele; Golfieri, Rita; Arcidiacono, Paolo G; Billi, Paola; Butturini, Giovanni; Calculli, Lucia; Cannizzaro, Renato; Carrara, Silvia; Crippa, Stefano; De Gaudio, Raffaele; De Rai, Paolo; Frulloni, Luca; Mazza, Ernesto; Mutignani, Massimiliano; Pagano, Nico; Rabitti, Piergiorgio; Balzano, Gianpaolo

    2015-07-01

    This Position Paper contains clinically oriented guidelines by the Italian Association for the Study of the Pancreas (AISP) for the diagnosis and treatment of severe acute pancreatitis. The statements were formulated by three working groups of experts who searched and analysed the most recent literature; a consensus process was then performed using a modified Delphi procedure. The statements provide recommendations on the most appropriate definition of the complications of severe acute pancreatitis, the diagnostic approach and the timing of conservative as well as interventional endoscopic, radiological and surgical treatments.

  14. Multiple chemical sensitivity: a 1999 consensus.

    PubMed

    1999-01-01

    Consensus criteria for the definition of multiple chemical sensitivity (MCS) were first identified in a 1989 multidisciplinary survey of 89 clinicians and researchers with extensive experience in, but widely differing views of, MCS. A decade later, their top 5 consensus criteria (i.e., defining MCS as [1] a chronic condition [2] with symptoms that recur reproducibly [3] in response to low levels of exposure [4] to multiple unrelated chemicals and [5] improve or resolve when incitants are removed) are still unrefuted in published literature. Along with a 6th criterion that we now propose adding (i.e., requiring that symptoms occur in multiple organ systems), these criteria are all commonly encompassed by research definitions of MCS. Nonetheless, their standardized use in clinical settings is still lacking, long overdue, and greatly needed--especially in light of government studies in the United States, United Kingdom, and Canada that revealed 2-4 times as many cases of chemical sensitivity among Gulf War veterans than undeployed controls. In addition, state health department surveys of civilians in New Mexico and California showed that 2-6%, respectively, already had been diagnosed with MCS and that 16% of the civilians reported an "unusual sensitivity" to common everyday chemicals. Given this high prevalence, as well as the 1994 consensus of the American Lung Association, American Medical Association, U.S. Environmental Protection Agency, and the U.S. Consumer Product Safety Commission that "complaints [of MCS] should not be dismissed as psychogenic, and a thorough workup is essential," we recommend that MCS be formally diagnosed--in addition to any other disorders that may be present--in all cases in which the 6 aforementioned consensus criteria are met and no single other organic disorder (e.g., mastocytosis) can account for all the signs and symptoms associated with chemical exposure. The millions of civilians and tens of thousands of Gulf War veterans who

  15. PERMANENT GENETIC RESOURCES: Consensus primers of cyp73 genes discriminate willow species and hybrids (Salix, Salicaceae).

    PubMed

    Trung, Le Quang; VAN Puyvelde, Karolien; Triest, Ludwig

    2008-03-01

    Consensus primers, based on exon sequences of the cyp73 gene family coding for cinnamate 4-hydroxylase (C4H) of the lignin biosynthesis pathway, were designed for the tetraploid willow species Salix alba and Salix fragilis. Diagnostic alleles at species level were observed among introns of three cyp73 genes and allowed unambiguous detection of the first generation and introgressed hybrids in populations. Progeny analysis of a female S. alba with a male introgressed hybrid confirmed the codominant inheritance of each intron. Sequences of the diagnostic alleles of both species were similar to those found in the hybrids.

  16. Beyond consensus: statistical free energies reveal hidden interactions in the design of a TPR motif.

    PubMed

    Magliery, Thomas J; Regan, Lynne

    2004-10-22

    Consensus design methods have been used successfully to engineer proteins with a particular fold, and moreover to engineer thermostable exemplars of particular folds. Here, we consider how a statistical free energy approach can expand upon current methods of phylogenetic design. As an example, we have analyzed the tetratricopeptide repeat (TPR) motif, using multiple sequence alignment to identify the significance of each position in the TPR. The results provide information above and beyond that revealed by consensus design alone, especially at poorly conserved positions. A particularly striking finding is that certain residues, which TPR-peptide co-crystal structures show are in direct contact with the ligand, display a marked hypervariability. This suggests a novel means of identifying ligand-binding sites, and also implies that TPRs generally function as ligand-binding domains. Using perturbation analysis (or statistical coupling analysis), we examined site-site interactions within the TPR motif. Correlated occurrences of amino acid residues at poorly conserved positions explain how TPRs achieve their near-neutral surface charge distributions, and why a TPR designed from straight consensus has an unusually high net charge. Networks of interacting sites revealed that TPRs fall into two unrecognized families with distinct sets of interactions related to the identity of position 7 (Leu or Lys/Arg). Statistical free energy analysis provides a more complete description of "What makes a TPR a TPR?" than consensus alone, and it suggests general approaches to extend and improve the phylogenetic design of proteins.

  17. Consensus physical activity guidelines for Asian Indians.

    PubMed

    Misra, Anoop; Nigam, Priyanka; Hills, Andrew P; Chadha, Davinder S; Sharma, Vineeta; Deepak, K K; Vikram, Naval K; Joshi, Shashank; Chauhan, Ashish; Khanna, Kumud; Sharma, Rekha; Mittal, Kanchan; Passi, Santosh Jain; Seth, Veenu; Puri, Seema; Devi, Ratna; Dubey, A P; Gupta, Sunita

    2012-01-01

    India is currently undergoing rapid economic, demographic, and lifestyle transformations. A key feature of the latter transformation has been inappropriate and inadequate diets and decreases in physical activity. Data from various parts of India have shown a steady increase in the prevalence of lifestyle-related diseases such as type 2 diabetes mellitus (T2DM), the metabolic syndrome, hypertension, coronary heart disease (CHD), etc., frequently in association with overweight or obesity. Comparative data show that Asian Indians are more sedentary than white Caucasians. In this review, the Consensus Group considered the available physical activity guidelines from international and Indian studies and formulated India-specific guidelines. A total of 60 min of physical activity is recommended every day for healthy Asian Indians in view of the high predisposition to develop T2DM and CHD. This should include at least 30 min of moderate-intensity aerobic activity, 15 min of work-related activity, and 15 min of muscle-strengthening exercises. For children, moderate-intensity physical activity for 60 min daily should be in the form of sport and physical activity. This consensus statement also includes physical activity guidelines for pregnant women, the elderly, and those suffering from obesity, T2DM, CHD, etc. Proper application of guidelines is likely to have a significant impact on the prevalence and management of obesity, the metabolic syndrome, T2DM, and CHD in Asian Indians.

  18. Consensus on biomarkers for neuroendocrine tumour disease

    PubMed Central

    Oberg, Kjell; Modlin, Irvin M; De Herder, Wouter; Pavel, Marianne; Klimstra, David; Frilling, Andrea; Metz, David C; Heaney, Anthony; Kwekkeboom, Dik; Strosberg, Jonathan; Meyer, Timothy; Moss, Steven F; Washington, Kay; Wolin, Edward; Liu, Eric; Goldenring, James

    2016-01-01

    Management of neuroendocrine neoplasia represents a clinical challenge because of its late presentation, lack of treatment options, and limitations in present imaging modalities and biomarkers to guide management. Monoanalyte biomarkers have poor sensitivity, specificity, and predictive ability. A National Cancer Institute summit, held in 2007, on neuroendocrine tumours noted biomarker limitations to be a crucial unmet need in the management of neuroendocrine tumours. A multinational consensus meeting of multidisciplinary experts in neuroendocrine tumours assessed the use of current biomarkers and defined the perquisites for novel biomarkers via the Delphi method. Consensus (at >75%) was achieved for 88 (82%) of 107 assessment questions. The panel concluded that circulating multianalyte biomarkers provide the highest sensitivity and specificity necessary for minimum disease detection and that this type of biomarker had sufficient information to predict treatment effectiveness and prognosis. The panel also concluded that no monoanalyte biomarker of neuroendocrine tumours has yet fulfilled these criteria and there is insufficient information to support the clinical use of miRNA or circulating tumour cells as useful prognostic markers for this disease. The panel considered that trials measuring multianalytes (eg, neuroendocrine gene transcripts) should also identify how such information can optimise the management of patients with neuroendocrine tumours. PMID:26370353

  19. International Consensus On (ICON) Pediatric Asthma

    PubMed Central

    Papadopoulos, N. G.; Arakawa, H.; Carlsen, K.-H.; Custovic, A.; Gern, J.; Lemanske, R.; Le Souef, P.; Makela, M.; Roberts, G.; Wong, G.; Zar, H.; Akdis, C. A.; Bacharier, L. B.; Baraldi, E.; van Bever, H. P.; de Blic, J.; Boner, A.; Burks, W.; Casale, T. B.; Castro-Rodriguez, J. A.; Chen, Y. Z.; El-Gamal, Y. M.; Everard, M. L.; Frischer, T.; Geller, M.; Gereda, J.; Goh, D. Y.; Guilbert, T. W.; Hedlin, G.; Heymann, P. W.; Hong, S. J.; Hossny, E. M.; Huang, J. L.; Jackson, D. J.; de Jongste, J. C.; Kalayci, O.; Khaled, N.; Kling, S.; Kuna, P.; Lau, S.; Ledford, D. K.; Lee, S. I.; Liu, A. H.; Lockey, R. F.; Lodrup-Carlsen, K.; Lotvall, J.; Morikawa, A.; Nieto, A.; Paramesh, H.; Pawankar, R.; Pohunek, P.; Pongracic, J.; Price, D.; Robertson, C.; Rosario, N.; Rossenwasser, L. J.; Sly, P. D.; Stein, R.; Stick, S.; Szefler, S.; Taussig, L. M.; Valovirta, E.; Vichyanond, P.; Wallace, D.; Weinberg, E.; Wennergren, G.; Wildhaber, J.; Zeiger, R. S.

    2015-01-01

    Asthma is the most common chronic lower respiratory disease in childhood throughout the world. Several guidelines and/or consensus documents are available to support medical decisions on pediatric asthma. Although there is no doubt that the use of common systematic approaches for management can considerably improve outcomes, dissemination and implementation of these are still major challenges. Consequently, the International Collaboration in Asthma, Allergy and Immunology (iCAALL), recently formed by the EAACI, AAAAI, ACAAI and WAO, has decided to propose an International Consensus on (ICON) Pediatric Asthma. The purpose of this document is to highlight the key messages that are common to many of the existing guidelines, while critically reviewing and commenting on any differences, thus providing a concise reference. The principles of pediatric asthma management are generally accepted. Overall, the treatment goal is disease control. In order to achieve this, patients and their parents should be educated to optimally manage the disease, in collaboration with health care professionals. Identification and avoidance of triggers is also of significant importance. Assessment and monitoring should be performed regularly to re-evaluate and fine-tune treatment. Pharmacotherapy is the cornerstone of treatment. The optimal use of medication can, in most cases, help patients control symptoms and reduce the risk for future morbidity. The management of exacerbations is a major consideration, independent from chronic treatment. There is a trend towards considering phenotype specific treatment choices; however this goal has not yet been achieved. PMID:22702533

  20. Military consensus behind Soviet arms control proposals

    SciTech Connect

    Weickhardt, G.C.

    1987-09-01

    For nearly two years General Secretary Mikhail Gorbachev has tried to entice the West with a spectacular array of arms control proposals and initiatives. On issues such as on-site inspections and European missile reductions, he has made such significant concessions over previous Soviet positions that questions have been raised, and not satisfactorily answered, about how much support Gorbachev's diplomacy enjoys among the Soviet military. For example, have Gorbachev's proposals been a bold personal gamble to achieve agreement without the prior approval of the Soviet military bureaucracy. Or does his arms control diplomacy represent a broad consensus among the military leadership and a realignment of Soviet military doctrine and grand strategy. A careful examination of recent Soviet military thought shows that such a consensus exists. A broad and stable coalition of key military leaders supports the General Secretary's policies. Moreover, recent Soviet concessions are not, as commonly argued, a stopgap ploy to halt the US Strategic Defense Initiative or Star Wars. Rather, the military's support for Gorbachev's arms-control diplomacy is based on some serious strategic analysis and stems from broad, fundamental, and enduring changes in Soviet national security policy.

  1. Consensus Paper: Management of Degenerative Cerebellar Disorders

    PubMed Central

    Ilg, W.; Bastian, A. J.; Boesch, S.; Burciu, R. G.; Celnik, P.; Claaßen, J.; Feil, K.; Kalla, R.; Miyai, I.; Nachbauer, W.; Schöls, L.; Strupp, M.; Synofzik, M.; Teufel, J.

    2015-01-01

    Treatment of motor symptoms of degenerative cerebellar ataxia remains difficult. Yet there are recent developments that are likely to lead to significant improvements in the future. Most desirable would be a causative treatment of the underlying cerebellar disease. This is currently available only for a very small subset of cerebellar ataxias with known metabolic dysfunction. However, increasing knowledge of the pathophysiology of hereditary ataxia should lead to an increasing number of medically sensible drug trials. In this paper, data from recent drug trials in patients with recessive and dominant cerebellar ataxias will be summarized. There is consensus that up to date, no medication has been proven effective. Aminopyridines and acetazolamide are the only exception, which are beneficial in patients with episodic ataxia type 2. Aminopyridines are also effective in a subset of patients presenting with downbeat nystagmus. As such, all authors agreed that the mainstays of treatment of degenerative cerebellar ataxia are currently physiotherapy, occupational therapy, and speech therapy. For many years, well-controlled rehabilitation studies in patients with cerebellar ataxia were lacking. Data of recently published studies show that coordinative training improves motor function in both adult and juvenile patients with cerebellar degeneration. Given the well-known contribution of the cerebellum to motor learning, possible mechanisms underlying improvement will be outlined. There is consensus that evidence-based guidelines for the physiotherapy of degenerative cerebellar ataxia need to be developed. Future developments in physiotherapeutical interventions will be discussed including application of non-invasive brain stimulation. PMID:24222635

  2. Consensus document on allergic conjunctivitis (DECA).

    PubMed

    Sánchez-Hernández, M C; Montero, J; Rondon, C; Benitez del Castillo, J M; Velázquez, E; Herreras, J M; Fernández-Parra, B; Merayo-Lloves, J; Del Cuvillo, A; Vega, F; Valero, A; Panizo, C; Montoro, J; Matheu, V; Lluch-Bernal, M; González, M L; González, R; Dordal, M T; Dávila, I; Colás, C; Campo, P; Antón, E; Navarro, A

    2015-01-01

    Allergic conjunctivitis (AC) is an inflammatory disease of the conjunctiva caused mainly by an IgE-mediated mechanism. It is the most common type of ocular allergy. Despite being the most benign form of conjunctivitis, AC has a considerable effect on patient quality of life, reduces work productivity, and increases health care costs. No consensus has been reached on its classification, diagnosis, or treatment. Consequently, the literature provides little information on its natural history, epidemiological data are scarce, and it is often difficult to ascertain its true morbidity. The main objective of the Consensus Document on Allergic Conjunctivitis (Documento dE Consenso sobre Conjuntivitis Alérgica [DECA]), which was drafted by an expert panel from the Spanish Society of Allergology and Spanish Society of Ophthalmology, was to reach agreement on basic criteria that could prove useful for both specialists and primary care physicians and facilitate the diagnosis, classification, and treatment of AC. This document is the first of its kind to describe and analyze aspects of AC that could make it possible to control symptoms.

  3. Global consensus on ADHD/HKD.

    PubMed

    Remschmidt, Helmut

    2005-05-01

    A Global ADHD Working Group of experienced clinicians and researchers was gathered to review the latest evidence, discuss current best practice in the treatment of attention-deficit/hyperactivity disorder (ADHD), and make a statement based on consensus. The statement aims to re-affirm ADHD as a valid disorder that exists across different cultures, has a significant global impact, and should be diagnosed and effectively treated wherever it occurs. ADHD is one of the most common neurobehavioural disorders of childhood and impacts on many aspects of development, including social, emotional and cognitive functioning, in the home and school environment. Although these findings are from developed countries, the impact in developing countries is likely to be similar. There is strong supportive evidence for the validity of ADHD as a syndrome with neurobiological aspects, and complex genetic factors are primarily implicated in the aetiology. Accurate diagnosis and measurement of impairment is important to enable appropriate and successful management of symptoms. ADHD is a persistent condition that needs to be treated and monitored over time. The evidence supporting medication-based interventions (such as methylphenidate) is strong and consensus treatment algorithms to guide the multimodal treatment of ADHD, alone and in combination with common comorbidities, are suggested. PMID:15959658

  4. Consensus and ordering in language dynamics

    NASA Astrophysics Data System (ADS)

    Castelló, X.; Baronchelli, A.; Loreto, V.

    2009-10-01

    We consider two social consensus models, the AB-model and the Naming Game restricted to two conventions, which describe a population of interacting agents that can be in either of two equivalent states (A or B) or in a third mixed (AB) state. Proposed in the context of language competition and emergence, the AB state was associated with bilingualism and synonymy respectively. We show that the two models are equivalent in the mean field approximation, though the differences at the microscopic level have non-trivial consequences. To point them out, we investigate an extension of these dynamics in which confidence/trust is considered, focusing on the case of an underlying fully connected graph, and we show that the consensus-polarization phase transition taking place in the Naming Game is not observed in the AB model. We then consider the interface motion in regular lattices. Qualitatively, both models show the same behavior: a diffusive interface motion in a one-dimensional lattice, and a curvature driven dynamics with diffusing stripe-like metastable states in a two-dimensional one. However, in comparison to the Naming Game, the AB-model dynamics is shown to slow down the diffusion of such configurations.

  5. Comparing whole-genome sequencing with Sanger sequencing for spa typing of methicillin-resistant Staphylococcus aureus.

    PubMed

    Bartels, Mette Damkjær; Petersen, Andreas; Worning, Peder; Nielsen, Jesper Boye; Larner-Svensson, Hanna; Johansen, Helle Krogh; Andersen, Leif Percival; Jarløv, Jens Otto; Boye, Kit; Larsen, Anders Rhod; Westh, Henrik

    2014-12-01

    spa typing of methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been done by PCR amplification and Sanger sequencing of the spa repeat region. At Hvidovre Hospital, Denmark, whole-genome sequencing (WGS) of all MRSA isolates has been performed routinely since January 2013, and an in-house analysis pipeline determines the spa types. Due to national surveillance, all MRSA isolates are sent to Statens Serum Institut, where the spa type is determined by PCR and Sanger sequencing. The purpose of this study was to evaluate the reliability of the spa types obtained by 150-bp paired-end Illumina WGS. MRSA isolates from new MRSA patients in 2013 (n = 699) in the capital region of Denmark were included. We found a 97% agreement between spa types obtained by the two methods. All isolates achieved a spa type by both methods. Nineteen isolates differed in spa types by the two methods, in most cases due to the lack of 24-bp repeats in the whole-genome-sequenced isolates. These related but incorrect spa types should have no consequence in outbreak investigations, since all epidemiologically linked isolates, regardless of spa type, will be included in the single nucleotide polymorphism (SNP) analysis. This will reveal the close relatedness of the spa types. In conclusion, our data show that WGS is a reliable method to determine the spa type of MRSA.

  6. Comparing whole-genome sequencing with Sanger sequencing for spa typing of methicillin-resistant Staphylococcus aureus.

    PubMed

    Bartels, Mette Damkjær; Petersen, Andreas; Worning, Peder; Nielsen, Jesper Boye; Larner-Svensson, Hanna; Johansen, Helle Krogh; Andersen, Leif Percival; Jarløv, Jens Otto; Boye, Kit; Larsen, Anders Rhod; Westh, Henrik

    2014-12-01

    spa typing of methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been done by PCR amplification and Sanger sequencing of the spa repeat region. At Hvidovre Hospital, Denmark, whole-genome sequencing (WGS) of all MRSA isolates has been performed routinely since January 2013, and an in-house analysis pipeline determines the spa types. Due to national surveillance, all MRSA isolates are sent to Statens Serum Institut, where the spa type is determined by PCR and Sanger sequencing. The purpose of this study was to evaluate the reliability of the spa types obtained by 150-bp paired-end Illumina WGS. MRSA isolates from new MRSA patients in 2013 (n = 699) in the capital region of Denmark were included. We found a 97% agreement between spa types obtained by the two methods. All isolates achieved a spa type by both methods. Nineteen isolates differed in spa types by the two methods, in most cases due to the lack of 24-bp repeats in the whole-genome-sequenced isolates. These related but incorrect spa types should have no consequence in outbreak investigations, since all epidemiologically linked isolates, regardless of spa type, will be included in the single nucleotide polymorphism (SNP) analysis. This will reveal the close relatedness of the spa types. In conclusion, our data show that WGS is a reliable method to determine the spa type of MRSA. PMID:25297335

  7. Networks maximizing the consensus time of voter models

    NASA Astrophysics Data System (ADS)

    Iwamasa, Yuni; Masuda, Naoki

    2014-07-01

    We explore the networks that yield the largest mean consensus time of voter models under different update rules. By analytical and numerical means, we show that the so-called lollipop graph, barbell graph, and double-star graph maximize the mean consensus time under the update rules called the link dynamics, voter model, and invasion process, respectively. For each update rule, the largest mean consensus time scales as O (N3), where N is the number of nodes in the network.

  8. Human consensus interferons: Bridging the natural and artificial cytokines with intrinsic disorder.

    PubMed

    El-Baky, Nawal Abd; Uversky, Vladimir N; Redwan, Elrashdy M

    2015-12-01

    The consensus interferons are artificially engineered proteins that combine most of the therapeutic features of natural human α-interferons and show high anti-cancer and anti-viral activities. Egyptian patients infected with hepatitis C virus (HCV) genotype 4 show lower responses to interferon (IFN) therapy than the distributed worldwide patients infected with the other HCV genotypes. Numerous studies have reported that patients with hepatitis C who have not responded to a previous standard IFN-alpha therapy or those who relapsed following treatment cessation may benefit from retreatment with consensus IFN-α (cIFN-α). IFNs-α are shown here to have functionally important disordered regions. Furthermore, a strong correlation is established between the peculiarities of disorder profiles of these proteins and their known structural features. Intrinsic disorder profiles of existing cIFNs-α possess remarkable similarity to the consensus disorder profile calculated as averaged disorder predispositions of all human IFNs-α. If the peculiarities of disorder distribution within the protein sequence are related to protein functionality, then comparison of the disorder profiles of artificial cIFNs (query profiles) with the averaged disorder predisposition profile of human IFNs-α (target profile) can be used in the design of novel cIFNs. The goal here would be to achieve a close similarity between the query and target profiles by manipulating the cIFN sequence.

  9. Universal full-length nucleosome mapping sequence probe.

    PubMed

    Tripathi, Vijay; Salih, Bilal; Trifonov, Edward N

    2015-01-01

    For the computational sequence-directed mapping of the nucleosomes, the knowledge of the nucleosome positioning motifs - 10-11 base long sequences - and respective matrices of bendability, is not sufficient, since there is no justified way to fuse these motifs in one continuous nucleosome DNA sequence. Discovery of the strong nucleosome (SN) DNA sequences, with visible sequence periodicity allows derivation of the full-length nucleosome DNA bendability pattern as matrix or consensus sequence. The SN sequences of three species (A. thaliana, C. elegans, and H. sapiens) are aligned (512 sequences for each species), and long (115 dinucleotides) matrices of bendability derived for the species. The matrices have strong common property - alternation of runs of purine-purine (RR) and pyrimidine-pyrimidine (YY) dinucleotides, with average period 10.4 bases. On this basis the universal [R,Y] consensus of the nucleosome DNA sequence is derived, with exactly defined positions of respective penta- and hexamers RRRRR, RRRRRR, YYYYY, and YYYYYY.

  10. Using Network Dynamical Influence to Drive Consensus

    PubMed Central

    Punzo, Giuliano; Young, George F.; Macdonald, Malcolm; Leonard, Naomi E.

    2016-01-01

    Consensus and decision-making are often analysed in the context of networks, with many studies focusing attention on ranking the nodes of a network depending on their relative importance to information routing. Dynamical influence ranks the nodes with respect to their ability to influence the evolution of the associated network dynamical system. In this study it is shown that dynamical influence not only ranks the nodes, but also provides a naturally optimised distribution of effort to steer a network from one state to another. An example is provided where the “steering” refers to the physical change in velocity of self-propelled agents interacting through a network. Distinct from other works on this subject, this study looks at directed and hence more general graphs. The findings are presented with a theoretical angle, without targeting particular applications or networked systems; however, the framework and results offer parallels with biological flocks and swarms and opportunities for design of technological networks. PMID:27210291

  11. Using Network Dynamical Influence to Drive Consensus

    NASA Astrophysics Data System (ADS)

    Punzo, Giuliano; Young, George F.; MacDonald, Malcolm; Leonard, Naomi E.

    2016-05-01

    Consensus and decision-making are often analysed in the context of networks, with many studies focusing attention on ranking the nodes of a network depending on their relative importance to information routing. Dynamical influence ranks the nodes with respect to their ability to influence the evolution of the associated network dynamical system. In this study it is shown that dynamical influence not only ranks the nodes, but also provides a naturally optimised distribution of effort to steer a network from one state to another. An example is provided where the “steering” refers to the physical change in velocity of self-propelled agents interacting through a network. Distinct from other works on this subject, this study looks at directed and hence more general graphs. The findings are presented with a theoretical angle, without targeting particular applications or networked systems; however, the framework and results offer parallels with biological flocks and swarms and opportunities for design of technological networks.

  12. The consensus molecular subtypes of colorectal cancer.

    PubMed

    Guinney, Justin; Dienstmann, Rodrigo; Wang, Xin; de Reyniès, Aurélien; Schlicker, Andreas; Soneson, Charlotte; Marisa, Laetitia; Roepman, Paul; Nyamundanda, Gift; Angelino, Paolo; Bot, Brian M; Morris, Jeffrey S; Simon, Iris M; Gerster, Sarah; Fessler, Evelyn; De Sousa E Melo, Felipe; Missiaglia, Edoardo; Ramay, Hena; Barras, David; Homicsko, Krisztian; Maru, Dipen; Manyam, Ganiraju C; Broom, Bradley; Boige, Valerie; Perez-Villamil, Beatriz; Laderas, Ted; Salazar, Ramon; Gray, Joe W; Hanahan, Douglas; Tabernero, Josep; Bernards, Rene; Friend, Stephen H; Laurent-Puig, Pierre; Medema, Jan Paul; Sadanandam, Anguraj; Wessels, Lodewyk; Delorenzi, Mauro; Kopetz, Scott; Vermeulen, Louis; Tejpar, Sabine

    2015-11-01

    Colorectal cancer (CRC) is a frequently lethal disease with heterogeneous outcomes and drug responses. To resolve inconsistencies among the reported gene expression-based CRC classifications and facilitate clinical translation, we formed an international consortium dedicated to large-scale data sharing and analytics across expert groups. We show marked interconnectivity between six independent classification systems coalescing into four consensus molecular subtypes (CMSs) with distinguishing features: CMS1 (microsatellite instability immune, 14%), hypermutated, microsatellite unstable and strong immune activation; CMS2 (canonical, 37%), epithelial, marked WNT and MYC signaling activation; CMS3 (metabolic, 13%), epithelial and evident metabolic dysregulation; and CMS4 (mesenchymal, 23%), prominent transforming growth factor-β activation, stromal invasion and angiogenesis. Samples with mixed features (13%) possibly represent a transition phenotype or intratumoral heterogeneity. We consider the CMS groups the most robust classification system currently available for CRC-with clear biological interpretability-and the basis for future clinical stratification and subtype-based targeted interventions.

  13. Reproductive technology: in Japan, consensus has limits.

    PubMed

    Bai, Koichi; Shirai, Yasuko; Ishii, Michiko

    1987-06-01

    As part of a Hastings Center Report series of six articles on reproductive technologies around the world, three Japanese scholars report on the situation in their country. At present, artificial insemination and in vitro fertilization are offered to infertile married couples, and research is performed on early embryos up to 14 days after fertilization. Neither surrogate mothers nor donated gametes are used in Japan. Bai, Shirai, and Ishii identify several issues that they believe merit further public debate, among them the legal status of AID children, the experimental nature of in vitro fertilization, genetic manipulation of embryos, and gender selection. They summarize the findings of four opinion surveys that show a lack of consensus among the Japanese on the acceptability of reproductive technologies, which in the words of the authors "create a tension and a link between traditional belief and contemporary practice."

  14. American National Standards: The Consensus Process

    NASA Technical Reports Server (NTRS)

    Schafer, Thom

    2000-01-01

    Since the early 20th Century, technical and professional societies have developed standards within their areas of expertise addressing aspects of their industries which they feel would benefit from a degree of standardization. From the beginning, the use of these standards was strictly voluntary. It did not take jurisdictional authorities long, however, to recognize that application of these voluntary standards enhanced public safety, as well as leveling the playing field in trade. Hence, laws were passed mandating their use. Purchasers of goods and services also recognized the advantages of standardization, and began requiring the use of standards in their procurement contracts. But how do jurisdictions and purchasers know that the standard they are mandating is a broad-based industry standard, or a narrowly focused set of rules which only apply to one company or institution, thereby giving them an unfair advantage? The answer is "consensus", and a unified approach in achieving it.

  15. Diagnosis of GDM: a suggested consensus.

    PubMed

    McIntyre, Harold David; Colagiuri, Stephen; Roglic, Gojka; Hod, Moshe

    2015-02-01

    Despite recent attempts at building consensus, an internationally consistent definition of gestational diabetes mellitus (GDM) remains elusive. Within and between countries, there is disagreement between obstetric, medical, and endocrine groups as to the diagnosis and management of GDM. The current article aims to discuss the background to the controversy of GDM diagnosis and to address issues related to the detection and treatment of GDM in low-, middle-, and high-resource settings. The criteria recommended by the International Association of the Diabetes and Pregnancy Study Groups (IADPSG), the American Diabetes Association (ADA), and the World Health Organization (WHO) are endorsed. We also wish to put into perspective the importance of GDM, both during and after pregnancy, in terms of its relationship to overall women's health. PMID:25242583

  16. A healthy bladder: a consensus statement

    PubMed Central

    Lukacz, E S; Sampselle, C; Gray, M; MacDiarmid, S; Rosenberg, M; Ellsworth, P; Palmer, M H

    2011-01-01

    A panel of experts in urology, urogynecology, nursing, and behavioral therapy convened in 2010 to discuss the importance of a healthy bladder on overall health. They determined that a consensus statement was necessary to raise awareness among the general public, healthcare providers, payors, and policymakers, with the goals of minimizing the impact of poor bladder health and stimulating primary prevention of bladder conditions. In this statement, ‘healthy’ bladder function is described, as well as internal and external factors that influence bladder health. It is suggested that primary prevention strategies should be aimed at providing education regarding normal lower urinary tract structures and functioning to the public, including patients and healthcare providers. This education may promote the achievement of optimal bladder health by increasing healthy bladder habits and behaviors, awareness of risk factors, healthcare seeking, and clinician engagement and reducing stigma and other barriers to treatment. Promoting optimal bladder health may reduce the personal, societal and economic impact of bladder conditions, including anxiety and depression and costs associated with conditions or diseases and their treatment. While adopting healthy bladder habits and behaviors and behaviors may improve or maintain bladder health, it is important to recognize that certain symptoms may indicate the presence of conditions that require medical attention; many bladder conditions are treatable with a range of options for most bladder conditions. Lastly, the authors propose clinical directives based on persuasive and convergent research to improve and maintain bladder health. The authors hope that this statement will lead to promotion and achievement of optimal bladder health, which may improve overall health and help minimize the effects of bladder conditions on the public, healthcare professionals, educators, employers, and payors. The advisors are in consensus regarding the

  17. Early Gnathostome Phylogeny Revisited: Multiple Method Consensus

    PubMed Central

    Qiao, Tuo; King, Benedict; Long, John A.; Ahlberg, Per E.; Zhu, Min

    2016-01-01

    A series of recent studies recovered consistent phylogenetic scenarios of jawed vertebrates, such as the paraphyly of placoderms with respect to crown gnathostomes, and antiarchs as the sister group of all other jawed vertebrates. However, some of the phylogenetic relationships within the group have remained controversial, such as the positions of Entelognathus, ptyctodontids, and the Guiyu-lineage that comprises Guiyu, Psarolepis and Achoania. The revision of the dataset in a recent study reveals a modified phylogenetic hypothesis, which shows that some of these phylogenetic conflicts were sourced from a few inadvertent miscodings. The interrelationships of early gnathostomes are addressed based on a combined new dataset with 103 taxa and 335 characters, which is the most comprehensive morphological dataset constructed to date. This dataset is investigated in a phylogenetic context using maximum parsimony (MP), Bayesian inference (BI) and maximum likelihood (ML) approaches in an attempt to explore the consensus and incongruence between the hypotheses of early gnathostome interrelationships recovered from different methods. Our findings consistently corroborate the paraphyly of placoderms, all ‘acanthodians’ as a paraphyletic stem group of chondrichthyans, Entelognathus as a stem gnathostome, and the Guiyu-lineage as stem sarcopterygians. The incongruence using different methods is less significant than the consensus, and mainly relates to the positions of the placoderm Wuttagoonaspis, the stem chondrichthyan Ramirosuarezia, and the stem osteichthyan Lophosteus—the taxa that are either poorly known or highly specialized in character complement. Given that the different performances of each phylogenetic approach, our study provides an empirical case that the multiple phylogenetic analyses of morphological data are mutually complementary rather than redundant. PMID:27649538

  18. RNAalifold: improved consensus structure prediction for RNA alignments

    PubMed Central

    Bernhart, Stephan H; Hofacker, Ivo L; Will, Sebastian; Gruber, Andreas R; Stadler, Peter F

    2008-01-01

    Background The prediction of a consensus structure for a set of related RNAs is an important first step for subsequent analyses. RNAalifold, which computes the minimum energy structure that is simultaneously formed by a set of aligned sequences, is one of the oldest and most widely used tools for this task. In recent years, several alternative approaches have been advocated, pointing to several shortcomings of the original RNAalifold approach. Results We show that the accuracy of RNAalifold predictions can be improved substantially by introducing a different, more rational handling of alignment gaps, and by replacing the rather simplistic model of covariance scoring with more sophisticated RIBOSUM-like scoring matrices. These improvements are achieved without compromising the computational efficiency of the algorithm. We show here that the new version of RNAalifold not only outperforms the old one, but also several other tools recently developed, on different datasets. Conclusion The new version of RNAalifold not only can replace the old one for almost any application but it is also competitive with other approaches including those based on SCFGs, maximum expected accuracy, or hierarchical nearest neighbor classifiers. PMID:19014431

  19. Consensus networks with time-delays over finite fields

    NASA Astrophysics Data System (ADS)

    Li, Xiuxian; Su, Housheng; Chen, Michael Z. Q.

    2016-05-01

    In this paper, we investigate the consensus problem in networks with time-delays over finite fields. The delays are categorised into three cases: single constant delay, multiple constant delays, and time-varying bounded delays. For all cases, some sufficient and necessary conditions for consensus are derived. Furthermore, assuming that the communication graph is strongly connected, some of the obtained necessary conditions reveal that the conditions for consensus with time-delays over finite fields depend not only on the diagonal entries but also on the off-diagonal entries, something that is intrinsically distinct from the case over real numbers (where having at least one nonzero diagonal entry is a sufficient and necessary condition to guarantee consensus). In addition, it is shown that delayed networks cannot achieve consensus when the interaction graph is a tree if the corresponding delay-free networks cannot reach consensus, which is consistent with the result over real numbers. As for average consensus, we show that it can never be achieved for delayed networks over finite fields, although it indeed can be reached under several conditions for delay-free networks over finite fields. Finally, networks with time-varying delays are discussed and one sufficient condition for consensus is presented by graph-theoretic method.

  20. Is Liberalism Strong Enough for a Moral Consensus?

    ERIC Educational Resources Information Center

    Wilson, John

    1990-01-01

    Argues that liberalism is strong enough to sustain a moral consensus if its logic and psychological bases are understood. Rejects ideological positions, emphasizing the value of rational discourse for reaching consensus. Encourages liberal educators to make clear their commitment to a liberalism that avoids both authoritarianism and paranoia. (CH)

  1. A Dynamic Measurement of Consensus in Small Decision Making Groups.

    ERIC Educational Resources Information Center

    Spillman, Bonnie; And Others

    A new method for the measurement of consensus in small groups is proposed. The method allows for the study of the dynamic formation of consensus and, with the aid of some mathematical manipulations, reveals the development of subgroup relations over time. In a pilot test, the method was used to study groups of students choosing a topic which they…

  2. The Consensus Definition Redefined from a Representational Perspective

    ERIC Educational Resources Information Center

    Zand Scholten, Annemarie

    2012-01-01

    This paper presents the author's critique to Paul E. Newton's article titled "Clarifying the consensus definition of validity." In his article, Newton not only clarifies but also redefines the consensus definition of validity. In this redefinition he omits the term "construct" and introduces the term "measurement." Both omission and introduction…

  3. The Search for a Value Consensus. Working Papers.

    ERIC Educational Resources Information Center

    Rockefeller Foundation, New York, NY.

    These papers by four social scientists were prepared for a conference to analyze the current absence of a value consensus in American life and to examine grounds for a consensus. Further, the contribution of education and the media to the shaping and dissemination of values is explored. Kenneth Boulding contends that underlying moral diversity is…

  4. Joining consensus of networked multi-agent systems with nonlinear couplings and weighting constraints

    NASA Astrophysics Data System (ADS)

    Wang, Bohui; Wang, Jingcheng; Zhang, Langwen; Ge, Yang

    2016-04-01

    This paper studies the joining consensus of networked multi-agent systems subject to nonlinear couplings and weighted directed graphs via pinning control. A weighted-average consensus protocol is proposed to achieve the collective decision by interacting with the local information of some pinned agents. By proposing a novel joining consensus protocol, average consensus and general consensus strategies are joined to achieve an agreement for the weighting networked system. Furthermore, by calculating a proper consensus gain and using finite control Lyapunov controllers, an efficient joining consensus protocol is presented to improve the consensus speed. Sufficient conditions for achieving the consensuses asymptotically are proved. Finally, theoretical results are validated via simulations.

  5. Finding the most significant common sequence and structure motifs in a set of RNA sequences.

    PubMed Central

    Gorodkin, J; Heyer, L J; Stormo, G D

    1997-01-01

    We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints. In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections. The first part utilizes a simplified version of the Sankoff algorithm for simultaneous folding and alignment of RNA sequences, but maintains tractability by constructing multi-sequence alignments from pairwise comparisons. The algorithm finds the multiple alignments using a greedy approach and has similarities to both CLUSTAL and CONSENSUS, but the core algorithm assures that the pairwise alignments are optimized for both sequence and structure conservation. The choice of scoring system and the method of progressively constructing the final solution are important considerations that are discussed. Example solutions, and comparisons with other approaches, are provided. The solutions include finding consensus structures identical to published ones. PMID:9278497

  6. The role of fanatics in consensus formation

    NASA Astrophysics Data System (ADS)

    Gündüç, Semra

    2015-08-01

    A model of opinion dynamics with two types of agents as social actors are presented, using the Ising thermodynamic model as the dynamics template. The agents are considered as opportunists which live at sites and interact with the neighbors, or fanatics/missionaries which move from site to site randomly in persuasion of converting agents of opposite opinion with the help of opportunists. Here, the moving agents act as an external influence on the opportunists to convert them to the opposite opinion. It is shown by numerical simulations that such dynamics of opinion formation may explain some details of consensus formation even when one of the opinions are held by a minority. Regardless the distribution of the opinion, different size societies exhibit different opinion formation behavior and time scales. In order to understand general behavior, the scaling relations obtained by comparing opinion formation processes observed in societies with varying population and number of randomly moving agents are studied. For the proposed model two types of scaling relations are observed. In fixed size societies, increasing the number of randomly moving agents give a scaling relation for the time scale of the opinion formation process. The second type of scaling relation is due to the size dependent information propagation in finite but large systems, namely finite-size scaling.

  7. Managing Carious Lesions: Consensus Recommendations on Terminology.

    PubMed

    Innes, N P T; Frencken, J E; Bjørndal, L; Maltz, M; Manton, D J; Ricketts, D; Van Landuyt, K; Banerjee, A; Campus, G; Doméjean, S; Fontana, M; Leal, S; Lo, E; Machiulskiene, V; Schulte, A; Splieth, C; Zandona, A; Schwendicke, F

    2016-05-01

    Variation in the terminology used to describe clinical management of carious lesions has contributed to a lack of clarity in the scientific literature and beyond. In this article, the International Caries Consensus Collaboration presents 1) issues around terminology, a scoping review of current words used in the literature for caries removal techniques, and 2) agreed terms and definitions, explaining how these were decided.Dental cariesis the name of the disease, and thecarious lesionis the consequence and manifestation of the disease-the signs or symptoms of the disease. The termdental caries managementshould be limited to situations involving control of the disease through preventive and noninvasive means at a patient level, whereascarious lesion managementcontrols the disease symptoms at the tooth level. While it is not possible to directly relate the visual appearance of carious lesions' clinical manifestations to the histopathology, we have based the terminology around the clinical consequences of disease (soft, leathery, firm, and hard dentine). Approaches to carious tissue removal are defined: 1)selective removal of carious tissue-includingselective removal to soft dentineandselective removal to firm dentine; 2)stepwise removal-including stage 1,selective removal to soft dentine, and stage 2,selective removal to firm dentine6 to 12 mo later; and 3)nonselective removal to hard dentine-formerly known ascomplete caries removal(technique no longer recommended). Adoption of these terms, around managing dental caries and its sequelae, will facilitate improved understanding and communication among researchers and within dental educators and the wider clinical dentistry community. PMID:27099357

  8. Consensus document on European brain research.

    PubMed

    Olesen, Jes; Baker, Mary G; Freund, Tamas; di Luca, Monica; Mendlewicz, Julien; Ragan, Ian; Westphal, Manfred

    2006-08-01

    countries, greater collaboration between industry, academia and patient organisations, and increased investment in the brain sciences. The EBC was formed in 2002 to bring together scientists, clinicians, the pharmaceutical industry, charities and patient organisations from all over Europe to campaign for these goals. It takes a novel, bottom-up approach to research policy, and in developing this consensus document, it aims to promote a greater and more focused effort in this area, to improve public understanding of the brain sciences and above all, to support brain research as a priority under the European Commission's Seventh Framework Programme (FP7, 2007-2013). The research programme outlined here was first conceived by the EBC board. An outline was sent to all member organisations and a number of individual experts for comments. Following that, a table of contents was developed. The 45 research themes were written by groups of experts from across Europe who represent a wide range of disciplines. Each one contains a proposal for future research on a specific brain-related theme which the EBC believes could form the basis of one or more integrated projects or strategic targeted research projects (STREP) funded under FP7. The EBC has deliberately focused on the major diseases and then described the basic research needed to understand and treat or perhaps even cure those diseases. The programme is therefore constructed "from man to molecule" and not the other way round, with equal importance attached to basic and clinical research. The EBC suggests that each of the proposed integrated projects or STREP should be awarded a budget in the order of Euro 10 to 15 million. In addition, brain research should be treated as an important element of many other parts of FP7, such as the European Research Council and research programmes on information technology and the causes of violence. Any research programme that concerns human behaviour should, by definition, take account of brain

  9. Parma consensus statement on metabolic disruptors.

    PubMed

    Heindel, Jerrold J; vom Saal, Frederick S; Blumberg, Bruce; Bovolin, Patrizia; Calamandrei, Gemma; Ceresini, Graziano; Cohn, Barbara A; Fabbri, Elena; Gioiosa, Laura; Kassotis, Christopher; Legler, Juliette; La Merrill, Michele; Rizzir, Laura; Machtinger, Ronit; Mantovani, Alberto; Mendez, Michelle A; Montanini, Luisa; Molteni, Laura; Nagel, Susan C; Parmigiani, Stefano; Panzica, Giancarlo; Paterlini, Silvia; Pomatto, Valentina; Ruzzin, Jérôme; Sartor, Giorgio; Schug, Thaddeus T; Street, Maria E; Suvorov, Alexander; Volpi, Riccardo; Zoeller, R Thomas; Palanza, Paola

    2015-06-20

    A multidisciplinary group of experts gathered in Parma Italy for a workshop hosted by the University of Parma, May 16-18, 2014 to address concerns about the potential relationship between environmental metabolic disrupting chemicals, obesity and related metabolic disorders. The objectives of the workshop were to: 1. Review findings related to the role of environmental chemicals, referred to as "metabolic disruptors", in obesity and metabolic syndrome with special attention to recent discoveries from animal model and epidemiology studies; 2. Identify conclusions that could be drawn with confidence from existing animal and human data; 3. Develop predictions based on current data; and 4. Identify critical knowledge gaps and areas of uncertainty. The consensus statements are intended to aid in expanding understanding of the role of metabolic disruptors in the obesity and metabolic disease epidemics, to move the field forward by assessing the current state of the science and to identify research needs on the role of environmental chemical exposures in these diseases. We propose broadening the definition of obesogens to that of metabolic disruptors, to encompass chemicals that play a role in altered susceptibility to obesity, diabetes and related metabolic disorders including metabolic syndrome.

  10. [New argentine consensus of respiratory rehabilitation 2008].

    PubMed

    Sívori, Martín; Almeida, Marta; Benzo, Roberto; Boim, Clarisa; Brassesco, Marisa; Callejas, Osvaldo; Capparelli, Ignacio; Conti, Ernesto; Díaz, Mariano; Draghi, Jorge; Franco, Javier; Gando, Sebastián; Giuliano, Germán; Guida, Roxana; Jolly, Enrique; Pessolano, Fernando; Rabinovich, Roberto; Ratto, Patricia; Rhodius, Edgardo; Saadia, Marcela; Salvado, Alejandro; Sobrino, Edgardo; Victorio, Carlos

    2008-01-01

    Respiratory rehabilitation (RR) is a multidisciplinary program of care for patients with chronic respiratory impairment, individually tailored, designed to optimize physical and social performance and patient autonomy. It is particularly indicated in chronic obstructive pulmonary disease (COPD) patients with exercise intolerance. The objectives of respiratory rehabilitation are: reduction in symptoms and exercise intolerance, improvement of health-related quality of life, and reduction of health costs. A group of neumonologists, nutritionists and physical therapists performed a systematic review of the evidence in RR to update previous local guidelines. Inclusion and exclusion criteria, guidelines for initial evaluation and follow up and resources needed are defined. Training characteristics are recommended regarding frequency of the visits, intensity, progression and duration of the exercise training. Aerobic training was recommended for lower limb (1A), upper limb (1B). Strength training must be added (1B). Respiratory muscle training and other physiotherapy techniques were recommended only for specific patients (1C). In addition recommendations have been made for educational objectives of the program including smoking cessation, nutritional and psychological support. The positive impact of RR on reductions of health care costs and reductions on hospitalizations (Evidence A) and mortality (Evidence B) were analized. Respiratory rehabilitation is a key component in the modern treatment of COPD patients. This consensus statement was prepared based on the most recent scientific evidence and adjusted to the local environment with the aim of being implemented nationally. PMID:18786894

  11. Current Consensus Guidelines for Treatment of Neurocysticercosis

    PubMed Central

    García, Hector H.; Evans, Carlton A. W.; Nash, Theodore E.; Takayanagui, Osvaldo M.; White, A. Clinton; Botero, David; Rajshekhar, Vedantam; Tsang, Victor C. W.; Schantz, Peter M.; Allan, James C.; Flisser, Ana; Correa, Dolores; Sarti, Elsa; Friedland, Jon S.; Martinez, S. Manuel; Gonzalez, Armando E.; Gilman, Robert H.; Del Brutto, Oscar H.

    2002-01-01

    Taenia solium neurocysticercosis is a common cause of epileptic seizures and other neurological morbidity in most developing countries. It is also an increasingly common diagnosis in industrialized countries because of immigration from areas where it is endemic. Its clinical manifestations are highly variable and depend on the number, stage, and size of the lesions and the host's immune response. In part due to this variability, major discrepancies exist in the treatment of neurocysticercosis. A panel of experts in taeniasis/cysticercosis discussed the evidence on treatment of neurocysticercosis for each clinical presentation, and we present the panel's consensus and areas of disagreement. Overall, four general recommendations were made: (i) individualize therapeutic decisions, including whether to use antiparasitic drugs, based on the number, location, and viability of the parasites within the nervous system; (ii) actively manage growing cysticerci either with antiparasitic drugs or surgical excision; (iii) prioritize the management of intracranial hypertension secondary to neurocysticercosis before considering any other form of therapy; and (iv) manage seizures as done for seizures due to other causes of secondary seizures (remote symptomatic seizures) because they are due to an organic focus that has been present for a long time. PMID:12364377

  12. Managing Carious Lesions: Consensus Recommendations on Terminology.

    PubMed

    Innes, N P T; Frencken, J E; Bjørndal, L; Maltz, M; Manton, D J; Ricketts, D; Van Landuyt, K; Banerjee, A; Campus, G; Doméjean, S; Fontana, M; Leal, S; Lo, E; Machiulskiene, V; Schulte, A; Splieth, C; Zandona, A; Schwendicke, F

    2016-05-01

    Variation in the terminology used to describe clinical management of carious lesions has contributed to a lack of clarity in the scientific literature and beyond. In this article, the International Caries Consensus Collaboration presents 1) issues around terminology, a scoping review of current words used in the literature for caries removal techniques, and 2) agreed terms and definitions, explaining how these were decided.Dental cariesis the name of the disease, and thecarious lesionis the consequence and manifestation of the disease-the signs or symptoms of the disease. The termdental caries managementshould be limited to situations involving control of the disease through preventive and noninvasive means at a patient level, whereascarious lesion managementcontrols the disease symptoms at the tooth level. While it is not possible to directly relate the visual appearance of carious lesions' clinical manifestations to the histopathology, we have based the terminology around the clinical consequences of disease (soft, leathery, firm, and hard dentine). Approaches to carious tissue removal are defined: 1)selective removal of carious tissue-includingselective removal to soft dentineandselective removal to firm dentine; 2)stepwise removal-including stage 1,selective removal to soft dentine, and stage 2,selective removal to firm dentine6 to 12 mo later; and 3)nonselective removal to hard dentine-formerly known ascomplete caries removal(technique no longer recommended). Adoption of these terms, around managing dental caries and its sequelae, will facilitate improved understanding and communication among researchers and within dental educators and the wider clinical dentistry community.

