Science.gov

Sample records for 26s ribosomal dna

  1. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene.

    PubMed Central

    Kurtzman, C P; Robnett, C J

    1997-01-01

    Clinically important species of Candida and related organisms were compared for extent of nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA (rDNA) gene. This rDNA region is sufficiently variable to allow reliable separation of all known clinically significant yeast species. Of the 204 described species examined, 21 appeared to be synonyms of previously described organisms. Phylogenetic relationships among the species are presented. PMID:9114410

  2. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  3. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    PubMed

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  4. Genotyping of a miso and soy sauce fermentation yeast, Zygosaccharomyces rouxii, based on sequence analysis of the partial 26S ribosomal RNA gene and two internal transcribed spacers.

    PubMed

    Suezawa, Yasuhiko; Suzuki, Motofumi; Mori, Haruhiko

    2008-09-01

    We analyzed sequences of the D1D2 domain of the 26S ribosomal RNA gene (26S rDNA sequence), the internal transcribed spacer 1, the 5.8S ribosomal RNA gene, and the internal transcribed spacer 2 (the ITS sequence) from 46 strains of miso and soy sauce fermentation yeast, Zygosaccharomyces rouxii and a closely related species, Z. mellis, for typing. Based on the 26S rDNA sequence analysis, the Z. rouxii strains were of two types, and the extent of sequence divergence between them was 2.6%. Based on the ITS sequence analysis, they were divided into seven types (I-VII). Between the type strain (type I) and type VI, in particular, a 12% difference was detected. The occurrence of these nine genotypes with a divergence of more than 1% in these two sequences suggests that Z. rouxii is a species complex including novel species and hybrids. Z. mellis strains were of two types (type alpha and type beta) based on the ITS sequence. Z. rouxii could clearly be distinguished from Z. mellis by 26S rDNA and ITS sequence analyses, but not by the 16% NaCl tolerance, when used as the sole key characteristic for differentiation between the two species. PMID:18776675

  5. DNA homologies of ribosomal RNA genes of Neurospora species

    SciTech Connect

    Mukhopadhyay, D.K.; Mimiko, R.; Dutta, S.K.

    1980-01-01

    Ribosomal RNA genes (rDNAs) of Neurospora crassa contain DNA sequences which code for 17S, 5.8S, and 26S rRNAs, in addition to internal and external spacers. As has been reported for many eukaryotes, the DNA sequences which code for 17S, 5.8S, and 26S rRNAs in Neurospora species are probably conserved while the internal and external spacer regions are probably variable sequences. Extensive electron microscopic studies of 45S precursor rRNA of several cold and warm blooded animals confirm that spacer regions vary extensively from species to species. It was desirable to know whether such differences in rDNA sequences exist between Neurospora species. Any such difference should be detectable using standard procedures for DNA homology studies rDNA sequences were isolated from N. crassa mycelial cells using the procedure described previously. The purified rDNA was /sup 3/H-labeled (by nick translation) and reassociated with total DNA isolated from the heterothallic species N. crassa and from three homothalliospecies: N. dodgei, N. lineolata, and N. africana. In addition, /sup 32/P-labeled total DNA of N. crassa was reannealed with unlabeled bulk DNA from N. crassa, N. dodgei, and N. lineolata.

  6. Replication of ribosomal DNA in Xenopus laevis.

    PubMed

    Bozzoni, I; Baldari, C T; Amaldi, F; Buongiorno-Nardelli, M

    1981-09-01

    The study of the localization of the replication origins of rDNA in Xenopus laevis has been approached by two different methods. 1. The DNA of X. laevis larvae was fractionated by CsCl gradient centrifugation in bulk and ribosomal DNA and examined in the electron microscope. In bulk DNA, clusters of microbubbles, which are related with the origins of replication, appear to be spaced along the DNA molecules at intervals comparable with the size of the 'average' replicon of X. laevis. In ribosomal DNA, the distance between adjacent clusters is much shorter and corresponds to the size of the rDNA repeating unit. When ribosomal DNA was submitted to digestion with restriction enzymes (Eco RI and HindIII) the microbubbles are observed in the non-transcribed spacer-containing fragment. 2. Cultured cells of X. laevis were synchronized by mitotic selection and incubated with 5-fluoro-2-deoxyuridine for a time longer than the G1 phase. This treatment synchronizes the replicons and allows them to start replicating very slowly. It was thus possible to obtain a preferential labelling of the regions containing the origins. The analysis by gel electrophoresis of the Eco Ri-digested rDNA showed that the radioactivity was preferentially incorporated in the fragments which contain the non-transcribed spacer. The results of these two approaches indicate that the rRNA gene cluster consists of multiple units of replication, possibly one per gene unit. Furthermore they show that the origins of replication are localized into the non-transcribed spacer. PMID:7297565

  7. DNA damage modulates interactions between microRNAs and the 26S proteasome

    PubMed Central

    Tsimokha, Anna S; Kulichkova, Valentina A.; Karpova, Elena V.; Zaykova, Julia J.; Aksenov, Nikolai D; Vasilishina, Anastasia A.; Kropotov, Andrei V.; Antonov, Alexey; Barlev, Nikolai A.

    2014-01-01

    26S proteasomes are known as major non-lysosomal cellular machines for coordinated and specific destruction of ubiquitinylated proteins. The proteolytic activities of proteasomes are controlled by various post-translational modifications in response to environmental cues, including DNA damage. Besides proteolysis, proteasomes also associate with RNA hydrolysis and splicing. Here, we extend the functional diversity of proteasomes by showing that they also dynamically associate with microRNAs (miRNAs) both in the nucleus and cytoplasm of cells. Moreover, DNA damage induced by an anti-cancer drug, doxorubicin, alters the repertoire of proteasome-associated miRNAs, enriching the population of miRNAs that target cell cycle checkpoint regulators and DNA repair proteins. Collectively, these data uncover yet another potential mode of action for proteasomes in the cell via their dynamic association with microRNAs. PMID:25004448

  8. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  9. Does Blood of Healthy Subjects Contain Bacterial Ribosomal DNA?

    PubMed Central

    Nikkari, Simo; McLaughlin, Ian J.; Bi, Wanli; Dodge, Deborah E.; Relman, David A.

    2001-01-01

    Real-time PCR methods with primers and a probe targeting conserved regions of the bacterial 16S ribosomal DNA (rDNA) revealed a larger amount of rDNA in blood specimens from healthy individuals than in matched reagent controls. However, the origins and identities of these blood-associated bacterial rDNA sequences remain obscure. PMID:11326021

  10. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  11. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  12. Prevalence and Dynamics of Ribosomal DNA Micro-heterogeneity Are Linked to Population History in Two Contrasting Yeast Species

    PubMed Central

    James, Stephen A.; West, Claire; Davey, Robert P.; Dicks, Jo; Roberts, Ian N.

    2016-01-01

    Despite the considerable number and taxonomic breadth of past and current genome sequencing projects, many of which necessarily encompass the ribosomal DNA, detailed information on the prevalence and evolutionary significance of sequence variation in this ubiquitous genomic region are severely lacking. Here, we attempt to address this issue in two closely related yet contrasting yeast species, the baker’s yeast Saccharomyces cerevisiae and the wild yeast Saccharomyces paradoxus. By drawing on existing datasets from the Saccharomyces Genome Resequencing Project, we identify a rich seam of ribosomal DNA sequence variation, characterising 1,068 and 970 polymorphisms in 34 S. cerevisiae and 26 S. paradoxus strains respectively. We discover the two species sets exhibit distinct mutational profiles. Furthermore, we show for the first time that unresolved rDNA sequence variation resulting from imperfect concerted evolution of the ribosomal DNA region follows a U-shaped allele frequency distribution in each species, similar to loci that evolve under non-concerted mechanisms but arising through rather different evolutionary processes. Finally, we link differences between the shapes of these allele frequency distributions to the two species’ contrasting population histories. PMID:27345953

  13. Prevalence and Dynamics of Ribosomal DNA Micro-heterogeneity Are Linked to Population History in Two Contrasting Yeast Species.

    PubMed

    James, Stephen A; West, Claire; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2016-01-01

    Despite the considerable number and taxonomic breadth of past and current genome sequencing projects, many of which necessarily encompass the ribosomal DNA, detailed information on the prevalence and evolutionary significance of sequence variation in this ubiquitous genomic region are severely lacking. Here, we attempt to address this issue in two closely related yet contrasting yeast species, the baker's yeast Saccharomyces cerevisiae and the wild yeast Saccharomyces paradoxus. By drawing on existing datasets from the Saccharomyces Genome Resequencing Project, we identify a rich seam of ribosomal DNA sequence variation, characterising 1,068 and 970 polymorphisms in 34 S. cerevisiae and 26 S. paradoxus strains respectively. We discover the two species sets exhibit distinct mutational profiles. Furthermore, we show for the first time that unresolved rDNA sequence variation resulting from imperfect concerted evolution of the ribosomal DNA region follows a U-shaped allele frequency distribution in each species, similar to loci that evolve under non-concerted mechanisms but arising through rather different evolutionary processes. Finally, we link differences between the shapes of these allele frequency distributions to the two species' contrasting population histories. PMID:27345953

  14. Kinetoplast DNA-encoded ribosomal protein S12

    PubMed Central

    Aphasizheva, Inna; Maslov, Dmitri A; Aphasizhev, Ruslan

    2013-01-01

    Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, which are encoded by the kinetoplast genome, and more than 150 proteins encoded in the nucleus and imported from the cytoplasm. However, a single ribosomal protein RPS12 is encoded by the kinetoplast DNA (kDNA) in all trypanosomatid species examined. As typical for these organisms, the gene itself is cryptic and its transcript undergoes an extensive U-insertion/deletion editing. An evolutionary trend to reduce or eliminate RNA editing could be traced with other cryptogenes, but the invariably pan-edited RPS12 cryptogene is apparently spared. Here we inquired whether editing of RPS12 mRNA is essential for mitochondrial translation. By RNAi-mediated knockdowns of RNA editing complexes and inducible knock-in of a key editing enzyme in procyclic parasites, we could reversibly downregulate production of edited RPS12 mRNA and, by inference, synthesis of this protein. While inhibition of editing decreased edited mRNA levels, the translation of edited (Cyb) and unedited (COI) mRNAs was blocked. Furthermore, the population of SSU-related 45S complexes declined upon inactivation of editing and so did the amount of mRNA-bound ribosomes. In bloodstream parasites, which lack active electron transport chain but still require translation of ATP synthase subunit 6 mRNA (A6), both edited RPS12 and A6 mRNAs were detected in translation complexes. Collectively, our results indicate that a single ribosomal protein gene retained by the kinetoplast mitochondrion serves as a possible functional link between editing and translation processes and provide the rationale for the evolutionary conservation of RPS12 pan-editing. PMID:24270388

  15. Epidemiologic Study of Malassezia Yeasts in Patients with Malassezia Folliculitis by 26S rDNA PCR-RFLP Analysis

    PubMed Central

    Ko, Jong Hyun; Choe, Yong Beom; Ahn, Kyu Joong

    2011-01-01

    Background So far, studies on the inter-relationship between Malassezia and Malassezia folliculitis have been rather scarce. Objective We sought to analyze the differences in body sites, gender and age groups, and to determine whether there is a relationship between certain types of Malassezia species and Malassezia folliculitis. Methods Specimens were taken from the forehead, cheek and chest of 60 patients with Malassezia folliculitis and from the normal skin of 60 age- and gender-matched healthy controls by 26S rDNA PCR-RFLP. Results M. restricta was dominant in the patients with Malassezia folliculitis (20.6%), while M. globosa was the most common species (26.7%) in the controls. The rate of identification was the highest in the teens for the patient group, whereas it was the highest in the thirties for the control group. M. globosa was the most predominant species on the chest with 13 cases (21.7%), and M. restricta was the most commonly identified species, with 17 (28.3%) and 12 (20%) cases on the forehead and cheek, respectively, for the patient group. Conclusion Statistically significant differences were observed between the patient and control groups for the people in their teens and twenties, and in terms of the body site, on the forehead only. PMID:21747616

  16. Epidemiologic Study of Malassezia Yeasts in Acne Patients by Analysis of 26S rDNA PCR-RFLP

    PubMed Central

    Song, Young Chan; Hahn, Hyung Jin; Kim, Ji Young; Ko, Jong Hyun; Choe, Yong Beom; Ahn, Kyu Joong

    2011-01-01

    Background Although acne is a common follicular inflammatory dermatosis, studies of the relationship between Malassezia yeasts and acne have rarely been conducted. Objective We sought to identify Malassezia yeasts from acne patients and establish a relationship between specific types of species of Malassezia and acne. Methods Sixty acne patients were enrolled. Each strain obtained was identified as one of eleven species by 26S rDNA PCR-RFLP. We then compared these data with those of age- and sex-matched healthy subjects. Results Growth of Malassezia was evident in fewer patients with acne (50%) in comparison to controls (70.6%). M. restricta was dominant in patients with acne (23.9%), whereas M. globosa was most common (26.7%) in healthy controls. In the patients group, the rate was the highest (71.7%) in the twenties and, in terms of body site, the rate was the highest (60%) in the chest. In the control group, the rate was the highest (75.0%) in the thirties and in the forehead (85.0%). Conclusion The detection rate of Malassezia yeasts was conspicuously low in the acne patients group. Statistically significant differences were observed between the patient and the control groups in the twenties and thirties, and in terms of body site, in the forehead and chest. PMID:21909202

  17. ABH2 couples regulation of ribosomal DNA transcription with DNA alkylation repair.

    PubMed

    Li, Pishun; Gao, Shuman; Wang, Lina; Yu, Fang; Li, Jialun; Wang, Chuangui; Li, Jiwen; Wong, Jiemin

    2013-08-29

    Transcription has been linked to DNA damage. How the most highly transcribed mammalian ribosomal (rDNA) genes maintain genome integrity in the absence of transcription-coupled DNA damage repair is poorly understood. Here, we report that ABH2/ALKBH2, a DNA alkylation repair enzyme, is highly enriched in the nucleolus. ABH2 interacts with DNA repair proteins Ku70 and Ku80 as well as nucleolar proteins nucleolin, nucleophosmin 1, and upstream binding factor (UBF). ABH2 associates with and promotes rDNA transcription through its DNA repair activity. ABH2 knockdown impairs rDNA transcription and leads to increased single-stranded and double-stranded DNA breaks that are more pronounced in the rDNA genes, whereas ABH2 overexpression protects cells from methyl-methanesulfonate-induced DNA damage and inhibition of rDNA transcription. In response to massive alkylation damage, ABH2 rapidly redistributes from the nucleolus to nucleoplasm. Our study thus reveals a critical role of ABH2 in maintaining rDNA gene integrity and transcription and provides insight into the ABH2 DNA repair function. PMID:23972994

  18. Intragenomic polymorphisms among high-copy loci: a genus-wide study of nuclear ribosomal DNA in Asclepias (Apocynaceae).

    PubMed

    Weitemier, Kevin; Straub, Shannon C K; Fishbein, Mark; Liston, Aaron

    2015-01-01

    Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA) across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual's consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%). Most nrDNA positions (91%) were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the "noncoding" ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming). PMID:25653903

  19. Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.

    NASA Astrophysics Data System (ADS)

    Lobuglio, Katherine Frances

    1990-01-01

    Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four

  20. Simultaneous Discrimination between 15 Fish Pathogens by Using 16S Ribosomal DNA PCR and DNA Microarrays

    PubMed Central

    Warsen, Adelaide E.; Krug, Melissa J.; LaFrentz, Stacey; Stanek, Danielle R.; Loge, Frank J.; Call, Douglas R.

    2004-01-01

    We developed a DNA microarray suitable for simultaneous detection and discrimination between multiple bacterial species based on 16S ribosomal DNA (rDNA) polymorphisms using glass slides. Microarray probes (22- to 31-mer oligonucleotides) were spotted onto Teflon-masked, epoxy-silane-derivatized glass slides using a robotic arrayer. PCR products (ca. 199 bp) were generated using biotinylated, universal primer sequences, and these products were hybridized overnight (55°C) to the microarray. Targets that annealed to microarray probes were detected using a combination of Tyramide Signal Amplification and Alexa Fluor 546. This methodology permitted 100% specificity for detection of 18 microbes, 15 of which were fish pathogens. With universal 16S rDNA PCR (limited to 28 cycles), detection sensitivity for purified control DNA was equivalent to <150 genomes (675 fg), and this sensitivity was not adversely impacted either by the presence of competing bacterial DNA (1.1 × 106 genomes; 5 ng) or by the addition of up to 500 ng of fish DNA. Consequently, coupling 16S rDNA PCR with a microarray detector appears suitable for diagnostic detection and surveillance for commercially important fish pathogens. PMID:15240304

  1. Phylogenetic Relationships in Bupleurum (Apiaceae) Based on Nuclear Ribosomal DNA ITS Sequence Data

    PubMed Central

    NEVES, SUSANA S.; WATSON, MARK F.

    2004-01-01

    • Backgroud and Aims The genus Bupleurum has long been recognized as a natural group, but its infrageneric classification is controversial and has not yet been studied in the light of sequence data. • Methods Phylogenetic relationships among 32 species (35 taxa) of the genus Bupleurum were investigated by comparative sequencing of the ITS region of the 18–26S nuclear ribosomal DNA repeat. Exemplar taxa from all currently accepted sections and subsections of the genus were included, along with outgroups from four other early branching Apioideae genera (Anginon, Heteromorpha, Physospermum and Pleurospermum). • Key Results Phylogenies generated by maximum parsimony, maximum likelihood, and neighbour‐joining methods show similar topologies, demonstrating monophyly of Bupleurum and the division of the genus into two major clades. This division is also supported by analysis of the 5.8S coding sequence alone. The first branching clade is formed by all the species of the genus with pinnate‐reticulate veined leaves and B. rigidum with a unique type of leaf venation. The other major clade includes the remaining species studied, all of which have more or less parallel‐veined leaves. • Conclusions These phylogenetic results do not agree with any previous classifications of the genus. Molecular data also suggest that the endemic Macaronesian species B. salicifolium is a neoendemic, as the sequence divergence between the populations in Madeira and Canary Islands, and closer mainland relatives in north‐west Africa is small. All endemic north‐west African taxa are included in a single unresolved but well‐supported clade, and the low nucleotide variation of ITS suggests a recent radiation within this group. The only southern hemisphere species, B. mundii (southern Africa), is shown to be a neoendemic, apparently closely related to B. falcatum, a Eurasian species. PMID:14980972

  2. Determination of fruit origin by using 26S rDNA fingerprinting of yeast communities by PCR-DGGE: preliminary application to Physalis fruits from Egypt.

    PubMed

    El Sheikha, Aly Farag; Condur, Ana; Métayer, Isabelle; Nguyen, Doan Duy Le; Loiseau, Gérard; Montet, Didier

    2009-10-01

    The determination of geographical origin is a demand of the traceability system of import-export food products. One hypothesis for tracing the source of a product is by global analysis of the microbial communities of the food and statistical linkage of this analysis to the geographical origin of the food. For this purpose, a molecular technique employing 26S rDNA profiles generated by PCR-DGGE was used to detect the variation in yeast community structures of three species of Physalis fruit (Physalis ixocarpa Brat, Physalis pubescens L, Physalis pruinosa L) from four Egyptian regions (Qalyoubia, Minufiya, Beheira and Alexandria Governments). When the 26S rDNA profiles were analysed by multivariate analysis, distinct microbial communities were detected. The band profiles of Physalis yeasts from different Governments were specific for each location and could be used as a bar code to discriminate the origin of the fruits. This method is a new traceability tool which provides fruit products with a unique biological bar code and makes it possible to trace back the fruits to their original location. PMID:19784935

  3. PCR amplification of the 3' external transcribed and intergenic spacers of the ribosomal DNA repeat unit in three species of Saccharomyces.

    PubMed

    Molina, F I; Jong, S C; Huffman, J L

    1993-04-15

    Two spacer regions outside the ribosomal DNA (rDNA) transcriptional unit in three species of Saccharomyces, S. cerevisiae, S. carlsbergensis and S. pastorianus, were amplified using the polymerase chain reaction. These regions were composed of the 3' external transcribed spacer (ETS) and the intergenic spacer (IGS). Primers were developed from sequence alignments and by taking the reverse complement of a previously described sequence. The region amplified spanned base position 3110 on the 26S rRNA to base position 27 on the 5S rRNA of S. cerevisiae. Nine of the twelve strains used in this study exhibited different restriction profiles, showing that the spacers are highly variable between species. The results suggest that PCR fingerprinting of the non-coding spacer regions can be used to distinguish between closely related Saccharomyces species and may have potential in DNA profiling of other yeasts. PMID:8099889

  4. Morphology and Small-Subunit Ribosomal DNA Sequence of Henneguya Adiposa (Myxosporea) From Ictalurus punctatus (Siluriformes)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The original description of Henneguya adiposa, a myxozoan parasitizing channel catfish Ictalurus punctatus, is supplemented with new data on spore morphology, including photomicrographs and line drawings, as well as 18S small-subunit (SSU) ribosomal DNA (rDNA) sequence. Elongate, translucent, linear...

  5. Intragenomic polymorphisms among high-copy loci: a genus-wide study of nuclear ribosomal DNA in Asclepias (Apocynaceae)

    PubMed Central

    Straub, Shannon C.K.; Fishbein, Mark; Liston, Aaron

    2015-01-01

    Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA) across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual’s consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%). Most nrDNA positions (91%) were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the “noncoding” ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming). PMID:25653903

  6. Comparison of ribosomal DNA sites in Lolium species by fluorescence in situ hybridization.

    PubMed

    Thomas, H M; Harper, J A; Meredith, M R; Morgan, W G; Thomas, I D; Timms, E; King, I P

    1996-11-01

    The position of the 18S-5.8S-26S and 5S rRNA genes have been physically mapped on the chromosomes of seven Lolium taxa. 18S-5.8S-26S sites were seen on two pairs of chromosomes in the inbreeding taxa. In the outbreeding taxa six sites were found in the L. multiflorum, seven in L. perenne and nine in L. rigidum var. rigidum. Two 5S sites were found in each of the taxa. In the inbreeders, the 5S sites were found adjacent to the 18S-5.8S-26S sites on chromosome 2. In L. multifiorum and L.perenne the 5S sites were on the short arm of chromosome 3. However, in L. rigidum var. rigidum the 5S rDNA site was found in either of the two positions. PMID:8939359

  7. Ultra-barcoding in cacao (Theobroma spp.; malvaceae) using whole chloroplast genomes and nuclear ribosomal DNA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-throughput next-generation sequencing was used to scan the genome and generate reliable sequence of high copy number regions. Using this method, we examined whole plastid genomes as well as nearly 6000 bases of nuclear ribosomal DNA sequences for nine genotypes of Theobroma cacao and an indivi...

  8. Analyses of the ribosomal DNA region in Nosema bombycis NIS 001.

    PubMed

    Iiyama, Kazuhiro; Chieda, Yuuka; Yasunaga-Aoki, Chisa; Hayasaka, Shoji; Shimizu, Susumu

    2004-01-01

    Ribosomal DNA (rDNA) containing small subunit (SSU) rDNA and both flanking regions in the entomopathogenic microsporidian Nosema bombycis NIS 001 was amplified from genomic DNA with a primer set based on the sequence of an inverse polymerase chain reaction (PCR)-derived fragment. In this fragment, SSU rDNA was divided by a 618-bp insert at nt 599, and 5S rDNA was located downstream of the SSU rDNA, fragmented by 284-bp intergenic spacer. In addition, the 48-bp 3'-end of large subunit (LSU) rDNA was located 118 bp upstream of the fragmented SSU rDNA. In the amplicon, the region upstream of the LSU rDNA was a homologue of the C-terminal CHARLIE8 transposon-like element of human GTF2IRD2. In this organism, another fragmented SSU rDNA, which was divided by a 231-bp insert at nt 50, was also detected. Both the intact (insertless) and fragmented SSU rDNAs clustered with LSU rDNA and 5S rDNA and the intergenic sequences between SSU rDNA and 5S rDNA were divergent in an organism. Reverse transcription (RT)-PCR assay indicated that not only the intact SSU rDNA but also the fragmened SSU rDNA were transcribed in N. bombycis. PMID:15666716

  9. The ribosomal protein S26 regulates p53 activity in response to DNA damage.

    PubMed

    Cui, D; Li, L; Lou, H; Sun, H; Ngai, S-M; Shao, G; Tang, J

    2014-04-24

    Ribosomal proteins have emerged as novel regulators of the Mdm2-p53 feedback loop, especially in the context of ribosomal stress. RPS26 is a recently identified Diamond-Blackfan Anemia-related ribosomal protein and its role in p53 activation has not been previously explored. In this study we found knockdown of RPS26 induced p53 stabilization and activation via a RPL11-dependent mechanism, resulting in p53-dependent cell growth inhibition. Moreover, RPS26 has the ability to interact with Mdm2 and inhibits Mdm2-mediated p53 ubiquitination that leads to p53 stabilization upon overexpression. Importantly, we discovered that RPS26 knockdown impaired p53's ability to transcriptionally activate its target genes in response to DNA damage, without affecting its stability. Accordingly, the cells lost the ability to induce G2/M cell cycle arrest. We further found that upon RPS26 knockdown, the DNA damage induced recruitment of p53 to the promoters of its target genes and p53 acetylation were both greatly reduced. In addition, RPS26 can interact with p53 independent of Mdm2 and coexist in a complex with p53 and p300. These data establish a role of RPS26 in DNA damage response by directly influencing p53 transcriptional activity, and suggest that RPS26 acts distinctively in different scenarios of p53 activation. Our finding also implicates p53 transcriptional activity control as an important mechanism of p53 regulation by ribosomal proteins. PMID:23728348

  10. Computational and Experimental Characterization of Ribosomal DNA and RNA G-Quadruplexes

    NASA Astrophysics Data System (ADS)

    Cho, Samuel

    DNA G-quadruplexes in human telomeres and gene promoters are being extensively studied for their role in controlling the growth of cancer cells. Recent studies strongly suggest that guanine (G)-rich genes encoding pre-ribosomal RNA (pre-rRNA) are a potential anticancer target through the inhibition of RNA polymerase I (Pol I) in ribosome biogenesis. However, the structures of ribosomal G-quadruplexes at atomic resolution are unknown, and very little biophysical characterization has been performed on them to date. Here, we have modeled two putative rDNA G-quadruplex structures, NUC 19P and NUC 23P, which we observe via circular dichroism (CD) spectroscopy to adopt a predominantly parallel topology, and their counterpart rRNA. To validate and refine the putative ribosomal G-quadruplex structures, we performed all-atom molecular dynamics (MD) simulations using the CHARMM36 force field in the presence and absence of stabilizing K + or Na + ions. We optimized the CHARMM36 force field K + parameters to be more consistent with quantum mechanical calculations (and the polarizable Drude model force field) so that the K + ion is predominantly in the G-quadruplex channel. Our MD simulations show that the rDNA G-quadruplex have more well-defined, predominantly parallel-topology structures than rRNA and NUC 19P is more structured than NUC 23P, which features extended loops. Our study demonstrates that they are both potential targets for the design of novel chemotherapeutics.

  11. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  12. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  13. Concerted copy number variation balances ribosomal DNA dosage in human and mouse genomes.

    PubMed

    Gibbons, John G; Branco, Alan T; Godinho, Susana A; Yu, Shoukai; Lemos, Bernardo

    2015-02-24

    Tandemly repeated ribosomal DNA (rDNA) arrays are among the most evolutionary dynamic loci of eukaryotic genomes. The loci code for essential cellular components, yet exhibit extensive copy number (CN) variation within and between species. CN might be partly determined by the requirement of dosage balance between the 5S and 45S rDNA arrays. The arrays are nonhomologous, physically unlinked in mammals, and encode functionally interdependent RNA components of the ribosome. Here we show that the 5S and 45S rDNA arrays exhibit concerted CN variation (cCNV). Despite 5S and 45S rDNA elements residing on different chromosomes and lacking sequence similarity, cCNV between these loci is strong, evolutionarily conserved in humans and mice, and manifested across individual genotypes in natural populations and pedigrees. Finally, we observe that bisphenol A induces rapid and parallel modulation of 5S and 45S rDNA CN. Our observations reveal a novel mode of genome variation, indicate that natural selection contributed to the evolution and conservation of cCNV, and support the hypothesis that 5S CN is partly determined by the requirement of dosage balance with the 45S rDNA array. We suggest that human disease variation might be traced to disrupted rDNA dosage balance in the genome. PMID:25583482

  14. Epidemiologic Study of Malassezia Yeasts in Seborrheic Dermatitis Patients by the Analysis of 26S rDNA PCR-RFLP

    PubMed Central

    Oh, Byung Ho; Choe, Yong Beom; Ahn, Kyu Joong

    2010-01-01

    Background This case-control study concerns a molecular biological method based on the data gathered from a group of Korean subjects to examine the distribution of Malassezia yeasts in seborrheic dermatitis (SD) patients. Cultures for Malassezia yeasts were taken from the foreheads, cheeks and chests of 60 patients with SD and in 60 healthy controls of equivalent age. Objective The purpose of this study is to identify the relationship between certain species of Malassezia and SD. This was done by analyzing the differences in the distribution of Malassezia species in terms of age and body parts of the host with healthy controls. Methods 26S rDNA PCR-RFLP, a fast and accurate molecular biological method, was used to overcome the limits of morphological and biochemical methods. Results The positive Malassezia culture rate was 51.7% in patients with SD, which was lower than that of healthy adults (63.9%). M. restricta was dominant in patients with SD (19.5%). Likewise, M. restricta was identified as a common species (20.5%) in healthy controls. In the ages 31~40, M. restricta was found to be the most common species (31.6%) among SD patients. Conclusion According to the results of the study, the most frequently isolated species was M. restricta (19.5%) in patients with SD. There was no statistically significant difference in the distribution of Malassezia species between the SD patients and healthy control groups. PMID:20548904

  15. Karyotypic Variability in Ribosomal DNA Subchromosome Size among Colpodid Ciliates, a Possible Tool To Differentiate Colpodid Species

    PubMed Central

    Martin, A.; Palacios, G.; Olmo, A.; Martin-Gonzalez, A.; Ruiz-Perez, L. M.; Gutierrez, J. C.

    1997-01-01

    Pulsed-field gel electrophoresis has been applied to analyze the karyotypic variability among colpodid ciliates. The 18S ribosomal gene was found at different locations in the electrophoretic pattern, and these size variations in the ribosomal DNA subchromosomal molecule seem to be species specific. This could potentially be a useful new tool with which to differentiate colpodid ciliates. PMID:16535582

  16. Telomerase stimulates ribosomal DNA transcription under hyperproliferative conditions.

    PubMed

    Gonzalez, Omar Garcia; Assfalg, Robin; Koch, Sylvia; Schelling, Adrian; Meena, Jitendra K; Kraus, Johann; Lechel, Andre; Katz, Sarah-Fee; Benes, Vladimir; Scharffetter-Kochanek, Karin; Kestler, Hans A; Günes, Cagatay; Iben, Sebastian

    2014-01-01

    In addition to performing its canonical function, Telomerase Reverse Transcriptase (TERT) has been shown to participate in cellular processes independent of telomerase activity. Furthermore, although TERT mainly localizes to Cajal bodies, it is also present within the nucleolus. Because the nucleolus is the site of rDNA transcription, we investigated the possible role of telomerase in regulating RNA polymerase I (Pol I). Here we show that TERT binds to rDNA and stimulates transcription by Pol I during liver regeneration and Ras-induced hyperproliferation. Moreover, the inhibition of telomerase activity by TERT- or TERC-specific RNA interference, the overexpression of dominant-negative-TERT, and the application of the telomerase inhibitor imetelstat reduce Pol I transcription and the growth of tumour cells. In vitro, telomerase can stimulate the formation of the transcription initiation complex. Our results demonstrate how non-canonical features of telomerase may direct Pol I transcription in oncogenic and regenerative hyperproliferation. PMID:25118183

  17. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    PubMed Central

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo, Luis I; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

    2016-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in-trans signaling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identified TCOF1-Treacle, a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1, and demonstrate that NBS1 translocation and accumulation in the nucleoli is Treacle-dependent. Finally, we provide evidence that Treacle-mediated NBS1 recruitment into the nucleoli regulates rRNA silencing in-trans in the presence of distant chromosome breaks. PMID:25064736

  18. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    PubMed

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  19. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    PubMed Central

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  20. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    NASA Astrophysics Data System (ADS)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-01-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  1. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    NASA Astrophysics Data System (ADS)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  2. Mapping of replication initiation sites in human ribosomal DNA by nascent-strand abundance analysis.

    PubMed Central

    Yoon, Y; Sanchez, J A; Brun, C; Huberman, J A

    1995-01-01

    New techniques for mapping mammalian DNA replication origins are needed. We have modified the existing nascent-strand size analysis technique (L. Vassilev and E.M. Johnson, Nucleic Acids Res. 17:7693-7705, 1989) to provide an independent means of studying replication initiation sites. We call the new method nascent-strand abundance analysis. We confirmed the validity of this method with replicating simian virus 40 DNA as a model. We then applied nascent-strand abundance and nascent-strand size analyses to mapping of initiation sites in human (HeLa) ribosomal DNA (rDNA), a region previously examined exclusively by two-dimensional gel electrophoresis methods (R.D. Little, T.H.K. Platt, and C.L. Schildkraut, Mol. Cell. Biol. 13:6600-6613, 1993). Our results partly confirm those obtained by two-dimensional gel electrophoresis techniques. Both studies suggest that replication initiates at relatively high frequency a few kilobase pairs upstream of the transcribed region and that many additional low-frequency initiation sites are distributed through most of the remainder of the ribosomal DNA repeat unit. PMID:7739533

  3. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    PubMed Central

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  4. Sequence analysis of the ribosomal internal transcribed spacer DNA of the crayfish parasite Psorospermium haeckeli.

    PubMed

    Bangyeekhun, E; Ryynänen, H J; Henttonen, P; Huner, J V; Cerenius, L; Söderhäll, K

    2001-10-01

    Two morphotypes of the crayfish parasite Psorospermium haeckeli were isolated from 2 crayfish species of different geographical origin. The oval-shaped sporocysts were obtained from the epidermal and connective tissue beneath the carapace of the noble crayfish Astacus astacus from Sweden and Finland. Elongated spores were isolated from the abdominal muscle tissue of the red swamp crayfish Procambarus clarkii from USA. To compare genetic divergence of 2 morphotypes of the parasite, the ribosomal internal transcribed spacer (ITS) DNA (ITS 1 and ITS 2) and the 5.8S rRNA gene were cloned and sequenced. The analysed region is variable in length, with the ribosomal ITS sequence of the European morphotype longer than the North American one. Sequence diversity is found mainly in ITS 1 and ITS 2 regions, and there is 66% and 58% similarity between the 2 morphotypes, respectively. Thus, analysis of the ribosomal ITS DNA suggests that P. haeckeli forms obtained from Europe and North America are genetically diverse, which supports the previously reported morphological characteristics. PMID:11710556

  5. Ribosomal DNA and Stellate gene copy number variation on the Y chromosome of Drosophila melanogaster.

    PubMed Central

    Lyckegaard, E M; Clark, A G

    1989-01-01

    Multigene families on the Y chromosome face an unusual array of evolutionary forces. Both ribosomal DNA and Stellate, the two families examined here, have multiple copies of similar sequences on the X and Y chromosomes. Although the rate of sequence divergence on the Y chromosome depends on rates of mutation, gene conversion and exchange with the X chromosome, as well as purifying selection, the regulation of gene copy number may also depend on other pleiotropic functions, such as maintenance of chromosome pairing. Gene copy numbers were estimated for a series of 34 Y chromosome replacement lines using densitometric measurements of slot blots of genomic DNA from adult Drosophila melanogaster. Scans of autoradiographs of the same blots probed with the cloned alcohol dehydrogenase gene, a single copy gene, served as internal standards. Copy numbers span a 6-fold range for ribosomal DNA and a 3-fold range for Stellate DNA. Despite this magnitude of variation, there was no association between copy number and segregation variation of the sex chromosomes. Images PMID:2494656

  6. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  7. Variability of chloroplast DNA and nuclear ribosomal DNA in cassava (Manihot esculenta Crantz) and its wild relatives.

    PubMed

    Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M

    1994-11-01

    Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability. PMID:24178017

  8. Characterization of unrelated strains of Staphylococcus schleiferi by using ribosomal DNA fingerprinting, DNA restriction patterns, and plasmid profiles.

    PubMed Central

    Grattard, F; Etienne, J; Pozzetto, B; Tardy, F; Gaudin, O G; Fleurette, J

    1993-01-01

    The molecular characteristics of 31 unrelated strains of Staphylococcus schleiferi isolated from 13 hospitals between 1973 and 1991 were determined by ribosomal DNA fingerprinting by using a digoxigenin-labeled DNA probe, genomic DNA restriction patterns, and plasmid profiles. Only six strains harbored one or two plasmids. DNA restriction analysis, which was carried out with five endonucleases (EcoRI, HindIII, PstI, PvuII, and ClaI), did not allow us to discriminate between isolates. Ribotyping with HindIII, ClaI, or EcoRI enzymes generated six, seven, and nine distinct patterns, respectively. With the combination ClaI-EcoRI, 13 ribotypes were obtained among the 31 strains, suggesting a relative heterogeneity within the species. Moreover, all strains shared two or three common bands, according to the endonuclease used, which were relatively specific for S. schleiferi in comparison with the ribosomal banding patterns described for other coagulase-negative staphylococci. These results illustrate that ribotyping can be used for the epidemiological investigation of S. schleiferi isolates and possibly for taxonomic analysis in this species. Images PMID:8385149

  9. Ribosomal DNA haplotype distribution of Bursaphelenchus xylophilus in Kyushu and Okinawa islands, Japan.

    PubMed

    Nose, Mine; Shiraishi, Susumu; Miyahara, Fumihiko; Ohira, Mineko; Matsunaga, Koji; Tobase, Masashi; Koyama, Takao; Yoshimoto, Kikuo

    2009-09-01

    Ribosomal DNA region sequences (partial 18S, 28S and complete ITS1, 5.8S, and ITS2) of the pinewood nematode (Bursaphelenchus xylophilus) were obtained from DNA extracted directly from wood pieces collected from wilted pine trees throughout the Kyushu and Okinawa islands, Japan. Either a 2569bp or 2573bp sequence was obtained from 88 of 143 samples. Together with the 45 rDNA sequences of pinewood nematode isolates previously reported, there were eight single nucleotide polymorphisms and two indels of two bases. Based on these mutations, nine haplotypes were estimated. The haplotype frequencies differed among regions in Kyushu island (northwest, northeast and center, southeast, and southwest), and the distribution was consistent with the invasion and spreading routes of the pinewood nematode previously estimated from past records of pine wilt and wood importation. There was no significant difference in haplotype frequencies among the collection sites on Okinawa island. PMID:22736814

  10. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    PubMed

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  11. The phylogenetic relationships of Rhodosporidium dacryoidum Fell, Hunter et Tallman based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Sakaguchia gen. nov., a heterobasidiomycetous yeast genus.

    PubMed

    Yamada, Y; Maeda, K; Mikata, K

    1994-01-01

    The partial base sequences of 18S and 26S rRNAs of Rhodosporidium fluviale, R. lusitaniae, and Erythrobasidium hasegawianum were analyzed. In the 26S rRNA partial base sequencings, R. fluviale CBS 6568 and R. lusitaniae IGC 4599 and IGC 4641 had 81-82 and 77 percent similarities compared with R. toruloides (type species of genus Rhodosporidium) IFO 0559 and IFO 0880. Erythrobasidium hasegawianum IFO 1058 showed 69-71, 59, 63, and 61 percent similarities with R. toruloides IFO 0559 and IFO 0880, L. scottii (type species of genus Leucosporidium) IFO 1923, R. dacryoidum IFO 1930 and IFO 1931, and Kondoa malvinella IFO 1936, respectively. In the 18S rRNA partial base sequencings, R. fluviale CBS 6568 and R. lusitaniae IGC 4599 and IGC 4641 had zero and two base differences with R. toruloides. Erythrobasidium hasegawianum IFO 1058 showed ten, sixteen, three, and twenty base differences with R. toruloides IFO 0559 and IFO 0880, L. scottii IFO 1923, R. dacryoidum IFO 1930 and IFO 1931, and K. malvinella IFO 1936, respectively. Based on the sequence data obtained, a new genus, Sakaguchia was proposed for R. dacryoidum with a new combination, Sakaguchia dacryoides. PMID:7765151

  12. Ribosomal DNA ITS-1 and ITS-2 sequence comparisons as a tool for predicting genetic relatedness.

    PubMed

    Coleman, A W; Mai, J C

    1997-08-01

    The determination of the secondary structure of the internal transcribed spacer (ITS) regions separating nuclear ribosomal RNA genes of Chlorophytes has improved the fidelity of alignment of nuclear ribosomal ITS sequences from related organisms. Application of this information to sequences from green algae and plants suggested that a subset of the ITS-2 positions is relatively conserved. Organisms that can mate are identical at all of these 116 positions, or differ by at most, one nucleotide change. Here we sequenced and compared the ITS-1 and ITS-2 of 40 green flagellates in search of the nearest relative to Chlamydomonas reinhardtii. The analysis clearly revealed one unique candidate, C. incerta. Several ancillary benefits of the analysis included the identification of mislabelled cultures, the resolution of confusion concerning C. smithii, the discovery of misidentified sequences in GenBank derived from a green algal contaminant, and an overview of evolutionary relationships among the Volvocales, which is congruent with that derived from rDNA gene sequence comparisons but improves upon its resolution. The study further delineates the taxonomic level at which ITS sequences, in comparison to ribosomal gene sequences, are most useful in systematic and other studies. PMID:9236277

  13. Detection of sequence variation in parasite ribosomal DNA by electrophoresis in agarose gels supplemented with a DNA-intercalating agent.

    PubMed

    Zhu, X Q; Chilton, N B; Gasser, R B

    1998-05-01

    This study evaluated the use of a commercially available DNA intercalating agent (Resolver Gold) in agarose gels for the direct detection of sequence variation in ribosomal DNA (rDNA). This agent binds preferentially to AT sequence motifs in DNA. Regions of nuclear rDNA, known to provide genetic markers for the identification of species of parasitic ascarid nematodes (order Ascaridida), were amplified by polymerase chain reaction (PCR) and subjected to electrophoresis in standard agarose gels versus gels supplemented with Resolver Gold. Individual taxa examined could not be distinguished reliably based on the size of their amplicons in standard agarose gels, whereas they could be readily delineated based on mobility using Resolver Gold-supplemented gels. The latter was achieved because of differences (approximately 0.1-8.2%) in the AT content of the fragments among different taxa, which were associated with significant interspecific differences (approximately 11-39%) in the rDNA sequences employed. There was a tendency for fragments with higher AT content to migrate slower in supplemented agarose gels compared with those of lower AT content. The results indicate the usefulness of this electrophoretic approach to rapidly screen for sequence variability within or among PCR-amplified rDNA fragments of similar sizes but differing AT contents. Although evaluated on rDNA of parasites, the approach has potential to be applied to a range of genes of different groups of infectious organisms. PMID:9629896

  14. Molecular phylogeny of Asian Meconopsis based on nuclear ribosomal and chloroplast DNA sequence data.

    PubMed

    Liu, Yu-Cheng; Liu, Ya-Nan; Yang, Fu-Sheng; Wang, Xiao-Quan

    2014-01-01

    The taxonomy and phylogeny of Asian Meconopsis (Himalayan blue poppy) remain largely unresolved. We used the internal transcribed spacer (ITS) region of nuclear ribosomal DNA (nrDNA) and the chloroplast DNA (cpDNA) trnL-F region for phylogenetic reconstruction of Meconopsis and its close relatives Papaver, Roemeria, and Stylomecon. We identified five main clades, which were well-supported in the gene trees reconstructed with the nrDNA ITS and cpDNA trnL-F sequences. We found that 41 species of Asian Meconopsis did not constitute a monophyletic clade, but formed two solid clades (I and V) separated in the phylogenetic tree by three clades (II, III and IV) of Papaver and its allies. Clade V includes only four Asian Meconopsis species, with the remaining 90 percent of Asian species included in clade I. In this core Asian Meconopsis clade, five subclades (Ia-Ie) were recognized in the nrDNA ITS tree. Three species (Meconopsis discigera, M. pinnatifolia, and M. torquata) of subgenus Discogyne were imbedded in subclade Ia, indicating that the present definition of subgenera in Meconopsis should be rejected. These subclades are inconsistent with any series or sections of the present classifications, suggesting that classifications of the genus should be completely revised. Finally, proposals for further revision of the genus Meconopsis were put forward based on molecular, morphological, and biogeographical evidences. PMID:25118100

  15. Tandem Repeats in Extrachromosomal Ribosomal DNA of Dictyostelium Discoideum, Resulting from Chromosomal Mutations

    PubMed Central

    Cole, R. A.; Williams, K. L.