  13. Deep sequencing increases hepatitis C virus phylogenetic cluster detection compared to Sanger sequencing.

    PubMed

    Montoya, Vincent; Olmstead, Andrea; Tang, Patrick; Cook, Darrel; Janjua, Naveed; Grebely, Jason; Jacka, Brendan; Poon, Art F Y; Krajden, Mel

    2016-09-01

    Effective surveillance and treatment strategies are required to control the hepatitis C virus (HCV) epidemic. Phylogenetic analyses are powerful tools for reconstructing the evolutionary history of viral outbreaks and identifying transmission clusters. These studies often rely on Sanger sequencing which typically generates a single consensus sequence for each infected individual. For rapidly mutating viruses such as HCV, consensus sequencing underestimates the complexity of the viral quasispecies population and could therefore generate different phylogenetic tree topologies. Although deep sequencing provides a more detailed quasispecies characterization, in-depth phylogenetic analyses are challenging due to dataset complexity and computational limitations. Here, we apply deep sequencing to a characterized population to assess its ability to identify phylogenetic clusters compared with consensus Sanger sequencing. For deep sequencing, a sample specific threshold determined by the 50th percentile of the patristic distance distribution for all variants within each individual was used to identify clusters. Among seven patristic distance thresholds tested for the Sanger sequence phylogeny ranging from 0.005-0.06, a threshold of 0.03 was found to provide the maximum balance between positive agreement (samples in a cluster) and negative agreement (samples not in a cluster) relative to the deep sequencing dataset. From 77 HCV seroconverters, 10 individuals were identified in phylogenetic clusters using both methods. Deep sequencing analysis identified an additional 4 individuals and excluded 8 other individuals relative to Sanger sequencing. The application of this deep sequencing approach could be a more effective tool to understand onward HCV transmission dynamics compared with Sanger sequencing, since the incorporation of minority sequence variants improves the discrimination of phylogenetically linked clusters.

  14. Development of a consensus microarray method for identification of some highly pathogenic viruses.

    PubMed

    Xiao-Ping, Kang; Yong-Qiang, Li; Qing-Ge, Sun; Hong, Liu; Qing-Yu, Zhu; Yin-Hui, Yang

    2009-11-01

    Some highly pathogenic viruses, such as Chikungunya virus, Japanese encephalitis virus, Yellow fever virus, Dengue virus, Hanta virus, SARS-CoV, and H5N1 avian influenza virus can cause severe infectious diseases. However, the consensus method for detecting these viruses has not been well established. A rapid and sensitive microarray approach for detection of these viruses and a panel of specific probes covering nine genera and 16 virus species were designed. 70-mer oligonucleotides were used at the genus level and 50-mer oligonucleotides were at the species level, respectively. To decrease the interference of the host genome in hybridization, the consensus genus primers were designed and used to reverse transcribe only virus genome. The synthesis of the second strand was carried out with a random primer sequence (5'-GTTTCCCAGTAGGTCTCNNNNNNNN-3'). The amplified products were labeled and processed for microarray analyses. This microarray-based method used the highly conserved consensus primers to synthesize specifically the virus cDNA and could identify effectively Chikungunya virus, Japanese encephalitis virus, Yellow fever virus, Dengue virus, Tick borne encephalitis virus, and H5N1 avian influenza virus. Using this method, one unknown virus isolated from pig brain in Shanxi Province, China was identified. This method may have an important potential application for the diagnosis of virus infection.

  15. Event-triggered nonlinear consensus in directed multi-agent systems with combinational state measurements

    NASA Astrophysics Data System (ADS)

    Li, Huaqing; Chen, Guo; Xiao, Li

    2016-10-01

    Event-triggered sampling control is motivated by the applications of embedded microprocessors equipped in the agents with limited computation and storage resources. This paper studied global consensus in multi-agent systems with inherent nonlinear dynamics on general directed networks using decentralised event-triggered strategy. For each agent, the controller updates are event-based and only triggered at its own event times by only utilising the locally current sampling data. A high-performance sampling event that only needs local neighbours' states at their own discrete time instants is presented. Furthermore, we introduce two kinds of general algebraic connectivity for strongly connected networks and strongly connected components of the directed network containing a spanning tree so as to describe the system's ability for reaching consensus. A detailed theoretical analysis on consensus is performed and two criteria are derived by virtue of algebraic graph theory, matrix theory and Lyapunov control approach. It is shown that the Zeno behaviour of triggering time sequence is excluded during the system's whole working process. A numerical simulation is given to show the effectiveness of the theoretical results.

  16. Status of conversion of NE standards to national consensus standards

    SciTech Connect

    Jennings, S.D.

    1990-06-01

    One major goal of the Nuclear Standards Program is to convert existing NE standards into national consensus standards (where possible). This means that an NE standard in the same subject area using the national consensus process. This report is a summary of the activities that have evolved to effect conversion of NE standards to national consensus standards, and the status of current conversion activities. In some cases, all requirements in an NE standard will not be incorporated into the published national consensus standard because these requirements may be considered too restrictive or too specific for broader application by the nuclear industry. If these requirements are considered necessary for nuclear reactor program applications, the program standard will be revised and issued as a supplement to the national consensus standard. The supplemental program standard will contain only those necessary requirements not reflected by the national consensus standard. Therefore, while complete conversion of program standards may not always be realized, the standards policy has been fully supported in attempting to make maximum use of the national consensus standard. 1 tab.

  17. Confronting the Ethical Conduct of Resuscitation Research: a consensus opinion.

    PubMed

    Mann, N Clay; Schmidt, Terri A; Richardson, Lynne D

    2005-11-01

    An objective of the 2005 Academic Emergency Medicine Consensus Conference, "Ethical Conduct of Resuscitation Research," was to identify if consensus exists regarding application of the Food and Drug Administration (FDA) Final Rule allowing an exception from informed consent in resuscitation research. At the start of the consensus conference, 49 attendees participated in a survey containing three sections: 1) demographic questions characterizing respondents, 2) questions regarding application of the FDA Final Rule, and 3) complexities associated with seeking informed consent in an emergency setting. Consensus analysis was used to determine if a formal consensus was reached, relying on a Bayesian posterior probability of 0.99 to consider survey responses a "consensus." Respondents demonstrated consensus regarding the need to further refine and standardize application of the FDA Final Rule in resuscitation research. However, participants agreed that current regulations provide adequate and appropriate protection to safeguard patients. Complexities associated with seeking informed consent in emergency departments were prevalent among most institutions represented at the conference. There was general agreement that current efforts to safeguard human subjects are effective, but participants agreed that refinements to and standardization of the FDA Final Rule would facilitate resuscitation research and enhance patient safety. PMID:16264078

  18. BRAZILIAN CONSENSUS FOR MULTIMODAL TREATMENT OF COLORECTAL LIVER METASTASES. MODULE 3: CONTROVERSIES AND UNRESECTABLE METASTASES

    PubMed Central

    TORRES, Orlando Jorge Martins; MARQUES, Márcio Carmona; SANTOS, Fabio Nasser; de FARIAS, Igor Correia; COUTINHO, Anelisa Kruschewsky; de OLIVEIRA, Cássio Virgílio Cavalcante; KALIL, Antonio Nocchi; de MELLO, Celso Abdon Lopes; KRUGER, Jaime Arthur Pirola; FERNANDES, Gustavo dos Santos; QUIREZE JR, Claudemiro; MURAD, André M.; SILVA, Milton José de BARROS E; ZURSTRASSEN, Charles Edouard; FREITAS, Helano Carioca; CRUZ, Marcelo Rocha; WESCHENFELDER, Rui; LINHARES, Marcelo Moura; CASTRO, Leonaldson dos Santos; VOLLMER, Charles; DIXON, Elijah; RIBEIRO, Héber Salvador de Castro; COIMBRA, Felipe José Fernandez

    2016-01-01

    ABSTRACT In the last module of this consensus, controversial topics were discussed. Management of the disease after progression during first line chemotherapy was the first discussion. Next, the benefits of liver resection in the presence of extra-hepatic disease were debated, as soon as, the best sequence of treatment. Conversion chemotherapy in the presence of unresectable liver disease was also discussed in this module. Lastly, the approach to the unresectable disease was also discussed, focusing in the best chemotherapy regimens and hole of chemo-embolization. PMID:27759781

  19. Consensus definitions of 14 severe acute toxic effects for childhood lymphoblastic leukaemia treatment: a Delphi consensus.

    PubMed

    Schmiegelow, Kjeld; Attarbaschi, Andishe; Barzilai, Shlomit; Escherich, Gabriele; Frandsen, Thomas Leth; Halsey, Christina; Hough, Rachael; Jeha, Sima; Kato, Motohiro; Liang, Der-Cherng; Mikkelsen, Torben Stamm; Möricke, Anja; Niinimäki, Riitta; Piette, Caroline; Putti, Maria Caterina; Raetz, Elizabeth; Silverman, Lewis B; Skinner, Roderick; Tuckuviene, Ruta; van der Sluis, Inge; Zapotocka, Ester

    2016-06-01

    Although there are high survival rates for children with acute lymphoblastic leukaemia, their outcome is often counterbalanced by the burden of toxic effects. This is because reported frequencies vary widely across studies, partly because of diverse definitions of toxic effects. Using the Delphi method, 15 international childhood acute lymphoblastic leukaemia study groups assessed acute lymphoblastic leukaemia protocols to address toxic effects that were to be considered by the Ponte di Legno working group. 14 acute toxic effects (hypersensitivity to asparaginase, hyperlipidaemia, osteonecrosis, asparaginase-associated pancreatitis, arterial hypertension, posterior reversible encephalopathy syndrome, seizures, depressed level of consciousness, methotrexate-related stroke-like syndrome, peripheral neuropathy, high-dose methotrexate-related nephrotoxicity, sinusoidal obstructive syndrome, thromboembolism, and Pneumocystis jirovecii pneumonia) that are serious but too rare to be addressed comprehensively within any single group, or are deemed to need consensus definitions for reliable incidence comparisons, were selected for assessment. Our results showed that none of the protocols addressed all 14 toxic effects, that no two protocols shared identical definitions of all toxic effects, and that no toxic effect definition was shared by all protocols. Using the Delphi method over three face-to-face plenary meetings, consensus definitions were obtained for all 14 toxic effects. In the overall assessment of outcome of acute lymphoblastic leukaemia treatment, these expert opinion-based definitions will allow reliable comparisons of frequencies and severities of acute toxic effects across treatment protocols, and facilitate international research on cause, guidelines for treatment adaptation, preventive strategies, and development of consensus algorithms for reporting on acute lymphoblastic leukaemia treatment. PMID:27299279

  20. Complete Genome Sequence of Vaccinia Virus Strain L-IVP

    PubMed Central

    Shvalov, Alexander N.; Sivolobova, Galina F.; Kuligina, Elena V.

    2016-01-01

    Most of the live vaccine doses of vaccinia virus donated to the Intensified Smallpox Eradication Programme after 1971 were prepared using the L-IVP strain. A mixture of three clones of the L-IVP strain was sequenced using MySEQ. Consensus sequence similarity with the vaccinia virus Lister strain is 99.5%. PMID:27174282

  1. Complete Genome Sequence of Vaccinia Virus Strain L-IVP.

    PubMed

    Shvalov, Alexander N; Sivolobova, Galina F; Kuligina, Elena V; Kochneva, Galina V

    2016-01-01

    Most of the live vaccine doses of vaccinia virus donated to the Intensified Smallpox Eradication Programme after 1971 were prepared using the L-IVP strain. A mixture of three clones of the L-IVP strain was sequenced using MySEQ. Consensus sequence similarity with the vaccinia virus Lister strain is 99.5%. PMID:27174282

  2. [Preliminary evaluation of Chile's First Citizen Consensus Conference].

    PubMed

    Pellegrini Filho, Alberto; Zurita, Laura

    2004-05-01

    This piece provides an initial assessment of the First Citizen Consensus Conference, an event held in the city of Santiago, Chile, from 22-24 November 2003, on the subject of "The Management of My Medical Record." This conference was the first citizen consensus conference that has been held in Chile as well as the first such conference in Latin America. Consensus conferences were devised by the Danish Board of Technology in 1987 as a way to assess science and technology issues through discussions between experts and a panel of lay persons. At the end of a consensus conference, the lay persons express their opinions and recommendations in a consensus report that is directed at policymakers, decision-makers, and the public in general. The objective of a consensus conference is to bridge the gaps that routinely exist among the general public, experts, and elected officials. So far, the Danish Board of Technology has organized more than 20 of these conferences, using a methodology that has become established as a model. Taking into account the changes that have occurred in the relationship between science and society at large, the Pan American Health Organization has decided to support the holding of consensus conferences in Latin America and the Caribbean. The First Citizen Consensus Conference adapted the Danish methodology to conditions in Chile, and this piece assesses the modifications that were made. In addition, some 6 to 12 months after the conference, there will be an external evaluation of the outcomes and impact of the conference, especially in the communications media, public debate, decision-making, and perceptions of the persons who were involved. Despite the criticisms made in this piece and some shortcomings that are pointed out, the First Citizen Consensus Conference achieved all of its objectives and will serve as an excellent model for similar conferences in other countries of the Americas. PMID:15231085

  3. [Preliminary evaluation of Chile's First Citizen Consensus Conference].

    PubMed

    Pellegrini Filho, Alberto; Zurita, Laura

    2004-05-01

    This piece provides an initial assessment of the First Citizen Consensus Conference, an event held in the city of Santiago, Chile, from 22-24 November 2003, on the subject of "The Management of My Medical Record." This conference was the first citizen consensus conference that has been held in Chile as well as the first such conference in Latin America. Consensus conferences were devised by the Danish Board of Technology in 1987 as a way to assess science and technology issues through discussions between experts and a panel of lay persons. At the end of a consensus conference, the lay persons express their opinions and recommendations in a consensus report that is directed at policymakers, decision-makers, and the public in general. The objective of a consensus conference is to bridge the gaps that routinely exist among the general public, experts, and elected officials. So far, the Danish Board of Technology has organized more than 20 of these conferences, using a methodology that has become established as a model. Taking into account the changes that have occurred in the relationship between science and society at large, the Pan American Health Organization has decided to support the holding of consensus conferences in Latin America and the Caribbean. The First Citizen Consensus Conference adapted the Danish methodology to conditions in Chile, and this piece assesses the modifications that were made. In addition, some 6 to 12 months after the conference, there will be an external evaluation of the outcomes and impact of the conference, especially in the communications media, public debate, decision-making, and perceptions of the persons who were involved. Despite the criticisms made in this piece and some shortcomings that are pointed out, the First Citizen Consensus Conference achieved all of its objectives and will serve as an excellent model for similar conferences in other countries of the Americas.

  4. Recent consensus statements in pediatric endocrinology: a selective review.

    PubMed

    Klein, Michelle; Sathasivam, Anpalakan; Novoa, Yeray; Rapaport, Robert

    2011-10-01

    Clinical guidelines and consensus statements serve to summarize and organize current knowledge on diverse subjects and provide practical guidelines for proper clinical management. Recommendations should be based on research and evidence derived from appropriate sources. In 2008, more than 20 consensus statements were published in the pediatric literature alone. This article summarizes the salient points of the latest consensus statements jointly developed by multiple endocrine societies including the Lawson Wilkins Society for Pediatric Endocrinology and the European Society for Pediatric Endocrinology. As much as possible, the original intent and language of the statements was respected and paraphrased.

  5. APASL consensus statements and recommendation on treatment of hepatitis C.

    PubMed

    Omata, Masao; Kanda, Tatsuo; Wei, Lai; Yu, Ming-Lung; Chuang, Wang-Long; Ibrahim, Alaaeldin; Lesmana, Cosmas Rinaldi Adithya; Sollano, Jose; Kumar, Manoj; Jindal, Ankur; Sharma, Barjesh Chander; Hamid, Saeed S; Dokmeci, A Kadir; Mamun-Al-Mahtab; McCaughan, Geofferey W; Wasim, Jafri; Crawford, Darrell H G; Kao, Jia-Horng; Yokosuka, Osamu; Lau, George K K; Sarin, Shiv Kumar

    2016-09-01

    The Asian-Pacific Association for the Study of the Liver (APASL) convened an international working party on the "APASL consensus statements and recommendation on management of hepatitis C" in March, 2015, in order to revise "APASL consensus statements and management algorithms for hepatitis C virus infection (Hepatol Int 6:409-435, 2012)". The working party consisted of expert hepatologists from the Asian-Pacific region gathered at Istanbul Congress Center, Istanbul, Turkey on 13 March 2015. New data were presented, discussed and debated to draft a revision. Participants of the consensus meeting assessed the quality of cited studies. Finalized recommendations on treatment of hepatitis C are presented in this review.

  6. Admissible consensus for heterogeneous descriptor multi-agent systems

    NASA Astrophysics Data System (ADS)

    Yang, Xin-Rong; Liu, Guo-Ping

    2016-09-01

    This paper focuses on the admissible consensus problem for heterogeneous descriptor multi-agent systems. Based on algebra, graph and descriptor system theory, the necessary and sufficient conditions are proposed for heterogeneous descriptor multi-agent systems achieving admissible consensus. The provided conditions depend on not only the structure properties of each agent dynamics but also the topologies within the descriptor multi-agent systems. Moreover, an algorithm is given to design the novel consensus protocol. A numerical example demonstrates the effectiveness of the proposed design approach.

  7. Consensus statement on diabetes in children.

    PubMed

    Prasanna Kumar, K M; Dev, N Prabhu; Raman, K V; Desai, Rajnanda; Prasadini, T Geetha; Das, A K; Ramoul, Soraya

    2014-05-01

    While T1DM has been traditionally seen as a minor concern in the larger picture of pediatric ailments, new data reveals that the incidence of T1DM has assumed alarming proportions. It has long been clear that while the disease may be diagnosed at an early age, its impact is not isolated to afflicted children. The direct impact of the disease on the patient is debilitating due to the nature of the disease and lack of proper access to treatment in India. But this impact is further compounded by the utter apathy and often times antipathy, which patients withT1DM have to face. Lack of awareness of the issue in all stakeholders, low access to quality healthcare, patient, physician, and system level barriers to the delivery of optimal diabetes care are some of the factors which hinder successful management of T1DM. The first international consensus meet on diabetes in children was convened with the aim of providing a common platform to all the stakeholders in the management of T1DM, to discuss the academic, administrative and healthcare system related issues. The ultimate aim was to articulate the problems faced by children with diabetes in a way that centralized their position and focused on creating modalities of management sensitive to their needs and aspirations. It was conceptualized to raise a strong voice of advocacy for improving the management of T1DM and ensuring that "No child should die of diabetes". The unique clinical presentations of T1DM coupled with ignorance on the part of the medical community and society in general results in outcomes that are far worse than that seen with T2DM. So there is a need to substantially improve training of HCPs at all levels on this neglected aspect of healthcare.

  8. Carotid endarterectomy: current consensus and controversies.

    PubMed

    Meerwaldt, Robbert; Hermus, Linda; Reijnen, Michel M P J; Zeebregts, Clark J

    2010-10-01

    Stroke is the third most common cause of mortality, and carotid artery stenosis causes 8% to 29% of all ischemic strokes. Best medical treatment forms the basis of carotid stenosis treatment, and carotid endarterectomy (CEA) has an additional beneficial effect in high-grade stenosis. Carotid angioplasty and stenting (CAS) has challenged CEA as a primary carotid intervention. At present, CEA remains the gold standard, but in the future, CAS techniques will evolve and might become beneficial for subgroups of patients with carotid stenosis. This chapter briefly describes the history of carotid interventions and current consensus and controversies in CEA. In the last two years, several meta-analyses were published on a variety of aspects of best medical treatment, CEA, and CAS. It is still a matter of debate as to whether asymptomatic patients with carotid stenosis should undergo a carotid intervention. Especially because medical treatment has dramatically evolved since the early carotid trials. On the other hand, it is clear that carotid interventions in symptomatic patients with a high-grade stenosis should be performed as early as possible after the initial neurological event in order to achieve optimal stroke risk reduction. In CEA, the use of patching is advocated above primary closure, while the role of selective patching is still unclear. No differences in stroke and mortality rates are observed for routine versus selective shunting, for conventional versus eversion CEA, or for local versus general anesthesia. It is anticipated that in the future, there will be several interesting developments in carotid interventions such as plaque morphology analysis, acute interventions during stroke in progress, and further evolvement of CAS techniques. PMID:21082576

  9. Carotid endarterectomy: current consensus and controversies.

    PubMed

    Meerwaldt, Robbert; Hermus, Linda; Reijnen, Michel M P J; Zeebregts, Clark J

    2010-10-01

    Stroke is the third most common cause of mortality, and carotid artery stenosis causes 8% to 29% of all ischemic strokes. Best medical treatment forms the basis of carotid stenosis treatment, and carotid endarterectomy (CEA) has an additional beneficial effect in high-grade stenosis. Carotid angioplasty and stenting (CAS) has challenged CEA as a primary carotid intervention. At present, CEA remains the gold standard, but in the future, CAS techniques will evolve and might become beneficial for subgroups of patients with carotid stenosis. This chapter briefly describes the history of carotid interventions and current consensus and controversies in CEA. In the last two years, several meta-analyses were published on a variety of aspects of best medical treatment, CEA, and CAS. It is still a matter of debate as to whether asymptomatic patients with carotid stenosis should undergo a carotid intervention. Especially because medical treatment has dramatically evolved since the early carotid trials. On the other hand, it is clear that carotid interventions in symptomatic patients with a high-grade stenosis should be performed as early as possible after the initial neurological event in order to achieve optimal stroke risk reduction. In CEA, the use of patching is advocated above primary closure, while the role of selective patching is still unclear. No differences in stroke and mortality rates are observed for routine versus selective shunting, for conventional versus eversion CEA, or for local versus general anesthesia. It is anticipated that in the future, there will be several interesting developments in carotid interventions such as plaque morphology analysis, acute interventions during stroke in progress, and further evolvement of CAS techniques.

  10. Consensus statement on diabetes in children

    PubMed Central

    Prasanna Kumar, K. M.; Dev, N. Prabhu; Raman, K. V.; Desai, Rajnanda; Prasadini, T. Geetha; Das, A. K.; Ramoul, Soraya

    2014-01-01

    While T1DM has been traditionally seen as a minor concern in the larger picture of pediatric ailments, new data reveals that the incidence of T1DM has assumed alarming proportions. It has long been clear that while the disease may be diagnosed at an early age, its impact is not isolated to afflicted children. The direct impact of the disease on the patient is debilitating due to the nature of the disease and lack of proper access to treatment in India. But this impact is further compounded by the utter apathy and often times antipathy, which patients withT1DM have to face. Lack of awareness of the issue in all stakeholders, low access to quality healthcare, patient, physician, and system level barriers to the delivery of optimal diabetes care are some of the factors which hinder successful management of T1DM. The first international consensus meet on diabetes in children was convened with the aim of providing a common platform to all the stakeholders in the management of T1DM, to discuss the academic, administrative and healthcare system related issues. The ultimate aim was to articulate the problems faced by children with diabetes in a way that centralized their position and focused on creating modalities of management sensitive to their needs and aspirations. It was conceptualized to raise a strong voice of advocacy for improving the management of T1DM and ensuring that “No child should die of diabetes”. The unique clinical presentations of T1DM coupled with ignorance on the part of the medical community and society in general results in outcomes that are far worse than that seen with T2DM. So there is a need to substantially improve training of HCPs at all levels on this neglected aspect of healthcare. PMID:24944917

  11. A High Density Consensus Map of Rye (Secale cereale L.) Based on DArT Markers

    PubMed Central

    Myśków, Beata; Stojałowski, Stefan; Heller-Uszyńska, Katarzyna; Góralska, Magdalena; Brągoszewski, Piotr; Uszyński, Grzegorz; Kilian, Andrzej; Rakoczy-Trojanowska, Monika

    2011-01-01

    Background Rye (Secale cereale L.) is an economically important crop, exhibiting unique features such as outstanding resistance to biotic and abiotic stresses and high nutrient use efficiency. This species presents a challenge to geneticists and breeders due to its large genome containing a high proportion of repetitive sequences, self incompatibility, severe inbreeding depression and tissue culture recalcitrance. The genomic resources currently available for rye are underdeveloped in comparison with other crops of similar economic importance. The aim of this study was to create a highly saturated, multilocus linkage map of rye via consensus mapping, based on Diversity Arrays Technology (DArT) markers. Methodology/Principal Findings Recombinant inbred lines (RILs) from 5 populations (564 in total) were genotyped using DArT markers and subjected to linkage analysis using Join Map 4.0 and Multipoint Consensus 2.2 software. A consensus map was constructed using a total of 9703 segregating markers. The average chromosome map length ranged from 199.9 cM (2R) to 251.4 cM (4R) and the average map density was 1.1 cM. The integrated map comprised 4048 loci with the number of markers per chromosome ranging from 454 for 7R to 805 for 4R. In comparison with previously published studies on rye, this represents an eight-fold increase in the number of loci placed on a consensus map and a more than two-fold increase in the number of genetically mapped DArT markers. Conclusions/Significance Through the careful choice of marker type, mapping populations and the use of software packages implementing powerful algorithms for map order optimization, we produced a valuable resource for rye and triticale genomics and breeding, which provides an excellent starting point for more in-depth studies on rye genome organization. PMID:22163026

  12. Estimating evolution of temporal sequence changes: a practical approach to inferring ancestral developmental sequences and sequence heterochrony.

    PubMed

    Harrison, Luke B; Larsson, Hans C E

    2008-06-01

    Developmental biology often yields data in a temporal context. Temporal data in phylogenetic systematics has important uses in the field of evolutionary developmental biology and, in general, comparative biology. The evolution of temporal sequences, specifically developmental sequences, has proven difficult to examine due to the highly variable temporal progression of development. Issues concerning the analysis of temporal sequences and problems with current methods of analysis are discussed. We present here an algorithm to infer ancestral temporal sequences, quantify sequence heterochronies, and estimate pseudoreplicate consensus support for sequence changes using Parsimov-based genetic inference [PGi]. Real temporal developmental sequence data sets are used to compare PGi with currently used approaches, and PGi is shown to be the most efficient, accurate, and practical method to examine biological data and infer ancestral states on a phylogeny. The method is also expandable to address further issues in developmental evolution, namely modularity. PMID:18570033

  13. Consensus statement: the 16th Annual Western Canadian Gastrointestinal Cancer Consensus Conference; Saskatoon, Saskatchewan; September 5–6, 2014

    PubMed Central

    Ahmed, S.; Bathe, O.; Berry, S.; Buie, D.; Davies, J.; Doll, C.; Dowden, S.; Gill, S.; Gordon, V.; Hebbard, P.; Jones, E.; Kennecke, H.; Koski, S.; Krahn, M.; Le, D.; Lim, H.; Lund, C.; Luo, Y.; Mcffadden, A.; Mcghie, J.; Mulder, K.; Park, J.; Rashidi, F.; Sami, A.; Tan, K.T.; Wong, R.

    2015-01-01

    The 16th annual Western Canadian Gastrointestinal Cancer Consensus Conference was held in Saskatoon, Saskatchewan, September 4–5, 2014. The Consensus Conference is an interactive, multidisciplinary event attended by health care professionals from across western Canada (British Columbia, Alberta, Saskatchewan, and Manitoba) involved in the care of gastrointestinal cancer. Surgical, medical, and radiation oncologists; pathologists; radiologists; and allied health care professionals participated in presentation and discussion sessions for the purposes of developing the recommendations presented here. This consensus statement addresses current issues in the management of colorectal cancer. PMID:25908916

  14. ESMO-ESGO-ESTRO Consensus Conference on Endometrial Cancer

    PubMed Central

    Colombo, Nicoletta; Creutzberg, Carien; Amant, Frederic; Bosse, Tjalling; González-Martín, Antonio; Ledermann, Jonathan; Marth, Christian; Nout, Remi; Querleu, Denis; Mirza, Mansoor Raza; Sessa, Cristiana

    2016-01-01

    Abstract The first joint European Society for Medical Oncology (ESMO), European SocieTy for Radiotherapy & Oncology (ESTRO) and European Society of Gynaecological Oncology (ESGO) consensus conference on endometrial cancer was held on 11–13 December 2014 in Milan, Italy, and comprised a multidisciplinary panel of 40 leading experts in the management of endometrial cancer. Before the conference, the expert panel prepared three clinically-relevant questions about endometrial cancer relating to the following four areas: prevention and screening, surgery, adjuvant treatment and advanced and recurrent disease. All relevant scientific literature, as identified by the experts, was reviewed in advance. During the consensus conference, the panel developed recommendations for each specific question and a consensus was reached. Results of this consensus conference, together with a summary of evidence supporting each recommendation, are detailed in this article. All participants have approved this final article. PMID:26645990

  15. NIH Blood and Marrow Transplant Late Effects Consensus Conference

    Cancer.gov

    This day and a half symposium will bring together experts in blood and marrow transplantation, late effects, and health care delivery to discuss current evidence and knowledge gaps, develop consensus guidelines, and inform future research in the BMT survivor population.

  16. Climate science, character, and the "hard-won" consensus.

    PubMed

    Ranalli, Brent

    2012-06-01

    What makes a consensus among scientists credible and convincing? This paper introduces the notion of a "hard-won" consensus and uses examples from recent debates over climate change science to show that this heuristic standard for evaluating the quality of a consensus is widely shared. The extent to which a consensus is "hard won" can be understood to depend on the personal qualities of the participating experts; the article demonstrates the continuing utility of the norms of modern science introduced by Robert K. Merton by showing that individuals on both sides of the climate science debate rely intuitively on Mertonian ideas--interpreted in terms of character--to frame their arguments. PMID:23002583

  17. Scientific consensus, the law, and same sex parenting outcomes.

    PubMed

    adams, Jimi; Light, Ryan

    2015-09-01

    While the US Supreme Court was considering two related cases involving the constitutionality of same-sex marriage, one major question informing that decision was whether scientific research had achieved consensus regarding how children of same-sex couples fare. Determining the extent of consensus has become a key aspect of how social science evidence and testimony is accepted by the courts. Here, we show how a method of analyzing temporal patterns in citation networks can be used to assess the state of social scientific literature as a means to inform just such a question. Patterns of clustering within these citation networks reveal whether and when consensus arises within a scientific field. We find that the literature on outcomes for children of same-sex parents is marked by scientific consensus that they experience "no differences" compared to children from other parental configurations.

  18. A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences

    NASA Technical Reports Server (NTRS)

    Ho, P. S.; Ellison, M. J.; Quigley, G. J.; Rich, A.

    1986-01-01

    The ease with which a particular DNA segment adopts the left-handed Z-conformation depends largely on the sequence and on the degree of negative supercoiling to which it is subjected. We describe a computer program (Z-hunt) that is designed to search long sequences of naturally occurring DNA and retrieve those nucleotide combinations of up to 24 bp in length which show a strong propensity for Z-DNA formation. Incorporated into Z-hunt is a statistical mechanical model based on empirically determined energetic parameters for the B to Z transition accumulated to date. The Z-forming potential of a sequence is assessed by ranking its behavior as a function of negative superhelicity relative to the behavior of similar sized randomly generated nucleotide sequences assembled from over 80,000 combinations. The program makes it possible to compare directly the Z-forming potential of sequences with different base compositions and different sequence lengths. Using Z-hunt, we have analyzed the DNA sequences of the bacteriophage phi X174, plasmid pBR322, the animal virus SV40 and the replicative form of the eukaryotic adenovirus-2. The results are compared with those previously obtained by others from experiments designed to locate Z-DNA forming regions in these sequences using probes which show specificity for the left-handed DNA conformation.

  19. Consensus time and conformity in the adaptive voter model

    NASA Astrophysics Data System (ADS)

    Rogers, Tim; Gross, Thilo

    2013-09-01

    The adaptive voter model is a paradigmatic model in the study of opinion formation. Here we propose an extension for this model, in which conflicts are resolved by obtaining another opinion, and analytically study the time required for consensus to emerge. Our results shed light on the rich phenomenology of both the original and extended adaptive voter models, including a dynamical phase transition in the scaling behavior of the mean time to consensus.

  20. Globular glial tauopathies (GGT): consensus recommendations

    PubMed Central

    Bigio, Eileen H.; Budka, Herbert; Dickson, Dennis W.; Ferrer, Isidro; Ghetti, Bernardino; Giaccone, Giorgio; Hatanpaa, Kimmo J.; Holton, Janice L.; Josephs, Keith A.; Powers, James; Spina, Salvatore; Takahashi, Hitoshi; White, Charles L.; Revesz, Tamas

    2014-01-01

    Rrecent studies have highlighted a group of 4-repeat (4R) tauopathies that are characterised neuropathologically by widespread, globular glial inclusions (GGIs). Tau immunohistochemistry reveals 4R immunore-active globular oligodendroglial and astrocytic inclusions and the latter are predominantly negative for Gallyas silver staining. These cases are associated with a range of clinical presentations, which correlate with the severity and distribution of underlying tau pathology and neurodegeneration. Their heterogeneous clinicopathological features combined with their rarity and under-recognition have led to cases characterised by GGIs being described in the literature using various and redundant terminologies. In this report, a group of neuropathologists form a consensus on the terminology and classification of cases with GGIs. After studying microscopic images from previously reported cases with suspected GGIs (n = 22), this panel of neuropathologists with extensive experience in the diagnosis of neurodegenerative diseases and a documented record of previous experience with at least one case with GGIs, agreed that (1) GGIs were present in all the cases reviewed; (2) the morphology of globular astrocytic inclusions was different to tufted astrocytes and finally that (3) the cases represented a number of different neuropathological subtypes. They also agreed that the different morphological subtypes are likely to be part of a spectrum of a distinct disease entity, for which they recommend that the overarching term globular glial tauopathy (GGT) should be used. Type I cases typically present with frontotemporal dementia, which correlates with the fronto-temporal distribution of pathology. Type II cases are characterised by pyramidal features reflecting motor cortex involvement and corticospinal tract degeneration. Type III cases can present with a combination of frontotemporal dementia and motor neuron disease with fronto-temporal cortex, motor cortex and

  1. From Arabidopsis thaliana to Brassica napus: development of amplified consensus genetic markers (ACGM) for construction of a gene map.

    PubMed

    Fourmann, M.; Barret, P.; Froger, N.; Baron, C.; Charlot, F.; Delourme, R.; Brunel, D.

    2002-12-01

    The evolution of genomes can be studied by comparing maps of homologous genes which show changes in nucleic acid sequences and chromosome rearrangements. In this study, we developed a set of 32 amplified consensus gene markers (ACGMs) that amplified gene sequences from Arabidopsis thaliana and Brassica napus. Our methodology, based on PCR, facilitated the rapid sequencing of homologous genes from various species of the same phylogenetic family and the detection of intragenic polymorphism. We found that such polymorphism principally concerned intron sequences and we used it to attribute a Brassica oleracea or Brassica rapa origin to the B. napus sequences and to map 43 rapeseed genes. We confirm that the genetic position of homologous genes varied between B. napus and A. thaliana. ACGMs are a useful tool for genome evolution studies and for the further development of single nucleotide polymorphism suitable for use in genetic mapping and genetic diversity analyses.

  2. A consensus opinion model based on the evolutionary game

    NASA Astrophysics Data System (ADS)

    Yang, Han-Xin

    2016-08-01

    We propose a consensus opinion model based on the evolutionary game. In our model, both of the two connected agents receive a benefit if they have the same opinion, otherwise they both pay a cost. Agents update their opinions by comparing payoffs with neighbors. The opinion of an agent with higher payoff is more likely to be imitated. We apply this model in scale-free networks with tunable degree distribution. Interestingly, we find that there exists an optimal ratio of cost to benefit, leading to the shortest consensus time. Qualitative analysis is obtained by examining the evolution of the opinion clusters. Moreover, we find that the consensus time decreases as the average degree of the network increases, but increases with the noise introduced to permit irrational choices. The dependence of the consensus time on the network size is found to be a power-law form. For small or larger ratio of cost to benefit, the consensus time decreases as the degree exponent increases. However, for moderate ratio of cost to benefit, the consensus time increases with the degree exponent. Our results may provide new insights into opinion dynamics driven by the evolutionary game theory.

  3. Oligonucleotide Sequence Motifs as Nucleosome Positioning Signals

    PubMed Central

    Collings, Clayton K.; Fernandez, Alfonso G.; Pitschka, Chad G.; Hawkins, Troy B.; Anderson, John N.

    2010-01-01

    To gain a better understanding of the sequence patterns that characterize positioned nucleosomes, we first performed an analysis of the periodicities of the 256 tetranucleotides in a yeast genome-wide library of nucleosomal DNA sequences that was prepared by in vitro reconstitution. The approach entailed the identification and analysis of 24 unique tetranucleotides that were defined by 8 consensus sequences. These consensus sequences were shown to be responsible for most if not all of the tetranucleotide and dinucleotide periodicities displayed by the entire library, demonstrating that the periodicities of dinucleotides that characterize the yeast genome are, in actuality, due primarily to the 8 consensus sequences. A novel combination of experimental and bioinformatic approaches was then used to show that these tetranucleotides are important for preferred formation of nucleosomes at specific sites along DNA in vitro. These results were then compared to tetranucleotide patterns in genome-wide in vivo libraries from yeast and C. elegans in order to assess the contributions of DNA sequence in the control of nucleosome residency in the cell. These comparisons revealed striking similarities in the tetranucleotide occurrence profiles that are likely to be involved in nucleosome positioning in both in vitro and in vivo libraries, suggesting that DNA sequence is an important factor in the control of nucleosome placement in vivo. However, the strengths of the tetranucleotide periodicities were 3–4 fold higher in the in vitro as compared to the in vivo libraries, which implies that DNA sequence plays less of a role in dictating nucleosome positions in vivo. The results of this study have important implications for models of sequence-dependent positioning since they suggest that a defined subset of tetranucleotides is involved in preferred nucleosome occupancy and that these tetranucleotides are the major source of the dinucleotide periodicities that are characteristic of

  4. Towards a European consensus for reporting incidental findings during clinical NGS testing.

    PubMed

    Hehir-Kwa, Jayne Y; Claustres, Mireille; Hastings, Ros J; van Ravenswaaij-Arts, Conny; Christenhusz, Gabrielle; Genuardi, Maurizio; Melegh, Béla; Cambon-Thomsen, Anne; Patsalis, Philippos; Vermeesch, Joris; Cornel, Martina C; Searle, Beverly; Palotie, Aarno; Capoluongo, Ettore; Peterlin, Borut; Estivill, Xavier; Robinson, Peter N

    2015-12-01

    In 2013, the American College of Medical Genetics (ACMG) examined the issue of incidental findings in whole exome and whole genome sequencing, and introduced recommendations to search for, evaluate and report medically actionable variants in a set of 56 genes. At a debate held during the 2014 European Society for Human Genetics Conference (ESHG) in Milan, Italy, the first author of that paper presented this view in a debate session that did not end with a conclusive vote from the mainly European audience for or against reporting back actionable incidental findings. In this meeting report, we elaborate on the discussions held during a special meeting hosted at the ESHG in 2013 from posing the question 'How to reach a (European) consensus on reporting incidental findings and unclassified variants in diagnostic next generation sequencing'. We ask whether an European consensus exists on the reporting of incidental findings in genome diagnostics, and present a series of key issues that require discussion at both a national and European level in order to develop recommendations for handling incidental findings and unclassified variants in line with the legal and cultural particularities of individual European member states.

  5. Immunization with a consensus epitope from Human Papillomavirus L2 induces antibodies that are broadly neutralizing

    PubMed Central

    Tyler, Mitchell; Tumban, Ebenezer; Dziduszko, Agnieszka; Ozbun, Michelle A.; Peabody, David S.; Chackerian, Bryce

    2014-01-01

    Vaccines targeting conserved epitopes in the HPV minor capsid protein, L2, can elicit antibodies that can protect against a broad spectrum of HPV types that are associated with cervical cancer and other HPV malignancies. Thus, L2 vaccines have been explored as alternatives to the current HPV vaccines, which are largely type-specific. In this study we assessed the immunogenicity of peptides spanning the N-terminal domain of L2 linked to the surface of a highly immunogenic bacteriophage virus-like particle (VLP) platform. Although all of the HPV16 L2 peptide-displaying VLPs elicited high-titer anti-peptide antibody responses, only a subset of the immunogens elicited antibody responses that were strongly protective from HPV16 pseudovirus (PsV) infection in a mouse genital challenge model. One of these peptides, mapping to HPV16 L2 amino acids 65–85, strongly neutralized HPV16 PsV but showed little ability to cross-neutralize other high-risk HPV types. In an attempt to broaden the protection generated through vaccination with this peptide, we immunized mice with VLPs displaying a peptide that represented a consensus sequence from high-risk and other HPV types. Vaccinated mice produced antibodies with broad, high-titer neutralizing activity against all of the HPV types that we tested. Therefore, immunization with virus-like particles displaying a consensus HPV sequence is an effective method to broaden neutralizing antibody responses against a type-specific epitope. PMID:24962748

  6. QPSO-MD: A Quantum Behaved Particle Swarm Optimization for Consensus Pattern Identification

    NASA Astrophysics Data System (ADS)

    Meshoul, Souham; Al-Owaisheq, Tasneem

    Particle Swarm Optimization (PSO) has been successfully applied to a wide range of fields. The recent introduction of quantum mechanics principles into PSO has given rise to a Quantum behaviour PSO (QPSO) algorithm. This paper investigates its application into motif discovery, a challenging task in bioinformatics and molecular biology. Given a set of input DNA sequences, the proposed framework acts as a search process where a population of particles is depicted by a quantum behavior. Each particle represents a set of regulatory patterns from which a consensus pattern or motif model is derived. The corresponding fitness function is related to the total number of pairwise matches between nucleotides in the input sequences. Experiment results on synthetic and real data are very promising and prove the effectiveness of the proposed framework.

  7. Enterobacterial repetitive intergenic consensus 1R PCR assay for detection of Raoultella sp. isolates among strains identified as Klebsiella oxytoca in the clinical laboratory.

    PubMed

    Granier, Sophie A; Leflon-Guibout, Véronique; Goldstein, Fred W; Nicolas-Chanoine, Marie-Hélène

    2003-04-01

    The enterobacterial repetitive intergenic consensus 1R PCR method, which provided recognizable profiles for reference strains of the three species of Raoultella and the two genetic groups of Klebsiella oxytoca, was applied to 19 clinical isolates identified as K. oxytoca. By this method, as confirmed by species-specific gene sequencing, two Raoultella ornithinolytica and two unclassifiable K. oxytoca isolates were identified.

  8. 2014 consensus statement from the first Economics of Physical Inactivity Consensus (EPIC) conference (Vancouver).

    PubMed

    Davis, Jennifer C; Verhagen, Evert; Bryan, Stirling; Liu-Ambrose, Teresa; Borland, Jeff; Buchner, David; Hendriks, Marike R C; Weiler, Richard; Morrow, James R; van Mechelen, Willem; Blair, Steven N; Pratt, Mike; Windt, Johann; al-Tunaiji, Hashel; Macri, Erin; Khan, Karim M

    2014-06-01

    This article describes major topics discussed from the 'Economics of Physical Inactivity Consensus Workshop' (EPIC), held in Vancouver, Canada, in April 2011. Specifically, we (1) detail existing evidence on effective physical inactivity prevention strategies; (2) introduce economic evaluation and its role in health policy decisions; (3) discuss key challenges in establishing and building health economic evaluation evidence (including accurate and reliable costs and clinical outcome measurement) and (4) provide insight into interpretation of economic evaluations in this critically important field. We found that most methodological challenges are related to (1) accurately and objectively valuing outcomes; (2) determining meaningful clinically important differences in objective measures of physical inactivity; (3) estimating investment and disinvestment costs and (4) addressing barriers to implementation. We propose that guidelines specific for economic evaluations of physical inactivity intervention studies are developed to ensure that related costs and effects are robustly, consistently and accurately measured. This will also facilitate comparisons among future economic evidence.

  9. Building of multilevel stakeholder consensus in radioactive waste repository siting

    SciTech Connect

    Dreimanis, A.

    2007-07-01

    This report considers the problem of multilevel consensus building for siting and construction of shared multinational/regional repositories for radioactive waste (RW) deep disposal. In the siting of a multinational repository there appears an essential innovative component of stakeholder consensus building, namely: to reach consent - political, social, economic, ecological - among international partners, in addition to solving the whole set of intra-national consensus building items. An entire partnering country is considered as a higher-level stakeholder - the national stakeholder, represented by the national government, being faced to simultaneous seeking an upward (international) and a downward (intra-national) consensus in a psychologically stressed environment, possibly being characterized by diverse political, economic and social interests. The following theses as a possible interdisciplinary approach towards building of shared understanding and stakeholder consensus on the international scale of RW disposal are forwarded and developed: a) building of international stakeholder consensus would be promoted by activating and diversifying on the international scale multilateral interactions between intra- and international stakeholders, including web-based networks of the RW disposal site investigations and decision-making, as well as networks for international cooperation among government authorities in nuclear safety, b) gradual progress in intergovernmental consensus and reaching multilateral agreements on shared deep repositories will be the result of democratic dialogue, via observing the whole set of various interests and common resolving of emerged controversies by using advanced synergetic approaches of conflict resolution, c) cross-cultural thinking and world perception, mental flexibility, creativity and knowledge are considered as basic prerogatives for gaining a higher level of mutual understanding and consensus for seeking further consensus, for

  10. Characterization of insertion sequence IS892 and related elements from the cyanobacterium Anabaena sp. strain PCC 7120

    SciTech Connect

    Yuping Cai )

    1991-09-01

    IS892, one of the several insertion sequence (IS) elements discovered in Anabaena sp. strain PCC 7120, is 1,675 bp with 24-bp near-perfect inverted terminal repeats and has two open reading frames (ORFs) that could code for proteins of 233 and 137 amino acids. Upon insertion into target sites, this IS generated an 8-bp directly repeated target duplication. A 32-bp sequence in the region between ORF1 and ORF2 is similar to the sequence of the inverted termini. Similar inverted repeats are found within each of those three segments, and the sequences of these repeats bear some similarity to the 11-bp direct repeats flanking the 11-kb insertion interrupting the nifD gene of this strain. A sequence similar to that of a binding site for the Escherichia coli integration host factor is found about 120 bp from the left end of IS892. Partial nucleotide sequences of active IS elements IS 892N and IS892T, members of the IS892 family from the same Anabaena strain, were shown to be very similar to the sequence of IS892.

  11. The ConsensusPathDB interaction database: 2013 update.

    PubMed

    Kamburov, Atanas; Stelzl, Ulrich; Lehrach, Hans; Herwig, Ralf

    2013-01-01

    Knowledge of the various interactions between molecules in the cell is crucial for understanding cellular processes in health and disease. Currently available interaction databases, being largely complementary to each other, must be integrated to obtain a comprehensive global map of the different types of interactions. We have previously reported the development of an integrative interaction database called ConsensusPathDB (http://ConsensusPathDB.org) that aims to fulfill this task. In this update article, we report its significant progress in terms of interaction content and web interface tools. ConsensusPathDB has grown mainly due to the integration of 12 further databases; it now contains 215 541 unique interactions and 4601 pathways from overall 30 databases. Binary protein interactions are scored with our confidence assessment tool, IntScore. The ConsensusPathDB web interface allows users to take advantage of these integrated interaction and pathway data in different contexts. Recent developments include pathway analysis of metabolite lists, visualization of functional gene/metabolite sets as overlap graphs, gene set analysis based on protein complexes and induced network modules analysis that connects a list of genes through various interaction types. To facilitate the interactive, visual interpretation of interaction and pathway data, we have re-implemented the graph visualization feature of ConsensusPathDB using the Cytoscape.js library.

  12. Weighted voting-based consensus clustering for chemical structure databases.

    PubMed

    Saeed, Faisal; Ahmed, Ali; Shamsir, Mohd Shahir; Salim, Naomie

    2014-06-01

    The cluster-based compound selection is used in the lead identification process of drug discovery and design. Many clustering methods have been used for chemical databases, but there is no clustering method that can obtain the best results under all circumstances. However, little attention has been focused on the use of combination methods for chemical structure clustering, which is known as consensus clustering. Recently, consensus clustering has been used in many areas including bioinformatics, machine learning and information theory. This process can improve the robustness, stability, consistency and novelty of clustering. For chemical databases, different consensus clustering methods have been used including the co-association matrix-based, graph-based, hypergraph-based and voting-based methods. In this paper, a weighted cumulative voting-based aggregation algorithm (W-CVAA) was developed. The MDL Drug Data Report (MDDR) benchmark chemical dataset was used in the experiments and represented by the AlogP and ECPF_4 descriptors. The results from the clustering methods were evaluated by the ability of the clustering to separate biologically active molecules in each cluster from inactive ones using different criteria, and the effectiveness of the consensus clustering was compared to that of Ward's method, which is the current standard clustering method in chemoinformatics. This study indicated that weighted voting-based consensus clustering can overcome the limitations of the existing voting-based methods and improve the effectiveness of combining multiple clusterings of chemical structures. PMID:24830925

  13. Big cat phylogenies, consensus trees, and computational thinking.

    PubMed

    Sul, Seung-Jin; Williams, Tiffani L

    2011-07-01

    Phylogenetics seeks to deduce the pattern of relatedness between organisms by using a phylogeny or evolutionary tree. For a given set of organisms or taxa, there may be many evolutionary trees depicting how these organisms evolved from a common ancestor. As a result, consensus trees are a popular approach for summarizing the shared evolutionary relationships in a group of trees. We examine these consensus techniques by studying how the pantherine lineage of cats (clouded leopard, jaguar, leopard, lion, snow leopard, and tiger) evolved, which is hotly debated. While there are many phylogenetic resources that describe consensus trees, there is very little information, written for biologists, regarding the underlying computational techniques for building them. The pantherine cats provide us with a small, relevant example to explore the computational techniques (such as sorting numbers, hashing functions, and traversing trees) for constructing consensus trees. Our hope is that life scientists enjoy peeking under the computational hood of consensus tree construction and share their positive experiences with others in their community.

  14. Expert Consensus Panel Guidelines on Geriatric Assessment in Oncology

    PubMed Central

    O'Donovan, A.; Mohile, S.G.; Leech, M.

    2015-01-01

    Introduction Despite consensus guidelines on best practice in the care of older patients with cancer, geriatric assessment (GA) has yet to be optimally integrated into the field of oncology in most countries. There is a relative lack of consensus in the published literature as to the best approach to take, and there is a degree of uncertainty as to how integration of geriatric medicine principles might optimally predict patient outcomes. The aim of the current study was to obtain consensus on GA in oncology to inform the implementation of a geriatric oncology programme. Methods A four round Delphi process was employed. The Delphi method is a structured group facilitation process, using multiple iterations in order to gain consensus on a given topic Results Consensus was reached on the optimal assessment method and interventions required for the commonly employed domains of GA. Other aspects of GA, such as screening methods and age cutoff for assessment represented a higher degree of disagreement. Discussion The expert panel employed in this study clearly identified the criteria that should be included in a clinical geriatric oncology programme. In the absence of evidence-based guidelines, this may prove useful in the care of older cancer patients. PMID:25757457

  15. Consensus collaboration enhances group and individual recall accuracy.

    PubMed

    Harris, Celia B; Barnier, Amanda J; Sutton, John

    2012-01-01

    We often remember in groups, yet research on collaborative recall finds "collaborative inhibition": Recalling with others has costs compared to recalling alone. In related paradigms, remembering with others introduces errors into recall. We compared costs and benefits of two collaboration procedures--turn taking and consensus. First, 135 individuals learned a word list and recalled it alone (Recall 1). Then, 45 participants in three-member groups took turns to recall, 45 participants in three-member groups reached a consensus, and 45 participants recalled alone but were analysed as three-member nominal groups (Recall 2). Finally, all participants recalled alone (Recall 3). Both turn-taking and consensus groups demonstrated the usual pattern of costs during collaboration and benefits after collaboration in terms of recall completeness. However, consensus groups, and not turn-taking groups, demonstrated clear benefits in terms of recall accuracy, both during and after collaboration. Consensus groups engaged in beneficial group source-monitoring processes. Our findings challenge assumptions about the negative consequences of social remembering.

  16. Big cat phylogenies, consensus trees, and computational thinking.

    PubMed

    Sul, Seung-Jin; Williams, Tiffani L

    2011-07-01

    Phylogenetics seeks to deduce the pattern of relatedness between organisms by using a phylogeny or evolutionary tree. For a given set of organisms or taxa, there may be many evolutionary trees depicting how these organisms evolved from a common ancestor. As a result, consensus trees are a popular approach for summarizing the shared evolutionary relationships in a group of trees. We examine these consensus techniques by studying how the pantherine lineage of cats (clouded leopard, jaguar, leopard, lion, snow leopard, and tiger) evolved, which is hotly debated. While there are many phylogenetic resources that describe consensus trees, there is very little information, written for biologists, regarding the underlying computational techniques for building them. The pantherine cats provide us with a small, relevant example to explore the computational techniques (such as sorting numbers, hashing functions, and traversing trees) for constructing consensus trees. Our hope is that life scientists enjoy peeking under the computational hood of consensus tree construction and share their positive experiences with others in their community. PMID:21563975

  17. Scalable distributed consensus to support MPI fault tolerance.

    SciTech Connect

    Buntinas, D.

    2011-01-01

    As system sizes increase, the amount of time in which an application can run without experiencing a failure decreases. Exascale applications will need to address fault tolerance. In order to support algorithm-based fault tolerance, communication libraries will need to provide fault-tolerance features to the application. One important fault-tolerance operation is distributed consensus. This is used, for example, to collectively decide on a set of failed processes. This paper describes a scalable, distributed consensus algorithm that is used to support new MPI fault-tolerance features proposed by the MPI 3 Forum's fault-tolerance working group. The algorithm was implemented and evaluated on a 4,096-core Blue Gene/P. The implementation was able to perform a full-scale distributed consensus in 305 {mu}s and scaled logarithmically.

  18. Consensus Conference on Clinical Management of pediatric Atopic Dermatitis.

    PubMed

    Galli, Elena; Neri, Iria; Ricci, Giampaolo; Baldo, Ermanno; Barone, Maurizio; Belloni Fortina, Anna; Bernardini, Roberto; Berti, Irene; Caffarelli, Carlo; Calamelli, Elisabetta; Capra, Lucetta; Carello, Rossella; Cipriani, Francesca; Comberiati, Pasquale; Diociaiuti, Andrea; El Hachem, Maya; Fontana, Elena; Gruber, Michaela; Haddock, Ellen; Maiello, Nunzia; Meglio, Paolo; Patrizi, Annalisa; Peroni, Diego; Scarponi, Dorella; Wielander, Ingrid; Eichenfield, Lawrence F

    2016-01-01

    The Italian Consensus Conference on clinical management of atopic dermatitis in children reflects the best and most recent scientific evidence, with the aim to provide specialists with a useful tool for managing this common, but complex clinical condition. Thanks to the contribution of experts in the field and members of the Italian Society of Pediatric Allergology and Immunology (SIAIP) and the Italian Society of Pediatric Dermatology (SIDerP), this Consensus statement integrates the basic principles of the most recent guidelines for the management of atopic dermatitis to facilitate a practical approach to the disease. The therapeutical approach should be adapted to the clinical severity and requires a tailored strategy to ensure good compliance by children and their parents. In this Consensus, levels and models of intervention are also enriched by the Italian experience to facilitate a practical approach to the disease.

  19. Neural mechanisms underlying human consensus decision-making

    PubMed Central

    Suzuki, Shinsuke; Adachi, Ryo; Dunne, Simon; Bossaerts, Peter; O'Doherty, John P.

    2015-01-01

    SUMMARY Consensus building in a group is a hallmark of animal societies, yet little is known about its underlying computational and neural mechanisms. Here, we applied a novel computational framework to behavioral and fMRI data from human participants performing a consensus decision-making task with up to five other participants. We found that participants reached consensus decisions through integrating their own preferences with information about the majority of group-members’ prior choices, as well as inferences about how much each option was stuck to by the other people. These distinct decision variables were separately encoded in distinct brain areas: the ventromedial prefrontal cortex, posterior superior temporal sulcus/temporoparietal junction and intraparietal sulcus, and were integrated in the dorsal anterior cingulate cortex. Our findings provide support for a theoretical account in which collective decisions are made through integrating multiple types of inference about oneself, others and environments, processed in distinct brain modules. PMID:25864634

  20. The importance of assessing and communicating scientific consensus

    NASA Astrophysics Data System (ADS)

    Maibach, Edward W.; van der Linden, Sander L.

    2016-09-01

    The spread of influential misinformation, such as conspiracy theories about the existence of a secret, large-scale atmospheric spraying program (SLAP), is contributing to the politicization of science. In an important recent study, Shearer et al (2016 Environ. Res. Lett. 11 084011) employ a novel methodology to quantify the expert consensus of popular SLAP assertions. The authors find that 99% (76/77) of surveyed experts have not encountered any evidence that would support the existence of such a program. Here we argue that this finding is important because a growing body of research has shown that the public’s perception of expert consensus on key societal issues acts an important ‘gateway’ to science acceptance. Furthermore, communicating normative agreement among experts, such as the strong scientific consensus against the existence of a SLAP, can help limit the spread of misinformation and promote more effective public decision-making about science and society.

  1. Cultural Consensus Theory: Aggregating Continuous Responses in a Finite Interval

    NASA Astrophysics Data System (ADS)

    Batchelder, William H.; Strashny, Alex; Romney, A. Kimball

    Cultural consensus theory (CCT) consists of cognitive models for aggregating responses of "informants" to test items about some domain of their shared cultural knowledge. This paper develops a CCT model for items requiring bounded numerical responses, e.g. probability estimates, confidence judgments, or similarity judgments. The model assumes that each item generates a latent random representation in each informant, with mean equal to the consensus answer and variance depending jointly on the informant and the location of the consensus answer. The manifest responses may reflect biases of the informants. Markov Chain Monte Carlo (MCMC) methods were used to estimate the model, and simulation studies validated the approach. The model was applied to an existing cross-cultural dataset involving native Japanese and English speakers judging the similarity of emotion terms. The results sharpened earlier studies that showed that both cultures appear to have very similar cognitive representations of emotion terms.

  2. Stem cell research ethics: consensus statement on emerging issues.

    PubMed

    Caulfield, Timothy; Ogbogu, Ubaka; Nelson, Erin; Einsiedel, Edna; Knoppers, Bartha; McDonald, Michael; Brunger, Fern; Downey, Robin; Fernando, Kanchana; Galipeau, Jacques; Geransar, Rose; Griener, Glenn; Grenier, Glenn; Hyun, Insoo; Isasi, Rosario; Kardel, Melanie; Knowles, Lori; Kucic, Terrence; Lotjonen, Salla; Lyall, Drew; Magnus, David; Mathews, Debra J H; Nisbet, Matthew; Nisker, Jeffrey; Pare, Guillaume; Pattinson, Shaun; Pullman, Daryl; Rudnicki, Michael; Williams-Jones, Bryn; Zimmerman, Susan

    2007-10-01

    This article is a consensus statement by an international interdisciplinary group of academic experts and Canadian policy-makers on emerging ethical, legal and social issues in human embryonic stem cells (hESC) research in Canada. The process of researching consensus included consultations with key stakeholders in hESC research (regulations, stem cell researchers, and research ethics experts), preparation and distribution of background papers, and an international workshop held in Montreal in February 2007 to discuss the papers and debate recommendations. The recommendations provided in the consensus statement focus on issues of immediate relevance to Canadian policy-makers, including informed consent to hESC research, the use of fresh embryos in research, management of conflicts of interest, and the relevance of public opinion research to policy-making.

  3. Climate Consensus and `Misinformation': A Rejoinder to Agnotology, Scientific Consensus, and the Teaching and Learning of Climate Change

    NASA Astrophysics Data System (ADS)

    Legates, David R.; Soon, Willie; Briggs, William M.; Monckton of Brenchley, Christopher

    2015-04-01

    Agnotology is the study of how ignorance arises via circulation of misinformation calculated to mislead. Legates et al. (Sci Educ 22:2007-2017, 2013) had questioned the applicability of agnotology to politically-charged debates. In their reply, Bedford and Cook (Sci Educ 22:2019-2030, 2013), seeking to apply agnotology to climate science, asserted that fossil-fuel interests had promoted doubt about a climate consensus. Their definition of climate `misinformation' was contingent upon the post-modernist assumptions that scientific truth is discernible by measuring a consensus among experts, and that a near unanimous consensus exists. However, inspection of a claim by Cook et al. (Environ Res Lett 8:024024, 2013) of 97.1 % consensus, heavily relied upon by Bedford and Cook, shows just 0.3 % endorsement of the standard definition of consensus: that most warming since 1950 is anthropogenic. Agnotology, then, is a two-edged sword since either side in a debate may claim that general ignorance arises from misinformation allegedly circulated by the other. Significant questions about anthropogenic influences on climate remain. Therefore, Legates et al. appropriately asserted that partisan presentations of controversies stifle debate and have no place in education.

  4. Consensus Conference on North American Training in Hepatopancreaticobiliary Surgery: A Review of the Conference and Presentation of Consensus Statements.

    PubMed

    Jeyarajah, D R; Berman, R S; Doyle, M B; Geevarghese, S K; Posner, M C; Farmer, D; Minter, R M

    2016-04-01

    The findings and recommendations of the North American consensus conference on training in hepatopancreaticobiliary (HPB) surgery held in October 2014 are presented. The conference was hosted by the Society for Surgical Oncology (SSO), the Americas Hepato-Pancreatico-Biliary Association (AHPBA), and the American Society of Transplant Surgeons (ASTS). The current state of training in HPB surgery in North America was defined through three pathways-HPB, surgical oncology, and solid organ transplant fellowships. Consensus regarding programmatic requirements included establishment of minimum case volumes and inclusion of quality metrics. Formative assessment, using milestones as a framework and inclusive of both operative and nonoperative skills, must be present. Specific core HPB cases should be defined and used for evaluation of operative skills. The conference concluded with a focus on the optimal means to perform summative assessment to evaluate the individual fellow completing a fellowship in HPB surgery. Presentations from the hospital perspective and the American Board of Surgery led to consensus that summative assessment was desired by the public and the hospital systems and should occur in a uniform but possibly modular manner for all HPB fellowship pathways. A task force composed of representatives of the SSO, AHPBA, and ASTS are charged with implementation of the consensus statements emanating from this consensus conference. PMID:26928942

  5. IncobotulinumtoxinA in aesthetics: Russian multidisciplinary expert consensus recommendations

    PubMed Central

    Yutskovskaya, Yana; Gubanova, Elena; Khrustaleva, Irina; Atamanov, Vasiliy; Saybel, Anastasiya; Parsagashvili, Elena; Dmitrieva, Irina; Sanchez, Elena; Lapatina, Natalia; Korolkova, Tatiana; Saromytskaya, Alena; Goltsova, Elena; Satardinova, Elmira

    2015-01-01

    Background Although there are various international consensus recommendations on the use of botulinum neurotoxin type A (BoNT/A) in facial aesthetics, there are no global or Russian guidelines on the optimal dose of incobotulinumtoxinA, free from complexing proteins, within specific aesthetic indications. This article reports the outcomes of two expert consensus meetings, conducted to review and analyze efficacy and tolerability data for incobotulinumtoxinA in various facial aesthetic indications and to give expert consensus recommendations to ensure best clinical practice among Russian clinicians. Methods Thirteen dermatology and/or plastic surgery experts attended meetings held in Paris, France (November 2013), and Moscow, Russia (March 2014). The expert group reviewed and analyzed the existing evidence, consensus recommendations, and Russian experts’ extensive practical experience of incobotulinumtoxinA in aesthetics to reach consensus on optimal doses, potential dose adjustments, and injection sites of incobotulinumtoxinA for facial aesthetics. Results All experts developed guidance on the optimal doses for incobotulinumtoxinA treatment of different regions of the upper and lower face. The expert panel agreed that there are no differences in the efficacy and duration of the effect between the four BoNT/As that are commercially available for facial aesthetic indications in Russia and that, when administered correctly, all BoNT/As can achieve optimal results. Experts also agreed that nonresponse to BoNT/A can be caused by neutralizing antibodies. Conclusion On the basis of the scientific and clinical evidence available for incobotulinumtoxinA, coupled with the extensive clinical experience of the consensus group, experts recommended the optimal doses of incobotulinumtoxinA effective for treatment of wrinkles of the upper and lower face to achieve the expected aesthetic outcome. These first Russian guidelines on the optimal use of incobotulinumtoxinA for

  6. Kyoto global consensus report on Helicobacter pylori gastritis

    PubMed Central

    Sugano, Kentaro; Tack, Jan; Kuipers, Ernst J; Graham, David Y; El-Omar, Emad M; Miura, Soichiro; Haruma, Ken; Asaka, Masahiro; Uemura, Naomi; Malfertheiner, Peter

    2015-01-01

    Objective To present results of the Kyoto Global Consensus Meeting, which was convened to develop global consensus on (1) classification of chronic gastritis and duodenitis, (2) clinical distinction of dyspepsia caused by Helicobacter pylori from functional dyspepsia, (3) appropriate diagnostic assessment of gastritis and (4) when, whom and how to treat H. pylori gastritis. Design Twenty-three clinical questions addressing the above-mentioned four domains were drafted for which expert panels were asked to formulate relevant statements. A Delphi method using an anonymous electronic system was adopted to develop the consensus, the level of which was predefined as ≥80%. Final modifications of clinical questions and consensus were achieved at the face-to-face meeting in Kyoto. Results All 24 statements for 22 clinical questions after extensive modifications and omission of one clinical question were achieved with a consensus level of >80%. To better organise classification of gastritis and duodenitis based on aetiology, a new classification of gastritis and duodenitis is recommended for the 11th international classification. A new category of H. pylori-associated dyspepsia together with a diagnostic algorithm was proposed. The adoption of grading systems for gastric cancer risk stratification, and modern image-enhancing endoscopy for the diagnosis of gastritis, were recommended. Treatment to eradicate H. pylori infection before preneoplastic changes develop, if feasible, was recommended to minimise the risk of more serious complications of the infection. Conclusions A global consensus for gastritis was developed for the first time, which will be the basis for an international classification system and for further research on the subject. PMID:26187502

  7. Integration Preferences of Wildtype AAV-2 for Consensus Rep-Binding Sites at Numerous Loci in the Human Genome

    PubMed Central

    Hüser, Daniela; Gogol-Döring, Andreas; Lutter, Timo; Weger, Stefan; Winter, Kerstin; Hammer, Eva-Maria; Cathomen, Toni; Reinert, Knut; Heilbronn, Regine

    2010-01-01

    Adeno-associated virus type 2 (AAV) is known to establish latency by preferential integration in human chromosome 19q13.42. The AAV non-structural protein Rep appears to target a site called AAVS1 by simultaneously binding to Rep-binding sites (RBS) present on the AAV genome and within AAVS1. In the absence of Rep, as is the case with AAV vectors, chromosomal integration is rare and random. For a genome-wide survey of wildtype AAV integration a linker-selection-mediated (LSM)-PCR strategy was designed to retrieve AAV-chromosomal junctions. DNA sequence determination revealed wildtype AAV integration sites scattered over the entire human genome. The bioinformatic analysis of these integration sites compared to those of rep-deficient AAV vectors revealed a highly significant overrepresentation of integration events near to consensus RBS. Integration hotspots included AAVS1 with 10% of total events. Novel hotspots near consensus RBS were identified on chromosome 5p13.3 denoted AAVS2 and on chromsome 3p24.3 denoted AAVS3. AAVS2 displayed seven independent junctions clustered within only 14 bp of a consensus RBS which proved to bind Rep in vitro similar to the RBS in AAVS3. Expression of Rep in the presence of rep-deficient AAV vectors shifted targeting preferences from random integration back to the neighbourhood of consensus RBS at hotspots and numerous additional sites in the human genome. In summary, targeted AAV integration is not as specific for AAVS1 as previously assumed. Rather, Rep targets AAV to integrate into open chromatin regions in the reach of various, consensus RBS homologues in the human genome. PMID:20628575

  8. Fibroids in infertility--consensus statement from ACCEPT (Australasian CREI Consensus Expert Panel on Trial evidence).

    PubMed

    Kroon, Ben; Johnson, Neil; Chapman, Michael; Yazdani, Anusch; Hart, Roger

    2011-08-01

    Fibroid management is surrounded by considerable controversy and uncertainty. This paper summarises the consensus developed by a group of Australasian subspecialists in reproductive endocrinology and infertility (the ACCEPT group) on the evidence concerning the impact and management of fibroids in infertility. The location of a fibroid within the uterus influences its effect on fertility. Subserosal fibroids do not appear to impact on fertility outcomes. Intramural (IM) fibroids may be associated with reduced fertility and an increased miscarriage rate (MR); however, there is insufficient evidence to inform whether myomectomy for IM fibroids improves fertility outcomes. Submucosal fibroids are associated with reduced fertility and an increased MR, and myomectomy for submucosal fibroids appears likely to improve fertility outcomes. The relative effect of multiple or different sized fibroids on fertility outcomes is uncertain, as is the relative usefulness of myomectomy in these situations. It is recommended that fibroids with suspected cavity involvement are defined by magnetic resonance imaging, sonohysterography or hysteroscopy because modalities such as transvaginal ultrasound and hysterosalpingography lack appropriate sensitivity and specificity. Medical management of fibroids delays efforts to conceive and is not recommended for the management of infertility associated with fibroids. Newer treatments such as uterine artery embolisation, radiofrequency ablation, bilateral uterine artery ligation, magnetic resonance-guided focussed ultrasound surgery and fibroid myolysis require further investigation prior to their establishment in the routine management of fibroid-associated infertility.

  9. Ethics and immunization policy: promoting dialogue to sustain consensus.

    PubMed

    Feudtner, C; Marcuse, E K

    2001-05-01

    The societal consensus that has supported the United States' universal childhood immunization programs for the past 50 years shows signs of eroding. This article proposes a systematic approach to evaluate immunization policy options. Through a unifying framework that combines epidemiologic, economic, and ethical concerns, this approach promotes a clearer understanding of underlying issues and inherent tradeoffs between alternative policies. Such a systematic examination of policy options could facilitate the public dialogue necessary to continually recreate a broad consensus on immunization practices and enable us to choose policies most in accord with our fundamental values.

  10. Effect of group means on the probability of consensus.

    PubMed

    Arima, Yoshiko

    2012-04-01

    In this study, groups who could not reach a consensus were investigated using the group polarization paradigm. The purpose was to explore the conditions leading to intragroup disagreement and attitude change following disagreement among 269 participants. Analysis indicated that the probability of consensus was low when the group means differed from the grand mean of the entire sample. When small differences among group members were found, depolarization (reverse direction of polarization) followed disagreement. These results suggested the groups which deviated most from the population tendency were the most likely to cause within-group disagreement, while within-group variances determined the direction of attitude change following disagreement within the group.

  11. [GEITDAH consensus on conduct disorders in children and adolescents].

    PubMed

    Sasot-Llevadot, Jordi; Ibáñez-Bordas, Rosa M; Soto-López, Antonio; Montañés-Rada, Francisco; Gastaminza-Pérez, Xavier; Alda-Díez, José A; Cantó-Díez, Tomás; Catalá, Miguel A; Ferrin-Erdozáin, Maite; García-Giral, Marta; Graell-Bernal, Montserrat; Granada-Jiménez, Olvido; Herreros-Rodríguez, Óscar; Mardomingo-Sanz, María J; Mojarro-Práxedes, Dolores; Morey-Canyelles, Jaume; Ortiz-Guerra, Juan; Pàmies-Massana, Montserrat; Rey-Sánchez, Francisco; Romera-Torrens, María; Rubio-Morell, Belén; Ruiz-Lázaro, Pedro M; Ruiz-Sanz, Francisco

    2015-08-16

    In this paper, the Special Interest Group on Attention Deficit Hyperactivity Disorder (GEITDAH, from its name in Spanish) presents a consensus reached by experts from all over Spain on conduct disorders in children and adolescents. Following the initial work by the team at the Pedopsychiatry Unit at the Quiron-Teknon Hospital in Barcelona, agreements have been reached on a number of basic aspects that could be the starting point for future consensuses. A top priority aim of the work was also to update the criteria in the Diagnostic and statistical manual of mental disorders, fifth edition, for conduct disorders in children and adolescents, together with their comorbidity with attention deficit hyperactivity disorder.

  12. Diagnosis and complications of Cushing's syndrome: a consensus statement.

    PubMed

    Arnaldi, G; Angeli, A; Atkinson, A B; Bertagna, X; Cavagnini, F; Chrousos, G P; Fava, G A; Findling, J W; Gaillard, R C; Grossman, A B; Kola, B; Lacroix, A; Mancini, T; Mantero, F; Newell-Price, J; Nieman, L K; Sonino, N; Vance, M L; Giustina, A; Boscaro, M

    2003-12-01

    In October 2002, a workshop was held in Ancona, Italy, to reach a Consensus on the management of Cushing's syndrome. The workshop was organized by the University of Ancona and sponsored by the Pituitary Society, the European Neuroendocrine Association, and the Italian Society of Endocrinology. Invited international participants included almost 50 leading endocrinologists with specific expertise in the management of Cushing's syndrome. The consensus statement on diagnostic criteria and the diagnosis and treatment of complications of this syndrome reached at the workshop is hereby summarized.

  13. Eating Disorders: Cultural Model and Consensus Regarding Food.

    PubMed

    Manochio-Pina, Marina; Dos Santos, José Ernesto; Dressler, William W; Pessa Ribeiro, Rosane Pilot

    2015-01-01

    The cultural model of food was applied to 112 adult patients with eating disorders (PG) and 36 healthy adult women (CG) of similar age. The Free List and Ranking of Foods was used to group foods and verify consensus and cultural aspects. Calories, health, and taste were the dimensions used by the participants to group the foods, and strong consensus was achieved in regard to calories and health. There were, however, inter- and intra-group divergences in regard to these ideas, especially in the PG. The CG used distinct criteria, showing a more complex model.

  14. Genomics and Machine Learning for Taxonomy Consensus: The Mycobacterium tuberculosis Complex Paradigm.

    PubMed

    Azé, Jérôme; Sola, Christophe; Zhang, Jian; Lafosse-Marin, Florian; Yasmin, Memona; Siddiqui, Rubina; Kremer, Kristin; van Soolingen, Dick; Refrégier, Guislaine

    2015-01-01

    Infra-species taxonomy is a prerequisite to compare features such as virulence in different pathogen lineages. Mycobacterium tuberculosis complex taxonomy has rapidly evolved in the last 20 years through intensive clinical isolation, advances in sequencing and in the description of fast-evolving loci (CRISPR and MIRU-VNTR). On-line tools to describe new isolates have been set up based on known diversity either on CRISPRs (also known as spoligotypes) or on MIRU-VNTR profiles. The underlying taxonomies are largely concordant but use different names and offer different depths. The objectives of this study were 1) to explicit the consensus that exists between the alternative taxonomies, and 2) to provide an on-line tool to ease classification of new isolates. Genotyping (24-VNTR, 43-spacers spoligotypes, IS6110-RFLP) was undertaken for 3,454 clinical isolates from the Netherlands (2004-2008). The resulting database was enlarged with African isolates to include most human tuberculosis diversity. Assignations were obtained using TB-Lineage, MIRU-VNTRPlus, SITVITWEB and an algorithm from Borile et al. By identifying the recurrent concordances between the alternative taxonomies, we proposed a consensus including 22 sublineages. Original and consensus assignations of the all isolates from the database were subsequently implemented into an ensemble learning approach based on Machine Learning tool Weka to derive a classification scheme. All assignations were reproduced with very good sensibilities and specificities. When applied to independent datasets, it was able to suggest new sublineages such as pseudo-Beijing. This Lineage Prediction tool, efficient on 15-MIRU, 24-VNTR and spoligotype data is available on the web interface "TBminer." Another section of this website helps summarizing key molecular epidemiological data, easing tuberculosis surveillance. Altogether, we successfully used Machine Learning on a large dataset to set up and make available the first consensual

  15. Genomics and Machine Learning for Taxonomy Consensus: The Mycobacterium tuberculosis Complex Paradigm

    PubMed Central

    Azé, Jérôme; Sola, Christophe; Zhang, Jian; Lafosse-Marin, Florian; Yasmin, Memona; Siddiqui, Rubina; Kremer, Kristin; van Soolingen, Dick; Refrégier, Guislaine

    2015-01-01

    Infra-species taxonomy is a prerequisite to compare features such as virulence in different pathogen lineages. Mycobacterium tuberculosis complex taxonomy has rapidly evolved in the last 20 years through intensive clinical isolation, advances in sequencing and in the description of fast-evolving loci (CRISPR and MIRU-VNTR). On-line tools to describe new isolates have been set up based on known diversity either on CRISPRs (also known as spoligotypes) or on MIRU-VNTR profiles. The underlying taxonomies are largely concordant but use different names and offer different depths. The objectives of this study were 1) to explicit the consensus that exists between the alternative taxonomies, and 2) to provide an on-line tool to ease classification of new isolates. Genotyping (24-VNTR, 43-spacers spoligotypes, IS6110-RFLP) was undertaken for 3,454 clinical isolates from the Netherlands (2004-2008). The resulting database was enlarged with African isolates to include most human tuberculosis diversity. Assignations were obtained using TB-Lineage, MIRU-VNTRPlus, SITVITWEB and an algorithm from Borile et al. By identifying the recurrent concordances between the alternative taxonomies, we proposed a consensus including 22 sublineages. Original and consensus assignations of the all isolates from the database were subsequently implemented into an ensemble learning approach based on Machine Learning tool Weka to derive a classification scheme. All assignations were reproduced with very good sensibilities and specificities. When applied to independent datasets, it was able to suggest new sublineages such as pseudo-Beijing. This Lineage Prediction tool, efficient on 15-MIRU, 24-VNTR and spoligotype data is available on the web interface “TBminer.” Another section of this website helps summarizing key molecular epidemiological data, easing tuberculosis surveillance. Altogether, we successfully used Machine Learning on a large dataset to set up and make available the first

  16. A high density barley microsatellite consensus map with 775 SSR loci.

    PubMed

    Varshney, R K; Marcel, T C; Ramsay, L; Russell, J; Röder, M S; Stein, N; Waugh, R; Langridge, P; Niks, R E; Graner, A

    2007-04-01

    A microsatellite or simple sequence repeat (SSR) consensus map of barley was constructed by joining six independent genetic maps based on the mapping populations 'Igri x Franka', 'Steptoe x Morex', 'OWB(Rec) x OWB(Dom)', 'Lina x Canada Park', 'L94 x Vada' and 'SusPtrit x Vada'. Segregation data for microsatellite markers from different research groups including SCRI (Bmac, Bmag, EBmac, EBmag, HVGeneName, scsssr), IPK (GBM, GBMS), WUR (GBM), Virginia Polytechnic Institute (HVM), and MPI for Plant Breeding (HVGeneName), generated in above mapping populations, were used in the computer program RECORD to order the markers of the individual linkage data sets. Subsequently, a framework map was constructed for each chromosome by integrating the 496 "bridge markers" common to two or more individual maps with the help of the computer programme JoinMap 3.0. The final map was calculated by following a "neighbours" map approach. The integrated map contained 775 unique microsatellite loci, from 688 primer pairs, ranging from 93 (6H) to 132 (2H) and with an average of 111 markers per linkage group. The genomic DNA-derived SSR marker loci had a higher polymorphism information content value (average 0.61) as compared to the EST/gene-derived SSR loci (average 0.48). The consensus map spans 1,068 cM providing an average density of one SSR marker every 1.38 cM. Such a high-density consensus SSR map provides barley molecular breeding programmes with a better choice regarding the quality of markers and a higher probability of polymorphic markers in an important chromosomal interval. This map also offers the possibilities of thorough alignment for the (future) physical map and implementation in haplotype diversity studies of barley. PMID:17345060

  17. Necessary and sufficient conditions of stationary average consensus for second-order multi-agent systems

    NASA Astrophysics Data System (ADS)

    Pei, Yongquan; Sun, Jitao

    2016-11-01

    This paper investigates the stationary average consensus problem for second-order discrete-time multi-agent systems (SDMAS). A stationary consensus problem is to find a control algorithm that brings the state of a group of agents to a common constant value which is called the collective decision. We introduce the concept of stationary average consensus of SDMAS and propose a consensus algorithm. Based on the polynomial stability and the graph theory, we obtain two necessary and sufficient conditions of stationary average consensus of SDMAS. The last theorem provides an algebraic criterion of stationary average consensus, and can help us to determine the parameters in the consensus algorithm. Furthermore, in this consensus algorithm, only the states of the agents are transferred among the agents. Therefore, this algorithm can not only solve the stationary average consensus problem but also reduce the amount of transferred data. A numerical example is provided to illustrate the efficiency of our results.

  18. Comparison of the backbone dynamics of a natural and a consensus designed 3-TPR domain.

    PubMed

    Jarymowycz, Virginia A; Cortajarena, Aitziber L; Regan, Lynne; Stone, Martin J

    2008-07-01

    The tetratricopeptide repeat (TPR) is a 34-amino acid helix-turn-helix motif that occurs in tandem arrays in numerous proteins. Here we compare the backbone dynamics of a natural 3-repeat TPR domain, from the protein UBP, with the behavior of a designed protein CTPR3, which consists of three identical consensus TPR units. Although the three tandem TPR repeats in both CTPR3 and UBP behave as a single unit, with no evidence of independent repeat motions, the data indicate that certain positions in UBP are significantly more flexible than are the corresponding positions in CTPR3. Most of the dynamical changes occur at or adjacent to positions that are involved in intra-repeat packing interactions. These observations lead us to suggest that the three-TPR domain of UBP does not incorporate optimized packing, compared to that seen in the idealized CTPR. The natural TPR domain is not only less stable overall than CTPR3, but also presents increased local flexibility at the positions where the sequences differs from the conserved consensus.

  19. A Consensus Method for the Prediction of ‘Aggregation-Prone’ Peptides in Globular Proteins

    PubMed Central

    Tsolis, Antonios C.; Papandreou, Nikos C.; Iconomidou, Vassiliki A.; Hamodrakas, Stavros J.

    2013-01-01

    The purpose of this work was to construct a consensus prediction algorithm of ‘aggregation-prone’ peptides in globular proteins, combining existing tools. This allows comparison of the different algorithms and the production of more objective and accurate results. Eleven (11) individual methods are combined and produce AMYLPRED2, a publicly, freely available web tool to academic users (http://biophysics.biol.uoa.gr/AMYLPRED2), for the consensus prediction of amyloidogenic determinants/‘aggregation-prone’ peptides in proteins, from sequence alone. The performance of AMYLPRED2 indicates that it functions better than individual aggregation-prediction algorithms, as perhaps expected. AMYLPRED2 is a useful tool for identifying amyloid-forming regions in proteins that are associated with several conformational diseases, called amyloidoses, such as Altzheimer's, Parkinson's, prion diseases and type II diabetes. It may also be useful for understanding the properties of protein folding and misfolding and for helping to the control of protein aggregation/solubility in biotechnology (recombinant proteins forming bacterial inclusion bodies) and biotherapeutics (monoclonal antibodies and biopharmaceutical proteins). PMID:23326595

  20. Genetic map of artichoke × wild cardoon: toward a consensus map for Cynara cardunculus.

    PubMed

    Sonnante, Gabriella; Gatto, Angela; Morgese, Anita; Montemurro, Francesco; Sarli, Giulio; Blanco, Emanuela; Pignone, Domenico

    2011-11-01

    An integrated consensus linkage map is proposed for globe artichoke. Maternal and paternal genetic maps were constructed on the basis of an F(1) progeny derived from crossing an artichoke genotype (Mola) with its progenitor, the wild cardoon (Tolfa), using EST-derived SSRs, genomic SSRs, AFLPs, ten genes, and two morphological traits. For most genes, mainly belonging to the chlorogenic acid pathway, new markers were developed. Five of these were SNP markers analyzed through high-resolution melt technology. From the maternal (Mola) and paternal (Tolfa) maps, an integrated map was obtained, containing 337 molecular and one morphological markers ordered in 17 linkage groups (LGs), linked between Mola and Tolfa. The integrated map covers 1,488.8 cM, with an average distance of 4.4 cM between markers. The map was aligned with already existing maps for artichoke, and 12 LGs were linked via 31 bridge markers. LG numbering has been proposed. A total of 124 EST-SSRs and two genes were mapped here for the first time, providing a framework for the construction of a functional map in artichoke. The establishment of a consensus map represents a necessary condition to plan a complete sequencing of the globe artichoke genome.

  1. Relevance of Web Documents:Ghosts Consensus Method.

    ERIC Educational Resources Information Center

    Gorbunov, Andrey L.

    2002-01-01

    Discusses how to improve the quality of Internet search systems and introduces the Ghosts Consensus Method which is free from the drawbacks of digital democracy algorithms and is based on linear programming tasks. Highlights include vector space models; determining relevant documents; and enriching query terms. (LRW)

  2. Functional Analysis of HIV/AIDS Stigma: Consensus or Divergence?

    ERIC Educational Resources Information Center

    Hosseinzadeh, Hassan; Hossain, Syeda Zakia

    2011-01-01

    Functional theory proposes that attitudes may serve a variety of purposes for individuals. This study aimed to determine whether stigmatized attitudes toward HIV/AIDS serve the same function for all (consensus function) or serve different functions for different individuals (divergence function) by assessing various aspects of HIV/AIDS stigma…

  3. Position Statements, Issue Briefs, Resolutions and Consensus Statements. Revised

    ERIC Educational Resources Information Center

    National Association of School Nurses (NJ1), 2012

    2012-01-01

    This article presents position statements, issue briefs, and resolutions and consensus statements of the National Association of School Nurses (NASN). The Position Statements include: (1) Allergy/Anaphylaxis Management in the School Setting; (2) Caseload Assignments; (3) Child Mortality in the School Setting; (4) Chronic Health Conditions, Managed…

  4. Ethics & Agenda 21: Moral Implications of a Global Consensus.

    ERIC Educational Resources Information Center

    Brown, Noel J., Ed.; Quiblier, Pierre, Ed.

    At the Earth Summit held at Rio in June 1992, the leaders of more than 170 countries were able to adopt by consensus a common global strategy, an agenda for action, namely Agenda 21, that envisions a future that will be prosperous, equitable, and sustainable. This book contains a collection of essays by leading environmental philosophers,…

  5. 75 FR 70074 - Consensus Standards, Light-Sport Aircraft

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-16

    ... Federal Aviation Administration Consensus Standards, Light-Sport Aircraft AGENCY: Federal Aviation... provisions of the Sport Pilot and Light-Sport Aircraft rule issued July 16, 2004, and effective September 1, 2004. ASTM International Committee F37 on Light Sport Aircraft developed the revised standards...

  6. 76 FR 45647 - Consensus Standards, Light-Sport Aircraft

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-29

    ... revision process. Background: Under the provisions of the Sport Pilot and Light-Sport Aircraft rule, 69 FR... Federal Aviation Administration Consensus Standards, Light-Sport Aircraft AGENCY: Federal Aviation... to the provisions of the Sport Pilot and Light-Sport Aircraft rule issued July 16, 2004,...

  7. 78 FR 35085 - Consensus Standards, Light-Sport Aircraft

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-11

    ... Federal Aviation Administration Consensus Standards, Light-Sport Aircraft AGENCY: Federal Aviation... Light-Sport Aircraft rule issued July 16, 2004, and effective September 1, 2004. ASTM International Committee F37 on Light Sport Aircraft developed the new and revised standards with Federal...

  8. 77 FR 24251 - Consensus Standards, Light-Sport Aircraft

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-23

    ... Federal Aviation Administration Consensus Standards, Light-Sport Aircraft AGENCY: Federal Aviation... and Light-Sport Aircraft rule issued July 16, 2004, and effective September 1, 2004. ASTM International Committee F37 on Light Sport Aircraft developed the new and revised standards with...

  9. Tracking and activity recognition through consensus in distributed camera networks.

    PubMed

    Song, Bi; Kamal, Ahmed T; Soto, Cristian; Ding, Chong; Farrell, Jay A; Roy-Chowdhury, Amit K

    2010-10-01

    Camera networks are being deployed for various applications like security and surveillance, disaster response and environmental modeling. However, there is little automated processing of the data. Moreover, most methods for multicamera analysis are centralized schemes that require the data to be present at a central server. In many applications, this is prohibitively expensive, both technically and economically. In this paper, we investigate distributed scene analysis algorithms by leveraging upon concepts of consensus that have been studied in the context of multiagent systems, but have had little applications in video analysis. Each camera estimates certain parameters based upon its own sensed data which is then shared locally with the neighboring cameras in an iterative fashion, and a final estimate is arrived at in the network using consensus algorithms. We specifically focus on two basic problems-tracking and activity recognition. For multitarget tracking in a distributed camera network, we show how the Kalman-Consensus algorithm can be adapted to take into account the directional nature of video sensors and the network topology. For the activity recognition problem, we derive a probabilistic consensus scheme that combines the similarity scores of neighboring cameras to come up with a probability for each action at the network level. Thorough experimental results are shown on real data along with a quantitative analysis.

  10. International consensus guidance for management of myasthenia gravis

    PubMed Central

    Wolfe, Gil I.; Benatar, Michael; Evoli, Amelia; Gilhus, Nils E.; Illa, Isabel; Kuntz, Nancy; Massey, Janice M.; Melms, Arthur; Murai, Hiroyuki; Nicolle, Michael; Palace, Jacqueline; Richman, David P.; Verschuuren, Jan; Narayanaswami, Pushpa

    2016-01-01

    Objective: To develop formal consensus-based guidance for the management of myasthenia gravis (MG). Methods: In October 2013, the Myasthenia Gravis Foundation of America appointed a Task Force to develop treatment guidance for MG, and a panel of 15 international experts was convened. The RAND/UCLA appropriateness methodology was used to develop consensus guidance statements. Definitions were developed for goals of treatment, minimal manifestations, remission, ocular MG, impending crisis, crisis, and refractory MG. An in-person panel meeting then determined 7 treatment topics to be addressed. Initial guidance statements were developed from literature summaries. Three rounds of anonymous e-mail votes were used to attain consensus on guidance statements modified on the basis of panel input. Results: Guidance statements were developed for symptomatic and immunosuppressive treatments, IV immunoglobulin and plasma exchange, management of impending and manifest myasthenic crisis, thymectomy, juvenile MG, MG associated with antibodies to muscle-specific tyrosine kinase, and MG in pregnancy. Conclusion: This is an international formal consensus of MG experts intended to be a guide for clinicians caring for patients with MG worldwide. PMID:27358333

  11. Facilitating a Faculty Learning Community: Determining Consensus Using Q Methodology

    ERIC Educational Resources Information Center

    Ramlo, Susan

    2011-01-01

    With plans to improve a Technical Report Writing course, writing faculty and engineering technology faculty formed a faculty learning community (FLC). Although discussions were often productive, it was often difficult to gauge consensus and differing views among the group members. In a previous study, Q methodology, a measure of subjectivity, was…

  12. How to Judge a Science Fair. Use the Consensus Method.

    ERIC Educational Resources Information Center

    Levin, Karen Noel; Levin, Robert E.

    1991-01-01

    Discussed is a method for judging science fair projects considered to be more accurate than just an averaging of scores. The use of many categories so that the number of projects in each is relatively small is proposed. The advantages of using the consensus method are described. (KR)

  13. The "Beijing Consensus" and the Chinese Model of University Autonomy

    ERIC Educational Resources Information Center

    Zha, Qiang; Hayhoe, Ruth

    2014-01-01

    This paper attempts to address connections between the Chinese model for development or the "Beijing Consensus" and Chinese universities. Chinese universities seem to be caught between serving governmental agendas and pursuing their own goals as an academic community. Up until recently, they had become used to following the lead of the…

  14. Canadian Athletic Therapists' Association Education Task Force Consensus Statements

    ERIC Educational Resources Information Center

    Lafave, Mark R.; Bergeron, Glen; Klassen, Connie; Parr, Kelly; Valdez, Dennis; Elliott, Jacqueline; Peeler, Jason; Orecchio, Elsa; McKenzie, Kirsty; Streed, Kristin; DeMont, Richard

    2016-01-01

    Context: A published commentary from 2 of the current authors acted as a catalyst for raising some key issues that have arisen in athletic therapy education in Canada over the years. Objective: The purpose of this article is to report on the process followed to establish a number of consensus statements related to postsecondary athletic therapy…

  15. Expert Consensus on Characteristics of Wisdom: A Delphi Method Study

    ERIC Educational Resources Information Center

    Jeste, Dilip V.; Ardelt, Monika; Blazer, Dan; Kraemer, Helena C.; Vaillant, George; Meeks, Thomas W.

    2010-01-01

    Purpose: Wisdom has received increasing attention in empirical research in recent years, especially in gerontology and psychology, but consistent definitions of wisdom remain elusive. We sought to better characterize this concept via an expert consensus panel using a 2-phase Delphi method. Design and Methods: A survey questionnaire comprised 53…

  16. Building a New American Consensus on Race Relations.

    ERIC Educational Resources Information Center

    Steinhorn, Leonard

    1991-01-01

    Civil rights legislation is not sufficient to challenge poverty and racial discrimination: a national consensus is needed. Using a marketing model, presents a public education campaign designed to facilitate changes in attitudes and understanding, including researching attitudes, identifying the audience, and message development. (CJS)

  17. Brain Hemispheric Consensus and the Quality of Investment Decisions.

    ERIC Educational Resources Information Center

    Boyd, Michael

    This on-going study explores the hypothesis that stock fund managers who underperform do so because they make bad decisions, and examines whether their choices can be improved by using a decision model that invokes principles of brain hemispheric consensus. The study, begun in fall 1999, involves two groups of business students: the control group…

  18. Consensus statement on the immunohistochemical detection of ocular lymphatic vessels.

    PubMed

    Schroedl, Falk; Kaser-Eichberger, Alexandra; Schlereth, Simona L; Bock, Felix; Regenfuss, Birgit; Reitsamer, Herbert A; Lutty, Gerard A; Maruyama, Kazuichi; Chen, Lu; Lütjen-Drecoll, Elke; Dana, Reza; Kerjaschki, Dontscho; Alitalo, Kari; De Stefano, Maria Egle; Junghans, Barbara M; Heindl, Ludwig M; Cursiefen, Claus

    2014-10-01

    There is currently considerable controversy about existence and classification of "lymphatic vessels" in the eye. Some of the confusion is certainly caused by inappropriate use (or nonuse) of the correct immunohistochemical markers. Many experts in the field expressed the need for a consensus statement, and, in this perspective, authors offer arguments and solutions to reliably continue with immunohistochemical ocular lymphatic research.

  19. ISPMD consensus on the management of premenstrual disorders

    PubMed Central

    O’Brien, Patrick Michael Shaughn; Bäckström, Torbjorn; Brown, Candace; Dennerstein, Lorraine; Endicott, Jean; Epperson, C. Neill; Eriksson, Elias; Freeman, Ellen W.; Halbreich, Uriel; Ismail, Khalid; Panay, Nicholas; Pearlstein, Teri; Rapkin, Andrea; Reid, Robert; Rubinow, David; Schmidt, Peter; Steiner, Meir; Studd, John; Sundström-Poromaa, Inger; Yonkers, Kimberly

    2014-01-01

    The second consensus meeting of the International Society for Premenstrual Disorders (ISPMD) took place in London during March 2011. The primary goal was to evaluate the published evidence and consider the expert opinions of the ISPMD members to reach a consensus on advice for the management of premenstrual disorders. Gynaecologists, psychiatrists, psychologists and pharmacologists each formally presented the evidence within their area of expertise; this was followed by an in-depth discussion leading to consensus recommendations. This article provides a comprehensive review of the outcomes from the meeting. The group discussed and agreed that careful diagnosis based on the recommendations and classification derived from the first ISPMD consensus conference is essential and should underlie the appropriate management strategy. Options for the management of premenstrual disorders fall under two broad categories, (a) those influencing central nervous activity, particularly the modulation of the neurotransmitter serotonin and (b) those that suppress ovulation. Psychotropic medication, such as selective serotonin reuptake inhibitors, probably acts by dampening the influence of sex steroids on the brain. Oral contraceptives, gonadotropin-releasing hormone agonists, danazol and estradiol all most likely function by ovulation suppression. The role of oophorectomy was also considered in this respect. Alternative therapies are also addressed, with, e.g. cognitive behavioural therapy, calcium supplements and Vitex agnus castus warranting further exploration. PMID:23624686

  20. Forging Consensus for Implementing Youth Socialization Policy in Northwest China

    ERIC Educational Resources Information Center

    Fairbrother, Gregory P.