    1992-01-01

    Extrachromosomal ribosomal DNA in the simple eukaryote Dictyostelium discoideum is readily separated from chromosomal DNA by orthogonal field electrophoresis (OFAGE), forming a prominent band in the 110-kb region of the gel. Here we show that mutations in at least two chromosomal genes give rise to a ladder of rDNA bands increasing in size up to about 300 kb. One of these mutations, the rrcA350 allele, which is recessive to wild type and maps to the centromere-proximal region of linkage group II, has an unstable phenotype; spontaneous revertants, which no longer exhibit the rDNA ladder, have been recovered. Another mutation rrc-351, provisionally mapped to linkage group IV, is dominant to wild type. The rDNA ladder is caused by concatamerization of a 34-kb fragment in the nontranscribed central spacer region of the 88-kb linear rDNA palindrome. Restriction enzyme analysis has revealed that each concatamer is generated by crossovers between two rDNA molecules. PMID:1582557

  16. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    PubMed Central

    Kvich, Lasse; Eickhardt, Steffen; Omland, Lars H.; Bjarnsholt, Thomas; Moser, Claus

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii-specific PCR and immunohistochemistry. The patient was later diagnosed with HIV/AIDS. PMID:25854484

  17. Diversity and Recombination of Dispersed Ribosomal DNA and Protein Coding Genes in Microsporidia

    PubMed Central

    Ironside, Joseph Edward

    2013-01-01

    Microsporidian strains are usually classified on the basis of their ribosomal DNA (rDNA) sequences. Although rDNA occurs as multiple copies, in most non-microsporidian species copies within a genome occur as tandem arrays and are homogenised by concerted evolution. In contrast, microsporidian rDNA units are dispersed throughout the genome in some species, and on this basis are predicted to undergo reduced concerted evolution. Furthermore many microsporidian species appear to be asexual and should therefore exhibit reduced genetic diversity due to a lack of recombination. Here, DNA sequences are compared between microsporidia with different life cycles in order to determine the effects of concerted evolution and sexual reproduction upon the diversity of rDNA and protein coding genes. Comparisons of cloned rDNA sequences between microsporidia of the genus Nosema with different life cycles provide evidence of intragenomic variability coupled with strong purifying selection. This suggests a birth and death process of evolution. However, some concerted evolution is suggested by clustering of rDNA sequences within species. Variability of protein-coding sequences indicates that considerable intergenomic variation also occurs between microsporidian cells within a single host. Patterns of variation in microsporidian DNA sequences indicate that additional diversity is generated by intragenomic and/or intergenomic recombination between sequence variants. The discovery of intragenomic variability coupled with strong purifying selection in microsporidian rRNA sequences supports the hypothesis that concerted evolution is reduced when copies of a gene are dispersed rather than repeated tandemly. The presence of intragenomic variability also renders the use of rDNA sequences for barcoding microsporidia questionable. Evidence of recombination in the single-copy genes of putatively asexual microsporidia suggests that these species may undergo cryptic sexual reproduction, a

  18. Analysis of histone modifications at human ribosomal DNA in liver cancer cell

    PubMed Central

    Yu, Feng; Shen, Xingyong; Fan, Li; Yu, Zhaocai

    2015-01-01

    Human liver cancer is the cancer commonly seen clinically. The transcription of ribosomal DNA (rDNA) is a critical step for cells, and epigenetic marks such as post-translational histone modifications have been involved in the regulation of rDNA transcription. But less is known about the pathogenesis of the liver cancers concerning the rDNA transcription regulation. Here we aligned the ChIP-seq data of histone modification markers and CTCF to the human genome assembly which contains a single rDNA repeat in human liver cancer cell and validated their distribution with ChIP-QPCR. Human liver cancer cell possesses a higher enrichment of H3K4me1 and H3K27me3 at ~28 kb within the intergenic spacer (IGS) of rDNA and a higher enrichment of H3K4me3 and H3K27ac upstream of TSS. Furtherly, we studied whether UBF could affect histone modification markers and CTCF at rDNA in human liver cancer cell. UBF depletion leads to a decrease of gene activation mark H3K4me3 across the rDNA promoter. And other histone modification marks and CTCF were not altered after UBF depletion. Taken together, our data showed a high resolution map of histone modification marks at rDNA in human liver cancer cell and provide novel evidence to decipher chromatin-mediated regulation of rDNA in liver cancer. PMID:26657029

  19. An unusual case of Streptococcus anginosus group pyomyositis diagnosed using direct 16S ribosomal DNA sequencing

    PubMed Central

    Walkty, Andrew; Embil, John M; Nichol, Kim; Karlowsky, James

    2014-01-01

    Bacteria belonging to the Streptococcus anginosus group (Streptococcus intermedius, Streptococcus constellatus and Streptococcus anginosus) are capable of causing serious pyogenic infections, with a tendency for abscess formation. The present article reports a case of S anginosus group pyomyositis in a 47-year-old man. The pathogen was recovered from one of two blood cultures obtained from the patient, but speciation was initially not performed because the organism was considered to be a contaminant (viridans streptococci group). The diagnosis was ultimately confirmed using 16S ribosomal DNA sequencing of purulent fluid obtained from a muscle abscess aspirate. The present case serves to emphasize that finding even a single positive blood culture of an organism belonging to the S anginosus group should prompt careful evaluation of the patient for a pyogenic focus of infection. It also highlights the potential utility of 16S ribosomal DNA amplification and sequencing in direct pathogen detection from aspirated fluid in cases of pyomyositis in which antimicrobial therapy was initiated before specimen collection. PMID:24634686

  20. Strongylus asini (Nematoda, Strongyloidea): genetic relationships with other Strongylus species determined by ribosomal DNA.

    PubMed

    Hung, G C; Jacobs, D E; Krecek, R C; Gasser, R B; Chilton, N B

    1996-12-01

    Genomic DNA was isolated from adult Strongylus asini collected from zebra. The second ribosomal transcribed spacer (ITS-2) was amplified and sequenced using polymerase chain reaction (PCR) based techniques. The DNA sequence was compared with previously published data for 3 related Strongylus species. A PCR-linked restriction fragment length polymorphism method allowed the 4 species to be differentiated unequivocally. The ITS-2 sequence of S. asini was found to be more similar to those of S. edentatus (87.1%) and S. equinus (95.3%) than to that of S vulgaris (73.9%). This result confirms that S. Asini and S vulgaris represent separate species and supports the retention of the 4 species within 1 genus. PMID:9024894

  1. Wnt5a Signals through DVL1 to Repress Ribosomal DNA Transcription by RNA Polymerase I.

    PubMed

    Dass, Randall A; Sarshad, Aishe A; Carson, Brittany B; Feenstra, Jennifer M; Kaur, Amanpreet; Obrdlik, Ales; Parks, Matthew M; Prakash, Varsha; Love, Damon K; Pietras, Kristian; Serra, Rosa; Blanchard, Scott C; Percipalle, Piergiorgio; Brown, Anthony M C; Vincent, C Theresa

    2016-08-01

    Ribosome biogenesis is essential for cell growth and proliferation and is commonly elevated in cancer. Accordingly, numerous oncogene and tumor suppressor signaling pathways target rRNA synthesis. In breast cancer, non-canonical Wnt signaling by Wnt5a has been reported to antagonize tumor growth. Here, we show that Wnt5a rapidly represses rDNA gene transcription in breast cancer cells and generates a chromatin state with reduced transcription of rDNA by RNA polymerase I (Pol I). These effects were specifically dependent on Dishevelled1 (DVL1), which accumulates in nucleolar organizer regions (NORs) and binds to rDNA regions of the chromosome. Upon DVL1 binding, the Pol I transcription activator and deacetylase Sirtuin 7 (SIRT7) releases from rDNA loci, concomitant with disassembly of Pol I transcription machinery at the rDNA promoter. These findings reveal that Wnt5a signals through DVL1 to suppress rRNA transcription. This provides a novel mechanism for how Wnt5a exerts tumor suppressive effects and why disruption of Wnt5a signaling enhances mammary tumor growth in vivo. PMID:27500936

  2. Wnt5a Signals through DVL1 to Repress Ribosomal DNA Transcription by RNA Polymerase I

    PubMed Central

    Dass, Randall A.; Sarshad, Aishe A.; Feenstra, Jennifer M.; Kaur, Amanpreet; Pietras, Kristian; Serra, Rosa; Blanchard, Scott C.; Percipalle, Piergiorgio; Brown, Anthony M. C.; Vincent, C. Theresa

    2016-01-01

    Ribosome biogenesis is essential for cell growth and proliferation and is commonly elevated in cancer. Accordingly, numerous oncogene and tumor suppressor signaling pathways target rRNA synthesis. In breast cancer, non-canonical Wnt signaling by Wnt5a has been reported to antagonize tumor growth. Here, we show that Wnt5a rapidly represses rDNA gene transcription in breast cancer cells and generates a chromatin state with reduced transcription of rDNA by RNA polymerase I (Pol I). These effects were specifically dependent on Dishevelled1 (DVL1), which accumulates in nucleolar organizer regions (NORs) and binds to rDNA regions of the chromosome. Upon DVL1 binding, the Pol I transcription activator and deacetylase Sirtuin 7 (SIRT7) releases from rDNA loci, concomitant with disassembly of Pol I transcription machinery at the rDNA promoter. These findings reveal that Wnt5a signals through DVL1 to suppress rRNA transcription. This provides a novel mechanism for how Wnt5a exerts tumor suppressive effects and why disruption of Wnt5a signaling enhances mammary tumor growth in vivo. PMID:27500936

  3. Dynamic distribution patterns of ribosomal DNA and chromosomal evolution in Paphiopedilum, a lady's slipper orchid

    PubMed Central

    2011-01-01

    Background Paphiopedilum is a horticulturally and ecologically important genus of ca. 80 species of lady's slipper orchids native to Southeast Asia. These plants have long been of interest regarding their chromosomal evolution, which involves a progressive aneuploid series based on either fission or fusion of centromeres. Chromosome number is positively correlated with genome size, so rearrangement processes must include either insertion or deletion of DNA segments. We have conducted Fluorescence In Situ Hybridization (FISH) studies using 5S and 25S ribosomal DNA (rDNA) probes to survey for rearrangements, duplications, and phylogenetically-correlated variation within Paphiopedilum. We further studied sequence variation of the non-transcribed spacers of 5S rDNA (5S-NTS) to examine their complex duplication history, including the possibility that concerted evolutionary forces may homogenize diversity. Results 5S and 25S rDNA loci among Paphiopedilum species, representing all key phylogenetic lineages, exhibit a considerable diversity that correlates well with recognized evolutionary groups. 25S rDNA signals range from 2 (representing 1 locus) to 9, the latter representing hemizygosity. 5S loci display extensive structural variation, and show from 2 specific signals to many, both major and minor and highly dispersed. The dispersed signals mainly occur at centromeric and subtelomeric positions, which are hotspots for chromosomal breakpoints. Phylogenetic analysis of cloned 5S rDNA non-transcribed spacer (5S-NTS) sequences showed evidence for both ancient and recent post-speciation duplication events, as well as interlocus and intralocus diversity. Conclusions Paphiopedilum species display many chromosomal rearrangements - for example, duplications, translocations, and inversions - but only weak concerted evolutionary forces among highly duplicated 5S arrays, which suggests that double-strand break repair processes are dynamic and ongoing. These results make the genus

  4. An abundant nucleolar phosphoprotein is associated with ribosomal DNA in Tetrahymena macronuclei.

    PubMed Central

    McGrath, K E; Smothers, J F; Dadd, C A; Madireddi, M T; Gorovsky, M A; Allis, C D

    1997-01-01

    An abundant 52-kDa phosphoprotein was identified and characterized from macronuclei of the ciliated protozoan Tetrahymena thermophila. Immunoblot analyses combined with light and electron microscopic immunocytochemistry demonstrate that this polypeptide, termed Nopp52, is enriched in the nucleoli of transcriptionally active macronuclei and missing altogether from transcriptionally inert micronuclei. The cDNA sequence encoding Nopp52 predicts a polypeptide whose amino-terminal half consists of multiple acidic/serine-rich regions alternating with basic/proline-rich regions. Multiple serines located in these acidic stretches lie within casein kinase II consensus motifs, and Nopp52 is an excellent substrate for casein kinase II in vitro. The carboxyl-terminal half of Nopp52 contains two RNA recognition motifs and an extreme carboxyl-terminal domain rich in glycine, arginine, and phenylalanine, motifs common in many RNA processing proteins. A similar combination and order of motifs is found in vertebrate nucleolin and yeast NSR1, suggesting that Nopp52 is a member of a family of related nucleolar proteins. NSR1 and nucleolin have been implicated in transcriptional regulation of rDNA and rRNA processing. Consistent with a role in ribosomal gene metabolism, rDNA and Nopp52 colocalize in situ, as well as by cross-linking and immunoprecipitation experiments, demonstrating an association between Nopp52 and rDNA in vivo. Images PMID:9017598

  5. Molecular phylogeny of the Blastocladiomycota (Fungi) based on nuclear ribosomal DNA.

    PubMed

    Porter, Teresita M; Martin, Wallace; James, Timothy Y; Longcore, Joyce E; Gleason, Frank H; Adler, Peter H; Letcher, Peter M; Vilgalys, Rytas

    2011-01-01

    The Blastocladiomycota is a recently described phylum of ecologically diverse zoosporic fungi whose species have not been thoroughly sampled and placed within a molecular phylogeny. In this study, we investigated the phylogeny of the Blastocladiomycota based on ribosomal DNA sequences from strains identified by traditional morphological and ultrastructural characters. Our results support the monophyly of the Coelomomycetaceae and Physodermataceae but the Blastocladiaceae and Catenariaceae are paraphyletic or polyphyletic. The data support two clades within Allomyces with strains identified as Allomyces arbusculus in both clades, suggesting that species concepts in Allomyces are in need of revision. A clade of Catenaria species isolated from midge larvae group separately from other Catenaria species, suggesting that this genus may need revision. In the Physodermataceae, Urophlyctis species cluster with a clade of Physoderma species. The algal parasite Paraphysoderma sedebokerensis nom. prov. clusters sister to other taxa in the Physodermataceae. Catenomyces persicinus, which has been classified in the Catenariaceae, groups with the Chytridiomycota rather than Blastocladiomycota. The rDNA operon seems to be suitable for classification within the Blastocladiomycota and distinguishes among genera; however, this region alone is not suitable to determine the position of the Blastocladiomycota among other basal fungal phyla with statistical support. A focused effort to find and isolate, or directly amplify DNA from additional taxa will be necessary to evaluate diversity in this phylum. We provide this rDNA phylogeny as a preliminary framework to guide further taxon and gene sampling and to facilitate future ecological, morphological, and systematic studies. PMID:21530920

  6. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

    PubMed

    Campbell, A J; Gasser, R B; Chilton, N B

    1995-03-01

    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces. PMID:7601594

  7. Development and Evaluation of a Quality-Controlled Ribosomal Sequence Database for 16S Ribosomal DNA-Based Identification of Staphylococcus Species

    PubMed Central

    Becker, Karsten; Harmsen, Dag; Mellmann, Alexander; Meier, Christian; Schumann, Peter; Peters, Georg; von Eiff, Christof

    2004-01-01

    To establish an improved ribosomal gene sequence database as part of the Ribosomal Differentiation of Microorganisms (RIDOM) project and to overcome the drawbacks of phenotypic identification systems and publicly accessible sequence databases, both strands of the 5′ end of the 16S ribosomal DNA (rDNA) of 81 type and reference strains comprising all validly described staphylococcal (sub)species were sequenced. Assuming a normal distribution for pairwise distances of all unique staphylococcal sequences and choosing a reporting criterion of ≥98.7% similarity for a “distinct species,” a statistical error probability of 1.0% was calculated. To evaluate this database, a 16S rDNA fragment (corresponding to Escherichia coli positions 54 to 510) of 55 clinical Staphylococcus isolates (including those of the small-colony variant phenotype) were sequenced and analyzed by the RIDOM approach. Of these isolates, 54 (98.2%) had a similarity score above the proposed threshold using RIDOM; 48 (87.3%) of the sequences gave a perfect match, whereas 83.6% were found by searching National Center for Biotechnology Information (NCBI) database entries. In contrast to RIDOM, which showed four ambiguities at the species level (mainly concerning Staphylococcus intermedius versus Staphylococcus delphini), the NCBI database search yielded 18 taxon-related ambiguities and showed numerous matches exhibiting redundant or unspecified entries. Comparing molecular results with those of biochemical procedures, ID 32 Staph (bioMérieux, Marcy I'Etoile, France) and VITEK 2 (bioMérieux) failed to identify 13 (23.6%) and 19 (34.5%) isolates, respectively, due to incorrect identification and/or categorization below acceptable values. In contrast to phenotypic methods and the NCBI database, the novel high-quality RIDOM sequence database provides excellent identification of staphylococci, including rarely isolated species and phenotypic variants. PMID:15528685

  8. B-Chromosome Ribosomal DNA Is Functional in the Grasshopper Eyprepocnemis plorans

    PubMed Central

    Ruiz-Estévez, Mercedes; Cabrero, Josefa; Camacho, Juan Pedro M.

    2012-01-01

    B-chromosomes are frequently argued to be genetically inert elements, but activity for some particular genes has been reported, especially for ribosomal RNA (rRNA) genes whose expression can easily be detected at the cytological level by the visualization of their phenotypic expression, i.e., the nucleolus. The B24 chromosome in the grasshopper Eyprepocnemis plorans frequently shows a nucleolus attached to it during meiotic prophase I. Here we show the presence of rRNA transcripts that unequivocally came from the B24 chromosome. To detect these transcripts, we designed primers specifically anchoring at the ITS-2 region, so that the reverse primer was complementary to the B chromosome DNA sequence including a differential adenine insertion being absent in the ITS2 of A chromosomes. PCR analysis carried out on genomic DNA showed amplification in B-carrying males but not in B-lacking ones. PCR analyses performed on complementary DNA showed amplification in about half of B-carrying males. Joint cytological and molecular analysis performed on 34 B-carrying males showed a close correspondence between the presence of B-specific transcripts and of nucleoli attached to the B chromosome. In addition, the molecular analysis revealed activity of the B chromosome rDNA in 10 out of the 13 B-carrying females analysed. Our results suggest that the nucleoli attached to B chromosomes are actively formed by expression of the rDNA carried by them, and not by recruitment of nucleolar materials formed in A chromosome nucleolar organizing regions. Therefore, B-chromosome rDNA in E. plorans is functional since it is actively transcribed to form the nucleolus attached to the B chromosome. This demonstrates that some heterochromatic B chromosomes can harbour functional genes. PMID:22570730

  9. Use of 16S Ribosomal DNA for Delineation of Marine Bacterioplankton Species

    PubMed Central

    Hagström, Åke; Pommier, Thomas; Rohwer, Forest; Simu, Karin; Stolte, Willem; Svensson, Dominika; Zweifel, Ulla Li

    2002-01-01

    All of the marine bacterioplankton-derived 16S ribosomal DNA sequences previously deposited in GenBank were reanalyzed to determine the number of bacterial species in the oceanic surface waters. These sequences have been entered into the database since 1990. The rate of new additions reached a peak in 1999 and subsequently leveled off, suggesting that much of the marine microbial species richness has been sampled. When the GenBank sequences were dereplicated by using 97% similarity as a cutoff, 1,117 unique ribotypes were found. Of the unique sequences, 609 came from uncultured environmental clones and 508 came from cultured bacteria. We conclude that the apparent bacterioplankton species richness is relatively low. PMID:12089052

  10. Phylogenetic analysis of Bambusa (Poaceae: Bambusoideae) based on internal transcribed spacer sequences of nuclear ribosomal DNA.

    PubMed

    Sun, Ye; Xia, Nianhe; Lin, Rushun

    2005-12-01

    Phylogenetic analyses of Bambusa species were performed using internal transcribed spacer sequences of nuclear ribosomal DNA. The 21 species sampled included members of Bambusa (sensu stricto), Dendrocalamopsis, Dendrocalamus, Guadua, Leleba, and Lingnania. Arundinaria gigantea was used as an outgroup. Using the maximum parsimony method with PAUP*, gaps were treated as missing states or new states. Parsimonious analysis revealed that Dendrocalamus latiflorus was closely related to the members of Dendrocalamopsis. Dendrocalamus membranaceus was a sister species to Dendrocalamus strictus. Three Dendrocalamus species were closely related to and nested in a polyphyletic Bambusa. Bambusa subaequalis was a sister species to B. multiplex, B. emeiensis to B. chungii, B. contracta to B. hainanensis, and B. flexuosa was a sister species to B. sinospinosa, B. tuldoides, B. surrecta, B. intermedia, and B. valida group, which raised doubts about the monophyly of the subgenera Bambusa (sensu stricto), Dendrocalamopsis, Leleba, and Lingnania under the genus Bambusa. PMID:16382365

  11. Ribosomal DNA phylogenies of Cyathus: is the current infrageneric classification appropriate?

    PubMed

    Zhao, Rui-Lin; Jeewon, Rajesh; Desjardin, Dennis E; Soytong, Kasem; Hyde, Kevin D

    2007-01-01

    Phylogenetic relationships within the genus Cyathus (bird's nest fungi) were investigated with neighbor joining, maximum likelihood, weighted maximum parsimony and MrBayes analyses of ITS and LSU ribosomal DNA sequences datasets. Twenty-two taxa of Cyathus were used in the analyses based primarily on type and authentic specimens. The current infrageneric classification system of Brodie recognizes seven infrageneric groups based on morphological characters, including peridium plications and variations in peridium hair anatomy, peridiole structure and fruit-body color. These groups are not supported by molecular data. Instead the ITS and LSU datasets support recognition of three infrageneric groups herein named the ollum, pallidum and striatum groups. Morphological characters useful in distinguishing these groups include basidiospore size, fruit-body coloration and peridium anatomy. Cyathus africanus var. latisporus is considered a synonym of Cyathus jiayuguanensis, and a new combination Cyathus lanatus (Brodie) R.L. Zhao is proposed based on morphological and molecular data. PMID:17883030

  12. A phylogeny of cockroaches and related insects based on DNA sequence of mitochondrial ribosomal RNA genes.

    PubMed Central

    Kambhampati, S

    1995-01-01

    Cockroaches are among the most ancient winged insects, the earliest fossils dating back to about 400 million years. Several conflicting phylogenies for cockroach families, subfamilies, and genera have been proposed in the past. In addition, the relationship of Cryptocercidae to other cockroach families and the relationship between the cockroach, Cryptocercus punctulatus, and the termite, Mastotermes darwiniensis, have generated debate. In this paper, a phylogeny for cockroaches, mantids, and termites based on DNA sequence of the mitochondrial ribosomal RNA genes is presented. The results indicated that cockroaches are a monophyletic group, whose sister group is Mantoidea. The inferred relationship among cockroach families was in agreement with the presently accepted phylogeny. However, there was only partial congruence at the subfamily and the generic levels. The phylogeny inferred here does not support a close relationship between C. punctulatus and M. darwiniensis. The apparent synapomorphies of these two species are likely a manifestation of convergent evolution because there are similarities in biology and habitat. PMID:7534409

  13. Intraspecific Variation in Ribosomal DNA in Populations of the Potato Cyst Nematode Globodera pallida.

    PubMed

    Blok, V C; Malloch, G; Harrower, B; Phillips, M S; Vrain, T C

    1998-06-01

    The relationships among a number of populations of Globodera pallida from Britian, the Netherlands, Germany, Switzerland, and South America were examined using PCR amplification of the ribosomal cistron between the 18S and 28S genes that include the two intergenic spacer regions (ITS1 and ITS2) and the 5.8S gene. Amplifications produced a similar-sized product of 1150 bp from all populations. Digestion of the amplified fragment with a number of restriction enzymes showed differences among the populations. The restriction enzyme RsaI distinguished the most populations. The RFLP patterns revealed by this enzyme were complex and could have arisen from heterogeneity between individuals within populations and from differences between the repeats of an individual. Sequence analysis from six of the populations, together with RFLP analysis of PCR products, shows that there is intraspecific variation in the rDNA of G. pallida. PMID:19274220

  14. Intraspecific Variation in Ribosomal DNA in Populations of the Potato Cyst Nematode Globodera pallida

    PubMed Central

    Blok, V. C.; Malloch, G.; Harrower, B.; Phillips, M. S.; Vrain, T. C.

    1998-01-01

    The relationships among a number of populations of Globodera pallida from Britian, the Netherlands, Germany, Switzerland, and South America were examined using PCR amplification of the ribosomal cistron between the 18S and 28S genes that include the two intergenic spacer regions (ITS1 and ITS2) and the 5.8S gene. Amplifications produced a similar-sized product of 1150 bp from all populations. Digestion of the amplified fragment with a number of restriction enzymes showed differences among the populations. The restriction enzyme RsaI distinguished the most populations. The RFLP patterns revealed by this enzyme were complex and could have arisen from heterogeneity between individuals within populations and from differences between the repeats of an individual. Sequence analysis from six of the populations, together with RFLP analysis of PCR products, shows that there is intraspecific variation in the rDNA of G. pallida. PMID:19274220

  15. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    PubMed Central

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  16. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects.

    PubMed

    Elbrecht, Vasco; Taberlet, Pierre; Dejean, Tony; Valentini, Alice; Usseglio-Polatera, Philippe; Beisel, Jean-Nicolas; Coissac, Eric; Boyer, Frederic; Leese, Florian

    2016-01-01

    Cytochrome c oxidase I (COI) is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate. PMID:27114891

  17. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    PubMed Central

    Elbrecht, Vasco; Taberlet, Pierre; Dejean, Tony; Valentini, Alice; Usseglio-Polatera, Philippe; Beisel, Jean-Nicolas; Coissac, Eric; Boyer, Frederic

    2016-01-01

    Cytochrome c oxidase I (COI) is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate. PMID:27114891

  18. Phylogeography of East Asian Lespedeza buergeri (Fabaceae) based on chloroplast and nuclear ribosomal DNA sequence variations.

    PubMed

    Jin, Dong-Pil; Lee, Jung-Hyun; Xu, Bo; Choi, Byoung-Hee

    2016-09-01

    The dynamic changes in land configuration during the Quaternary that were accompanied by climatic oscillations have significantly influenced the current distribution and genetic structure of warm-temperate forests in East Asia. Although recent surveys have been conducted, the historical migration of forest species via land bridges and, especially, the origins of Korean populations remains conjectural. Here, we reveal the genetic structure of Lespedeza buergeri, a warm-temperate shrub that is disjunctively distributed around the East China Sea (ECS) at China, Korea, and Japan. Two non-coding regions (rpl32-trnL, psbA-trnH) of chloroplast DNA (cpDNA) and the internal transcribed spacer of nuclear ribosomal DNA (nrITS) were analyzed for 188 individuals from 16 populations, which covered almost all of its distribution. The nrITS data demonstrated a genetic structure that followed geographic boundaries. This examination utilized AMOVA, comparisons of genetic differentiation based on haplotype frequency/genetic mutations among haplotypes, and Mantel tests. However, the cpDNA data showed contrasting genetic pattern, implying that this difference was due to a slower mutation rate in cpDNA than in nrITS. These results indicated frequent migration by this species via an ECS land bridge during the early Pleistocene that then tapered gradually toward the late Pleistocene. A genetic isolation between western and eastern Japan coincided with broad consensus that was suggested by the presence of other warm-temperate plants in that country. For Korean populations, high genetic diversity indicated the existence of refugia during the Last Glacial Maximum on the Korean Peninsula. However, their closeness with western Japanese populations at the level of haplotype clade implied that gene flow from western Japanese refugia was possible until post-glacial processing occurred through the Korea/Tsushima Strait land bridge. PMID:27206725

  19. Helianthus annuus ssp. texanus has chloroplast DNA and nuclear ribosomal RNA genes of Helianthus debilis ssp. cucumerifolius.

    PubMed Central

    Rieseberg, L H; Beckstrom-Sternberg, S; Doan, K

    1990-01-01

    Heiser [Heiser, C. B. (1951) Evolution 5, 42-51] hypothesized that Helianthus annuus ssp. texanus was derived by the introduction of H. annuus into Texas and subsequent introgression of genes from Helianthus debilis ssp. cucumerifolius into H. annuus. Although often considered to be one of the best cases of introgression in plants, alternative hypotheses to introgression, such as convergence or the joint retention of the ancestral condition, could not be ruled out in the original study. To test for the occurrence of introgression we examined 14 populations of H. annuus ssp. texanus, 14 allopatric populations of H. annuus, and three populations of H. debilis ssp. cucumerifolius with reference to diagnostic chloroplast DNA and nuclear ribosomal DNA markers. Thirteen of the 14 populations of H. annuus ssp. texanus had chloroplast DNA and/or ribosomal DNA markers of H. debilis ssp. cucumerifolius. In contrast, no chloroplast DNA or ribosomal DNA markers of H. debilis ssp. cucumerifolius were found in the 14 allopatric populations of H. annuus. Our findings provide strong support, therefore, for the hypothesized introgressive origin of H. annuus ssp. texanus. PMID:11607056

  20. Application of the Ribosomal DNA ITS2 Region of Physalis (Solanaceae): DNA Barcoding and Phylogenetic Study.

    PubMed

    Feng, Shangguo; Jiang, Mengying; Shi, Yujun; Jiao, Kaili; Shen, Chenjia; Lu, Jiangjie; Ying, Qicai; Wang, Huizhong

    2016-01-01

    Recently, commercial interest in Physalis species has grown worldwide due to their high nutritional value, edible fruit, and potential medicinal properties. However, many Physalis species have similar shapes and are easily confused, and consequently the phylogenetic relationships between Physalis species are poorly understood. This hinders their safe utilization and genetic resource conservation. In this study, the nuclear ribosomal ITS2 region was used to identify species and phylogenetically examine Physalis. Eighty-six ITS2 regions from 45 Physalis species were analyzed. The ITS2 sequences were aligned using Clustal W and genetic distances were calculated using MEGA V6.0. The results showed that ITS2 regions have significant intra- and inter-specific divergences, obvious barcoding gaps, and higher species discrimination rates (82.2% for both the BLASTA1 and nearest distance methods). In addition, the secondary structure of ITS2 provided another way to differentiate species. Cluster analysis based on ITS2 regions largely concurred with the relationships among Physalis species established by many previous molecular analyses, and showed that most sections of Physalis appear to be polyphyletic. Our results demonstrated that ITS2 can be used as an efficient and powerful marker in the identification and phylogenetic study of Physalis species. The technique provides a scientific basis for the conservation of Physalis plants and for utilization of resources. PMID:27486467

  1. Application of the Ribosomal DNA ITS2 Region of Physalis (Solanaceae): DNA Barcoding and Phylogenetic Study

    PubMed Central

    Feng, Shangguo; Jiang, Mengying; Shi, Yujun; Jiao, Kaili; Shen, Chenjia; Lu, Jiangjie; Ying, Qicai; Wang, Huizhong

    2016-01-01

    Recently, commercial interest in Physalis species has grown worldwide due to their high nutritional value, edible fruit, and potential medicinal properties. However, many Physalis species have similar shapes and are easily confused, and consequently the phylogenetic relationships between Physalis species are poorly understood. This hinders their safe utilization and genetic resource conservation. In this study, the nuclear ribosomal ITS2 region was used to identify species and phylogenetically examine Physalis. Eighty-six ITS2 regions from 45 Physalis species were analyzed. The ITS2 sequences were aligned using Clustal W and genetic distances were calculated using MEGA V6.0. The results showed that ITS2 regions have significant intra- and inter-specific divergences, obvious barcoding gaps, and higher species discrimination rates (82.2% for both the BLASTA1 and nearest distance methods). In addition, the secondary structure of ITS2 provided another way to differentiate species. Cluster analysis based on ITS2 regions largely concurred with the relationships among Physalis species established by many previous molecular analyses, and showed that most sections of Physalis appear to be polyphyletic. Our results demonstrated that ITS2 can be used as an efficient and powerful marker in the identification and phylogenetic study of Physalis species. The technique provides a scientific basis for the conservation of Physalis plants and for utilization of resources. PMID:27486467

  2. Hirudinella ventricosa (Pallas, 1774) Baird, 1853 represents a species complex based on ribosomal DNA.

    PubMed

    Calhoun, Dana M; Curran, Stephen S; Pulis, Eric E; Provaznik, Jennifer M; Franks, James S

    2013-10-01

    Digeneans in the genus Hirudinella de Blainville, 1828 (Hirudinellidae) from three species of pelagic fishes, Acanthocybium solandri (Cuvier), Makaira nigricans Lacépède and Thunnus albacares (Bonnaterre), and one benthic fish, Mulloidichthys martinicus (Cuvier), from the Gulf of Mexico are investigated using comparison of ribosomal DNA. Four species are identified based on molecular differences: Hirudinella ventricosa (Pallas, 1774) Baird, 1853 from A. solandri, Hirudinella ahi Yamaguti, 1970 from T. albacares, and two unidentified but distinct species of Hirudinella, herein referred to as Hirudinella sp. A (from both M. nigricans and M. martinicus) and Hirudinella sp. B from M. nigricans. Additionally, H. ahi, based tentatively on morphological identification, is reported from Thunnus thynnus (Linnaeus). This represents the first record of a hirudinellid from M. martinicus and the first record of H. ahi from T. thynnus. A phylogeny of some Hemiurata Skrjabin & Guschanskaja, 1954 using partial fragments of the 28S rDNA sequences is consistent with earlier phylogenies and the position of the Hirudinellidae Dollfus, 1932 is well-supported as a derived group most closely related to the Syncoeliidae Looss, 1899. PMID:24048751

  3. Molecular discrimination of lactobacilli used as starter and probiotic cultures by amplified ribosomal DNA restriction analysis.

    PubMed

    Roy, D; Sirois, S; Vincent, D

    2001-04-01

    Lactic acid bacteria such as Lactobacillus helveticus, L. delbrueckii subsp. delbrueckii, L. delbrueckii subsp. lactis, L. delbrueckii subsp. bulgaricus, L. acidophilus, and L. casei related taxa which are widely used as starter or probiotic cultures can be identified by amplified ribosomal DNA restriction analysis (ARDRA). The genetic discrimination of the related species belonging to these groups was first obtained by PCR amplifications by using group-specific or species-specific 16S rDNA primers. The numerical analysis of the ARDRA patterns obtained by using CfoI, HinfI, Tru9I, and ScrFI was an efficient typing tool for identification of species of the L. acidophilus and L. casei complex. ARDRA by using CfoI was a reliable method for differentiation of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. Finally, strains ATCC 393 and ATCC 15820 exhibited unique ARDRA patterns with CfoI and Tru9I restriction enzymes as compared with the other strains of L. casei, L. paracasei, and L. rhamnosus. PMID:11178730

  4. Global functional analysis of nucleophosmin in Taxol response, cancer, chromatin regulation, and ribosomal DNA transcription

    SciTech Connect

    Bergstralh, Daniel T. . E-mail: dan.bergstralh@med.unc.edu; Conti, Brian J.; Moore, Chris B.; Brickey, W. June; Taxman, Debra J.; Ting, Jenny P.-Y.

    2007-01-01

    Analysis of lung cancer response to chemotherapeutic agents showed the accumulation of a Taxol-induced protein that reacted with an anti-phospho-MEK1/2 antibody. Mass spectroscopy identified the protein as nucleophosmin/B23 (NPM), a multifunctional protein with diverse roles: ribosome biosynthesis, p53 regulation, nuclear-cytoplasmic shuttling, and centrosome duplication. Our work demonstrates that following cellular exposure to mitosis-arresting agents, NPM is phosphorylated and its chromatographic property is altered, suggesting changes in function during mitosis. To determine the functional relevance of NPM, its expression in tumor cells was reduced by siRNA. Cells with reduced NPM were treated with Taxol followed by microarray profiling accompanied by gene/protein pathway analyses. These studies demonstrate several expected and unexpected consequences of NPM depletion. The predominant downstream effectors of NPM are genes involved in cell proliferation, cancer, and the cell cycle. In congruence with its role in cancer, NPM is over-expressed in primary malignant lung cancer tissues. We also demonstrate a role for NPM in the expression of genes encoding SET (TAF1{beta}) and the histone methylase SET8. Additionally, we show that NPM is required for a previously unobserved G2/M upregulation of TAF1A, which encodes the rDNA transcription factor TAF{sub I}48. These results demonstrate multi-faceted functions of NPM that can affect cancer cells.

  5. Origin and relationships of Saintpaulia (Gesneriaceae) based on ribosomal DNA internal transcribed spacer (ITS) sequences.

    PubMed

    Moller, M; Cronk, Q

    1997-07-01

    Phylogenetic relationships of eight species of Saintpaulia H. Wendl., 19 species of Streptocarpus Lindl. (representing all major growth forms within the genus), and two outgroups (Haberlea rhodopensis Friv., Chirita spadiciformis W. T. Wang) were examined using comparative nucleotide sequences from the two internal transcribed spacers (ITS) of nuclear ribosomal DNA. The length of the ITS 1 region ranged from 228 to 249 base pairs (bp) and the ITS 2 region from 196 to 245 bp. Pairwise sequence divergence across both spacers for ingroup and outgroup species ranged from 0 to 29%. Streptocarpus is not monophyletic, and Saintpaulia is nested within Streptocarpus subgenus Streptocarpella. Streptocarpus subgenus Streptocarpus is monophyletic. The ITS sequence data demonstrate that the unifoliate Streptocarpus species form a clade, and are also characterized by a unique 47-bp deletion in ITS 2. The results strongly support the monophyly of (1) Saintpaulia, and (2) Saintpaulia plus the African members of the subgenus Streptocarpella of Streptocarpus. The data suggest the evolution of Saintpaulia from Streptocarpus subgenus Streptocarpella. The differences in flower and vegetative characters are probably due to ecological adaptation leading to a relatively rapid radiation of Saintpaulia. PMID:21708650

  6. Main airborne Ascomycota spores: characterization by culture, spore morphology, ribosomal DNA sequences and enzymatic analysis.

    PubMed

    Oliveira, Manuela; Amorim, M Isabel; Ferreira, Elsa; Delgado, Luís; Abreu, Ilda

    2010-04-01

    The aim of this work was to identify the main allergy-related Ascomycetes fungal spores present in the atmosphere of Porto, using different and complementary techniques. The atmospheric sampling, performed in the atmosphere of Porto (Portugal) from August 2006 to July 2008, indicated Cladosporium, Penicillium, Aspergillus and Alternaria as the main fungal spore taxa. Alternaria and Cladosporium peaks were registered during summer. Aspergillus and Penicillium highest values were registered from late winter to early spring. Additionally, the Andersen sampler allowed the culture and isolation of the collected viable spores subsequently used for different identification approaches. The internal-transcribed spacer region of the nuclear ribosomal repeat unit sequences of airborne Ascomycetes fungi isolates revealed 11 taxonomically related fungal species. Among the identified taxa, Penicillum and Aspergillus presented the highest diversity, while only one species of Cladosporium and Alternaria, respectively, were identified. All selected fungal spore taxa possessed phosphatase, esterase, leucine arylamidase and beta-glucosidase enzymatic activity, while none had lipase, cystine arylamidase, trypsin or beta-glucuronidase activity. The association between the spore cell wall morphology, DNA-based techniques and enzymatic activity approaches allowed a more reliable identification procedure of the airborne Ascomycota fungal spores. PMID:20143229

  7. Ribosomal DNA internal transcribed spacer analysis supports synonomy of Scedosporium inflatum and Lomentospora prolificans.

    PubMed Central

    Lennon, P A; Cooper, C R; Salkin, I F; Lee, S B

    1994-01-01

    Scedosporium inflatum is a dematiaceous opportunistic pathogen originally described by D. Malloch and I.F. Salkin (Mycotaxon 21:247-255, 1984). However, E. Gueho and G. S. De Hoog (J. Mycol. Med. 118:3-9, 1991) recently suggested reducing this mold to synonomy with Lomentospora prolificans on the basis of their similar morphological and molecular characteristics. We have investigated the ribosomal DNA internal transcribed spacers (ITS), i.e., ITS I and ITS II, of 18 isolates, including these two fungi and a closely related pathogen, Scedosporium apiospermum, and its telemorph, Pseudallescheria boydii. Identical ITS restriction fragment length polymorphisms were found in eight isolates of S. inflatum and L. prolificans. These results support Gueho and De Hoog's proposal to combine S. inflatum and L. prolificans into the binomial Scedosporium prolificans. However, the ITS I sequence of S. apiospermum and the ITS restriction fragment length polymorphisms of S. apiospermum and P. boydii were found to be significantly different from those of S. inflatum and L. prolificans. The ITS restriction pattern differences may be valuable in clinical settings for distinguishing these fungi. Images PMID:7814476

  8. Evaluation of phylogenetic relationships in Lemnaceae using nuclear ribosomal data.

    PubMed

    Tippery, N P; Les, D H; Crawford, D J

    2015-01-01

    Nuclear DNA sequence data are essential for obtaining a complete understanding of plant species relationships, yet these data have been conspicuously absent from phylogenetic analyses of Lemnaceae (duckweeds). Using a modified Sanger sequencing protocol, we obtained DNA sequences of duckweed nuclear ribosomal regions, including 18S and 26S rDNA genes, the external transcribed spacer (ETS) and the frequently used internal transcribed spacer (ITS). After obtaining sequence data for all Lemnaceae species, we ascertained that prior difficulty in sequencing the ITS regions likely resulted from extremely rigid secondary structures, precipitated by a high proportion of G/C nucleotides. In phylogenetic analyses, nuclear ribosomal data largely supported relationships that had been inferred using chloroplast DNA sequence data. PMID:24942778

  9. Characterization of Cryptocaryon irritans isolates from marine fishes in Mainland China by ITS ribosomal DNA sequences.

    PubMed

    Sun, H Y; Zhu, X Q; Xie, M Q; Wu, X Y; Li, A X; Lin, R Q; Song, H Q

    2006-07-01

    Seven isolates of Cryptocaryon irritans from different host species and geographical locations in Mainland China were characterized by the first (ITS-1) and second (ITS-2) internal transcribed spacers (ITS) of nuclear ribosomal DNA (rDNA) using two isolates of Ichthyophthirius multifiliis for comparative purposes. The rDNA region including the ITS-1, 5.8S, ITS-2, and flanking 18S and 28S sequences were amplified by polymerase chain reaction and the amplicons were sequenced directly. The ITS-1, 5.8S, and ITS-2 sequences were 129, 160, and 190 bp in length, respectively, for all seven C. irritans isolates, whereas the corresponding sequences for the two I. multifiliis isolates were 142, 153, and 194 bp, respectively. While sequence variation among the seven C. irritans isolates ranged from 0 to 1.6% in both the ITS-1 and ITS-2, and the two I. multifiliis isolates differed by 1.4% in the ITS-1 and 1.0% in the ITS-2; C. irritans differed from I. multifiliis by 57.1-60.9% in the ITS-1 and 79.4-83.0% in the ITS-2, indicating that ITS sequences provide reliable genetic markers for the identification and differentiation of the two species. Phylogenetic analysis using the sequence pairwise-distance data using the neighbor-joining method inferred that the seven C. irritans isolates from Mainland China and two other isolates (T.A and Aus.C) from other countries clustered together to show monophyly, which could be readily distinguished from the other monophyletic group all from other regions. Therefore, ITS sequence data and phylogenetic analysis provided strong support that C. irritans isolates from Mainland China represent a single species. The definition of genetic markers in the ITS rDNA provide opportunities for studying the ecology and population genetic structures of the C. irritans from Mainland China and elsewhere and is also relevant to the diagnosis and control of fish diseases they cause. PMID:16523350

  10. Pseudanoplocephala crawfordi is a member of genus Hymenolepis based on phylogenetic analysis using ribosomal and mitochondrial DNA sequences.

    PubMed

    Jia, Yan-Qing; Yan, Wen-Chao; Du, Shuai-Zhi; Song, Jun-Ke; Zhao, Wen; Zhao, Yu-Xin; Cheng, Wen-Yu; Zhao, Guang-Hui

    2016-05-01

    Pseudanoplocephala crawfordi is one of the important zoonotic cestodes causing economic significance and public health concern. In the present study, the phylogenetic position of P. crawfordi isolated from pigs was re-inferred using molecular markers of internal transcribed spacer ribosomal DNA (ITS rDNA) and partial NADH dehydrogenase subunit 1 (pnad1) mitochondrial DNA. The lengths of ITS1, ITS2 rDNA and pnad1 were 757 bp, 628 bp and 458 bp, respectively. Sequence differences in the ITS1, ITS2 rDNA and pnad1 between P. crawfordi and Hymenolepis species were smaller than that between cestodes within genus Hymenolepis. Phylogenetic analyses based on three gene fragments showed that P. crawfordi was grouped into cluster of Hymenolepis species. These results suggested that P. crawfordi would be one member of genus Hymenolepis but not in a new genus Pseudanoplocephala. PMID:25211088

  11. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

    PubMed

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

    2012-05-25

    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). PMID:22136768

  12. Non-random expression of ribosomal DNA units in a grasshopper showing high intragenomic variation for the ITS2 region.

    PubMed

    Ruiz-Estévez, M; Ruiz-Ruano, F J; Cabrero, J; Bakkali, M; Perfectti, F; López-León, M D; Camacho, J P M

    2015-06-01

    We analyse intragenomic variation of the ITS2 internal transcribed spacer of ribosomal DNA (rDNA) in the grasshopper Eyprepocnemis plorans, by means of tagged PCR 454 amplicon sequencing performed on both genomic DNA (gDNA) and RNA-derived complementary DNA (cDNA), using part of the ITS2 flanking coding regions (5.8S and 28S rDNA) as an internal control for sequencing errors. Six different ITS2 haplotypes (i.e. variants for at least one nucleotide in the complete ITS2 sequence) were found in a single population, one of them (Hap4) being specific to a supernumerary (B) chromosome. The analysis of both gDNA and cDNA from the same individuals provided an estimate of the expression efficiency of the different haplotypes. We found random expression (i.e. about similar recovery in gDNA and cDNA) for three haplotypes (Hap1, Hap2 and Hap5), but significant underexpression for three others (Hap3, Hap4 and Hap6). Hap4 was the most extremely underexpressed and, remarkably, it showed the lowest sequence conservation for the flanking 5.8-28S coding regions in the gDNA reads but the highest conservation (100%) in the cDNA ones, suggesting the preferential expression of mutation-free rDNA units carrying this ITS2 haplotype. These results indicate that the ITS2 region of rDNA is far from complete homogenization in this species, and that the different rDNA units are not expressed at random, with some of them being severely downregulated. PMID:25565136

  13. Ribosomal DNA clusters and telomeric (TTAGG)n repeats in blue butterflies (Lepidoptera, Lycaenidae) with low and high chromosome numbers

    PubMed Central

    Vershinina, Alisa O.; Anokhin, Boris A.; Lukhtanov, Vladimir A.

    2015-01-01

    Abstract Ribosomal DNA clusters and telomeric repeats are important parts of eukaryotic genome. However, little is known about their organization and localization in karyotypes of organisms with holocentric chromosomes. Here we present first cytogenetic study of these molecular structures in seven blue butterflies of the genus Polyommatus Latreille, 1804 with low and high chromosome numbers (from n=10 to n=ca.108) using fluorescence in situ hybridization (FISH) with 18S rDNA and (TTAGG)n telomeric probes. FISH with the 18S rDNA probe showed the presence of two different variants of the location of major rDNA clusters in Polyommatus species: with one or two rDNA-carrying chromosomes in haploid karyotype. We discuss evolutionary trends and possible mechanisms of changes in the number of ribosomal clusters. We also demonstrate that Polyommatus species have the classical insect (TTAGG)n telomere organization. This chromosome end protection mechanism probably originated de novo in small chromosomes that evolved via fragmentations. PMID:26140159

  14. Advantages and limitations of ribosomal RNA PCR and DNA sequencing for identification of bacteria in cardiac valves of danish patients.

    PubMed

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne; Schmidt, Thomas Andersen; Christensen, John; Irmukhamedov, Akhmadjon 6; Bruun, Niels Eske; Dargis, Rimtas; Andresen, Keld; Christensen, Jens Jørgen

    2013-01-01

    Studies on the value of culture-independent molecular identification of bacteria in cardiac valves are mostly restricted to comparing agreement of identification to what is obtained by culture to the number of identified bacteria in culture-negative cases. However, evaluation of the usefulness of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent DNA sequencing is an efficient and reliable method of identifying the cause of IE, but exact species identification of some of the most common causes, i.e. non-haemolytic streptococci, may be improved with other molecular methods. PMID:24403979

  15. Conversion of Topoisomerase I Cleavage Complexes on the Leading Strand of Ribosomal DNA into 5′-Phosphorylated DNA Double-Strand Breaks by Replication Runoff

    PubMed Central

    Strumberg, Dirk; Pilon, André A.; Smith, Melanie; Hickey, Robert; Malkas, Linda; Pommier, Yves

    2000-01-01

    Topoisomerase I cleavage complexes can be induced by a variety of DNA damages and by the anticancer drug camptothecin. We have developed a ligation-mediated PCR (LM-PCR) assay to analyze replication-mediated DNA double-strand breaks induced by topoisomerase I cleavage complexes in human colon carcinoma HT29 cells at the nucleotide level. We found that conversion of topoisomerase I cleavage complexes into replication-mediated DNA double-strand breaks was only detectable on the leading strand for DNA synthesis, which suggests an asymmetry in the way that topoisomerase I cleavage complexes are metabolized on the two arms of a replication fork. Extension by Taq DNA polymerase was not required for ligation to the LM-PCR primer, indicating that the 3′ DNA ends are extended by DNA polymerase in vivo closely to the 5′ ends of the topoisomerase I cleavage complexes. These findings suggest that the replication-mediated DNA double-strand breaks generated at topoisomerase I cleavage sites are produced by replication runoff. We also found that the 5′ ends of these DNA double-strand breaks are phosphorylated in vivo, which suggests that a DNA 5′ kinase activity acts on the double-strand ends generated by replication runoff. The replication-mediated DNA double-strand breaks were rapidly reversible after cessation of the topoisomerase I cleavage complexes, suggesting the existence of efficient repair pathways for removal of topoisomerase I-DNA covalent adducts in ribosomal DNA. PMID:10805740

  16. A phylogenetic study on galactose-containing Candida species based on 18S ribosomal DNA sequences.

    PubMed

    Suzuki, Motofumi; Suh, Sung-Oui; Sugita, Takashi; Nakase, Takashi

    1999-10-01

    Phylogenetic relationships of 33 Candida species containing galactose in the cells were investigated by using 18S ribosomal DNA sequence analysis. Galactose-containing Candida species and galactose-containing species from nine ascomycetous genera were a heterogeneous assemblage. They were divided into three clusters (II, III, and IV) which were phylogenetically distant from cluster I, comprising 9 galactose-lacking Candida species, C. glabrata, C. holmii, C. krusei, C. tropicalis (the type species of Candida), C. albicans, C. viswanathii, C. maltosa, C. parapsilosis, C. guilliermondii, and C. lusitaniae, and 17 related ascomycetous yeasts. These three clusters were also phylogenetically distant from Schizosaccharomyces pombe, which contains galactomannan in its cell wall. Cluster II comprised C. magnoliae, C. vaccinii, C. apis, C. gropengiesseri, C. etchellsii, C. floricola, C. lactiscondensi, Wickerhamiella domercqiae, C. versatilis, C. azyma, C. vanderwaltii, C. pararugosa, C. sorbophila, C. spandovensis, C. galacta, C. ingens, C. incommunis, Yarrowia lipolytica, Galactomyces geotrichum, and Dipodascus albidus. Cluster III comprised C. tepae, C. antillancae and its synonym C. bondarzewiae, C. ancudensis, C. petrohuensis, C. santjacobensis, C. ciferrii (anamorph of Stephanoascus ciferrii), Arxula terrestris, C. castrensis, C. valdiviana, C. paludigena, C. blankii, C. salmanticensis, C. auringiensis, C. bertae, and its synonym C. bertae var. chiloensis, C. edax (anamorph of Stephanoascus smithiae), Arxula adeninivorans, and C. steatolytica (synonym of Zygoascus hellenicus). Cluster IV comprised C. cantarellii, C. vinaria, Dipodascopsis uninucleata, and Lipomyces lipofer. Two galactose-lacking and Q-8-forming species, C. stellata and Pichia pastoris, and 5 galactose-lacking and Q-9-forming species, C. apicola, C. bombi, C. bombicola, C. geochares, and C. insectalens, were included in Cluster II. Two galactose-lacking and Q-9-forming species, C. drimydis and C

  17. Use of Quantitative 16S Ribosomal DNA Detection for Diagnosis of Central Vascular Catheter-Associated Bacterial Infection

    PubMed Central

    Warwick, S.; Wilks, M.; Hennessy, E.; Powell-Tuck, J.; Small, M.; Sharp, J.; Millar, M. R.

    2004-01-01

    Many central vascular catheters (CVCs) are removed unnecessarily because current diagnostic methods for CVC-associated infection are unreliable. A quantitative PCR assay using primers and probe targeted to bacterial 16S ribosomal DNA was used to measure the levels of bacterial DNA in blood samples drawn through the CVC in a population of patients receiving intravenous nutrition. Bacterial DNA concentrations were raised in 16 of 16 blood samples taken during episodes of probable bacterial CVC-associated infection. Bacterial DNA concentrations were raised in 4 of 29 episodes in which bacterial CVC-associated infection was unlikely. The use of this technique has the potential to substantially reduce the unnecessary removal of CVCs. PMID:15070980

  18. Seasonal Succession Leads to Habitat-Dependent Differentiation in Ribosomal RNA:DNA Ratios among Freshwater Lake Bacteria

    PubMed Central

    Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; Schmidt, Marian L.

    2016-01-01

    Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors. PMID:27199936

  19. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    DOE PAGESBeta

    Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; Schmidt, Marian L.

    2016-04-29

    Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less

  20. Decreased ribosomal DNA transcription in dorsal raphe nucleus neurons is specific for suicide regardless of psychiatric diagnosis.

    PubMed

    Krzyżanowska, Marta; Steiner, Johann; Brisch, Ralf; Mawrin, Christian; Busse, Stefan; Karnecki, Karol; Jankowski, Zbigniew; Gos, Tomasz

    2016-07-30

    The dorsal raphe nucleus (DRN) is the main source of serotonergic innervation of forebrain limbic structures disturbed in suicidal behaviour. We have evaluated the transcriptional activity of ribosomal DNA (rDNA) in DRN neurons by AgNOR silver staining method. The cohort (containing 24 suicidal and 20 non-suicidal patients, and 28 controls) was previously analysed regarding diagnosis-related differences between schizophrenia and affective disorders. Significant decreases in both AgNOR and nuclear areas suggestive of attenuated rDNA activity were currently found in suicidal versus non-suicidal patients. This effect, which was more accentuated in affective disorders patients, was not explained by antidepressant and antipsychotic medication. PMID:27155286

  1. Comparison of Sequences from the Ribosomal DNA Intergenic Region of Meloidogyne mayaguensis and Other Major Tropical Root-Knot Nematodes

    PubMed Central

    Blok, V. C.; Phillips, M. S.; Fargette, M.

    1997-01-01

    The unusual arrangement of the 5S ribosomal gene within the intergenic sequence (IGS) of the ribosomal cistron, previously reported for Meloidogyne arenaria, was also found in the ribosomal DNA of two other economically important species of tropical root-knot nematodes, M, incognita and M. javanica. This arrangement also was found in M. hapla, which is important in temperate regions, and M. mayaguensis, a virulent species of concern in West Africa. Amplification of the region between the 5S and 18S genes by PCR yielded products of three different sizes such that M. mayaguensis could be readily differentiated from the other species in this study. This product can be amplified from single juveniles, females, or egg masses. The sequences obtained in this region for one line of each of M. incognita, M. arenaria, and M. javanica were very similar, reflecting the close relationships of these lineages. The M. mayaguensis sequence for this region had a number of small deletions and insertions of various sizes, including possible sequence duplications. PMID:19274129

  2. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  3. Loss of Nucleolar Histone Chaperone NPM1 Triggers Rearrangement of Heterochromatin and Synergizes with a Deficiency in DNA Methyltransferase DNMT3A to Drive Ribosomal DNA Transcription*

    PubMed Central

    Holmberg Olausson, Karl; Nistér, Monica; Lindström, Mikael S.

    2014-01-01

    Nucleoli are prominent nuclear structures assembled and organized around actively transcribed ribosomal DNA (rDNA). The nucleolus has emerged as a platform for the organization of chromatin enriched for repressive histone modifications associated with repetitive DNA. NPM1 is a nucleolar protein required for the maintenance of genome stability. However, the role of NPM1 in nucleolar chromatin dynamics and ribosome biogenesis remains unclear. We found that normal fibroblasts and cancer cells depleted of NPM1 displayed deformed nucleoli and a striking rearrangement of perinucleolar heterochromatin, as identified by immunofluorescence staining of trimethylated H3K9, trimethylated H3K27, and heterochromatin protein 1γ (HP1γ/CBX3). By co-immunoprecipitation we found NPM1 associated with HP1γ and core and linker histones. Moreover, NPM1 was required for efficient tethering of HP1γ-enriched chromatin to the nucleolus. We next tested whether the alterations in perinucleolar heterochromatin architecture correlated with a difference in the regulation of rDNA. U1242MG glioma cells depleted of NPM1 presented with altered silver staining of nucleolar organizer regions, coupled to a modest decrease in H3K9 di- and trimethylation at the rDNA promoter. rDNA transcription and cell proliferation were sustained in these cells, indicating that altered organization of heterochromatin was not secondary to inhibition of rDNA transcription. Furthermore, knockdown of DNA methyltransferase DNMT3A markedly enhanced rDNA transcription in NPM1-depleted U1242MG cells. In summary, this study highlights a function of NPM1 in the spatial organization of nucleolus-associated heterochromatin. PMID:25349213

  4. [RIBOSOMAL DNA INTERNAL TRANSCRIBED SPACER 2 SEQUENCE AS A PHYLOGENETIC MARKER FOR THE IDENTIFICATION OF TRICHINELLA NEMATODES].

    PubMed

    Odoyevskaya, I M; Spiridonov, S E

    2015-01-01

    The results of testing several primer combinations were used to choose an optimal pair for the amplification of the internal transcribed spacer 2 (ITS2) region of ribosomal DNA (direct: Tri58s F 5 CGG TGG ATC RCT TGG CTC GTA CG and reverse: AB28 Rr (CGA CCG CTT ATT GAT ATG C). This pair of primers yields a 900 bp PCR product. Comparative analysis of obtained ITS2 sequences, for 8 Trichinella isolates from different regions of the Russian Federation permits different species and individual genotypes of these parasitic nematodes to be validly distinguished. PMID:26152035

  5. Evaluation of DNA encoding acidic ribosomal protein P2 of Cryptosporidium parvum as a potential vaccine candidate for cryptosporidiosis

    PubMed Central

    Benitez, Alvaro; Priest, Jeffrey W.; Ehigiator, Humphrey N.; McNair, Nina; Mead, Jan R.

    2011-01-01

    The Cryptosporidium parvum acidic ribosomal protein P2 (CpP2) is an important immunodominant marker in C. parvum infection. In this study, the CpP2 antigen was evaluated as a vaccine candidate using a DNA vaccine model in adult C57BL/6 IL-12 knockout (KO) mice, which are susceptible to C. parvum infection. Our data show that subcutaneous immunization in the ear with DNA encoding CpP2 (CpP2-DNA) cloned into the pUMVC4b vector induced a significant anti-CpP2 IgG antibody response that was predominantly of the IgG1 isotype. Compared to control KO mice immunized with plasmid alone, CpP2-immunized mice demonstrated specific in vitro spleen cell proliferation as well as enhanced IFN-γ production to recombinant CpP2. Further, parasite loads in CpP2 DNA-immunized mice were compared to control mice challenged with C. parvum oocysts. Although a trend in reduction of infection was observed in the CpP2 DNA-immunized mice, differences between groups were not statistically significant. These results suggest that a DNA vaccine encoding the C. parvum P2 antigen is able to provide an effective means of eliciting humoral and cellular responses and has the potential to generate protective immunity against C. parvum infection but may require using alternative vectors or adjuvant to generate a more potent and balanced response. PMID:21968447

  6. A ribosomal protein gene cluster is encoded in the mitochondrial DNA of Dictyostelium discoideum: UGA termination codons and similarity of gene order to Acanthamoeba castellanii.

    PubMed

    Iwamoto, M; Pi, M; Kurihara, M; Morio, T; Tanaka, Y

    1998-04-01

    We sequenced a region of about 14.5 kb downstream from the ribosomal protein L11 gene (rpl11) in the mitochondrial DNA (54+/-2 kb) of the cellular slime mold Dictyostelium discoideum. Sequence analysis revealed that eleven ribosomal protein genes and six open reading frames (ORFs) formed a cluster arranged in the order: rpl11-orf189-rps12-rps7-rpl2-rps19-+ ++orf425-orf1740-rpl16-rpl14-orf188- rps14-rps8-rpl6-rps13-orf127-orf796. This order was very similar to that of homologous genes in Acanthamoeba castellanii mitochondrial DNA. The N-terminal region of ORF425 and the C-terminal region of ORF1740 had partial similarities to the S3 ribosomal protein of other organisms. The termination codons of rpl16 and orf188 were UGA, which has not hitherto been found in genes encoded in D. discoideum mitochondrial DNA. PMID:9560439

  7. Bacterial Diversity and Community Structure in an Aerated Lagoon Revealed by Ribosomal Intergenic Spacer Analyses and 16S Ribosomal DNA Sequencing

    PubMed Central

    Yu, Zhongtang; Mohn, William W.

    2001-01-01

    We investigated the bacterial community structure in an aerated plug-flow lagoon treating pulp and paper mill effluent. For this investigation, we developed a composite method based on analyses of PCR amplicons containing the ribosomal intergenic spacer (RIS) and its flanking partial 16S rRNA gene. Community percent similarity was determined on the basis of RIS length polymorphism. A community succession was evident in the lagoon, indicated by a progressive community transition through seven sample locations. The most abrupt changes in community structure were associated with a temperature change from 39 to 35°C and with increases in dissolved oxygen. The temporal differences in community structure, based on summer and winter samplings, were greater than the spatial differences during either season. Clone libraries of rDNA-RIS amplicons were constructed from each of three summer samples. Among 90 clones analyzed (30 clones from each sample), 56 phylotypes were distinguished by restriction fragment length polymorphism. Indices of phylotype richness, evenness, and diversity all increased in clone libraries from the beginning to the end of the lagoon. A representative clone of each phylotype was phylogenetically analyzed on the basis of its partial 16S rRNA gene sequence (ca. 450 bp). Phylogenetic analysis confirmed the increase in diversity and further indicated increasing richness of bacterial divisions. Pioneers in the community spatial succession appeared to include thermotolerant, microaerophilic methanol-oxidizing bacteria related to the genus Methylobacillus, as well as thermotolerant, microaerophilic nitrogen-fixing bacteria related to the genus Azospirillum. PMID:11282606

  8. Phylogeny of the Sphaerotilus-Leptothrix group inferred from morphological comparisons, genomic fingerprinting, and 16S ribosomal DNA sequence analyses.

    PubMed

    Siering, P L; Ghiorse, W C

    1996-01-01

    Phase-contrast light microscopy revealed that only one of eight cultivated strains belonging to the Sphaerotilus-Leptothrix group of sheathed bacteria actually produced a sheath in standard growth media. Two Sphaerotilus natans strains produced branched cells, but other morphological characteristics that were used to identify these bacteria were consistent with previously published descriptions. Genomic fingerprints, which were obtained by performing PCR amplification with primers corresponding to enterobacterial repetitive intergenic consensus sequences, were useful for distinguishing between the genera Sphaerotilus and Leptothrix, as well as among individual strains. The complete 16S ribosomal DNA (rDNA) sequences of two strains of "Leptothrix discophora" (strains SP-6 and SS-1) were determined. In addition, partial sequences (approximately 300 nucleotides) of one strain of Leptothrix cholodnii (strain LMG 7171), an unidentified Leptothrix strain (strain NC-1), and four strains of Sphaerotilus natans (strains ATCC 13338T [T = type strain], ATCC 15291, ATCC 29329, and ATCC 29330) were determined. We found that two of the S. natans strains (ATCC 15291 and ATCC 13338T), which differed in morphology and in their genomic fingerprints, had identical sequences in the 300-nucleotide region sequenced. Both parsimony and distance matrix methods were used to infer the evolutionary relationships of the eight strains in a comparison of the 16S rDNA sequences of these organisms with 16S rDNA sequences obtained from ribosomal sequence databases. All of the strains clustered in the Rubrivivax subdivision of the beta subclass of the Proteobacteria, which confirmed previously published conclusions concerning selected individual strains. Additional analyses revealed that all of the S. natans strains clustered in one closely related group, while the Leptothrix strains clustered in two separate lineages that were approximately equidistant from the S. natans cluster. This finding

  9. Ribosomal DNA organization patterns within the dinoflagellate genus Alexandrium as revealed by FISH: life cycle and evolutionary implications.

    PubMed

    Figueroa, Rosa Isabel; Cuadrado, Angeles; Stüken, Anke; Rodríguez, Francisco; Fraga, Santiago

    2014-05-01

    Dinoflagellates are a group of protists whose genome differs from that of other eukaryotes in terms of size (contains up to 250pg per haploid cell), base composition, chromosomal organization, and gene expression. But rDNA gene mapping of the active nucleolus in this unusual eukaryotic genome has not been carried out thus far. Here we used FISH in dinoflagellate species belonging to the genus Alexandrium (genome sizes ranging from 21 to 170 pg of DNA per haploid genome) to localize the sequences encoding the 18S, 5.8S, and 28S rRNA genes. The results can be summarized as follows: 1) Each dinoflagellate cell contains only one active nucleolus, with no hybridization signals outside it. However, the rDNA organization varies among species, from repetitive clusters forming discrete nuclear organizer regions (NORs) in some to specialized "ribosomal chromosomes" in other species. The latter chromosomes, never reported before in other eukaryotes, are mainly formed by rDNA genes and appeared in the species with the highest DNA content. 2) Dinoflagellate chromosomes are first characterized by several eukaryotic features, such as structural differentiation (centromere-like constrictions), size differences (dot chromosomes), and SAT (satellite) chromosomes. 3) NOR patterns prove to be useful in discriminating between cryptic species and life cycle stages in protists. PMID:24846057

  10. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  11. Regulation of p53 translation and induction after DNA damage by ribosomal protein L26 and nucleolin.

    PubMed

    Takagi, Masatoshi; Absalon, Michael J; McLure, Kevin G; Kastan, Michael B

    2005-10-01

    Increases in p53 protein levels after DNA damage have largely been attributed to an increase in the half-life of p53 protein. Here we demonstrate that increased translation of p53 mRNA is also a critical step in the induction of p53 protein in irradiated cells. Ribosomal protein L26 (RPL26) and nucleolin were found to bind to the 5' untranslated region (UTR) of p53 mRNA and to control p53 translation and induction after DNA damage. RPL26 preferentially binds to the 5'UTR after DNA damage, and its overexpression enhances association of p53 mRNA with heavier polysomes, increases the rate of p53 translation, induces G1 cell-cycle arrest, and augments irradiation-induced apoptosis. Opposite effects were seen when RPL26 expression was inhibited. In contrast, nucleolin overexpression suppresses p53 translation and induction after DNA damage, whereas nucleolin downregulation promotes p53 expression. These findings demonstrate the importance of increased translation of p53 in DNA-damage responses and suggest critical roles for RPL26 and nucleolin in affecting p53 induction. PMID:16213212

  12. Polymorphism at the ribosomal DNA spacers and its relation to breeding structure of the widespread mushroom Schizophyllum commune.

    PubMed Central

    James, T Y; Moncalvo, J M; Li, S; Vilgalys, R

    2001-01-01

    The common split-gilled mushroom Schizophyllum commune is found throughout the world on woody substrates. This study addresses the dispersal and population structure of this fungal species by studying the phylogeny and evolutionary dynamics of ribosomal DNA (rDNA) spacer regions. Extensive sampling (n = 195) of sequences of the intergenic spacer region (IGS1) revealed a large number of unique haplotypes (n = 143). The phylogeny of these IGS1 sequences revealed strong geographic patterns and supported three evolutionarily distinct lineages within the global population. The same three geographic lineages were found in phylogenetic analysis of both other rDNA spacer regions (IGS2 and ITS). However, nested clade analysis of the IGS1 phylogeny suggested the population structure of S. commune has undergone recent changes, such as a long distance colonization of western North America from Europe as well as a recent range expansion in the Caribbean. Among all spacer regions, variation in length and nucleotide sequence was observed between but not within the tandem rDNA repeats (arrays). This pattern is consistent with strong within-array and weak among-array homogenizing forces. We present evidence for the suppression of recombination between rDNA arrays on homologous chromosomes that may account for this pattern of concerted evolution. PMID:11139499

  13. Systematics of Chaetognatha under the light of molecular data, using duplicated ribosomal 18S DNA sequences.

    PubMed

    Papillon, Daniel; Perez, Yvan; Caubit, Xavier; Le Parco, Yannick

    2006-03-01

    While the phylogenetic position of Chaetognatha has became central to the question of early bilaterian evolution, the internal systematics of the phylum are still not clear. The phylogenetic relationships of the chaetognaths were investigated using newly obtained small subunit ribosomal RNA nuclear 18S (SSU rRNA) sequences from 16 species together with 3 sequences available in GenBank. As previously shown with the large subunit ribosomal RNA 28S gene, two classes of Chaetognatha SSU rRNA gene can be identified, suggesting a duplication of the whole ribosomal cluster; allowing the rooting of one class of genes by another in phylogenetic analyses. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the molecular data, and statistical tests showed (1) that there are three main monophyletic groups: Sagittidae/Krohnittidae, Spadellidae/Pterosagittidae, and Eukrohniidae/Heterokrohniidae, (2) that the group of Aphragmophora without Pterosagittidae (Sagittidae/Krohnittidae) is monophyletic, (3) the Spadellidae/Pterosagittidae and Eukrohniidae/Heterokrohniidae families are very likely clustered, (4) the Krohnittidae and Pterosagittidae groups should no longer be considered as families as they are included in other groups designated as families, (5) suborder Ctenodontina is not monophyletic and the Flabellodontina should no longer be considered as a suborder, and (6) the Syngonata/Chorismogonata and the Monophragmophora/Biphragmophora hypotheses are rejected. Such conclusions are considered in the light of morphological characters, several of which are shown to be prone to homoplasy. PMID:16434216

  14. Nuclear Ribosomal DNA Variation and Pathogenic Specialization in Alternaria Fungi Known To Produce Host-Specific Toxins †

    PubMed Central

    Kusaba, Motoaki; Tsuge, Takashi

    1994-01-01

    A total of 99 strains of 11 Alternaria species, including 68 strains of seven fungi known to produce host-specific toxins, were subjected to analysis of restriction fragment length polymorphism (RFLP) in nuclear ribosomal DNA (rDNA). Total DNA was digested with XbaI, and the Southern blots were probed with a nuclear rDNA clone of Alternaria kikuchiana. The hybridization gave 17 different RFLPs from the 99 strains. On the basis of these RFLPs, populations of host-specific toxin-producing fungi could not be differentiated from one another nor from nonpathogenic A. alternata. Each population of the toxin-producing fungi carried rDNA variants. Nine different types, named A1 to A6 and B1 to B3, were detected among the toxin-producing fungi and nonpathogenic A. alternata. All of the populations contained the type A4 variant, and the other rDNA types were also shared by different toxin-producing fungi and A. alternata. In contrast, Alternaria species that are morphologically distinguishable from A. alternata could be differentiated from A. alternata on the basis of the rDNA RFLPs. Polymorphisms in rDNA digested with HaeIII and MspI were also evaluated in 61 Alternaria strains. These restriction enzymes produced 31 variations among all of the samples. The seven toxin-producing fungi and nonpathogenic A. alternata could not be resolved by phylogenetic analysis based on the RFLPs, although they could be differentiated from the other Alternaria species studied. These results provide support for the hypothesis that Alternaria fungi known to produce host-specific toxins are intraspecific variants of A. alternata specialized in pathogenicity. Images PMID:16349367

  15. Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing

    PubMed Central

    Lagacé, L.; Pitre, M.; Jacques, M.; Roy, D.

    2004-01-01

    The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the γ- and β-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). γ-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control. PMID:15066796

  16. Genetic Differentiation and Hybridization Among Festuca Idahoensis, F. Roemeri, and F. Ovina Detected From AFLP, ITS, and Chloroplast DNA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    North American forms of the F. ovina complex, Festuca idahoensis and F. roemert are distributed broadly east and narrowly west of the Cascade Mountains, respectively. The psbA-trnH and rps16-trnK chloroplast DNA intergenic sequences, 18S-5.8S-26S nuclear ribosomal DNA internal transcribed spacer (I...

  17. Identification of Aspergillus fumigatus and Related Species by Nested PCR Targeting Ribosomal DNA Internal Transcribed Spacer Regions

    PubMed Central

    Zhao, Jun; Kong, Fanrong; Li, Ruoyu; Wang, Xiaohong; Wan, Zhe; Wang, Duanli

    2001-01-01

    Aspergillus fumigatus is the most common species that causes invasive aspergillosis. In order to identify A. fumigatus, partial ribosomal DNA (rDNA) from two to six strains of five different Aspergillus species was sequenced. By comparing sequence data from GenBank, we designed specific primer pairs targeting rDNA internal transcribed spacer (ITS) regions of A. fumigatus. A nested PCR method for identification of other A. fumigatus-related species was established by using the primers. To evaluate the specificities and sensitivities of those primers, 24 isolates of A. fumigatus and variants, 8 isolates of Aspergillus nidulans, 7 isolates of Aspergillus flavus and variants, 8 isolates of Aspergillus terreus, 9 isolates of Aspergillus niger, 1 isolate each of Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus versicolor, Aspergillus wangduanlii, Aspergillus qizutongii, Aspergillus beijingensis, and Exophiala dermatitidis, 4 isolates of Candida, 4 isolates of bacteria, and human DNA were used. The nested PCR method specifically identified the A. fumigatus isolates and closely related species and showed a high degree of sensitivity. Additionally, four A. fumigatus strains that were recently isolated from our clinic were correctly identified by this method. Our results demonstrate that these primers are useful for the identification of A. fumigatus and closely related species in culture and suggest further studies for the identification of Aspergillus fumigatus species in clinical specimens. PMID:11376067

  18. Decreased ribosomal DNA transcription in dorsal raphe nucleus neurons differentiates between suicidal and non-suicidal death.

    PubMed

    Krzyżanowska, Marta; Steiner, Johann; Karnecki, Karol; Kaliszan, Michał; Brisch, Ralf; Wiergowski, Marek; Braun, Katharina; Jankowski, Zbigniew; Gos, Tomasz

    2016-04-01

    An involvement of the central serotonergic system has been implicated in the pathogenesis of suicide. The dorsal raphe nucleus (DRN) is the main source of serotonergic innervation of forebrain limbic structures disturbed in suicidal behaviour. The study was carried out on paraffin-embedded brainstem blocks containing the DRN obtained from 27 suicide completers (predominantly violent) with unknown psychiatric diagnosis and 30 non-suicidal controls. The transcriptional activity of ribosomal DNA (rDNA) in DRN neurons as a surrogate marker of protein biosynthesis was evaluated by the AgNOR silver staining method. Significant decreases in AgNOR parameters suggestive of attenuated rDNA activity were found in the cumulative analysis of all DRN subnuclei in suicide victims versus controls (U test P values < 0.00001). Our findings suggest that the decreased activity of rDNA transcription in DRN neurons plays an important role in suicide pathogenesis. The method accuracy represented by the area under receiver operating characteristic curve (>80 %) suggests a diagnostic value of the observed effect. However, the possible application of the method in forensic differentiation diagnostics between suicidal and non-suicidal death needs further research. PMID:26590846

  19. A nuclear ribosomal DNA pseudogene in triatomines opens a new research field of fundamental and applied implications in Chagas disease

    PubMed Central

    Zuriaga, María Angeles; Mas-Coma, Santiago; Bargues, María Dolores

    2015-01-01

    A pseudogene, designated as "ps(5.8S+ITS-2)", paralogous to the 5.8S gene and internal transcribed spacer (ITS)-2 of the nuclear ribosomal DNA (rDNA), has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2)" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2)" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control. PMID:25760450

  20. Ribosomal DNA Sequencing for Identification of Aerobic Gram-Positive Rods in the Clinical Laboratory (an 18-Month Evaluation)

    PubMed Central

    Bosshard, P. P.; Abels, S.; Zbinden, R.; Böttger, E. C.; Altwegg, M.

    2003-01-01

    We have evaluated over a period of 18 months the use of 16S ribosomal DNA (rDNA) sequence analysis as a means of identifying aerobic gram-positive rods in the clinical laboratory. Two collections of strains were studied: (i) 37 clinical strains of gram-positive rods well identified by phenotypic tests, and (ii) 136 clinical isolates difficult to identify by standard microbiological investigations, i.e., identification at the species level was impossible. Results of molecular analyses were compared with those of conventional phenotypic identification procedures. Good overall agreement between phenotypic and molecular identification procedures was found for the collection of 37 clinical strains well identified by conventional means. For the 136 clinical strains which were difficult to identify by standard microbiological investigations, phenotypic characterization identified 71 of 136 (52.2%) isolates at the genus level; 65 of 136 (47.8%) isolates could not be discriminated at any taxonomic level. In comparison, 16S rDNA sequencing identified 89 of 136 (65.4%) isolates at the species level, 43 of 136 (31.6%) isolates at the genus level, and 4 of 136 (2.9%) isolates at the family level. We conclude that (i) rDNA sequencing is an effective means for the identification of aerobic gram-positive rods which are difficult to identify by conventional techniques, and (ii) molecular identification procedures are not required for isolates well identified by phenotypic investigations. PMID:12958237

  1. A pathogenic non-coding RNA induces changes in dynamic DNA methylation of ribosomal RNA genes in host plants.

    PubMed

    Martinez, German; Castellano, Mayte; Tortosa, Maria; Pallas, Vicente; Gomez, Gustavo

    2014-02-01

    Viroids are plant-pathogenic non-coding RNAs able to interfere with as yet poorly known host-regulatory pathways and to cause alterations recognized as diseases. The way in which these RNAs coerce the host to express symptoms remains to be totally deciphered. In recent years, diverse studies have proposed a close interplay between viroid-induced pathogenesis and RNA silencing, supporting the belief that viroid-derived small RNAs mediate the post-transcriptional cleavage of endogenous mRNAs by acting as elicitors of symptoms expression. Although the evidence supporting the role of viroid-derived small RNAs in pathogenesis is robust, the possibility that this phenomenon can be a more complex process, also involving viroid-induced alterations in plant gene expression at transcriptional levels, has been considered. Here we show that plants infected with the 'Hop stunt viroid' accumulate high levels of sRNAs derived from ribosomal transcripts. This effect was correlated with an increase in the transcription of ribosomal RNA (rRNA) precursors during infection. We observed that the transcriptional reactivation of rRNA genes correlates with a modification of DNA methylation in their promoter region and revealed that some rRNA genes are demethylated and transcriptionally reactivated during infection. This study reports a previously unknown mechanism associated with viroid (or any other pathogenic RNA) infection in plants providing new insights into aspects of host alterations induced by the viroid infectious cycle. PMID:24178032

  2. Factors That Affect Large Subunit Ribosomal DNA Amplicon Sequencing Studies of Fungal Communities: Classification Method, Primer Choice, and Error

    PubMed Central

    Porter, Teresita M.; Golding, G. Brian

    2012-01-01

    Nuclear large subunit ribosomal DNA is widely used in fungal phylogenetics and to an increasing extent also amplicon-based environmental sequencing. The relatively short reads produced by next-generation sequencing, however, makes primer choice and sequence error important variables for obtaining accurate taxonomic classifications. In this simulation study we tested the performance of three classification methods: 1) a similarity-based method (BLAST + Metagenomic Analyzer, MEGAN); 2) a composition-based method (Ribosomal Database Project naïve Bayesian classifier, NBC); and, 3) a phylogeny-based method (Statistical Assignment Package, SAP). We also tested the effects of sequence length, primer choice, and sequence error on classification accuracy and perceived community composition. Using a leave-one-out cross validation approach, results for classifications to the genus rank were as follows: BLAST + MEGAN had the lowest error rate and was particularly robust to sequence error; SAP accuracy was highest when long LSU query sequences were classified; and, NBC runs significantly faster than the other tested methods. All methods performed poorly with the shortest 50–100 bp sequences. Increasing simulated sequence error reduced classification accuracy. Community shifts were detected due to sequence error and primer selection even though there was no change in the underlying community composition. Short read datasets from individual primers, as well as pooled datasets, appear to only approximate the true community composition. We hope this work informs investigators of some of the factors that affect the quality and interpretation of their environmental gene surveys. PMID:22558215

  3. Evolutionary site-number changes of ribosomal DNA loci during speciation: complex scenarios of ancestral and more recent polyploid events

    PubMed Central

    Rosato, Marcela; Moreno-Saiz, Juan C.; Galián, José A.; Rosselló, Josep A.

    2015-01-01

    Several genome duplications have been identified in the evolution of seed plants, providing unique systems for studying karyological processes promoting diversification and speciation. Knowledge about the number of ribosomal DNA (rDNA) loci, together with their chromosomal distribution and structure, provides clues about organismal and molecular evolution at various phylogenetic levels. In this work, we aim to elucidate the evolutionary dynamics of karyological and rDNA site-number variation in all known taxa of subtribe Vellinae, showing a complex scenario of ancestral and more recent polyploid events. Specifically, we aim to infer the ancestral chromosome numbers and patterns of chromosome number variation, assess patterns of variation of both 45S and 5S rDNA families, trends in site-number change of rDNA loci within homoploid and polyploid series, and reconstruct the evolutionary history of rDNA site number using a phylogenetic hypothesis as a framework. The best-fitting model of chromosome number evolution with a high likelihood score suggests that the Vellinae core showing x = 17 chromosomes arose by duplication events from a recent x = 8 ancestor. Our survey suggests more complex patterns of polyploid evolution than previously noted for Vellinae. High polyploidization events (6x, 8x) arose independently in the basal clade Vella castrilensis–V. lucentina, where extant diploid species are unknown. Reconstruction of ancestral rDNA states in Vellinae supports the inference that the ancestral number of loci in the subtribe was two for each multigene family, suggesting that an overall tendency towards a net loss of 5S rDNA loci occurred during the splitting of Vellinae ancestors from the remaining Brassiceae lineages. A contrasting pattern for rDNA site change in both paleopolyploid and neopolyploid species was linked to diversification of Vellinae lineages. This suggests dynamic and independent changes in rDNA site number during speciation processes and a

  4. Ribosomal DNA analysis of tsetse and non-tsetse transmitted Ethiopian Trypanosoma vivax strains in view of improved molecular diagnosis.