    2011-01-01

    The goal of this article is to examine how the provincial education media in China play a role of forging consensus among local actors responsible for the implementation of new centrally-promulgated youth socialization policy. In doing so, it also explores the tension among three of the Chinese state's claims to legitimacy: economic development,…

  1. When goals diverge: Staff consensus and the organizational climate.

    PubMed

    Melnick, Gerald; Ulaszek, Wendy R; Lin, Hsiu-Ju; Wexler, Harry K

    2009-08-01

    A sample of correctional officers and prison substance abuse treatment staff collected by the National Criminal Justice Treatment Practices Survey is used to provide an exploratory study of an aspect of organizational culture consisting of consensus (agreement) among prison personnel regarding their beliefs about rehabilitation in the presence of conflicting organizational goals and aspects of the organizational climate important to change. Findings show that among those staff members responding to the survey, the belief in rehabilitation scale mean score was associated with higher levels of organizational commitment, and interdepartmental coordination. However, an hierarchical linear modeling (HLM) analysis that used an index score derived from the standard deviation for staff consensus regarding these same beliefs about rehabilitation produced a different pattern of results, showing that high levels of consensus were associated with job frustration, cynicism towards the ability of the institution to change, and lower levels of organizational commitment. The authors conclude that, although the sample may not express the beliefs of corrections officers or prison-based treatment staff at large, within the sample, consensus appeared to play a unique role in evaluating the effect of divergent goals on organizational climate as it relates to change, and warrants consideration when considering the effects of organizational climate.

  2. [Consensus for the prevention of cervical cancer in Mexico].

    PubMed

    Kably Ambe, Alberto; Ruiz Moreno, José Antonio; Ponce, Eduardo Lazcano; Vargas Hernández, Victor Manuel; Aguado Pérez, Rogelio A; Alonso de Ruiz, Patricia

    2011-12-01

    Cervical cancer remains a serious public health problem in the world; that is why the Mexican Federation of Schools of Obstetrics and Gynecology convened the elaboration of a consensus that is devoted this number of Ginecologia y Obstetricia de Mexico. In recent years has strengthened perceptions (public and private) in the need for preventive strategies in the medium and long terms. The development of effective vaccines against the human papilloma virus and the application of new methods of detection from viral DNA (completely automated for personal application) allow some degree of optimism. It is proposed a consensus with general recommendations in two consecutive stages: (a) primary prevention consisting of education for the prevention of cervical cancer and universal immunization and (b) secondary prevention by early detection of infections or injuries that could favor carcinogenesis. The consensus reviewed characteristics of available vaccines in detail and proposes strategies for implementation in Mexican population. Also, check out main methods of early detection of infection (or predisposing lesions) and suggests public and private strategies for implementation. Consensus places particular emphasis on early immunization for female population and correct use of methods for detection of infections or injuries that might cause cervical cancer.

  3. Scalable and Fault Tolerant Failure Detection and Consensus

    SciTech Connect

    Katti, Amogh; Di Fatta, Giuseppe; Naughton III, Thomas J; Engelmann, Christian

    2015-01-01

    Future extreme-scale high-performance computing systems will be required to work under frequent component failures. The MPI Forum's User Level Failure Mitigation proposal has introduced an operation, MPI_Comm_shrink, to synchronize the alive processes on the list of failed processes, so that applications can continue to execute even in the presence of failures by adopting algorithm-based fault tolerance techniques. This MPI_Comm_shrink operation requires a fault tolerant failure detection and consensus algorithm. This paper presents and compares two novel failure detection and consensus algorithms. The proposed algorithms are based on Gossip protocols and are inherently fault-tolerant and scalable. The proposed algorithms were implemented and tested using the Extreme-scale Simulator. The results show that in both algorithms the number of Gossip cycles to achieve global consensus scales logarithmically with system size. The second algorithm also shows better scalability in terms of memory and network bandwidth usage and a perfect synchronization in achieving global consensus.

  4. Pre-hospital spinal immobilisation: an initial consensus statement.

    PubMed

    Connor, D; Greaves, I; Porter, K; Bloch, M

    2013-12-01

    This paper reviews the current evidence available on the practice of spinal immobilisation in the prehospital environment. Following this, initial conclusions from a consensus meeting held by the Faculty of Pre-hospital Care, Royal College of Surgeons of Edinburgh in March 2012 are presented.

  5. Deconstruction of archaeal genome depict strategic consensus in core pathways coding sequence assembly.

    PubMed

    Pal, Ayon; Banerjee, Rachana; Mondal, Uttam K; Mukhopadhyay, Subhasis; Bothra, Asim K

    2015-01-01

    A comprehensive in silico analysis of 71 species representing the different taxonomic classes and physiological genre of the domain Archaea was performed. These organisms differed in their physiological attributes, particularly oxygen tolerance and energy metabolism. We explored the diversity and similarity in the codon usage pattern in the genes and genomes of these organisms, emphasizing on their core cellular pathways. Our thrust was to figure out whether there is any underlying similarity in the design of core pathways within these organisms. Analyses of codon utilization pattern, construction of hierarchical linear models of codon usage, expression pattern and codon pair preference pointed to the fact that, in the archaea there is a trend towards biased use of synonymous codons in the core cellular pathways and the Nc-plots appeared to display the physiological variations present within the different species. Our analyses revealed that aerobic species of archaea possessed a larger degree of freedom in regulating expression levels than could be accounted for by codon usage bias alone. This feature might be a consequence of their enhanced metabolic activities as a result of their adaptation to the relatively O2-rich environment. Species of archaea, which are related from the taxonomical viewpoint, were found to have striking similarities in their ORF structuring pattern. In the anaerobic species of archaea, codon bias was found to be a major determinant of gene expression. We have also detected a significant difference in the codon pair usage pattern between the whole genome and the genes related to vital cellular pathways, and it was not only species-specific but pathway specific too. This hints towards the structuring of ORFs with better decoding accuracy during translation. Finally, a codon-pathway interaction in shaping the codon design of pathways was observed where the transcription pathway exhibited a significantly different coding frequency signature.

  6. Kinome profiling of Arabidopsis using arrays of kinase consensus substrates

    PubMed Central

    Ritsema, Tita; Joore, Jos; van Workum, Wilbert; Pieterse, Corné MJ

    2007-01-01

    Background Kinome profiling aims at the parallel analysis of kinase activities in a cell. Novel developed arrays containing consensus substrates for kinases are used to assess those kinase activities. The arrays described in this paper were already used to determine kinase activities in mammalian systems, but since substrates from many organisms are present we decided to test these arrays for the determination of kinase activities in the model plant species Arabidopsis thaliana. Results Kinome profiling using Arabidopsis cell extracts resulted in the labelling of many consensus peptides by kinases from the plant, indicating the usefulness of this kinome profiling tool for plants. Method development showed that fresh and frozen plant material could be used to make cell lysates containing active kinases. Dilution of the plant extract increased the signal to noise ratio and non-radioactive ATP enhances full development of spot intensities. Upon infection of Arabidopsis with an avirulent strain of the bacterial pathogen Pseudomonas syringae pv. tomato, we could detect differential kinase activities by measuring phosphorylation of consensus peptides. Conclusion We show that kinome profiling on arrays with consensus substrates can be used to monitor kinase activities in plants. In a case study we show that upon infection with avirulent P. syringae differential kinase activities can be found. The PepChip can for example be used to purify (unknown) kinases that play a role in P. syringae infection. This paper shows that kinome profiling using arrays of consensus peptides is a valuable new tool to study signal-transduction in plants. It complements the available methods for genomics and proteomics research. PMID:17295910

  7. Formal consensus: the development of a national clinical guideline

    PubMed Central

    Rycroft-Malone, J

    2001-01-01

    Background—There is currently a political enthusiasm for the development and use of clinical guidelines despite, paradoxically, there being relatively few healthcare issues that have a sound research evidence base. As decisions have to be made even where there is an undetermined evidence base and that limiting recommendations to where evidence exists may reduce the scope of guidelines, thus limiting their value to practitioners, guideline developers have to rely on various different sources of evidence and adapt their methods accordingly. This paper outlines a method for guideline development which incorporates a consensus process devised to tackle the challenges of a variable research evidence base for the development of a national clinical guideline on risk assessment and prevention of pressure ulcers. Method—To inform the recommendations of the guideline a formal consensus process based on a nominal group technique was used to incorporate three strands of evidence: research, clinical expertise, and patient experience. Results—The recommendations for this guideline were derived directly from the statements agreed in the formal consensus process and from key evidence-based findings from the systematic reviews. The existing format of the statements that participants had rated allowed a straightforward revision to "active" recommendations, thus reducing further risk of subjectivity entering into the process. Conclusions—The method outlined proved to be a practical and systematic way of integrating a number of different evidence sources. The resultant guideline is a mixture of research based and consensus based recommendations. Given the lack of available guidance on how to mix research with expert opinion and patient experiences, the method used for the development of this guideline has been outlined so that other guideline developers may use, adapt, and test it further. Key Words: guidelines; guideline development; formal consensus process; nominal group

  8. Direct Chloroplast Sequencing: Comparison of Sequencing Platforms and Analysis Tools for Whole Chloroplast Barcoding

    PubMed Central

    Brozynska, Marta; Furtado, Agnelo; Henry, Robert James

    2014-01-01

    Direct sequencing of total plant DNA using next generation sequencing technologies generates a whole chloroplast genome sequence that has the potential to provide a barcode for use in plant and food identification. Advances in DNA sequencing platforms may make this an attractive approach for routine plant identification. The HiSeq (Illumina) and Ion Torrent (Life Technology) sequencing platforms were used to sequence total DNA from rice to identify polymorphisms in the whole chloroplast genome sequence of a wild rice plant relative to cultivated rice (cv. Nipponbare). Consensus chloroplast sequences were produced by mapping sequence reads to the reference rice chloroplast genome or by de novo assembly and mapping of the resulting contigs to the reference sequence. A total of 122 polymorphisms (SNPs and indels) between the wild and cultivated rice chloroplasts were predicted by these different sequencing and analysis methods. Of these, a total of 102 polymorphisms including 90 SNPs were predicted by both platforms. Indels were more variable with different sequencing methods, with almost all discrepancies found in homopolymers. The Ion Torrent platform gave no apparent false SNP but was less reliable for indels. The methods should be suitable for routine barcoding using appropriate combinations of sequencing platform and data analysis. PMID:25329378

  9. Direct chloroplast sequencing: comparison of sequencing platforms and analysis tools for whole chloroplast barcoding.

    PubMed

    Brozynska, Marta; Furtado, Agnelo; Henry, Robert James

    2014-01-01

    Direct sequencing of total plant DNA using next generation sequencing technologies generates a whole chloroplast genome sequence that has the potential to provide a barcode for use in plant and food identification. Advances in DNA sequencing platforms may make this an attractive approach for routine plant identification. The HiSeq (Illumina) and Ion Torrent (Life Technology) sequencing platforms were used to sequence total DNA from rice to identify polymorphisms in the whole chloroplast genome sequence of a wild rice plant relative to cultivated rice (cv. Nipponbare). Consensus chloroplast sequences were produced by mapping sequence reads to the reference rice chloroplast genome or by de novo assembly and mapping of the resulting contigs to the reference sequence. A total of 122 polymorphisms (SNPs and indels) between the wild and cultivated rice chloroplasts were predicted by these different sequencing and analysis methods. Of these, a total of 102 polymorphisms including 90 SNPs were predicted by both platforms. Indels were more variable with different sequencing methods, with almost all discrepancies found in homopolymers. The Ion Torrent platform gave no apparent false SNP but was less reliable for indels. The methods should be suitable for routine barcoding using appropriate combinations of sequencing platform and data analysis.

  10. Sequence-specific interaction between HIV-1 matrix protein and viral genomic RNA revealed by in vitro genetic selection.

    PubMed Central

    Purohit, P; Dupont, S; Stevenson, M; Green, M R

    2001-01-01

    The human immunodeficiency virus type-1 matrix protein (HIV-1 MA) is a multifunctional structural protein synthesized as part of the Pr55 gag polyprotein. We have used in vitro genetic selection to identify an RNA consensus sequence that specifically interacts with MA (Kd = 5 x 10(-7) M). This 13-nt MA binding consensus sequence bears a high degree of homology (77%) to a region (nt 1433-1446) within the POL open reading frame of the HIV-1 genome (consensus sequence from 38 HIV-1 strains). Chemical interference experiments identified the nucleotides within the MA binding consensus sequence involved in direct contact with MA. We further demonstrate that this RNA-protein interaction is mediated through a stretch of basic amino acids within MA. Mutations that disrupt the interaction between MA and its RNA binding site within the HIV-1 genome resulted in a measurable decrease in viral replication. PMID:11345436

  11. Detection and Analysis of Six Lizard Adenoviruses by Consensus Primer PCR Provides Further Evidence of a Reptilian Origin for the Atadenoviruses

    PubMed Central

    Wellehan, James F. X.; Johnson, April J.; Harrach, Balázs; Benkö, Mária; Pessier, Allan P.; Johnson, Calvin M.; Garner, Michael M.; Childress, April; Jacobson, Elliott R.

    2004-01-01

    A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses. PMID:15542689

  12. Detection and analysis of six lizard adenoviruses by consensus primer PCR provides further evidence of a reptilian origin for the atadenoviruses.

    PubMed

    Wellehan, James F X; Johnson, April J; Harrach, Balázs; Benkö, Mária; Pessier, Allan P; Johnson, Calvin M; Garner, Michael M; Childress, April; Jacobson, Elliott R

    2004-12-01

    A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses.

  13. Assessment of minimal residual disease in myeloma and the need for a consensus approach.

    PubMed

    Rawstron, Andy C; Paiva, Bruno; Stetler-Stevenson, Maryalice

    2016-01-01

    Treatment options for myeloma continue to develop at a rapid pace, and it is becoming increasingly challenging to determine the optimal therapeutic approaches because demonstrating a clear survival benefit now requires many years of follow-up. The detection of minimal residual disease (MRD) is recognized as a sensitive and rapid approach to evaluate treatment efficacy that predicts progression-free and overall survival independent of categorical response assessment and patients' biology. The benefit of MRD analysis is reflected in the many different techniques (multiparameter flow cytometry, quantitative polymerase chain reaction, and high-throughput sequencing) and collaborative groups (including EMN, ESCCA, ICCS, EuroFlow, and EuroMRD) that have performed collaborative projects to harmonize quantitative MRD detection. The time has come to adopt a consensus approach, and this report reviews the benefits and disadvantages of different strategies for MRD detection in myeloma and highlights the requirements for a sensitive, reproducible, and clinically meaningful cellular analytical approach.

  14. Early Identification of Hearing Impairment in Infants and Young Children: NIH Consensus Statement [and] Summary of the NIH Consensus.

    ERIC Educational Resources Information Center

    NIH Consensus Statement, 1993

    1993-01-01

    This consensus statement on early identification of hearing impairment in infants and young children was developed by a nonadvocate, non-Federal panel of 58 experts during a 3-day meeting in 1993. The panel concluded that: (1) all infants admitted to the neonatal intensive care unit should be screened for hearing loss prior to discharge; (2)…

  15. Noise and Hearing Loss. NIH Consensus Development Conference Consensus Statement (January 22-24, 1990). Volume 8, Number 1.

    ERIC Educational Resources Information Center

    National Institutes of Health (DHHS), Bethesda, MD.

    This report is the product of a National Institutes of Health Consensus Development Conference on Noise and Hearing Loss which addressed the characteristics of noise-induced hearing loss, acoustic parameters of hazardous noise exposure, individual and age-specific susceptibility, and prevention strategies. The report examines the incidence of…

  16. Dna Sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  17. Consensus Conference on North American Training in Hepatopancreaticobiliary Surgery: A Review of the Conference and Presentation of Consensus Statements.

    PubMed

    Jeyarajah, D Rohan; Berman, Russell S; Doyle, Majella; Geevarghese, Sunil K; Posner, Mitchell C; Farmer, Douglas; Minter, Rebecca M

    2016-07-01

    The findings and recommendations of the North American Consensus Conference on Training in HPB Surgery held October 2014 are presented. The conference was hosted by the Society for Surgical Oncology (SSO), Americas Hepatopancreaticobiliary Association (AHPBA), and the American Society of Transplant Surgeons (ASTS). The current state of training in HPB surgery in North America was defined through three pathways-HPB, Surgical Oncology, and Solid Organ Transplant fellowships. Consensus regarding programmatic requirements included establishment of minimum case volumes and inclusion of quality metrics. Formative assessment, using milestones as a framework and inclusive of both operative and non-operative skills, must be present. Specific core HPB cases should be defined and used for evaluation of operative skills. The conference concluded with a focus on the optimal means to perform summative assessment to evaluate the individual fellow completing a fellowship in HPB surgery. Presentations from the hospital perspective and the American Board of Surgery led to consensus that summative assessment was desired by the public and the hospital systems, and should occur in a uniform but possibly modular manner for all HPB fellowship pathways. A task force comprised of representatives of the SSO, AHPBA, and ASTS are charged with implementation of the consensus statements emanating from this consensus conference.Copyright © 2016 The American Society of Transplantation, the American Society of Transplant Surgeons, and the Society of Surgical Oncology. All rights reserved. No part of this document may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without written permission by The American Society of Transplantation, the American Society of Transplant Surgeons, or the Society of Surgical Oncology. PMID:26932708

  18. An expanded collection and refined consensus model of glmS ribozymes

    PubMed Central

    McCown, Phillip J.; Roth, Adam; Breaker, Ronald R.

    2011-01-01

    Self-cleaving glmS ribozymes selectively bind glucosamine-6-phosphate (GlcN6P) and use this metabolite as a cofactor to promote self-cleavage by internal phosphoester transfer. Representatives of the glmS ribozyme class are found in Gram-positive bacteria where they reside in the 5′ untranslated regions (UTRs) of glmS messenger RNAs that code for the essential enzyme L-glutamine:D-fructose-6-phosphate aminotransferase. By using comparative sequence analyses, we have expanded the number of glmS ribozyme representatives from 160 to 463. All but two glmS ribozymes are present in glmS mRNAs and most exhibit striking uniformity in sequence and structure, which are features that make representatives attractive targets for antibacterial drug development. However, our discovery of rare variants broadens the consensus sequence and structure model. For example, in the Deinococcus-Thermus phylum, several structural variants exist that carry additional stems within the catalytic core and changes to the architecture of core-supporting substructures. These findings reveal that glmS ribozymes have a broader phylogenetic distribution than previously known and suggest that additional rare structural variants may remain to be discovered. PMID:21367971

  19. A Consensus Genetic Map for Pinus taeda and Pinus elliottii and Extent of Linkage Disequilibrium in Two Genotype-Phenotype Discovery Populations of Pinus taeda.

    PubMed

    Westbrook, Jared W; Chhatre, Vikram E; Wu, Le-Shin; Chamala, Srikar; Neves, Leandro Gomide; Muñoz, Patricio; Martínez-García, Pedro J; Neale, David B; Kirst, Matias; Mockaitis, Keithanne; Nelson, C Dana; Peter, Gary F; Davis, John M; Echt, Craig S

    2015-06-11

    A consensus genetic map for Pinus taeda (loblolly pine) and Pinus elliottii (slash pine) was constructed by merging three previously published P. taeda maps with a map from a pseudo-backcross between P. elliottii and P. taeda. The consensus map positioned 3856 markers via genotyping of 1251 individuals from four pedigrees. It is the densest linkage map for a conifer to date. Average marker spacing was 0.6 cM and total map length was 2305 cM. Functional predictions of mapped genes were improved by aligning expressed sequence tags used for marker discovery to full-length P. taeda transcripts. Alignments to the P. taeda genome mapped 3305 scaffold sequences onto 12 linkage groups. The consensus genetic map was used to compare the genome-wide linkage disequilibrium in a population of distantly related P. taeda individuals (ADEPT2) used for association genetic studies and a multiple-family pedigree used for genomic selection (CCLONES). The prevalence and extent of LD was greater in CCLONES as compared to ADEPT2; however, extended LD with LGs or between LGs was rare in both populations. The average squared correlations, r(2), between SNP alleles less than 1 cM apart were less than 0.05 in both populations and r(2) did not decay substantially with genetic distance. The consensus map and analysis of linkage disequilibrium establish a foundation for comparative association mapping and genomic selection in P. taeda and P. elliottii.

  20. A Consensus Genetic Map for Pinus taeda and Pinus elliottii and Extent of Linkage Disequilibrium in Two Genotype-Phenotype Discovery Populations of Pinus taeda

    PubMed Central

    Westbrook, Jared W.; Chhatre, Vikram E.; Wu, Le-Shin; Chamala, Srikar; Neves, Leandro Gomide; Muñoz, Patricio; Martínez-García, Pedro J.; Neale, David B.; Kirst, Matias; Mockaitis, Keithanne; Nelson, C. Dana; Peter, Gary F.; Echt, Craig S.

    2015-01-01

    A consensus genetic map for Pinus taeda (loblolly pine) and Pinus elliottii (slash pine) was constructed by merging three previously published P. taeda maps with a map from a pseudo-backcross between P. elliottii and P. taeda. The consensus map positioned 3856 markers via genotyping of 1251 individuals from four pedigrees. It is the densest linkage map for a conifer to date. Average marker spacing was 0.6 cM and total map length was 2305 cM. Functional predictions of mapped genes were improved by aligning expressed sequence tags used for marker discovery to full-length P. taeda transcripts. Alignments to the P. taeda genome mapped 3305 scaffold sequences onto 12 linkage groups. The consensus genetic map was used to compare the genome-wide linkage disequilibrium in a population of distantly related P. taeda individuals (ADEPT2) used for association genetic studies and a multiple-family pedigree used for genomic selection (CCLONES). The prevalence and extent of LD was greater in CCLONES as compared to ADEPT2; however, extended LD with LGs or between LGs was rare in both populations. The average squared correlations, r2, between SNP alleles less than 1 cM apart were less than 0.05 in both populations and r2 did not decay substantially with genetic distance. The consensus map and analysis of linkage disequilibrium establish a foundation for comparative association mapping and genomic selection in P. taeda and P. elliottii. PMID:26068575

  1. Simultaneous Alignment and Folding of Protein Sequences

    PubMed Central

    Waldispühl, Jérôme; O'Donnell, Charles W.; Will, Sebastian; Devadas, Srinivas; Backofen, Rolf

    2014-01-01

    Abstract Accurate comparative analysis tools for low-homology proteins remains a difficult challenge in computational biology, especially sequence alignment and consensus folding problems. We present partiFold-Align, the first algorithm for simultaneous alignment and consensus folding of unaligned protein sequences; the algorithm's complexity is polynomial in time and space. Algorithmically, partiFold-Align exploits sparsity in the set of super-secondary structure pairings and alignment candidates to achieve an effectively cubic running time for simultaneous pairwise alignment and folding. We demonstrate the efficacy of these techniques on transmembrane β-barrel proteins, an important yet difficult class of proteins with few known three-dimensional structures. Testing against structurally derived sequence alignments, partiFold-Align significantly outperforms state-of-the-art pairwise and multiple sequence alignment tools in the most difficult low-sequence homology case. It also improves secondary structure prediction where current approaches fail. Importantly, partiFold-Align requires no prior training. These general techniques are widely applicable to many more protein families (partiFold-Align is available at http://partifold.csail.mit.edu/). PMID:24766258

  2. The pivotal role of perceived scientific consensus in acceptance of science

    NASA Astrophysics Data System (ADS)

    Lewandowsky, Stephan; Gignac, Gilles E.; Vaughan, Samuel

    2013-04-01

    Although most experts agree that CO2 emissions are causing anthropogenic global warming (AGW), public concern has been declining. One reason for this decline is the `manufacture of doubt' by political and vested interests, which often challenge the existence of the scientific consensus. The role of perceived consensus in shaping public opinion is therefore of considerable interest: in particular, it is unknown whether consensus determines people's beliefs causally. It is also unclear whether perception of consensus can override people's `worldviews', which are known to foster rejection of AGW. Study 1 shows that acceptance of several scientific propositions--from HIV/AIDS to AGW--is captured by a common factor that is correlated with another factor that captures perceived scientific consensus. Study 2 reveals a causal role of perceived consensus by showing that acceptance of AGW increases when consensus is highlighted. Consensus information also neutralizes the effect of worldview.

  3. Children trust a consensus composed of outgroup members--but do not retain that trust.

    PubMed

    Chen, Eva E; Corriveau, Kathleen H; Harris, Paul L

    2013-01-01

    Children prefer to learn from informants in consensus with one another. However, no research has examined whether this preference exists across cultures, and whether the race of the informants impacts that preference. In 2 studies, one hundred thirty-six 4- to 7-year-old European American and Taiwanese children demonstrated a systematic preference for a consensus. Nevertheless, the initial strength and persistence of that preference depended on the racial composition of the consensus. Children's preference for consensus members belonging to the same race as themselves persisted even when only one consensus member remained to provide information. When the consensus consisted of different-race informants, preference for the consensus was initially apparent but lost when only one member from the consensus remained with the dissenting informant. PMID:22994587

  4. Sequencing Cucumber (Cucumis Sativus L.) Chloroplast Genomes Identifies Differences Between Chilling-Tolerant and-Susceptible Cucumber Lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Complete sequencing of cucumber chloroplast (cp)DNA was facilitated by the development of 414 consensus chloroplast sequencing primers (CCSPs) from conserved cpDNA sequences of Arabidopsis (Arabidopsis thaliana L.), spinach (Spinacia oleracea L.), and tobacco (Nicotiana tabacum L.) cpDNAs, using deg...

  5. Miz-1 activates gene expression via a novel consensus DNA binding motif.

    PubMed

    Barrilleaux, Bonnie L; Burow, Dana; Lockwood, Sarah H; Yu, Abigail; Segal, David J; Knoepfler, Paul S

    2014-01-01

    The transcription factor Miz-1 can either activate or repress gene expression in concert with binding partners including the Myc oncoprotein. The genomic binding of Miz-1 includes both core promoters and more distal sites, but the preferred DNA binding motif of Miz-1 has been unclear. We used a high-throughput in vitro technique, Bind-n-Seq, to identify two Miz-1 consensus DNA binding motif sequences--ATCGGTAATC and ATCGAT (Mizm1 and Mizm2)--bound by full-length Miz-1 and its zinc finger domain, respectively. We validated these sequences directly as high affinity Miz-1 binding motifs. Competition assays using mutant probes indicated that the binding affinity of Miz-1 for Mizm1 and Mizm2 is highly sequence-specific. Miz-1 strongly activates gene expression through the motifs in a Myc-independent manner. MEME-ChIP analysis of Miz-1 ChIP-seq data in two different cell types reveals a long motif with a central core sequence highly similar to the Mizm1 motif identified by Bind-n-Seq, validating the in vivo relevance of the findings. Miz-1 ChIP-seq peaks containing the long motif are predominantly located outside of proximal promoter regions, in contrast to peaks without the motif, which are highly concentrated within 1.5 kb of the nearest transcription start site. Overall, our results indicate that Miz-1 may be directed in vivo to the novel motif sequences we have identified, where it can recruit its specific binding partners to control gene expression and ultimately regulate cell fate. PMID:24983942

  6. Revisiting and re-engineering the classical zinc finger peptide: consensus peptide-1 (CP-1).

    PubMed

    Besold, Angelique N; Widger, Leland R; Namuswe, Frances; Michalek, Jamie L; Michel, Sarah L J; Goldberg, David P

    2016-04-01

    Zinc plays key structural and catalytic roles in biology. Structural zinc sites are often referred to as zinc finger (ZF) sites, and the classical ZF contains a Cys2His2 motif that is involved in coordinating Zn(II). An optimized Cys2His2 ZF, named consensus peptide 1 (CP-1), was identified more than 20 years ago using a limited set of sequenced proteins. We have reexamined the CP-1 sequence, using our current, much larger database of sequenced proteins that have been identified from high-throughput sequencing methods, and found the sequence to be largely unchanged. The CCHH ligand set of CP-1 was then altered to a CAHH motif to impart hydrolytic activity. This ligand set mimics the His2Cys ligand set of peptide deformylase (PDF), a hydrolytically active M(II)-centered (M = Zn or Fe) protein. The resultant peptide [CP-1(CAHH)] was evaluated for its ability to coordinate Zn(II) and Co(II) ions, adopt secondary structure, and promote hydrolysis. CP-1(CAHH) was found to coordinate Co(II) and Zn(II) and a pentacoordinate geometry for Co(II)-CP-1(CAHH) was implicated from UV-vis data. This suggests a His2Cys(H2O)2 environment at the metal center. The Zn(II)-bound CP-1(CAHH) was shown to adopt partial secondary structure by 1-D (1)H NMR spectroscopy. Both Zn(II)-CP-1(CAHH) and Co(II)-CP-1(CAHH) show good hydrolytic activity toward the test substrate 4-nitrophenyl acetate, exhibiting faster rates than most active synthetic Zn(II) complexes.

  7. Uroncor consensus statement: Management of biochemical recurrence after radical radiotherapy for prostate cancer: From biochemical failure to castration resistance.

    PubMed

    López Torrecilla, José; Hervás, Asunción; Zapatero, Almudena; Gómez Caamaño, Antonio; Macías, Victor; Herruzo, Ismael; Maldonado, Xavier; Gómez Iturriaga, Alfonso; Casas, Francesc; González San Segundo, Carmen

    2015-01-01

    Management of patients who experience biochemical failure after radical radiotherapy with or without hormonal therapy is highly challenging. The clinician must not only choose the type of treatment, but also the timing and optimal sequence of treatment administration. When biochemical failure occurs, numerous treatment scenarios are possible, thus making it more difficult to select the optimal approach. Moreover, rapid and ongoing advances in treatment options require that physicians make decisions that could impact both survival and quality of life. The aim of the present consensus statement, developed by the Urological Tumour Working Group (URONCOR) of the Spanish Society of Radiation Oncology (SEOR), is to provide cancer specialists with the latest, evidence-based information needed to make the best decisions for the patient under all possible treatment scenarios. The structure of this consensus statement follows the typical development of disease progression after biochemical failure, with the most appropriate treatment recommendations given for each stage. The consensus statement is organized into three separate chapters, as follows: biochemical failure with or without local recurrence and/or metastasis; progression after salvage therapy; and treatment of castration-resistant patients. PMID:26109913

  8. [Consensus on the change of criteria for cure of acromegaly during the last decade].

    PubMed

    Kovács, Gábor László; Dénes, Judit; Hubina, Erika; Kovács, László; Czirják, Sándor; Góth, Miklós

    2011-05-01

    The Acromegaly Consensus Group redefined the consensus criteria for cure of acromegaly. 74 neurosurgeons and experienced endocrinologists summarized the latest results on diagnosis and treatment of acromegaly. In this consensus statement the reliable growth hormone and insulin-like growth factor-1 assays were established. Definition of disease control was discussed based on the available publications and evidence. This short communication summarizes the clinical aspects of consensus criteria for diagnosis and cure of acromegaly based on the original article. PMID:21498158

  9. Efficient Reconstruction of Predictive Consensus Metabolic Network Models.

    PubMed

    van Heck, Ruben G A; Ganter, Mathias; Martins Dos Santos, Vitor A P; Stelling, Joerg

    2016-08-01

    Understanding cellular function requires accurate, comprehensive representations of metabolism. Genome-scale, constraint-based metabolic models (GSMs) provide such representations, but their usability is often hampered by inconsistencies at various levels, in particular for concurrent models. COMMGEN, our tool for COnsensus Metabolic Model GENeration, automatically identifies inconsistencies between concurrent models and semi-automatically resolves them, thereby contributing to consolidate knowledge of metabolic function. Tests of COMMGEN for four organisms showed that automatically generated consensus models were predictive and that they substantially increased coherence of knowledge representation. COMMGEN ought to be particularly useful for complex scenarios in which manual curation does not scale, such as for eukaryotic organisms, microbial communities, and host-pathogen interactions. PMID:27563720

  10. Engineering large-scale agent-based systems with consensus

    NASA Technical Reports Server (NTRS)

    Bokma, A.; Slade, A.; Kerridge, S.; Johnson, K.

    1994-01-01

    The paper presents the consensus method for the development of large-scale agent-based systems. Systems can be developed as networks of knowledge based agents (KBA) which engage in a collaborative problem solving effort. The method provides a comprehensive and integrated approach to the development of this type of system. This includes a systematic analysis of user requirements as well as a structured approach to generating a system design which exhibits the desired functionality. There is a direct correspondence between system requirements and design components. The benefits of this approach are that requirements are traceable into design components and code thus facilitating verification. The use of the consensus method with two major test applications showed it to be successful and also provided valuable insight into problems typically associated with the development of large systems.

  11. [Neuroendocrine dysfunction and brain damage. A consensus statement].

    PubMed

    Leal-Cerro, Alfonso; Rincón, María Dolores; Domingo, Manel Puig

    2009-01-01

    This consensus statement aims to enhance awareness of the incidence and risks of hypopituitarism in patients with traumatic brain injury (TBI) and/or brain hemorrhages among physicians treating patients with brain damage. The importance of this problem is related not only to the frequency of TBI but also to its prevalence in younger populations. The consequences of TBI are characterized by a series of symptoms that depend on the type of sequels related to neuroendocrine dysfunction. The signs and symptoms of hypopituitarism are often confused with those of other sequels of TBI. Consequently, patients with posttraumatic hypopituitarism may receive suboptimal rehabilitation unless the underlying hormone deficiency is identified and treated. This consensus is based on the recommendation supported by expert opinion that patients with a TBI and/or brain hemorrhage should undergo endocrine evaluation in order to assess pituitary function and, if deficiency is detected, should receive hormone replacement therapy.

  12. International Consensus on Allergen Immunotherapy II: Mechanisms, standardization, and pharmacoeconomics.

    PubMed

    Jutel, Marek; Agache, Ioana; Bonini, Sergio; Burks, A Wesley; Calderon, Moises; Canonica, Walter; Cox, Linda; Demoly, Pascal; Frew, Antony J; O'Hehir, Robyn; Kleine-Tebbe, Jörg; Muraro, Antonella; Lack, Gideon; Larenas, Désirée; Levin, Michael; Martin, Bryan L; Nelson, Harald; Pawankar, Ruby; Pfaar, Oliver; van Ree, Ronald; Sampson, Hugh; Sublett, James L; Sugita, Kazunari; Du Toit, George; Werfel, Thomas; Gerth van Wijk, Roy; Zhang, Luo; Akdis, Mübeccel; Akdis, Cezmi A

    2016-02-01

    This article continues the comprehensive international consensus (ICON) statement on allergen immunotherapy (AIT). The initial article also recently appeared in the Journal. The conclusions below focus on key mechanisms of AIT-triggered tolerance, requirements in allergen standardization, AIT cost-effectiveness, and regulatory guidance. Potential barriers to and facilitators of the use of AIT are described in addition to future directions. International allergy specialists representing the European Academy of Allergy and Clinical Immunology; the American Academy of Allergy, Asthma & Immunology; the American College of Allergy, Asthma and Immunology; and the World Allergy Organization critically reviewed the existing literature and prepared this summary of recommendations for best AIT practice. The authors contributed equally and reached consensus on the statements presented herein. PMID:26853128

  13. Link-Prediction Enhanced Consensus Clustering for Complex Networks

    PubMed Central

    Burgess, Matthew; Adar, Eytan; Cafarella, Michael

    2016-01-01

    Many real networks that are collected or inferred from data are incomplete due to missing edges. Missing edges can be inherent to the dataset (Facebook friend links will never be complete) or the result of sampling (one may only have access to a portion of the data). The consequence is that downstream analyses that “consume” the network will often yield less accurate results than if the edges were complete. Community detection algorithms, in particular, often suffer when critical intra-community edges are missing. We propose a novel consensus clustering algorithm to enhance community detection on incomplete networks. Our framework utilizes existing community detection algorithms that process networks imputed by our link prediction based sampling algorithm and merges their multiple partitions into a final consensus output. On average our method boosts performance of existing algorithms by 7% on artificial data and 17% on ego networks collected from Facebook. PMID:27203750

  14. A failed platform: The Citizen Consensus Conference travels to Chile.

    PubMed

    Ureta, Sebastián

    2016-05-01

    This article starts by reviewing the setbacks that the recent Science and Technology Studies literature has identified in the functioning of technologies of democracy, the different arrangements that look to enact deliberation on technoscientific issues. Putting a focus on the Citizen Consensus Conference, it then proposes that several of these setbacks are related to the kind of "work" that these technologies are expected to do, identifying two kinds of it: performing a laboratory-based experiment and constituting a platform for the dissemination of facts. It then applies this framework to study a Citizen Consensus Conference carried out in Chile in 2003. After a detailed genealogy of the planning, implementation and afterlife of this exercise, the article concludes that several of the limitations experienced are derived from a "successful outcome" conceived as solely running a neat lab-based experiment, arguing for the need to incorporate its functioning as a platform with all the associated transformations and messiness.

  15. On the accurate construction of consensus genetic maps.

    PubMed

    Wu, Yonghui; Close, Timothy J; Lonardi, Stefano

    2008-01-01

    We study the problem of merging genetic maps, when the individual genetic maps are given as directed acyclic graphs. The problem is to build a consensus map, which includes and is consistent with all (or, the vast majority of) the markers in the individual maps. When markers in the input maps have ordering conflicts, the resulting consensus map will contain cycles. We formulate the problem of resolving cycles in a combinatorial optimization framework, which in turn is expressed as an integer linear program. A faster approximation algorithm is proposed, and an additional speed-up heuristic is developed. According to an extensive set of experimental results, our tool is consistently better than JOINMAP, both in terms of accuracy and running time. PMID:19642288

  16. Efficient Reconstruction of Predictive Consensus Metabolic Network Models

    PubMed Central

    Martins dos Santos, Vitor A. P.; Stelling, Joerg

    2016-01-01

    Understanding cellular function requires accurate, comprehensive representations of metabolism. Genome-scale, constraint-based metabolic models (GSMs) provide such representations, but their usability is often hampered by inconsistencies at various levels, in particular for concurrent models. COMMGEN, our tool for COnsensus Metabolic Model GENeration, automatically identifies inconsistencies between concurrent models and semi-automatically resolves them, thereby contributing to consolidate knowledge of metabolic function. Tests of COMMGEN for four organisms showed that automatically generated consensus models were predictive and that they substantially increased coherence of knowledge representation. COMMGEN ought to be particularly useful for complex scenarios in which manual curation does not scale, such as for eukaryotic organisms, microbial communities, and host-pathogen interactions. PMID:27563720

  17. Boltzmann-type control of opinion consensus through leaders

    PubMed Central

    Albi, G.; Pareschi, L.; Zanella, M.

    2014-01-01

    The study of formations and dynamics of opinions leading to the so-called opinion consensus is one of the most important areas in mathematical modelling of social sciences. Following the Boltzmann-type control approach recently introduced by the first two authors, we consider a group of opinion leaders who modify their strategy accordingly to an objective functional with the aim of achieving opinion consensus. The main feature of the Boltzmann-type control is that, owing to an instantaneous binary control formulation, it permits the minimization of the cost functional to be embedded into the microscopic leaders’ interactions of the corresponding Boltzmann equation. The related Fokker–Planck asymptotic limits are also derived, which allow one to give explicit expressions of stationary solutions. The results demonstrate the validity of the Boltzmann-type control approach and the capability of the leaders’ control to strategically lead the followers’ opinion. PMID:25288820

  18. [GEITDAH consensus on conduct disorders in children and adolescents].

    PubMed

    Sasot-Llevadot, Jordi; Ibáñez-Bordas, Rosa M; Soto-López, Antonio; Montañés-Rada, Francisco; Gastaminza-Pérez, Xavier; Alda-Díez, José A; Cantó-Díez, Tomás; Catalá, Miguel A; Ferrin-Erdozáin, Maite; García-Giral, Marta; Graell-Bernal, Montserrat; Granada-Jiménez, Olvido; Herreros-Rodríguez, Óscar; Mardomingo-Sanz, María J; Mojarro-Práxedes, Dolores; Morey-Canyelles, Jaume; Ortiz-Guerra, Juan; Pàmies-Massana, Montserrat; Rey-Sánchez, Francisco; Romera-Torrens, María; Rubio-Morell, Belén; Ruiz-Lázaro, Pedro M; Ruiz-Sanz, Francisco

    2015-08-16

    In this paper, the Special Interest Group on Attention Deficit Hyperactivity Disorder (GEITDAH, from its name in Spanish) presents a consensus reached by experts from all over Spain on conduct disorders in children and adolescents. Following the initial work by the team at the Pedopsychiatry Unit at the Quiron-Teknon Hospital in Barcelona, agreements have been reached on a number of basic aspects that could be the starting point for future consensuses. A top priority aim of the work was also to update the criteria in the Diagnostic and statistical manual of mental disorders, fifth edition, for conduct disorders in children and adolescents, together with their comorbidity with attention deficit hyperactivity disorder. PMID:26204088

  19. Canadian student leaders' perspective on interprofessional education: A consensus statement.

    PubMed

    Chicorelli, Jennifer; Dennie, Anik; Heinrich, Christina; Hinchey, Blake; Honarparvar, Faraz; Jennings, Morgan; Keefe, Chad; Metro, Trisha Lee; Peel, Celeste; Snowdon, Cordelia; Tempelman, Justine; Wong, Melody Elise; Forbes, Susan L; Livingston, Lori A

    2016-07-01

    The purpose of this article is to report on the outcomes of an interprofessional education (IPE) consensus-building exercise amongst student leaders enrolled in health science-related degree programs. The 12 participants included undergraduate and graduate students from eight different universities situated in five Canadian provinces. Their areas of study spanned a broad range of professions and disciplines including child and youth care, health promotion, nursing, kinesiology, medicine, physical education, psychology, and social work. A consensus statement regarding IPE and, more specifically, "what we know," "what we don't know," and "where do we go from here" is presented. These insights are unique, and a willingness to embrace them may be critical in building the next generation of improved IPE offerings across the country.

  20. International Consensus on Allergen Immunotherapy II: Mechanisms, standardization, and pharmacoeconomics.

    PubMed

    Jutel, Marek; Agache, Ioana; Bonini, Sergio; Burks, A Wesley; Calderon, Moises; Canonica, Walter; Cox, Linda; Demoly, Pascal; Frew, Antony J; O'Hehir, Robyn; Kleine-Tebbe, Jörg; Muraro, Antonella; Lack, Gideon; Larenas, Désirée; Levin, Michael; Martin, Bryan L; Nelson, Harald; Pawankar, Ruby; Pfaar, Oliver; van Ree, Ronald; Sampson, Hugh; Sublett, James L; Sugita, Kazunari; Du Toit, George; Werfel, Thomas; Gerth van Wijk, Roy; Zhang, Luo; Akdis, Mübeccel; Akdis, Cezmi A

    2016-02-01

    This article continues the comprehensive international consensus (ICON) statement on allergen immunotherapy (AIT). The initial article also recently appeared in the Journal. The conclusions below focus on key mechanisms of AIT-triggered tolerance, requirements in allergen standardization, AIT cost-effectiveness, and regulatory guidance. Potential barriers to and facilitators of the use of AIT are described in addition to future directions. International allergy specialists representing the European Academy of Allergy and Clinical Immunology; the American Academy of Allergy, Asthma & Immunology; the American College of Allergy, Asthma and Immunology; and the World Allergy Organization critically reviewed the existing literature and prepared this summary of recommendations for best AIT practice. The authors contributed equally and reached consensus on the statements presented herein.

  1. Consensus radiation protection practices for academic research institutions.

    PubMed

    Schiager, K J; McDougall, M M; Christman, E A; Party, E; Ring, J; Carlson, D E; Warfield, C A; Barkley, W E

    1996-12-01

    Under the auspices of the Howard Hughes Medical Institute, a set of consensus guidelines for Radiation Protection Practices has been developed for biomedical research using radioactive materials. The purposes of the guidelines are (1) to promote good radiation protection practices consistent with the needs of biomedical research, the ALARA principle, and regulatory requirements; (2) to establish common goals and consistent practices within radiation safety programs; and (3) to build a meaningful partnership between radiation safety professionals and the biomedical research community. These practices are intended to enhance radiation protection and the efficiency of the research staff. The consensus guidelines will lessen the variability in radiation safety practices that is evident among many academic research institutions and will encourage better acceptance and regulatory compliance by users of radioactive materials in biomedical research. PMID:8919082

  2. Canadian student leaders' perspective on interprofessional education: A consensus statement.

    PubMed

    Chicorelli, Jennifer; Dennie, Anik; Heinrich, Christina; Hinchey, Blake; Honarparvar, Faraz; Jennings, Morgan; Keefe, Chad; Metro, Trisha Lee; Peel, Celeste; Snowdon, Cordelia; Tempelman, Justine; Wong, Melody Elise; Forbes, Susan L; Livingston, Lori A

    2016-07-01

    The purpose of this article is to report on the outcomes of an interprofessional education (IPE) consensus-building exercise amongst student leaders enrolled in health science-related degree programs. The 12 participants included undergraduate and graduate students from eight different universities situated in five Canadian provinces. Their areas of study spanned a broad range of professions and disciplines including child and youth care, health promotion, nursing, kinesiology, medicine, physical education, psychology, and social work. A consensus statement regarding IPE and, more specifically, "what we know," "what we don't know," and "where do we go from here" is presented. These insights are unique, and a willingness to embrace them may be critical in building the next generation of improved IPE offerings across the country. PMID:27268765

  3. A failed platform: The Citizen Consensus Conference travels to Chile.

    PubMed

    Ureta, Sebastián

    2016-05-01

    This article starts by reviewing the setbacks that the recent Science and Technology Studies literature has identified in the functioning of technologies of democracy, the different arrangements that look to enact deliberation on technoscientific issues. Putting a focus on the Citizen Consensus Conference, it then proposes that several of these setbacks are related to the kind of "work" that these technologies are expected to do, identifying two kinds of it: performing a laboratory-based experiment and constituting a platform for the dissemination of facts. It then applies this framework to study a Citizen Consensus Conference carried out in Chile in 2003. After a detailed genealogy of the planning, implementation and afterlife of this exercise, the article concludes that several of the limitations experienced are derived from a "successful outcome" conceived as solely running a neat lab-based experiment, arguing for the need to incorporate its functioning as a platform with all the associated transformations and messiness. PMID:25573750

  4. After seven years, where`s the consensus?

    SciTech Connect

    Norman, M.R.

    1993-04-01

    It has been 7 years since the discovery of copper oxide superconductors, yet there is no consensus on the correct theory for this phenomenon. The theory can be divided into 3 groups: ordinary (phonons), exotic (AF spin fluctuations, nested Fermi liquid, excitons, spin bags, odd frequency pairing), and revolutionary (Luttinger liquid, spin-charge separation, gauge theories, anyons, marginal Fermi liquid). C-axis dispersion, dHvA, and magneto-oscillations are also discussed.

  5. Global Consensus Recommendations on Prevention and Management of Nutritional Rickets

    PubMed Central

    Munns, Craig F.; Shaw, Nick; Kiely, Mairead; Specker, Bonny L.; Thacher, Tom D.; Ozono, Keiichi; Michigami, Toshimi; Tiosano, Dov; Mughal, M. Zulf; Mäkitie, Outi; Ramos-Abad, Lorna; Ward, Leanne; DiMeglio, Linda A.; Atapattu, Navoda; Cassinelli, Hamilton; Braegger, Christian; Pettifor, John M.; Seth, Anju; Idris, Hafsatu Wasagu; Bhatia, Vijayalakshmi; Fu, Junfen; Goldberg, Gail; Sävendahl, Lars; Khadgawat, Rajesh; Pludowski, Pawel; Maddock, Jane; Hyppönen, Elina; Oduwole, Abiola; Frew, Emma; Aguiar, Magda; Tulchinsky, Ted; Butler, Gary

    2016-01-01

    Background: Vitamin D and calcium deficiencies are common worldwide, causing nutritional rickets and osteomalacia, which have a major impact on health, growth, and development of infants, children, and adolescents; the consequences can be lethal or can last into adulthood. The goals of this evidence-based consensus document are to provide health care professionals with guidance for prevention, diagnosis, and management of nutritional rickets and to provide policy makers with a framework to work toward its eradication. Evidence: A systematic literature search examining the definition, diagnosis, treatment, and prevention of nutritional rickets in children was conducted. Evidence-based recommendations were developed using the Grading of Recommendations, Assessment, Development and Evaluation (GRADE) system that describe the strength of the recommendation and the quality of supporting evidence. Process: Thirty-three nominated experts in pediatric endocrinology, pediatrics, nutrition, epidemiology, public health, and health economics evaluated the evidence on specific questions within five working groups. The consensus group, representing 11 international scientific organizations, participated in a multiday conference in May 2014 to reach a global evidence-based consensus. Results: This consensus document defines nutritional rickets and its diagnostic criteria and describes the clinical management of rickets and osteomalacia. Risk factors, particularly in mothers and infants, are ranked, and specific prevention recommendations including food fortification and supplementation are offered for both the clinical and public health contexts. Conclusion: Rickets, osteomalacia, and vitamin D and calcium deficiencies are preventable global public health problems in infants, children, and adolescents. Implementation of international rickets prevention programs, including supplementation and food fortification, is urgently required. PMID:26745253

  6. Consensusability of multi-agent systems via observer with limited communication data rate

    NASA Astrophysics Data System (ADS)

    Liu, Kai; Mu, Xiaowu

    2016-11-01

    This paper investigates the consensusability of multi-agent systems via observer with limited communication data. A novel algorithm to determine the parameters of quantizer and encoder is provided. The observer-based consensusability with unlimited bandwidth and observer-based consensusability with communication data rate are discussed separately. Finally, a simulation is given to illustrate the results.

  7. Food Security: The Elaboration of Contested Claims to a Consensus Frame

    ERIC Educational Resources Information Center

    Mooney, Patrick H.; Hunt, Scott A.