    PubMed

    Fikru, Regassa; Matetovici, Irina; Rogé, Stijn; Merga, Bekana; Goddeeris, Bruno Maria; Büscher, Philippe; Van Reet, Nick

    2016-04-15

    Animal trypanosomosis caused by Trypanosoma vivax (T. vivax) is a devastating disease causing serious economic losses. Most molecular diagnostics for T. vivax infection target the ribosomal DNA locus (rDNA) but are challenged by the heterogeneity among T. vivax strains. In this study, we investigated the rDNA heterogeneity of Ethiopian T. vivax strains in relation to their presence in tsetse-infested and tsetse-free areas and its effect on molecular diagnosis. We sequenced the rDNA loci of six Ethiopian (three from tsetse-infested and three from tsetse-free areas) and one Nigerian T. vivax strain. We analysed the obtained sequences in silico for primer-mismatches of some commonly used diagnostic PCR assays and for GC content. With these data, we selected some rDNA diagnostic PCR assays for evaluation of their diagnostic accuracy. Furthermore we constructed two phylogenetic networks based on sequences within the smaller subunit (SSU) of 18S and within the 5.8S and internal transcribed spacer 2 (ITS2) to assess the relatedness of Ethiopian T. vivax strains to strains from other African countries and from South America. In silico analysis of the rDNA sequence showed important mismatches of some published diagnostic PCR primers and high GC content of T. vivax rDNA. The evaluation of selected diagnostic PCR assays with specimens from cattle under natural T. vivax challenge showed that this high GC content interferes with the diagnostic accuracy of PCR, especially in cases of mixed infections with T. congolense. Adding betain to the PCR reaction mixture can enhance the amplification of T. vivax rDNA but decreases the sensitivity for T. congolense and Trypanozoon. The networks illustrated that Ethiopian T. vivax strains are considerably heterogeneous and two strains (one from tsetse-infested and one from tsetse-free area) are more related to the West African and South American strains than to the East African strains. The rDNA locus sequence of six Ethiopian T. vivax

  5. 16S Ribosomal DNA Sequence Analysis of a Large Collection of Environmental and Clinical Unidentifiable Bacterial Isolates

    PubMed Central

    Drancourt, Michel; Bollet, Claude; Carlioz, Antoine; Martelin, Rolland; Gayral, Jean-Pierre; Raoult, Didier

    2000-01-01

    Some bacteria are difficult to identify with phenotypic identification schemes commonly used outside reference laboratories. 16S ribosomal DNA (rDNA)-based identification of bacteria potentially offers a useful alternative when phenotypic characterization methods fail. However, as yet, the usefulness of 16S rDNA sequence analysis in the identification of conventionally unidentifiable isolates has not been evaluated with a large collection of isolates. In this study, we evaluated the utility of 16S rDNA sequencing as a means to identify a collection of 177 such isolates obtained from environmental, veterinary, and clinical sources. For 159 isolates (89.8%) there was at least one sequence in GenBank that yielded a similarity score of ≥97%, and for 139 isolates (78.5%) there was at least one sequence in GenBank that yielded a similarity score of ≥99%. These similarity score values were used to defined identification at the genus and species levels, respectively. For isolates identified to the species level, conventional identification failed to produce accurate results because of inappropriate biochemical profile determination in 76 isolates (58.7%), Gram staining in 16 isolates (11.6%), oxidase and catalase activity determination in 5 isolates (3.6%) and growth requirement determination in 2 isolates (1.5%). Eighteen isolates (10.2%) remained unidentifiable by 16S rDNA sequence analysis but were probably prototype isolates of new species. These isolates originated mainly from environmental sources (P = 0.07). The 16S rDNA approach failed to identify Enterobacter and Pantoea isolates to the species level (P = 0.04; odds ratio = 0.32 [95% confidence interval, 0.10 to 1.14]). Elsewhere, the usefulness of 16S rDNA sequencing was compromised by the presence of 16S rDNA sequences with >1% undetermined positions in the databases. Unlike phenotypic identification, which can be modified by the variability of expression of characters, 16S rDNA sequencing provides

  6. Comparison of Antifungal Activities and 16S Ribosomal DNA Sequences of Clinical and Environmental Isolates of Stenotrophomonas maltophilia

    PubMed Central

    Minkwitz, Arite; Berg, Gabriele

    2001-01-01

    In recent years, the gram-negative bacterium Stenotrophomonas maltophilia has become increasingly important in biotechnology and as a nosocomial pathogen, giving rise to a need for new information about its taxonomy and epidemiology. To determine intraspecies diversity and whether strains can be distinguished based on the sources of their isolation, 50 S. maltophilia isolates from clinical and environmental sources, including strains of biotechnological interest, were investigated. The isolates were characterized by in vitro antagonism against pathogenic fungi and the production of antifungal metabolites and enzymes. Phenotypically the strains showed variability that did not correlate significantly with their sources of isolation. Clinical strains displayed remarkable activity against the human pathogenic fungus Candida albicans. Antifungal activity against plant pathogens was more common and generally more severe from the environmental isolates, although not exclusive to them. All isolates, clinical and environmental, produced a range of antifungal metabolites including antibiotics, siderophores, and the enzymes proteases and chitinases. From 16S ribosomal DNA sequencing analysis, the isolates could be separated into three clusters, two of which consisted of isolates originating from the environment, especially rhizosphere isolates, and one of which consisted of clinical and aquatic strains. In contrast to the results of other recent investigations, these strains could be grouped based on their sources of isolation, with the exception of three rhizosphere isolates. Because there was evidence of nucleotide signature positions within the sequences that are suitable for distinguishing among the clusters, the clusters could be defined as different genomovars of S. maltophilia. Key sequences on the 16S ribosomal DNA could be used to develop a diagnostic method that differentiates these genomovars. PMID:11136762

  7. Ribosomal DNA and Plastid Markers Used to Sample Fungal and Plant Communities from Wetland Soils Reveals Complementary Biotas

    PubMed Central

    Porter, Teresita M.; Shokralla, Shadi; Baird, Donald; Golding, G. Brian; Hajibabaei, Mehrdad

    2016-01-01

    Though the use of metagenomic methods to sample below-ground fungal communities is common, the use of similar methods to sample plants from their underground structures is not. In this study we use high throughput sequencing of the ribulose-bisphosphate carboxylase large subunit (rbcL) plastid marker to study the plant community as well as the internal transcribed spacer and large subunit ribosomal DNA (rDNA) markers to investigate the fungal community from two wetland sites. Observed community richness and composition varied by marker. The two rDNA markers detected complementary sets of fungal taxa and total fungal composition clustered according to primer rather than by site. The composition of the most abundant plants, however, clustered according to sites as expected. We suggest that future studies consider using multiple genetic markers, ideally generated from different primer sets, to detect a more taxonomically diverse suite of taxa compared with what can be detected by any single marker alone. Conclusions drawn from the presence of even the most frequently observed taxa should be made with caution without corroborating lines of evidence. PMID:26731732

  8. Ribosomal DNA and Plastid Markers Used to Sample Fungal and Plant Communities from Wetland Soils Reveals Complementary Biotas.

    PubMed

    Porter, Teresita M; Shokralla, Shadi; Baird, Donald; Golding, G Brian; Hajibabaei, Mehrdad

    2016-01-01

    Though the use of metagenomic methods to sample below-ground fungal communities is common, the use of similar methods to sample plants from their underground structures is not. In this study we use high throughput sequencing of the ribulose-bisphosphate carboxylase large subunit (rbcL) plastid marker to study the plant community as well as the internal transcribed spacer and large subunit ribosomal DNA (rDNA) markers to investigate the fungal community from two wetland sites. Observed community richness and composition varied by marker. The two rDNA markers detected complementary sets of fungal taxa and total fungal composition clustered according to primer rather than by site. The composition of the most abundant plants, however, clustered according to sites as expected. We suggest that future studies consider using multiple genetic markers, ideally generated from different primer sets, to detect a more taxonomically diverse suite of taxa compared with what can be detected by any single marker alone. Conclusions drawn from the presence of even the most frequently observed taxa should be made with caution without corroborating lines of evidence. PMID:26731732

  9. Intraspecific polymorphism of ribosomal DNA loci number and morphology in Brachypodium pinnatum and Brachypodium sylvaticum.

    PubMed

    Breda, Ewa; Wolny, Elzbieta; Hasterok, Robert

    2012-12-01

    The genus Brachypodium has become the target of extensive cytomolecular studies since one of its representatives, B. distachyon, has been accepted as a model plant for temperate cereals and forage grasses. Recent preliminary studies suggested that intraspecific rDNA polymorphism can occur in at least two members of the genus, B. sylvaticum and B. pinnatum, so the aim of this study was to further analyse this phenomenon. FISH with 25S rDNA and 5S rDNA probes was performed on somatic metaphase chromosomes, supplemented by the silver staining technique which distinguishes transcriptionally active from inactive 18S-5.8S-25S rDNA loci. The number, size and chromosomal distribution of 5S rDNA loci were very constant: two loci were invariably observed in all studied diploid accessions of both species, while four 5S rDNA loci were present in the tetraploid B. pinnatum. In contrast to 5S rDNA loci, those of the 35S rDNA were more variable. Two or three loci were observed in the diploid B. pinnatum and four in tetraploid accessions. In chromosome complements of B. sylvaticum accessions from two to six 35S rDNA sites were detected. Regardless of total rDNA locus number, only two were transcriptionally active in diploid accessions of both species, while two or four were active in the tetraploid B. pinnatum. Additionally, the fluorescent CMA/DAPI banding method was used to identify the relation between rDNA sites and CMA+ bands. It was revealed that the number and chromosomal distribution of CMA+ bands are in congruence only with 35S rDNA loci which gave strong FISH signals. PMID:22893263

  10. FOB1 affects DNA topoisomerase I in vivo cleavages in the enhancer region of the Saccharomyces cerevisiae ribosomal DNA locus

    PubMed Central

    Di Felice, Francesca; Cioci, Francesco; Camilloni, Giorgio

    2005-01-01

    In Saccharomyces cerevisiae the FOB1 gene affects replication fork blocking activity at the replication fork block (RFB) sequences and promotes recombination events within the rDNA cluster. Using in vivo footprinting assays we mapped two in vivo Fob1p-binding sites, RFB1 and RFB3, located in the rDNA enhancer region and coincident with those previously reported to be in vitro binding sites. We previously provided evidences that DNA topoisomerase I is able to cleave two sites within this region. The results reported in this paper, indicate that the DNA topoisomerase I cleavage specific activity at the enhancer region is affected by the presence of Fob1p and independent of replication and transcription activities. We thus hypothesize that the binding to DNA of Fob1p itself may be the cause of the DNA topoisomerase I activity in the rDNA enhancer. PMID:16269824

  11. From DNA to proteins via the ribosome: structural insights into the workings of the translation machinery.

    PubMed

    Agirrezabala, Xabier; Frank, Joachim

    2010-04-01

    Understanding protein synthesis in bacteria and humans is important for understanding the origin of many human diseases and devising treatments for them. Over the past decade, the field of structural biology has made significant advances in the visualisation of the molecular machinery involved in protein synthesis. It is now possible to discern, at least in outline, the way that interlocking ribosomal components and factors adapt their conformations throughout this process. The determination of structures in various functional contexts, along with the application of kinetic and fluorescent resonance energy transfer approaches to the problem, has given researchers the frame of reference for what remains as the greatest challenge: the complete dynamic portrait of protein synthesis in the cell. PMID:20511136

  12. From DNA to proteins via the ribosome: Structural insights into the workings of the translation machinery

    PubMed Central

    2010-01-01

    Understanding protein synthesis in bacteria and humans is important for understanding the origin of many human diseases and devising treatments for them. Over the past decade, the field of structural biology has made significant advances in the visualisation of the molecular machinery involved in protein synthesis. It is now possible to discern, at least in outline, the way that interlocking ribosomal components and factors adapt their conformations throughout this process. The determination of structures in various functional contexts, along with the application of kinetic and fluorescent resonance energy transfer approaches to the problem, has given researchers the frame of reference for what remains as the greatest challenge: the complete dynamic portrait of protein synthesis in the cell. PMID:20511136

  13. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...

  14. Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

    PubMed Central

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality. PMID:12514026

  15. Extensive Pyrosequencing Reveals Frequent Intra-Genomic Variations of Internal Transcribed Spacer Regions of Nuclear Ribosomal DNA

    PubMed Central

    Li, Dezhu; Sun, Yongzhen; Niu, Yunyun; Chen, Zhiduan; Luo, Hongmei; Pang, Xiaohui; Sun, Zhiying; Liu, Chang; Lv, Aiping; Deng, Youping; Larson-Rabin, Zachary; Wilkinson, Mike; Chen, Shilin

    2012-01-01

    Background Internal transcribed spacer of nuclear ribosomal DNA (nrDNA) is already one of the most popular phylogenetic and DNA barcoding markers. However, the existence of its multiple copies has complicated such usage and a detailed characterization of intra-genomic variations is critical to address such concerns. Methodology/Principal Findings In this study, we used sequence-tagged pyrosequencing and genome-wide analyses to characterize intra-genomic variations of internal transcribed spacer 2 (ITS2) regions from 178 plant species. We discovered that mutation of ITS2 is frequent, with a mean of 35 variants per species. And on average, three of the most abundant variants make up 91% of all ITS2 copies. Moreover, we found different congeneric species share identical variants in 13 genera. Interestingly, different species across different genera also share identical variants. In particular, one minor variant of ITS2 in Eleutherococcus giraldii was found identical to the ITS2 major variant of Panax ginseng, both from Araliaceae family. In addition, DNA barcoding gap analysis showed that the intra-genomic distances were markedly smaller than those of the intra-specific or inter-specific variants. When each of 5543 variants were examined for its species discrimination efficiency, a 97% success rate was obtained at the species level. Conclusions Identification of identical ITS2 variants across intra-generic or inter-generic species revealed complex species evolutionary history, possibly, horizontal gene transfer and ancestral hybridization. Although intra-genomic multiple variants are frequently found within each genome, the usage of the major variants alone is sufficient for phylogeny construction and species determination in most cases. Furthermore, the inclusion of minor variants further improves the resolution of species identification. PMID:22952830

  16. Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata

    PubMed Central

    Yang, Kiwoung; Robin, Arif Hasan Khan; Yi, Go-Eun; Lee, Jonghoon; Chung, Mi-Young; Yang, Tae-Jin; Nou, Ill-Sup

    2015-01-01

    Ribosomal DNA (rDNA) of plants is present in high copy number and shows variation between and within species in the length of the intergenic spacer (IGS). The 45S rDNA of flowering plants includes the 5.8S, 18S and 25S rDNA genes, the internal transcribed spacer (ITS1 and ITS2), and the intergenic spacer 45S-IGS (25S-18S). This study identified six different types of 45S-IGS, A to F, which at 363 bp, 1121 bp, 1717 bp, 1969 bp, 2036 bp and 2111 bp in length, respectively, were much shorter than the reported reference IGS sequences in B. oleracea var. alboglabra. The shortest two IGS types, A and B, lacked the transcription initiation site, non-transcribed spacer, and external transcribed spacer. Functional behavior of those two IGS types in relation to rRNA synthesis is a subject of further investigation. The other four IGSs had subtle variations in the transcription termination site, guanine-cytosine (GC) content, and number of tandem repeats, but the external transcribed spacers of these four IGSs were quite similar in length. The 45S IGSs were found to follow Mendelian inheritance in a population of 15 F1s and their 30 inbred parental lines, which suggests that these sequences could be useful for development of new breeding tools. In addition, this study represents the first report of intra-specific (within subspecies) variation of the 45S IGS in B. oleracea. PMID:26633391

  17. Rapid Concerted Evolution of Nuclear Ribosomal DNA in Two Tragopogon Allopolyploids of Recent and Recurrent Origin

    PubMed Central

    Kovarik, A.; Pires, J. C.; Leitch, A. R.; Lim, K. Y.; Sherwood, A. M.; Matyasek, R.; Rocca, J.; Soltis, D. E.; Soltis, P. S.

    2005-01-01

    We investigated concerted evolution of rRNA genes in multiple populations of Tragopogon mirus and T. miscellus, two allotetraploids that formed recurrently within the last 80 years following the introduction of three diploids (T. dubius, T. pratensis, and T. porrifolius) from Europe to North America. Using the earliest herbarium specimens of the allotetraploids (1949 and 1953) to represent the genomic condition near the time of polyploidization, we found that the parental rDNA repeats were inherited in roughly equal numbers. In contrast, in most present-day populations of both tetraploids, the rDNA of T. dubius origin is reduced and may occupy as little as 5% of total rDNA in some individuals. However, in two populations of T. mirus the repeats of T. dubius origin outnumber the repeats of the second diploid parent (T. porrifolius), indicating bidirectional concerted evolution within a single species. In plants of T. miscellus having a low rDNA contribution from T. dubius, the rDNA of T. dubius was nonetheless expressed. We have apparently caught homogenization of rDNA repeats (concerted evolution) in the act, although it has not proceeded to completion in any allopolyploid population yet examined. PMID:15654116

  18. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  19. Analysis of Fungal Flora in Indoor Dust by Ribosomal DNA Sequence Analysis, Quantitative PCR, and Culture▿ †

    PubMed Central

    Pitkäranta, M.; Meklin, T.; Hyvärinen, A.; Paulin, L.; Auvinen, P.; Nevalainen, A.; Rintala, H.

    2008-01-01

    In recent years increasing attention has been given to the potential health effects of fungal exposure in indoor environments. We used large-scale sequencing of the fungal internal transcribed spacer region (ITS) of nuclear ribosomal DNA to describe the mycoflora of two office buildings over the four seasons. DNA sequencing was complemented by cultivation, ergosterol determination, and quantitative PCR analyses. Sequences of 1,339 clones were clustered into 394 nonredundant fungal operational taxonomical units containing sequences from 18 fungal subclasses. The observed flora differed markedly from that recovered by cultivation, the major differences being the near absence of several typical indoor mold genera such as Penicillium and Aspergillus spp. and a high prevalence of basidiomycetes in clone libraries. A total of 55% of the total diversity constituted of unidentifiable ITS sequences, some of which may represent novel fungal species. Dominant species were Cladosporium cladosporioides and C. herbarum, Cryptococcus victoriae, Leptosphaerulina americana and L. chartarum, Aureobasidium pullulans, Thekopsora areolata, Phaeococcomyces nigricans, Macrophoma sp., and several Malassezia species. Seasonal differences were observed for community composition, with ascomycetous molds and basidiomycetous yeasts predominating in the winter and spring and Agaricomycetidae basidiomycetes predominating in the fall. The comparison of methods suggested that the cloning, cultivation, and quantitative PCR methods complemented each other, generating a more comprehensive picture of fungal flora than any of the methods would give alone. The current restrictions of the methods are discussed. PMID:17981947

  20. Sequence analysis of the ribosomal DNA internal transcribed spacer 2 from populations of Anopheles nuneztovari (Diptera: Culicidae).

    PubMed

    Fritz, G N; Conn, J; Cockburn, A; Seawright, J

    1994-05-01

    Sequence variation of the ribosomal DNA internal transcribed spacer 2 (ITS2) was examined for populations of the malaria vector Anopheles nuneztovari collected in Colombia, Venezuela, Bolivia, Suriname, and Brazil. Mosquitoes from Colombia and Venezuela had identical ITS2 sequences and were distinguished from sequences in other populations by three insertion/deletion events (indels) and by one transversion. The length of the ITS2 was 363-369 bp, and it had a G+C content of 55.3%-55.7%. Variation in the length of the ITS2 between and within populations was due to indels in simple repeats. ITS2 consensus sequences were similar or identical for samples from the following three groups: (1) Colombia, Bolivia, and Venezuela; (2) Suriname and northern Brazil; and (3) eastern and central Brazil. The presence of two different consensus sequences from a single location near Manaus, Brazil, suggests that populations from eastern Brazil and those from Suriname converge in this region of the Amazon Basin. These data show that putative cryptic species of An. nuneztovari are distinguished by very minor differences in DNA sequence of the ITS2 region. PMID:8015435

  1. Phylogenetic Relationships and Genetic Variation in Longidorus and Xiphinema Species (Nematoda: Longidoridae) Using ITS1 Sequences of Nuclear Ribosomal DNA

    PubMed Central

    Ye, Weimin; Szalanski, Allen L.; Robbins, R. T.

    2004-01-01

    Genetic analyses using DNA sequences of nuclear ribosomal DNA ITS1 were conducted to determine the extent of genetic variation within and among Longidorus and Xiphinema species. DNA sequences were obtained from samples collected from Arkansas, California and Australia as well as 4 Xiphinema DNA sequences from GenBank. The sequences of the ITS1 region including the 3' end of the 18S rDNA gene and the 5' end of the 5.8S rDNA gene ranged from 1020 bp to 1244 bp for the 9 Longidorus species, and from 870 bp to 1354 bp for the 7 Xiphinema species. Nucleotide frequencies were: A = 25.5%, C = 21.0%, G = 26.4%, and T = 27.1%. Genetic variation between the two genera had a maximum divergence of 38.6% between X. chambersi and L. crassus. Genetic variation among Xiphinema species ranged from 3.8% between X. diversicaudatum and X. bakeri to 29.9% between X. chambersi and X. italiae. Within Longidorus, genetic variation ranged from 8.9% between L. crassus and L. grandis to 32.4% between L. fragilis and L. diadecturus. Intraspecific genetic variation in X. americanum sensu lato ranged from 0.3% to 1.9%, while genetic variation in L. diadecturus had 0.8% and L. biformis ranged from 0.6% to 10.9%. Identical sequences were obtained between the two populations of L. grandis, and between the two populations of X. bakeri. Phylogenetic analyses based on the ITS1 DNA sequence data were conducted on each genus separately using both maximum parsimony and maximum likelihood analysis. Among the Longidorus taxa, 4 subgroups are supported: L. grandis, L. crassus, and L. elongatus are in one cluster; L. biformis and L. paralongicaudatus are in a second cluster; L. fragilis and L. breviannulatus are in a third cluster; and L. diadecturus is in a fourth cluster. Among the Xiphinema taxa, 3 subgroups are supported: X. americanum with X. chambersi, X. bakeri with X. diversicaudatum, and X. italiae and X. vuittenezi forming a sister group with X. index. The relationships observed in this study

  2. Phylogenetic relationships of three hymenolepidid species inferred from nuclear ribosomal and mitochondrial DNA sequences.

    PubMed

    Okamoto, M; Agatsuma, T; Kurosawa, T; Ito, A

    1997-12-01

    Three hymenolepidid tapeworms, Hymenolepis diminuta, H. nana and H. microstoma, are commonly maintained in laboratory rodents and used in many experimental model systems of tapeworm infections. We examined partial sequences from the mitochondrial cytochrome c oxidase subunit 1 (CO1) gene and nuclear ribosomal internal transcribed spacer 2 (ITS2) sequences to infer phylogenetic relationships of the 3 hymenolepidid species. Parts of the CO1 gene and ITS2 were amplified by PCR and sequenced directly. The CO1 gene sequence obtained was the same in length (391 bp) among all specimens. In the case of ITS2, however, several insertions and deletions were detected (671-741 bp) not only among species but also between an American isolate and a Japanese isolate of H. diminuta. Percentage nucleotide differences between H. diminuta and H. microstoma, or H. diminuta and H. nana were 16.6-18.2% for the CO1 gene and 21.3-22.9% for ITS2. The differences in both sequences between H. microstoma and H. nana were about 14%. Phylogenetic trees inferred from both of the nucleotide sequences showed similar topology, and suggest that H. diminuta may have diverged from the common ancestral line the earliest, and that H. nana is closer to H. microstoma than to H. diminuta. PMID:9488878

  3. Extensive length variation in the ribosomal DNA intergenic spacer of yellow perch (Perca flavescens).

    PubMed

    Kakou, Bidénam; Angers, Bernard; Glémet, Hélène

    2016-03-01

    The intergenic spacer (IGS) is located between ribosomal RNA (rRNA) gene copies. Within the IGS, regulatory elements for rRNA gene transcription are found, as well as a varying number of other repetitive elements that are at the root of IGS length heterogeneity. This heterogeneity has been shown to have a functional significance through its effect on growth rate. Here, we present the structural organization of yellow perch (Perca flavescens) IGS based on its entire sequence, as well as the IGS length variation within a natural population. Yellow perch IGS structure has four discrete regions containing tandem repeat elements. For three of these regions, no specific length class was detected as allele size was seemingly normally distributed. However, for one repeat region, PCR amplification uncovered the presence of two distinctive IGS variants representing a length difference of 1116 bp. This repeat region was also devoid of any CpG sites despite a high GC content. Balanced selection may be holding the alleles in the population and would account for the high diversity of length variants observed for adjacent regions. Our study is an important precursor for further work aiming to assess the role of IGS length variation in influencing growth rate in fish. PMID:26841134

  4. PCR amplification and characterization of the intergenic spacer region of the ribosomal DNA in Pyrenophora graminea.

    PubMed

    Pecchia, S; Mercatelli, E; Vannacci, G

    1998-09-01

    Successful amplification of the whole intergenic spacer region of the nuclear ribosomal repeat (IGS) in Pyrenophora graminea was obtained with a PCR-based assay. Single amplification products showed length differences. Depending on the length of the IGS-PCR product, ca. 3.8 or 4.4 kb, two groups of isolates could be identified. The RFLP patterns of isolates obtained with the 6-base cutting enzymes Apal, BglII, DraI, EcoRV, HindIII and SacI were similar within each group and different between the two groups. Restriction patterns of IGS-PCR products digested with the 4-base cutting enzyme AluI were polymorphic among isolates in spite of their IGS-PCR product length. In order to characterize the long and short IGS-PCR products the restriction map is shown. The long product shows an additional HindIII site and a BglII site that is lacking in the short product. However, the latter shows a SacI site that is not present in the long IGS-PCR product. Therefore, the described PCR-RFLP analysis of the IGS appears to be a useful tool to resolve genetic variation between P. graminea isolates. PMID:9741081

  5. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    PubMed Central

    2008-01-01

    Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny. PMID:18366624

  6. Restriction enzyme mapping of ribosomal DNA can distinguish between fasciolid (liver fluke) species.

    PubMed

    Blair, D; McManus, D P

    1989-10-01

    Recognition sites for nine different restriction endonucleases were mapped on rDNA genes of fasciolid species. Southern blots of digested DNA from individual worms were probed sequentially with three different probes derived from rDNA of Schistosoma mansoni and known to span between them the entire rDNA repeat unit in that species. Eighteen recognition sites were mapped for Fasciola hepatica, and seventeen for Fasciola gigantica and Fascioloides magna. Each fasciolid species had no more than two unique recognition sites, the remainder being common to one or both of the other two species. No intraspecific variation in restriction sites was noted in F. hepatica (individuals from 11 samples studied; hosts were sheep, cattle and laboratory animals; geographical origins. Australia, New Zealand, Mexico, U.K., Hungary and Spain), or in F. gigantica (two samples; Indonesia and Malaysia). Only one sample of F. magna was available. One specimen of Fasciola sp. from Japan (specific identity regarded in the literature as uncertain) yielded a restriction map identical to that of F. gigantica. Almost all recognition sites occurred in or near the putative rRNA coding regions. The non-transcribed spacer region had few or no cut sites despite the fact that this region is up to about one half of the entire repeat unit in length. Length heterogeneity was noted in the non-transcribed spacer, even within individual worms. PMID:2552311

  7. Chromosome fission associated with growth of ribosomal DNA in Neodiprion abietis (Hymenoptera: Diprionidae).

    PubMed Central

    Rousselet, J; Monti, L; Auger-Rozenberg, M A; Parker, J S; Lemeunier, F

    2000-01-01

    The haploid complement consists of seven metacentric chromosomes in most diprionid species but has evolved to n = 8 by fission in Neodiprion abietis. This fission generated a small telocentric chromosome and a large pseudoacrocentric chromosome with a short arm carrying a satellite. In situ hybridization indicated that the location of the rRNA gene cluster corresponds to the whole short arm. This suggests that (i) the breaking point was located close to an rRNA gene cluster, and (ii) fission was associated with growth of rDNA. These results suggest rDNA as a preferential breaking point but with a role in the healing of naked chromosome ends. PMID:11052531

  8. Ribosomal DNA of fly Sciara coprophila has a very small and homogeneous repeat unit.

    PubMed

    Renkawitz, R; Gerbi, S A; Glätzer, K H

    1979-05-23

    In this report we show by hybridization of restriction fragments and by Miller spreads that the unit repeat of the fly Sciara coprophila is only 8.4 kb which is the smallest known for a multicellular eukaryote. The 8.4 kb EcoR1 fragment containing a complete unit of Sciara rDNA was cloned in pBR322, and mapped by the method of Parker (1977) and also by double digestions. The coding regions for 28S, 18S, and 5.8S RNA were localized by the method of Berk and Sharp (1977). From these data we conclude that the nontranscribed spacer, external transcribed spacer, and internal transcribed spacer are all shorter than in other organisms, thereby giving rise to the shorter overall rDNA repeat unit of Sciara. At least 90% of the Sciara rDNA repeats are homogeneous, with a length of 8.4 kb, but a 700 bp ladder of minor bands can also be found in digestions of total genome DNA. This profile of major and minor bands is identical between the X and X' chromosomes, as seen by a comparison of several genotypes. There are only 45 rRNA genes per X chromosome of Sciara (Gerbi and Crouse, 1976). These can easily be counted by low magnification Miller spreads which show that virtually all gene copies are actively being transcribed in the stage of spermatogenesis examined. This is the first demonstration for any reiterated gene family where all copies are shown to be simultaneously active. PMID:288964

  9. Identification of Dermatophyte Species by 28S Ribosomal DNA Sequencing with a Commercial Kit

    PubMed Central

    Ninet, Béatrice; Jan, Isabelle; Bontems, Olympia; Léchenne, Barbara; Jousson, Olivier; Panizzon, Renato; Lew, Daniel; Monod, Michel

    2003-01-01

    We have shown that dermatophyte species can be easily identified on the basis of a DNA sequence encoding a part of the large-subunit (LSU) rRNA (28S rRNA) by using the MicroSeq D2 LSU rRNA Fungal Sequencing Kit. Two taxa causing distinct dermatophytoses were clearly distinguished among isolates of the Trichophyton mentagrophytes species complex. PMID:12574293

  10. Ribosomal DNA in diploid and polyploid Setaria (Poaceae) species: number and distribution

    PubMed Central

    Nani, Thaís Furtado; Cenzi, Gisele; Pereira, Daniele Lais; Davide, Lisete Chamma; Techio, Vânia Helena

    2015-01-01

    Abstract Setaria Beauvois, 1812 is a genus of economically important forage species, including Setaria italica (Linnaeus, 1753) Beauvois, 1812 and Setaria viridis (Linnaeus, 1753) Beauvois, 1812, closely related species and considered as model systems for studies of C4 plants. However, complications and uncertainties related to taxonomy of other species of the genus are frequent due to the existence of numerous synonyms for the same species or multiple species with the same name, and overlapping of morphological characteristics. Cytogenetic studies in Setaria can be useful for taxonomic and evolutionary studies as well as for applications in breeding. Thus, this study is aimed at locating 45S and 5S rDNA sites through fluorescent in situ hybridization (FISH) in Setaria italica, Setaria viridis and Setaria sphacelata (Schumacher, 1827) Stapf, Hubbard, Moss, 1929 cultivars (cvs.) Narok and Nandi. Setaria italica and Setaria viridis have 18 chromosomes with karyotype formulas 6m + 3sm and 9m, respectively. The location of 45S and 5S rDNA for these species was in different chromosome pairs among the evaluated species. Setaria viridis presented a more symmetrical karyotype, strengthening the ancestral relationship with Setaria italica. Setaria sphacelata cvs. Narok and Nandi have 36 chromosomes, and karyotype formulas 11m+7sm and 16m+2sm, respectively. The 45S rDNA signals for both cultivars were also observed in distinct chromosome pairs; however chromosomes bearing 5S rDNA are conserved. Karyotypic variations found among the studied species are evidence of chromosomal rearrangements. PMID:26753080

  11. Physical localisation of repetitive DNA sequences in Alstroemeria: karyotyping of two species with species-specific and ribosomal DNA.

    PubMed

    Kamstra, S A; Kuipers, A G; De Jeu, M J; Ramanna, M S; Jacobsen, E

    1997-10-01

    Fluorescence in situ hybridization (FISH) was used to localise two species-specific repetitive DNA sequences, A001-I and D32-13, and two highly conserved 25S and 5S rDNA sequences on the metaphase chromosomes of two species of Alstroemeria. The Chilean species, Alstroemeria aurea (2n = 16), has abundant constitutive heterochromatin, whereas the Brazilian species, Alstroemeria inodora, has hardly any heterochromatin. The A. aurea specific A001-I probe hybridized specifically to the C-band regions on all chromosomes. The FISH patterns on A. inodora chromosomes using species-specific probe D32-13 resembled the C-banding pattern and the A001-I pattern on A. aurea chromosomes. There were notable differences in number and distribution of rDNA sites between the two species. The 25S rDNA probe revealed 16 sites in A. aurea that closely colocalised with A001-I sites and 12 in A. inodora that were predominantly detected in the centromeric regions. FISH karyotypes of the two Alstroemeria species were constructed accordingly, enabling full identification of all individual chromosomes. These FISH karyotypes will be useful for monitoring the chromosomes of both Alstroemeria species in hybrids and backcross derivatives. PMID:9352644

  12. Phylogenetics of Bonamia parasites based on small subunit and internal transcribed spacer region ribosomal DNA sequence data.

    PubMed

    Hill, Kristina M; Stokes, Nancy A; Webb, Stephen C; Hine, P Mike; Kroeck, Marina A; Moore, James D; Morley, Margaret S; Reece, Kimberly S; Burreson, Eugene M; Carnegie, Ryan B

    2014-07-24

    The genus Bonamia (Haplosporidia) includes economically significant oyster parasites. Described species were thought to have fairly circumscribed host and geographic ranges: B. ostreae infecting Ostrea edulis in Europe and North America, B. exitiosa infecting O. chilensis in New Zealand, and B. roughleyi infecting Saccostrea glomerata in Australia. The discovery of B. exitiosa-like parasites in new locations and the observation of a novel species, B. perspora, in non-commercial O. stentina altered this perception and prompted our wider evaluation of the global diversity of Bonamia parasites. Samples of 13 oyster species from 21 locations were screened for Bonamia spp. by PCR, and small subunit and internal transcribed spacer regions of Bonamia sp. ribosomal DNA were sequenced from PCR-positive individuals. Infections were confirmed histologically. Phylogenetic analyses using parsimony and Bayesian methods revealed one species, B. exitiosa, to be widely distributed, infecting 7 oyster species from Australia, New Zealand, Argentina, eastern and western USA, and Tunisia. More limited host and geographic distributions of B. ostreae and B. perspora were confirmed, but nothing genetically identifiable as B. roughleyi was found in Australia or elsewhere. Newly discovered diversity included a Bonamia sp. in Dendostrea sandvicensis from Hawaii, USA, that is basal to the other Bonamia species and a Bonamia sp. in O. edulis from Tomales Bay, California, USA, that is closely related to both B. exitiosa and the previously observed Bonamia sp. from O. chilensis in Chile. PMID:25060496

  13. Identification of Ustilago cynodontis as a new producer of glycolipid biosurfactants, mannosylerythritol lipids, based on ribosomal DNA sequences.

    PubMed

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2008-01-01

    Mannosylerythritol lipids (MELs) are one of the most promising glycolipid biosurfactants known because of their multifunctionality and biocompatibility. The search for novel producers of MELs was undertaken based on the analysis of ribosomal DNA sequences on basidiomycetous yeasts. The bermuda grass smut fungus Ustilago cynodontis NBRC 7530, which taxonomically relates to Pseudozyma shanxiensis known as a MEL-C producer, was found to accumulate glycolipids in the cultured medium. Under a shake flask culture with soybean oil, the amount of the glycolipids was 1.4 g/L for 7 days at 25 degrees C. As a result of the structural characterization, the main glycolipids was identified as 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol, and the major fatty acids were C(14) and C(16) ones. The glycolipid was highly hydrophilic MEL-C, and very similar to those produced by P. shanxiensis. The fungi of the genus Ustilago are thus likely to be potential producers of MELs as well as the yeasts of the genus Pseudozyma. PMID:18781055

  14. Genetic heterogeneity and phylogeny of Trichuris spp. from captive non-human primates based on ribosomal DNA sequence data.

    PubMed

    Cavallero, Serena; De Liberato, Claudio; Friedrich, Klaus G; Di Cave, David; Masella, Valentina; D'Amelio, Stefano; Berrilli, Federica

    2015-08-01

    Nematodes of the genus Trichuris, known as whipworms, are recognized to infect numerous mammalian species including humans and non-human primates. Several Trichuris spp. have been described and species designation/identification is traditionally based on host-affiliation, although cross-infection and hybridization events may complicate species boundaries. The main aims of the present study were to genetically characterize adult Trichuris specimens from captive Japanese macaques (Macaca fuscata) and grivets (Chlorocebus aethiops), using the ribosomal DNA (ITS) as molecular marker and to investigate the phylogeny and the extent of genetic variation also by comparison with data on isolates from other humans, non-human primates and other hosts. The phylogenetic analysis of Trichuris sequences from M. fuscata and C. aethiops provided evidences of distinct clades and subclades thus advocating the existence of additional separated taxa. Neighbor Joining and Bayesian trees suggest that specimens from M. fuscata may be distinct from, but related to Trichuris trichiura, while a close relationship is suggested between the subclade formed by the specimens from C. aethiops and the subclade formed by T. suis. The tendency to associate Trichuris sp. to host species can lead to misleading taxonomic interpretations (i.e. whipworms found in primates are identified as T. trichiura). The results here obtained confirm previous evidences suggesting the existence of Trichuris spp. other than T. trichiura infecting non-human living primates. PMID:26066463

  15. Phenotypic variability confirmed by nuclear ribosomal DNA suggests a possible natural hybrid zone of Triatoma brasiliensis species complex.

    PubMed

    Costa, Jane; Bargues, Maria Dolores; Neiva, Vanessa Lima; Lawrence, Gena G; Gumiel, Marcia; Oliveira, Genova; Cabello, Pedro; Lima, Marli Maria; Dotson, Ellen; Provance, David William; Almeida, Carlos Eduardo; Mateo, Lucia; Mas-Coma, Santiago; Dujardin, Jean Pierre

    2016-01-01

    Triatoma brasiliensis macromelasoma occurs in Pernambuco state, Brazil, which is situated between the distribution areas of Triatoma brasiliensis brasiliensis (north) and Triatoma juazeirensis (south). T. b. macromelasoma displays greater variations in its chromatic phenotype than either T. b. brasiliensis or T. juazeirensis, and patterns reminiscent of one or the other. Experimental crosses from each of these members of the T. brasiliensis species complex generated fertile offspring suggesting that viable hybrids could be present in nature, despite their significant genetic distances. Considering the geographical position of occurrence of the T. b. macromelasoma (in Pernambuco) it was proposed to be an area capable of supporting natural hybridization between T. b. brasiliensis and T. juazeirensis. Since phenotypic variability is expected, this study investigated the existence of intermediate chromatic phenotypes for T. b. macromelasoma in various locations in areas between the T. b. brasiliensis and T. juazeirensis occurrences. Thirteen different color patterns were for the first time characterized and nine of those displayed intermediate phenotypes. Molecular analysis performed using ribosomal DNA intergenic region, grouped all within the T. brasiliensis complex. The intermediate chromatic phenotypes, molecular analysis and experimental crosses all support the distinction of a zone of hybridization that gave rise to the T. b. macromelasoma through homoploidal evolution. PMID:26520796

  16. Ribosomal and mitochondrial DNA analysis of Trichuridae nematodes of carnivores and small mammals.

    PubMed

    Guardone, Lisa; Deplazes, Peter; Macchioni, Fabio; Magi, Marta; Mathis, Alexander

    2013-10-18

    Several species of Trichuridae nematodes can infect dogs, cats and wild mammals. The diagnosis of these infections relies on the microscopic identification of eggs which are characterized by a similar "lemon" shape and polar plugs in all Trichuridae. Thus, morphological diagnosis to species level is challenging. The use of biomolecular diagnostic methods is desirable but very little genetic data are known from Trichuridae of carnivores and small mammals. The aim of this work was to genetically characterize several species of Trichuridae that can affect dogs, cats and wild mammals, as a basis to develop molecular diagnostic tests. Specimens (adult worms or eggs) of Eucoleus aerophilus (syn. Capillaria aerophila), Eucoleus boehmi (syn. Capillaria boehmi), Pearsonema plica (syn. Capillaria plica), Aonchotheca putorii (syn. Capillaria putorii), Calodium hepaticum (syn. Capillaria hepatica), Calodium splenaecum (syn. Capillaria splenaeca) and Trichuris vulpis were obtained from carcasses of red foxes, feces of dogs, the liver of a vole and from the spleen of Crocidura sp. Parts of the small subunit rRNA (18S rRNA) gene and of the mitochondrial cytochrome c oxidase subunit I (cox 1 mtDNA) gene were amplified from the above mentioned nematodes, yielding the first 18S rRNA gene sequences of all the capillariid nematodes and the first cox 1 mtDNA sequences of E. boehmi, P. plica, C. hepaticum, A. putorii and T. vulpis. The 18S rRNA gene is highly conserved among the different species and not suitable as a target for specific diagnostic oligonucleotides. However, these sequences contribute to a better understanding of the complex taxonomic relations among Trichuridae. Indeed, a dendrogram based on the 18S rRNA gene locus supports the latest taxonomic revision. Interspecies divergence was much higher at the cox 1 mtDNA gene locus, rendering it suitable for DNA barcoding and particularly valuable in resolving closely related species. Furthermore, the mitochondrial genetic

  17. Comparison of fungi within the Gaeumannomyces-Phialophora complex by analysis of ribosomal DNA sequences.

    PubMed Central

    Bryan, G T; Daniels, M J; Osbourn, A E

    1995-01-01

    Four ascomycete species of the genus Gaeumannomyces infect roots of monocotyledons. Gaeumannomyces graminis contains four varieties, var. tritici, var. avenae, var. graminis, and var. maydis. G. graminis varieties tritici, avenae, and graminis have Phialophora-like anamorphs and, together with the other Gaeumannomyces and Phialophora species found on cereal roots, constitute the Gaeumannomyces-Phialophora complex. Relatedness of a number of Gaeumannomyces and Phialophora isolates was assessed by comparison of DNA sequences of the 18S rRNA gene, the 5.8S rRNA gene, and the internal transcribed spacers (ITS). G. graminis var. tritici, G. graminis var. avenae, and G. graminis var. graminis isolates can be distinguished from each other by nucleotide sequence differences in the ITS regions. The G. graminis var. tritici isolates can be further subdivided into R and N isolates (correlating with ability [R] or inability [N] to infect rye). Phylogenetic analysis of the ITS regions of several oat-infecting G. graminis var. tritici isolates suggests that these isolates are actually more closely related to G. graminis var. avenae. The isolates of Magnaporthe grisea included in the analysis showed a surprising degree of relatedness to members of the Gaeumannomyces-Phialophora complex. G. graminis variety-specific oligonucleotide primers were used in PCRs to amplify DNA from cereal seedlings infected with G. graminis var. tritici or G. graminis var. avenae, and these should be valuable for sensitive detection of pathogenic isolates and for diagnosis of take-all. PMID:7574606

  18. Identification of airborne bacterial and fungal species in the clinical microbiology laboratory of a university teaching hospital employing ribosomal DNA (rDNA) PCR and gene sequencing techniques.

    PubMed

    Nagano, Yuriko; Walker, Jim; Loughrey, Anne; Millar, Cherie; Goldsmith, Colin; Rooney, Paul; Elborn, Stuart; Moore, John

    2009-06-01

    Universal or "broad-range" PCR-based ribosomal DNA (rDNA) was performed on a collection of 58 isolates (n = 30 bacteria + 28 fungi), originating from environmental air from several locations within a busy clinical microbiology laboratory, supporting a university teaching hospital. A total of 10 bacterial genera were identified including both Gram-positive and Gram-negative genera. Gram-positive organisms accounted for 27/30 (90%) of total bacterial species, consisting of seven genera and included (in descending order of frequency) Staphylococcus, Micrococcus, Corynebacterium, Paenibacillus, Arthrobacter, Janibacter and Rothia. Gram-negative organisms were less frequently isolated 3/30 (10%) and comprised three genera, including Moraxella, Psychrobacter and Haloanella. Eight fungal genera were identified among the 28 fungal organisms isolated, including (in descending order of frequency) Cladosporium, Penicillium, Aspergillus, Thanatephorus, Absidia, Eurotium, Paraphaeosphaeria and Tritirachium, with Cladosporium accounting for 10/28 (35.7%) of the total fungal isolates. In conclusion, this study identified the presence of 10 bacterial and eight fungal genera in the air within the laboratory sampled. Although this reflected diversity of the microorganisms present, none of these organisms have been described previously as having an inhalational route of laboratory-acquired infection. Therefore, we believe that the species of organisms identified and the concentration levels of these airborne contaminants determined, do not pose a significant health and safety threat for immunocompotent laboratory personnel and visitors. PMID:20183192

  19. DNaseI-hypersensitive sites at promoter-like sequences in the spacer of Xenopus laevis and Xenopus borealis ribosomal DNA.

    PubMed Central

    La Volpe, A; Taggart, M; McStay, B; Bird, A

    1983-01-01

    We have detected a DNAseI hypersensitive site in the ribosomal DNA spacer of Xenopus laevis and Xenopus borealis. The site is present in blood and embryonic nuclei of each species. In interspecies hybrids, however, the site is absent in unexpressed borealis rDNA, but is present normally in expressed laevis rDNA. Hypersensitive sites are located well upstream (over lkb) of the pre-ribosomal RNA promoter. Sequencing of the hypersensitive region in borealis rDNA, however, shows extensive homology with the promoter sequence, and with the hypersensitive region in X. laevis. Of two promoter-like duplications in each spacer, only the most upstream copy is associated with hypersensitivity to DNAaseI. Unlike DNAaseI, Endo R. MspI digests the rDNA of laevis blood nuclei at a domain extending downstream from the hypersensitive site to near the 40S promoter. Since the organisation of conserved sequence elements within this "proximal domain" is similar in three Xenopus species whose spacers have otherwise evolved rapidly, we conclude that this domain plays an important role in rDNA function. Images PMID:6310495

  20. The phylogenetic position of Rhopalura ophiocomae (Orthonectida) based on 18S ribosomal DNA sequence analysis.

    PubMed

    Hanelt, B; Van Schyndel, D; Adema, C M; Lewis, L A; Loker, E S

    1996-11-01

    The Orthonectida is a small, poorly known phylum of parasites of marine invertebrates. Their phylogenetic placement is obscure; they have been considered to be multicellular protozoans, primitive animals at a "mesozoan" grade of organization, or secondarily simplified flatworm-like organisms. The best known species in the phylum, Rhopalura ophiocomae, was collected on San Juan Island, Wash. and a complete 18S rDNA sequence was obtained. Using the models of minimum evolution and parsimony, phylogenetic analyses were undertaken and the results lend support to the following hypotheses about orthonectids: (1) orthonectids are more closely aligned with triploblastic metazoan taxa than with the protist or diploblastic metazoan taxa considered in this analysis; (2) orthonectids are not derived members of the phylum Platyhelminthes; and (3) orthonectids and rhombozoans are not each other's closest relatives, thus casting further doubt on the validity of the phylum Mesozoa previously used to encompass both groups. PMID:8896370

  1. A deeply conserved, noncanonical miRNA hosted by ribosomal DNA

    PubMed Central

    Chak, Li-Ling; Mohammed, Jaaved; Lai, Eric C.; Tucker-Kellogg, Greg

    2015-01-01

    Advances in small RNA sequencing technologies and comparative genomics have fueled comprehensive microRNA (miRNA) gene annotations in humans and model organisms. Although new miRNAs continue to be discovered in recent years, these have universally been lowly expressed, recently evolved, and of debatable endogenous activity, leading to the general assumption that virtually all biologically important miRNAs have been identified. Here, we analyzed small RNAs that emanate from the highly repetitive rDNA arrays of Drosophila. In addition to endo-siRNAs derived from sense and antisense strands of the pre-rRNA sequence, we unexpectedly identified a novel, deeply conserved, noncanonical miRNA. Although this miRNA is widely expressed, this miRNA was not identified by previous studies due to bioinformatics filters removing such repetitive sequences. Deep-sequencing data provide clear evidence for specific processing with precisely defined 5′ and 3′ ends. Furthermore, we demonstrate that the mature miRNA species is incorporated in the effector complexes and has detectable trans regulatory activity. Processing of this miRNA requires Dicer-1, whereas the Drosha–Pasha complex is dispensable. The miRNA hairpin sequence is located in the internal transcribed spacer 1 region of rDNA and is highly conserved among Dipteran species that were separated from their common ancestor ∼100 million years ago. Our results suggest that biologically active miRNA genes may remain unidentified even in well-studied organisms. PMID:25605965

  2. Directed gene copy number amplification in Pichia pastoris by vector integration into the ribosomal DNA locus.

    PubMed

    Marx, Hans; Mecklenbräuker, Astrid; Gasser, Brigitte; Sauer, Michael; Mattanovich, Diethard

    2009-12-01

    The yeast Pichia pastoris is a widely used host organism for heterologous protein production. One of the basic steps for strain improvement is to ensure a sufficient level of transcription of the heterologous gene, based on promoter strength and gene copy number. To date, high-copy-number integrants of P. pastoris are achievable only by screening of random events or by cloning of gene concatemers. Methods for rapid and reliable multicopy integration of the expression cassette are therefore desirable. Here we present such a method based on vector integration into the rDNA locus and post-transformational vector amplification by repeated selection on increased antibiotic concentrations. Data are presented for two exemplary products: human serum albumin, which is secreted into the supernatant, and human superoxide dismutase, which is accumulated in the cytoplasm of the cells. The striking picture evolving is that intracellular protein production is tightly correlated with gene copy number, while use of the secretory pathway introduces a high clonal variability and the correlation with gene copy number is valid only for low gene copy numbers. PMID:19799640

  3. Ribosomal DNA locus variation and REMAP analysis of the diploid and triploid complexes of Lilium lancifolium.

    PubMed

    Nguyen, Truong Xuan; Lee, Sung-Il; Rai, Rameshwar; Kim, Nam-Soo; Kim, Jong Hwa

    2016-08-01

    Lilium lancifolium Thunb. (2n = 2x = 24) is a cytologically conspicuous species with both diploids and triploids in nature. Cytological and molecular genetic analyses were carried out in both diploids and triploids that were collected from 55 geographical locations in Korea, Japan, and China. While the 5S rRNA gene loci were located at duplicated loci on the long arm of chromosome 2, the 45S rRNA gene loci were present in chromosomes 1, 2, 4, 6, 7, and 11. While the loci on chromosomes 1 and 7 were constant, the loci on chromosomes 2, 4, 6, 7, and 11 were variable in some plants so that the L. lancifolium accessions were grouped into 7 cytotypes in diploids and 12 cytotypes in triploids. REMAP marker analysis revealed that the diploids were classified into seven clusters, and the triploids were classified into a large cluster. Geographic, cytological, and genetic differentiations were not related in both the diploid and triploid accessions of L. lancifolium. Thus, current genetic variations occurred prior to the geographic differentiation in both diploids and triploids, and the 45S rDNA cytotype variations occurred after geographic differentiation in the current habitats of L. lancifolium. PMID:27458741

  4. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    PubMed Central

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  5. Independent host switching events by digenean parasites of cetaceans inferred from ribosomal DNA.

    PubMed

    Fraija-Fernández, Natalia; Olson, Peter D; Crespo, Enrique A; Raga, Juan A; Aznar, Francisco J; Fernández, Mercedes

    2015-02-01

    Cetaceans harbour a unique fauna of digeneans whose origin and relationships have sparked considerable debate during recent decades. Disparity in the species reported indicates that they do not share close affinities, but their unusual morphology has made their taxonomic identities and phylogenetic positions uncertain. Here we use sequence data to investigate the phylogenetic relationships of the main species of flukes infecting cetaceans. We sequenced the 18S, 28S and internal transcribed spacer 2 rDNA of digenean species representing all known families reported from cetaceans: Braunina cordiformis (Brauninidae), Ogmogaster antarcticus (Notocotylidae), Pholeter gastrophilus (Heterophyidae), and Campula oblonga, Nasitrema sp. and Oschmarinella rochebruni (Brachycladiidae). The phylogenetic position of the taxa was estimated by Bayesian inference and maximum likelihood incorporating published sequences of 177 species of Digenea. Further Bayesian and maximum likelihood analyses were performed with sequences of 14 Heterophyidae and Opisthorchiidae taxa, incorporating new sequences of P. gastrophilus. Species nominally assigned to the Brachycladiidae formed a clade that was embedded among species of the Acanthocolpidae, thus making the latter family paraphyletic. Braunina cordiformis formed a sister lineage to the Strigeidae and Diplostomidae, whereas O. antarcticus was placed within the Notocotylidae, in agreement with the previous taxonomy of this genus. Similarly, P. gastrophilus was placed within the Heterophyidae as originally described. Our results suggest a paraphyletic relationship between the Heterophyidae and Opisthorchiidae, mirroring the uncertain taxonomic placement of P. gastrophilus, which has been assigned to both families in the past. The digenean families involved are parasites of fish-eating birds and mammals (i.e. Strigeidae, Diplostomidae and Heterophyidae), parasites of marine fish (i.e. Acanthocolpidae) and other herbivorous aquatic birds and

  6. Human acidic ribosomal phosphoproteins P0, P1, and P2: Analysis of cDNA clones, in vitro synthesis, and assembly

    SciTech Connect

    Rich, B.E.; Steitz, J.A.

    1987-11-01

    cDNA clones encoding three antigenically related human ribosomal phosophoproteins (P-proteins) P0, P1, and P2 were isolated and sequenced. P1 and P2 are analogous to Escherichia coli ribosomal protein L7/L12, and P0 is likely to be an analog of L10. The three proteins have a nearly identical carboxy-terminal 17-amino-acid sequence (KEESEESD(D/E)DMGFGLFD-COOH) that is the basis of their immunological cross-reactivity. The identifies of the P1 and P2 cDNAs were confirmed by the strong similarities of their encoded amino acid sequences to published primary structures of the homologous rat, brine shrimp, and Saccharomyces cerevisiae proteins. The P0 cDNA was initially identified by translation of hybrid-selected mRNA and immunoprecipitation of the products. To demonstrate that the coding sequences are full length, the P0, P1, and P2 cDNAs were transcribed in vitro by bacteriophage T7 RNA polymerase and the resulting mRNAs were translated in vitro. The synthetic P0, P1, and P2 proteins were serologically and electrophoretically identical to P-proteins extracted from HeLa cells. These synthetic P-proteins were incorporated into 60S but not 40S ribosomes and also assembled into a complex similar to that described for E. coli L7/L12 and L10.

  7. Brachyspira aalborgi Infection Diagnosed by Culture and 16S Ribosomal DNA Sequencing Using Human Colonic Biopsy Specimens

    PubMed Central

    Kraaz, Wolfgang; Pettersson, Bertil; Thunberg, Ulf; Engstrand, Lars; Fellström, Claes

    2000-01-01

    In this study we report on the isolation and characterization of the intestinal spirochete Brachyspira aalborgi using human mucosal biopsy specimens taken from the colon of a young adult male with intestinal spirochetosis. A selective medium, containing 400 μg of spectinomycin/ml and 5 μg of polymyxin/ml was used for the isolation procedure. A high degree of similarity, in terms of phenotypic properties and 16S ribosomal DNA sequence, was observed between the isolated strain, named W1, and the type strain, 513A, of B. aalborgi. A similarity of 99.7% in the nucleotide sequence was found between W1 and 513AT, based on the almost-complete gene. A short segment of the 16S rRNA gene was amplified by PCR using genetic material enriched from paraffin-embedded biopsy specimens, which were taken from the patient on two occasions. The products showed 16S rRNA gene sequences virtually identical to that of strain 513AT in the actual region. Immunohistochemistry was performed on the colonic biopsy specimens with a polyclonal antibody raised against an intestinal spirochete isolated in a previous case of human intestinal spirochetosis. The antibody reacted strongly with the spirochete on the luminal epithelium. No immune reaction was seen within or below the surface epithelium. Routine histology did not reveal signs of colitis. Electron microscopy showed spirochetes attached end-on to the colonic mucosal surface. The isolate grew poorly on a commonly used selective medium for intestinal spirochetes, which may explain previous failures to isolate B. aalborgi. PMID:11015363

  8. Differentiation of Closely Related Carnobacterium Food Isolates Based on 16S-23S Ribosomal DNA Intergenic Spacer Region Polymorphism

    PubMed Central

    Kabadjova, Petia; Dousset, Xavier; Le Cam, Virginie; Prevost, Hervé

    2002-01-01

    A novel strategy for identification of Carnobacterium food isolates based on restriction fragment length polymorphism (RFLP) of PCR-amplified 16S-23S ribosomal intergenic spacer regions (ISRs) was developed. PCR amplification from all Carnobacterium strains studied always yielded three ISR amplicons, which were designated the small ISR (S-ISR), the medium ISR (M-ISR), and the large ISR (L-ISR). The lengths of these ISRs varied from one species to another. Carnobacterium divergens NCDO 2763T and C. mobile DSM 4849T generated one major S-ISR band (ca. 400 bp) and minor M-ISR and L-ISR bands (ca. 500 and ca. 600 bp, respectively). The ISRs amplified from C. gallinarum NCFB 2766T and C. piscicola NCDO 2762T were larger (S-ISR, ca. 600 bp; M-ISR, ca. 700 bp; and L-ISR, ca. 800 bp). The L-ISR contained two tDNAs coding for tRNAIle and tRNAAla genes. The M-ISR included one tRNAAla gene, and the S-ISR did not contain a tDNA gene. The RFLP scheme devised involves estimation of variable PCR product sizes together with HinfI, TaqI, and HindIII restriction analysis. Forty-two isolates yielded four unique band patterns that correctly resolved these isolates into four Carnobacterium species. This method is very suitable for rapid, low-cost identification of a wide variety of Carnobacterium species without sequencing. PMID:12406725

  9. Reexamination of Culex pipiens Hybridization Zone in the Eastern United States by Ribosomal DNA-Based Single Nucleotide Polymorphism Markers

    PubMed Central

    Huang, Shaoming; Molaei, Goudarz; Andreadis, Theodore G.

    2011-01-01

    Mosquitoes in the Culex pipiens complex are important vectors of several disease-causing pathogens, including West Nile virus. In North America, the complex consists of Cx. pipiens pipiens form pipiens, Cx. pipiens pipiens form molestus, Cx. pipiens quinquefasciatus, and their hybrids that exhibit substantial diversity in physiology, behavior, and geographic range. Hybridization among these mosquitoes is of concern because of potential implications for disease transmission. Currently, several morphological and molecular markers exist for differentiating members of the Cx. pipiens complex; however, these markers have specific limitations. We report here two highly reliable ribosomal DNA-based single nucleotide polymorphism (SNP) markers, CxpG2T and CxpA2d, for detecting Cx. pipiens complex mosquitoes containing Cx. p. quinquefasciatus alleles. Both CxpG2T and CxpA2d contain one allele that is present in all members of the Cx. pipiens complex, and the other allele is specific to Cx. p. quinquefasciatus. Testing of field populations from the eastern United States showed that these two SNP markers are capable of identifying a south to north gradient of Cx. p. quinquefasciatus and hybrids. The northern limit of detection of Cx. p. quinquefasciatus alleles in this study was in Fort Totten, NY (40.79°N), whereas the southern boundary was determined between Atlanta, GA (33.81°N) and Gainesville, FL (29.64°N). CxpG2T and CxpA2d were more accurate than the ACE-2 marker, and they may conceivably provide comparable resolution with microsatellite markers for detecting Cx. p. quinquefasciatus alleles. PMID:21896800

  10. The Ribosome Biogenesis Factor Nol11 Is Required for Optimal rDNA Transcription and Craniofacial Development in Xenopus

    PubMed Central

    Griffin, John N.; Sondalle, Samuel B.; del Viso, Florencia; Baserga, Susan J.; Khokha, Mustafa K.

    2015-01-01

    The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC) of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival. PMID:25756904

  11. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    PubMed

    Griffin, John N; Sondalle, Samuel B; Del Viso, Florencia; Baserga, Susan J; Khokha, Mustafa K

    2015-03-01

    The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC) of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival. PMID:25756904

  12. The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons

    SciTech Connect

    Xiong, Y.; Eickbush, T.H.

    1988-01-01

    Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. The authors present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. The authors therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons.

  13. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  14. Genome differentiation in a species pair of coregonine fishes: an extremely rapid speciation driven by stress-activated retrotransposons mediating extensive ribosomal DNA multiplications

    PubMed Central

    2013-01-01

    Background Sympatric species pairs are particularly common in freshwater fishes associated with postglacial lakes in northern temperate environments. The nature of divergences between co-occurring sympatric species, factors contributing to reproductive isolation and modes of genome evolution is a much debated topic in evolutionary biology addressed by various experimental tools. To the best of our knowledge, nobody approached this field using molecular cytogenetics. We examined chromosomes and genomes of one postglacial species pair, sympatric European winter-spawning Coregonus albula and the local endemic dwarf-sized spring-spawning C. fontanae, both originating in Lake Stechlin. We have employed molecular cytogenetic tools to identify the genomic differences between the two species of the sympatric pair on the sub-chromosomal level of resolution. Results Fluorescence in situ hybridization (FISH) experiments consistently revealed a distinct variation in the copy number of loci of the major ribosomal DNA (the 45S unit) between C. albula and C. fontanae genomes. In C. fontanae, up to 40 chromosomes were identified to bear a part of the major ribosomal DNA, while in C. albula only 8–10 chromosomes possessed these genes. To determine mechanisms how such extensive genome alternation might have arisen, a PCR screening for retrotransposons from genomic DNA of both species was performed. The amplified retrotransposon Rex1 was used as a probe for FISH mapping onto chromosomes of both species. These experiments showed a clear co-localization of the ribosomal DNA and the retrotransposon Rex1 in a pericentromeric region of one or two acrocentric chromosomes in both species. Conclusion We demonstrated genomic consequences of a rapid ecological speciation on the level undetectable by neither sequence nor karyotype analysis. We provide indirect evidence that ribosomal DNA probably utilized the spreading mechanism of retrotransposons subsequently affecting recombination rates

  15. Nuclear-encoded chloroplast ribosomal protein L12 of Nicotiana tabacum: characterization of mature protein and isolation and sequence analysis of cDNA clones encoding its cytoplasmic precursor.

    PubMed Central

    Elhag, G A; Thomas, F J; McCreery, T P; Bourque, D P

    1992-01-01

    Poly(A)+ mRNA isolated from Nicotiana tabacum (cv. Petite Havana) leaves was used to prepare a cDNA library in the expression vector lambda gt11. Recombinant phage containing cDNAs coding for chloroplast ribosomal protein L12 were identified and sequenced. Mature tobacco L12 protein has 44% amino acid identity with ribosomal protein L7/L12 of Escherichia coli. The longest L12 cDNA (733 nucleotides) codes for a 13,823 molecular weight polypeptide with a transit peptide of 53 amino acids and a mature protein of 133 amino acids. The transit peptide and mature protein share 43% and 79% amino acid identity, respectively, with corresponding regions of spinach chloroplast ribosomal protein L12. The predicted amino terminus of the mature protein was confirmed by partial sequence analysis of HPLC-purified tobacco chloroplast ribosomal protein L12. A single L12 mRNA of about 0.8 kb was detected by hybridization of L12 cDNA to poly(A)+ and total leaf RNA. Hybridization patterns of restriction fragments of tobacco genomic DNA probed with the L12 cDNA suggested the existence of more than one gene for ribosomal protein L12. Characterization of a second cDNA with an identical L12 coding sequence but a different 3'-noncoding sequence provided evidence that at least two L12 genes are expressed in tobacco. Images PMID:1542565

  16. Deriving ribosomal binding site (RBS) statistical models from unannotated DNA sequences and the use of the RBS model for N-terminal prediction.

    PubMed

    Hayes, W S; Borodovsky, M

    1998-01-01

    Accurate prediction of the position of translation initiation (N-terminal prediction) is a difficult problem. N-terminal prediction from DNA sequence alone is ambiguous is several candidate start sites are close to each other. Protein similarity search is usually unable to indicate the true start of a gene as it would require a strong protein sequence similarity at the N-terminal portion of a protein where conservative regions are rarely situated. With the aid of the GeneMark program for gene identification, we extract DNA sequence fragments presumably containing ribosome binding sites (RBS) from unannotated complete genomic sequences. These DNA segments are aligned to generate the RBS model using the Gibbs' sampling method. N-terminal prediction is then performed by using the RBS model in conjunction with the GeneMark start codon prediction to aid in determining the true N-terminal site. PMID:9697189

  17. Yeast linker histone Hho1p is required for efficient RNA polymerase I processivity and transcriptional silencing at the ribosomal DNA

    PubMed Central

    Levy, Anat; Eyal, Miri; Hershkovits, Gitit; Salmon-Divon, Mali; Klutstein, Michael; Katcoff, Don Jay

    2008-01-01

    Nucleosome core particles in eukaryotes are linked by a stretch of DNA that is usually associated with a linker histone. Here, we show in yeast, that the presence of yeast linker histone Hho1p represses expression of a pol II transcribed gene (MET15) embedded in the rDNA. In vivo deletions of Hho1p sequences showed that the second globular domain is sufficient for that repression, whereas the presence of the N terminus is required for its derepression. In contrast, a run-on assay confirmed by a ChIP experiment showed that Hho1p is required for maximal pol I processivity during rDNA transcription. Psoralen accessibility experiments indicated that Hho1p is necessary for normal rDNA compaction. DNA array expression analysis comparing RNA transcripts in wild-type and hho1 strains before and after a heat-shock showed that Hho1p is necessary to achieve wild-type mRNA levels of transcripts that encode ribosomal components. Taken together, our results suggest that Hho1p is involved in rDNA compaction, and like core histones, is required for efficient rDNA transcription by pol I. PMID:18687885

  18. Double trouble for grasshopper molecular systematics: intra-individual heterogeneity of both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer ribosomal DNA sequences in Hesperotettix viridis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Hesperotettix viridis grasshoppers (Orthoptera: Acrididae:Melanoplinae) exhibit intra-individual variation in both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer (ITS) ribosomal DNA sequences. These findings violate core assumptions underlying DNA sequence data obtained via pol...

  19. Single-step co-integration of multiple expressible heterologous genes into the ribosomal DNA of the methylotrophic yeast Hansenula polymorpha.

    PubMed

    Klabunde, J; Diesel, A; Waschk, D; Gellissen, G; Hollenberg, C P; Suckow, M

    2002-05-01

    We have investigated the methylotrophic yeast Hansenula polymorpha as a host for the co-integration and expression of multiple heterologous genes using an rDNA integration approach. The ribosomal DNA (rDNA) of H. polymorpha was found to consist of a single rDNA cluster of about 50-60 repeats of an 8-kb unit located on chromosome II. A 2.4-kb segment of H. polymorpha rDNA encompassing parts of the 25S, the complete 5S and the non-transcribed spacer region between 25S and 18S rDNA was isolated and inserted into conventional integrative H. polymorpha plasmids harboring the Saccharomyces- cerevisiae-derived URA3 gene for selection. These rDNA plasmids integrated homologously into the rDNA repeats of a H. polymorpha (odc1) host as several independent clusters. Anticipating that this mode of multiple-cluster integration could be used for the simultaneous integration of several distinct rDNA plasmids, the host strain was co-transformed with a mixture of up to three different plasmids, all bearing the same URA3 selection marker. Transformations indeed resulted in mitotically stable strains harboring one, two, or all three plasmids integrated into the rDNA. The overall copy number of the plasmids integrated did not exceed the number of rDNA repeats present in the untransformed host strain, irrespective of the number of different plasmids involved. Strains harboring different plasmids co-expressed the introduced genes, resulting in functional proteins. Thus, this approach provides a new and attractive tool for the rapid generation of recombinant strains that simultaneously co-produce several proteins in desired stoichiometric ratios. PMID:12021801

  20. The effects of anti-DNA topoisomerase II drugs, etoposide and ellipticine, are modified in root meristem cells of Allium cepa by MG132, an inhibitor of 26S proteasomes.

    PubMed

    Żabka, Aneta; Winnicki, Konrad; Polit, Justyna Teresa; Maszewski, Janusz

    2015-11-01

    DNA topoisomerase II (Topo II), a highly specialized nuclear enzyme, resolves various entanglement problems concerning DNA that arise during chromatin remodeling, transcription, S-phase replication, meiotic recombination, chromosome condensation and segregation during mitosis. The genotoxic effects of two Topo II inhibitors known as potent anti-cancer drugs, etoposide (ETO) and ellipticine (EPC), were assayed in root apical meristem cells of Allium cepa. Despite various types of molecular interactions between these drugs and DNA-Topo II complexes at the chromatin level, which have a profound negative impact on the genome integrity (production of double-strand breaks, chromosomal bridges and constrictions, lagging fragments of chromosomes and their uneven segregation to daughter cell nuclei), most of the elicited changes were apparently similar, regarding both their intensity and time characteristics. No essential changes between ETO- and EPC-treated onion roots were noticed in the frequency of G1-, S-, G2-and M-phase cells, nuclear morphology, chromosome structures, tubulin-microtubule systems, extended distribution of mitosis-specific phosphorylation sites of histone H3, and the induction of apoptosis-like programmed cell death (AL-PCD). However, the important difference between the effects induced by the ETO and EPC concerns their catalytic activities in the presence of MG132 (proteasome inhibitor engaged in Topo II-mediated formation of cleavage complexes) and relates to the time-variable changes in chromosomal aberrations and AL-PCD rates. This result implies that proteasome-dependent mechanisms may contribute to the course of physiological effects generated by DNA lesions under conditions that affect the ability of plant cells to resolve topological problems that associated with the nuclear metabolic activities. PMID:26233708

  1. Three-Dimensional Distribution of UBF and Nopp140 in Relationship to Ribosomal DNA Transcription During Mouse Preimplantation Development.

    PubMed

    Koné, Maïmouna Coura; Fleurot, Renaud; Chebrout, Martine; Debey, Pascale; Beaujean, Nathalie; Bonnet-Garnier, Amélie

    2016-04-01

    The nucleolus is a dynamic nuclear compartment that is mostly involved in ribosome subunit biogenesis; however, it may also play a role in many other biological processes, such as stress response and the cell cycle. Mainly using electron microscopy, several studies have tried to decipher how active nucleoli are set up during early development in mice. In this study, we analyzed nucleologenesis during mouse early embryonic development using 3D-immunofluorescent detection of UBF and Nopp140, two proteins associated with different nucleolar compartments. UBF is a transcription factor that helps maintain the euchromatic state of ribosomal genes; Nopp140 is a phosphoprotein that has been implicated in pre-rRNA processing. First, using detailed image analyses and the in situ proximity ligation assay technique, we demonstrate that UBF and Nopp140 dynamic redistribution between the two-cell and blastocyst stages (time of implantation) is correlated with morphological and structural modifications that occur in embryonic nucleolar compartments. Our results also support the hypothesis that nucleoli develop at the periphery of nucleolar precursor bodies. Finally, we show that the RNA polymerase I inhibitor CX-5461: 1) disrupts transcriptional activity, 2) alters preimplantation development, and 3) leads to a complete reorganization of UBF and Nopp140 distribution. Altogether, our results underscore that highly dynamic changes are occurring in the nucleoli of embryos and confirm a close link between ribosomal gene transcription and nucleologenesis during the early stages of development. PMID:26984997

  2. A mobile group I intron from Physarum polycephalum can insert itself and induce point mutations in the nuclear ribosomal DNA of saccharomyces cerevisiae.

    PubMed Central

    Muscarella, D E; Vogt, V M

    1993-01-01

    Pp LSU3 is a mobile group I intron in the extrachromosomal nuclear ribosomal DNA (rDNA) of Physarum polycephalum. As found for other mobile introns, Pp LSU3 encodes a site-specific endonuclease, I-Ppo, which mediates "homing" to unoccupied target sites in Physarum rDNA. The recognition sequence for this enzyme is conserved in all eucaryotic nuclear rDNAs. We have introduced this intron into a heterologous species, Saccharomyces cerevisiae, in which nuclear group I introns have not been detected. The expression of Pp LSU3, under control of the inducible GAL10 promoter, was found to be lethal as a consequence of double-strand breaks in the rDNA. However, surviving colonies that are resistant to the lethal effects of I-Ppo because of alterations in the rDNA at the cleavage site were recovered readily. These survivors are of two classes. The first comprises cells that acquired one of three types of point mutations. The second comprises cells in which Pp LSU3 became inserted into the rDNA. In both cases, each resistant survivor appears to carry the same alterations in all approximately 150 rDNA repeats. When it is embedded in yeast rDNA, Pp LSU3 leads to the synthesis of I-Ppo and appears to be mobile in appropriate genetic crosses. The existence of yeast cells carrying a mobile intron should allow dissection of the steps that allow expression of the highly unusual I-Ppo gene. Images PMID:8380887

  3. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  4. Characterization of I-Ppo, an intron-encoded endonuclease that mediates homing of a group I intron in the ribosomal DNA of Physarum polycephalum.

    PubMed Central

    Muscarella, D E; Ellison, E L; Ruoff, B M; Vogt, V M

    1990-01-01

    A novel and only recently recognized class of enzymes is composed of the site-specific endonucleases encoded by some group I introns. We have characterized several aspects of I-Ppo, the endonuclease that mediates the mobility of intron 3 in the ribosomal DNA of Physarum polycephalum. This intron is unique among mobile group I introns in that it is located in nuclear DNA. We found that I-Ppo is encoded by an open reading frame in the 5' half of intron 3, upstream of the sequences required for self-splicing of group I introns. Either of two AUG initiation codons could start this reading frame, one near the beginning of the intron and the other in the upstream exon, leading to predicted polypeptides of 138 and 160 amino acid residues. The longer polypeptide was the major form translated in vitro in a reticulocyte extract. From nuclease assays of proteins synthesized in vitro with partially deleted DNAs, we conclude that both polypeptides possess endonuclease activity. We also have expressed I-Ppo in Escherichia coli, using a bacteriophage T7 RNA polymerase expression system. The longer polypeptide also was the predominant form made in this system. It showed enzymatic activity in bacteria in vivo, as demonstrated by the cleavage of a plasmid carrying the target site. Like several other intron-encoded endonucleases, I-Ppo makes a four-base staggered cut in its ribosomal DNA target sequence, very near the site where intron 3 becomes integrated in crosses of intron 3-containing and intron 3-lacking Physarum strains. Images PMID:2355911

  5. New Degenerate Cytophaga-Flexibacter-Bacteroides-Specific 16S Ribosomal DNA-Targeted Oligonucleotide Probes Reveal High Bacterial Diversity in River Taff Epilithon

    PubMed Central

    O’Sullivan, Louise A.; Weightman, Andrew J.; Fry, John C.

    2002-01-01

    River microbial communities play an important role in global nutrient cycles, and aggregated bacteria such as those in epilithic biofilms may be major contributors. In this study the bacterial diversity of River Taff epilithon in South Wales was investigated. A 16S ribosomal DNA (rDNA) clone library was constructed and analyzed by partial sequencing of 76 of 347 clones and hybridization with taxon-specific probes. The epilithon was found to be very diverse, with an estimated 59.6% of the bacterial populations not accounted for by these clones. Members of the Cytophaga-Flexibacter-Bacteroides division (CFBs) were most abundant in the library, representing 25% of clones, followed by members of the α subdivision of the division Proteobacteria (α-Proteobacteria), γ-Proteobacteria, gram-positive bacteria, Cyanobacteria, β-Proteobacteria, δ-Proteobacteria, and the Prosthecobacter group. This study concentrated on the epilithic CFB populations, and a new set of degenerate 16S rDNA probes was developed to enhance their detection, namely, CFB560, CFB562, and CFB376. The commonly used probe CF319a/b may frequently lead to the underestimation of CFB populations in environmental studies, because it does not fully detect members of the division. CFB560 had exact matches to 95.6% of CFBs listed in the Ribosomal Database Project (release 8.0) small-subunit phylogenetic trees, compared to 60% for CF319a/b. The CFB probes detected 66 of 347 epilithon TAF clones, and 60 of these were partially sequenced. They affiliated with the RDP-designated groups Cytophaga, Sphingobacterium, Lewinella, and Cytophaga aurantiaca. CFB560 and CF319a/b detected 94% (62 of 66) and 48.5% (32 of 66) of clones, respectively, and therefore CFB560 is recommended for future use. Probe design in this study illustrated that multiple degenerate positions can greatly increase target range without adversely effecting specificity or experimental performance. PMID:11772628

  6. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    PubMed Central

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  7. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

    PubMed Central

    Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

    2015-01-01

    Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

  8. Detection and quantification of schistosome DNA in freshwater snails using either fluorescent probes in real-time PCR or oligochromatographic dipstick assays targeting the ribosomal intergenic spacer.

    PubMed

    Kane, Richard A; Stothard, J Russell; Rollinson, David; Leclipteux, Thierry; Evraerts, Jonathan; Standley, Claire J; Allan, Fiona; Betson, Martha; Kaba, Rehana; Mertens, Pascal; Laurent, Thierry

    2013-11-01

    Several DNA probes were designed for use in real-time polymerase chain reaction (PCR) assays to target sequence variation within the ribosomal intergenic spacer (IGS) of schistosomes. A sub-section of the IGS (∼300bp) was amplified, with cross-specific primers, after which group-specific fluorescent, locked nucleic acid probes were assessed for their ability to differentiate and quantify DNA from Schistosoma haematobium and Schistosoma mansoni group parasites. A number of fluorescent probe candidates were screened and validated against genomic DNA from adult schistosome worms and laboratory infected freshwater snails. Two fluorescent, locked nucleic acid probes ShaemLNA5 and SmanLNA2, of 20-26bp in length, were identified and found to be effective in providing evidence of infection in field-collected snails. To adapt these real-time PCR assays for more resource-poor laboratory settings, a PCR-restriction fragment length polymorphism (RFLP) assay was developed and primer/probe combinations were modified for use in oligochromatography, a DNA 'dipstick' technology. An appropriate dipstick was developed, inclusive of internal amplification and amplicon migration controls that could be of particular importance for assessing schistosome transmission dynamics. These assays and tools also have future potential for use in detection of schistosome infections in humans and livestock. PMID:22100540

  9. Sequencing of whole plastid genomes and nuclear ribosomal DNA of Diospyros species (Ebenaceae) endemic to New Caledonia: many species, little divergence

    PubMed Central

    Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W.; Samuel, Rosabelle

    2016-01-01

    Background and Aims Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Methods Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. Key Results The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. Conclusions In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with

  10. Specific Detection of Bradyrhizobium and Rhizobium Strains Colonizing Rice (Oryza sativa) Roots by 16S-23S Ribosomal DNA Intergenic Spacer-Targeted PCR

    PubMed Central

    Tan, Zhiyuan; Hurek, Thomas; Vinuesa, Pablo; Müller, Peter; Ladha, Jagdish K.; Reinhold-Hurek, Barbara

    2001-01-01

    In addition to forming symbiotic nodules on legumes, rhizobial strains are members of soil or rhizosphere communities or occur as endophytes, e.g., in rice. Two rhizobial strains which have been isolated from root nodules of the aquatic legumes Aeschynomene fluminensis (IRBG271) and Sesbania aculeata (IRBG74) were previously found to promote rice growth. In addition to analyzing their phylogenetic positions, we assessed the suitability of the 16S-23S ribosomal DNA (rDNA) intergenic spacer (IGS) sequences for the differentiation of closely related rhizobial taxa and for the development of PCR protocols allowing the specific detection of strains in the environment. 16S rDNA sequence analysis (sequence identity, 99%) and phylogenetic analysis of IGS sequences showed that strain IRBG271 was related to but distinct from Bradyrhizobium elkanii. Rhizobium sp. (Sesbania) strain IRBG74 was located in the Rhizobium-Agrobacterium cluster as a novel lineage according to phylogenetic 16S rDNA analysis (96.8 to 98.9% sequence identity with Agrobacterium tumefaciens; emended name, Rhizobium radiobacter). Strain IRBG74 harbored four copies of rRNA operons whose IGS sequences varied only slightly (2 to 9 nucleotides). The IGS sequence analyses allowed intraspecies differentiation, especially in the genus Bradyrhizobium, as illustrated here for strains of Bradyrhizobium japonicum, B. elkanii, Bradyrhizobium liaoningense, and Bradyrhizobium sp. (Chamaecytisus) strain BTA-1. It also clearly differentiated fast-growing rhizobial species and strains, albeit with lower statistical significance. Moreover, the high sequence variability allowed the development of highly specific IGS-targeted nested-PCR assays. Strains IRBG74 and IRBG271 were specifically detected in complex DNA mixtures of numerous related bacteria and in the DNA of roots of gnotobiotically cultured or even of soil-grown rice plants after inoculation. Thus, IGS sequence analysis is an attractive technique for both microbial

  11. Effects of anti-C23 (nucleolin) antibody on transcription of ribosomal DNA in Chironomus salivary gland cells

    SciTech Connect

    Egyhazi, E.; Pigon, A. ); Chang, Jinhong; Ghaffari, S.H.; Dreesen, T.D.; Wellman, S.E.; Case, S.T.; Olson, M.O.J. )

    1988-10-01

    Protein C23 (also called nucleolin or 100-kDa nucleolar protein) is a major nucleolar phosphoprotein involved in ribosome biogenesis. To determine the effects of protein C23 on preribosomal RNA (pre-rRNA) synthesis anti-C23 antiserum was microinjected into nuclei of Chironomus tentans salivary glands. Transcription was measured by incubation of the glands with {sup 32}P-labeled RNA precursors followed by microdissection of nucleoli, RNA extraction, and electrophoretic analyses. Injection of the anti-C23 antibody caused a 2- to 3.5-fold stimulation of {sup 32}P incorporation into 38 S pre-rRNA. No stimulation was observed in salivary glands injected with preimmune serum or antiserum preabsorbed with protein C23. The stimulatory effect was selective for pre-rRNA as indicated by the lack of stimulation of {sup 32}P incorporation into extranucleolar RNA. Injection of the antiserum produced little or no effect on pre-RNA processing as measured by the relative amounts of {sup 32}P-labeled intermediate cleavage products of pre-rRNA in stimulated versus control glands. These results suggest that protein C23 not only is involved in ribosome assembly but also plays a role in regulating the transcription of the preribosomal RNA.

  12. Molecular phylogenetic relationships among members of the family Phytolaccaceae sensu lato inferred from internal transcribed spacer sequences of nuclear ribosomal DNA.

    PubMed

    Lee, J; Kim, S Y; Park, S H; Ali, M A

    2013-01-01

    The phylogeny of a phylogenetically poorly known family, Phytolaccaceae sensu lato (s.l.), was constructed for resolving conflicts concerning taxonomic delimitations. Cladistic analyses were made based on 44 sequences of the internal transcribed spacer of nuclear ribosomal DNA from 11 families (Aizoaceae, Basellaceae, Didiereaceae, Molluginaceae, Nyctaginaceae, Phytolaccaceae s.l., Polygonaceae, Portulacaceae, Sarcobataceae, Tamaricaceae, and Nepenthaceae) of the order Caryophyllales. The maximum parsimony tree from the analysis resolved a monophyletic group of the order Caryophyllales; however, the members, Agdestis, Anisomeria, Gallesia, Gisekia, Hilleria, Ledenbergia, Microtea, Monococcus, Petiveria, Phytolacca, Rivinia, Schindleria, Seguieria, Stegnosperma, and Trichostigma, which belong to the family Phytolaccaceae s.l., did not cluster under a single clade, demonstrating that Phytolaccaceae is polyphyletic. PMID:23479160

  13. Detection and discrimination of Loa loa, Mansonella perstans and Wuchereria bancrofti by PCR-RFLP and nested-PCR of ribosomal DNA ITS1 region.

    PubMed

    Jiménez, Maribel; González, Luis Miguel; Carranza, Cristina; Bailo, Begoña; Pérez-Ayala, Ana; Muro, Antonio; Pérez-Arellano, José Luis; Gárate, Teresa

    2011-01-01

    The ribosomal deoxyribonucleic acid (DNA) internal transcribed spacer region (ITS1) of two filarial nematodes, Loa loa and Mansonella perstans, was amplified and further sequenced to develop an species-specific polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) protocol for the differentiation of both species from Wuchereria bancrofti, three filarial nematodes with blood circulating microfilariae. The ITS1-PCR product digested with the restriction endonuclease Ase I generated an specific diagnostic pattern for each of the three species. Moreover, three new specific nested-PCRs, targeting the ITS1 region, for differential detection of L. loa, M. perstans and W. bancrofti were developed and used when the ITS1-PCR products were insufficient for the Ase I enzymatic digestion. These filarial species-specific molecular protocols were evaluated in forty blood samples from African adult immigrants attending in the Hospital Insular of Gran Canaria, Canarias, Spain. PMID:20599994

  14. Evaluation of the MicroSeq System for Identification of Mycobacteria by 16S Ribosomal DNA Sequencing and Its Integration into a Routine Clinical Mycobacteriology Laboratory

    PubMed Central

    Hall, Leslie; Doerr, Kelly A.; Wohlfiel, Sherri L.; Roberts, Glenn D.

    2003-01-01

    An evaluation of the MicroSeq 500 microbial identification system by nucleic acid sequencing and the Mayo Clinic experience with its integration into a routine clinical laboratory setting are described. Evaluation of the MicroSeq 500 microbial identification system was accomplished with 59 American Type Culture Collection (ATCC) strains and 328 clinical isolates of mycobacteria identified by conventional and 16S ribosomal DNA sequencing by using the MicroSeq 500 microbial identification system. Nucleic acid sequencing identified 58 of 59 (98.3%) ATCC strains to the species level or to the correct group or complex level. The identification results for 219 of 243 clinical isolates (90.1%) with a distance score of <1% were concordant with the identifications made by phenotypic methods. The remaining 85 isolates had distance scores of >1%; 35 (41.1%) were identified to the appropriate species level or group or complex level; 13 (15.3%) were identified to the species level. All 85 isolates were determined to be mycobacterial species, either novel species or species that exhibited significant genotypic divergence from an organism in the database with the closest match. Integration of nucleic acid sequencing into the routine mycobacteriology laboratory and use of the MicroSeq 500 microbial identification system and Mayo Clinic databases containing additional genotypes of common species and added species significantly reduced the number of organisms that could not be identified by phenotypic methods. The turnaround time was shortened to 24 h, and results were reported much earlier. A limited number of species could not be differentiated from one another by 16S ribosomal DNA sequencing; however, the method provides for the identification of unusual species and more accurate identifications and offers the promise of being the most accurate method available. PMID:12682128

  15. An 18S ribosomal DNA barcode for the study of Isomermis lairdi, a parasite of the blackfly Simulium damnosum s.l.

    PubMed

    Crainey, J L; Wilson, M D; Post, R J

    2009-09-01

    The mermithid parasite, Isomermis lairdi Mondet, Poinar & Bernadou (Nematoda: Mermithidae), is known to have a major impact on populations of Simulium damnosum s.l. Theobald (Diptera: Simuliidae) and on their efficiency as vectors of Onchocerca volvulus (Leuckart) (Nematoda: Filarioidea). However, the value of I. lairdi and other mermithid parasites as potential means of integrated vector control has not been fully realized. This is partly because traditional taxonomic approaches have been insufficient for describing and analysing important aspects of their biology and host range. In total, rDNA barcode sequences have been obtained from over 70 I. lairdi mermithids found parasitizing S. damnosum s.l. larvae in three different rivers. No two sequences were found to vary by more than 0.5%, and cytospecies identification of mermithid hosts revealed that I. lairdi with identical rDNA barcodes can parasitize multiple cytoforms of the S. damnosum complex, including S. squamosum (Enderlein). Phylogenetic analysis using a partial sequence from the 18S ribosomal DNA barcode, grouped I. lairdi in a monophyletic group with Gastromermis viridis Welch (Nematoda: Mermithidae) and Isomermis wisconsinensis Welch (Nematoda: Mermithidae). PMID:19712154

  16. Deregulation of Internal Ribosome Entry Site-Mediated p53 Translation in Cancer Cells with Defective p53 Response to DNA Damage

    PubMed Central

    Halaby, Marie-Jo; Harris, Benjamin R. E.; Miskimins, W. Keith; Cleary, Margot P.

    2015-01-01

    Synthesis of the p53 tumor suppressor and its subsequent activation following DNA damage are critical for its protection against tumorigenesis. We previously discovered an internal ribosome entry site (IRES) at the 5′ untranslated region of the p53 mRNA. However, the connection between IRES-mediated p53 translation and p53's tumor suppressive function is unknown. In this study, we identified two p53 IRES trans-acting factors, translational control protein 80 (TCP80), and RNA helicase A (RHA), which positively regulate p53 IRES activity. Overexpression of TCP80 and RHA also leads to increased expression and synthesis of p53. Furthermore, we discovered two breast cancer cell lines that retain wild-type p53 but exhibit defective p53 induction and synthesis following DNA damage. The levels of TCP80 and RHA are extremely low in both cell lines, and expression of both proteins is required to significantly increase the p53 IRES activity in these cells. Moreover, we found cancer cells transfected with a shRNA against TCP80 not only exhibit decreased expression of TCP80 and RHA but also display defective p53 induction and diminished ability to induce senescence following DNA damage. Therefore, our findings reveal a novel mechanism of p53 inactivation that links deregulation of IRES-mediated p53 translation with tumorigenesis. PMID:26391949

  17. DIVERSITY OF BAT-ASSOCIATED LEPTOSPIRA IN THE PERUVIAN AMAZON INFERRED BY BAYESIAN PHYLOGENETIC ANALYSIS OF 16S RIBOSOMAL DNA SEQUENCES

    PubMed Central

    MATTHIAS, MICHAEL A.; DÍAZ, M. MÓNICA; CAMPOS, KALINA J.; CALDERON, MARITZA; WILLIG, MICHAEL R.; PACHECO, VICTOR; GOTUZZO, EDUARDO; GILMAN, ROBERT H.; VINETZ, JOSEPH M.