    2009-01-01

    This article demonstrates Gamson's claim that behind the apparent agreement implied by "consensus frames" lies considerable dissensus. Ironically, the very potency of consensus frames may generate contested claims to the ownership of a social problem. Food security is a potent consensus frame that has generated at least three distinct collective…

  8. Consensus on Surgical Management of Myeloma Bone Disease.

    PubMed

    2016-08-01

    Myeloma bone disease (MBD), the skeletal lesions caused by multiple myeloma, is also known as skeletal related events and includes bone pain, osteoporosis, pathological fractures, osteolytic bone lesions, spinal instability, spinal cord and nerve root compression and extramedullary plasmacytoma. It is now generally accepted that patients with these complications usually require surgical management and that such treatment is safe and effective. The aims of surgical interventions are to alleviate pain, improve quality of life, treat potential or existing pathological fractures, decompress the spinal cord and nerve roots, and reestablish bone continuity. Thus far, there have not been uniform standards for surgical treatment of MBD. The Surgeon's Committee of the Chinese Myeloma Working Group has therefore achieved a consensus with the aim of providing guidance for clinicians and benefitting patients with MBD. This consensus focuses on the treatment of MBD, including its clinical definition and characteristics, diagnosis and surgical management. This expert consensus document was compiled after discussion and revision by experts from several relevant institutions in China. However, it is only an interim guide that cannot be enforced legally. It will be updated with development of new techniques of treatment. PMID:27627707

  9. Synchronous consensus under hybrid process and link failures☆

    PubMed Central

    Biely, Martin; Schmid, Ulrich; Weiss, Bettina

    2011-01-01

    We introduce a comprehensive hybrid failure model for synchronous distributed systems, which extends a conventional hybrid process failure model by adding communication failures: Every process in the system is allowed to commit up to fℓs send link failures and experience up to fℓr receive link failures per round here, without being considered faulty; up to some fℓsa≤fℓs and fℓra≤fℓr among those may even cause erroneous messages rather than just omissions. In a companion paper (Schmid et al. (2009) [14]), devoted to a complete suite of related impossibility results and lower bounds, we proved that this model surpasses all existing link failure modeling approaches in terms of the assumption coverage in a simple probabilistic setting. In this paper, we show that several well-known synchronous consensus algorithms can be adapted to work under our failure model, provided that the number of processes required for tolerating process failures is increased by small integer multiples of fℓs, fℓr, fℓsa, fℓra. This is somewhat surprising, given that consensus in the presence of unrestricted link failures and mobile (moving) process omission failures is impossible. We provide detailed formulas for the required number of processes and rounds, which reveal that the lower bounds established in our companion paper are tight. We also explore the power and limitations of authentication in our setting, and consider uniform consensus algorithms, which guarantee their properties also for benign faulty processes. PMID:22031791

  10. Spanish Consensus Statement: The Treatment of Muscle Tears in Sport.

    PubMed

    Fernandez-Jaén, Tomas F; Rey, Guillermo Álvarez; Cuesta, Jordi Ardevol; Loureda, Rafael Arriaza; España, Fernando Ávila; Matas, Ramón Balius; Pazos, Fernando Baró; de Dios Beas Jiménez, Juan; Rosell, Jorge Candel; Fernandez, César Cobián; Ros, Francisco Esparza; Colmenero, Josefina Espejo; de Prado, Jorge Fernández; Cota, Juan José García; González, Jose Ignacio Garrido; Santander, Manuela González; Munilla, Miguel Ángel Herrador; Ruiz, Francisco Ivorra; Díaz, Fernando Jiménez; Marqueta, Pedro Manonelles; Fernandez, Antonio Maestro; Benito, Juan José Muñoz; Vilás, Ramón Olivé; Teres, Xavier Peirau; Amaro, José Peña; Roque, Juan Pérez San; Parenteu, Christophe Ramírez; Serna, Juan Ribas; Álvarez, Mikel Sánchez; Marchori, Carlos Sanchez; Soto, Miguel Del Valle; Alonso, José María Villalón; García, Pedro Guillen; de la Iglesia, Nicolas Hugo; Alcorocho, Juan Manuel Lopez

    2015-12-01

    On the 21st of March, 2015, experts met at Clínica CEMTRO in Madrid, Spain, under the patronage of The Spanish Society for Sports Traumatology (SETRADE), The Spanish Federation of Sports Medicine (FEMEDE), The Spanish Association of Medical Services for Football Clubs (AEMEF), and The Spanish Association of Medical Services for Basketball Clubs (AEMB) with the aim of establishing a round table that would allow specialists to consider the most appropriate current general actions to be taken when treating muscle tears in sport, based on proven scientific data described in the medical literature. Each expert received a questionnaire prior to the aforementioned meeting comprising a set of questions concerning therapeutic indications generally applied in the different stages present during muscle repair. The present Consensus Document is the result of the answers to the questionnaire and resulting discussion and consensus over which are the best current indications in the treatment of muscle tears in sport. Avoiding immobilization, not taking nonsteroidal anti-inflammatory drugs (NSAIDs) randomly, fostering early mobilization, increasing vascularization of injured, site and regulating inflammatory mechanisms-without inhibiting these from the early stages of the recovery period-all stood out as main points of the Consensus Document. Additionally, there is controversy concerning cell stimulation techniques and the use of growth factors or cell inhibitors. The decision concerning discharge was unanimous, as was the criteria considered when it came to performing sport techniques without pain.

  11. Time for a neonatal–specific consensus definition for sepsis

    PubMed Central

    Wynn, James L.; Wong, Hector R.; Shanley, Thomas P.; Bizzarro, Matthew J.; Saiman, Lisa; Polin, Richard A.

    2014-01-01

    Objective To review the accuracy of the pediatric consensus definition of sepsis in term neonates and to determine the definition of neonatal sepsis used. Study selection The review focused primarily on pediatric literature relevant to the topic of interest. Conclusions Neonatal sepsis is variably defined based on a number of clinical and laboratory criteria that make the study of this common and devastating condition very difficult. Diagnostic challenges and uncertain disease epidemiology necessarily result from a variable definition of disease. In 2005, intensivists caring for children recognized that as new drugs became available, children would be increasingly studied and thus, pediatric-specific consensus definitions were needed. Pediatric sepsis criteria are not accurate for term neonates and have not been examined in preterm neonates for whom the developmental stage influences aberrations associated with host immune response. Thus, specific consensus definitions for both term and preterm neonates are needed. Such definitions are critical for the interpretation of observational studies, future training of scientists and practitioners, and implementation of clinical trials in neonates. PMID:24751791

  12. C1 inhibitor deficiency: 2014 United Kingdom consensus document.

    PubMed

    Longhurst, H J; Tarzi, M D; Ashworth, F; Bethune, C; Cale, C; Dempster, J; Gompels, M; Jolles, S; Seneviratne, S; Symons, C; Price, A; Edgar, D

    2015-06-01

    C1 inhibitor deficiency is a rare disorder manifesting with recurrent attacks of disabling and potentially life-threatening angioedema. Here we present an updated 2014 United Kingdom consensus document for the management of C1 inhibitor-deficient patients, representing a joint venture between the United Kingdom Primary Immunodeficiency Network and Hereditary Angioedema UK. To develop the consensus, we assembled a multi-disciplinary steering group of clinicians, nurses and a patient representative. This steering group first met in 2012, developing a total of 48 recommendations across 11 themes. The statements were distributed to relevant clinicians and a representative group of patients to be scored for agreement on a Likert scale. All 48 statements achieved a high degree of consensus, indicating strong alignment of opinion. The recommendations have evolved significantly since the 2005 document, with particularly notable developments including an improved evidence base to guide dosing and indications for acute treatment, greater emphasis on home therapy for acute attacks and a strong focus on service organization. PMID:25605519

  13. Probabilistic consensus scoring improves tandem mass spectrometry peptide identification.

    PubMed

    Nahnsen, Sven; Bertsch, Andreas; Rahnenführer, Jörg; Nordheim, Alfred; Kohlbacher, Oliver

    2011-08-01

    Database search is a standard technique for identifying peptides from their tandem mass spectra. To increase the number of correctly identified peptides, we suggest a probabilistic framework that allows the combination of scores from different search engines into a joint consensus score. Central to the approach is a novel method to estimate scores for peptides not found by an individual search engine. This approach allows the estimation of p-values for each candidate peptide and their combination across all search engines. The consensus approach works better than any single search engine across all different instrument types considered in this study. Improvements vary strongly from platform to platform and from search engine to search engine. Compared to the industry standard MASCOT, our approach can identify up to 60% more peptides. The software for consensus predictions is implemented in C++ as part of OpenMS, a software framework for mass spectrometry. The source code is available in the current development version of OpenMS and can easily be used as a command line application or via a graphical pipeline designer TOPPAS.

  14. Spanish Consensus Statement: The Treatment of Muscle Tears in Sport.

    PubMed

    Fernandez-Jaén, Tomas F; Rey, Guillermo Álvarez; Cuesta, Jordi Ardevol; Loureda, Rafael Arriaza; España, Fernando Ávila; Matas, Ramón Balius; Pazos, Fernando Baró; de Dios Beas Jiménez, Juan; Rosell, Jorge Candel; Fernandez, César Cobián; Ros, Francisco Esparza; Colmenero, Josefina Espejo; de Prado, Jorge Fernández; Cota, Juan José García; González, Jose Ignacio Garrido; Santander, Manuela González; Munilla, Miguel Ángel Herrador; Ruiz, Francisco Ivorra; Díaz, Fernando Jiménez; Marqueta, Pedro Manonelles; Fernandez, Antonio Maestro; Benito, Juan José Muñoz; Vilás, Ramón Olivé; Teres, Xavier Peirau; Amaro, José Peña; Roque, Juan Pérez San; Parenteu, Christophe Ramírez; Serna, Juan Ribas; Álvarez, Mikel Sánchez; Marchori, Carlos Sanchez; Soto, Miguel Del Valle; Alonso, José María Villalón; García, Pedro Guillen; de la Iglesia, Nicolas Hugo; Alcorocho, Juan Manuel Lopez

    2015-12-01

    On the 21st of March, 2015, experts met at Clínica CEMTRO in Madrid, Spain, under the patronage of The Spanish Society for Sports Traumatology (SETRADE), The Spanish Federation of Sports Medicine (FEMEDE), The Spanish Association of Medical Services for Football Clubs (AEMEF), and The Spanish Association of Medical Services for Basketball Clubs (AEMB) with the aim of establishing a round table that would allow specialists to consider the most appropriate current general actions to be taken when treating muscle tears in sport, based on proven scientific data described in the medical literature. Each expert received a questionnaire prior to the aforementioned meeting comprising a set of questions concerning therapeutic indications generally applied in the different stages present during muscle repair. The present Consensus Document is the result of the answers to the questionnaire and resulting discussion and consensus over which are the best current indications in the treatment of muscle tears in sport. Avoiding immobilization, not taking nonsteroidal anti-inflammatory drugs (NSAIDs) randomly, fostering early mobilization, increasing vascularization of injured, site and regulating inflammatory mechanisms-without inhibiting these from the early stages of the recovery period-all stood out as main points of the Consensus Document. Additionally, there is controversy concerning cell stimulation techniques and the use of growth factors or cell inhibitors. The decision concerning discharge was unanimous, as was the criteria considered when it came to performing sport techniques without pain. PMID:27213161

  15. Consensus methods for medical and health services research.

    PubMed Central

    Jones, J.; Hunter, D.

    1995-01-01

    Health providers face the problem of trying to make decisions in situations where there is insufficient information and also where there is an overload of (often contradictory) information. Statistical methods such as meta-analysis have been developed to summarise and to resolve inconsistencies in study findings--where information is available in an appropriate form. Consensus methods provide another means of synthesising information, but are liable to use a wider range of information than is common in statistical methods, and where published information is inadequate or non-existent these methods provide a means of harnessing the insights of appropriate experts to enable decisions to be made. Two consensus methods commonly adopted in medical, nursing, and health services research--the Delphi process and the nominal group technique (also known as the expert panel)--are described, together with the most appropriate situations for using them; an outline of the process involved in undertaking a study using each method is supplemented by illustrations of the authors' work. Key methodological issues in using the methods are discussed, along with the distinct contribution of consensus methods as aids to decision making, both in clinical practice and in health service development. Images p377-a PMID:7640549

  16. Synchronous consensus under hybrid process and link failures.

    PubMed

    Biely, Martin; Schmid, Ulrich; Weiss, Bettina

    2011-09-16

    WE INTRODUCE A COMPREHENSIVE HYBRID FAILURE MODEL FOR SYNCHRONOUS DISTRIBUTED SYSTEMS, WHICH EXTENDS A CONVENTIONAL HYBRID PROCESS FAILURE MODEL BY ADDING COMMUNICATION FAILURES: Every process in the system is allowed to commit up to fℓs send link failures and experience up to fℓr receive link failures per round here, without being considered faulty; up to some fℓsa≤fℓs and fℓra≤fℓr among those may even cause erroneous messages rather than just omissions. In a companion paper (Schmid et al. (2009) [14]), devoted to a complete suite of related impossibility results and lower bounds, we proved that this model surpasses all existing link failure modeling approaches in terms of the assumption coverage in a simple probabilistic setting.In this paper, we show that several well-known synchronous consensus algorithms can be adapted to work under our failure model, provided that the number of processes required for tolerating process failures is increased by small integer multiples of fℓs, fℓr, fℓsa, fℓra. This is somewhat surprising, given that consensus in the presence of unrestricted link failures and mobile (moving) process omission failures is impossible. We provide detailed formulas for the required number of processes and rounds, which reveal that the lower bounds established in our companion paper are tight. We also explore the power and limitations of authentication in our setting, and consider uniform consensus algorithms, which guarantee their properties also for benign faulty processes.

  17. Regulatory evolution in proteins by turnover and lineage-specific changes of cyclin-dependent kinase consensus sites

    PubMed Central

    Moses, Alan M.; Liku, Muluye E.; Li, Joachim J.; Durbin, Richard

    2007-01-01

    Evolutionary change in gene regulation is a key mechanism underlying the genetic component of organismal diversity. Here, we study evolution of regulation at the posttranslational level by examining the evolution of cyclin-dependent kinase (CDK) consensus phosphorylation sites in the protein subunits of the pre-replicative complex (RC). The pre-RC, an assembly of proteins formed during an early stage of DNA replication, is believed to be regulated by CDKs throughout the animals and fungi. Interestingly, although orthologous pre-RC components often contain clusters of CDK consensus sites, the positions and numbers of sites do not seem conserved. By analyzing protein sequences from both distantly and closely related species, we confirm that consensus sites can turn over rapidly even when the local cluster of sites is preserved, consistent with the notion that precise positioning of phosphorylation events is not required for regulation. We also identify evolutionary changes in the clusters of sites and further examine one replication protein, Mcm3, where a cluster of consensus sites near a nucleocytoplasmic transport signal is confined to a specific lineage. We show that the presence or absence of the cluster of sites in different species is associated with differential regulation of the transport signal. These findings suggest that the CDK regulation of MCM nuclear localization was acquired in the lineage leading to Saccharomyces cerevisiae after the divergence with Candida albicans. Our results begin to explore the dynamics of regulatory evolution at the posttranslational level and show interesting similarities to recent observations of regulatory evolution at the level of transcription. PMID:17978194

  18. Consensus HIV-1 subtype A integrase and its raltegravir-resistant variants: design and characterization of the enzymatic properties.

    PubMed

    Shadrina, Olga; Krotova, Olga; Agapkina, Julia; Knyazhanskaya, Ekaterina; Korolev, Sergey; Starodubova, Elizaveta; Viklund, Alecia; Lukashov, Vladimir; Magnani, Mauro; Medstrand, Patrik; Karpov, Vadim; Gottikh, Marina; Isaguliants, Maria

    2014-07-01

    Model studies of the subtype B and non-subtype B integrases are still required to compare their susceptibility to antiretroviral drugs, evaluate the significance of resistance mutations and identify the impact of natural polymorphisms on the level of enzymatic reactivity. We have therefore designed the consensus integrase of the HIV-1 subtype A strain circulating in the former Soviet Union territory (FSU-A) and two of its variants with mutations of resistance to the strand transfer inhibitor raltegravir. Their genes were synthesized, and expressed in E coli; corresponding His-tagged proteins were purified using the affinity chromatography. The enzymatic properties of the consensus integrases and their sensitivity to raltegravir were examined in a series of standard in vitro reactions and compared to the properties of the integrase of HIV-1 subtype B strain HXB2. The consensus enzyme demonstrated similar DNA-binding properties, but was significantly more active than HXB-2 integrase in the reactions of DNA cleavage and integration. All integrases were equally susceptible to inhibition by raltegravir and elvitegravir, indicating that the sporadic polymorphisms inherent to the HXB-2 enzyme have little effect on its susceptibility to drugs. Insensitivity of the mutated enzymes to the inhibitors of strand transfer occurred at a cost of a 30-90% loss of the efficacies of both 3'-processing and strand transfer. This is the first study to describe the enzymatic properties of the consensus integrase of HIV-1 clade A and the effects of the resistance mutations when the complex actions of sporadic sequence polymorphisms are excluded. PMID:24594066

  19. Complete Genome Sequence of Border Disease Virus Genotype 3 Strain Gifhorn

    PubMed Central

    Fahnøe, Ulrik; Höper, Dirk; Schirrmeier, Horst; Beer, Martin

    2014-01-01

    The complete genome sequence of the genotype 3 border disease virus strain Gifhorn has been determined; this strain was originally isolated from pigs. This represents the consensus sequence for the virus used to produce the bacterial artificial chromosome (BAC) cDNA clone pBeloGif3, which yields a virus that is severely attenuated in cell culture. PMID:24435861

  20. Genome Sequence of a Novel Archaeal Rudivirus Recovered from a Mexican Hot Spring

    PubMed Central

    Peng, Xu; Garrett, Roger A.; Martínez-Romero, Esperanza

    2013-01-01

    We report the consensus genome sequence of a novel GC-rich rudivirus, designated SMR1 (Sulfolobales Mexican rudivirus 1), assembled from a high-throughput sequenced environmental sample from a hot spring in Los Azufres National Park in western Mexico. PMID:23405288

  1. Challenges with using primer IDs to improve accuracy of next generation sequencing.

    PubMed

    Brodin, Johanna; Hedskog, Charlotte; Heddini, Alexander; Benard, Emmanuel; Neher, Richard A; Mild, Mattias; Albert, Jan

    2015-01-01

    Next generation sequencing technologies, like ultra-deep pyrosequencing (UDPS), allows detailed investigation of complex populations, like RNA viruses, but its utility is limited by errors introduced during sample preparation and sequencing. By tagging each individual cDNA molecule with barcodes, referred to as Primer IDs, before PCR and sequencing these errors could theoretically be removed. Here we evaluated the Primer ID methodology on 257,846 UDPS reads generated from a HIV-1 SG3Δenv plasmid clone and plasma samples from three HIV-infected patients. The Primer ID consisted of 11 randomized nucleotides, 4,194,304 combinations, in the primer for cDNA synthesis that introduced a unique sequence tag into each cDNA molecule. Consensus template sequences were constructed for reads with Primer IDs that were observed three or more times. Despite high numbers of input template molecules, the number of consensus template sequences was low. With 10,000 input molecules for the clone as few as 97 consensus template sequences were obtained due to highly skewed frequency of resampling. Furthermore, the number of sequenced templates was overestimated due to PCR errors in the Primer IDs. Finally, some consensus template sequences were erroneous due to hotspots for UDPS errors. The Primer ID methodology has the potential to provide highly accurate deep sequencing. However, it is important to be aware that there are remaining challenges with the methodology. In particular it is important to find ways to obtain a more even frequency of resampling of template molecules as well as to identify and remove artefactual consensus template sequences that have been generated by PCR errors in the Primer IDs.

  2. Non-consensus Opinion Models on Complex Networks

    NASA Astrophysics Data System (ADS)

    Li, Qian; Braunstein, Lidia A.; Wang, Huijuan; Shao, Jia; Stanley, H. Eugene; Havlin, Shlomo

    2013-04-01

    Social dynamic opinion models have been widely studied to understand how interactions among individuals cause opinions to evolve. Most opinion models that utilize spin interaction models usually produce a consensus steady state in which only one opinion exists. Because in reality different opinions usually coexist, we focus on non-consensus opinion models in which above a certain threshold two opinions coexist in a stable relationship. We revisit and extend the non-consensus opinion (NCO) model introduced by Shao et al. (Phys. Rev. Lett. 103:01870, 2009). The NCO model in random networks displays a second order phase transition that belongs to regular mean field percolation and is characterized by the appearance (above a certain threshold) of a large spanning cluster of the minority opinion. We generalize the NCO model by adding a weight factor W to each individual's original opinion when determining their future opinion (NCO W model). We find that as W increases the minority opinion holders tend to form stable clusters with a smaller initial minority fraction than in the NCO model. We also revisit another non-consensus opinion model based on the NCO model, the inflexible contrarian opinion (ICO) model (Li et al. in Phys. Rev. E 84:066101, 2011), which introduces inflexible contrarians to model the competition between two opinions in a steady state. Inflexible contrarians are individuals that never change their original opinion but may influence the opinions of others. To place the inflexible contrarians in the ICO model we use two different strategies, random placement and one in which high-degree nodes are targeted. The inflexible contrarians effectively decrease the size of the largest rival-opinion cluster in both strategies, but the effect is more pronounced under the targeted method. All of the above models have previously been explored in terms of a single network, but human communities are usually interconnected, not isolated. Because opinions propagate not

  3. Partial molecular cloning of the JHK retrovirus using gammaretrovirus consensus PCR primers

    PubMed Central

    Halligan, Brian D; Sun, Hai-Yuan; Kushnaryov, Vladimir M; Grossberg, Sidney E

    2013-01-01

    The JHK virus (JHKV) was previously described as a type C retrovirus that has some distinctive ultrastructural features and replicates constitutively in a human B-lymphoblastoid cell line, JHK-3. In order to facilitate the cloning of sequences from JHKV, a series of partially degenerate consensus retroviral PCR primers were created by a data-driven design approach based on an alignment of 14 diverse gammaretroviral genomes. These primers were used in the PCR amplification of purified JHK virion cDNA, and ana lysis of the resulting amplified sequence indicates that the JHKV is in the murine leukemia virus (MLV) family. The JHK sequence is nearly identical to the corresponding region of the Bxv-1 endogenous mouse retrovirus (GenBank accession AC115959) and distinct from XMRV. JHKV gag-specific amplification was demonstrated with nucleic acids from uncultivated, frozen, peripheral blood mononuclear cells (PBMCs) of the index patient, but not in PBMCs from nine healthy blood donors. Unlike earlier reports, in which MLV-like sequences were identified in human source material, which may have been due to murine contamination, budding retrovirions were demonstrated repeatedly by electron microscopy in uncultivated lymphocytes of the index patient that were morphologically identical in their development to the virions in the JHK-3 cells, and immunological evidence was obtained that the index patient produced IgG antibodies that bound to the budding viral particles in patient PBMCs and in the JHK-3 cells. These data indicate that the patient had been infected by JHKV, lending significance to the demonstration of JHKV amplicons in nucleic acids of the patient’s PBMCs. In future studies, the PCR primer sets described herein may expand the detection of an amplifiable subset of viruses related to MLV. PMID:24159361

  4. Globally, unrelated protein sequences appear random

    PubMed Central

    Lavelle, Daniel T.; Pearson, William R.

    2010-01-01

    Motivation: To test whether protein folding constraints and secondary structure sequence preferences significantly reduce the space of amino acid words in proteins, we compared the frequencies of four- and five-amino acid word clumps (independent words) in proteins to the frequencies predicted by four random sequence models. Results: While the human proteome has many overrepresented word clumps, these words come from large protein families with biased compositions (e.g. Zn-fingers). In contrast, in a non-redundant sample of Pfam-AB, only 1% of four-amino acid word clumps (4.7% of 5mer words) are 2-fold overrepresented compared with our simplest random model [MC(0)], and 0.1% (4mers) to 0.5% (5mers) are 2-fold overrepresented compared with a window-shuffled random model. Using a false discovery rate q-value analysis, the number of exceptional four- or five-letter words in real proteins is similar to the number found when comparing words from one random model to another. Consensus overrepresented words are not enriched in conserved regions of proteins, but four-letter words are enriched 1.18- to 1.56-fold in α-helical secondary structures (but not β-strands). Five-residue consensus exceptional words are enriched for α-helix 1.43- to 1.61-fold. Protein word preferences in regular secondary structure do not appear to significantly restrict the use of sequence words in unrelated proteins, although the consensus exceptional words have a secondary structure bias for α-helix. Globally, words in protein sequences appear to be under very few constraints; for the most part, they appear to be random. Contact: wrp@virginia.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19948773

  5. "Ditto Heads": Do Conservatives Perceive Greater Consensus Within Their Ranks Than Liberals?

    PubMed

    Stern, Chadly; West, Tessa V; Jost, John T; Rule, Nicholas O

    2014-06-27

    In three studies, we examined (a) whether conservatives possess a stronger desire to share reality than liberals and are therefore more likely to perceive consensus with politically like-minded others even for non-political judgments and, if so, (b) whether motivated perceptions of consensus would give conservatives an edge in progressing toward collective goals. In Study 1, participants estimated ingroup consensus on non-political judgments. Conservatives perceived more ingroup consensus than liberals, regardless of the amount of actual consensus. The desire to share reality mediated the relationship between ideology and perceived ingroup consensus. Study 2 replicated these results and demonstrated that perceiving ingroup consensus predicted a sense of collective efficacy in politics. In Study 3, experimental manipulations of affiliative motives eliminated ideological differences in the desire to share reality. A sense of collective efficacy predicted intentions to vote in a major election. Implications for the attainment of shared goals are discussed. PMID:24972941

  6. Scientists Are from Mars, Laypeople Are from Venus: An Evidence-Based Approach to Consensus Messaging

    NASA Astrophysics Data System (ADS)

    Cook, J.; Jacobs, P.; Nuccitelli, D.

    2014-12-01

    Laypeople use expert opinion as a mental shortcut to form views on complex scientific issues. This heuristic is particularly relevant in the case of climate change, where perception of consensus is one of the main predictors of public support for climate action. A low public perception of consensus (around 60% compared to the actual 97% consensus) is a significant stumbling block to meaningful climate action, underscoring the importance of closing the "consensus gap". However, some scientists question the efficacy or appropriateness of emphasizing consensus in climate communication. I'll summarize the social science research examining the importance and effectiveness of consensus messaging. I'll also present several case studies of consensus messaging employed by the team of communicators at the Skeptical Science website.

  7. Analysis of the structural consensus of the zinc coordination centers of metalloprotein structures.

    PubMed

    Patel, Kirti; Kumar, Anil; Durani, Susheel

    2007-10-01

    In a recent sequence-analysis study it was concluded that up to 10% of the human proteome could be comprised of zinc proteins, quite varied in the functional spread. The native structures of only few of the proteins are actually established. The elucidation of rest of the sequences of not just human but even other actively investigated genomes may benefit from knowledge of the structural consensus of the zinc-binding centers of the currently known zinc proteins. Nearly four hundred X-ray and NMR structures in the database of zinc-protein structures available as of April 2007 were investigated for geometry and conformation in the zinc-binding centers; separately for the structural and catalytic proteins and individually in the zinc centers coordinated to three and four amino-acid ligands. Enhanced cysteine involvement in agreement with the observation in human proteome has been detected in contrast with previous reports. Deviations from ideal coordination geometries are detected, possible underlying reasons are investigated, and correlations of geometry and conformation in zinc-coordination centers with protein function are established, providing possible benchmarks for putative zinc-binding patterns of the burgeoning genome data.

  8. A consensus linkage map of oil palm and a major QTL for stem height

    PubMed Central

    Lee, May; Xia, Jun Hong; Zou, Zhongwei; Ye, Jian; Rahmadsyah; Alfiko, Yuzer; Jin, Jingjing; Lieando, Jessica Virginia; Purnamasari, Maria Indah; Lim, Chin Huat; Suwanto, Antonius; Wong, Limsoon; Chua, Nam-Hai; Yue, Gen Hua

    2015-01-01

    Oil palm (Elaeis guinensis Jacquin) is the most important source of vegetable oil and fat. Several linkage maps had been constructed using dominant and co-dominant markers to facilitate mapping of QTL. However, dominant markers are not easily transferable among different laboratories. We constructed a consensus linkage map for oil palm using co-dominant markers (i.e. microsatellite and SNPs) and two F1 breeding populations generated by crossing Dura and Pisifera individuals. Four hundreds and forty-four microsatellites and 36 SNPs were mapped onto 16 linkage groups. The map length was 1565.6 cM, with an average marker space of 3.72 cM. A genome-wide scan of QTL identified a major QTL for stem height on the linkage group 5, which explained 51% of the phenotypic variation. Genes in the QTL were predicted using the palm genome sequence and bioinformatic tools. The linkage map supplies a base for mapping QTL for accelerating the genetic improvement, and will be also useful in the improvement of the assembly of the genome sequences. Markers linked to the QTL may be used in selecting dwarf trees. Genes within the QTL will be characterized to understand the mechanisms underlying dwarfing. PMID:25648560

  9. Consensus recommendations for a standardized Brain Tumor Imaging Protocol in clinical trials

    PubMed Central

    Ellingson, Benjamin M.; Bendszus, Martin; Boxerman, Jerrold; Barboriak, Daniel; Erickson, Bradley J.; Smits, Marion; Nelson, Sarah J.; Gerstner, Elizabeth; Alexander, Brian; Goldmacher, Gregory; Wick, Wolfgang; Vogelbaum, Michael; Weller, Michael; Galanis, Evanthia; Kalpathy-Cramer, Jayashree; Shankar, Lalitha; Jacobs, Paula; Pope, Whitney B.; Yang, Dewen; Chung, Caroline; Knopp, Michael V.; Cha, Soonme; van den Bent, Martin J.; Chang, Susan; Al Yung, W.K.; Cloughesy, Timothy F.; Wen, Patrick Y.; Gilbert, Mark R.

    2015-01-01

    A recent joint meeting was held on January 30, 2014, with the US Food and Drug Administration (FDA), National Cancer Institute (NCI), clinical scientists, imaging experts, pharmaceutical and biotech companies, clinical trials cooperative groups, and patient advocate groups to discuss imaging endpoints for clinical trials in glioblastoma. This workshop developed a set of priorities and action items including the creation of a standardized MRI protocol for multicenter studies. The current document outlines consensus recommendations for a standardized Brain Tumor Imaging Protocol (BTIP), along with the scientific and practical justifications for these recommendations, resulting from a series of discussions between various experts involved in aspects of neuro-oncology neuroimaging for clinical trials. The minimum recommended sequences include: (i) parameter-matched precontrast and postcontrast inversion recovery-prepared, isotropic 3D T1-weighted gradient-recalled echo; (ii) axial 2D T2-weighted turbo spin-echo acquired after contrast injection and before postcontrast 3D T1-weighted images to control timing of images after contrast administration; (iii) precontrast, axial 2D T2-weighted fluid-attenuated inversion recovery; and (iv) precontrast, axial 2D, 3-directional diffusion-weighted images. Recommended ranges of sequence parameters are provided for both 1.5 T and 3 T MR systems. PMID:26250565

  10. PRECISE: a Database of Predicted and Consensus Interaction Sites in Enzymes.

    PubMed

    Sheu, Shu-Hsien; Lancia, David R; Clodfelter, Karl H; Landon, Melissa R; Vajda, Sandor

    2005-01-01

    PRECISE (Predicted and Consensus Interaction Sites in Enzymes) is a database of interactions between the amino acid residues of an enzyme and its ligands (substrate and transition state analogs, cofactors, inhibitors and products). It is available online at http://precise.bu.edu/. In the current version, all information on interactions is extracted from the enzyme-ligand complexes in the Protein Data Bank (PDB) by performing the following steps: (i) clustering homologous enzyme chains such that, in each cluster, the proteins have the same EC number and all sequences are similar; (ii) selecting a representative chain for each cluster; (iii) selecting ligand types; (iv) finding non-bonded interactions and hydrogen bonds; and (v) summing the interactions for all chains within the cluster. The output of the search is the color-coded sequence of the representative. The colors indicate the total number of interactions found at each amino acid position in all chains of the cluster. Clicking on a residue displays a detailed list of interactions for that residue. Optional filters allow restricting the output to selected chains in the cluster, to non-bonded or hydrogen bonding interactions, and to selected ligand types. The binding site information is essential for understanding and altering substrate specificity and for the design of enzyme inhibitors.

  11. Development of a consensus reverse transcription PCR assay for the specific detection of tortoise picornaviruses.

    PubMed

    Marschang, Rachel E; Ihász, Katalin; Kugler, Renáta; Lengyel, György; Fehér, Enikő; Marton, Szilvia; Bányai, Krisztián; Aqrawi, Tara; Farkas, Szilvia L

    2016-05-01

    Picornaviruses (PVs) of different terrestrial tortoise species, previously designated as Virus "X," have been frequently detected from various tissues by virus isolation in Terrapene heart cell culture as the preferred laboratory method for diagnosis. Here, we describe the development of 2 diagnostic reverse transcription (RT)-PCR-based assays for the identification and characterization of tortoise PVs belonging to the tentative genus Topivirus To test the novel diagnostic systems, PVs were isolated from swab and tissue samples collected in Germany, Italy, and Hungary between 2000 and 2013. All 25 tested isolates gave positive results with both novel consensus primer sets. Sequencing of the amplified products confirmed that all studied viruses were members of the new proposed genus Topivirus Phylogenetic analyses clearly distinguished 2 lineages within the genus. Based on sequence analysis, no association was observed between the geographic distribution and genetic relatedness. Furthermore, no strict host specificity was indicated. The PCR-based diagnosis may provide a time-saving and sensitive method to detect tortoise PVs, and evaluation of PV presence in these animals may help control virus spread. PMID:27034342

  12. Archaebacterial rhodopsin sequences: Implications for evolution

    NASA Technical Reports Server (NTRS)

    Lanyi, J. K.

    1991-01-01

    It was proposed over 10 years ago that the archaebacteria represent a separate kingdom which diverged very early from the eubacteria and eukaryotes. It follows that investigations of archaebacterial characteristics might reveal features of early evolution. So far, two genes, one for bacteriorhodopsin and another for halorhodopsin, both from Halobacterium halobium, have been sequenced. We cloned and sequenced the gene coding for the polypeptide of another one of these rhodopsins, a halorhodopsin in Natronobacterium pharaonis. Peptide sequencing of cyanogen bromide fragments, and immuno-reactions of the protein and synthetic peptides derived from the C-terminal gene sequence, confirmed that the open reading frame was the structural gene for the pharaonis halorhodopsin polypeptide. The flanking DNA sequences of this gene, as well as those of other bacterial rhodopsins, were compared to previously proposed archaebacterial consensus sequences. In pairwise comparisons of the open reading frame with DNA sequences for bacterio-opsin and halo-opsin from Halobacterium halobium, silent divergences were calculated. These indicate very considerable evolutionary distance between each pair of genes, even in the dame organism. In spite of this, three protein sequences show extensive similarities, indicating strong selective pressures.

  13. RNA backbone: Consensus all-angle conformers and modular string nomenclature (an RNA Ontology Consortium contribution)

    PubMed Central

    Richardson, Jane S.; Schneider, Bohdan; Murray, Laura W.; Kapral, Gary J.; Immormino, Robert M.; Headd, Jeffrey J.; Richardson, David C.; Ham, Daniela; Hershkovits, Eli; Williams, Loren Dean; Keating, Kevin S.; Pyle, Anna Marie; Micallef, David; Westbrook, John; Berman, Helen M.

    2008-01-01

    A consensus classification and nomenclature are defined for RNA backbone structure using all of the backbone torsion angles. By a consensus of several independent analysis methods, 46 discrete conformers are identified as suitably clustered in a quality-filtered, multidimensional dihedral angle distribution. Most of these conformers represent identifiable features or roles within RNA structures. The conformers are given two-character names that reflect the seven-angle δεζαβγδ combinations empirically found favorable for the sugar-to-sugar “suite” unit within which the angle correlations are strongest (e.g., 1a for A-form, 5z for the start of S-motifs). Since the half-nucleotides are specified by a number for δεζ and a lowercase letter for αβγδ, this modular system can also be parsed to describe traditional nucleotide units (e.g., a1) or the dinucleotides (e.g., a1a1) that are especially useful at the level of crystallographic map fitting. This nomenclature can also be written as a string with two-character suite names between the uppercase letters of the base sequence (N1aG1gN1aR1aA1cN1a for a GNRA tetraloop), facilitating bioinformatic comparisons. Cluster means, standard deviations, coordinates, and examples are made available, as well as the Suitename software that assigns suite conformer names and conformer match quality (suiteness) from atomic coordinates. The RNA Ontology Consortium will combine this new backbone system with others that define base pairs, base-stacking, and hydrogen-bond relationships to provide a full description of RNA structural motifs. PMID:18192612

  14. MSLICE Sequencing

    NASA Technical Reports Server (NTRS)

    Crockett, Thomas M.; Joswig, Joseph C.; Shams, Khawaja S.; Norris, Jeffrey S.; Morris, John R.

    2011-01-01

    MSLICE Sequencing is a graphical tool for writing sequences and integrating them into RML files, as well as for producing SCMF files for uplink. When operated in a testbed environment, it also supports uplinking these SCMF files to the testbed via Chill. This software features a free-form textural sequence editor featuring syntax coloring, automatic content assistance (including command and argument completion proposals), complete with types, value ranges, unites, and descriptions from the command dictionary that appear as they are typed. The sequence editor also has a "field mode" that allows tabbing between arguments and displays type/range/units/description for each argument as it is edited. Color-coded error and warning annotations on problematic tokens are included, as well as indications of problems that are not visible in the current scroll range. "Quick Fix" suggestions are made for resolving problems, and all the features afforded by modern source editors are also included such as copy/cut/paste, undo/redo, and a sophisticated find-and-replace system optionally using regular expressions. The software offers a full XML editor for RML files, which features syntax coloring, content assistance and problem annotations as above. There is a form-based, "detail view" that allows structured editing of command arguments and sequence parameters when preferred. The "project view" shows the user s "workspace" as a tree of "resources" (projects, folders, and files) that can subsequently be opened in editors by double-clicking. Files can be added, deleted, dragged-dropped/copied-pasted between folders or projects, and these operations are undoable and redoable. A "problems view" contains a tabular list of all problems in the current workspace. Double-clicking on any row in the table opens an editor for the appropriate sequence, scrolling to the specific line with the problem, and highlighting the problematic characters. From there, one can invoke "quick fix" as described

  15. Laying the foundation for a Genomic Rosetta Stone: creating information hubs through the use of consensus identifiers.

    PubMed

    Van Brabant, Bart; Gray, Tanya; Verslyppe, Bert; Kyrpides, Nikos; Dietrich, Karin; Glöckner, Frank Oliver; Cole, James; Farris, Ryan; Schriml, Lynn M; De Vos, Paul; De Baets, Bernard; Field, Dawn; Dawyndt, Peter

    2008-06-01

    Given the growing wealth of downstream information, the integration of molecular and non-molecular data on a given organism has become a major challenge. For micro-organisms, this information now includes a growing collection of sequenced genes and complete genomes, and for communities of organisms it includes metagenomes. Integration of the data is facilitated by the existence of authoritative, community-recognized, consensus identifiers that may form the heart of so-called information knuckles. The Genomic Standards Consortium (GSC) is building a mapping of identifiers across a group of federated databases with the aim to improve navigation across these resources and to enable the integration of their information in the near future. In particular, this is possible because of the existence of INSDC Genome Project Identifiers (GPIDs) and accession numbers, and the ability of the community to define new consensus identifiers such as the culture identifiers used in the StrainInfo.net bioportal. Here we outline (1) the general design of the Genomic Rosetta Stone project, (2) introduce example linkages between key databases (that cover information about genomes, 16S rRNA gene sequences, and microbial biological resource centers), and (3) make an open call for participation in this project providing a vision for its future use. PMID:18479205

  16. Moving Toward Consensus on a Photovoltaic Generation Capacity Valuation Methodology

    SciTech Connect

    Richard Perez; Mike Taylor; Tom Hoff; JP Ross

    2011-06-22

    Maintaining adequate generating capacity to meet electricity demand at all times is a fundamental principle for the electric utility industry. This is accomplished through a variety of means including providing/purchasing sufficient generation capacity as well as acquiring the associated ancillary services for the electricity grid. The generation capacity of dispatchable resources is assessed based on technology design parameters. While dispatchable resources have some uncertainty in their output due to unforeseen equipment failures, their dispatch is managed around the demand for electricity and their marginal operating costs. Photovoltaic resources are non-dispatchable because their electrical output is based on both technology design parameters (technology selection, installation characteristics, and site conditions) and a solar resource that varies over a range of time periods (seasonal, daily, hourly, second to second). These solar resource variations, however, are not random and there is an intuitively positive relationship between PV system output and summer peak electricity demand for many locations throughout the U.S. This is because system demand peaks for most utilities are driven by heat-wave cooling demand, and because heat waves are indirectly fed by solar gain, i.e., by the fuel for PV generation. Despite this relationship, there is no consensus across the utility or solar industries on a method for calculating PV capacity or its practical use in electricity markets and utility planning. The U.S. Department of Energy’s Solar America Initiative has provided funding to evaluate the variety of photovoltaic capacity valuation methods and to bring the solar industry, electric utility, and research communities together with the goal of moving toward consensus on what is the most appropriate PV generation capacity valuation methodology using a consensus-oriented process. Developing a framework for accurately and appropriately calculating photovoltaic

  17. An evidence and consensus based guideline for acute diarrhoea management

    PubMed Central

    Armon, K; Stephenson, T; MacFaul, R; Eccleston, P; Werneke, U; BAUMER, H.

    2001-01-01

    OBJECTIVE—To develop an evidence and consensus based guideline for the management of the child who presents to hospital with diarrhoea (with or without vomiting), a common problem representing 16% of all paediatric medical attenders at an accident and emergency department. Clinical assessment, investigations (biochemistry and stool culture in particular), admission, and treatment are addressed. The guideline aims to aid junior doctors in recognising children who need admission for observation and treatment and those who may safely go home.
EVIDENCE—A systematic review of the literature was performed. Selected articles were appraised, graded, and synthesised qualitatively. Statements on recommendation were generated.
CONSENSUS—An anonymous, postal Delphi consensus process was used. A panel of 39 selected medical and nursing staff were asked to grade their agreement with the generated statements. They were sent the papers, appraisals, and literature review. On the second and third rounds they were asked to re-grade their agreement in the light of other panellists' responses. Consensus was predefined as 83% of panellists agreeing with the statement.
RECOMMENDATIONS—Clinical signs useful in assessment of level of dehydration were agreed. Admission to a paediatric facility is advised for children who show signs of dehydration. For those with mild to moderate dehydration, estimated deficit is replaced over four hours with oral rehydration solution (glucose based, 200-250 mOsm/l) given "little and often". A nasogastric tube should be used if fluid is refused and normal feeds started following rehydration. Children at high risk of dehydration should be observed to ensure at least maintenance fluid is tolerated. Management of more severe dehydration is detailed. Antidiarrhoeal medication is not indicated.
VALIDATION—The guideline has been successfully implemented and evaluated in a paediatric accident and emergency department.

 PMID:11466188

  18. Expert consensus: Renal denervation for the treatment of hypertension.

    PubMed

    Pathak, Atul; Girerd, Xavier; Azizi, Michel; Benamer, Hakim; Halimi, Jean-Michel; Lantelme, Pierre; Lefevre, Thierry; Sapoval, Marc

    2012-05-01

    Catheter-based renal denervation is a new method able to disrupt renal sympathetic nerves located in the adventitia of renal arteries. A randomized clinical trial showed a decrease in blood pressure in resistant hypertensive patients. In order to guide clinicians and interventional practitioner for the use of this new approach, different French scientific societies (Hypertension, Cardiology and Radiology) decided to combine their expertise and propose an expert consensus to assess benefit/risk ratio of this technique in the field of arterial hypertension. In 2012, this expert consensus propose to limit renal denervation technique to patients with essential hypertension uncontrolled by four or more antihypertensive therapies with at least one treatment being a diuretic and spironolactone at a dose of 25mg shown to be unable to control blood pressure. Measurement of office BP should be at least with SBP more than 160mmHg and/or DBP more than 100mmHg confirmed by ambulatory BP measurement (home or ABP measurement with SBP more than 135mmHg and DBP more than 85mm during daytime period). Finally, renal artery anatomy and function should allow proper intervention (i.e., two functional kidneys, absence of previous renal angioplasty). Renal enervation is a complex interventional procedure with potentially arterial complications, training is required for practitioners. Antihypertensive treatment should not be interrupted immediately after renal denervation since blood pressure lowering effect are delayed and reached maximum effect after 3 months. Monitoring of blood pressure, renal function and anatomy of renal arteries is required 12 months and 36 months after procedure. The expert consensus requires the inclusion of patients experiencing this procedure in a observational study with record form and follow-up.

  19. Tobacco control: consensus report of the National Medical Association.

    PubMed Central

    Marable, Sharon; Crim, Courtney; Dennis, Gary C.; Epps, Roselyn Payne; Freeman, Harold; Mills, Sherry; Coolchan, Eric T.; Robinson, Lawrence; Robinson, Robert; Cole, Lorraine; Payne, Pamela H.

    2002-01-01

    ISSUES: Tobacco Control remains one of the greatest determinants for reducing the morbidity and mortality of African Americans. OBJECTIVE: To examine the scope and consequences of tobacco use among African Americans and characterize its implications for the National Medical Association physician membership and their patients, and identify policy, education, advocacy and research issues in Tobacco Control for the organization. CONSENSUS PROCESS: Literature review using the MEDLINE database from January 1966 to August 1999 Week 1, searching Medical Subject Heading (MeSH) reading combined with text words "Black" or "African American" and "Tobacco" as a search term, identified 130 articles/110 abstracts published between 1988 and February 1999. The panel selected 61 appropriate articles and a paper summarizing the literature review was developed. The summary paper was used as background material for a formal consensus panel discussion on July 16-17, 1999. Consensus among committee members was reached via mail, fax and e-mail using the summary review paper, annotated bibliographies key informant surveys, and previous NMA resolutions on tobacco control. A formal working session was held on July 16-17, 1999 in which four areas of concentration of issues were determined: Policy, Advocacy, Education and Research. All committee members approved the final report. SUMMARY: Because tobacco control issues in African Americans are both complex and poorly understood, the panel views the NMA's role as pivotal in the coordination of resources and capacity-building to address all four areas identified. Stronger partner-ships with traditional federal and nonprofit agencies associated with tobacco control/advocacy in African Americans as well as nontraditional organizations (i.e., churches, academia, marketing and media organizations) also must occur to strengthen the infra-structure needed to assess needs, design appropriate interventions and evaluate the appropriateness

  20. [3rd Hungarian Breast Cancer Consensus Conference - Surgery Guidelines].

    PubMed

    Lázár, György; Bursics, Attila; Farsang, Zoltán; Harsányi, László; Kósa, Csaba; Maráz, Róbert; Mátrai, Zoltán; Paszt, Attila; Pavlovics, Gábor; Tamás, Róbert

    2016-09-01

    Therapy for breast cancer today is characterised by ever more precise diagnostic methods and ever more effective oncological treatments, a trend which will certainly continue in the future. Breast preservation and the application of oncoplastic principles are increasingly popular. A sentinel lymph node biopsy in the surgical treatment of the axilla is primary, with the indication for axillary block dissection (ABD) narrowing and radiation therapy becoming an alternative to ABD in certain cases. This publication summarises our recommendations on the surgical treatment of breast cancer based on the content of the 2nd Breast Cancer Consensus Conference and considering the latest international studies and professional recommendations. PMID:27579720

  1. Suicide and public policy: a critique of the "new consensus.

    PubMed

    Sherlock, Richard

    Sherlock offers a critique of the "new consensus" on suicide, the idea that individuals have an inherent prima facie right to kill themselves and that public policies which permit intervention are unjustified intrusions upon personal liberty. Basing his reasoning on Locke's theories, the author argues that in allowing suicide a government would violate its commitment to the equal worth of each person. He draws attention to the difficulty of determining when suicide is "reasonable," and concludes that intervention is the only clinically coherent and socially viable response to a suicidal individual.

  2. [Consensus document on the aetiology, diagnosis and treatment of sinusitis].

    PubMed

    Martinez Campos, L; Albañil Ballesteros, R; de la Flor Bru, J; Piñeiro Pérez, R; Cervera, J; Baquero Artigao, F; Alfayate Miguelez, S; Moraga Llop, F; Cilleruelo Ortega, M J; Calvo Rey, C

    2013-11-01

    The Spanish National Consensus (Spanish Society of Pediatric Infectious Diseases, Spanish Association of Primary Care Pediatrics, Spanish Society of Pediatric Outpatient and Primary Care, Spanish Society of Otorhinolaryngology and Cervical-Facial Pathology) on Sinusitis is presented. Rhinosinusitis is a difficult to diagnose and often unrecognised disease. The document discusses the aetiology, the clinical signs and symptoms, and the diagnostic criteria. A proposal for treatment is made based on the epidemiological situation in our country. Oral amoxicillin is the treatment of choice (80mg/kg/day divided every 8hours). Alternative treatment is proposed in special cases and when amoxicillin is not sufficient. The main complications are reviewed.