    2008-01-01

    The role of bats as potential sources of transmission to humans or as maintenance hosts of leptospires is poorly understood. We quantified the prevalence of leptospiral colonization in bats in the Peruvian Amazon in the vicinity of Iquitos, an area of high biologic diversity. Of 589 analyzed bats, culture (3 of 589) and molecular evidence (20 of 589) of leptospiral colonization was found in the kidneys, yielding an overall colonization rate of 3.4%. Infection rates differed with habitat and location, and among different bat species. Bayesian analysis was used to infer phylogenic relationships of leptospiral 16S ribosomal DNA sequences. Tree topologies were consistent with groupings based on DNA-DNA hybridization studies. A diverse group of leptospires was found in peri-Iquitos bat populations including Leptospira interrogans (5 clones), L. kirschneri (1), L. borgpetersenii (4), L. fainei (1), and two previously undescribed leptospiral species (8). Although L. kirschenri and L. interrogans have been previously isolated from bats, this report is the first to describe L. borgpetersenii and L. fainei infection of bats. A wild animal reservoir of L. fainei has not been previously described. The detection in bats of the L. interrogans serovar Icterohemorrhagiae, a leptospire typically maintained by peridomestic rats, suggests a rodent-bat infection cycle. Bats in Iquitos maintain a genetically diverse group of leptospires. These results provide a solid basis for pursuing molecular epidemiologic studies of bat-associated Leptospira, a potentially new epidemiologic reservoir of transmission of leptospirosis to humans. PMID:16282313

  18. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

    PubMed

    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

    2016-08-01

    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  19. Optimization of PCR—RFLP Directly from the Skin and Nails in Cases of Dermatophytosis, Targeting the ITS and the 18S Ribosomal DNA Regions

    PubMed Central

    Elavarashi, Elangovan; Kindo, Anupma Jyoti; Kalyani, Jagannathan

    2013-01-01

    Purpose: A pan fungal primer targeting the Internal Transcribed Spacer (ITS) region and optimization of PCR-RFLP using a dermatophyte specific primer targeted the 18S ribosomal DNA (rDNA) region were performed for the identification of dermatophyte species and strains directly from clinical specimens. Materials and Methods: One hundred and thirty eight specimens (129 skin scrapings and 9 nail clippings) from clinically suspected cases of dermatophytosis were collected and subjected to direct microscopy and culture. Among them, 66 skin scrapings and 3 nail clippings were processed for genotyping by PCR-RFLP analysis using the Mva I, Hae III and the Dde I restriction enzymes. Results: Of the 138 specimens, 81 specimens were positive for dermatophytosis, the most common one being Trichophyton rubrum (47), followed by Trichophyton mentagrophytes (25) and Epidermophyton floccosum (9). Of the 47 T. rubrum isolates, 10 were T. rubrum var. raubitschekii which were identified phenotypically as urease positive and by DNA sequencing. Since they exhibited minor morphological and physiological features, they have currently been synonymized with T. rubrum. Of the 25 T. mentagrophytes isolates, three were Trichophyton interdigitale, which were identified by DNA sequencing. Among the 66 skin specimens smear, culture and PCR showed the presence of dermatophytes in 36 (54.54%), 42 (63.63%) and 47 (71.21%) cases respectively. Among the three nail specimens, only one was found to be positive for dermatophytosis by smear, culture and PCR. Conclusion: Amplification of the dermatophyte specific primer is appropriate in the identification of dermatophytes directly from the clinical material. PCR targeting the ITS region by using the Mva I and the Dde I enzymes was equally good for the RFLP analysis. However, by using the above three restriction enzymes, no strain variations were detected among the T. rubrum and the T. mentagrophytes strains. PMID:23730638

  20. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  1. The DNA virus white spot syndrome virus uses an internal ribosome entry site for translation of the highly expressed nonstructural protein ICP35.

    PubMed

    Kang, Shih-Ting; Wang, Han-Ching; Yang, Yi-Ting; Kou, Guang-Hsiung; Lo, Chu-Fang

    2013-12-01

    Although shrimp white spot syndrome virus (WSSV) is a large double-stranded DNA virus (∼300 kbp), it expresses many polycistronic mRNAs that are likely to use internal ribosome entry site (IRES) elements for translation. A polycistronic mRNA encodes the gene of the highly expressed nonstructural protein ICP35, and here we use a dual-luciferase assay to demonstrate that this protein is translated cap independently by an IRES element located in the 5' untranslated region of icp35. A deletion analysis of this region showed that IRES activity was due to stem-loops VII and VIII. A promoterless assay, a reverse transcription-PCR together with quantitative real-time PCR analysis, and a stable stem-loop insertion upstream of the Renilla luciferase open reading frame were used, respectively, to rule out the possibility that cryptic promoter activity, abnormal splicing, or read-through was contributing to the IRES activity. In addition, a Northern blot analysis was used to confirm that only a single bicistronic mRNA was expressed. The importance of ICP35 to viral replication was demonstrated in a double-stranded RNA (dsRNA) interference knockdown experiment in which the mortality of the icp35 dsRNA group was significantly reduced. Tunicamycin was used to show that the α subunit of eukaryotic initiation factor 2 is required for icp35 IRES activity. We also found that the intercalating drug quinacrine significantly inhibited icp35 IRES activity in vitro and reduced the mortality rate and viral copy number in WSSV-challenged shrimp. Lastly, in Sf9 insect cells, we found that knockdown of the gene for the Spodoptera frugiperda 40S ribosomal protein RPS10 decreased icp35 IRES-regulated firefly luciferase activity but had no effect on cap-dependent translation. PMID:24089551

  2. Ultrastructural characteristics and small subunit ribosomal DNA sequence of Vairimorpha cheracis sp. nov., (Microspora: Burenellidae), a parasite of the Australian yabby, Cherax destructor (Decapoda: Parastacidae).

    PubMed

    Moodie, Elizabeth G; Le Jambre, Leo F; Katz, Margaret E

    2003-11-01

    This is the first record of a species of Vairimorpha infecting a crustacean host. Vairimorpha cheracis sp. nov. was found in a highland population of the Australian freshwater crayfish, Cherax destructor. The majority of spores and earlier developmental stages of V. cheracis sp. nov. were found within striated muscle cells of the thorax, abdomen, and appendages of the crayfish. Only octosporoblastic sporogony within sporophorous vesicles (SPVs) was observed. Diplokaryotic sporonts separated into two uninucleate daughter cells, each of which gave rise to four sporoblasts in a rosette-shaped plasmodium, so that eight uninucleate spores were produced within the persistent ovoid SPV. Ultrastructural features of stages in the octosporoblastic sequence were similar to those described for Vairimorpha necatrix, the type species. Mature spores were pyriform in shape and averaged 3.4x1.9 microm in dimensions. The anterior polaroplast was lamellar in structure, and the posterior polaroplast vesicular. The polar filament was coiled 10-12 times, lateral to the posterior vacuole. The small subunit ribosomal DNA (SSU rDNA) of V. cheracis sp. nov. was sequenced and compared with other microsporidia. V. cheracis sp. nov. showed over 97% sequence identity with Vairimorpha imperfecta and five species of Nosema, and only 86% sequence identity with V. necatrix. The need for a taxonomic revision of the Nosema/Vairimorpha group of species is discussed. PMID:14726242

  3. Ribosomal DNA internal transcribed spacer sequences do not support the species status of Ampelomyces quisqualis, a hyperparasite of powdery mildew fungi.

    PubMed

    Kiss, L; Nakasone, K K

    1998-05-01

    Phylogenetic relationships among Ampelomyces isolates, pycnidial hyperparasites and biological control agents of powdery mildews, were inferred from internal transcribed spacer (ITS) sequences of the ribosomal DNA (rDNA). Currently, these hyperparasites are considered to be a single species, A. quisqualis, despite observed morphological and cultural differences. Ten Ampelomyces isolates, representing seven previously defined ITS RFLP groups, were sequenced and analyzed. Sequence-divergence values among isolates belonging to different RFLP groups ranged from 4.3 to 22.4%, suggesting that these isolates may represent different taxa. When Ampelomyces ITS sequences were analyzed by cladistic methods with the sequences of other ascomycetous fungi, they formed two lineages in the Dothideales. Slow-growing Ampelomyces isolates formed a clade with Leptosphaeria microscopica and L. nodorum, whereas fast-growing Ampelomyces isolates formed a clade with Epicoccum nigrum. Sequence-divergence values between these two clades ranged from 17.3 to 22.4%, suggesting that the taxa in the two clades are not closely related and possibly not congeneric. The data presented here indicate that the identification of 'A. quisqualis' isolates used in biological control experiments should be re-evaluated. PMID:9618587

  4. Prospective Study of Use of PCR Amplification and Sequencing of 16S Ribosomal DNA from Cerebrospinal Fluid for Diagnosis of Bacterial Meningitis in a Clinical Setting

    PubMed Central

    Schuurman, Tim; de Boer, Richard F.; Kooistra-Smid, Anna M. D.; van Zwet, Anton A.

    2004-01-01

    We have evaluated the use of a broad-range PCR aimed at the 16S rRNA gene in detecting bacterial meningitis in a clinical setting. To achieve a uniform DNA extraction procedure for both gram-positive and gram-negative organisms, a combination of physical disruption (bead beating) and a silica-guanidiniumthiocyanate procedure was used for nucleic acid preparation. To diminish the risk of contamination as much as possible, we chose to amplify almost the entire 16S rRNA gene. The analytical sensitivity of the assay was approximately 1 × 102 to 2 × 102 CFU/ml of cerebrospinal fluid (CSF) for both gram-negative and gram-positive bacteria. In a prospective study of 227 CSF samples, broad-range PCR proved to be superior to conventional methods in detecting bacterial meningitis when antimicrobial therapy had already started. Overall, our assay showed a sensitivity of 86%, a specificity of 97%, a positive predictive value of 80%, and a negative predictive value of 98% compared to culture. We are currently adapting the standard procedures in our laboratory for detecting bacterial meningitis; broad-range 16S ribosomal DNA PCR detection is indicated when antimicrobial therapy has already started at time of lumbar puncture or when cultures remain negative, although the suspicion of bacterial meningitis remains. PMID:14766845

  5. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA

    PubMed Central

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2015-01-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift–mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicumchinense and Capsicumfrutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili. PMID:26862481

  6. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    PubMed

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili. PMID:26862481

  7. Evolution of the assassin's arms: insights from a phylogeny of combined transcriptomic and ribosomal DNA data (Heteroptera: Reduvioidea).

    PubMed

    Zhang, Junxia; Gordon, Eric R L; Forthman, Michael; Hwang, Wei Song; Walden, Kim; Swanson, Daniel R; Johnson, Kevin P; Meier, Rudolf; Weirauch, Christiane

    2016-01-01

    Assassin bugs (Reduvioidea) are one of the most diverse (>7,000 spp.) lineages of predatory animals and have evolved an astounding diversity of raptorial leg modifications for handling prey. The evolution of these modifications is not well understood due to the lack of a robust phylogeny, especially at deeper nodes. We here utilize refined data from transcriptomes (370 loci) to stabilize the backbone phylogeny of Reduvioidea, revealing the position of major clades (e.g., the Chagas disease vectors Triatominae). Analyses combining transcriptomic and Sanger-sequencing datasets result in the first well-resolved phylogeny of Reduvioidea. Despite amounts of missing data, the transcriptomic loci resolve deeper nodes while the targeted ribosomal genes anchor taxa at shallower nodes, both with high support. This phylogeny reveals patterns of raptorial leg evolution across major leg types. Hairy attachment structures (fossula spongiosa), present in the ancestor of Reduvioidea, were lost multiple times within the clade. In contrast to prior hypotheses, this loss is not directly correlated with the evolution of alternative raptorial leg types. Our results suggest that prey type, predatory behavior, salivary toxicity, and morphological adaptations pose intricate and interrelated factors influencing the evolution of this diverse group of predators. PMID:26916580

  8. Evolution of the assassin’s arms: insights from a phylogeny of combined transcriptomic and ribosomal DNA data (Heteroptera: Reduvioidea)

    PubMed Central

    Zhang, Junxia; Gordon, Eric R. L.; Forthman, Michael; Hwang, Wei Song; Walden, Kim; Swanson, Daniel R.; Johnson, Kevin P.; Meier, Rudolf; Weirauch, Christiane

    2016-01-01

    Assassin bugs (Reduvioidea) are one of the most diverse (>7,000 spp.) lineages of predatory animals and have evolved an astounding diversity of raptorial leg modifications for handling prey. The evolution of these modifications is not well understood due to the lack of a robust phylogeny, especially at deeper nodes. We here utilize refined data from transcriptomes (370 loci) to stabilize the backbone phylogeny of Reduvioidea, revealing the position of major clades (e.g., the Chagas disease vectors Triatominae). Analyses combining transcriptomic and Sanger-sequencing datasets result in the first well-resolved phylogeny of Reduvioidea. Despite amounts of missing data, the transcriptomic loci resolve deeper nodes while the targeted ribosomal genes anchor taxa at shallower nodes, both with high support. This phylogeny reveals patterns of raptorial leg evolution across major leg types. Hairy attachment structures (fossula spongiosa), present in the ancestor of Reduvioidea, were lost multiple times within the clade. In contrast to prior hypotheses, this loss is not directly correlated with the evolution of alternative raptorial leg types. Our results suggest that prey type, predatory behavior, salivary toxicity, and morphological adaptations pose intricate and interrelated factors influencing the evolution of this diverse group of predators. PMID:26916580

  9. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  10. Identification of Nonpoint Sources of Fecal Pollution in Coastal Waters by Using Host-Specific 16S Ribosomal DNA Genetic Markers from Fecal Anaerobes

    PubMed Central

    Bernhard, Anne E.; Field, Katharine G.

    2000-01-01

    We describe a new PCR-based method for distinguishing human and cow fecal contamination in coastal waters without culturing indicator organisms, and we show that the method can be used to track bacterial marker sequences in complex environments. We identified two human-specific genetic markers and five cow-specific genetic markers in fecal samples by amplifying 16S ribosomal DNA (rDNA) fragments from members of the genus Bifidobacterium and the Bacteroides-Prevotella group and performing length heterogeneity PCR and terminal restriction fragment length polymorphism analyses. Host-specific patterns suggested that there are species composition differences in the Bifidobacterium and Bacteroides-Prevotella populations of human and cow feces. The patterns were highly reproducible among different hosts belonging to the same species. Additionally, all host-specific genetic markers were detected in water samples collected from areas frequently contaminated with fecal pollution. Ease of detection and longer survival in water made Bacteroides-Prevotella indicators better than Bifidobacterium indicators. Fecal 16S rDNA sequences corresponding to our Bacteroides-Prevotella markers comprised closely related gene clusters, none of which exactly matched previously published Bacteroides or Prevotella sequences. Our method detected host-specific markers in water at pollutant concentrations of 2.8 × 10−5 to 2.8 × 10−7 g (dry weight) of feces/liter and 6.8 × 10−7 g (dry weight) of sewage/liter. Although our aim was to identify nonpoint sources of fecal contamination, the method described here should be widely applicable for monitoring spatial and temporal fluctuations in specific bacterial groups in natural environments. PMID:10742246

  11. Development of molecular markers, based on chloroplast and ribosomal DNA regions, to discriminate three popular medicinal plant species, Cynanchum wilfordii, Cynanchum auriculatum, and Polygonum multiflorum.

    PubMed

    Han, Eun-Heui; Cho, KyeMan; Goo, YoungMin; Kim, ManBae; Shin, Young-Wook; Kim, Yun-Hee; Lee, Shin-Woo

    2016-04-01

    Identification of plant species is important for standardizing herbal medicine. Cynanchum wilfordii (Baekshuoh in Korean) and Polygonum multiflorum (Hashuoh in Korean) are important oriental medicinal herbs in Korea, Japan, and China. Cynanchum auriculatum is a faster growing and more productive plant than C. wilfordii; and, it is not recognized as a medicinal plant in the Korean Pharmacopoeia. C. wilfordii, P. multiflorum, and C. auriculatum are often misidentified in the Korean herbal medicine marketplace due to their morphological similarities and similar names. In this study, we investigated molecular authentication of these three medicinal plants using DNA sequences in the TrnL-F chloroplast intergenic region. Specific species identification was achieved by detecting allelic variations of single nucleotide polymorphisms (SNPs) using amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) and high resolution melting curve analysis. Our results demonstrate that the intraspecific genetic distance between C. wilfordii and C. auriculatum is relatively low. We also developed a quantitative PCR assay using species-specific TrnL-F primers, which allowed us to estimate the ratio of C. wilfordii and C. auriculatum using varying ratios of mixed genomic DNA template from the two species. Additionally, to identify species in hybrid plants produced by cross-fertilization, we analyzed nuclear ribosomal DNA internal transcribed spacer regions in C. wilfordii and C. auriculatum by ARMS-PCR. Our results indicate that SNP-based molecular markers, usable to barcode tools could provide efficient and rapid authentication of these closely related medicinal plant species, and will be useful for preventing the distribution of products contaminated with adulterants. PMID:26902862

  12. Molecular systematics of Gagea and Lloydia (Liliaceae; Liliales): implications of analyses of nuclear ribosomal and plastid DNA sequences for infrageneric classification

    PubMed Central

    Zarrei, M.; Wilkin, P.; Fay, M. F.; Ingrouille, M. J.; Zarre, S.; Chase, M. W.

    2009-01-01

    Background and Aims Gagea is a Eurasian genus of petaloid monocots, with a few species in North Africa, comprising between 70 and approximately 275 species depending on the author. Lloydia (thought to be the closest relative of Gagea) consists of 12–20 species that have a mostly eastern Asian distribution. Delimitation of these genera and their subdivisions are unresolved questions in Liliaceae taxonomy. The objective of this study is to evaluate generic and infrageneric circumscription of Gagea and Lloydia using DNA sequence data. Methods A phylogenetic study of Gagea and Lloydia (Liliaceae) was conducted using sequences of nuclear ribosomal internal transcribed spacer (ITS) and plastid (rpl16 intron, trnL intron, trnL-F spacer, matK and the psbA-trnH spacer) DNA regions. This included 149 accessions (seven as outgroups), with multiple accessions of some taxa; 552 sequences were included, of which 393 were generated as part of this research. Key Results A close relationship of Gagea and Lloydia was confirmed in analyses using different datasets, but neither Gagea nor Lloydia forms a monophyletic group as currently circumscribed; however, the ITS and plastid analyses did not produce congruent results for the placement of Lloydia relative to the major groups within Gagea. Gagea accessions formed five moderately to strongly supported clades in all trees, with most Lloydia taxa positioned at the basal nodes; in the strict consensus trees from the combined data a basal polytomy occurs. There is limited congruence between the classical, morphology-derived infrageneric taxonomy in Gagea (including Lloydia) and clades in the present phylogenetic analyses. Conclusions The analyses support monophyly of Gagea/Lloydia collectively, and they clearly comprise a single lineage, as some previous authors have hypothesized. The results provide the basis for a new classification of Gagea that has support from some morphological features. Incongruence between plastid and nuclear

  13. Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA sequences.

    PubMed Central

    Vilgalys, R; Sun, B L

    1994-01-01

    Evidence from molecular systematic studies suggests that many mushroom species may be quite ancient. Gene phylogenies were developed to examine the relationship between reproductive isolation, genetic divergence, and biogeography in oyster mushrooms (Pleurotus). Sequence data were obtained for two regions of DNA from populations belonging to eight intersterility groups (biological species). Phylogenetic analysis of sequences from the 5' portion of the nuclear encoded large subunit rDNA demonstrates an ancient origin for four intersterility groups of broad geographic distribution (world-wide), with a more recent radiation of several intersterility groups that are restricted to the Northern Hemisphere. An expanded analysis using sequence data from the more variable rDNA internal transcribed spacer region also reveals a phylogenetically based pattern of genetic divergence associated with allopatric speciation among populations from different continents in the Northern Hemisphere. The ability of rDNA sequences to resolve phylogenetic relationships among geographically isolated populations within intersterility groups illustrates the importance of biogeography for understanding speciation in Pleurotus. Patterns of geographic distribution among intersterility groups suggest that several species lineages evolved quite early, with recently evolved groups restricted to the Northern Hemisphere and older lineages occurring throughout the world. Based on phylogenetic evidence, analysis of historical biogeography using area cladograms shows that multiple dispersal and vicariance events are responsible for patterns of speciation observed. Images PMID:8183955

  14. Characterization of the nuclear ribosomal DNA units and phylogeny of Beta L. wild forms and cultivated beets.

    PubMed

    Santoni, S; Bervillé, A

    1992-03-01

    The nuclear rDNA units of species belonging to the genus Beta were characterized using heterologous probes of flax (entire unit and 25S) and sunflower (6.1-kb Eco fragment containing the 18S, the entire intergenic spacer (IGS) and a small piece of the 25S). The physical maps of one species from each section of the genus was constructed by localization of the EcoRI, BamHI, HindIII, KpnI and SacI restriction sites. For each species a single individual was used to obtain total DNA. The major unit length is 11 kb, but variant length units at 10.4, 10.7 and 11.3 kb were found as minor forms. However, some individuals carried the 10.4-kb or the 10.7-kb variant length unit as the major form. For the variant length units of one species the restriction sites were conserved, so that the variation in length occurred in the IGS. The EcoRI fragment corresponding to the intergenic spacer appeared to be the best indicator of variation. The variable sequence in the IGS sometimes generated new restriction sites for the Corollinae and mainly, did so, for the Vulgares relative to the Procumbentes. The variable sites were able, to differentiate the three sections and species within the sections. Corollinae species belong to two different groups according to the absence or the presence of the BamHI (B4) site. The Vulgares species contain several unit types. We proposed that all the unit types derived from a unique unit, V-11-2.3, by unequal crossing-overs or conversion. We also supposed a homogenization mechanism because we found individuals homogeneous for every unit type. Among the cultivated beets, all the root beets contain only one rDNA unit type, V-11-2.9. Thus, we supposed that the common unit type of cultivated beets either brings a physiological advantage or is strictly linked to a favorable allele. It is likely that the rDNA unit of B. maritima were eliminated from sugar beet by the breeding process since they were not recovered. Whatever the process, we deduced that all the

  15. Molecular characterization by amplified ribosomal DNA restriction analysis and antimicrobial potential of endophytic fungi isolated from Luehea divaricata (Malvaceae) against plant pathogenic fungi and pathogenic bacteria.

    PubMed

    Bernardi-Wenzel, J; Garcia, A; Azevedo, J L; Pamphile, J A

    2013-01-01

    Luehea divaricata is an important plant in popular medicine; it is used for its depurative, anti-inflammatory, and other therapeutic activities. We evaluated the antimicrobial activity of endophytic fungi isolated from leaves of L. divaricata against phytopathogens and pathogenic bacteria, and characterized the isolates based on amplified ribosomal DNA restriction analysis (ARDRA). The in vitro antagonistic activity of these endophytes against the phytopathogen Alternaria alternata was assayed by dual culture technique. Based on this evaluation of antimicrobial activity, we extracted secondary metabolites from nine endophytic fungi by partitioning in ethyl acetate and methanol. These were tested against the phytopathogens A. alternata, Colletotrichum sp and Moniliophthora perniciosa, and against the human pathogenic bacteria Escherichia coli and Staphylococcus aureus. Molecular characterization by ARDRA technique was used for phylogenetic analysis, based on comparison with sequences in GenBank. The endophytes had varied effects on A. alternata. One isolate produced an inhibition halo against M. perniciosa and against E. coli. This antibiosis activity indicates a role in the protection of the plant against microbial pathogens in nature, with potential for pharmaceutical and agricultural applications. Based on ARDRA, the 13 isolates were grouped. We found three different haplotypes of Phomopsis sp, showing interspecific variability. It appears that examination of the microbial community associated with medicinal plants of tropical regions has potential as a useful strategy to look for species with biotechnological applications. PMID:24301768

  16. Detection and Identification of Lactobacillus Species in Crops of Broilers of Different Ages by Using PCR-Denaturing Gradient Gel Electrophoresis and Amplified Ribosomal DNA Restriction Analysis

    PubMed Central

    Guan, Le Luo; Hagen, Karen E.; Tannock, Gerald W.; Korver, Doug R.; Fasenko, Gaylene M.; Allison, Gwen E.

    2003-01-01

    The microflora of the crop was investigated throughout the broiler production period (0 to 42 days) using PCR combined with denaturing gradient gel electrophoresis (PCR-DGGE) and selective bacteriological culture of lactobacilli followed by amplified ribosomal DNA restriction analysis (ARDRA). The birds were raised under conditions similar to those used in commercial broiler production. Lactobacilli predominated and attained populations of 108 to 109 CFU per gram of crop contents. Many of the lactobacilli present in the crop (61.9% of isolates) belonged to species of the Lactobacillus acidophilus group and could not be differentiated by PCR-DGGE. A rapid and simple ARDRA method was developed to distinguish between the members of the L. acidophilus group. HaeIII-ARDRA was used for preliminary identification of isolates in the L. acidophilus group and to identify Lactobacillus reuteri and Lactobacillus salivarius. MseI-ARDRA generated unique patterns for all species of the L. acidophilus group, identifying Lactobacillus crispatus, Lactobacillus johnsonii, and Lactobacillus gallinarum among crop isolates. The results of our study provide comprehensive knowledge of the Lactobacillus microflora in the crops of birds of different ages using nucleic acid-based methods of detection and identification based on current taxonomic criteria. PMID:14602636

  17. Nonisotopic single-strand conformation polymorphism analysis of sequence variability in ribosomal DNA expansion segments within the genus Trichinella (Nematoda: Adenophorea).

    PubMed

    Gasser, Robin B; Hu, Min; Abs El-Osta, Youssef G; Zarlenga, Dante S; Pozio, Edoardo

    2004-10-01

    A nonisotopic single-strand conformation polymorphism (SSCP) approach was employed to 'fingerprint' sequence variability in the expansion segment 5 (ES5) of domain IV and the D3 domain of nuclear ribosomal DNA within and/or among isolates and individual muscle (first-stage) larvae representing all currently recognized species/genotypes of Trichinella. In addition, phylogenetic analyses of the D3 sequence data set, employing three different tree-building algorithms, examined the relationships among all of them. These analyses showed strong support that the encapsulated species T. spiralis and T. nelsoni formed a group to the exclusion of the other encapsulated species T. britovi and its related genotypes Trichinella T8 and T9 and T. murrelli, and T. nativa and Trichinella T6, and strong support that T. nativa and Trichinella T6 grouped together. Also, these eight encapsulated members grouped to the exclusion of the nonencapsulated species T. papuae and T. zimbabwensis and the three representatives of T. pseudospiralis investigated. The findings showed that nonencapsulated species constitute a complex group which is distinct from the encapsulated species and supported the current hypothesis that encapsulated Trichinella group external to the nonencapsulated forms, in accordance with independent biological and biochemical data sets. PMID:15490459

  18. Turnover of R1 (Type I) and R2 (Type Ii) Retrotransposable Elements in the Ribosomal DNA of Drosophila Melanogaster

    PubMed Central

    Jakubczak, J. L.; Zenni, M. K.; Woodruff, R. C.; Eickbush, T. H.

    1992-01-01

    R1 and R2 are distantly related non-long terminal repeat retrotransposable elements each of which inserts into a specific site in the 28S rRNA genes of most insects. We have analyzed aspects of R1 and R2 abundance and sequence variation in 27 geographical isolates of Drosophila melanogaster. The fraction of 28S rRNA genes containing these elements varied greatly between strains, 17-67% for R1 elements and 2-28% for R2 elements. The total percentage of the rDNA repeats inserted ranged from 32 to 77%. The fraction of the rDNA repeats that contained both of these elements suggested that R1 and R2 exhibit neither an inhibition of nor preference for insertion into a 28S gene already containing the other type of element. Based on the conservation of restriction sites in the elements of all strains, and sequence analysis of individual elements from three strains, nucleotide divergence is very low for R1 and R2 elements within or between strains (<0.6%). This sequence uniformity is the expected result of the forces of concerted evolution (unequal crossovers and gene conversion) which act on the rRNA genes themselves. Evidence for the role of retrotransposition in the turnover of R1 and R2 was obtained by using naturally occurring 5' length polymorphisms of the elements as markers for independent transposition events. The pattern of these different length 5' truncations of R1 and R2 was found to be diverse and unique to most strains analyzed. Because recombination can only, with time, amplify or eliminate those length variants already present, the diversity found in each strain suggests that retrotransposition has played a critical role in maintaining these elements in the rDNA repeats of D. melanogaster. PMID:1317313

  19. PFR²: a curated database of planktonic foraminifera 18S ribosomal DNA as a resource for studies of plankton ecology, biogeography and evolution.

    PubMed

    Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban

    2015-11-01

    Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent. PMID:25828689

  20. The nuclear ribosomal DNA intergenic spacer as a target sequence to study intraspecific diversity of the ectomycorrhizal basidiomycete Hebeloma cylindrosporum directly on pinus root systems.

    PubMed

    Guidot, A; Lumini, E; Debaud, J C; Marmeisse, R

    1999-03-01

    Polymorphism of the nuclear ribosomal DNA intergenic spacer (IGS) of the ectomycorrhizal basidiomycete Hebeloma cylindrosporum was studied to evaluate whether this sequence could be used in field studies to estimate the diversity of strains forming mycorrhizas on individual Pinus pinaster root systems. This sequence was amplified by PCR from 125 haploid homokaryotic strains collected in 14 P. pinaster stands along the Atlantic coast of France by using conserved oligonucleotide primers. Restriction enzyme digestion of the amplified 3.4-kbp-long IGS allowed us to characterize 24 alleles whose frequencies differed. Nine of these alleles were found only once, whereas about 60% of the strains contained four of the alleles. Local populations could be almost as diverse as the entire population along a 150-km stretch of coastline that was examined; for example, 13 alleles were found in a single forest stand. The IGS from one strain was partially sequenced, and the sequence data were used to design oligonucleotides which allowed separate PCR amplification of three different segments of the IGS. Most polymorphisms observed among the full-length IGS regions resulted from polymorphisms in an internal ca. 1,500-bp-long sequence characterized by length variations that may have resulted from variable numbers of a T2AG3 motif. This internal polymorphic sequence could not be amplified from the genomes of nine other Hebeloma species. Analysis of this internal sequence amplified from the haploid progenies of 10 fruiting bodies collected in a 70-m2 area resulted in identification of six allelic forms and seven distinct diplotypes out of the 21 possible different combinations. Moreover, optimization of the PCR conditions resulted in amplification of this sequence from more than 80% of the DNA samples extracted from individual H. cylindrosporum infected P. pinaster mycorrhizal root tips, thus demonstrating the usefulness of this sequence for studying the below-ground diversity of

  1. The Nuclear Ribosomal DNA Intergenic Spacer as a Target Sequence To Study Intraspecific Diversity of the Ectomycorrhizal Basidiomycete Hebeloma cylindrosporum Directly on Pinus Root Systems

    PubMed Central

    Guidot, Alice; Lumini, Erica; Debaud, Jean-Claude; Marmeisse, Roland

    1999-01-01

    Polymorphism of the nuclear ribosomal DNA intergenic spacer (IGS) of the ectomycorrhizal basidiomycete Hebeloma cylindrosporum was studied to evaluate whether this sequence could be used in field studies to estimate the diversity of strains forming mycorrhizas on individual Pinus pinaster root systems. This sequence was amplified by PCR from 125 haploid homokaryotic strains collected in 14 P. pinaster stands along the Atlantic coast of France by using conserved oligonucleotide primers. Restriction enzyme digestion of the amplified 3.4-kbp-long IGS allowed us to characterize 24 alleles whose frequencies differed. Nine of these alleles were found only once, whereas about 60% of the strains contained four of the alleles. Local populations could be almost as diverse as the entire population along a 150-km stretch of coastline that was examined; for example, 13 alleles were found in a single forest stand. The IGS from one strain was partially sequenced, and the sequence data were used to design oligonucleotides which allowed separate PCR amplification of three different segments of the IGS. Most polymorphisms observed among the full-length IGS regions resulted from polymorphisms in an internal ca. 1,500-bp-long sequence characterized by length variations that may have resulted from variable numbers of a T2AG3 motif. This internal polymorphic sequence could not be amplified from the genomes of nine other Hebeloma species. Analysis of this internal sequence amplified from the haploid progenies of 10 fruiting bodies collected in a 70-m2 area resulted in identification of six allelic forms and seven distinct diplotypes out of the 21 possible different combinations. Moreover, optimization of the PCR conditions resulted in amplification of this sequence from more than 80% of the DNA samples extracted from individual H. cylindrosporum infected P. pinaster mycorrhizal root tips, thus demonstrating the usefulness of this sequence for studying the below-ground diversity of

  2. Ribo HRM--detection of inter- and intra-species polymorphisms within ribosomal DNA by high resolution melting analysis supported by application of artificial allelic standards.

    PubMed

    Masny, Aleksander; Jagiełło, Agata; Płucienniczak, Grażyna; Golab, Elzbieta

    2012-09-01

    Ribo HRM, a single-tube PCR and high resolution melting (HRM) assay for detection of polymorphisms in the large subunit ribosomal DNA expansion segment V, was developed on a Trichinella model. Four Trichinella species: T. spiralis (isolates ISS3 and ISS160), T. nativa (isolates ISS10 and ISS70), T. britovi (isolates ISS2 and ISS392) and T. pseudospiralis (isolates ISS13 and ISS1348) were genotyped. Cloned allelic variants of the expansion segment V were used as standards to prepare reference HRM curves characteristic for single sequences and mixtures of several cloned sequences imitating allelic composition detected in Trichinella isolates. Using the primer pair Tsr1 and Trich1bi, it was possible to amplify a fragment of the ESV and detect PCR products obtained from the genomic DNA of pools of larvae belonging to the four investigated species: T. pseudospiralis, T. spiralis, T. britovi and T. nativa, in a single tube Real-Time PCR reaction. Differences in the shape of the HRM curves of Trichinella isolates suggested the presence of differences between examined isolates of T. nativa, T. britovi and T. pseudospiralis species. No differences were observed between T. spiralis isolates. The presence of polymorphisms within the amplified ESV sequence fragment of T. nativa T. britovi and T. pseudospiralis was confirmed by sequencing of the cloned PCR products. Novel sequences were discovered and deposited in GenBank (GenBank IDs: JN971020-JN971027, JN120902.1, JN120903.1, JN120904.1, JN120906.1, JN120905.1). Screening the ESV region of Trichinella for polymorphism is possible using the genotyping assay Ribo HRM at the current state of its development. The Ribo HRM assay could be useful in phylogenetic studies of the Trichinella genus. PMID:22766326

  3. Phylogeny of the sundews, Drosera (Droseraceae), based on chloroplast rbcL and nuclear 18S ribosomal DNA Sequences.

    PubMed

    Rivadavia, Fernando; Kondo, Katsuhiko; Kato, Masahiro; Hasebe, Mitsuyasu

    2003-01-01

    The sundew genus Drosera consists of carnivorous plants with active flypaper traps and includes nearly 150 species distributed mainly in Australia, Africa, and South America, with some Northern Hemisphere species. In addition to confused intrageneric classification of Drosera, the intergeneric relationships among the Drosera and two other genera in the Droseraceae with snap traps, Dionaea and Aldrovanda, are problematic. We conducted phylogenetic analyses of DNA sequences of the chloroplast rbcL gene for 59 species of Drosera, covering all sections except one. These analyses revealed that five of 11 sections, including three monotypic sections, are polyphyletic. Combined rbcL and 18S rDNA sequence data were used to infer phylogenetic relationships among Drosera, Dionaea, and Aldrovanda. This analysis revealed that all Drosera species form a clade sister to a clade including Dionaea and Aldrovanda, suggesting that the snap traps of Aldrovanda and Dionaea are homologous despite their morphological differences. MacClade reconstructions indicated that multiple episodes of aneuploidy occurred in a clade that includes mainly Australian species, while the chromosome numbers in the other clades are not as variable. Drosera regia, which is native to South Africa, and most species native to Australia, were clustered basally, suggesting that Drosera originated in Africa or Australia. The rbcL tree indicates that Australian species expanded their distribution to South America and then to Africa. Expansion of distribution to the Northern Hemisphere from the Southern Hemispere occurred in a few different lineages. PMID:21659087

  4. Both the Exact Target Site Sequence and a Long Poly(A) Tail Are Required for Precise Insertion of the 18S Ribosomal DNA-Specific Non-Long Terminal Repeat Retrotransposon R7Ag.

    PubMed

    Nichuguti, Narisu; Hayase, Mayumi; Fujiwara, Haruhiko

    2016-05-15

    Ribosomal elements (R elements) are site-specific non-long terminal repeat (LTR) retrotransposons that target ribosomal DNA (rDNA). To elucidate how R elements specifically access their target sites, we isolated and characterized the 18S rDNA-specific R element R7Ag from Anopheles gambiae Using an in vivo and ex vivo recombinant baculovirus retrotransposition system, we found that the exact host 18S rDNA sequence at the target site is essential for the precise insertion of R7Ag. In addition, a long poly(A) tail is necessary for the accurate initiation of R7Ag reverse transcription, a novel mechanism found in non-LTR elements. We further compared the subcellular localizations of proteins in R7Ag as well as R1Bm, another R element that targets 28S rDNA. Although the open reading frame 1 proteins (ORF1ps) of both R7Ag and R1Bm localized predominantly in the cytoplasm, ORF2 proteins (ORF2ps) colocalized in the nucleus with the nucleolar marker fibrillarin. The ORF1ps and ORF2ps of both R elements colocalized largely in the nuclear periphery and to a lesser extent within the nucleus. These results suggest that R7Ag and R1Bm proteins may access nucleolar rDNA targets in an ORF2p-dependent manner. PMID:26976636

  5. Identification of Fasciola flukes in Thailand based on their spermatogenesis and nuclear ribosomal DNA, and their intraspecific relationships based on mitochondrial DNA.

    PubMed

    Chaichanasak, Pannigan; Ichikawa, Madoka; Sobhon, Prasert; Itagaki, Tadashi

    2012-12-01

    We analyzed 147 Fasciola flukes obtained from cattle in Thailand based on their spermatogenetic ability, and nuclear ribosomal internal transcribed spacer 1 (ITS1) and mitochondrial nicotiamide adenine dinucleotide dehydrogenase subunit 1 (ND1) genes as molecular markers. One hundred twenty-eight flukes, which had abundant sperm in their seminal vesicles (spermic) and showed the PCR-RFLP pattern of F. gigantica in the ITS1, were accurately identified as F. gigantica. The other 19 flukes that had no sperm in their seminal vesicles were aspermic Fasciola sp. with the RFLP patterns identical to that of F. gigantica. Twenty-nine ND1 haplotypes (Fg-ND1-Thai 2-30) were distinguished in the 128 F. gigantica flukes and were divided into haplotypes unique to Thailand and those common to other countries, suggesting the possibility that ancestral haplotypes were introduced into Thailand. Three haplotypes (Fg-ND1-Thai 7, 9 and 27) appeared to be the major haplotypes found in F. gigantica from Thailand. Only one haplotype (Fg-ND1-Thai 1) was found in the 19 aspermic Fasciola sp. flukes obtained from geographical regions, and the nucleotide sequence of Fg-ND1-Thai 1 was identical to that of the aspermic Fasciola sp. from Japan, Korea, China, Vietnam and Myanmar, suggesting that they were descendants with a common provenance and expanded to these countries in the relatively recent past. PMID:22575172

  6. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    SciTech Connect

    Son, Ora; Kim, Sunghan; Shin, Yun-jeong; Kim, Woo-Young; Koh, Hee-Jong; Cheon, Choong-Ill

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  7. SSU Ribosomal DNA-Based Monitoring of Nematode Assemblages Reveals Distinct Seasonal Fluctuations within Evolutionary Heterogeneous Feeding Guilds

    PubMed Central

    Vervoort, Mariëtte T. W.; Vonk, J. Arie; Mooijman, Paul J. W.; Van den Elsen, Sven J. J.; Van Megen, Hanny H. B.; Veenhuizen, Peter; Landeweert, Renske; Bakker, Jaap; Mulder, Christian; Helder, Johannes

    2012-01-01

    Soils are among the most complex, diverse and competitive habitats on Earth and soil biota are responsible for ecosystem services such as nutrient cycling, carbon sequestration and remediation of freshwater. The extreme biodiversity prohibits the making of a full inventory of soil life. Hence, an appropriate indicator group should be selected to determine the biological condition of soil systems. Due to their ubiquity and the diverse responses to abiotic and biotic changes, nematodes are suitable indicators for environmental monitoring. However, the time-consuming microscopic analysis of nematode communities has limited the scale at which this indicator group is used. In an attempt to circumvent this problem, a quantitative PCR-based tool for the detection of a consistent part of the soil nematofauna was developed based on a phylum-wide molecular framework consisting of 2,400 full-length SSU rDNA sequences. Taxon-specific primers were designed and tested for specificity. Furthermore, relationships were determined between the quantitative PCR output and numbers of target nematodes. As a first field test for this DNA sequence signature-based approach, seasonal fluctuations of nematode assemblages under open canopy (one field) and closed canopy (one forest) were monitored. Fifteen taxa from four feeding guilds (covering ∼ 65% of the free-living nematode biodiversity at higher taxonomical level) were detected at two trophic levels. These four feeding guilds are composed of taxa that developed independently by parallel evolution and we detected ecologically interpretable patterns for free-living nematodes belonging to the lower trophic level of soil food webs. Our results show temporal fluctuations, which can be even opposite within taxa belonging to the same guild. This research on nematode assemblages revealed ecological information about the soil food web that had been partly overlooked. PMID:23112818

  8. Nuclear ribosomal DNA evidence for a western North American origin of Hawaiian and South American species of Sanicula (Apiaceae)

    PubMed Central

    Vargas, Pablo; Baldwin, Bruce G.; Constance, Lincoln

    1998-01-01

    Results from phylogenetic analysis of nuclear rDNA internal transcribed spacer (ITS) sequences from a worldwide sample of Sanicula indicate that Hawaiian sanicles (Sanicula sect. Sandwicenses) constitute a monophyletic group that descended from a western North American ancestor in Sanicula sect. Sanicoria, a paraphyletic assemblage of mostly Californian species. A monophyletic group comprising representatives of all 15 species of S. sect. Sanicoria and the three sampled species of S. sect. Sandwicenses was resolved in all maximally parsimonious trees, rooted with sequences from species of Astrantia and Eryngium. All sequences sampled from eastern North American, European, and Asian species of Sanicula fell outside the ITS clade comprising S. sect. Sanicoria and S. sect. Sandwicenses. A lineage comprising the Hawaiian taxa and three species endemic to coastal or near-coastal habitats in western North America (Sanicula arctopoides, Sanicula arguta, and Sanicula laciniata) is diagnosed by nucleotide substitutions and a 24-bp deletion in ITS2. The hooked fruits in Sanicula lead us to conclude that the ancestor of Hawaiian sanicles arrived from North America by external bird dispersal; similar transport has been hypothesized for the North American tarweed ancestor of the Hawaiian silversword alliance (Asteraceae). Two additional long-distance dispersal events involving members of S. sect. Sanicoria can be concluded from the ITS phylogeny: dispersal of Sanicula crassicaulis and Sanicula graveolens from western North America to southern South America. PMID:9419359

  9. Phylogenetic Relationships of Tribes Within Harpalinae (Coleoptera: Carabidae) as Inferred from 28S Ribosomal DNA and the Wingless Gene

    PubMed Central

    Ober, Karen A.; Maddison, David R.

    2008-01-01

    Harpalinae is a large, monophyletic subfamily of carabid ground beetles containing more than 19,000 species in approximately 40 tribes. The higher level phylogenetic relationships within harpalines were investigated based on nucleotide data from two nuclear genes, wingless and 28S rDNA. Phylogenetic analyses of combined data indicate that many harpaline tribes are monophyletic, however the reconstructed trees showed little support for deeper nodes. In addition, our results suggest that the Lebiomorph Assemblage (tribes Lebiini, Cyclosomini, Graphipterini, Perigonini, Odacanthini, Lachnophorini, Pentagonicini, Catapiesini and Calophaenini), which is united by a morphological synapomorphy, is not monophyletic, and the tribe Lebiini is paraphyletic with respect to members of Cyclosomini. Two unexpected clades of tribes were supported: the Zuphiitae, comprised of Anthiini, Zuphiini, Helluonini, Dryptini, Galeritini, and Physocrotaphini; and a clade comprised of Orthogoniini, Pseudomorphini, and Graphipterini. The data presented in this study represent a dense sample of taxa to examine the molecular phylogeny of Harpalinae and provide a useful framework to examine the origin and evolution of morphological and ecological diversity in this group. PMID:20302528

  10. Ribosomal DNA as molecular markers and their applications in the identification of fish parasites (Platyhelminthes: Monogenea) from India

    PubMed Central

    Chaudhary, Anshu; Verma, Chandni; Singh, Hridaya Shanker

    2014-01-01

    The development of molecular techniques for taxonomic analysis of monogenean parasites has led to a great increase for proper identification and factualness. These molecular techniques, in particular the use of molecular markers, have been used to identify and validate the monogenean parasites. Although, improvements in marker detection systems particularly of elements of rDNA like 18S, ITS and 28S used in monogeneans parasites have enabled great advances to be made in recent years in India. However, the molecular sequence analysis and phylogenetic relationships among the parasitic helminthes is unconventional in India. Many workers have been always questioned the validity of Indian species of monogeneans and emphasized the need to ascertain the status of species from Indian fish. Here we would like to provide additional resolution for the interpretation of use of molecular markers in study of monogeneans in India. This review provides an overview of current stage of studies in India that have been used in applying molecular techniques to monogenean.

  11. Divergence between Asian, European and Canadian populations of the monogenean Pseudodactylogyrus bini indicated by ribosomal DNA patterns.

    PubMed

    Kania, P W; Taraschewski, H; Han, Y-S; Cone, D K; Buchmann, K

    2010-12-01

    The monogenean Pseudodactylogyrus bini parasitizes the gills of eels belonging to the genus Anguilla. Circumstantial evidence suggests that the parasite has been spread accidentally from the Pacific area (East Asia) to Europe by the intercontinental eel trade. This is based on early descriptions of the parasites from Asian regions and the lack of records of the parasites in Europe before 1977. In addition, the susceptibility of European eels to infections with the parasite is significantly higher compared to that of Japanese eels, which could indicate that the European eel had not undergone co-evolution with this parasite. The present study was undertaken to elucidate the origin of the parasite by using molecular tools. Parasite samples were obtained from Europe (Germany), Asia (Taiwan) and Nova Scotia, the latter of which is the first record of P. bini in Canada. Sequencing of rDNA comprising part of the internal transcribed spacer 1 (ITS1) gene, 5.8S and part of ITS2 (1323 bp) showed that P. bini isolates from the first two regions showed high variability. One sequence was found both in a number of Asian parasites and with one to a few transitions in European parasites, which could indicate that they were split recently into the two regions. Other sequence variations suggested that one or a few genotypes of P. bini were imported on one occasion from Asia to Europe and that the two geographic isolates subsequently developed differently in the two regions. The Nova Scotian/Canadian isolates showed no variation and were found to be unique compared to the European and Taiwanese forms, indicating that this population is independent in origin. This could indicate that the Canadian parasites were introduced to North America on another occasion and independently of the European colonization. PMID:20230654

  12. Riding the ice age El Niño? Pacific biogeography and evolution of Metrosideros subg. Metrosideros (Myrtaceae) inferred from nuclear ribosomal DNA

    PubMed Central

    Wright, S. D.; Yong, C. G.; Dawson, J. W.; Whittaker, D. J.; Gardner, R. C.

    2000-01-01

    Metrosideros subg. Metrosideros (Myrtaceae) comprises ≈26 species distributed widely across the Pacific basin. They occur on the ancient Gondwanan landmasses of New Zealand and New Caledonia, as well as on the volcanic islands of the remote Pacific, from Melanesia to tropical Polynesia and the Bonin Island. Phylogenetic analysis based on nuclear ribosomal DNA spacer sequences from all named species showed Metrosideros umbellata of New Zealand as basal in the subgenus, with the remaining species falling into three monophyletic clades. One includes the seven New Caledonian species together with three daughters in western Oceania that probably dispersed during the mid/late Tertiary. A second contains six taxa located in east Melanesia and Samoa that may also have arisen from a mid/late Tertiary dispersal, in this instance from New Zealand. The third includes three New Zealand endemics along with all of the taxa in remote Polynesia and accounts for much of the total range of the subgenus. These dispersed taxa in Polynesia either are identical to the New Zealand species Metrosideros excelsa or differ by a single nucleotide change. We suggest that they are all derived from a Pleistocene dispersal out of New Zealand. A relatively recent dispersal is surprising, given that this wind-dispersed genus has occupied New Zealand for much of the Tertiary and that some of the islands in remote Polynesia date to at least the Miocene. We attribute this dramatic range expansion to climate change—specifically changes in wind flow patterns—in the southern hemisphere during worldwide glaciation. PMID:10725356

  13. The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology.

    PubMed

    Whiting, M F; Carpenter, J C; Wheeler, Q D; Wheeler, W C

    1997-03-01

    Phylogenetic relationships among the holometabolous insect orders were inferred from cladistic analysis of nucleotide sequences of 18S ribosomal DNA (rDNA) (85 exemplars) and 28S rDNA (52 exemplars) and morphological characters. Exemplar outgroup taxa were Collembola (1 sequence), Archaeognatha (1), Ephemerida (1), Odonata (2), Plecoptera (2), Blattodea (1), Mantodea (1), Dermaptera (1), Orthoptera (1), Phasmatodea (1), Embioptera (1), Psocoptera (1), Phthiraptera (1), Hemiptera (4), and Thysanoptera (1). Exemplar ingroup taxa were Coleoptera: Archostemata (1), Adephaga (2), and Polyphaga (7); Megaloptera (1); Raphidioptera (1); Neuroptera (sensu stricto = Planipennia): Mantispoidea (2), Hemerobioidea (2), and Myrmeleontoidea (2); Hymenoptera: Symphyta (4) and Apocrita (19); Trichoptera: Hydropsychoidea (1) and Limnephiloidea (2); Lepidoptera: Ditrysia (3); Siphonaptera: Pulicoidea (1) and Ceratophylloidea (2); Mecoptera: Meropeidae (1), Boreidae (1), Panorpidae (1), and Bittacidae (2); Diptera: Nematocera (1), Brachycera (2), and Cyclorrhapha (1); and Strepsiptera: Corioxenidae (1), Myrmecolacidae (1), Elenchidae (1), and Stylopidae (3). We analyzed approximately 1 kilobase of 18S rDNA, starting 398 nucleotides downstream of the 5' end, and approximately 400 bp of 28S rDNA in expansion segment D3. Multiple alignment of the 18S and 28S sequences resulted in 1,116 nucleotide positions with 24 insert regions and 398 positions with 14 insert regions, respectively. All Strepsiptera and Neuroptera have large insert regions in 18S and 28S. The secondary structure of 18S insert 23 is composed of long stems that are GC rich in the basal Strepsiptera and AT rich in the more derived Strepsiptera. A matrix of 176 morphological characters was analyzed for holometabolous orders. Incongruence length difference tests indicate that the 28S + morphological data sets are incongruent but that 28S + 18S, 18S + morphology, and 28S + 18S + morphology fail to reject the hypothesis of

  14. Molecular characterisation of three regions of the nuclear ribosomal DNA unit and the mitochondrial cox1 gene of Sarcocystis fusiformis from water buffaloes (Bubalus bubalis) in Egypt.

    PubMed

    Gjerde, Bjørn; Hilali, Mosaad; Mawgood, Sahar Abdel

    2015-09-01

    A total of 33 macroscopically visible (3-11 × 1-5 mm) sarcocysts of Sarcocystis fusiformis were excised from the oesophagus of 12 freshly slaughtered water buffalos in Giza, Egypt. Genomic DNA was extracted from the sarcocysts, and all isolates were characterised at the mitochondrial cytochrome c oxidase subunit I (cox1) gene through PCR amplification and direct sequencing, whereas a few selected isolates were characterised at the 18S and 28S ribosomal (r) RNA genes and the internal transcribed spacer 1 (ITS1) region of the nuclear rDNA unit following cloning. Among the 33 cox1 sequences (1,038-bp long), there was a total of 13 haplotypes, differing from each other by one to seven substitutions and sharing an identity of 99.3-99.9 %. In comparison, the sequence identity was 98.8-99.0 % among eight complete 18S rRNA gene sequences (1,873-1,879-bp long), 98.1-100 % among 28 complete ITS1 sequences (853-864-bp long) and 97.4-99.6 % among five partial 28S rRNA gene sequences (1,607-1,622 bp). At the three nuclear loci, the intraspecific (and intra-isolate) sequence variation was due to both substitutions and indels, which necessitated cloning of the PCR products before sequencing. Some additional clones of the 18S and 28S rRNA genes were highly divergent from the more typical clones, but the true nature of these aberrant clones could not be determined. Sequence comparisons and phylogenetic analyses based on either 18S rRNA gene or cox1 nucleotide sequences, placed S. fusiformis closest to Sarcocystis cafferi from the African buffalo, but only the analyses based on cox1 data separated the two taxa clearly from each other and showed that they were separate species (monophyletic clusters and 93 % sequence identity at cox1 versus interleaved sequences and 98.7-99.1 % sequence identity at the 18S rRNA gene). Two cats experimentally infected with sarcocysts of S. fusiformis started shedding small numbers of sporocysts 8-10 days post-infection (dpi) and were euthanized 15

  15. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  16. Molecular Characterization of Stool Microbiota in HIV-Infected Subjects by Panbacterial and Order-Level 16S Ribosomal DNA (rDNA) Quantification and Correlations with Immune Activation

    PubMed Central

    Ellis, Collin L.; Ma, Zhong-Min; Mann, Surinder K.; Li, Chin-Shang; Wu, Jian; Knight, Thomas H.; Yotter, Tammy; Hayes, Timothy L.; Maniar, Archana H.; Troia-Cancio, Paolo V.; Overman, Heather A; Torok, Natalie J.; Albanese, Anthony; Rutledge, John C.; Miller, Christopher J.; Pollard, Richard B.; Asmuth, David M.

    2011-01-01

    Background The relationship between gut microbial community composition at the higher-taxonomic order-level and local and systemic immunologic abnormalities in HIV disease may provide insight into how bacterial translocation impacts HIV disease. Methods Antiretroviral (ART)-naive HIV patients underwent upper endoscopy before and nine months after starting ART. Duodenal tissue was paraffin-embedded for immunohistochemical analysis (IHC) and digested for FACS for T-cell subsets and immune activation (CD38+/HLA-DR+) enumeration. Stool samples were provided from patients and controls for comparison. Metagenomic microbial DNA was extracted from feces for optimized 16S ribosomal RNA gene (rDNA) real-time qPCR assays designed to quantify panbacterial loads and the relative abundances of proinflammatory Enterobacteriales order, and the dominant Bacteroidales and Clostridiales orders. Results Samples from 10 HIV-subjects prior to initiating, and from 6 subjects receiving, ART were available for analysis. There was a trend for a greater proportion of Enterobacteriales in HIV-positive subjects compared to controls (p=0.099). There were significant negative correlations between total bacterial load and duodenal CD4+ and CD8+ T-cell activation levels (r= −0.74, p= 0.004 and r= −0.67, p=0.013, respectively). The proportions of Enterobacteriales and Bacteroidales were significantly correlated with duodenal CD4+ T-cell depletion and peripheral CD8+ T-cell activation, respectively. Conclusions These data represent the first report of quantitative molecular and cellular correlations between total/universal and order-level gut bacterial populations and GALT levels of immune activation in HIV-infected subjects. The correlations between lower overall 16S rDNA levels and tissue immune activation suggest that the gut microbiome may contribute to immune activation and influence HIV progression. PMID:21436711

  17. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  18. Structure of psoralen-crosslinked ribosomal RNA from Drosophila melanogaster.

    PubMed Central

    Wollenzien, P L; Youvan, D C; Hearst, J E

    1978-01-01

    Ribosomal RNA from Drosophila melanogaster photoreacted with hydroxymethyltrioxsalen has been examined by electron microscopy. Reproducible patterns of hairpins were found in both the 26S and 18S RNA. The frequency of these hairpins and the amount of incorporated drug were dependent upon the conditions under which the crosslinking was performed. A prominent central hairpin occurs in the 26S RNA and the break that interrupts the continuity of the RNA chain is located within it. In addition to several small hairpins, the crosslinked 18S RNA contains a large open loop. Images PMID:417342

  19. Characterization of strains of Leuconostoc mesenteroides by analysis of soluble whole-cell protein pattern, DNA fingerprinting and restriction of ribosomal DNA.

    PubMed

    Villani, F; Moschetti, G; Blaiotta, G; Coppola, S

    1997-05-01

    Of 215 leuconostocs isolated from field grass, natural whey cultures and water-buffalo milk, 178 were identified as Leuconostoc mesenteroides ssp. mesenteroides while 37 strains could not be identified. Biochemical characterization allowed seven groups to be defined. Representative strains of each group and different habitat and nine reference strains were selected for further analyses. Protein profiles appeared suitable for species discrimination, but did not differentiate between the three subspecies of Leuc. mesenteroides. The technique also showed some differences among equivocal strains. DNA fingerprinting for most strains of Leuc. mesenteroides ssp. mesenteroides examined showed a different restriction pattern from that of the type strain. Ribotyping was not useful for discriminating species and subspecies of the genus Leuconostoc: Leuc. mesenteroides ssp. mesenteroides and ssp. dextranicum showed the same ribopattern as Leuc. lactis while Leuc. mesenteroides ssp. cremoris exhibited a pattern distinct from all the other species examined. On the basis of ARDRA-PCR, two main groups could be distinguished: the larger group included Leuc. mesenteroides, Leuc. lactis, Leuc. pseudomesenteroides and some unidentifiable strains; the second one included Leuc. citreum, Leuc. fallax, Weissella paramesenteroides and some unidentified strains. PMID:9172399

  20. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  1. ESTIMATION OF BACTERIAL CELL NUMBERS IN HUMIC ACID-RICH SALT MARSH SEDIMENTS WITH PROBES DIRECTED TO 16S RIBOSOMAL DNA

    EPA Science Inventory

    The feasibility of using probes directed towards ribosomal DNAs (rDNAs) as a quantitative approach to estimating cell numbers was examined and applied to study the structure of a bacterial community in humic acid-rich salt marsh sediments. Hybridizations were performed with membr...

  2. Characterization of the multigene family encoding the mouse S16 ribosomal protein: strategy for distinguishing an expressed gene from its processed pseudogene counterparts by an analysis of total genomic DNA.

    PubMed Central

    Wagner, M; Perry, R P

    1985-01-01

    Two genes from the family encoding mouse ribosomal protein S16 were cloned, sequenced, and analyzed. One gene was found to be a processed pseudogene, i.e., a nonfunctional gene presumably derived from an mRNA intermediate. The other S16 gene contained introns and had exonic sequences identical to those of a cloned S16 cDNA. The expression of this gene was demonstrated by Northern blot analysis of nuclear poly(A)+ RNA with cDNA and unique sequence intron probes. Each S16 intron contains a well-preserved remnant of the TACTAAC motif, which is ubiquitous in yeast introns and known to play a critical role in intron splicing. A sequence comparison with two other mouse ribosomal protein genes analyzed in our laboratory, L30 and L32, revealed common structural features which might be involved in the control and coordination of ribosomal protein gene expression. These include the lack of a canonical TATA box in the -20 to -30 region and a remarkably similar 12-nucleotide pyrimidine sequence (CTTCCYTYYTC) that spans the cap site and is flanked by C + G-rich sequences. The nature of the other members of the S16 family was evaluated by three types of experiment: a DNase I sensitivity analysis to measure the extent of chromatin condensation; an analysis of the thermal stability of cDNA-gene hybrids to estimate the extent of divergence of each gene sequence from that of the expressed gene; and a restriction fragment analysis which distinguishes intron-containing genes from intronless processed genes. The results of these analyses show that all genes except the expressed S16 gene are in a condensed chromatin configuration associated with transcriptional quiescence; that most of the genes within the S16 family have sequences greater than 7% divergent from the expressed S16 gene; and that at least 7 of the 10 S16 genes lack introns. We conclude that the ribosomal protein S16 multigene family contains one expressed intron-containing gene and nine inactive pseudogenes, most or all

  3. The expression of acidic ribosomal phosphoproteins on the surface membrane of different tissues in autoimmune and normal mice which are the target molecules for anti-double-stranded DNA antibodies.

    PubMed Central

    Sun, K H; Liu, W T; Tang, S J; Tsai, C Y; Hsieh, S C; Wu, T H; Han, S H; Yu, C L

    1996-01-01

    Affinity-purified polyclonal anti-double-stranded DNA (anti-dsDNA) antibodies from patients with systemic lupus erythematosus (SLE) exert a cytostatic effect on cultured rat glomerular mesangial cells (MC). The cognate antigens expressed on the surface of MC have been proved to be acidic ribosomal phosphoproteins (P proteins) in our previous study. The mesangial cytostatic effect of anti-dsDNA antibodies is attributed to the cross-reactivity of the antibodies with membrane-expressed P proteins, but not to the effect of minute amounts of anti-ribosomal P proteins antibodies contained in the anti-dsDNA preparations. Immunofluorescence staining of the native cells demonstrated that anti-dsDNA antibodies bound to the surface of rat mesangial cells, rat brain astrocytes (RBA-1) and mouse fibroblasts (3T3). Anti-dsDNA antibodies also exert potent cytostatic effects on these cells in a dose-dependent manner. In addition, the plasma membranes of different cell lines and tissues from normal and autoimmune mice were isolated and probed by anti-dsDNA antibodies in Western blot analysis. We found the actively proliferating cells such as MC, RBA-1 and 3T3 may express both P0 (38,000 MW) and P1 (19,000 MW) on the surface membrane. In addition, the kidney, liver and spleen from either autoimmune MRL-lpr/lpr or BALB/c mice may constantly express P0 protein, but the expression of P1 is inconsistent. In contrast, brain and muscle from either mice failed to express P proteins on their surface. Unexpectedly, a high molecular weight substance (larger than 205,000 MW) with unknown nature appears in the membrane of brain and muscle tissues in both mice. Immunoprecipitation of the surface-biotinylated MC-lysate by anti-dsDNA antibodies further confirmed that P1 (19,000 MW) and P2 (17,000 MW) are really expressed on the cell surface. These results suggest that P proteins expressed on the surface of different tissues become the targets for anti-dsDNA antibodies mediating pleomorphic tissue

  4. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  5. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  6. The 26S Proteasome and Initiation of Gene Transcription

    PubMed Central

    Durairaj, Geetha; Kaiser, Peter

    2014-01-01

    Transcription activation is the foremost step of gene expression and is modulated by various factors that act in synergy. Misregulation of this process and its associated factors has severe effects and hence requires strong regulatory control. In recent years, growing evidence has highlighted the 26S proteasome as an important contributor to the regulation of transcription initiation. Well known for its role in protein destruction, its contribution to protein synthesis was initially viewed with skepticism. However, studies over the past several years have established the proteasome as an important component of transcription initiation through proteolytic and non-proteolytic activities. In this review, we discuss findings made so far in understanding the connections between transcription initiation and the 26S proteasome complex. PMID:25211636

  7. 26S Proteasome: Hunter and Prey in Auxin Signaling.

    PubMed

    Kong, Xiangpei; Zhang, Liangran; Ding, Zhaojun

    2016-07-01

    Auxin binds to TRANSPORT INHIBITOR RESPONSE 1 and AUXIN SIGNALLING F-BOX proteins (TIR1/AFBs) and promotes the degradation of Aux/IAA transcriptional repressors. The proteasome regulator PROTEASOME REGULATOR1 (PTRE1) has now been shown to be required for auxin-mediated repression of 26S proteasome activity, thus providing new insights into the fine-tuning of the homoeostasis of Aux/IAA proteins and auxin signaling. PMID:27246455

  8. The murine cardiac 26S proteasome: an organelle awaiting exploration.

    PubMed

    Gomes, Aldrin V; Zong, Chenggong; Edmondson, Ricky D; Berhane, Beniam T; Wang, Guang-Wu; Le, Steven; Young, Glen; Zhang, Jun; Vondriska, Thomas M; Whitelegge, Julian P; Jones, Richard C; Joshua, Irving G; Thyparambil, Sheeno; Pantaleon, Dawn; Qiao, Joe; Loo, Joseph; Ping, Peipei

    2005-06-01

    Multiprotein complexes have been increasingly recognized as essential functional units for a variety of cellular processes, including the protein degradation system. Selective degradation of proteins in eukaryotes is primarily conducted by the ubiquitin proteasome system. The current knowledge base, pertaining to the proteasome complexes in mammalian cells, relies largely upon information gained in the yeast system, where the 26S proteasome is hypothesized to contain a 20S multiprotein core complex and one or two 19S regulatory complexes. To date, the molecular structure of the proteasome system, the proteomic composition of the entire 26S multiprotein complexes, and the specific designated function of individual components within this essential protein degradation system in the heart remain virtually unknown. A functional proteomic approach, employing multidimensional chromatography purification combined with liquid chromatography tandem mass spectrometry and protein chemistry, was utilized to explore the murine cardiac 26S proteasome system. This article presents an overview on the subject of protein degradation in mammalian cells. In addition, this review shares the limited information that has been garnered thus far pertaining to the molecular composition, function, and regulation of this important organelle in the cardiac cells. PMID:16093497

  9. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  10. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    USGS Publications Warehouse

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  11. DNA sequence analysis of a 10 624 bp fragment of the left arm of chromosome XV from Saccharomyces cerevisiae reveals a RNA binding protein, a mitochondrial protein, two ribosomal proteins and two new open reading frames.

    PubMed

    Lafuente, M J; Gamo, F J; Gancedo, C

    1996-09-01

    We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine. PMID:8896268

  12. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  13. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  14. Characterization of the 26S proteasome network in Plasmodium falciparum

    PubMed Central

    Wang, Lihui; Delahunty, Claire; Fritz-Wolf, Karin; Rahlfs, Stefan; Helena Prieto, Judith; Yates, John R.; Becker, Katja

    2015-01-01

    In eukaryotic cells, the ubiquitin-proteasome system as a key regulator of protein quality control is an excellent drug target. We therefore aimed to analyze the 26S proteasome complex in the malaria parasite Plasmodium falciparum, which still threatens almost half of the world’s population. First, we established an affinity purification protocol allowing for the isolation of functional 26S proteasome complexes from the parasite. Subunit composition of the proteasome and component stoichiometry were studied and physiologic interacting partners were identified via in situ protein crosslinking. Furthermore, intrinsic ubiquitin receptors of the plasmodial proteasome were determined and their roles in proteasomal substrate recognition were analyzed. Notably, PfUSP14 was characterized as a proteasome-associated deubiquitinase resulting in the concept that targeting proteasomal deubiquitinating activity in P. falciparum may represent a promising antimalarial strategy. The data provide insights into a profound network orchestrated by the plasmodial proteasome and identified novel drug target candidates in the ubiquitin-proteasome system. PMID:26639022

  15. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  16. Structure of the DNA distal to the gene for ribosomal protein S20 in Escherichia coli K12: presence of a strong terminator and an IS1 element.

    PubMed Central

    Mackie, G A

    1986-01-01

    The sequence of nucleotides extending over 2.3 kb distal to the gene for ribosomal protein S20 of E. coli has been determined. Included in the sequence is an efficient rho-independent terminator 50 b.p. distal to the coding sequence for S20, a complete copy of IS1 which lacks, however, flanking direct repeats, and finally, an open reading frame capable of encoding a 28 kDa polypeptide of unknown function. Several lines of evidence suggest that the IS1 sequence described here must represent one of the copies resident in the bacterial chromosome rather than a newly transposed copy. Northern blotting experiments show that the gene for S20 is functionally monocistronic under all conditions tested in several genetic backgrounds. Thus it seems unlikely that the distal copy of IS1 plays any role in the termination or stability of mRNA transcribed from the gene for S20. Images PMID:2429258

  17. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  18. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.

    PubMed

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  19. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  20. Phylogeny of Trypanosoma brucei and Trypanosoma evansi in naturally infected cattle in Nigeria by analysis of repetitive and ribosomal DNA sequences.

    PubMed

    Takeet, Michael I; Peters, Sunday O; Fagbemi, Benjamin O; De Donato, Marcos; Takeet, Vivian O; Wheto, Mathew; Imumorin, Ikhide G

    2016-08-01

    In continuing efforts to better understand the genetics of bovine trypanosomosis, we assessed genetic diversity of Trypanosoma brucei and Trypanosoma evansi in naturally infected Nigerian cattle using repetitive DNA and internal transcribed spacer 1 of rDNA sequences and compared these sequences to species from other countries. The length of repetitive DNA sequences in both species ranged from 161 to 244 bp and 239 to 240 bp for T. brucei and T. evansi, respectively, while the ITS1 rDNA sequences length range from 299 to 364 bp. The mean GC content of ITS1 rDNA sequences was 33.57 %, and that of repetitive sequences were 39.9 and 31.1 % for T. brucei and T. evansi, respectively. Result from sequence alignment revealed both T. brucei and T. evansi repetitive DNA sequences to be more polymorphic than ITS1 rDNA sequences, with moderate points of deletion and insertions. T. brucei separated into two clades when subjected to phylogenetic analysis. T. evansi repetitive DNA sequences clustered tightly within the T. brucei clade while the ITS1 rDNA sequences of T. brucei were clearly separated from T. theileri and T. vivax individually used as outgroups. This study suggest that ITS1 rDNA sequences may not be suitable for phylogenetic differentiation of the Trypanozoon group and also suggest that T. evansi may be a phenotypic variant of T. brucei which may have potential implications in designing prevention and therapeutic strategies. PMID:27174432

  1. Alterations in the ribosomal machinery in cancer and hematologic disorders

    PubMed Central

    2012-01-01

    Ribosomes are essential components of the protein translation machinery and are composed of more than 80 unique large and small ribosomal proteins. Recent studies show that in addition to their roles in protein translation, ribosomal proteins are also involved in extra-ribosomal functions of DNA repair, apoptosis and cellular homeostasis. Consequently, alterations in the synthesis or functioning of ribosomal proteins can lead to various hematologic disorders. These include congenital anemias such as Diamond Blackfan anemia and Shwachman Diamond syndrome; both of which are associated with mutations in various ribosomal genes. Acquired uniallelic deletion of RPS14 gene has also been shown to lead to the 5q syndrome, a distinct subset of MDS associated with macrocytic anemia. Recent evidence shows that specific ribosomal proteins are overexpressed in liver, colon, prostate and other tumors. Ribosomal protein overexpression can promote tumorigenesis by interactions with the p53 tumor suppressor pathway and also by direct effects on various oncogenes. These data point to a broad role of ribosome protein alterations in hematologic and oncologic diseases. PMID:22709827

  2. Molecular Identification of Closely Related Candida Species Using Two Ribosomal Intergenic Spacer Fingerprinting Methods

    PubMed Central

    Cornet, Muriel; Sendid, Boualem; Fradin, Chantal; Gaillardin, Claude; Poulain, Daniel; Nguyen, Huu-Vang

    2011-01-01

    Recent changes in the epidemiology of candidiasis highlighted an increase in non- Candida albicans species emphasizing the need for reliable identification methods. Molecular diagnostics in fungal infections may improve species characterization, particularly in cases of the closely related species in the Candida complexes. We developed two PCR/restriction fragment length polymorphism assays, targeting either a part of the intergenic spacer 2 or the entire intergenic spacer (IGS) of ribosomal DNA using a panel of 270 isolates. A part of the intergenic spacer was used for discrimination between C. albicans and C. dubliniensis and between species of the C. glabrata complex (C. glabrata/C. bracarensis/C. nivariensis). The whole IGS was applied to C. parapsilosis, C. metapsilosis, and C. orthopsilosis, and to separate C. famata (Debaryomyces hansenii) from C. guilliermondii (Pichia guilliermondii) and from the other species within this complex (ie, C. carpophila, C. fermentati and C. xestobii). Sharing similar biochemical patterns, Pichia norvegensis and C. inconspicua exhibited specific IGS profiles. Our study confirmed that isolates of C. guilliermondii were frequently mis-identified as C. famata. As much as 67% of the clinical isolates phenotypically determined as C. famata were recognized mostly as true P. guilliermondii. Conversely, 44% of the isolates initially identified as C. guilliermondii were corrected by the IGS fingerprints as C. parapsilosis, C. fermentati, or C. zeylanoides. These two PCR/restriction fragment length polymorphism methods may be used as reference tools [either alternatively or adjunctively to the existing ribosomal DNA (26S or ITS) sequence comparisons] for unambiguous determination of the Candida species for which phenotypic characterization remains problematic. PMID:21227390

  3. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  4. Proteomics of the 26S proteasome in Spodoptera frugiperda cells infected with the nucleopolyhedrovirus, AcMNPV.

    PubMed

    Lyupina, Yulia V; Zatsepina, Olga G; Serebryakova, Marina V; Erokhov, Pavel A; Abaturova, Svetlana B; Kravchuk, Oksana I; Orlova, Olga V; Beljelarskaya, Svetlana N; Lavrov, Andrey I; Sokolova, Olga S; Mikhailov, Victor S

    2016-06-01

    Baculoviruses are large DNA viruses that infect insect species such as Lepidoptera and are used in biotechnology for protein production and in agriculture as insecticides against crop pests. Baculoviruses require activity of host proteasomes for efficient reproduction, but how they control the cellular proteome and interact with the ubiquitin proteasome system (UPS) of infected cells remains unknown. In this report, we analyzed possible changes in the subunit composition of 26S proteasomes of the fall armyworm, Spodoptera frugiperda (Sf9), cells in the course of infection with the Autographa californica multiple nucleopolyhedrovirus (AcMNPV). 26S proteasomes were purified from Sf9 cells by an immune affinity method and subjected to 2D gel electrophoresis followed by MALDI-TOF mass spectrometry and Mascot search in bioinformatics databases. A total of 34 homologues of 26S proteasome subunits of eukaryotic species were identified including 14 subunits of the 20S core particle (7 α and 7 β subunits) and 20 subunits of the 19S regulatory particle (RP). The RP contained homologues of 11 of RPN-type and 6 of RPT-type subunits, 2 deubiquitinating enzymes (UCH-14/UBP6 and UCH-L5/UCH37), and thioredoxin. Similar 2D-gel maps of 26S proteasomes purified from uninfected and AcMNPV-infected cells at 48hpi confirmed the structural integrity of the 26S proteasome in insect cells during baculovirus infection. However, subtle changes in minor forms of some proteasome subunits were detected. A portion of the α5(zeta) cellular pool that presumably was not associated with the proteasome underwent partial proteolysis at a late stage in infection. PMID:26945516

  5. The influence of the ratio of protein energy to total energy in the feed on the activity of protein synthesis in vitro, the level of ribosomal RNA and the RNA-DNA ratio in white trunk muscle of Atlantic cod (Gadus morhua).

    PubMed

    Lied, E; Rosenlund, G

    1984-01-01

    Cod (Gadus morhua) were fed diets containing protein energy to total energy levels (PE/TE) of 10.0, 20.6, 29.6, 38.4, 56.2 and 74.1% for 21 days. Ribosomes were isolated from the white trunk muscle tissue, the capacity for protein synthesis in vitro determined and related to muscle tissue wet weight rRNA and DNA. Protein concentrations of less than 47.4% PE/TE in the diets reduce the ribosomal capacity for protein synthesis per g wet weight and per mg DNA, and the tissue contents of rRNA and ratio of rRNA/DNA. The capacity for muscle protein synthesis in vitro is a significant and sensitive parameter of protein inadequacy in fish diets. PMID:6200270

  6. Diversity of Salmonella Strains Isolated from the Aquatic Environment as Determined by Serotyping and Amplification of the Ribosomal DNA Spacer Regions

    PubMed Central

    Baudart, Julia; Lemarchand, Karine; Brisabois, Anne; Lebaron, Philippe

    2000-01-01

    Salmonella species are pathogenic bacteria often detected in sewage, freshwater, marine coastal water, and groundwater. Salmonella spp. can survive for long periods in natural waters, and the persistence of specific and epidemic strains is of great concern in public health. However, the diversity of species found in the natural environment remains unknown. The aim of this study was to investigate the diversity of Salmonella strains isolated from different natural aquatic systems within a Mediterranean coastal watershed (river, wastewater, and marine coastal areas). A total of 574 strains isolated from these natural environments were identified by both conventional serotyping and the ribosomal spacer-heteroduplex polymorphism (RS-HP) method (M. A. Jensen and N. Straus, PCR Methods Appl. 3:186–194, 1993). More than 40 different serotypes were found, and some serotypes probably mobilized from widespread animal-rearing activities were detected only during storm events. These serotypes may be good indicators of specific contamination sources. Furthermore, the RS-HP method based on the PCR amplification of the intergenic spacer region between the 16S and 23S rRNA genes can produce amplicon profiles allowing the discrimination of species at both serotype and intraserotype levels. This method represents a powerful tool that could be used for rapid typing of Salmonella isolates. PMID:10742240

  7. Mitochondrial and Nuclear Ribosomal DNA Evidence Supports the Existence of a New Trichuris Species in the Endangered François’ Leaf-Monkey

    PubMed Central

    Liu, Guo-Hua; Gasser, Robin B.; Nejsum, Peter; Wang, Yan; Chen, Qiang; Song, Hui-Qun; Zhu, Xing-Quan

    2013-01-01

    The whipworm of humans, Trichuris trichiura, is responsible for a neglected tropical disease (NTD) of major importance in tropical and subtropical countries of the world. Whipworms also infect animal hosts, including pigs, dogs and non-human primates, cause clinical disease (trichuriasis) similar to that of humans. Although Trichuris species are usually considered to be host specific, it is not clear whether non-human primates are infected with T. trichiura or other species. In the present study, we sequenced the complete mitochondrial (mt) genome as well as the first and second internal transcribed spacers (ITS-1 and ITS-2) of Trichuris from the François’ leaf-monkey (langur), and compared them with homologous sequences from human- and pig-derived Trichuris. In addition, sequence comparison of a conserved mt ribosomal gene among multiple individual whipworms revealed substantial nucleotide differences among these three host species but limited sequence variation within each of them. The molecular data indicate that the monkey-derived whipworm is a separate species from that of humans. Future work should focus on detailed population genetic and morphological studies (by electron microscopy) of whipworms from various non-humans primates and humans. PMID:23840431

  8. Phylogenetic study of six species of Anopheles mosquitoes in Peninsular Malaysia based on inter-transcribed spacer region 2 (ITS2) of ribosomal DNA

    PubMed Central

    2014-01-01

    Background Molecular techniques are invaluable for investigation on the biodiversity of Anopheles mosquitoes. This study aimed at investigating the spatial-genetic variations among Anopheles mosquitoes from different areas of Peninsular Malaysia, as well as deciphering evolutionary relationships of the local Anopheles mosquitoes with the mosquitoes from neighbouring countries using the anopheline ITS2 rDNA gene. Methods Mosquitoes were collected, identified, dissected to check infection status, and DNA extraction was performed for PCR with primers targeting the ITS2 rDNA region. Sequencing was done and phylogenetic tree was constructed to study the evolutionary relationship among Anopheles mosquitoes within Peninsular Malaysia, as well as across the Asian region. Results A total of 133 Anopheles mosquitoes consisting of six different species were collected from eight different locations across Peninsular Malaysia. Of these, 65 ITS2 rDNA sequences were obtained. The ITS2 rDNA amplicons of the studied species were of different sizes. One collected species, Anopheles sinensis, shows two distinct pools of population in Peninsular Malaysia, suggesting evolvement of geographic race or allopatric speciation. Conclusion Anopheles mosquitoes from Peninsular Malaysia show close evolutionary relationship with the Asian anophelines. Nevertheless, genetic differences due to geographical segregation can be seen. Meanwhile, some Anopheles mosquitoes in Peninsular Malaysia show vicariance, exemplified by the emergence of distinct cluster of An. sinensis population. PMID:24993022

  9. Fungal community analysis in the deep-sea sediments of the Pacific Ocean assessed by comparison of ITS, 18S and 28S ribosomal DNA regions

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Luo, Zhu-Hua; Guo, Shuangshuang; Pang, Ka-Lai

    2016-03-01

    We investigated the diversity of fungal communities in 6 different deep-sea sediment samples of the Pacific Ocean based on three different types of clone libraries, including internal transcribed spacer (ITS), 18S rDNA, and 28S rDNA regions. A total of 1978 clones were generated from 18 environmental clone libraries, resulting in 140 fungal operational taxonomic units (OTUs), including 18 OTUs from ITS, 44 OTUs from 18S rDNA, and 78 OTUs from 28S rDNA gene primer sets. The majority of the recovered sequences belonged to diverse phylotypes of the Ascomycota and Basidiomycota. Additionally, our study revealed a total of 46 novel fungal phylotypes, which showed low similarities (<97%) with available fungal sequences in the GenBank, including a novel Zygomycete lineage, suggesting possible new fungal taxa occurring in the deep-sea sediments. The results suggested that 28S rDNA is an efficient target gene to describe fungal community in deep-sea environment.

  10. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    PubMed

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  11. Ribosomal DNA identification of Nosema/Vairimorpha in freshwater polychaete, Manayunkia speciosa, from Oregon/California and the Laurentian Great Lakes.

    PubMed

    Malakauskas, David M; Altman, Emory C; Malakauskas, Sarah J; Thiem, Suzanne M; Schloesser, Donald W

    2015-11-01

    We examined Manayunkia speciosa individuals from the Klamath River, Oregon/California and Lake Erie, Michigan, USA for the presence of Microsporidia. We identified microsporidian spores and sequenced their SSU, ITS, and part of the LSU rDNA. Phylogenetic analysis of SSU rDNA indicated spores from both populations belonged to the Nosema/Vairimorpha clade. PCR showed an infection prevalence in Lake Erie M. speciosa of 0.6% (95% CI=0.5%, 0.7%). This represents the first known example of molecularly characterized Nosema/Vairimorpha isolates infecting a non-arthropod host. PMID:26386327

  12. Ribosomal DNA identification of Nosema/Vairimorpha in freshwater polychaete, Manayunkia speciosa, from Oregon/California and the Laurentian Great Lakes

    USGS Publications Warehouse

    Malakauskas, David M.; Altman, Emory C.; Malakauskas, Sarah J.; Thiem, Suzanne M.; Schloesser, Donald W.

    2015-01-01

    We examined Manayunkia speciosa individuals from the Klamath River, Oregon/California and Lake Erie, Michigan, USA for the presence of Microsporidia. We identified microsporidian spores and sequenced their SSU, ITS, and part of the LSU rDNA. Phylogenetic analysis of SSU rDNA indicated spores from both populations belonged to the Nosema/Vairimorpha clade. PCR showed an infection prevalence in Lake Erie M. speciosa of 0.6% (95% CI = 0.5%, 0.7%). This represents the first known example of molecularly characterized Nosema/Vairimorpha isolates infecting a non-arthropod host.

  13. Two ribosomal DNA-binding factors interact with a cluster of motifs on the 5' external transcribed spacer, upstream from the primary pre-rRNA processing site in a higher plant.

    PubMed

    Caparros-Ruiz, D; Lahmy, S; Piersanti, S; Echeverría, M

    1997-08-01

    In radish the primary processing site in pre-rRNA has been mapped to a TTTTCGCGC sequence (motif P) in the 5' external transcribed spacer (5' ETS) of the ribosomal DNA (rDNA) [Delcasso-Tremousaygue, D., Grellet, F., Panabières, F., Ananiev, E. & Delseny, M. (1988) Eur. J. Biochem. 172, 767-776]. The processing site is just downstream of four similar motifs named A1, A2, A3 and B. The five motifs constitute cluster A123BP. We have described previously that in radish extracts a nuclear protein, nuclear factor B (NF B) specifically binds to motif B [Echeverría, M., Penon, P. & Delseny, M. (1994) Mol. Gen. Genet. 243, 442-452]. Here, by means of electrophoretic-mobility-shift assays, we describe an rDNA-binding activity, nuclear factor D (NF D), that interacts with the A123BP cluster. Using various rDNA probes and competitors we show that NF D binds specifically to the A123 clustered motifs but not to similar B or P motifs. We used sequence-specific DNA-affinity chromatography to separate NF D from NF B. DNase I footprinting was used to map the binding site of NF D on the A123BP cluster and we compared it with that of NF B on the same probe. The footprint of NF D extends from the A1 motif to the 5' end of the NF B-binding site and includes motifs A2 and A3 on each strand. The footprinting of NF B is restricted to motif B and adjacent nucleotides. Thus the NF D-binding and NF B-binding sites are distinct but overlap. These two factors bind with a high specificity to the A123BP cluster in the radish 5' ETS. The possibility that these factors regulate rDNA transcription elongation at the level of the primary pre-rRNA processing site in crucifers is discussed. PMID:9288923

  14. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  15. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  16. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  17. Evaluation of internal transcribed spacer region of ribosomal DNA sequence analysis for molecular characterization of Candida albicans and Candida dubliniensis isolates from HIV-infected patients.

    PubMed

    Millon, L; Piarroux, R; Drobacheff, C; Monod, M; Grenouillet, F; Bulle, B; Bole, J; Blancard, A; Meillet, D

    2002-12-01

    Molecular typing systems have been needed to study Candida colonization in HIV-infected patients, particularly for investigating virulence and fluconazole resistance. Three methods--electrophoretic karyotyping (EK), detection of restriction fragment length polymorphisms (RFLP) and randomly amplified polymorphic DNA analysis (RAPD)--have been most frequently used. In this study, comparative sequence analysis of the internal transcribed spacer (ITS) region of rDNA was evaluated for delineation of Candida isolates from 14 HIV-infected patients. EK, ITS sequence analysis, RFLP and RAPD resulted in 11, 10, 9 and 8 DNA genotypes, respectively, from 39 Candida albicans isolates. The 10 genotypes observed using ITS sequence analysis were defined by six variation sites in the sequence. Molecular typing of sequential oral isolates showed the persistence of the same genotype of C. albicans in nine patients, and genotype variation in one patient. EK and RAPD showed that another patient was co-infected by two distinct genotypes and ITS analysis identified one of the two genotypes as Candida dubliniensis. Comparative ITS sequence analysis is a quick and reproducible method that provides clear and objective results, and it also identifies C. dubliniensis. The discriminatory power of this new typing approach could be improved by concomitant analysis of other DNA polymorphic sequences. PMID:12521117

  18. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    NASA Astrophysics Data System (ADS)

    Després, V. R.; Nowoisky, J. F.; Klose, M.; Conrad, R.; Andreae, M. O.; Pöschl, U.