  3. SEPAR-ALAT Consensus Document on Antipneumoccal Vaccination in Smokers.

    PubMed

    Jiménez Ruiz, Carlos A; Buljubasich, Daniel; Sansores, Raúl; Riesco Miranda, Juan Antonio; Guerreros Benavides, Alfredo; Luhning, Susana; Chatkin, José Miguel; Zabert, Gustavo; de Granda Orive, José Ignacio; Solano Reina, Segismundo; Casas Herrera, Alejandro; de Lucas Ramos, Pilar

    2015-07-01

    Streptococcus pneumoniae is responsible for several clinical syndromes, such as community-acquired pneumonia, sinusitis, otitis media, and others. The most severe clinical entity caused by this bacteria is undoubtedly invasive pneumococcal disease. Certain factors are known to increase the risk of presenting invasive pneumococcal disease, the most important being smoking habit and underlying concomitant diseases. This article comprises a consensus document on antipneumococcal vaccination in smokers, drawn up by a Smoking Expert Group from the Spanish Society of Pulmonology and Thoracic Surgery and the Latin American Chest Association.

  4. Core Outcomes for Colorectal Cancer Surgery: A Consensus Study

    PubMed Central

    Whistance, Robert N.; Forsythe, Rachael O.; Macefield, Rhiannon; Pullyblank, Anne M.; Avery, Kerry N. L.; Brookes, Sara T.; Thomas, Michael G.; Sylvester, Paul A.; Russell, Ann; Oliver, Alfred; Morton, Dion; Kennedy, Robin; Jayne, David G.; Huxtable, Richard; Hackett, Roland; Card, Mia; Brown, Julia; Blazeby, Jane M.

    2016-01-01

    Background Colorectal cancer (CRC) is a major cause of worldwide morbidity and mortality. Surgical treatment is common, and there is a great need to improve the delivery of such care. The gold standard for evaluating surgery is within well-designed randomized controlled trials (RCTs); however, the impact of RCTs is diminished by a lack of coordinated outcome measurement and reporting. A solution to these issues is to develop an agreed standard “core” set of outcomes to be measured in all trials to facilitate cross-study comparisons, meta-analysis, and minimize outcome reporting bias. This study defines a core outcome set for CRC surgery. Methods and Findings The scope of this COS includes clinical effectiveness trials of surgical interventions for colorectal cancer. Excluded were nonsurgical oncological interventions. Potential outcomes of importance to patients and professionals were identified through systematic literature reviews and patient interviews. All outcomes were transcribed verbatim and categorized into domains by two independent researchers. This informed a questionnaire survey that asked stakeholders (patients and professionals) from United Kingdom CRC centers to rate the importance of each domain. Respondents were resurveyed following group feedback (Delphi methods). Outcomes rated as less important were discarded after each survey round according to predefined criteria, and remaining outcomes were considered at three consensus meetings; two involving international professionals and a separate one with patients. A modified nominal group technique was used to gain the final consensus. Data sources identified 1,216 outcomes of CRC surgery that informed a 91 domain questionnaire. First round questionnaires were returned from 63 out of 81 (78%) centers, including 90 professionals, and 97 out of 267 (35%) patients. Second round response rates were high for all stakeholders (>80%). Analysis of responses lead to 45 and 23 outcome domains being retained

  5. The Brazilian health informatics and information policy: building the consensus.

    PubMed

    Leão, Beatriz F; Costa, Cláudio G; Facchini, Luiz Augusto; Bandarra, Ernani B; Gonçalves, Sibele F; Bretas Jr, Nilo; Ferla, Alcindo

    2004-01-01

    This paper describes the construction of the Brazilian Health Information Policy. The Introduction gives an overview of the health informatics scenario in the country and the motivation for the definition of a national policy for the area. The process adopted and the strategies to reach consensus among the different players of the healthcare arena are discussed. The interface with the national health card project and the standards already established are also depicted. The current document and the strategies so far proposed are presented with their respective time table and goals. At the end, a comparison with other national initiatives is drawn. PMID:15361004

  6. European consensus statement on leptospirosis in dogs and cats.

    PubMed

    Schuller, S; Francey, T; Hartmann, K; Hugonnard, M; Kohn, B; Nally, J E; Sykes, J

    2015-03-01

    Leptospirosis is a zoonotic disease with a worldwide distribution affecting most mammalian species. Clinical leptospirosis is common in dogs but appears to be rare in cats. Both dogs and cats, however, can shed leptospires in the urine. This is problematic as it can lead to exposure of humans. The control of leptospirosis, therefore, is important not only from an animal but also from a public health perspective. The aim of this consensus statement is to raise awareness of leptospirosis and to outline the current knowledge on the epidemiology, clinical features, diagnostic tools, prevention and treatment measures relevant to canine and feline leptospirosis in Europe. PMID:25754092

  7. Towards a Consensus Annotation System (GSC8 Meeting)

    ScienceCinema

    White, Owen [University of Maryland

    2016-07-12

    The Genomic Standards Consortium was formed in September 2005. It is an international, open-membership working body which promotes standardization in the description of genomes and the exchange and integration of genomic data. The 2009 meeting was an activity of a five-year funding "Research Coordination Network" from the National Science Foundation and was organized held at the DOE Joint Genome Institute with organizational support provided by the JGI and by the University of California - San Diego. "Comparing Annotations: Towards Consensus Annotation" at the Genomic Standards Consortium's 8th meeting at the DOE JGI in Walnut Creek, Calif. on Sept. 10, 2009

  8. BPROMPT: A consensus server for membrane protein prediction.

    PubMed

    Taylor, Paul D; Attwood, Teresa K; Flower, Darren R

    2003-07-01

    Protein structure prediction is a cornerstone of bioinformatics research. Membrane proteins require their own prediction methods due to their intrinsically different composition. A variety of tools exist for topology prediction of membrane proteins, many of them available on the Internet. The server described in this paper, BPROMPT (Bayesian PRediction Of Membrane Protein Topology), uses a Bayesian Belief Network to combine the results of other prediction methods, providing a more accurate consensus prediction. Topology predictions with accuracies of 70% for prokaryotes and 53% for eukaryotes were achieved. BPROMPT can be accessed at http://www.jenner.ac.uk/BPROMPT. PMID:12824397

  9. Consensus guidelines for the use of ultrasound for diving research.

    PubMed

    Møllerløkken, Andreas; Blogg, S Lesley; Doolette, David J; Nishi, Ronald Y; Pollock, Neal W

    2016-03-01

    The International Meeting on Ultrasound for Diving Research produced expert consensus recommendations for ultrasound detection of vascular gas bubbles and the analysis, interpretation and reporting of such data. Recommendations for standardization of techniques to allow comparison between studies included bubble monitoring site selection, frequency and duration of monitoring, and use of the Spencer, Kisman-Masurel or Eftedal-Brubakk scales. Recommendations for reporting of results included description of subject posture and provocation manoeuvres during monitoring, reporting of untransformed data and the appropriate use of statistics. These guidelines are available from www.dhmjournal.com.

  10. Bipartite opinion forming: Towards consensus over coopetition networks

    NASA Astrophysics Data System (ADS)

    Hou, Bo; Chen, Yao; Liu, Guangbin; Sun, Fuchun; Li, Hongbo

    2015-12-01

    Within the framework of signed graph and multi-agent systems, this paper investigates the distributed bipartite opinion forming problem over coopetition networks. Several sufficient algebraic and geometric topology conditions that guarantee consensus, regardless of the magnitudes of individual coupling strengths among the agents, have been derived by exploring the interaction direction patterns. All the criteria presented do not require the global knowledge of the coupling weights of the entire network, and thus are easier to check. The effectiveness of the theoretical results are illustrated by numerical examples.

  11. Unexplained symptoms after terrorism and war: an expert consensus statement.

    PubMed

    Clauw, Daniel J; Engel, Charles C; Aronowitz, Robert; Jones, Edgar; Kipen, Howard M; Kroenke, Kurt; Ratzan, Scott; Sharpe, Michael; Wessely, Simon

    2003-10-01

    Twelve years of concern regarding a possible "Gulf War syndrome" has now given way to societal concerns of a "World Trade Center syndrome" and efforts to prevent unexplained symptoms following the most recent war in Iraq. These events serve to remind us that unexplained symptoms frequently occur after war and are likely after terrorist attacks. An important social priority is to recognize, define, prevent, and care for individuals with unexplained symptoms after war and related events (eg, terrorism, natural or industrial disasters). An international, multidisciplinary, and multiinstitutional consensus project was completed to summarize current knowledge on unexplained symptoms after terrorism and war.

  12. Consensus guidelines for the use of ultrasound for diving research.

    PubMed

    Møllerløkken, Andreas; Blogg, S Lesley; Doolette, David J; Nishi, Ronald Y; Pollock, Neal W

    2016-03-01

    The International Meeting on Ultrasound for Diving Research produced expert consensus recommendations for ultrasound detection of vascular gas bubbles and the analysis, interpretation and reporting of such data. Recommendations for standardization of techniques to allow comparison between studies included bubble monitoring site selection, frequency and duration of monitoring, and use of the Spencer, Kisman-Masurel or Eftedal-Brubakk scales. Recommendations for reporting of results included description of subject posture and provocation manoeuvres during monitoring, reporting of untransformed data and the appropriate use of statistics. These guidelines are available from www.dhmjournal.com. PMID:27044459

  13. Recommendations for Probiotic Use--2015 Update: Proceedings and Consensus Opinion.

    PubMed

    Floch, Martin H; Walker, W Allan; Sanders, Mary Ellen; Nieuwdorp, Max; Kim, Adam S; Brenner, David A; Qamar, Amir A; Miloh, Tamir A; Guarino, Alfredo; Guslandi, Mario; Dieleman, Levinus A; Ringel, Yehuda; Quigley, Eamonn M M; Brandt, Lawrence J

    2015-01-01

    This paper describes the consensus opinion of the participants in the 4th Triennial Yale/Harvard Workshop on Probiotic Recommendations. The recommendations update those of the first 3 meetings that were published in 2006, 2008, and 2011. Recommendations for the use of probiotics in necrotizing enterocolitis, childhood diarrhea, inflammatory bowel disease, irritable bowel syndrome and Clostridium difficile diarrhea are reviewed. In addition, we have added recommendations for liver disease for the first time. As in previous publications, the recommendations are given as A, B, or C ratings. PMID:26447969

  14. Reaching a consensus: a discrete nonlinear time-varying case

    NASA Astrophysics Data System (ADS)

    Saburov, M.; Saburov, K.

    2016-07-01

    In this paper, we have considered a nonlinear protocol for a structured time-varying and synchronous multi-agent system. By means of cubic triple stochastic matrices, we present an opinion sharing dynamics of the multi-agent system as a trajectory of a non-homogeneous system of cubic triple stochastic matrices. We show that the multi-agent system eventually reaches to a consensus if either of the following two conditions is satisfied: (1) every member of the group people has a positive subjective distribution on the given task after some revision steps or (2) all entries of some cubic triple stochastic matrix are positive.

  15. Insertion Sequences

    PubMed Central

    Mahillon, Jacques; Chandler, Michael

    1998-01-01

    Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608

  16. Sequence Bundles: a novel method for visualising, discovering and exploring sequence motifs

    PubMed Central

    2014-01-01

    Background We introduce Sequence Bundles--a novel data visualisation method for representing multiple sequence alignments (MSAs). We identify and address key limitations of the existing bioinformatics data visualisation methods (i.e. the Sequence Logo) by enabling Sequence Bundles to give salient visual expression to sequence motifs and other data features, which would otherwise remain hidden. Methods For the development of Sequence Bundles we employed research-led information design methodologies. Sequences are encoded as uninterrupted, semi-opaque lines plotted on a 2-dimensional reconfigurable grid. Each line represents a single sequence. The thickness and opacity of the stack at each residue in each position indicates the level of conservation and the lines' curved paths expose patterns in correlation and functionality. Several MSAs can be visualised in a composite image. The Sequence Bundles method is designed to favour a tangible, continuous and intuitive display of information. Results We have developed a software demonstration application for generating a Sequence Bundles visualisation of MSAs provided for the BioVis 2013 redesign contest. A subsequent exploration of the visualised line patterns allowed for the discovery of a number of interesting features in the dataset. Reported features include the extreme conservation of sequences displaying a specific residue and bifurcations of the consensus sequence. Conclusions Sequence Bundles is a novel method for visualisation of MSAs and the discovery of sequence motifs. It can aid in generating new insight and hypothesis making. Sequence Bundles is well disposed for future implementation as an interactive visual analytics software, which can complement existing visualisation tools. PMID:25237395

  17. Integrated consensus map of cultivated peanut and wild relatives reveals structures of the A and B genomes of Arachis and divergence of the legume genomes.

    PubMed

    Shirasawa, Kenta; Bertioli, David J; Varshney, Rajeev K; Moretzsohn, Marcio C; Leal-Bertioli, Soraya C M; Thudi, Mahendar; Pandey, Manish K; Rami, Jean-Francois; Foncéka, Daniel; Gowda, Makanahally V C; Qin, Hongde; Guo, Baozhu; Hong, Yanbin; Liang, Xuanqiang; Hirakawa, Hideki; Tabata, Satoshi; Isobe, Sachiko

    2013-04-01

    The complex, tetraploid genome structure of peanut (Arachis hypogaea) has obstructed advances in genetics and genomics in the species. The aim of this study is to understand the genome structure of Arachis by developing a high-density integrated consensus map. Three recombinant inbred line populations derived from crosses between the A genome diploid species, Arachis duranensis and Arachis stenosperma; the B genome diploid species, Arachis ipaënsis and Arachis magna; and between the AB genome tetraploids, A. hypogaea and an artificial amphidiploid (A. ipaënsis × A. duranensis)(4×), were used to construct genetic linkage maps: 10 linkage groups (LGs) of 544 cM with 597 loci for the A genome; 10 LGs of 461 cM with 798 loci for the B genome; and 20 LGs of 1442 cM with 1469 loci for the AB genome. The resultant maps plus 13 published maps were integrated into a consensus map covering 2651 cM with 3693 marker loci which was anchored to 20 consensus LGs corresponding to the A and B genomes. The comparative genomics with genome sequences of Cajanus cajan, Glycine max, Lotus japonicus, and Medicago truncatula revealed that the Arachis genome has segmented synteny relationship to the other legumes. The comparative maps in legumes, integrated tetraploid consensus maps, and genome-specific diploid maps will increase the genetic and genomic understanding of Arachis and should facilitate molecular breeding. PMID:23315685

  18. Using multi-locus allelic sequence data to estimate genetic divergence among four Lilium (Liliaceae) cultivars.

    PubMed

    Shahin, Arwa; Smulders, Marinus J M; van Tuyl, Jaap M; Arens, Paul; Bakker, Freek T

    2014-01-01

    Next Generation Sequencing (NGS) may enable estimating relationships among genotypes using allelic variation of multiple nuclear genes simultaneously. We explored the potential and caveats of this strategy in four genetically distant Lilium cultivars to estimate their genetic divergence from transcriptome sequences using three approaches: POFAD (Phylogeny of Organisms from Allelic Data, uses allelic information of sequence data), RAxML (Randomized Accelerated Maximum Likelihood, tree building based on concatenated consensus sequences) and Consensus Network (constructing a network summarizing among gene tree conflicts). Twenty six gene contigs were chosen based on the presence of orthologous sequences in all cultivars, seven of which also had an orthologous sequence in Tulipa, used as out-group. The three approaches generated the same topology. Although the resolution offered by these approaches is high, in this case there was no extra benefit in using allelic information. We conclude that these 26 genes can be widely applied to construct a species tree for the genus Lilium. PMID:25368628

  19. An Application of Supertree Methods to Mammalian Mitogenomic Sequences

    PubMed Central

    Campbell, Véronique; Lapointe, François-Joseph

    2010-01-01

    Two different approaches can be used in phylogenomics: combined or separate analysis. In the first approach, different datasets are combined in a concatenated supermatrix. In the second, datasets are analyzed separately and the phylogenetic trees are then combined in a supertree. The supertree method is an interesting alternative to avoid missing data, since datasets that are analyzed separately do not need to represent identical taxa. However, the supertree approach and the corresponding consensus methods have been highly criticized for not providing valid phylogenetic hypotheses. In this study, congruence of trees estimated by consensus and supertree approaches were compared to model trees obtained from a combined analysis of complete mitochondrial sequences of 102 species representing 93 mammal families. The consensus methods produced poorly resolved consensus trees and did not perform well, except for the majority rule consensus with compatible groupings. The weighted supertree and matrix representation with parsimony methods performed equally well and were highly congruent with the model trees. The most similar supertree method was the least congruent with the model trees. We conclude that some of the methods tested are worth considering in a phylogenomic context. PMID:20535231

  20. Collective Learning and Optimal Consensus Decisions in Social Animal Groups

    PubMed Central

    Kao, Albert B.; Miller, Noam; Torney, Colin; Hartnett, Andrew; Couzin, Iain D.

    2014-01-01

    Learning has been studied extensively in the context of isolated individuals. However, many organisms are social and consequently make decisions both individually and as part of a collective. Reaching consensus necessarily means that a single option is chosen by the group, even when there are dissenting opinions. This decision-making process decouples the otherwise direct relationship between animals' preferences and their experiences (the outcomes of decisions). Instead, because an individual's learned preferences influence what others experience, and therefore learn about, collective decisions couple the learning processes between social organisms. This introduces a new, and previously unexplored, dynamical relationship between preference, action, experience and learning. Here we model collective learning within animal groups that make consensus decisions. We reveal how learning as part of a collective results in behavior that is fundamentally different from that learned in isolation, allowing grouping organisms to spontaneously (and indirectly) detect correlations between group members' observations of environmental cues, adjust strategy as a function of changing group size (even if that group size is not known to the individual), and achieve a decision accuracy that is very close to that which is provably optimal, regardless of environmental contingencies. Because these properties make minimal cognitive demands on individuals, collective learning, and the capabilities it affords, may be widespread among group-living organisms. Our work emphasizes the importance and need for theoretical and experimental work that considers the mechanism and consequences of learning in a social context. PMID:25101642

  1. Critical limitations of consensus clustering in class discovery

    PubMed Central

    Șenbabaoğlu, Yasin; Michailidis, George; Li, Jun Z.

    2014-01-01

    Consensus clustering (CC) has been adopted for unsupervised class discovery in many genomic studies. It calculates how frequently two samples are grouped together in repeated clustering runs, and uses the resulting pairwise "consensus rates" for visual demonstration that clusters exist, for comparing cluster stability, and for estimating the optimal cluster number (K). However, the sensitivity and specificity of CC have not been systemically assessed. Through simulations we find that CC is able to divide randomly generated unimodal data into apparently stable clusters for a range of K, essentially reporting chance partitions of cluster-less data. For data with known structure, the common implementations of CC perform poorly in identifying the true K. These results suggest that CC should be applied and interpreted with caution. We found that a new metric based on CC, the proportion of ambiguously clustered pairs (PAC), infers K equally or more reliably than similar methods in simulated data with known K. Our overall approach involves the use of realistic null distributions based on the observed gene-gene correlation structure in a given study, and the implementation of PAC to more accurately estimate K. We discuss the strength of our approach in the context of other ensemble-based methods. PMID:25158761

  2. Critical limitations of consensus clustering in class discovery.

    PubMed

    Șenbabaoğlu, Yasin; Michailidis, George; Li, Jun Z

    2014-01-01

    Consensus clustering (CC) has been adopted for unsupervised class discovery in many genomic studies. It calculates how frequently two samples are grouped together in repeated clustering runs, and uses the resulting pairwise "consensus rates" for visual demonstration that clusters exist, for comparing cluster stability, and for estimating the optimal cluster number (K). However, the sensitivity and specificity of CC have not been systemically assessed. Through simulations we find that CC is able to divide randomly generated unimodal data into apparently stable clusters for a range of K, essentially reporting chance partitions of cluster-less data. For data with known structure, the common implementations of CC perform poorly in identifying the true K. These results suggest that CC should be applied and interpreted with caution. We found that a new metric based on CC, the proportion of ambiguously clustered pairs (PAC), infers K equally or more reliably than similar methods in simulated data with known K. Our overall approach involves the use of realistic null distributions based on the observed gene-gene correlation structure in a given study, and the implementation of PAC to more accurately estimate K. We discuss the strength of our approach in the context of other ensemble-based methods. PMID:25158761

  3. Starling flock networks manage uncertainty in consensus at low cost.

    PubMed

    Young, George F; Scardovi, Luca; Cavagna, Andrea; Giardina, Irene; Leonard, Naomi E

    2013-01-01

    Flocks of starlings exhibit a remarkable ability to maintain cohesion as a group in highly uncertain environments and with limited, noisy information. Recent work demonstrated that individual starlings within large flocks respond to a fixed number of nearest neighbors, but until now it was not understood why this number is seven. We analyze robustness to uncertainty of consensus in empirical data from multiple starling flocks and show that the flock interaction networks with six or seven neighbors optimize the trade-off between group cohesion and individual effort. We can distinguish these numbers of neighbors from fewer or greater numbers using our systems-theoretic approach to measuring robustness of interaction networks as a function of the network structure, i.e., who is sensing whom. The metric quantifies the disagreement within the network due to disturbances and noise during consensus behavior and can be evaluated over a parameterized family of hypothesized sensing strategies (here the parameter is number of neighbors). We use this approach to further show that for the range of flocks studied the optimal number of neighbors does not depend on the number of birds within a flock; rather, it depends on the shape, notably the thickness, of the flock. The results suggest that robustness to uncertainty may have been a factor in the evolution of flocking for starlings. More generally, our results elucidate the role of the interaction network on uncertainty management in collective behavior, and motivate the application of our approach to other biological networks. PMID:23382667

  4. [Consensus statement for accreditation of multidisciplinary thyroid cancer units].

    PubMed

    Díez, Juan José; Galofré, Juan Carlos; Oleaga, Amelia; Grande, Enrique; Mitjavila, Mercedes; Moreno, Pablo

    2016-03-01

    Thyroid cancer is the leading endocrine system tumor. Great advances have recently been made in understanding of the origin of these tumors and the molecular biology that makes them grow and proliferate, which have been associated to improvements in diagnostic procedures and increased availability of effective local and systemic treatments. All of the above makes thyroid cancer a paradigm of how different specialties should work together to achieve the greatest benefit for the patients. Coordination of all the procedures and patient flows should continue throughout diagnosis, treatment, and follow-up, and is essential for further optimization of resources and time. This manuscript was prepared at the request of the Working Group on Thyroid Cancer of the Spanish Society of Endocrinology and Nutrition, and is aimed to provide a consensus document on the definition, composition, requirements, structure, and operation of a multidisciplinary team for the comprehensive care of patients with thyroid cancer. For this purpose, we have included contributions by several professionals from different specialties with experience in thyroid cancer treatment at centers where multidisciplinary teams have been working for years, with the aim of developing a practical consensus applicable in clinical practice.

  5. Modelling Adaptive Learning Behaviours for Consensus Formation in Human Societies.

    PubMed

    Yu, Chao; Tan, Guozhen; Lv, Hongtao; Wang, Zhen; Meng, Jun; Hao, Jianye; Ren, Fenghui

    2016-01-01

    Learning is an important capability of humans and plays a vital role in human society for forming beliefs and opinions. In this paper, we investigate how learning affects the dynamics of opinion formation in social networks. A novel learning model is proposed, in which agents can dynamically adapt their learning behaviours in order to facilitate the formation of consensus among them, and thus establish a consistent social norm in the whole population more efficiently. In the model, agents adapt their opinions through trail-and-error interactions with others. By exploiting historical interaction experience, a guiding opinion, which is considered to be the most successful opinion in the neighbourhood, can be generated based on the principle of evolutionary game theory. Then, depending on the consistency between its own opinion and the guiding opinion, a focal agent can realize whether its opinion complies with the social norm (i.e., the majority opinion that has been adopted) in the population, and adapt its behaviours accordingly. The highlight of the model lies in that it captures the essential features of people's adaptive learning behaviours during the evolution and formation of opinions. Experimental results show that the proposed model can facilitate the formation of consensus among agents, and some critical factors such as size of opinion space and network topology can have significant influences on opinion dynamics. PMID:27282089

  6. Consensus paper: pathological role of the cerebellum in autism.

    PubMed

    Fatemi, S Hossein; Aldinger, Kimberly A; Ashwood, Paul; Bauman, Margaret L; Blaha, Charles D; Blatt, Gene J; Chauhan, Abha; Chauhan, Ved; Dager, Stephen R; Dickson, Price E; Estes, Annette M; Goldowitz, Dan; Heck, Detlef H; Kemper, Thomas L; King, Bryan H; Martin, Loren A; Millen, Kathleen J; Mittleman, Guy; Mosconi, Matthew W; Persico, Antonio M; Sweeney, John A; Webb, Sara J; Welsh, John P

    2012-09-01

    There has been significant advancement in various aspects of scientific knowledge concerning the role of cerebellum in the etiopathogenesis of autism. In the current consensus paper, we will observe the diversity of opinions regarding the involvement of this important site in the pathology of autism. Recent emergent findings in literature related to cerebellar involvement in autism are discussed, including: cerebellar pathology, cerebellar imaging and symptom expression in autism, cerebellar genetics, cerebellar immune function, oxidative stress and mitochondrial dysfunction, GABAergic and glutamatergic systems, cholinergic, dopaminergic, serotonergic, and oxytocin-related changes in autism, motor control and cognitive deficits, cerebellar coordination of movements and cognition, gene-environment interactions, therapeutics in autism, and relevant animal models of autism. Points of consensus include presence of abnormal cerebellar anatomy, abnormal neurotransmitter systems, oxidative stress, cerebellar motor and cognitive deficits, and neuroinflammation in subjects with autism. Undefined areas or areas requiring further investigation include lack of treatment options for core symptoms of autism, vermal hypoplasia, and other vermal abnormalities as a consistent feature of autism, mechanisms underlying cerebellar contributions to cognition, and unknown mechanisms underlying neuroinflammation.

  7. When can scientific studies promote consensus among conflicting stakeholders?

    PubMed

    Small, Mitchell J; Güvenç, Ümit; DeKay, Michael L

    2014-11-01

    While scientific studies may help conflicting stakeholders come to agreement on a best management option or policy, often they do not. We review the factors affecting trust in the efficacy and objectivity of scientific studies in an analytical-deliberative process where conflict is present, and show how they may be incorporated in an extension to the traditional Bayesian decision model. The extended framework considers stakeholders who differ in their prior beliefs regarding the probability of possible outcomes (in particular, whether a proposed technology is hazardous), differ in their valuations of these outcomes, and differ in their assessment of the ability of a proposed study to resolve the uncertainty in the outcomes and their hazards--as measured by their perceived false positive and false negative rates for the study. The Bayesian model predicts stakeholder-specific preposterior probabilities of consensus, as well as pathways for increasing these probabilities, providing important insights into the value of scientific information in an analytic-deliberative decision process where agreement is sought. It also helps to identify the interactions among perceived risk and benefit allocations, scientific beliefs, and trust in proposed scientific studies when determining whether a consensus can be achieved. The article provides examples to illustrate the method, including an adaptation of a recent decision analysis for managing the health risks of electromagnetic fields from high voltage transmission lines.

  8. Phenomenology and classification of dystonia: a consensus update

    PubMed Central

    Albanese, Alberto; Bhatia, Kailash; Bressman, Susan B.; DeLong, Mahlon R.; Fahn, Stanley; Fung, Victor S.C.; Hallett, Mark; Jankovic, Joseph; Jinnah, H.A.; Klein, Christine; Lang, Anthony E.; Mink, Jonathan W.; Teller, Jan K.

    2013-01-01

    This report describes the consensus outcome of an international panel consisting of investigators with years of experience in this field that reviewed the definition and classification of dystonia. Agreement was obtained based on a consensus development methodology during three in-person meetings and manuscript review by mail. Dystonia is defined as a movement disorder characterized by sustained or intermittent muscle contractions causing abnormal, often repetitive, movements, postures, or both. Dystonic movements are typically patterned and twisting, and may be tremulous. Dystonia is often initiated or worsened by voluntary action and associated with overflow muscle activation. Dystonia is classified along two axes: clinical characteristics, including age at onset, body distribution, temporal pattern and associated features (additional movement disorders or neurological features), and etiology, which includes nervous system pathology and inheritance. The clinical characteristics fall into several specific dystonia syndromes that help to guide diagnosis and treatment. We provide here a new general definition of dystonia and propose a new classification. We encourage clinicians and researchers to use these innovative definition and classification and test them in the clinical setting on a variety of patients with dystonia. PMID:23649720

  9. [Consensus on Systemic Arterial Hypertension In México].

    PubMed

    Rosas-Peralta, Martín; Palomo-Piñón, Silvia; Borrayo-Sánchez, Gabriela; Madrid-Miller, Alejandra; Almeida-Gutiérrez, Eduardo; Galván-Oseguera, Héctor; Magaña-Serrano, José Antonio; Saturno-Chiu, Guillermo; Ramírez-Arias, Erick; Santos-Martínez, Efrén; Díaz-Díaz, Enrique; Salgado-Pastor, Selene Janette; Morales-Mora, Gerardo; Medina-Concebida, Luz Elena; Mejía-Rodríguez, Oliva; Pérez-Ruiz, Claudia Elsa; Chapa-Mejía, Luis Raúl; Álvarez-Aguilar, Cleto; Pérez-Rodríguez, Gilberto; Castro-Martínez, María Guadalupe; López-Bárcena, Joaquín; Paniagua-Sierra, José Ramón

    2016-01-01

    This Consenso Nacional de Hipertensión Arterial Sistémica (National Consensus on Systemic Arterial Hypertension) brings together experiences and joint work of 79 specialists who have been in contact with the patient affected by systemic arterial hypertension. All concepts here presented were outlined on the basis of the real world practice of Mexican hypertensive population. The consensus was developed under strict methodological guidelines. The Delphi technique was applied in two rounds for the development of an appropriate statistical analysis of the concepts exposed by all the specialists, who posed key questions, later developed by the panel of experts of the Hospital de Cardiología, and specialists from the Centro Médico Nacional. Several angles of this illness are shown: detection, diagnosis, pathophysiology, classification, treatment and prevention. The evidence analysis was carried out using PRISMA method. More than 600 articles were reviewed, leaving only the most representative in the references. This document concludes with practical and useful recommendations for the three levels of health care of our country. PMID:27284844

  10. [Consensus on health assistance for smoking control in Spain].

    PubMed

    Camarelles Guillem, Francisco; Salvador Llivina, Teresa; Ramón Torell, Josep M; Córdoba García, Rodrigo; Jiménez Ruiz, Carlos; López García-Aranda, Víctor; Villalbí Hereter, Joan Ramón; Planchuelo Santos, M Angeles; Sánchez Monfort, Josep; López de Santiago, Asensio

    2009-01-01

    The Consensus on Health Assistance for Smoking Cessation in Spain, is a document reviewing the treatment evidence, as well as policy needs in relation to smoking cessation in Spain. It has been developed by technical representatives of public health administrations, at a national and autonomous level, together with representatives of the scientific societies and professional bodies which are members of the Spanish coalition on smoking prevention National Committee on Tobacco Prevention (CNPT). After approval of a new national tobacco control law 28/2005, several tobacco control policies are being developed, especially by the autonomous governments, including treatment policies. Within this framework, and as part of the requirements of the law, all parties have considered the need to review effectiveness, experimentally validated tobacco dependence treatments and practices. An initial draft written by an expert committee was presented to all parties and discussed at three meetings over a period of a year and a half. The initial draft did review primary and secondary scientific literature from 1987 to 2007 on efficacy and effectiveness of different smoking cessation interventions, including: medical advice and brief smoking cessation interventions; pharmacological aids for treating nicotine dependence; behavioral interventions; specialized intensive treatment; community interventions; and treatment for groups with special needs. Considering the available evidence; current treatment needs; policy gaps; and the criteria of risk, accessibility, efficiency, sustainability and equity; the consensus document recommends the minimal requirements which should be taken into account when developing a policy on smoking cessation in Spain.

  11. International consensus for a definition of disease flare in lupus.

    PubMed

    Ruperto, N; Hanrahan, L M; Alarcón, G S; Belmont, H M; Brey, R L; Brunetta, P; Buyon, J P; Costner, M I; Cronin, M E; Dooley, M A; Filocamo, G; Fiorentino, D; Fortin, P R; Franks, A G; Gilkeson, G; Ginzler, E; Gordon, C; Grossman, J; Hahn, B; Isenberg, D A; Kalunian, K C; Petri, M; Sammaritano, L; Sánchez-Guerrero, J; Sontheimer, R D; Strand, V; Urowitz, M; von Feldt, J M; Werth, V P; Merrill, J T

    2011-04-01

    The Lupus Foundation of America (LFA) convened an international working group to obtain a consensus definition of disease flare in lupus. With help from the Paediatric Rheumatology International Trials Organization (PRINTO), two web-based Delphi surveys of physicians were conducted. Subsequently, the LFA held a second consensus conference followed by a third Delphi survey to reach a community-wide agreement for flare definition. Sixty-nine of the 120 (57.5%) polled physicians responded to the first survey. Fifty-nine of the responses were available to draft 12 preliminary statements, which were circulated in the second survey. Eighty-seven of 118 (74%) physicians completed the second survey, with an agreement of 70% for 9/12 (75%) statements. During the second conference, three alternative flare definitions were consolidated and sent back to the international community. One hundred and sixteen of 146 (79.5%) responded, with agreement by 71/116 (61%) for the following definition: "A flare is a measurable increase in disease activity in one or more organ systems involving new or worse clinical signs and symptoms and/or laboratory measurements. It must be considered clinically significant by the assessor and usually there would be at least consideration of a change or an increase in treatment." The LFA proposes this definition for lupus flare on the basis of its high face validity.

  12. Modelling Adaptive Learning Behaviours for Consensus Formation in Human Societies

    PubMed Central

    Yu, Chao; Tan, Guozhen; Lv, Hongtao; Wang, Zhen; Meng, Jun; Hao, Jianye; Ren, Fenghui

    2016-01-01

    Learning is an important capability of humans and plays a vital role in human society for forming beliefs and opinions. In this paper, we investigate how learning affects the dynamics of opinion formation in social networks. A novel learning model is proposed, in which agents can dynamically adapt their learning behaviours in order to facilitate the formation of consensus among them, and thus establish a consistent social norm in the whole population more efficiently. In the model, agents adapt their opinions through trail-and-error interactions with others. By exploiting historical interaction experience, a guiding opinion, which is considered to be the most successful opinion in the neighbourhood, can be generated based on the principle of evolutionary game theory. Then, depending on the consistency between its own opinion and the guiding opinion, a focal agent can realize whether its opinion complies with the social norm (i.e., the majority opinion that has been adopted) in the population, and adapt its behaviours accordingly. The highlight of the model lies in that it captures the essential features of people’s adaptive learning behaviours during the evolution and formation of opinions. Experimental results show that the proposed model can facilitate the formation of consensus among agents, and some critical factors such as size of opinion space and network topology can have significant influences on opinion dynamics. PMID:27282089

  13. A consensus approach to wound care in epidermolysis bullosa

    PubMed Central

    Pope, Elena; Lara-Corrales, Irene; Mellerio, Jemima; Martinez, Anna; Schultz, Gregory; Burrell, Robert; Goodman, Laurie; Coutts, Patricia; Wagner, John; Allen, Upton; Sibbald, Gary

    2013-01-01

    Background Wound care is the cornerstone of treatment for patients with epidermolysis bullosa (EB); however, there are currently no guidelines to help practitioners care for these patients. Objectives The objective of this study was to generate a list of recommendations that will enable practitioners to better care for patients with EB. Methods An expert panel generated a list of recommendations based on the best evidence available. The recommendations were translated into a survey, and sent to other EB experts to generate consensus using an online-based modified Delphi method. The list was refined and grouped into themes and specific recommendations. Results There were15 respondents (45% response rate), with significant experience in the EB field (>10 years [67%]). Respondents included physicians (67%), nurses (17%), and allied health professionals (7%). There was more than 85% agreement for all the proposed items. These were further refined and grouped into 5 main themes (assessment and management of factors that impair healing, patient-centered concerns, local wound care, development of an individualized care plan, and organizational support) and 17 specific recommendations. Limitations There is a paucity of scientific evidence with most recommendations based on expert opinion. Conclusions These recommendations will provide practitioners with a framework for caring for these patients. Additional scientific research including effectiveness studies for everyday practice and expert consensus, may further refine these recommendations. PMID:22387035

  14. [Second Brazilian Consensus Conference on Helicobacter pylori infection].

    PubMed

    Coelho, Luiz Gonzaga Vaz; Zaterka, Schlioma

    2005-01-01

    Significant progress has been obtained since the First Brazilian Consensus Conference on H. pylori Infection held in 1995, in Belo Horizonte, MG, and justify a second meeting to establish updated guidelines on the current management of H. pylori infection. The Second Brazilian Consensus Conference on H. pylori Infection was organized by the Brazilian Federation of Gastroenterology and Brazilian Nucleus for the Study of Helicobacter and took place on June, 19-20, 2004 in São Paulo, SP. Thirty six delegates coming from 15 different Brazilian states including gastroenterologists, pathologists, microbiologists and pediatricians undertook the meeting. The participants were allocated in one the five main topics of the meeting: H. pylori and dyspepsia, H. pylori and NSAIDs, H. pylori and gastroesophageal reflux disease, H. pylori treatment, and H. pylori retreatment. Seventy per cent and more votes were considered as acceptance for the final statement. The results were presented during a special session on the VI Brazilian Week of Digestive System, in Recife, PE (October 2004), and this publication represents the summary of the main recommendations and conclusions emerged from the meeting.

  15. Modelling Adaptive Learning Behaviours for Consensus Formation in Human Societies

    NASA Astrophysics Data System (ADS)

    Yu, Chao; Tan, Guozhen; Lv, Hongtao; Wang, Zhen; Meng, Jun; Hao, Jianye; Ren, Fenghui

    2016-06-01

    Learning is an important capability of humans and plays a vital role in human society for forming beliefs and opinions. In this paper, we investigate how learning affects the dynamics of opinion formation in social networks. A novel learning model is proposed, in which agents can dynamically adapt their learning behaviours in order to facilitate the formation of consensus among them, and thus establish a consistent social norm in the whole population more efficiently. In the model, agents adapt their opinions through trail-and-error interactions with others. By exploiting historical interaction experience, a guiding opinion, which is considered to be the most successful opinion in the neighbourhood, can be generated based on the principle of evolutionary game theory. Then, depending on the consistency between its own opinion and the guiding opinion, a focal agent can realize whether its opinion complies with the social norm (i.e., the majority opinion that has been adopted) in the population, and adapt its behaviours accordingly. The highlight of the model lies in that it captures the essential features of people’s adaptive learning behaviours during the evolution and formation of opinions. Experimental results show that the proposed model can facilitate the formation of consensus among agents, and some critical factors such as size of opinion space and network topology can have significant influences on opinion dynamics.

  16. Accurate construction of consensus genetic maps via integer linear programming.

    PubMed

    Wu, Yonghui; Close, Timothy J; Lonardi, Stefano

    2011-01-01

    We study the problem of merging genetic maps, when the individual genetic maps are given as directed acyclic graphs. The computational problem is to build a consensus map, which is a directed graph that includes and is consistent with all (or, the vast majority of) the markers in the input maps. However, when markers in the individual maps have ordering conflicts, the resulting consensus map will contain cycles. Here, we formulate the problem of resolving cycles in the context of a parsimonious paradigm that takes into account two types of errors that may be present in the input maps, namely, local reshuffles and global displacements. The resulting combinatorial optimization problem is, in turn, expressed as an integer linear program. A fast approximation algorithm is proposed, and an additional speedup heuristic is developed. Our algorithms were implemented in a software tool named MERGEMAP which is freely available for academic use. An extensive set of experiments shows that MERGEMAP consistently outperforms JOINMAP, which is the most popular tool currently available for this task, both in terms of accuracy and running time. MERGEMAP is available for download at http://www.cs.ucr.edu/~yonghui/mgmap.html. PMID:20479505

  17. Consensus Paper: Pathological Role of the Cerebellum in Autism

    PubMed Central

    Fatemi, S. Hossein; Aldinger, Kimberly A.; Ashwood, Paul; Bauman, Margaret L.; Blaha, Charles D.; Blatt, Gene J.; Chauhan, Abha; Chauhan, Ved; Dager, Stephen R.; Dickson, Price E.; Estes, Annette M.; Goldowitz, Dan; Heck, Detlef H.; Kemper, Thomas L.; King, Bryan H.; Martin, Loren A.; Millen, Kathleen J.; Mittleman, Guy; Mosconi, Matthew W.; Persico, Antonio M.; Sweeney, John A.; Webb, Sara J.; Welsh, John P.

    2013-01-01

    There has been significant advancement in various aspects of scientific knowledge concerning the role of cerebellum in the etiopathogenesis of autism. In the current consensus paper, we will observe the diversity of opinions regarding the involvement of this important site in the pathology of autism. Recent emergent findings in literature related to cerebellar involvement in autism are discussed, including: cerebellar pathology, cerebellar imaging and symptom expression in autism, cerebellar genetics, cerebellar immune function, oxidative stress and mitochondrial dysfunction, GABAergic and glutamatergic systems, cholinergic, dopaminergic, serotonergic, and oxytocin related changes in autism, motor control and cognitive deficits, cerebellar coordination of movements and cognition, gene-environment interactions, therapeutics in autism and relevant animal models of autism. Points of consensus include presence of abnormal cerebellar anatomy, abnormal neurotransmitter systems, oxidative stress, cerebellar motor and cognitive deficits, and neuroinflammation in subjects with autism. Undefined areas or areas requiring further investigation include lack of treatment options for core symptoms of autism, vermal hypoplasia and other vermal abnormalities as a consistent feature of autism, mechanisms underlying cerebellar contributions to cognition, and unknown mechanisms underlying neuroinflammation. PMID:22370873

  18. Collective learning and optimal consensus decisions in social animal groups.

    PubMed

    Kao, Albert B; Miller, Noam; Torney, Colin; Hartnett, Andrew; Couzin, Iain D

    2014-08-01

    Learning has been studied extensively in the context of isolated individuals. However, many organisms are social and consequently make decisions both individually and as part of a collective. Reaching consensus necessarily means that a single option is chosen by the group, even when there are dissenting opinions. This decision-making process decouples the otherwise direct relationship between animals' preferences and their experiences (the outcomes of decisions). Instead, because an individual's learned preferences influence what others experience, and therefore learn about, collective decisions couple the learning processes between social organisms. This introduces a new, and previously unexplored, dynamical relationship between preference, action, experience and learning. Here we model collective learning within animal groups that make consensus decisions. We reveal how learning as part of a collective results in behavior that is fundamentally different from that learned in isolation, allowing grouping organisms to spontaneously (and indirectly) detect correlations between group members' observations of environmental cues, adjust strategy as a function of changing group size (even if that group size is not known to the individual), and achieve a decision accuracy that is very close to that which is provably optimal, regardless of environmental contingencies. Because these properties make minimal cognitive demands on individuals, collective learning, and the capabilities it affords, may be widespread among group-living organisms. Our work emphasizes the importance and need for theoretical and experimental work that considers the mechanism and consequences of learning in a social context.

  19. Accurate construction of consensus genetic maps via integer linear programming.

    PubMed

    Wu, Yonghui; Close, Timothy J; Lonardi, Stefano

    2011-01-01

    We study the problem of merging genetic maps, when the individual genetic maps are given as directed acyclic graphs. The computational problem is to build a consensus map, which is a directed graph that includes and is consistent with all (or, the vast majority of) the markers in the input maps. However, when markers in the individual maps have ordering conflicts, the resulting consensus map will contain cycles. Here, we formulate the problem of resolving cycles in the context of a parsimonious paradigm that takes into account two types of errors that may be present in the input maps, namely, local reshuffles and global displacements. The resulting combinatorial optimization problem is, in turn, expressed as an integer linear program. A fast approximation algorithm is proposed, and an additional speedup heuristic is developed. Our algorithms were implemented in a software tool named MERGEMAP which is freely available for academic use. An extensive set of experiments shows that MERGEMAP consistently outperforms JOINMAP, which is the most popular tool currently available for this task, both in terms of accuracy and running time. MERGEMAP is available for download at http://www.cs.ucr.edu/~yonghui/mgmap.html.

  20. International consensus diagnostic criteria for neuromyelitis optica spectrum disorders

    PubMed Central

    Banwell, Brenda; Bennett, Jeffrey L.; Cabre, Philippe; Carroll, William; Chitnis, Tanuja; de Seze, Jérôme; Fujihara, Kazuo; Greenberg, Benjamin; Jacob, Anu; Jarius, Sven; Lana-Peixoto, Marco; Levy, Michael; Simon, Jack H.; Tenembaum, Silvia; Traboulsee, Anthony L.; Waters, Patrick; Wellik, Kay E.

    2015-01-01

    Neuromyelitis optica (NMO) is an inflammatory CNS syndrome distinct from multiple sclerosis (MS) that is associated with serum aquaporin-4 immunoglobulin G antibodies (AQP4-IgG). Prior NMO diagnostic criteria required optic nerve and spinal cord involvement but more restricted or more extensive CNS involvement may occur. The International Panel for NMO Diagnosis (IPND) was convened to develop revised diagnostic criteria using systematic literature reviews and electronic surveys to facilitate consensus. The new nomenclature defines the unifying term NMO spectrum disorders (NMOSD), which is stratified further by serologic testing (NMOSD with or without AQP4-IgG). The core clinical characteristics required for patients with NMOSD with AQP4-IgG include clinical syndromes or MRI findings related to optic nerve, spinal cord, area postrema, other brainstem, diencephalic, or cerebral presentations. More stringent clinical criteria, with additional neuroimaging findings, are required for diagnosis of NMOSD without AQP4-IgG or when serologic testing is unavailable. The IPND also proposed validation strategies and achieved consensus on pediatric NMOSD diagnosis and the concepts of monophasic NMOSD and opticospinal MS. PMID:26092914

  1. Combination therapy in hypertension: an Asia-Pacific consensus viewpoint.

    PubMed

    Abdul Rahman, Abdul Rashid; Reyes, Eugenio B; Sritara, Piyamitr; Pancholia, Arvind; Van Phuoc, Dang; Tomlinson, Brian

    2015-05-01

    Hypertension incurs a significant healthcare burden in Asia-Pacific countries, which have suboptimal rates of blood pressure (BP) treatment and control. A consensus meeting of hypertension experts from the Asia-Pacific region convened in Hanoi, Vietnam, in April 2013. The principal objectives were to discuss the growing problem of hypertension in the Asia-Pacific region, and to develop consensus recommendations to promote standards of care across the region. A particular focus was recommendations for combination therapy, since it is known that most patients with hypertension will require two or more antihypertensive drugs to achieve BP control, and also that combinations of drugs with complementary mechanisms of action achieve BP targets more effectively than monotherapy. The expert panel reviewed guidelines for hypertension management from the USA and Europe, as well as individual Asia-Pacific countries, and devised a treatment matrix/guide, in which they propose the preferred combination therapy regimens for patients with hypertension, both with and without compelling indications. This report summarizes key recommendations from the group, including recommended antihypertensive combinations for specific patient populations. These strategies generally entail initiating therapy with free drug combinations, starting with the lowest available dosage, followed by treatment with single-pill combinations once the BP target has been achieved. A single reference for the whole Asia-Pacific region may contribute to increased consistency of treatment and greater proportions of patients achieving BP control, and hence reducing hypertension-related morbidity and mortality.

  2. [Consensus on Systemic Arterial Hypertension In México].

    PubMed

    Rosas-Peralta, Martín; Palomo-Piñón, Silvia; Borrayo-Sánchez, Gabriela; Madrid-Miller, Alejandra; Almeida-Gutiérrez, Eduardo; Galván-Oseguera, Héctor; Magaña-Serrano, José Antonio; Saturno-Chiu, Guillermo; Ramírez-Arias, Erick; Santos-Martínez, Efrén; Díaz-Díaz, Enrique; Salgado-Pastor, Selene Janette; Morales-Mora, Gerardo; Medina-Concebida, Luz Elena; Mejía-Rodríguez, Oliva; Pérez-Ruiz, Claudia Elsa; Chapa-Mejía, Luis Raúl; Álvarez-Aguilar, Cleto; Pérez-Rodríguez, Gilberto; Castro-Martínez, María Guadalupe; López-Bárcena, Joaquín; Paniagua-Sierra, José Ramón

    2016-01-01

    This Consenso Nacional de Hipertensión Arterial Sistémica (National Consensus on Systemic Arterial Hypertension) brings together experiences and joint work of 79 specialists who have been in contact with the patient affected by systemic arterial hypertension. All concepts here presented were outlined on the basis of the real world practice of Mexican hypertensive population. The consensus was developed under strict methodological guidelines. The Delphi technique was applied in two rounds for the development of an appropriate statistical analysis of the concepts exposed by all the specialists, who posed key questions, later developed by the panel of experts of the Hospital de Cardiología, and specialists from the Centro Médico Nacional. Several angles of this illness are shown: detection, diagnosis, pathophysiology, classification, treatment and prevention. The evidence analysis was carried out using PRISMA method. More than 600 articles were reviewed, leaving only the most representative in the references. This document concludes with practical and useful recommendations for the three levels of health care of our country.

  3. [Consensus statement for accreditation of multidisciplinary thyroid cancer units].

    PubMed

    Díez, Juan José; Galofré, Juan Carlos; Oleaga, Amelia; Grande, Enrique; Mitjavila, Mercedes; Moreno, Pablo

    2016-03-01

    Thyroid cancer is the leading endocrine system tumor. Great advances have recently been made in understanding of the origin of these tumors and the molecular biology that makes them grow and proliferate, which have been associated to improvements in diagnostic procedures and increased availability of effective local and systemic treatments. All of the above makes thyroid cancer a paradigm of how different specialties should work together to achieve the greatest benefit for the patients. Coordination of all the procedures and patient flows should continue throughout diagnosis, treatment, and follow-up, and is essential for further optimization of resources and time. This manuscript was prepared at the request of the Working Group on Thyroid Cancer of the Spanish Society of Endocrinology and Nutrition, and is aimed to provide a consensus document on the definition, composition, requirements, structure, and operation of a multidisciplinary team for the comprehensive care of patients with thyroid cancer. For this purpose, we have included contributions by several professionals from different specialties with experience in thyroid cancer treatment at centers where multidisciplinary teams have been working for years, with the aim of developing a practical consensus applicable in clinical practice. PMID:26456892

  4. Mapping and sequencing the human genome

    SciTech Connect

    1988-01-01

    Numerous meetings have been held and a debate has developed in the biological community over the merits of mapping and sequencing the human genome. In response a committee to examine the desirability and feasibility of mapping and sequencing the human genome was formed to suggest options for implementing the project. The committee asked many questions. Should the analysis of the human genome be left entirely to the traditionally uncoordinated, but highly successful, support systems that fund the vast majority of biomedical research. Or should a more focused and coordinated additional support system be developed that is limited to encouraging and facilitating the mapping and eventual sequencing of the human genome. If so, how can this be done without distorting the broader goals of biological research that are crucial for any understanding of the data generated in such a human genome project. As the committee became better informed on the many relevant issues, the opinions of its members coalesced, producing a shared consensus of what should be done. This report reflects that consensus.

  5. Mapping and Sequencing the Human Genome

    DOE R&D Accomplishments Database

    1988-01-01

    Numerous meetings have been held and a debate has developed in the biological community over the merits of mapping and sequencing the human genome. In response a committee to examine the desirability and feasibility of mapping and sequencing the human genome was formed to suggest options for implementing the project. The committee asked many questions. Should the analysis of the human genome be left entirely to the traditionally uncoordinated, but highly successful, support systems that fund the vast majority of biomedical research. Or should a more focused and coordinated additional support system be developed that is limited to encouraging and facilitating the mapping and eventual sequencing of the human genome. If so, how can this be done without distorting the broader goals of biological research that are crucial for any understanding of the data generated in such a human genome project. As the committee became better informed on the many relevant issues, the opinions of its members coalesced, producing a shared consensus of what should be done. This report reflects that consensus.

  6. Improvement in Protein Domain Identification Is Reached by Breaking Consensus, with the Agreement of Many Profiles and Domain Co-occurrence.

    PubMed

    Bernardes, Juliana; Zaverucha, Gerson; Vaquero, Catherine; Carbone, Alessandra

    2016-07-01

    Traditional protein annotation methods describe known domains with probabilistic models representing consensus among homologous domain sequences. However, when relevant signals become too weak to be identified by a global consensus, attempts for annotation fail. Here we address the fundamental question of domain identification for highly divergent proteins. By using high performance computing, we demonstrate that the limits of state-of-the-art annotation methods can be bypassed. We design a new strategy based on the observation that many structural and functional protein constraints are not globally conserved through all species but might be locally conserved in separate clades. We propose a novel exploitation of the large amount of data available: 1. for each known protein domain, several probabilistic clade-centered models are constructed from a large and differentiated panel of homologous sequences, 2. a decision-making protocol combines outcomes obtained from multiple models, 3. a multi-criteria optimization algorithm finds the most likely protein architecture. The method is evaluated for domain and architecture prediction over several datasets and statistical testing hypotheses. Its performance is compared against HMMScan and HHblits, two widely used search methods based on sequence-profile and profile-profile comparison. Due to their closeness to actual protein sequences, clade-centered models are shown to be more specific and functionally predictive than the broadly used consensus models. Based on them, we improved annotation of Plasmodium falciparum protein sequences on a scale not previously possible. We successfully predict at least one domain for 72% of P. falciparum proteins against 63% achieved previously, corresponding to 30% of improvement over the total number of Pfam domain predictions on the whole genome. The method is applicable to any genome and opens new avenues to tackle evolutionary questions such as the reconstruction of ancient domain

  7. Improvement in Protein Domain Identification Is Reached by Breaking Consensus, with the Agreement of Many Profiles and Domain Co-occurrence

    PubMed Central

    Bernardes, Juliana; Zaverucha, Gerson; Vaquero, Catherine; Carbone, Alessandra

    2016-01-01

    Traditional protein annotation methods describe known domains with probabilistic models representing consensus among homologous domain sequences. However, when relevant signals become too weak to be identified by a global consensus, attempts for annotation fail. Here we address the fundamental question of domain identification for highly divergent proteins. By using high performance computing, we demonstrate that the limits of state-of-the-art annotation methods can be bypassed. We design a new strategy based on the observation that many structural and functional protein constraints are not globally conserved through all species but might be locally conserved in separate clades. We propose a novel exploitation of the large amount of data available: 1. for each known protein domain, several probabilistic clade-centered models are constructed from a large and differentiated panel of homologous sequences, 2. a decision-making protocol combines outcomes obtained from multiple models, 3. a multi-criteria optimization algorithm finds the most likely protein architecture. The method is evaluated for domain and architecture prediction over several datasets and statistical testing hypotheses. Its performance is compared against HMMScan and HHblits, two widely used search methods based on sequence-profile and profile-profile comparison. Due to their closeness to actual protein sequences, clade-centered models are shown to be more specific and functionally predictive than the broadly used consensus models. Based on them, we improved annotation of Plasmodium falciparum protein sequences on a scale not previously possible. We successfully predict at least one domain for 72% of P. falciparum proteins against 63% achieved previously, corresponding to 30% of improvement over the total number of Pfam domain predictions on the whole genome. The method is applicable to any genome and opens new avenues to tackle evolutionary questions such as the reconstruction of ancient domain

  8. Improvement in Protein Domain Identification Is Reached by Breaking Consensus, with the Agreement of Many Profiles and Domain Co-occurrence.

    PubMed

    Bernardes, Juliana; Zaverucha, Gerson; Vaquero, Catherine; Carbone, Alessandra

    2016-07-01

    Traditional protein annotation methods describe known domains with probabilistic models representing consensus among homologous domain sequences. However, when relevant signals become too weak to be identified by a global consensus, attempts for annotation fail. Here we address the fundamental question of domain identification for highly divergent proteins. By using high performance computing, we demonstrate that the limits of state-of-the-art annotation methods can be bypassed. We design a new strategy based on the observation that many structural and functional protein constraints are not globally conserved through all species but might be locally conserved in separate clades. We propose a novel exploitation of the large amount of data available: 1. for each known protein domain, several probabilistic clade-centered models are constructed from a large and differentiated panel of homologous sequences, 2. a decision-making protocol combines outcomes obtained from multiple models, 3. a multi-criteria optimization algorithm finds the most likely protein architecture. The method is evaluated for domain and architecture prediction over several datasets and statistical testing hypotheses. Its performance is compared against HMMScan and HHblits, two widely used search methods based on sequence-profile and profile-profile comparison. Due to their closeness to actual protein sequences, clade-centered models are shown to be more specific and functionally predictive than the broadly used consensus models. Based on them, we improved annotation of Plasmodium falciparum protein sequences on a scale not previously possible. We successfully predict at least one domain for 72% of P. falciparum proteins against 63% achieved previously, corresponding to 30% of improvement over the total number of Pfam domain predictions on the whole genome. The method is applicable to any genome and opens new avenues to tackle evolutionary questions such as the reconstruction of ancient domain

  9. Sequence duplication and internal deletion in the integrated human papillomavirus type 16 genome cloned from a cervical carcinoma

    SciTech Connect

    Choo, Kongbung; Lee, Hsienhsiung; Pan, Chaochih; Wu, Sheuemei; Liew, Lipnyin; Cheung, Wingfai; Han, Shouhwa )

    1988-05-01

    Integrated human papillomavirus type 16 (HPV16) sequences were cloned from a cervical carcinoma and analyzed by restriction mapping and nucleotide sequencing. The viral integration sites were mapped within the E1 and E2 open reading frames (ORFs). The E4 and E5 ORFs were entirely deleted. An internal deletion of 376 base pairs (bp) was found disrupting the L1 and L2 ORFs. Sequencing analysis showed that an AGATGT/ACATCT inverted repeat marked the deletion junction with two flanking direct repeats 14 and 8 bp in length. A 1,330-bp sequence duplication containing the long control region (LCR) and the E6 and E7 ORFs was also found. The duplication junction was formed by two 24-bp direct repeats with 79% (19 of 24) homology located within the LCR and the E2 ORF of the prototype viral genome, respectively. This observation leads us to propose that the initial viral integration involved an HPV16 dimer in which the direct repeats in tandem units recombined, resulting in reiteration of only a portion of the original duplication. A guanosine insertion between nucleotides 1,137 and 1,138 created a continuous E1 ORF which was previously shown to be disrupted. Results from this study indicate that sequence reiteration and internal deletion in the integrated, and possibly in the episomal, HPV16 genome are influenced by specific nucleotide sequences in the viral genome. Moreover, reiteration of the LCR/E6/E7 sequences further supports the hypothesis that the E6/E7 ORFs may code for oncogenic proteins and that regulatory signals in the LCR may play a role in cellular transformation.

  10. Populism vs. elitism: social consensus and social status as bases of attitude certainty.

    PubMed

    Prislin, Radmila; Shaffer, Emily; Crowder, Marisa

    2012-01-01

    This study examined the effects of social consensus and social status on attitude certainty that is conceptualized multi-dimensionally as perceived clarity and correctness of one's attitude. In a mock opinion exchange about a social issue, participants were either supported (high consensus) or opposed (low consensus) by most of the confederates. They were informed that their opinion (high status) or their opponents' opinion (low status) had the alleged psychological significance indicative of future success. Post-experimental attitude clarity was significantly greater when attitudinal position was associated with high rather than low status. Attitude correctness was interactively affected by social status and social consensus. Supporting the compensatory effect hypothesis, attitude correctness was comparable across the levels of social consensus as long as they were associated with high status, and across the levels of social status as long as they were associated with high social consensus. PMID:22558827

  11. Assessing excellence in translational cancer research: a consensus based framework

    PubMed Central

    2013-01-01

    Background It takes several years on average to translate basic research findings into clinical research and eventually deliver patient benefits. An expert-based excellence assessment can help improve this process by: identifying high performing Comprehensive Cancer Centres; best practices in translational cancer research; improving the quality and efficiency of the translational cancer research process. This can help build networks of excellent Centres by aiding focused partnerships. In this paper we report on a consensus building exercise that was undertaken to construct an excellence assessment framework for translational cancer research in Europe. Methods We used mixed methods to reach consensus: a systematic review of existing translational research models critically appraised for suitability in performance assessment of Cancer Centres; a survey among European stakeholders (researchers, clinicians, patient representatives and managers) to score a list of potential excellence criteria, a focus group with selected representatives of survey participants to review and rescore the excellence criteria; an expert group meeting to refine the list; an open validation round with stakeholders and a critical review of the emerging framework by an independent body: a committee formed by the European Academy of Cancer Sciences. Results The resulting excellence assessment framework has 18 criteria categorized in 6 themes. Each criterion has a number of questions/sub-criteria. Stakeholders favoured using qualitative excellence criteria to evaluate the translational research “process” rather than quantitative criteria or judging only the outputs. Examples of criteria include checking if the Centre has mechanisms that can be rated as excellent for: involvement of basic researchers and clinicians in translational research (quality of supervision and incentives provided to clinicians to do a PhD in translational research) and well designed clinical trials based on ground

  12. Cluster consensus of high-order multi-agent systems with switching topologies

    NASA Astrophysics Data System (ADS)

    Hou, Bo; Sun, Fuchun; Li, Hongbo; Chen, Yao; Xi, Jianxiang

    2016-09-01

    This paper investigates the cluster consensus problems of generic linear multi-agent systems with switching topologies. Sufficient criteria for cluster consensus, which generalise the results in existing literatures, are derived for both state feedback and observer-based control schemes. By using an averaging method, it is shown that cluster consensus can be achieved when the union of the acyclic topologies contains a directed spanning tree within each cluster frequently enough. We also provide a principle to construct digraphs with inter-cluster cyclic couplings that promote cluster consensus regardless of the magnitude of inter-agent coupling weights. Finally, numerical examples are given to demonstrate the effectiveness of the proposed approaches.

  13. Impulsive consensus seeking in directed networks of multi-agent systems with communication time delays

    NASA Astrophysics Data System (ADS)

    Wu, Quanjun; Zhou, Jin; Xiang, Lan

    2012-08-01

    In this article, we consider average consensus problem in directed delayed networked multi-agent systems having impulsive effects with fixed topology and stochastic switching topology. A simple impulsive consensus protocol for such networks is proposed, and some generic criteria for solving the average consensus problem are analytically derived. It is shown that a directed delayed networked multi-agent system can achieve average consensus globally exponentially with suitable impulsive gain and impulsive interval. Subsequently, two typical illustrative examples, along with computer simulation results, are provided to visualise the effectiveness and feasibility of our theoretical results.

  14. Group consensus of multi-agent systems in directed networks with noises and time delays

    NASA Astrophysics Data System (ADS)

    Shang, Yilun

    2015-10-01

    In this paper, group consensus problems in fixed directed networks of dynamic agents are investigated. Group consensus means that the agents in each group share a consistent value while there is no agreement between any two groups. Based on algebraic graph theory, sufficient conditions guaranteeing group consensus under the proposed control protocol in the presence of random noises and communication delays are derived. The analysis uses a stability result of Mao for stochastic differential delay equations, which ensures the consensus can be achieved almost surely and exponentially fast. Numerical examples are provided to demonstrate the availability of the obtained results as well as the effect of time delay/noise intensity.

  15. A High Density Consensus Genetic Map of Tetraploid Cotton That Integrates Multiple Component Maps through Molecular Marker Redundancy Check

    PubMed Central

    Blenda, Anna; Fang, David D.; Rami, Jean-François; Garsmeur, Olivier; Luo, Feng; Lacape, Jean-Marc

    2012-01-01

    A consensus genetic map of tetraploid cotton was constructed using six high-density maps and after the integration of a sequence-based marker redundancy check. Public cotton SSR libraries (17,343 markers) were curated for sequence redundancy using 90% as a similarity cutoff. As a result, 20% of the markers (3,410) could be considered as redundant with some other markers. The marker redundancy information had been a crucial part of the map integration process, in which the six most informative interspecific Gossypium hirsutum×G. barbadense genetic maps were used for assembling a high density consensus (HDC) map for tetraploid cotton. With redundant markers being removed, the HDC map could be constructed thanks to the sufficient number of collinear non-redundant markers in common between the component maps. The HDC map consists of 8,254 loci, originating from 6,669 markers, and spans 4,070 cM, with an average of 2 loci per cM. The HDC map presents a high rate of locus duplications, as 1,292 markers among the 6,669 were mapped in more than one locus. Two thirds of the duplications are bridging homoeologous AT and DT chromosomes constitutive of allopolyploid cotton genome, with an average of 64 duplications per AT/DT chromosome pair. Sequences of 4,744 mapped markers were used for a mutual blast alignment (BBMH) with the 13 major scaffolds of the recently released Gossypium raimondii genome indicating high level of homology between the diploid D genome and the tetraploid cotton genetic map, with only a few minor possible structural rearrangements. Overall, the HDC map will serve as a valuable resource for trait QTL comparative mapping, map-based cloning of important genes, and better understanding of the genome structure and evolution of tetraploid cotton. PMID:23029214

  16. A multi-population consensus genetic map reveals inconsistent marker order among maps likely attributed to structural variations in the apple genome.

    PubMed

    Khan, Muhammad Awais; Han, Yuepeng; Zhao, Youfu Frank; Troggio, Michela; Korban, Schuyler S

    2012-01-01

    Genetic maps serve as frameworks for determining the genetic architecture of quantitative traits, assessing structure of a genome, as well as aid in pursuing association mapping and comparative genetic studies. In this study, a dense genetic map was constructed using a high-throughput 1,536 EST-derived SNP GoldenGate genotyping platform and a global consensus map established by combining the new genetic map with four existing reliable genetic maps of apple. The consensus map identified markers with both major and minor conflicts in positioning across all five maps. These major inconsistencies among marker positions were attributed either to structural variations within the apple genome, or among mapping populations, or genotyping technical errors. These also highlighted problems in assembly and anchorage of the reference draft apple genome sequence in regions with known segmental duplications. Markers common across all five apple genetic maps resulted in successful positioning of 2875 markers, consisting of 2033 SNPs and 843 SSRs as well as other specific markers, on the global consensus map. These markers were distributed across all 17 linkage groups, with an average of 169±33 marker per linkage group and with an average distance of 0.70±0.14 cM between markers. The total length of the consensus map was 1991.38 cM with an average length of 117.14±24.43 cM per linkage group. A total of 569 SNPs were mapped onto the genetic map, consisting of 140 recombinant individuals, from our recently developed apple Oligonucleotide pool assays (OPA). The new functional SNPs, along with the dense consensus genetic map, will be useful for high resolution QTL mapping of important traits in apple and for pursuing comparative genetic studies in Rosaceae.

  17. A high-density, SNP-based consensus map of tetraploid wheat as a bridge to integrate durum and bread wheat genomics and breeding.

    PubMed

    Maccaferri, Marco; Ricci, Andrea; Salvi, Silvio; Milner, Sara Giulia; Noli, Enrico; Martelli, Pier Luigi; Casadio, Rita; Akhunov, Eduard; Scalabrin, Simone; Vendramin, Vera; Ammar, Karim; Blanco, Antonio; Desiderio, Francesca; Distelfeld, Assaf; Dubcovsky, Jorge; Fahima, Tzion; Faris, Justin; Korol, Abraham; Massi, Andrea; Mastrangelo, Anna Maria; Morgante, Michele; Pozniak, Curtis; N'Diaye, Amidou; Xu, Steven; Tuberosa, Roberto

    2015-06-01

    Consensus linkage maps are important tools in crop genomics. We have assembled a high-density tetraploid wheat consensus map by integrating 13 data sets from independent biparental populations involving durum wheat cultivars (Triticum turgidum ssp. durum), cultivated emmer (T. turgidum ssp. dicoccum) and their ancestor (wild emmer, T. turgidum ssp. dicoccoides). The consensus map harboured 30 144 markers (including 26 626 SNPs and 791 SSRs) half of which were present in at least two component maps. The final map spanned 2631 cM of all 14 durum wheat chromosomes and, differently from the individual component maps, all markers fell within the 14 linkage groups. Marker density per genetic distance unit peaked at centromeric regions, likely due to a combination of low recombination rate in the centromeric regions and even gene distribution along the chromosomes. Comparisons with bread wheat indicated fewer regions with recombination suppression, making this consensus map valuable for mapping in the A and B genomes of both durum and bread wheat. Sequence similarity analysis allowed us to relate mapped gene-derived SNPs to chromosome-specific transcripts. Dense patterns of homeologous relationships have been established between the A- and B-genome maps and between nonsyntenic homeologous chromosome regions as well, the latter tracing to ancient translocation events. The gene-based homeologous relationships are valuable to infer the map location of homeologs of target loci/QTLs. Because most SNP and SSR markers were previously mapped in bread wheat, this consensus map will facilitate a more effective integration and exploitation of genes and QTL for wheat breeding purposes. PMID:25424506

  18. A high-density, SNP-based consensus map of tetraploid wheat as a bridge to integrate durum and bread wheat genomics and breeding.

    PubMed

    Maccaferri, Marco; Ricci, Andrea; Salvi, Silvio; Milner, Sara Giulia; Noli, Enrico; Martelli, Pier Luigi; Casadio, Rita; Akhunov, Eduard; Scalabrin, Simone; Vendramin, Vera; Ammar, Karim; Blanco, Antonio; Desiderio, Francesca; Distelfeld, Assaf; Dubcovsky, Jorge; Fahima, Tzion; Faris, Justin; Korol, Abraham; Massi, Andrea; Mastrangelo, Anna Maria; Morgante, Michele; Pozniak, Curtis; N'Diaye, Amidou; Xu, Steven; Tuberosa, Roberto

    2015-06-01

    Consensus linkage maps are important tools in crop genomics. We have assembled a high-density tetraploid wheat consensus map by integrating 13 data sets from independent biparental populations involving durum wheat cultivars (Triticum turgidum ssp. durum), cultivated emmer (T. turgidum ssp. dicoccum) and their ancestor (wild emmer, T. turgidum ssp. dicoccoides). The consensus map harboured 30 144 markers (including 26 626 SNPs and 791 SSRs) half of which were present in at least two component maps. The final map spanned 2631 cM of all 14 durum wheat chromosomes and, differently from the individual component maps, all markers fell within the 14 linkage groups. Marker density per genetic distance unit peaked at centromeric regions, likely due to a combination of low recombination rate in the centromeric regions and even gene distribution along the chromosomes. Comparisons with bread wheat indicated fewer regions with recombination suppression, making this consensus map valuable for mapping in the A and B genomes of both durum and bread wheat. Sequence similarity analysis allowed us to relate mapped gene-derived SNPs to chromosome-specific transcripts. Dense patterns of homeologous relationships have been established between the A- and B-genome maps and between nonsyntenic homeologous chromosome regions as well, the latter tracing to ancient translocation events. The gene-based homeologous relationships are valuable to infer the map location of homeologs of target loci/QTLs. Because most SNP and SSR markers were previously mapped in bread wheat, this consensus map will facilitate a more effective integration and exploitation of genes and QTL for wheat breeding purposes.

  19. Automated Sanger Analysis Pipeline (ASAP): A Tool for Rapidly Analyzing Sanger Sequencing Data with Minimum User Interference

    PubMed Central

    Singh, Aditya; Bhatia, Prateek

    2016-01-01

    Sanger sequencing platforms, such as applied biosystems instruments, generate chromatogram files. Generally, for 1 region of a sequence, we use both forward and reverse primers to sequence that area, in that way, we have 2 sequences that need to be aligned and a consensus generated before mutation detection studies. This work is cumbersome and takes time, especially if the gene is large with many exons. Hence, we devised a rapid automated command system to filter, build, and align consensus sequences and also optionally extract exonic regions, translate them in all frames, and perform an amino acid alignment starting from raw sequence data within a very short time. In full capabilities of Automated Mutation Analysis Pipeline (ASAP), it is able to read "*.ab1" chromatogram files through command line interface, convert it to the FASTQ format, trim the low-quality regions, reverse-complement the reverse sequence, create a consensus sequence, extract the exonic regions using a reference exonic sequence, translate the sequence in all frames, and align the nucleic acid and amino acid sequences to reference nucleic acid and amino acid sequences, respectively. All files are created and can be used for further analysis. ASAP is available as Python 3.x executable at https://github.com/aditya-88/ASAP. The version described in this paper is 0.28. PMID:27790076

  20. Proton and electron mean free paths: The Palmer consensus revisited

    NASA Technical Reports Server (NTRS)

    Bieber, John W.; Matthaeus, William H.; Smith, Charles W.; Wanner, Wolfgang; Kallenrode, May-Britt; Wibberenz, Gerd

    1994-01-01

    We present experimental and theoretical evidence suggesting that the mean free path of cosmic-ray electrons and protons may be fundamentally different at low to intermediate (less than 50 MV) rigidities. The experimental evidence is from Helios observations of solar energetic particles, which show that the mean free path of 1.4 MV electrons is often similar to that of 187 MV protons, even though proton mean free paths continue to decrease comparatively rapidly with decreasing rigidty down to the lowest channels (about 100 MV) observed. The theoretical evidence is from computations of particle scattering in dynamical magnetic turbulence, which predict that electrons will have a larger mean free path than protons of the same rigidity. In the light of these new results, 'consensus' ideas about cosmic-ray mean free paths may require drastic revision.

  1. Multidisciplinary Management of Mastocytosis: Nordic Expert Group Consensus.

    PubMed

    Broesby-Olsen, Sigurd; Dybedal, Ingunn; Gülen, Theo; Kristensen, Thomas K; Møller, Michael B; Ackermann, Leena; Sääf, Maria; Karlsson, Maria A; Agertoft, Lone; Brixen, Kim; Hermann, Pernille; Stylianou, Eva; Mortz, Charlotte G; Torfing, Trine; Havelund, Troels; Sander, Birgitta; Bergström, Anna; Bendix, Marie; Garvey, Lene H; Bjerrum, Ole Weis; Valent, Peter; Bindslev-Jensen, Carsten; Nilsson, Gunnar; Vestergaard, Hanne; Hägglund, Hans

    2016-06-15

    Mastocytosis is a heterogeneous group of diseases defined by an increased number and accumulation of mast cells, and often also by signs and symptoms of mast cell activation. Disease subtypes range from indolent to rare aggressive forms. Mastocytosis affects people of all ages and has been considered rare; however, it is probably underdiagnosed with potential severe implications. Diagnosis can be challenging and symptoms may be complex and involve multiple organ-systems. In general it is advised that patients should be referred to centres with experience in the disease offering an individualized, multidisciplinary approach. We present here consensus recommendations from a Nordic expert group for the diagnosis and general management of patients with mastocytosis.

  2. An Interactive Multi-Model for Consensus on Climate Change

    SciTech Connect

    Kocarev, Ljupco

    2014-07-02

    This project purports to develop a new scheme for forming consensus among alternative climate models, that give widely divergent projections as to the details of climate change, that is more intelligent than simply averaging the model outputs, or averaging with ex post facto weighting factors. The method under development effectively allows models to assimilate data from one another in run time with weights that are chosen in an adaptive training phase using 20th century data, so that the models synchronize with one another as well as with reality. An alternate approach that is being explored in parallel is the automated combination of equations from different models in an expert-system-like framework.

  3. Melanoma: diagnosis, staging, and treatment. Consensus group recommendations.

    PubMed

    Berrocal, Alfonso; Cabañas, Luis; Espinosa, Enrique; Fernández-de-Misa, Ricardo; Martín-Algarra, Salvador; Martínez-Cedres, José Carlos; Ríos-Buceta, Luis; Rodríguez-Peralto, José Luis

    2014-09-01

    The incidence of malignant melanoma is increasing worldwide. In Spain, its incidence is increasing faster than any other cancer type, with a 5-year survival rate of about 85%. The impact and characteristics of malignant melanoma in the Spanish population can be ascertained from the national melanoma registry of the Academia Española de Dermatología y Venereología. This review presents consensus group recommendations for the diagnosis, staging and treatment of malignant melanoma in Spain. Incidence and mortality are discussed, as well as evaluation of various prevention and treatment strategies. Prognostic factors, such as BRAF and C-KIT mutations, which are expected to become routine staging procedures over the next few years, are outlined, especially in relation to treatment options. The use of recently approved targeted agents such as ipilimumab, a cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) inhibitor, and vemurafenib, a BRAF inhibitor, in metastatic disease are also discussed.

  4. A constraint consensus memetic algorithm for solving constrained optimization problems

    NASA Astrophysics Data System (ADS)

    Hamza, Noha M.; Sarker, Ruhul A.; Essam, Daryl L.; Deb, Kalyanmoy; Elsayed, Saber M.

    2014-11-01

    Constraint handling is an important aspect of evolutionary constrained optimization. Currently, the mechanism used for constraint handling with evolutionary algorithms mainly assists the selection process, but not the actual search process. In this article, first a genetic algorithm is combined with a class of search methods, known as constraint consensus methods, that assist infeasible individuals to move towards the feasible region. This approach is also integrated with a memetic algorithm. The proposed algorithm is tested and analysed by solving two sets of standard benchmark problems, and the results are compared with other state-of-the-art algorithms. The comparisons show that the proposed algorithm outperforms other similar algorithms. The algorithm has also been applied to solve a practical economic load dispatch problem, where it also shows superior performance over other algorithms.

  5. [Kawasaki disease: interdisciplinary and intersocieties consensus (clinical guidelines). Brief version].

    PubMed

    2016-08-01

    Kawasaki disease is an acute self-limiting systemic vasculitis. It is the most common cause of acquired heart disease, with the risk of developing coronary artery aneurysms, myocardial infarction and sudden death. Diagnosis is based on the presence of fever in addition to other clinical criteria. The quarter of the Kawasaki disease patients have "incomplete" presentation. Treatment with intravenous immunoglobulin within ten days of fever onset improves clinical outcomes and reduces the incidence of coronary artery dilation to less than 5%. Non-responders to standard therapy have shown a successful response with the use of corticosteroids and/or biological agents. The long-term management must be delineated according to the degree of coronary involvement in a multidisciplinary manner. To facilitate the pediatrician's diagnosis, treatment and monitoring of Kawasaki disease, a group of experts from the Argentine Society of Pediatrics and the Argentine Society of Cardiology carried out a consensus to develop practical clinical guidelines. PMID:27399018

  6. Italian consensus conference for colonic diverticulosis and diverticular disease

    PubMed Central

    Barbara, Giovanni; Pace, Fabio; Annese, Vito; Bassotti, Gabrio; Binda, Gian Andrea; Casetti, Tino; Colecchia, Antonio; Festi, Davide; Fiocca, Roberto; Laghi, Andrea; Maconi, Giovanni; Nascimbeni, Riccardo; Scarpignato, Carmelo; Villanacci, Vincenzo; Annibale, Bruno

    2014-01-01

    The statements produced by the Consensus Conference on Diverticular Disease promoted by GRIMAD (Gruppo Italiano Malattia Diverticolare, Italian Group on Diverticular Diseases) are reported. Topics such as epidemiology, risk factors, diagnosis, medical and surgical treatment of diverticular disease (DD) in patients with uncomplicated and complicated DD were reviewed by a scientific board of experts who proposed 55 statements graded according to level of evidence and strength of recommendation, and approved by an independent jury. Each topic was explored focusing on the more relevant clinical questions. Comparison and discussion of expert opinions, pertinent statements and replies to specific questions, were presented and approved based on a systematic literature search of the available evidence. Comments were added explaining the basis for grading the evidence, particularly for controversial areas. PMID:25360320

  7. Four functions for four relationships: consensus definitions of university students.

    PubMed

    Jonason, Peter K

    2013-11-01

    In this study (N = 192; 124 women, 68 men), consensus definitions of one-night stands, booty-call relationships, friends-with-benefits, and serious romantic relationships were fashioned using a sample of university students. Participants provided a Likert and forced-choice assessment of how each relationship was characterized by the functions of sexual gratification, trial run, placeholder, and socioemotional support. Serious romantic relationships were primarily used to gain socioemotional support. Friends-with-benefits relationships were motivated by seeking a placeholder until someone better came along and as a trial run for a more serious relationship. Booty-call relationships and one-night stands were motivated primarily by a desire for sexual gratification. Men ascribed a greater range of reasons to engage in sexual relationships than women did and the more short-term the relationship was in nature, the greater the emergence of sex differences in ascribed functions. PMID:24217952

  8. Proceedings of the International Consensus on Periprosthetic Joint Infection.

    PubMed

    Parvizi, J; Gehrke, T; Chen, A F

    2013-11-01

    Louis Pasteur once said that: "Fortune favours the prepared mind." As one of the great scientists who contributed to the fight against infection, he emphasised the importance of being prepared at all times to recognise infection and deal with it. Despite the many scientific discoveries and technological advances, such as the advent of antibiotics and the use of sterile techniques, infection continues to be a problem that haunts orthopaedic surgeons and inflicts suffering on patients. The medical community has implemented many practices with the intention of preventing infection and treating it effectively when it occurs. Although high-level evidence may support some of these practices, many are based on little to no scientific foundation. Thus, around the world, there is great variation in practices for the prevention and management of periprosthetic joint infection. This paper summaries the instigation, conduct and findings of a recent International Consensus Meeting on Surgical Site and Periprosthetic Joint Infection. PMID:24151261

  9. The Spanish human papillomavirus vaccine consensus group: a working model.

    PubMed

    Cortés-Bordoy, Javier; Martinón-Torres, Federico

    2010-08-01

    Successful implementation of Human Papillomavirus (HPV) vaccine in each country can only be achieved from a complementary and synergistic perspective, integrating all the different points of view of the diverse related professionals. It is this context where the Spanish HPV Vaccine Consensus Group (Grupo Español de Consenso sobre la Vacuna VPH, GEC-VPH) was created. GEC-VPH philosophy, objectives and experience are reported in this article, with particular attention to the management of negative publicity and anti-vaccine groups. Initiatives as GEC-VPH--adapted to each country's particular idiosyncrasies--might help to overcome the existing barriers and to achieve wide and early implementation of HPV vaccination. PMID:20484987

  10. A consensus statement on critical thinking in nursing.

    PubMed

    Scheffer, B K; Rubenfeld, M G

    2000-11-01

    The purpose of this study was to define critical thinking in nursing. A Delphi technique with 5 rounds of input was used to achieve this purpose. An international panel of expert nurses from nine countries: Brazil, Canada, England, Iceland, Japan, Korea, Netherlands, Thailand, and 23 states in the U.S. participated in this study between 1995 and 1998. A consensus definition (statement) of critical thinking in nursing was achieved. The panel also identified and defined 10 habits of the mind (affective components) and 7 skills (cognitive components) of critical thinking in nursing. The habits of the mind of critical thinking in nursing included: confidence, contextual perspective, creativity, flexibility, inquisitiveness, intellectual integrity, intuition, open-mindedness, perseverance, and reflection. Skills of critical thinking in nursing included: analyzing, applying standards, discriminating, information seeking, logical reasoning, predicting and transforming knowledge. These findings can be used by practitioners, educators and researchers to advance understanding of the essential role of critical thinking in nursing.

  11. Surgical research in Canada: synopsis of a consensus conference

    PubMed Central

    Warnock, Garth L.; Tator, Charles H.

    1998-01-01

    Canadian surgical research requires careful nurturing if it is to flourish in tomorrow’s environment. A consensus conference organized by the Research Development Committee of the Canadian Association of Surgical Chairs has addressed a number of issues to promote Canadian surgical research. This synopsis is a summary of the proceedings of that conference. It reflects on the meaning of surgical science, elements of establishing a successful research program, leadership in surgical science, identification of talented trainees, and the means to make the most of opportunities for funding. The information contained in the synopsis should not only assist departments of surgery and surgical specialty societies but should challenge them to set goals and innovative approaches to plan for strong surgical research in a changing environment. PMID:9711162

  12. [Consensus report on the management of immune thrombocytopenia in pregnancy].

    PubMed

    Miyakawa, Yoshitaka

    2015-10-01

    Primary immune thrombocytopenia (ITP) is a benign hematological disorder characterized by platelet counts under 100×10(9)/l. We updated the consensus report for the management of ITP in pregnancy after a 20-year lag. For this update, not only hematologists, but also obstetricians, pediatricians, and anesthesiologists joined our committee. We recommend that physicians maintain platelet counts above 20×10(6)/l in the first and second trimesters. We also agree that counts should be at least 50×10(9)/l and 80×10(9)/l for vaginal and C-section deliveries, respectively. There might be no obvious reasons to forbid lactation in ITP patients receiving treatment with corticosteroids. In this educational session, I will discuss the differential diagnosis of thrombocytopenia and the management of ITP in pregnant women and their neonates based on international and updated domestic guidelines. PMID:26458448

  13. The Hartford Consensus IV: A Call for Increased National Resilience.

    PubMed

    Jacobs, Lenworth M

    2016-04-01

    Despite advances in the response to active shooter and intentional mass casualty events, a gap remains in our national preparedness and resilience. Drawing from experiences at myriad mass casualty events, the immediate responder (volunteer responder) represents an underutilized resource, yet one capable of dramatically increasing our all-hazards (injuries from all natural and man-made causes) national resilience. The overarching principle of the Hartford Consensus, outlined in previous reports, is that no one should die from uncontrolled bleeding. We have championed the following acronym to summarize what we have determined are appropriate steps to ensure that the maximum number of victims of these tragic events can be saved: THREAT: Threat suppression. Hemorrhage control. Rapid Extrication to safety. Assessment by medical providers. Transport to definitive care. PMID:27265929

  14. International Consensus Document (ICON): Common Variable Immunodeficiency Disorders

    PubMed Central

    Bonilla, Francisco A.; Barlan, Isil; Chapel, Helen; Costa-Carvalho, Beatriz T.; Cunningham-Rundles, Charlotte; de la Morena, M. Teresa; Espinosa-Rosales, Francisco J.; Hammarström, Lennart; Nonoyama, Shigeaki; Quinti, Isabella; Routes, John M.; Tang, Mimi L.K.; Warnatz, Klaus

    2016-01-01

    The International Collaboration in Asthma, Allergy and Immunology initiated an international coalition among the American Academy of Allergy, Asthma & Immunology; the European Academy of Allergy and Clinical Immunology; the World Allergy Organization; and the American College of Allergy, Asthma & Immunology on common variable immunodeficiency. An author group was formed and then divided into individual committees. Within the committee, teams of authors were subgrouped to generate content for specific sections of the document. Content was derived from literature searches, relevant published guidelines, and clinical experience. After a draft of the document was assembled, it was collectively reviewed and revised by the authors. Where evidence was lacking or conflicting, the information presented represents the consensus expert opinion of the group. The full document was then independently reviewed by 5 international experts in the field, none of whom was among the authors of the original. The comments of these reviewers were incorporated before submission for publication. PMID:26563668

  15. CONSENSUS TREATMENT RECOMMENDATIONS FOR LATE-ONSET POMPE DISEASE

    PubMed Central

    Cupler, Edward J.; Berger, Kenneth I.; Leshner, Robert T.; Wolfe, Gil I.; Han, Jay J.; Barohn, Richard J.; Kissel, John T.

    2012-01-01

    Introduction Pompe disease is a rare, autosomal recessive disorder caused by deficiency of the glycogen-degrading lysosomal enzyme acid alpha-glucosidase. Late-onset Pompe disease is a multisystem condition, with a heterogeneous clinical presentation that mimics other neuromuscular disorders. Methods Objective is to propose consensus-based treatment and management recommendations for late-onset Pompe disease. Methods A systematic review of the literature by a panel of specialists with expertise in Pompe disease was undertaken. Conclusions A multidisciplinary team should be involved to properly treat the pulmonary, neuromuscular, orthopedic, and gastrointestinal elements of late-onset Pompe disease. Presymptomatic patients with subtle objective signs of Pompe disease (and patients symptomatic at diagnosis) should begin treatment with enzyme replacement therapy (ERT) immediately; presymptomatic patients without symptoms or signs should be observed without use of ERT. After 1 year of ERT, patients’ condition should be reevaluated to determine whether ERT should be continued. PMID:22173792

  16. Outcome Measures for Artificial Pancreas Clinical Trials: A Consensus Report.

    PubMed

    Maahs, David M; Buckingham, Bruce A; Castle, Jessica R; Cinar, Ali; Damiano, Edward R; Dassau, Eyal; DeVries, J Hans; Doyle, Francis J; Griffen, Steven C; Haidar, Ahmad; Heinemann, Lutz; Hovorka, Roman; Jones, Timothy W; Kollman, Craig; Kovatchev, Boris; Levy, Brian L; Nimri, Revital; O'Neal, David N; Philip, Moshe; Renard, Eric; Russell, Steven J; Weinzimer, Stuart A; Zisser, Howard; Lum, John W

    2016-07-01

    Research on and commercial development of the artificial pancreas (AP) continue to progress rapidly, and the AP promises to become a part of clinical care. In this report, members of the JDRF Artificial Pancreas Project Consortium in collaboration with the wider AP community 1) advocate for the use of continuous glucose monitoring glucose metrics as outcome measures in AP trials, in addition to HbA1c, and 2) identify a short set of basic, easily interpreted outcome measures to be reported in AP studies whenever feasible. Consensus on a broader range of measures remains challenging; therefore, reporting of additional metrics is encouraged as appropriate for individual AP studies or study groups. Greater consistency in reporting of basic outcome measures may facilitate the interpretation of study results by investigators, regulatory bodies, health care providers, payers, and patients themselves, thereby accelerating the widespread adoption of AP technology to improve the lives of people with type 1 diabetes. PMID:27330126

  17. The Stellenbosch consensus statement on health promoting schools.

    PubMed

    Macnab, Andrew

    2013-03-01

    Health promotion uses a range of complementary approaches to provide individuals and communities with knowledge that will enable them to improve their own health and wellbeing. Encouraging children to adopt healthy lifestyle habits is a central objective, and health promotion at a community level, particularly through health promoting schools, may be an effective strategy. Health promoting schools are well within the capacity of even poor countries, as they focus on the school and its culture, and establishing health promoting schools requires a change in mindset and refinement of educational investment rather than the provision of major new resources, engagement of non-government organizations or obtaining international funding. A consensus of current evidence and essential concepts underlying health promotion in schools, principles that contribute to success or failure, and opportunities for implementation and engagement is presented, based on shared experience and dialogue at a 2011 international colloquium held at Stellenbosch University.

  18. Continuous Glucose Monitoring: Evidence and Consensus Statement for Clinical Use

    PubMed Central

    Liebl, Andreas; Henrichs, Helmut R.; Heinemann, Lutz; Freckmann, Guido; Biermann, Eberhard; Thomas, Andreas

    2013-01-01

    Continuous glucose monitoring (CGM) is an essential tool for modern diabetes therapy. Randomized controlled studies have provided evidence that hemoglobin A1c (HbA1c) results can be improved in patients with type 1 diabetes with elevated baseline HbA1c when using CGM frequently enough and that the frequency and duration of hypoglycemic events can be reduced in patients with satisfactory baseline HbA1c. The CGM group within the Working Group Diabetes Technology (AGDT) of the German Diabetes Association (DDG) has defined evidence-based indications for the practical use of CGM in this consensus statement related to hypoglycemia (frequent, severe, or nocturnal) or hypoglycemia unawareness, insufficient metabolic control despite use of all possible therapeutic options and patient compliance, pregnancy associated with inadequate blood glucose results, and the need for more than 10 blood glucose measurements per day. Contraindications and defined preconditions for the successful use of CGM should be considered. PMID:23567009

  19. A model of consensus formation for reconciling nursing's disciplinary matrix.

    PubMed

    Dobratz, Marjorie C

    2010-01-01

    With questions raised as to whether or not nursing knowledge should be developed from extant conceptual/theoretical models or from practice-based environments, this paper utilizes Kuhn's disciplinary matrix and Laudan's model of consensus formation to explore the changing nature of the discipline's structural matrix. Kuhn's notion that a discipline's structural matrix includes symbolic generalizations, models and exemplars, and Laudan's view that a maturing discipline embraces factual, methodological, and axiological (goals and aims) knowledge, and that context and discourse are also involved in advancing a discipline is described as a means for reconciling the source of nursing knowledge. This paper posits that shared axiological goals connect both theorists and practitioners, and resolve potential conflicts as to viable sources of nursing knowledge. Through shared goals that include humanization, meaning, quality of life, caring, consciousness, transcendence, and presence, which bridge both theoretical and practice approaches, nursing's charge to contribute to the good of society is fulfilled. PMID:20017883

  20. IMWG consensus on risk stratification in multiple myeloma.

    PubMed

    Chng, W J; Dispenzieri, A; Chim, C-S; Fonseca, R; Goldschmidt, H; Lentzsch, S; Munshi, N; Palumbo, A; Miguel, J S; Sonneveld, P; Cavo, M; Usmani, S; Durie, B G M; Avet-Loiseau, H

    2014-02-01

    Multiple myeloma is characterized by underlying clinical and biological heterogeneity, which translates to variable response to treatment and outcome. With the recent increase in treatment armamentarium and the projected further increase in approved therapeutic agents in the coming years, the issue of having some mechanism to dissect this heterogeneity and rationally apply treatment is coming to the fore. A number of robustly validated prognostic markers have been identified and the use of these markers in stratifying patients into different risk groups has been proposed. In this consensus statement, the International Myeloma Working Group propose well-defined and easily applicable risk categories based on current available information and suggests the use of this set of prognostic factors as gold standards in all clinical trials and form the basis of subsequent development of more complex prognostic system or better prognostic factors. At the same time, these risk categories serve as a framework to rationalize the use of therapies. PMID:23974982

  1. A model of consensus formation for reconciling nursing's disciplinary matrix.

    PubMed

    Dobratz, Marjorie C

    2010-01-01

    With questions raised as to whether or not nursing knowledge should be developed from extant conceptual/theoretical models or from practice-based environments, this paper utilizes Kuhn's disciplinary matrix and Laudan's model of consensus formation to explore the changing nature of the discipline's structural matrix. Kuhn's notion that a discipline's structural matrix includes symbolic generalizations, models and exemplars, and Laudan's view that a maturing discipline embraces factual, methodological, and axiological (goals and aims) knowledge, and that context and discourse are also involved in advancing a discipline is described as a means for reconciling the source of nursing knowledge. This paper posits that shared axiological goals connect both theorists and practitioners, and resolve potential conflicts as to viable sources of nursing knowledge. Through shared goals that include humanization, meaning, quality of life, caring, consciousness, transcendence, and presence, which bridge both theoretical and practice approaches, nursing's charge to contribute to the good of society is fulfilled.

  2. [Kawasaki disease: interdisciplinary and intersocieties consensus (clinical guidelines). Brief version].

    PubMed

    2016-08-01

    Kawasaki disease is an acute self-limiting systemic vasculitis. It is the most common cause of acquired heart disease, with the risk of developing coronary artery aneurysms, myocardial infarction and sudden death. Diagnosis is based on the presence of fever in addition to other clinical criteria. The quarter of the Kawasaki disease patients have "incomplete" presentation. Treatment with intravenous immunoglobulin within ten days of fever onset improves clinical outcomes and reduces the incidence of coronary artery dilation to less than 5%. Non-responders to standard therapy have shown a successful response with the use of corticosteroids and/or biological agents. The long-term management must be delineated according to the degree of coronary involvement in a multidisciplinary manner. To facilitate the pediatrician's diagnosis, treatment and monitoring of Kawasaki disease, a group of experts from the Argentine Society of Pediatrics and the Argentine Society of Cardiology carried out a consensus to develop practical clinical guidelines.

  3. Consensus-ADMM for General Quadratically Constrained Quadratic Programming

    NASA Astrophysics Data System (ADS)

    Huang, Kejun; Sidiropoulos, Nicholas D.

    2016-10-01

    Non-convex quadratically constrained quadratic programming (QCQP) problems have numerous applications in signal processing, machine learning, and wireless communications, albeit the general QCQP is NP-hard, and several interesting special cases are NP-hard as well. This paper proposes a new algorithm for general QCQP. The problem is first reformulated in consensus optimization form, to which the alternating direction method of multipliers (ADMM) can be applied. The reformulation is done in such a way that each of the sub-problems is a QCQP with only one constraint (QCQP-1), which is efficiently solvable irrespective of (non-)convexity. The core components are carefully designed to make the overall algorithm more scalable, including efficient methods for solving QCQP-1, memory efficient implementation, parallel/distributed implementation, and smart initialization. The proposed algorithm is then tested in two applications: multicast beamforming and phase retrieval. The results indicate superior performance over prior state-of-the-art methods.

  4. Spreading the message. Building a general consensus on the environment.

    PubMed

    Burke, A

    1991-01-01

    In communicating an environmental message to society at large, it is useful to distinguish between decision-makers and the general public. The influence of decision-makers on public debates is as significant as their ability to implement decisions; in democratic societies, the two functions are inseparable. Proceeding from an environmental consensus, physicians can provide a source of impartial medical/ecological wisdom, and serve as mediators of public debates. For those purposes, a network of physicians and/or scientists can be useful; three examples are provided. Communicating to the general public can only be achieved economically through the mass news media, which operate under conditions very different from those of physicians and scientists. There is considerable room for improvement in environmental journalism, and physicians can make a useful contribution to any such process. It is an important issue, since the mass media constitute the 'ecology textbook' of the general public. PMID:1910871

  5. Seeking consensus for cyberinfrastructure governance in the USA

    NASA Astrophysics Data System (ADS)

    Allison, M. Lee; Zanzkerkia, Eva

    2014-05-01

    Governance of geosciences cyberinfrastructure is a complex and essential undertaking, critical in enabling distributed knowledge communities to collaborate and communicate across disciplines, distances, and cultures. Advancing science with respect to "grand challenges," such as global change, Earth system observation, modeling, and prediction, and core fundamental science, depends not just on technical cyber systems, but also on social systems for strategic planning, decision-making, project management, learning, teaching, and building a community of practice. Simply put, a robust, agile technical system depends on an equally robust and adaptable social system. Cyberinfrastructure development is wrapped in social, organizational and governance challenges which may significantly impede technical progress and result in inefficiencies, duplication of effort, incompatibilities, wasted resources or user frustration. These issues are also the most time consuming to resolve due to significant institutional and social inertia: hence the urgency for developing a governance blueprint. An agile development process is underway for governance of transformative investments in geosciences cyberinfrastructure through the US National Science Foundation's EarthCube Program. Agile development is iterative and incremental, and promotes adaptive planning and rapid and flexible response. Such iterative deployment across a variety of EarthCube stakeholders encourages transparency, consensus, accountability, and inclusiveness. A broad coalition of stakeholder groups comprises an Assembly to serve as a preliminary venue for identifying, evaluating, and testing potential governance models. To offer opportunity for ensure broader end-user input and buy-in, a crowd-source approach engages stakeholders not involved otherwise in the Assembly. Developmental evaluators from the social sciences embedded in the project will provide real-time review and adjustments. In order to ensure an open and

  6. [Consensus document on overactive bladder in older patients].

    PubMed

    Verdejo-Bravo, Carlos; Brenes-Bermúdez, Francisco; Valverde-Moyar, Maria Victoria; Alcántara-Montero, Antonio; Pérez-León, Noemí

    2015-01-01

    Overactive nladder (OAB) is a clinical entity with a high prevalence in the population, having a high impact on quality of life, especially when it occurs with urge urinary incontinence. It is very important to highlight the low rate of consultation of this condition by the older population. This appears to depend on several factors (educational, cultural, professional), and thus leads to the low percentage of older patients who receive appropriate treatment and, on the other hand, a large percentage of older patients with a significant deterioration in their quality of life. Therefore, Scientific societies and Working Groups propose the early detection of OAB in their documents and clinical guidelines. Its etiology is not well known, but is influenced by cerebrovascular processes and other neurological problems, abnormalities of the detrusor muscle of bladder receptors, and obstructive and inflammatory processes of the lower urinary tract. Its diagnosis is clinical, and in the great majority of the cases it can be possible to establish its diagnosis and etiopathogenic orientation, without the need for complex diagnostic procedures. Currently, there are effective treatments for OAB, and we should decide the most appropriate for each elderly patient, based on their individual characteristics. Based on the main clinical practice guidelines, a progressive treatment is proposed, with the antimuscarinics being the most recommended drug treatment. Therefore, a group of very involved professionals in clinical practice for the elderly, and representing two scientific Societies (Spanish Society of Geriatrics and Gerontology [SEGG], and the Spanish Society of Primary Care Physicians [SEMERGEN]) developed this consensus document with the main objective of establishing practices and valid strategies, focused to simplify the management of this clinical entity in the elderly population, and especially to improve their quality of life. The recommendations presented in this

  7. Supportive management strategies for disseminated intravascular coagulation. An international consensus.

    PubMed

    Squizzato, Alessandro; Hunt, Beverley J; Kinasewitz, Gary T; Wada, Hideo; Ten Cate, Hugo; Thachil, Jecko; Levi, Marcel; Vicente, Vicente; D'Angelo, Armando; Di Nisio, Marcello

    2016-05-01

    The cornerstone of the management of disseminated intravascular coagulation (DIC) is the treatment of the underlying condition triggering the coagulopathy. However, a number of uncertainties remain over the optimal supportive treatment. The aim of this study was to provide evidence and expert-based recommendations on the optimal supportive haemostatic and antithrombotic treatment strategies for patients with DIC. A working group defined five relevant clinical scenarios. Published studies were systematically searched in the MEDLINE and EMBASE databases (up to May 2014). Seven internationally recognised experts were asked to independently provide clinical advice. A two-phase blinded data collection technique was used to reach consensus. Only three randomised controlled trials (RCTs) on the supportive management of DIC were identified. The RCTs (overall less than 100 patients) investigated the use of fresh frozen plasma and platelet transfusion and found no differences in survival between the intervention and control groups. The experts' approach was heterogeneous, although there was consensus that supportive management should vary according to the underlying cause, clinical manifestations and severity of blood test abnormalities. Platelet transfusion should be given to maintain platelet count > 50×10⁹/l in case of bleeding while a lower threshold of 20 to 30×10⁹/l may be used in DIC without bleeding. Thromboprophylaxis with low-molecular-weight heparin is advised until bleeding ensues or platelet count drops below 30×10⁹/l. In conclusion, in the absence of solid evidence from RCTs, an individualised supportive management of DIC is advisable based on the type of underlying disease, presence of bleeding or thrombotic complications and laboratory tests results.

  8. Managing Carious Lesions: Consensus Recommendations on Carious Tissue Removal.

    PubMed

    Schwendicke, F; Frencken, J E; Bjørndal, L; Maltz, M; Manton, D J; Ricketts, D; Van Landuyt, K; Banerjee, A; Campus, G; Doméjean, S; Fontana, M; Leal, S; Lo, E; Machiulskiene, V; Schulte, A; Splieth, C; Zandona, A F; Innes, N P T

    2016-05-01

    The International Caries Consensus Collaboration undertook a consensus process and here presents clinical recommendations for carious tissue removal and managing cavitated carious lesions, including restoration, based on texture of demineralized dentine. Dentists should manage the disease dental caries and control activity of existing cavitated lesions to preserve hard tissues and retain teeth long-term. Entering the restorative cycle should be avoided as far as possible. Controlling the disease in cavitated carious lesions should be attempted using methods which are aimed at biofilm removal or control first. Only when cavitated carious lesions either are noncleansable or can no longer be sealed are restorative interventions indicated. When a restoration is indicated, the priorities are as follows: preserving healthy and remineralizable tissue, achieving a restorative seal, maintaining pulpal health, and maximizing restoration success. Carious tissue is removed purely to create conditions for long-lasting restorations. Bacterially contaminated or demineralized tissues close to the pulp do not need to be removed. In deeper lesions in teeth with sensible (vital) pulps, preserving pulpal health should be prioritized, while in shallow or moderately deep lesions, restoration longevity becomes more important. For teeth with shallow or moderately deep cavitated lesions, carious tissue removal is performed according toselective removal to firm dentine.In deep cavitated lesions in primary or permanent teeth,selective removal to soft dentineshould be performed, although in permanent teeth,stepwise removalis an option. The evidence and, therefore, these recommendations support less invasive carious lesion management, delaying entry to, and slowing down, the restorative cycle by preserving tooth tissue and retaining teeth long-term. PMID:27099358

  9. Consensus Paper: Language and the Cerebellum: an Ongoing Enigma

    PubMed Central

    Mariën, Peter; Ackermann, Herman; Adamaszek, Michael; Barwood, Caroline H. S.; Beaton, Alan; Desmond, John; De Witte, Elke; Fawcett, Angela J.; Hertrich, Ingo; Küper, Michael; Leggio, Maria; Marvel, Cherie; Molinari, Marco; Murdoch, Bruce E.; Nicolson, Roderick I.; Schmahmann, Jeremy D.; Stoodley, Catherine J.; Thürling, Markus; Timmann, Dagmar; Wouters, Ellen; Ziegler, Wolfram

    2014-01-01

    In less than three decades, the concept “cerebellar neurocognition” has evolved from a mere afterthought to an entirely new and multifaceted area of neuroscientific research. A close interplay between three main strands of contemporary neuroscience induced a substantial modification of the traditional view of the cerebellum as a mere coordinator of autonomic and somatic motor functions. Indeed, the wealth of current evidence derived from detailed neuroanatomical investigations, functional neuroimaging studies with healthy subjects and patients and in-depth neuropsychological assessment of patients with cerebellar disorders shows that the cerebellum has a cardinal role to play in affective regulation, cognitive processing, and linguistic function. Although considerable progress has been made in models of cerebellar function, controversy remains regarding the exact role of the “linguistic cerebellum” in a broad variety of nonmotor language processes. This consensus paper brings together a range of different viewpoints and opinions regarding the contribution of the cerebellum to language function. Recent developments and insights in the nonmotor modulatory role of the cerebellum in language and some related disorders will be discussed. The role of the cerebellum in speech and language perception, in motor speech planning including apraxia of speech, in verbal working memory, in phonological and semantic verbal fluency, in syntax processing, in the dynamics of language production, in reading and in writing will be addressed. In addition, the functional topography of the linguistic cerebellum and the contribution of the deep nuclei to linguistic function will be briefly discussed. As such, a framework for debate and discussion will be offered in this consensus paper. PMID:24318484

  10. Consensus paper: Language and the cerebellum: an ongoing enigma.

    PubMed

    Mariën, Peter; Ackermann, Herman; Adamaszek, Michael; Barwood, Caroline H S; Beaton, Alan; Desmond, John; De Witte, Elke; Fawcett, Angela J; Hertrich, Ingo; Küper, Michael; Leggio, Maria; Marvel, Cherie; Molinari, Marco; Murdoch, Bruce E; Nicolson, Roderick I; Schmahmann, Jeremy D; Stoodley, Catherine J; Thürling, Markus; Timmann, Dagmar; Wouters, Ellen; Ziegler, Wolfram

    2014-06-01

    In less than three decades, the concept "cerebellar neurocognition" has evolved from a mere afterthought to an entirely new and multifaceted area of neuroscientific research. A close interplay between three main strands of contemporary neuroscience induced a substantial modification of the traditional view of the cerebellum as a mere coordinator of autonomic and somatic motor functions. Indeed, the wealth of current evidence derived from detailed neuroanatomical investigations, functional neuroimaging studies with healthy subjects and patients and in-depth neuropsychological assessment of patients with cerebellar disorders shows that the cerebellum has a cardinal role to play in affective regulation, cognitive processing, and linguistic function. Although considerable progress has been made in models of cerebellar function, controversy remains regarding the exact role of the "linguistic cerebellum" in a broad variety of nonmotor language processes. This consensus paper brings together a range of different viewpoints and opinions regarding the contribution of the cerebellum to language function. Recent developments and insights in the nonmotor modulatory role of the cerebellum in language and some related disorders will be discussed. The role of the cerebellum in speech and language perception, in motor speech planning including apraxia of speech, in verbal working memory, in phonological and semantic verbal fluency, in syntax processing, in the dynamics of language production, in reading and in writing will be addressed. In addition, the functional topography of the linguistic cerebellum and the contribution of the deep nuclei to linguistic function will be briefly discussed. As such, a framework for debate and discussion will be offered in this consensus paper. PMID:24318484

  11. Consensus conference on the management of tumor lysis syndrome.

    PubMed

    Tosi, Patrizia; Barosi, Giovanni; Lazzaro, Carlo; Liso, Vincenzo; Marchetti, Monia; Morra, Enrica; Pession, Andrea; Rosti, Giovanni; Santoro, Antonio; Zinzani, Pier Luigi; Tura, Sante

    2008-12-01

    Tumor lysis syndrome is a potentially life threatening complication of massive cellular lysis in cancers. Identification of high-risk patients and early recognition of the syndrome is crucial in the institution of appropriate treatments. Drugs that act on the metabolic pathway of uric acid to allantoin, like allopurinol or rasburicase, are effective for prophylaxis and treatment of tumor lysis syndrome. Sound recommendations should regulate diagnosis and drug application in the clinical setting. The current article reports the recommendations on the management of tumor lysis syndrome that were issued during a Consensus Conference project, and which were endorsed by the Italian Society of Hematology (SIE), the Italian Association of Pediatric Oncologists (AIEOP) and the Italian Society of Medical Oncology (AIOM). Current concepts on the pathophysiology, clinical features, and therapy of tumor lysis syndrome were evaluated by a Panel of 8 experts. A consensus was then developed for statements regarding key questions on tumor lysis syndrome management selected according to the criterion of relevance by group discussion. Hydration and rasburicase should be administered to adult cancer patients who are candidates for tumor-specific therapy and who carry a high risk of tumor lysis syndrome. Cancer patients with a low-risk of tumor lysis syndrome should instead receive hydration along with oral allopurinol. Hydration and rasburicase should also be administered to patients with clinical tumor lysis syndrome and to adults and high-risk children who develop laboratory tumor lysis syndrome. In conclusion, the Panel recommended rasburicase for tumor lysis syndrome prophylaxis in selected patients based on the drug efficacy profile. Methodologically rigorous studies are needed to clarify its cost-effectiveness profile. PMID:18838473

  12. Priorities for endometriosis research: recommendations from an international consensus workshop.

    PubMed

    Rogers, Peter A W; D'Hooghe, Thomas M; Fazleabas, Asgerally; Gargett, Caroline E; Giudice, Linda C; Montgomery, Grant W; Rombauts, Luk; Salamonsen, Lois A; Zondervan, Krina T

    2009-04-01

    Endometriosis is an estrogen-dependent disorder where endometrial tissue forms lesions outside the uterus. Endometriosis affects an estimated 10% of women in the reproductive-age group, rising to 30% to 50% in patients with infertility and/or pain, with significant impact on their physical, mental, and social well-being. There is no known cure, and most current medical treatments are not suitable long term due to their side-effect profiles. Endometriosis has an estimated annual cost in the United States of $18.8 to $22 billion (2002 figures). Although endometriosis was first described more than 100 years ago, current knowledge of its pathogenesis, spontaneous evolution, and the pathophysiology of the related infertility and pelvic pain, remain unclear. A consensus workshop was convened following the 10th World Congress on Endometriosis to establish recommendations for priorities in endometriosis research. One major issue identified as impacting on the capacity to undertake endometriosis research is the need for multidisciplinary expertise. A total of 25 recommendations for research have been developed, grouped under 5 subheadings: (1) diagnosis, (2) classification and prognosis, (3) treatment and outcome, (4) epidemiology, and (5) pathophysiology. Endometriosis research is underfunded relative to other diseases with high health care burdens. This may be due to the practical difficulties of developing competitive research proposals on a complex and poorly understood disease, which affects only women. By producing this consensus international research priorities statement it is the hope of the workshop participants that researchers will be encouraged to develop new interdisciplinary research proposals that will attract increased funding support for work on endometriosis. PMID:19196878

  13. Consensus on guidelines for stereotactic neurosurgery for psychiatric disorders

    PubMed Central

    Nuttin, Bart; Wu, Hemmings; Mayberg, Helen; Hariz, Marwan; Gabriëls, Loes; Galert, Thorsten; Merkel, Reinhard; Kubu, Cynthia; Vilela-Filho, Osvaldo; Matthews, Keith; Taira, Takaomi; Lozano, Andres M; Schechtmann, Gastón; Doshi, Paresh; Broggi, Giovanni; Régis, Jean; Alkhani, Ahmed; Sun, Bomin; Eljamel, Sam; Schulder, Michael; Kaplitt, Michael; Eskandar, Emad; Rezai, Ali; Krauss, Joachim K; Hilven, Paulien; Schuurman, Rick; Ruiz, Pedro; Chang, Jin Woo; Cosyns, Paul; Lipsman, Nir; Voges, Juergen; Cosgrove, Rees; Li, Yongjie; Schlaepfer, Thomas

    2014-01-01

    Background For patients with psychiatric illnesses remaining refractory to ‘standard’ therapies, neurosurgical procedures may be considered. Guidelines for safe and ethical conduct of such procedures have previously and independently been proposed by various local and regional expert groups. Methods To expand on these earlier documents, representative members of continental and international psychiatric and neurosurgical societies, joined efforts to further elaborate and adopt a pragmatic worldwide set of guidelines. These are intended to address a broad range of neuropsychiatric disorders, brain targets and neurosurgical techniques, taking into account cultural and social heterogeneities of healthcare environments. Findings The proposed consensus document highlights that, while stereotactic ablative procedures such as cingulotomy and capsulotomy for depression and obsessive-compulsive disorder are considered ‘established’ in some countries, they still lack level I evidence. Further, it is noted that deep brain stimulation in any brain target hitherto tried, and for any psychiatric or behavioural disorder, still remains at an investigational stage. Researchers are encouraged to design randomised controlled trials, based on scientific and data-driven rationales for disease and brain target selection. Experienced multidisciplinary teams are a mandatory requirement for the safe and ethical conduct of any psychiatric neurosurgery, ensuring documented refractoriness of patients, proper consent procedures that respect patient's capacity and autonomy, multifaceted preoperative as well as postoperative long-term follow-up evaluation, and reporting of effects and side effects for all patients. Interpretation This consensus document on ethical and scientific conduct of psychiatric surgery worldwide is designed to enhance patient safety. PMID:24444853

  14. Managing Carious Lesions: Consensus Recommendations on Carious Tissue Removal.

    PubMed

    Schwendicke, F; Frencken, J E; Bjørndal, L; Maltz, M; Manton, D J; Ricketts, D; Van Landuyt, K; Banerjee, A; Campus, G; Doméjean, S; Fontana, M; Leal, S; Lo, E; Machiulskiene, V; Schulte, A; Splieth, C; Zandona, A F; Innes, N P T

    2016-05-01

    The International Caries Consensus Collaboration undertook a consensus process and here presents clinical recommendations for carious tissue removal and managing cavitated carious lesions, including restoration, based on texture of demineralized dentine. Dentists should manage the disease dental caries and control activity of existing cavitated lesions to preserve hard tissues and retain teeth long-term. Entering the restorative cycle should be avoided as far as possible. Controlling the disease in cavitated carious lesions should be attempted using methods which are aimed at biofilm removal or control first. Only when cavitated carious lesions either are noncleansable or can no longer be sealed are restorative interventions indicated. When a restoration is indicated, the priorities are as follows: preserving healthy and remineralizable tissue, achieving a restorative seal, maintaining pulpal health, and maximizing restoration success. Carious tissue is removed purely to create conditions for long-lasting restorations. Bacterially contaminated or demineralized tissues close to the pulp do not need to be removed. In deeper lesions in teeth with sensible (vital) pulps, preserving pulpal health should be prioritized, while in shallow or moderately deep lesions, restoration longevity becomes more important. For teeth with shallow or moderately deep cavitated lesions, carious tissue removal is performed according toselective removal to firm dentine.In deep cavitated lesions in primary or permanent teeth,selective removal to soft dentineshould be performed, although in permanent teeth,stepwise removalis an option. The evidence and, therefore, these recommendations support less invasive carious lesion management, delaying entry to, and slowing down, the restorative cycle by preserving tooth tissue and retaining teeth long-term.

  15. Fusion to a highly stable consensus albumin binding domain allows for tunable pharmacokinetics.

    PubMed

    Jacobs, Steven A; Gibbs, Alan C; Conk, Michelle; Yi, Fang; Maguire, Diane; Kane, Colleen; O'Neil, Karyn T

    2015-10-01

    A number of classes of proteins have been engineered for high stability using consensus sequence design methods. Here we describe the engineering of a novel albumin binding domain (ABD) three-helix bundle protein. The resulting engineered ABD molecule, called ABDCon, is expressed at high levels in the soluble fraction of Escherichia coli and is highly stable, with a melting temperature of 81.5°C. ABDCon binds human, monkey and mouse serum albumins with affinity as high as 61 pM. The solution structure of ABDCon is consistent with the three-helix bundle design and epitope mapping studies enabled a precise definition of the albumin binding interface. Fusion of a 10 kDa scaffold protein to ABDCon results in a long terminal half-life of 60 h in mice and 182 h in cynomolgus monkeys. To explore the link between albumin affinity and in vivo exposure, mutations were designed at the albumin binding interface of ABDCon yielding variants that span an 11 000-fold range in affinity. The PK properties of five such variants were determined in mice in order to demonstrate the tunable nature of serum half-life, exposure and clearance with variations in albumin binding affinity.

  16. Identification of a consensus motif in substrates bound by a Type I Hsp40

    PubMed Central

    Kota, Pradeep; Summers, Daniel W.; Ren, Hong-Yu; Cyr, Douglas M.; Dokholyan, Nikolay V.

    2009-01-01

    Protein aggregation is a hallmark of a large and diverse number of conformational diseases. Molecular chaperones of the Hsp40 family (Escherichia coli DnaJ homologs) recognize misfolded disease proteins and suppress the accumulation of toxic protein species. Type I Hsp40s are very potent at suppressing protein aggregation and facilitating the refolding of damaged proteins. Yet, the molecular mechanism for the recognition of nonnative polypeptides by Type I Hsp40s such as yeast Ydj1 is not clear. Here we computationally identify a unique motif that is selectively recognized by Ydj1p. The motif is characterized by the consensus sequence GX[LMQ]{P}X{P}{CIMPVW}, where [XY] denotes either X or Y and {XY} denotes neither X nor Y. We further verify the validity of the motif by site-directed mutagenesis and show that substrate binding by Ydj1 requires recognition of this motif. A yeast proteome screen revealed that many proteins contain more than one stretch of residues that contain the motif and are separated by varying numbers of amino acids. In light of our results, we propose a 2-site peptide-binding model and a plausible mechanism of peptide presentation by Ydj1p to the chaperones of the Hsp70 family. Based on our results, and given that Ydj1p and its human ortholog Hdj2 are functionally interchangeable, we hypothesize that our results can be extended to understanding human diseases. PMID:19549854

  17. Improving the assessment of the outcome of nonsynonymous SNVs with a consensus deleteriousness score, Condel.

    PubMed

    González-Pérez, Abel; López-Bigas, Nuria

    2011-04-01

    Several large ongoing initiatives that profit from next-generation sequencing technologies have driven--and in coming years will continue to drive--the emergence of long catalogs of missense single-nucleotide variants (SNVs) in the human genome. As a consequence, researchers have developed various methods and their related computational tools to classify these missense SNVs as probably deleterious or probably neutral polymorphisms. The outputs produced by each of these computational tools are of different natures and thus difficult to compare and integrate. Taking advantage of the possible complementarity between different tools might allow more accurate classifications. Here we propose an effective approach to integrating the output of some of these tools into a unified classification; this approach is based on a weighted average of the normalized scores of the individual methods (WAS). (In this paper, the approach is illustrated for the integration of five tools.) We show that this WAS outperforms each individual method in the task of classifying missense SNVs as deleterious or neutral. Furthermore, we demonstrate that this WAS can be used not only for classification purposes (deleterious versus neutral mutation) but also as an indicator of the impact of the mutation on the functionality of the mutant protein. In other words, it may be used as a deleteriousness score of missense SNVs. Therefore, we recommend the use of this WAS as a consensus deleteriousness score of missense mutations (Condel). PMID:21457909

  18. Methylation of RNA polymerase II non-consensus Lysine residues marks early transcription in mammalian cells

    PubMed Central

    Dias, João D; Rito, Tiago; Torlai Triglia, Elena; Kukalev, Alexander; Ferrai, Carmelo; Chotalia, Mita; Brookes, Emily; Kimura, Hiroshi; Pombo, Ana

    2015-01-01

    Dynamic post-translational modification of RNA polymerase II (RNAPII) coordinates the co-transcriptional recruitment of enzymatic complexes that regulate chromatin states and processing of nascent RNA. Extensive phosphorylation of serine residues at the largest RNAPII subunit occurs at its structurally-disordered C-terminal domain (CTD), which is composed of multiple heptapeptide repeats with consensus sequence Y1-S2-P3-T4-S5-P6-S7. Serine-5 and Serine-7 phosphorylation mark transcription initiation, whereas Serine-2 phosphorylation coincides with productive elongation. In vertebrates, the CTD has eight non-canonical substitutions of Serine-7 into Lysine-7, which can be acetylated (K7ac). Here, we describe mono- and di-methylation of CTD Lysine-7 residues (K7me1 and K7me2). K7me1 and K7me2 are observed during the earliest transcription stages and precede or accompany Serine-5 and Serine-7 phosphorylation. In contrast, K7ac is associated with RNAPII elongation, Serine-2 phosphorylation and mRNA expression. We identify an unexpected balance between RNAPII K7 methylation and acetylation at gene promoters, which fine-tunes gene expression levels. DOI: http://dx.doi.org/10.7554/eLife.11215.001 PMID:26687004

  19. The consensus 5' splice site motif inhibits mRNA nuclear export.

    PubMed

    Lee, Eliza S; Akef, Abdalla; Mahadevan, Kohila; Palazzo, Alexander F

    2015-01-01

    In eukaryotes, mRNAs are synthesized in the nucleus and then exported to the cytoplasm where they are translated into proteins. We have mapped an element, which when present in the 3'terminal exon or in an unspliced mRNA, inhibits mRNA nuclear export. This element has the same sequence as the consensus 5'splice site motif that is used to define the start of introns. Previously it was shown that when this motif is retained in the mRNA, it causes defects in 3'cleavage and polyadenylation and promotes mRNA decay. Our new data indicates that this motif also inhibits nuclear export and promotes the targeting of transcripts to nuclear speckles, foci within the nucleus which have been linked to splicing. The motif, however, does not disrupt splicing or the recruitment of UAP56 or TAP/Nxf1 to the RNA, which are normally required for nuclear export. Genome wide analysis of human mRNAs, lncRNA and eRNAs indicates that this motif is depleted from naturally intronless mRNAs and eRNAs, but less so in lncRNAs. This motif is also depleted from the beginning and ends of the 3'terminal exons of spliced mRNAs, but less so for lncRNAs. Our data suggests that the presence of the 5'splice site motif in mature RNAs promotes their nuclear retention and may help to distinguish mRNAs from misprocessed transcripts and transcriptional noise.

  20. Charged single alpha-helices in proteomes revealed by a consensus prediction approach.

    PubMed

    Gáspári, Zoltán; Süveges, Dániel; Perczel, András; Nyitray, László; Tóth, Gábor

    2012-04-01

    Charged single α-helices (CSAHs) constitute a recently recognized protein structural motif. Its presence and role is characterized in only a few proteins. To explore its general features, a comprehensive study is necessary. We have set up a consensus prediction method available as a web service (at http://csahserver.chem.elte.hu) and downloadable scripts capable of predicting CSAHs from protein sequences. Using our method, we have performed a comprehensive search on the UniProt database. We found that the motif is very rare but seems abundant in proteins involved in symbiosis and RNA binding/processing. Although there are related proteins with CSAH segments, the motif shows no deep conservation in protein families. We conclude that CSAH-containing proteins, although rare, are involved in many key biological processes. Their conservation pattern and prevalence in symbiosis-associated proteins suggest that they might be subjects of relatively rapid molecular evolution and thus can contribute to the emergence of novel functions.

  1. Characterization of human chromosomal DNA sequences which replicate autonomously in Saccharomyces cerevisiae.

    PubMed Central

    Montiel, J F; Norbury, C J; Tuite, M F; Dobson, M J; Mills, J S; Kingsman, A J; Kingsman, S M

    1984-01-01

    We have characterised two restriction fragments, isolated from a "shotgun" collection of human DNA, which function as autonomously replicating sequences (ARSs) in Saccharomyces cerevisiae. Functional domains of these fragments have been defined by subcloning and exonuclease (BAL 31) deletion analysis. Both fragments contain two spatially distinct domains. One is essential for high frequency transformation and is termed the Replication Sequence (RS) domain, the other, termed the Replication Enhancer (RE) domain, has no inherent replication competence but is essential for ensuring maximum function of the RS domain. The nucleotide sequence of these domains reveals several conserved sequences one of which is strikingly similar to the yeast ARS consensus sequence. PMID:6320114

  2. Modular sequence elements associated with origin regions in eukaryotic chromosomal DNA.

    PubMed Central

    Dobbs, D L; Shaiu, W L; Benbow, R M

    1994-01-01

    We have postulated that chromosomal replication origin regions in eukaryotes have in common clusters of certain modular sequence elements (Benbow, Zhao, and Larson, BioEssays 14, 661-670, 1992). In this study, computer analyses of DNA sequences from six origin regions showed that each contained one or more potential initiation regions consisting of a putative DUE (DNA unwinding element) aligned with clusters of SAR (scaffold associated region), and ARS (autonomously replicating sequence) consensus sequences, and pyrimidine tracts. The replication origins analyzed were from the following loci: Tetrahymena thermophila macronuclear rDNA gene, Chinese hamster ovary dihydrofolate reductase amplicon, human c-myc proto-oncogene, chicken histone H5 gene, Drosophila melanogaster chorion gene cluster on the third chromosome, and Chinese hamster ovary rhodopsin gene. The locations of putative initiation regions identified by the computer analyses were compared with published data obtained using diverse methods to map initiation sites. For at least four loci, the potential initiation regions identified by sequence analysis aligned with previously mapped initiation events. A consensus DNA sequence, WAWTTDDWWWDHWGWHMAWTT, was found within the potential initiation regions in every case. An additional 35 kb of combined flanking sequences from the six loci were also analyzed, but no additional copies of this consensus sequence were found. Images PMID:8041609

  3. The sequence of sequencers: The history of sequencing DNA.

    PubMed

    Heather, James M; Chain, Benjamin

    2016-01-01

    Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way.

  4. Review of Consensus Standard Spectra for Flat Plate and Concentrating Photovoltaic Performance

    SciTech Connect

    Myers, D.

    2011-09-01

    Consensus standard reference terrestrial solar spectra are used to establish nameplate ratings for photovoltaic device performance at standard reporting conditions. This report describes reference solar spectra developed in the United States and international consensus standards community which are widely accepted as of this writing (June 2011).

  5. High and Low Consensus Groups: A Content and Relational Interaction Analysis.

    ERIC Educational Resources Information Center

    DeStephen, Rolayne S.

    1983-01-01

    Analyzed the complete interaction of high and low consensus groups in a basic small group course. Interaction analysis indicated that both the relational and content levels of communication are significantly different for high versus low consensus groups. The conclusion that increased feedback leads to decision satisfaction was confirmed. (JAC)

  6. 76 FR 78307 - Manufactured Housing Consensus Committee; Notice Inviting Nominations of Individuals To Serve on...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-16

    ... URBAN DEVELOPMENT Manufactured Housing Consensus Committee; Notice Inviting Nominations of Individuals To Serve on the Committee AGENCY: Office of the Assistant Secretary for Housing--Federal Housing... criteria as a prerequisite to final appointment. Consensus Committee--Advisory Role The MHCC's role...

  7. Collaborative Learning: The Effects of Trust and Open and Closed Dynamics on Consensus and Efficacy

    ERIC Educational Resources Information Center

    Harney, Owen; Hogan, Michael J.; Broome, Benjamin J.

    2012-01-01

    The current study compared the effects of open versus closed group dynamics on perceived consensus, objective consensus, and perceived efficacy of collaborative learning in participants high and low in dispositional trust in the context of an Interactive Management (IM) session. Interactive management is a computer-mediated collaborative tool…

  8. The myxoma virus thymidine kinase gene: sequence and transcriptional mapping.

    PubMed

    Jackson, R J; Bults, H G

    1992-02-01

    The myxoma virus thymidine kinase (TK) gene is encoded on a 1.6 kb SacI-SalI restriction fragment located between 57.7 and 59.3 kb on the 163 kb genomic map. The nucleotide sequence of this fragment as well as 228 bp from the adjacent SalI-AA2 fragment was determined and found to encode four major open reading frames (ORFs). Three of these ORFs are similar in nucleotide sequence to ORFs L5R and J1R, and the TK gene of vaccinia virus (VV). The fourth ORF, MF8a, shows similarity to the ORFs found in the same position relative to the TK genes of Shope fibroma virus, Kenya sheep-1 virus and swine-pox virus. A search of the complete VV nucleotide sequence for regions of similarity to MF8a identified the host specificity gene C7L. Northern blot analysis of early viral RNA identified transcripts of approximately 700 nucleotides for both the TK gene and ORF MF8a. The 5' ends of the TK gene and ORF MF8a early mRNAs were mapped by primer extension to initiation sites 13 nucleotides downstream of sequences with similarity to the VV early promoter consensus. The sizes of the TK and MF8a mRNAs are consistent with transcription termination and polyadenylation occurring downstream of the sequence TTTTTNT, which is identical to the consensus sequence for the VV transcription termination signal.

  9. Applying machine learning techniques to DNA sequence analysis

    SciTech Connect

    Shavlik, J.W.

    1992-01-01

    We are developing a machine learning system that modifies existing knowledge about specific types of biological sequences. It does this by considering sample members and nonmembers of the sequence motif being learned. Using this information (which we call a domain theory''), our learning algorithm produces a more accurate representation of the knowledge needed to categorize future sequences. Specifically, the KBANN algorithm maps inference rules, such as consensus sequences, into a neural (connectionist) network. Neural network training techniques then use the training examples of refine these inference rules. We have been applying this approach to several problems in DNA sequence analysis and have also been extending the capabilities of our learning system along several dimensions.

  10. Consensus guidelines for the management of hepatitis C infection.

    PubMed

    2003-07-01

    At prevalence of 2.7% in the early 1990's, it is estimated that approximately 500,000 people in Saudi Arabia have been exposed to the hepatitis C virus (HCV). Over 80% of such individuals remain infected and most of them progress to chronic hepatitis C (CHC), cirrhosis, and/or hepatocellular carcinoma (HCC). The incidence of newly acquired hepatitis C infection in Saudi Arabia has declined with the recent reported prevalence of approximately 1%. This decline is largely due to the early implementation of testing of blood donors for HCV. However, it is pertinent that measures are taken to identify patients already infected and offer treatment to those with good prognostic factors. Hepatitis C genotype 4, the most predominant genotype in Saudi Arabia (62%) has been resistant to conventional interferon (IFN) therapy and sustained response rate to combination therapy with IFN plus ribavirin (RBV) has been poor. The recently completed Ministry of Health (MOH) clinical trial reports improved sustained virological response (SVR) rate of 65.2% among week 12 early responders of HCV genotype 4 chronic hepatitis patients using pegylated (PEG)-IFN alfa-2a (40 KD) plus RBV. This encouraging process calls for a change in patient management towards a more community-based approach. With the aim of assessing these changes and defining a management strategy for HCV infected patients in Saudi Arabia, a consensus conference was held and consensus guidelines issued. The final recommendation will be made available to all MOH, tertiary and non-government hospitals in the Kingdom to provide uniform care to all CHC patients. Based on the SVR of the above mentioned clinical trial, the committee recommends treatment for patients with histologically proven CHC, with elevated serum alanine aminotransferase (ALT) and positive HCV ribonucleic acid (RNA). Patients with normal serum ALT may not be treated if liver histology is normal or reveals only minimal changes. Patients with decompensated

  11. Constrained dynamics approach for motion synchronization and consensus

    NASA Astrophysics Data System (ADS)

    Bhatia, Divya

    In this research we propose to develop constrained dynamical systems based stable attitude synchronization, consensus and tracking (SCT) control laws for the formation of rigid bodies. The generalized constrained dynamics Equations of Motion (EOM) are developed utilizing constraint potential energy functions that enforce communication constraints. Euler-Lagrange equations are employed to develop the non-linear constrained dynamics of multiple vehicle systems. The constraint potential energy is synthesized based on a graph theoretic formulation of the vehicle-vehicle communication. Constraint stabilization is achieved via Baumgarte's method. The performance of these constrained dynamics based formations is evaluated for bounded control authority. The above method has been applied to various cases and the results have been obtained using MATLAB simulations showing stability, synchronization, consensus and tracking of formations. The first case corresponds to an N-pendulum formation without external disturbances, in which the springs and the dampers connected between the pendulums act as the communication constraints. The damper helps in stabilizing the system by damping the motion whereas the spring acts as a communication link relaying relative position information between two connected pendulums. Lyapunov stabilization (energy based stabilization) technique is employed to depict the attitude stabilization and boundedness. Various scenarios involving different values of springs and dampers are simulated and studied. Motivated by the first case study, we study the formation of N 2-link robotic manipulators. The governing EOM for this system is derived using Euler-Lagrange equations. A generalized set of communication constraints are developed for this system using graph theory. The constraints are stabilized using Baumgarte's techniques. The attitude SCT is established for this system and the results are shown for the special case of three 2-link robotic manipulators

  12. Realization of consensus of multi-agent systems with stochastically mixed interactions

    NASA Astrophysics Data System (ADS)

    Sun, Yongzheng; Li, Wang; Zhao, Donghua

    2016-07-01

    In this paper, we propose a new consensus model in which the interactions among agents stochastically switch between attraction and repulsion. Such a positive-and-negative mechanism is described by the white-noise-based coupling. Analytic criteria for the consensus and non-consensus in terms of the eigenvalues of the noise intensity matrix are derived, which provide a better understanding of the constructive roles of random interactions. Specifically, we discover a positive role of noise coupling that noise can accelerate the emergence of consensus. We find that the converging speed of the multi-agent network depends on the square of the second smallest eigenvalue of its graph Laplacian. The influence of network topologies on the consensus time is also investigated.

  13. Consensus Statement on Indications and Contraindications for Medial Unicompartmental Knee Arthroplasty.

    PubMed

    Berend, Keith R; Berend, Michael E; Dalury, David F; Argenson, Jean-Noel; Dodd, Chris A; Scott, Richard D

    2015-01-01

    Previous work, now nearly 30 years dated, is frequently cited as the "gold standard" for the indications and contraindications for medial unicompartmental knee arthroplasty (UKA). The purpose of this article is to review current literature on the indications and contraindications to UKA and develop a consensus statement based on those data. Six surgeons with a combined experience of performing more than 8,000 partial knee arthroplasties were surveyed. Surgeons then participated in a discussion, emerging proposal, collaborative modification, and final consensus phase. The final consensus on primary indications and contraindications is presented. Notably, the authors provide consensus on previous contraindications, which are no longer considered to be contraindications. The authors provide an updated and concise review of the current indications and contraindications for medial UKA using scientifically based consensus-building methodology. PMID:26731390

  14. 1st ESMO Consensus Conference in lung cancer; Lugano 2010: small-cell lung cancer.

    PubMed

    Stahel, R; Thatcher, N; Früh, M; Le Péchoux, C; Postmus, P E; Sorensen, J B; Felip, E

    2011-09-01

    The 1st ESMO Consensus Conference on lung cancer was held in Lugano, Switzerland on 21st and 22nd May 2010 with the participation of a multidisciplinary panel of leading professionals in pathology and molecular diagnostics and medical, surgical and radiation oncology. Before the conference, the expert panel prepared clinically relevant questions concerning five areas as follows: early and locally advanced non-small-cell lung cancer (NSCLC), first-line metastatic NSCLC, second-/third-line NSCLC, NSCLC pathology and molecular testing, and small-cell lung cancer (SCLC) to be addressed through discussion at the Consensus Conference. All relevant scientific literature for each question was reviewed in advance. During the Consensus Conference, the panel developed recommendations for each specific question. The consensus agreement in SCLC is reported in this article. The recommendations detailed here are based on an expert consensus after careful review of published data. All participants have approved this final update.

  15. [The next consensus for the irritable bowel syndrome has to be interdisciplinary].

    PubMed

    Enck, P; Martens, U

    2008-02-01

    The publication of the Rome III consensus on functional bowel disorders one year ago has raised the question of whether a revision of the 1999 Celle consensus on the irritable bowel syndrome is necessary and who should be involved in this consensus. Therefore, the this review article attempts to reconstruct the history of the Rome criteria (and its predecessor, the Manning criteria) and contrasts this with the parallel history of the DSM/ICD classification in primary care and psychiatry/psychosomatics. The formulation of a common consensus between all medical societies (primary care, gastroenterology/neurogastroenterology, psychiatry/psychosomatics) is proposed instead of another consensus of gastroenterologists alone, in order to avoid the tendency--at both national and international levels--towards isolation between the medical subspecialties.

  16. Decentralised consensus for multiple Lagrangian systems based on event-triggered strategy

    NASA Astrophysics Data System (ADS)

    Liu, Xiangdong; Du, Changkun; Lu, Pingli; Yang, Dapeng

    2016-06-01

    This paper considers the decentralised event-triggered consensus problem for multi-agent systems with Lagrangian dynamics under undirected graphs. First, a distributed, leaderless, and event-triggered consensus control algorithm is presented based on the definition of generalised positions and velocities for all agents. There is only one triggering function for both the generalised positions and velocities and no Zeno behaviour exhibited under the proposed consensus strategy. Second, an adaptive event-triggered consensus control algorithm is proposed for such multi-agent systems with unknown constant parameters. Third, based on sliding-mode method, an event-triggered consensus control algorithm is considered for the case with external disturbance. Finally, simulation results are given to illustrate the theoretical results.

  17. Accurate whole human genome sequencing using reversible terminator chemistry.

    PubMed

    Bentley, David R; Balasubramanian, Shankar; Swerdlow, Harold P; Smith, Geoffrey P; Milton, John; Brown, Clive G; Hall, Kevin P; Evers, Dirk J; Barnes, Colin L; Bignell, Helen R; Boutell, Jonathan M; Bryant, Jason; Carter, Richard J; Keira Cheetham, R; Cox, Anthony J; Ellis, Darren J; Flatbush, Michael R; Gormley, Niall A; Humphray, Sean J; Irving, Leslie J; Karbelashvili, Mirian S; Kirk, Scott M; Li, Heng; Liu, Xiaohai; Maisinger, Klaus S; Murray, Lisa J; Obradovic, Bojan; Ost, Tobias; Parkinson, Michael L; Pratt, Mark R; Rasolonjatovo, Isabelle M J; Reed, Mark T; Rigatti, Roberto; Rodighiero, Chiara; Ross, Mark T; Sabot, Andrea; Sankar, Subramanian V; Scally, Aylwyn; Schroth, Gary P; Smith, Mark E; Smith, Vincent P; Spiridou, Anastassia; Torrance, Peta E; Tzonev, Svilen S; Vermaas, Eric H; Walter, Klaudia; Wu, Xiaolin; Zhang, Lu; Alam, Mohammed D; Anastasi, Carole; Aniebo, Ify C; Bailey, David M D; Bancarz, Iain R; Banerjee, Saibal; Barbour, Selena G; Baybayan, Primo A; Benoit, Vincent A; Benson, Kevin F; Bevis, Claire; Black, Phillip J; Boodhun, Asha; Brennan, Joe S; Bridgham, John A; Brown, Rob C; Brown, Andrew A; Buermann, Dale H; Bundu, Abass A; Burrows, James C; Carter, Nigel P; Castillo, Nestor; Chiara E Catenazzi, Maria; Chang, Simon; Neil Cooley, R; Crake, Natasha R; Dada, Olubunmi O; Diakoumakos, Konstantinos D; Dominguez-Fernandez, Belen; Earnshaw, David J; Egbujor, Ugonna C; Elmore, David W; Etchin, Sergey S; Ewan, Mark R; Fedurco, Milan; Fraser, Louise J; Fuentes Fajardo, Karin V; Scott Furey, W; George, David; Gietzen, Kimberley J; Goddard, Colin P; Golda, George S; Granieri, Philip A; Green, David E; Gustafson, David L; Hansen, Nancy F; Harnish, Kevin; Haudenschild, Christian D; Heyer, Narinder I; Hims, Matthew M; Ho, Johnny T; Horgan, Adrian M; Hoschler, Katya; Hurwitz, Steve; Ivanov, Denis V; Johnson, Maria Q; James, Terena; Huw Jones, T A; Kang, Gyoung-Dong; Kerelska, Tzvetana H; Kersey, Alan D; Khrebtukova, Irina; Kindwall, Alex P; Kingsbury, Zoya; Kokko-Gonzales, Paula I; Kumar, Anil; Laurent, Marc A; Lawley, Cynthia T; Lee, Sarah E; Lee, Xavier; Liao, Arnold K; Loch, Jennifer A; Lok, Mitch; Luo, Shujun; Mammen, Radhika M; Martin, John W; McCauley, Patrick G; McNitt, Paul; Mehta, Parul; Moon, Keith W; Mullens, Joe W; Newington, Taksina; Ning, Zemin; Ling Ng, Bee; Novo, Sonia M; O'Neill, Michael J; Osborne, Mark A; Osnowski, Andrew; Ostadan, Omead; Paraschos, Lambros L; Pickering, Lea; Pike, Andrew C; Pike, Alger C; Chris Pinkard, D; Pliskin, Daniel P; Podhasky, Joe; Quijano, Victor J; Raczy, Come; Rae, Vicki H; Rawlings, Stephen R; Chiva Rodriguez, Ana; Roe, Phyllida M; Rogers, John; Rogert Bacigalupo, Maria C; Romanov, Nikolai; Romieu, Anthony; Roth, Rithy K; Rourke, Natalie J; Ruediger, Silke T; Rusman, Eli; Sanches-Kuiper, Raquel M; Schenker, Martin R; Seoane, Josefina M; Shaw, Richard J; Shiver, Mitch K; Short, Steven W; Sizto, Ning L; Sluis, Johannes P; Smith, Melanie A; Ernest Sohna Sohna, Jean; Spence, Eric J; Stevens, Kim; Sutton, Neil; Szajkowski, Lukasz; Tregidgo, Carolyn L; Turcatti, Gerardo; Vandevondele, Stephanie; Verhovsky, Yuli; Virk, Selene M; Wakelin, Suzanne; Walcott, Gregory C; Wang, Jingwen; Worsley, Graham J; Yan, Juying; Yau, Ling; Zuerlein, Mike; Rogers, Jane; Mullikin, James C; Hurles, Matthew E; McCooke, Nick J; West, John S; Oaks, Frank L; Lundberg, Peter L; Klenerman, David; Durbin, Richard; Smith, Anthony J

    2008-11-01

    DNA sequence information underpins genetic research, enabling discoveries of important biological or medical benefit. Sequencing projects have traditionally used long (400-800 base pair) reads, but the existence of reference sequences for the human and many other genomes makes it possible to develop new, fast approaches to re-sequencing, whereby shorter reads are compared to a reference to identify intraspecies genetic variation. Here we report an approach that generates several billion bases of accurate nucleotide sequence per experiment at low cost. Single molecules of DNA are attached to a flat surface, amplified in situ and used as templates for synthetic sequencing with fluorescent reversible terminator deoxyribonucleotides. Images of the surface are analysed to generate high-quality sequence. We demonstrate application of this approach to human genome sequencing on flow-sorted X chromosomes and then scale the approach to determine the genome sequence of a male Yoruba from Ibadan, Nigeria. We build an accurate consensus sequence from >30x average depth of paired 35-base reads. We characterize four million single-nucleotide polymorphisms and four hundred thousand structural variants, many of which were previously unknown. Our approach is effective for accurate, rapid and economical whole-genome re-sequencing and many other biomedical applications.

  18. Building Consensus on Community Standards for Reproducible Science

    NASA Astrophysics Data System (ADS)

    Lehnert, K. A.; Nielsen, R. L.

    2015-12-01

    As geochemists, the traditional model by which standard methods for generating, presenting, and using data have been generated relied on input from the community, the results of seminal studies, a variety of authoritative bodies, and has required a great deal of time. The rate of technological and related policy change has accelerated to the point that this historical model does not satisfy the needs of the community, publishers, or funders. The development of a new mechanism for building consensus raises a number of questions: Which aspects of our data are the focus of reproducibility standards? Who sets the standards? How do we subdivide the development of the consensus? We propose an open, transparent, and inclusive approach to the development of data and reproducibility standards that is organized around specific sub-disciplines and driven by the community of practitioners in those sub-disciplines. It should involve editors, program managers, and representatives of domain data facilities as well as professional societies, but avoid any single group to be the final authority. A successful example of this model is the Editors Roundtable, a cross section of editors, funders, and data facility managers that discussed and agreed on leading practices for the reporting of geochemical data in publications, including accessibility and format of the data, data quality information, and metadata and identifiers for samples (Goldstein et al., 2014). We argue that development of data and reproducibility standards needs to heavily rely on representatives from the community of practitioners to set priorities and provide perspective. Groups of editors, practicing scientists, and other stakeholders would be assigned the task of reviewing existing practices and recommending changes as deemed necessary. They would weigh the costs and benefits of changing the standards for that community, propose appropriate tools to facilitate those changes, work through the professional societies

  19. Establishing Consensus Turbulence Statistics for Hot Subsonic Jets

    NASA Technical Reports Server (NTRS)

    Bridges, James; Werner, Mark P.

    2010-01-01

    velocimetry (LDV) data published in the open literature. Compare different datasets acquired at roughly the same flow conditions to establish uncertainties. Create a consensus dataset for a range of hot jet flows, including uncertainty bands. Analyze this consensus dataset for self-consistency and compare jet characteristics to those of the open literature. One final objective fulfilled by this work was the demonstration of a universal scaling for the jet flow fields, at least within the region of interest to aeroacoustics. The potential core length and the spread rate of the half-velocity radius were used to collapse of the mean and turbulent velocity fields over the first 20 jet diameters in a highly satisfying manner.

  20. The Importance of Consensus Information in Acceptance of Climate Change (Invited)

    NASA Astrophysics Data System (ADS)

    Cook, J.; Lewandowsky, S.

    2013-12-01

    In recent years, public perception of the scientific consensus on human-caused global warming has been disturbingly low, in contrast to the overwhelming level of agreement among climate scientists and in peer-reviewed research. The misperception is partly cultural, with a significant link between perceived consensus and political ideology, and partly informational with all cultural groups exhibiting the misperception to varying degrees. This universal 'consensus gap' is in large part due to a persistent and focused misinformation campaign casting doubt on the consensus, dating back as early as the 1980s. Opponents of climate action have long recognized that perception of scientific consensus is linked to support for climate policy, a link only acknowledged by social scientists in the last few years. How do we counter the all-too-effective misinformation campaign? Psychological research tells us that a crucial aspect of effective refutations is an alternative narrative. In this case, an important counter-narrative to the consensus story is the strategy to perpetuate the impression of ongoing scientific debate. I will also present recent research into the effect that consensus information has on climate beliefs of Australians and Americans. For both groups, the consensus message significantly increased beliefs about human-caused global warming and outperformed interventions that feature evidence or scientists' expertise. For the Australian sample, consensus information partially neutralised the biasing influence of ideology. However, for Americans, a backfire effect (reduced climate belief) was observed for a small minority holding strong conservative views. A psychological model employing Bayesian Networks indicates that a key element to the backfire effect is conspiratorial thinking, consistent with other research finding a link between rejection of climate science and conspiratorial ideation. Thus when presented to a general audience, consensus information has an