    2007-12-01

    This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA) particles in the atmosphere. Samples of fine particulate matter (PM2.5) and total suspended particulates (TSP) have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze). From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP) were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses. Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m-3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively). Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42) and some from Actinobacteria (10) and Firmicutes (1). The fungal sequences were characteristic for Ascomycota (3) and Basidiomycota (1), which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2) and moss spores (2), while animal DNA was found only for one unicellular eukaryote (protist). Over 80% of the 53 bacterial sequences could be matched to one of the 19 T-RF peaks found in the PM2.5 samples, but only 40% of the T-RF peaks

  19. Structure-Driven Developments of 26S Proteasome Inhibitors.

    PubMed

    Śledź, Paweł; Baumeister, Wolfgang

    2016-01-01

    The 26S proteasome is a 2.5-MDa complex, and it operates at the executive end of the ubiquitin-proteasome pathway. It is a proven target for therapeutic agents for the treatment of some cancers and autoimmune diseases, and moreover, it has potential as a target of antibacterial agents. Most inhibitors, including all molecules approved for clinical use, target the 20S proteolytic core complex; its structure was determined two decades ago. Hitherto, efforts to develop inhibitors targeting the 19S regulatory particle subunits have been less successful. This is, in part, because the molecular architecture of this subcomplex has been, until recently, poorly understood, and high-resolution structures have been available only for a few subunits. In this review, we describe, from a structural perspective, the development of inhibitory molecules that target both the 20S and 19S subunits of the proteasome. We highlight the recent progress achieved in structure-based drug-discovery approaches, and we discuss the prospects for further improvement. PMID:26738474

  20. Molecular characterization of Gastrothylax crumenifer (Platyhelminthes: Gastrothylacidae) from goats in the western part of India by LSU of nuclear ribosomal DNA.

    PubMed

    Kumar, Ashwani; Chaudhary, Anshu; Verma, Chandni; Singh, Hridaya Shanker

    2014-12-01

    The rumen parasite, Gastrothylax crumenifer (Platyhelminthes: Gastrothylacidae), is a highly pathogenic trematode parasite of goat (Capra hircus). It sucks blood that causes acute disease like anemia, and severe economic losses occur due to morbidity and mortality of the ruminant infected by these worms. The study of these rumen paramphistomes, their infection, and public health importance remains unclear in India especially in the western part of state Uttar Pradesh (U.P.), Meerut, India, where the goat meat consumption is very high. This paper provides the molecular characterization of G. crumenifer recovered from the rumen of Capra hircus from Meerut, U.P., India by the partial sequence of 28S rDNA. Nucleotide sequence similarity searching on BLAST of 28S rDNA from parasites showed the highest identity with those of G. crumenifer from the same host Capra hircus. This is the first report of molecular identification of G. crumenifer from this part of India. PMID:25548426

  1. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  2. Experience with the MicroSeq D2 Large-Subunit Ribosomal DNA Sequencing Kit for Identification of Filamentous Fungi Encountered in the Clinical Laboratory

    PubMed Central

    Hall, Leslie; Wohlfiel, Sherri; Roberts, Glenn D.

    2004-01-01

    Described herein is our experience with the MicroSeq D2 large-subunit rDNA sequencing kit for the identification of filamentous fungi encountered in the mycology laboratory at the Mayo Clinic. A total of 234 filamentous fungi recovered from clinical specimens were used in the evaluation. All were identified by using phenotypic characteristics as observed macroscopically and microscopically on any medium or a combination of media, which included Sabouraud's dextrose, inhibitory mold, cornmeal, Czapek-Dox, potato dextrose, and V8 juice agars; all isolates were sequenced using the MicroSeq D2 large-subunit rDNA sequencing kit. Of the of 234 isolates, 158 were correctly identified to the appropriate genus or genus and species by using nucleic acid sequencing. Sequences for 70 (29.9%) of the isolates (27 genera) were not included in the MicroSeq library. Of the 80 dematiaceous and 154 hyaline fungi sequenced, 65 and 51.2%, respectively, gave results concordant with those determined by phenotypic identification. Nucleic acid sequencing using the MicroSeq D2 large-subunit rDNA sequencing kit offers promise of being an accurate identification system; however, the associated library needs to include more of the clinically important genera and species. PMID:14766826

  3. Chapter 2: Genetic Variability in Nuclear Ribosomal and Chloroplast DNA in Utah (Juniperus Osteosperma) and Western (J. Occidentalis) Juniper (Cupressaceae): Evidence for Interspecific Gene Flow1

    SciTech Connect

    Terry, Randall G.; Tausch, Robin J.; Nowak, Robert S.

    1998-02-14

    Early studies of evolutionary change in chloroplast DNA indicated limited variability within species. This finding has been attributed to relatively low rates of sequence evolution and has been maintained as justification for the lack of intraspecific sampling in studies examining, relationships at the species level and above. However, documentation of intraspecific variation in cpDNA has become increasingly common and has been attributed in many cases to ''chloroplast capture'' following genetic exchange across species boundaries. Rleseberg and Wendel (1993) list 37 cases of proposed hybridization in plants that include intraspecific variation in cpDNA, 24 (65%) of which they considered to be probable instances of introgression. Rieseberg (1995) suspected that a review of the literature at that time would reveal over 100 cases of intraspecific variation in CPDNA that could be attributed to hybridization and introgression. That intraspecific variation in cpDNA is potentially indicative of hybridization is founded on the expectation that slowly evolving loci or genomes will produce greater molecular variation between than within species. In cases where a species is polymorphic for CPDNA and at least one of the molecular variants is diagnostic for a second species, interspecific hybridization is a plausible explanation. Incongruence between relationships suggested by cpDNA variation and those supported by other types of data (e.g., morphology or molecular data from an additional locus) provides additional support for introgression. One aspect of hybridization in both animals and plants that has become increasingly evident is incongruence in the phylogenetic and geographic distribution of cytoplasmic and nuclear markers. In most cases cytoplasmic introgression appears to be more pervasive than nuclear exchange. This discordance appears attributable to several factors including differences in the mutation rate, number of effective alleles, and modes of inheritance of

  4. Yeast Identification Algorithm Based on Use of the Vitek MS System Selectively Supplemented with Ribosomal DNA Sequencing: Proposal of a Reference Assay for Invasive Fungal Surveillance Programs in China

    PubMed Central

    Zhang, Li; Xiao, Meng; Wang, He; Gao, Ran; Fan, Xin; Brown, Mitchell; Gray, Timothy J.; Kong, Fanrong

    2014-01-01

    Sequence analysis of the internal transcribed spacer (ITS) region was employed as the gold standard method for yeast identification in the China Hospital Invasive Fungal Surveillance Net (CHIF-NET). It has subsequently been found that matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) is potentially a more practical approach for this purpose. In the present study, the performance of the Vitek MS v2.0 system for the identification of yeast isolates collected from patients with invasive fungal infections in the 2011 CHIF-NET was evaluated. A total of 1,243 isolates representing 31 yeast species were analyzed, and the identification results by the Vitek MS v2.0 system were compared to those obtained by ITS sequence analysis. By the Vitek MS v2.0 system, 96.7% (n = 1,202) of the isolates were correctly assigned to the species level and 0.2% (n = 2) of the isolates were identified to the genus level, while 2.4% (n = 30) and 0.7% (n = 9) of the isolates were unidentified and misidentified, respectively. After retesting of the unidentified and misidentified strains, 97.3% (n = 1,209) of the isolates were correctly identified to the species level. Based on these results, a testing algorithm that combines the use of the Vitek MS system with selected supplementary ribosomal DNA (rDNA) sequencing was developed and validated for yeast identification purposes. By employing this algorithm, 99.7% (1,240/1,243) of the study isolates were accurately identified with the exception of two isolates of Candida fermentati and one isolate of Cryptococcus gattii. In conclusion, the proposed identification algorithm could be practically implemented in strategic programs of fungal infection surveillance. PMID:24478490

  5. Restriction Analysis of PCR-Amplified Internal Transcribed Spacers of Ribosomal DNA as a Tool for Species Identification in Different Genera of the Order Glomales

    PubMed Central

    Redecker, D.; Thierfelder, H.; Walker, C.; Werner, D.

    1997-01-01

    A technique combining PCR and restriction fragment length polymorphism analysis was used to generate specific DNA fragment patterns from spore extracts of arbuscular mycorrhizal fungi. With the universal primers ITS1 and ITS4, DNA fragments were amplified from species of Scutellospora and Gigaspora that were approximately 500 bp long. The apparent lengths of the corresponding fragments from Glomus spp. varied between 580 and 600 bp. Within the genus Glomus, the restriction enzymes MboI, HinfI, and TaqI were useful for distinguishing species. Depending on the restriction enzyme used, groups of species with common fragment patterns could be found. Five tropical and subtropical isolates identified as Glomus manihotis and G. clarum could not be distinguished by their restriction patterns, corresponding to the morphological similarity of the spores. The variation of internal transcribed spacer sequences among the Gigaspora species under study was low. Fragment patterns of Scutellospora spp. showed their phylogenetic relationship with Gigaspora and revealed only a slightly higher degree of variation. PMID:16535592

  6. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  7. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  8. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  9. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  10. Targeted cancer therapy with ribosome biogenesis inhibitors: a real possibility?

    PubMed Central

    Brighenti, Elisa; Treré, Davide; Derenzini, Massimo

    2015-01-01

    The effects of many chemotherapeutic drugs on ribosome biogenesis have been underestimated for a long time. Indeed, many drugs currently used for cancer treatment – and which are known to either damage DNA or hinder DNA synthesis – have been shown to exert their toxic action mainly by inhibiting rRNA synthesis or maturation. Moreover, there are new drugs that have been proposed recently for cancer chemotherapy, which only hinder ribosome biogenesis without any genotoxic activity. Even though ribosome biogenesis occurs in both normal and cancer cells, whether resting or proliferating, there is evidence that the selective inhibition of ribosome biogenesis may, in some instances, result in a selective damage to neoplastic cells. The higher sensitivity of cancer cells to inhibitors of rRNA synthesis appears to be the consequence of either the loss of the mechanisms controlling the cell cycle progression or the acquisition of activating oncogene and inactivating tumor suppressor gene mutations that up-regulate the ribosome biogenesis rate. This article reviews those cancer cell characteristics on which the selective cancer cell cytotoxicity induced by the inhibitors of ribosome biogenesis is based. PMID:26415219

  11. Application of 16s rDNA and cytochrome b ribosomal markers in studies of lineage and fish populations structure of aquatic species.

    PubMed

    Baharum, Syarul Nataqain; Nurdalila, A'wani Aziz

    2012-05-01

    The most economically important form of aquaculture is fish farming, which is an industry that accounts for an ever increasing share of world fishery production. Molecular markers can be used to enhance the productivity of the aquaculture and fish industries to meet the increasing demand. Molecular markers can be identified via a DNA test regardless of the developmental stage, age or environmental challenges experienced by the organism. The application of 16s and cytochrome b markers has enabled rapid progress in investigations of genetic variability and inbreeding, parentage assignments, species and strain identification and the construction of high resolution genetic linkage maps for aquaculture fisheries. In this review, the advantages of principles and potential power tools of 16s and cytochrome b markers are discussed. Main findings in term of trend, aspects and debates on the reviewed issue made from the model of aquatic species for the benefit of aquaculture genomics and aquaculture genetics research are discussed. The concepts in this review are illustrated with various research examples and results that relate theory to reality and provide a strong review of the current status of these biotechnology topics. PMID:22167328

  12. Analysis of the systematic relationships among ticks of the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on mitochondrial 12S ribosomal DNA gene sequences and morphological characters.

    PubMed

    Beati, L; Keirans, J E

    2001-02-01

    A portion of mitochondrial 12S rDNA sequences (337-355 base pairs) and 63 morphological characters of 36 hard-tick species belonging to 7 genera were analyzed to determine the phylogenetic relationships among groups and species of Rhipicephalus and between the genera Rhipicephalus and Boophilus. Molecular and morphological data sets were first examined separately. The molecular data were analyzed by maximum parsimony (MP), maximum likelihood, and neighbor-joining distance methods; the morphological data were analyzed by MP After their level of congruence was evaluated by a partition homogeneity test, all characters were combined and analyzed by MP. The branches of the tree obtained by combining the data sets were better resolved than those of the trees inferred from the separate analyses. Boophilus is monophyletic and arose within Rhipicephalus. Boophilus species clustered with species of the Rhipicephalus evertsi group. Most of the clustering within Rhipicephalus was, however, consistent with previous classifications based on morphological data. Morphological characters were traced on the molecular reconstruction in order to identify characters diagnostic for monophyletic clades. Within the Rhipicephalus sanguineus complex, the sequences of specimens morphologically identified as Rhipicephalus turanicus were characterized by a high level of variability, indicating that R. turanicus-like morphology may cover a spectrum of distinct species. PMID:11227901

  13. Phylogenetic position of the yeast-like symbiotes of Tagosodes orizicolus (Homoptera: Delphacidae) based on 18S ribosomal DNA partial sequences.

    PubMed

    Xet-Mull, Ana M; Quesada, Tania; Espinoza, Ana M

    2004-09-01

    Tagosodes orizicolus Muir (Homoptera: Delphacidae), the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS) in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus (YLSTo) were purified on Percoll gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR) program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP), showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella fur cifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. PMID:17361570

  14. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  15. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  16. Genetic Characterization of Fasciola Isolates from West Azerbaijan Province Iran Based on ITS1 and ITS2 Sequence of Ribosomal DNA

    PubMed Central

    GALAVANI, Hossein; GHOLIZADEH, Saber; HAZRATI TAPPEH, Khosrow

    2016-01-01

    Background: Fascioliasis, caused by Fasciola hepatica and F. gigantica, has medical and economic importance in the world. Molecular approaches comparing traditional methods using for identification and characterization of Fasciola spp. are precise and reliable. The aims of current study were molecular characterization of Fasciola spp. in West Azerbaijan Province, Iran and then comparative analysis of them using GenBank sequences. Methods: A total number of 580 isolates were collected from different hosts in five cities of West Azerbaijan Province, in 2014 from 90 slaughtered cattle (n=50) and sheep (n=40). After morphological identification and DNA extraction, designing specific primer were used to amplification of ITS1, 5.8s and ITS2 regions, 50 samples were conducted to sequence, randomly. Result: Using morphometric characters 99.14% and 0.86% of isolates identified as F. hepatica and F. gigantica, respectively. PCR amplification of 1081 bp fragment and sequencing result showed 100% similarity with F. hepatica in ITS1 (428 bp), 5.8s (158 bp), and ITS2 (366 bp) regions. Sequence comparison among current study sequences and GenBank data showed 98% identity with 11 nucleotide mismatches. However, in phylogenetic tree F. hepatica sequences of West Azerbaijan Province, Iran, were in a close relationship with Iranian, Asian, and African isolates. Conclusions: Only F. hepatica species is distributed among sheep and cattle in West Azerbaijan Province Iran. However, 5 and 6 bp variation in ITS1 and ITS2 regions, respectively, is not enough to separate of Fasciola spp. Therefore, more studies are essential for designing new molecular markers to correct species identification. PMID:27095969

  17. Nucleotide excision repair and the 26S proteasome function together to promote trinucleotide repeat expansions.

    PubMed

    Concannon, Claire; Lahue, Robert S

    2014-01-01

    Trinucleotide repeat (TNR) expansion underpins a number of inheritable neurological human disorders. Multiple mechanisms are thought to contribute to the expansion process. The incorrect processing of the repeat tract by DNA repair proteins can drive this mutation process forward, as expansions are suppressed following ablation of certain repair factors in mouse models and cell models of disease. Nucleotide excision repair (NER) is one repair pathway implicated in TNR instability, although most previous work focussed on TNR contractions, not expansions. Here we investigated the role of NER in modulating expansions of threshold-length (CTG·CAG) repeats in yeast. We show that both the global genome and transcription-coupled repair subpathways promote expansions of threshold-length TNRs. Furthermore, NER works with the 26S proteasome to drive expansions, based on analysis of double mutants defective in both pathways, and of Rad23, a protein involved in both NER and the shuttling of ubiquitinated proteins to the proteasome. This work provides the first evidence that both subpathways of NER can promote threshold-length TNR expansions and that NER interacts with the proteasome to drive expansions. PMID:24359926

  18. TOPORS, a Dual E3 Ubiquitin and Sumo1 Ligase, Interacts with 26 S Protease Regulatory Subunit 4, Encoded by the PSMC1 Gene

    PubMed Central

    Czub, Barbara; Shah, Amna Z.; Alfano, Giovanna; Kruczek, Przemysław M.; Chakarova, Christina F.; Bhattacharya, Shomi S.

    2016-01-01

    The significance of the ubiquitin-proteasome system (UPS) for protein degradation has been highlighted in the context of neurodegenerative diseases, including retinal dystrophies. TOPORS, a dual E3 ubiquitin and SUMO1 ligase, forms a component of the UPS and selected substrates for its enzymatic activities, such as DJ-1/PARK7 and APOBEC2, are important for neuronal as well as retinal homeostasis, respectively. TOPORS is ubiquitously expressed, yet its mutations are only known to result in autosomal dominant retinitis pigmentosa. We performed a yeast two-hybrid (Y2H) screen of a human retinal cDNA library in order to identify interacting protein partners of TOPORS from the retina, and thus begin delineating the putative disease mechanism(s) associated with the retina-specific phenotype resulting from mutations in TOPORS. The screen led to isolation of the 26 S protease regulatory subunit 4 (P26s4/ PSMC1), an ATPase indispensable for correct functioning of UPS-mediated proteostasis. The interaction between endogenous TOPORS and P26s4 proteins was validated by co-immuno-precipitation from mammalian cell extracts and further characterised by immunofluorescent co-localisation studies in cell lines and retinal sections. Findings from hTERT-RPE1 and 661W cells demonstrated that TOPORS and P26s4 co-localise at the centrosome in cultured cells. Immunofluorescent staining of mouse retinae revealed a strong P26s4 reactivity at the interface between retinal pigmented epithelium (RPE) layer and the photoreceptors outer segments (OS). This finding leads us to speculate that P26s4, along with TOPORS, may have a role(s) in RPE phagocytosis, in addition to contributing to the overall photoreceptor and retinal homeostasis via the UPS. PMID:26872363

  19. Next generation sequencing analysis reveals a relationship between rDNA unit diversity and locus number in Nicotiana diploids

    PubMed Central

    2012-01-01

    Background Tandemly arranged nuclear ribosomal DNA (rDNA), encoding 18S, 5.8S and 26S ribosomal RNA (rRNA), exhibit concerted evolution, a pattern thought to result from the homogenisation of rDNA arrays. However rDNA homogeneity at the single nucleotide polymorphism (SNP) level has not been detailed in organisms with more than a few hundred copies of the rDNA unit. Here we study rDNA complexity in species with arrays consisting of thousands of units. Methods We examined homogeneity of genic (18S) and non-coding internally transcribed spacer (ITS1) regions of rDNA using Roche 454 and/or Illumina platforms in four angiosperm species, Nicotiana sylvestris, N. tomentosiformis, N. otophora and N. kawakamii. We compared the data with Southern blot hybridisation revealing the structure of intergenic spacer (IGS) sequences and with the number and distribution of rDNA loci. Results and Conclusions In all four species the intragenomic homogeneity of the 18S gene was high; a single ribotype makes up over 90% of the genes. However greater variation was observed in the ITS1 region, particularly in species with two or more rDNA loci, where >55% of rDNA units were a single ribotype, with the second most abundant variant accounted for >18% of units. IGS heterogeneity was high in all species. The increased number of ribotypes in ITS1 compared with 18S sequences may reflect rounds of incomplete homogenisation with strong selection for functional genic regions and relaxed selection on ITS1 variants. The relationship between the number of ITS1 ribotypes and the number of rDNA loci leads us to propose that rDNA evolution and complexity is influenced by locus number and/or amplification of orphaned rDNA units at new chromosomal locations. PMID:23259460

  20. Tomato 26S Proteasome subunit RPT4a regulates ToLCNDV transcription and activates hypersensitive response in tomato.

    PubMed

    Sahu, Pranav Pankaj; Sharma, Namisha; Puranik, Swati; Chakraborty, Supriya; Prasad, Manoj

    2016-01-01

    Involvement of 26S proteasomal subunits in plant pathogen-interactions, and the roles of each subunit in independently modulating the activity of many intra- and inter-cellular regulators controlling physiological and defense responses of a plant were well reported. In this regard, we aimed to functionally characterize a Solanum lycopersicum 26S proteasomal subunit RPT4a (SlRPT4) gene, which was differentially expressed after Tomato leaf curl New Delhi virus (ToLCNDV) infection in tolerant cultivar H-88-78-1. Molecular analysis revealed that SlRPT4 protein has an active ATPase activity. SlRPT4 could specifically bind to the stem-loop structure of intergenic region (IR), present in both DNA-A and DNA-B molecule of the bipartite viral genome. Lack of secondary structure in replication-associated gene fragment prevented formation of DNA-protein complex suggesting that binding of SlRPT4 with DNA is secondary structure specific. Interestingly, binding of SlRPT4 to IR inhibited the function of RNA Pol-II and subsequently reduced the bi-directional transcription of ToLCNDV genome. Virus-induced gene silencing of SlRPT4 gene incited conversion of tolerant attributes of cultivar H-88-78-1 into susceptibility. Furthermore, transient overexpression of SlRPT4 resulted in activation of programmed cell death and antioxidant enzymes system. Overall, present study highlights non-proteolytic function of SlRPT4 and their participation in defense pathway against virus infection in tomato. PMID:27252084

  1. Tomato 26S Proteasome subunit RPT4a regulates ToLCNDV transcription and activates hypersensitive response in tomato

    PubMed Central

    Sahu, Pranav Pankaj; Sharma, Namisha; Puranik, Swati; Chakraborty, Supriya; Prasad, Manoj

    2016-01-01

    Involvement of 26S proteasomal subunits in plant pathogen-interactions, and the roles of each subunit in independently modulating the activity of many intra- and inter-cellular regulators controlling physiological and defense responses of a plant were well reported. In this regard, we aimed to functionally characterize a Solanum lycopersicum 26S proteasomal subunit RPT4a (SlRPT4) gene, which was differentially expressed after Tomato leaf curl New Delhi virus (ToLCNDV) infection in tolerant cultivar H-88-78-1. Molecular analysis revealed that SlRPT4 protein has an active ATPase activity. SlRPT4 could specifically bind to the stem-loop structure of intergenic region (IR), present in both DNA-A and DNA-B molecule of the bipartite viral genome. Lack of secondary structure in replication-associated gene fragment prevented formation of DNA-protein complex suggesting that binding of SlRPT4 with DNA is secondary structure specific. Interestingly, binding of SlRPT4 to IR inhibited the function of RNA Pol-II and subsequently reduced the bi-directional transcription of ToLCNDV genome. Virus-induced gene silencing of SlRPT4 gene incited conversion of tolerant attributes of cultivar H-88-78-1 into susceptibility. Furthermore, transient overexpression of SlRPT4 resulted in activation of programmed cell death and antioxidant enzymes system. Overall, present study highlights non-proteolytic function of SlRPT4 and their participation in defense pathway against virus infection in tomato. PMID:27252084

  2. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  3. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  4. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    PubMed Central

    2012-01-01

    Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a) as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters. PMID:22686419

  5. Highly efficient ribosome display selection by use of purified components for in vitro translation.

    PubMed

    Villemagne, Denis; Jackson, Ronald; Douthwaite, Julie A

    2006-06-30

    Ribosome display is a powerful in vitro technology for the selection and directed evolution of proteins. The ribosome display process exploits cell-free translation to achieve coupling of phenotype and genotype by the production of stabilised ribosome complexes in which translated proteins and their encoding mRNA remain attached to the ribosome. Current ribosome display systems that are well proven, by the evolution of high affinity antibodies and the optimisation of defined protein characteristics, use an Escherichia coli cell extract for in vitro translation and display of an mRNA library. Recently, a cell-free translation system has been produced by combining recombinant E. coli protein factors with purified 70S ribosomes. We have applied this development in cell-free translation technology to ribosome display by using the reconstituted system to generate stabilised ribosome complexes for selection. We show that higher cDNA yields are recovered from ribosome display selections when using a reconstituted translation system and the degree of improvement seen is selection specific. These effects are likely to reflect higher mRNA and protein stability and potentially other advantages that may include protein specific improvements in expression. Reconstituted translation systems therefore enable a highly efficient, robust and accessible prokaryotic ribosome display technology. PMID:16730021

  6. Nin1p, a regulatory subunit of the 26S proteasome, is necessary for activation of Cdc28p kinase of Saccharomyces cerevisiae.

    PubMed Central

    Kominami, K; DeMartino, G N; Moomaw, C R; Slaughter, C A; Shimbara, N; Fujimuro, M; Yokosawa, H; Hisamatsu, H; Tanahashi, N; Shimizu, Y

    1995-01-01

    The nin1-1 mutant of Saccharomyces cerevisiae cannot perform the G1/S and G2/M transitions at restrictive temperatures. At such temperatures, nin1-1 strains fail to activate histone H1 kinase after release from alpha factor-imposed G1 block and after release from hydroxyurea-imposed S block. The nin1-1 mutation shows synthetic lethality with certain cdc28 mutant alleles such as cdc28-IN. Two lines of evidence indicate that Nin1p is a component of the 26S proteasome complex: (i) Nin1p, as well as the known component of the 26S proteasome, shifted to the 26S proteasome peak in the glycerol density gradient after preincubation of crude extract with ATP-Mg2+, and (ii) nin1-1 cells accumulated polyubiquitinated proteins under restrictive conditions. These results suggest that activation of Cdc28p kinase requires proteolysis. We have cloned a human cDNA encoding a regulatory subunit of the 26S proteasome, p31, which was found to be a homolog of Nin1p. Images PMID:7621825

  7. Inherent Asymmetry in the 26S Proteasome Is Defined by the Ubiquitin Receptor RPN13*

    PubMed Central

    Berko, Dikla; Herkon, Ora; Braunstein, Ilana; Isakov, Elada; David, Yael; Ziv, Tamar; Navon, Ami; Stanhill, Ariel

    2014-01-01

    The 26S double-capped proteasome is assembled in a hierarchic event that is orchestrated by dedicated set of chaperons. To date, all stoichiometric subunits are considered to be present in equal ratios, thus providing symmetry to the double-capped complex. Here, we show that although the vast majority (if not all) of the double-capped 26S proteasomes, both 19S complexes, contain the ubiquitin receptor Rpn10/S5a, only one of these 19S particles contains the additional ubiquitin receptor Rpn13, thereby defining asymmetry in the 26S proteasome. These results were validated in yeast and mammals, utilizing biochemical and unbiased AQUA-MS methodologies. Thus, the double-capped 26S proteasomes are asymmetric in their polyubiquitin binding capacity. Our data point to a potential new role for ubiquitin receptors as directionality factors that may participate in the prevention of simultaneous substrates translocation into the 20S from both 19S caps. PMID:24429290

  8. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    SciTech Connect

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon . E-mail: shkim@khu.ac.kr

    2007-04-27

    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein.

  9. Entropy-based mechanism of ribosome-nucleoid segregation in E. coli cells.

    PubMed

    Mondal, Jagannath; Bratton, Benjamin P; Li, Yijie; Yethiraj, Arun; Weisshaar, James C

    2011-06-01

    In Escherichia coli, ribosomes concentrate near the cylindrical wall and at the endcaps, whereas the chromosomal DNA segregates in the more centrally located nucleoid. A simple statistical model recovers the observed ribosome-nucleoid segregation remarkably well. Plectonemic DNA is represented as a hyperbranched hard-sphere polymer, and multiple ribosomes that simultaneously translate the same mRNA strand (polysomes) are represented as freely jointed chains of hard spheres. There are no attractive interactions between particles, only excluded-volume effects. At realistic DNA and ribosome concentrations, segregation arises primarily from two effects: the DNA polymer avoids walls to maximize conformational entropy, and the polysomes occupy the empty space near the walls to maximize translational entropy. In this complex system, maximizing total entropy results in spatial organization of the components. Due to coupling of mRNA to DNA through RNA polymerase, the same entropic effects should favor the placement of highly expressed genes at the interface between the nucleoid and the ribosome-rich periphery. Such a placement would enable efficient cotranscriptional translation and facile transertion of membrane proteins into the cytoplasmic membrane. Finally, in the model, monofunctional DNA polymer beads representing the tips of plectonemes preferentially locate near the cylindrical wall. This suggests that initiation of transcription may occur preferentially near the ribosome-rich periphery. PMID:21641305

  10. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  11. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  12. Plant rDNA database: update and new features

    PubMed Central

    Garcia, Sònia; Gálvez, Francisco; Gras, Airy; Kovařík, Aleš; Garnatje, Teresa

    2014-01-01

    The Plant rDNA database (www.plantrdnadatabase.com) is an open access online resource providing detailed information on numbers, structures and positions of 5S and 18S-5.8S-26S (35S) ribosomal DNA loci. The data have been obtained from >600 publications on plant molecular cytogenetics, mostly based on fluorescent in situ hybridization (FISH). This edition of the database contains information on 1609 species derived from 2839 records, which means an expansion of 55.76 and 94.45%, respectively. It holds the data for angiosperms, gymnosperms, bryophytes and pteridophytes available as of June 2013. Information from publications reporting data for a single rDNA (either 5S or 35S alone) and annotation regarding transcriptional activity of 35S loci now appears in the database. Preliminary analyses suggest greater variability in the number of rDNA loci in gymnosperms than in angiosperms. New applications provide ideograms of the species showing the positions of rDNA loci as well as a visual representation of their genome sizes. We have also introduced other features to boost the usability of the Web interface, such as an application for convenient data export and a new section with rDNA–FISH-related information (mostly detailing protocols and reagents). In addition, we upgraded and/or proofread tabs and links and modified the website for a more dynamic appearance. This manuscript provides a synopsis of these changes and developments. Database URL: http://www.plantrdnadatabase.com PMID:24980131

  13. Yeast ribosomal protein L7 and its homologue Rlp7 are simultaneously present at distinct sites on pre-60S ribosomal particles

    PubMed Central

    Babiano, Reyes; Badis, Gwenael; Saveanu, Cosmin; Namane, Abdelkader; Doyen, Antonia; Díaz-Quintana, Antonio; Jacquier, Alain; Fromont-Racine, Micheline; de la Cruz, Jesús

    2013-01-01

    Ribosome biogenesis requires >300 assembly factors in Saccharomyces cerevisiae. Ribosome assembly factors Imp3, Mrt4, Rlp7 and Rlp24 have sequence similarity to ribosomal proteins S9, P0, L7 and L24, suggesting that these pre-ribosomal factors could be placeholders that prevent premature assembly of the corresponding ribosomal proteins to nascent ribosomes. However, we found L7 to be a highly specific component of Rlp7-associated complexes, revealing that the two proteins can bind simultaneously to pre-ribosomal particles. Cross-linking and cDNA analysis experiments showed that Rlp7 binds to the ITS2 region of 27S pre-rRNAs, at two sites, in helix III and in a region adjacent to the pre-rRNA processing sites C1 and E. However, L7 binds to mature 25S and 5S rRNAs and cross-linked predominantly to helix ES7Lb within 25S rRNA. Thus, despite their predicted structural similarity, our data show that Rlp7 and L7 clearly bind at different positions on the same pre-60S particles. Our results also suggest that Rlp7 facilitates the formation of the hairpin structure of ITS2 during 60S ribosomal subunit maturation. PMID:23945946

  14. Tripartite mitochondrial genome of spinach: physical structure, mitochondrial gene mapping, and locations of transposed chloroplast DNA sequences.

    PubMed Central

    Stern, D B; Palmer, J D

    1986-01-01

    A complete physical map of the spinach mitochondrial genome has been established. The entire sequence content of 327 kilobase pairs (kb) is postulated to occur as a single circular molecule. Two directly repeated elements of approximately 6 kb, located on this "master chromosome", are proposed to participate in an intragenomic recombination event that reversibly generates two "subgenomic" circles of 93 kb and 234 kb. The positions of protein and ribosomal RNA-encoding genes, determined by heterologous filter hybridizations, are scattered throughout the genome, with duplicate 26S rRNA genes located partially or entirely within the 6 kb repeat elements. Filter hybridizations between spinach mitochondrial DNA and cloned segments of spinach chloroplast DNA reveal at least twelve dispersed regions of inter-organellar sequence homology. Images PMID:3016660

  15. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  16. HSP70 Mediates Dissociation and Reassociation of the 26S Proteasome During Adaptation to Oxidative Stress

    PubMed Central

    Grune, Tilman; Catalgol, Betül; Licht, Anke; Ermak, Gennady; Pickering, Andrew; Ngo, Jenny K.; Davies, Kelvin J. A.

    2011-01-01

    We report an entirely new role for the HSP70 chaperone in dissociating 26S proteasome complexes (into free 20S proteasomes and bound 19S regulators), preserving 19S regulators, and reconstituting 26S proteasomes in the first 1-3 hours following mild oxidative stress. These responses, coupled with direct 20S proteasome activation by poly-ADP ribose polymerase in the nucleus and by PA28αβ in the cytoplasm, instantly provides cells with increased capacity to degrade oxidatively damaged proteins and to survive the initial effects of stress exposure. Subsequent adaptive (hormetic) processes (3-24 hours following stress exposure), mediated by several signal transduction pathways and involving increased transcription/translation of 20S proteasomes, immunoproteasomes, and PA28αβ, abrogate the need for 26S proteasome dissociation. During this adaptive period, HSP70 releases its bound 19S regulators, 26S proteasomes are reconstituted, and ATP-stimulated proteolysis is restored. The 26S proteasome-dependent, and ATP-stimulated, turnover of ubiquitinylated proteins is essential for normal cell metabolism, and its restoration is required for successful stress-adaptation. PMID:21767633

  17. Cinnamomin: a multifunctional type II ribosome-inactivating protein.

    PubMed

    He, Wen-Jun; Liu, Wang-Yi

    2003-07-01

    Plant ribosome-inactivating proteins (RIPs) are a group of toxic proteins that can irreversibly inactivate ribosomes by specifically removing the conserved adenine base from the "Sarcin/Ricin domain" of the 28S RNA in ribosome. Cinnamomin is a novel type II RIP isolated in our laboratory from the mature seeds of camphor tree. Besides site-specific deadenylation of the A4324 in the Sarcin/Ricin domain of rat ribosome, this protein could also release the adenine base from DNA molecules at multiple sites and from AMP, ADP, dAMP and adenosine. Furthermore, cinnamomin displays cytotoxicity to carcinoma cells and insect larvae by modifying their ribosomal RNA. These functions possessed by cinnamomin shed a new light on the possible application of cinnamomin in the field of immunotoxin design and transgenic reagents. In this review, we introduce the major recent results on cinnamomin obtained in our laboratory, including purification of this protein, characterization of its enzymatic mechanism, structure and function, gene pattern, physiological role and its biological implications in cytotoxicity. PMID:12672471

  18. CDNA cloning of p112, the largest regulatory subunit of the human 26s proteasome, and functional analysis of its yeast homologue, sen3p.

    PubMed Central

    Yokota, K; Kagawa, S; Shimizu, Y; Akioka, H; Tsurumi, C; Noda, C; Fujimuro, M; Yokosawa, H; Fujiwara, T; Takahashi, E; Ohba, M; Yamasaki, M; DeMartino, G N; Slaughter, C A; Toh-e, A; Tanaka, K

    1996-01-01

    The 26S proteasome is a large multisubunit protease complex, the largest regulatory subunit of which is a component named p112. Molecular cloning of cDNA encoding human p112 revealed a polypeptide predicted to have 953 amino acid residues and a molecular mass of 105,865. The human p112 gene was mapped to the q37.1-q37.2 region of chromosome 2. Computer analysis showed that p112 has strong similarity to the Saccharomyces cerevisiae Sen3p, which has been listed in a gene bank as a factor affecting tRNA splicing endonuclease. The SEN3 also was identified in a synthetic lethal screen with the nin1-1 mutant, a temperature-sensitive mutant of NIN1. NIN1 encodes p31, another regulatory subunit of the 26S proteasome, which is necessary for activation of Cdc28p kinase. Disruption of the SEN3 did not affect cell viability, but led to temperature-sensitive growth. The human p112 cDNA suppressed the growth defect at high temperature in a SEN3 disruptant, indicating that p112 is a functional homologue of the yeast Sen3p. Maintenance of SEN3 disruptant cells at the restrictive temperature resulted in a variety of cellular dysfunctions, including defects in proteolysis mediated by the ubiquitin pathway, in the N-end rule system, in the stress response upon cadmium exposure, and in nuclear protein transportation. The functional abnormality induced by SEN3 disruption differs considerably from various phenotypes shown by the nin1-1 mutation, suggesting that these two regulatory subunits of the 26S proteasome play distinct roles in the various processes mediated by the 26S proteasome. Images PMID:8816993

  19. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  20. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  1. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  2. The toxin GraT inhibits ribosome biogenesis.

    PubMed

    Ainelo, Andres; Tamman, Hedvig; Leppik, Margus; Remme, Jaanus; Hõrak, Rita

    2016-05-01

    Most bacteria encode numerous chromosomal toxin-antitoxin (TA) systems that are proposed to contribute to stress tolerance, as they are able to shift the cells to a dormant state. Toxins act on a variety of targets with the majority attacking the translational apparatus. Intriguingly, the toxicity mechanisms of even closely related toxins may differ essentially. Here, we report on a new type of TA toxin that inhibits ribosome biogenesis. GraT of the GraTA system has previously been described in Pseudomonas putida as an unusually moderate toxin at optimal growth temperatures. However, GraT causes a severe growth defect at lower temperatures. Here, we demonstrate that GraT causes the accumulation of free ribosomal subunits. Mapping the rRNA 5' ends reveals incomplete processing of the free subunits and quantification of modified nucleosides shows an underrepresentation of late subunit assembly specific modifications. This indicates that GraT inhibits ribosome subunit assembly. Interestingly, GraT effects can be alleviated by modification of the chaperone DnaK, a known facilitator of late stages in ribosome biogenesis. We show that GraT directly interacts with DnaK and suggest two possible models for the role of this interaction in GraT toxicity. PMID:26833678

  3. PTRF/Cavin-1 promotes efficient ribosomal RNA transcription in response to metabolic challenges.

    PubMed

    Liu, Libin; Pilch, Paul F

    2016-01-01

    Ribosomal RNA transcription mediated by RNA polymerase I represents the rate-limiting step in ribosome biogenesis. In eukaryotic cells, nutrients and growth factors regulate ribosomal RNA transcription through various key factors coupled to cell growth. We show here in mature adipocytes, ribosomal transcription can be acutely regulated in response to metabolic challenges. This acute response is mediated by PTRF (polymerase I transcription and release factor, also known as cavin-1), which has previously been shown to play a critical role in caveolae formation. The caveolae-independent rDNA transcriptional role of PTRF not only explains the lipodystrophy phenotype observed in PTRF deficient mice and humans, but also highlights its crucial physiological role in maintaining adipocyte allostasis. Multiple post-translational modifications of PTRF provide mechanistic bases for its regulation. The role of PTRF in ribosomal transcriptional efficiency is likely relevant to many additional physiological situations of cell growth and organismal metabolism. PMID:27528195

  4. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  5. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  6. MPV17L2 is required for ribosome assembly in mitochondria

    PubMed Central

    Dalla Rosa, Ilaria; Durigon, Romina; Pearce, Sarah F.; Rorbach, Joanna; Hirst, Elizabeth M.A.; Vidoni, Sara; Reyes, Aurelio; Brea-Calvo, Gloria; Minczuk, Michal; Woellhaf, Michael W.; Herrmann, Johannes M.; Huynen, Martijn A.; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    MPV17 is a mitochondrial protein of unknown function, and mutations in MPV17 are associated with mitochondrial deoxyribonucleic acid (DNA) maintenance disorders. Here we investigated its most similar relative, MPV17L2, which is also annotated as a mitochondrial protein. Mitochondrial fractionation analyses demonstrate MPV17L2 is an integral inner membrane protein, like MPV17. However, unlike MPV17, MPV17L2 is dependent on mitochondrial DNA, as it is absent from ρ0 cells, and co-sediments on sucrose gradients with the large subunit of the mitochondrial ribosome and the monosome. Gene silencing of MPV17L2 results in marked decreases in the monosome and both subunits of the mitochondrial ribosome, leading to impaired protein synthesis in the mitochondria. Depletion of MPV17L2 also induces mitochondrial DNA aggregation. The DNA and ribosome phenotypes are linked, as in the absence of MPV17L2 proteins of the small subunit of the mitochondrial ribosome are trapped in the enlarged nucleoids, in contrast to a component of the large subunit. These findings suggest MPV17L2 contributes to the biogenesis of the mitochondrial ribosome, uniting the two subunits to create the translationally competent monosome, and provide evidence that assembly of the small subunit of the mitochondrial ribosome occurs at the nucleoid. PMID:24948607

  7. Genomic architecture and inheritance of human ribosomal RNA gene clusters

    PubMed Central

    Stults, Dawn M.; Killen, Michael W.; Pierce, Heather H.; Pierce, Andrew J.

    2008-01-01

    The finishing of the Human Genome Project largely completed the detailing of human euchromatic sequences; however, the most highly repetitive regions of the genome still could not be assembled. The 12 gene clusters producing the structural RNA components of the ribosome are critically important for cellular viability, yet fall into this unassembled region of the Human Genome Project. To determine the extent of human variation in ribosomal RNA gene content (rDNA) and patterns of rDNA cluster inheritance, we have determined the physical lengths of the rDNA clusters in peripheral blood white cells of healthy human volunteers. The cluster lengths exhibit striking variability between and within human individuals, ranging from 50 kb to >6 Mb, manifest essentially complete heterozygosity, and provide each person with their own unique rDNA electrophoretic karyotype. Analysis of these rDNA fingerprints in multigenerational human families demonstrates that the rDNA clusters are subject to meiotic rearrangement at a frequency >10% per cluster, per meiosis. With this high intrinsic recombinational instability, the rDNA clusters may serve as a unique paradigm of potential human genomic plasticity. PMID:18025267

  8. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  9. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  10. Structure of the human 26S proteasome at a resolution of 3.9 Å.

    PubMed

    Schweitzer, Andreas; Aufderheide, Antje; Rudack, Till; Beck, Florian; Pfeifer, Günter; Plitzko, Jürgen M; Sakata, Eri; Schulten, Klaus; Förster, Friedrich; Baumeister, Wolfgang

    2016-07-12

    Protein degradation in eukaryotic cells is performed by the Ubiquitin-Proteasome System (UPS). The 26S proteasome holocomplex consists of a core particle (CP) that proteolytically degrades polyubiquitylated proteins, and a regulatory particle (RP) containing the AAA-ATPase module. This module controls access to the proteolytic chamber inside the CP and is surrounded by non-ATPase subunits (Rpns) that recognize substrates and deubiquitylate them before unfolding and degradation. The architecture of the 26S holocomplex is highly conserved between yeast and humans. The structure of the human 26S holocomplex described here reveals previously unidentified features of the AAA-ATPase heterohexamer. One subunit, Rpt6, has ADP bound, whereas the other five have ATP in their binding pockets. Rpt6 is structurally distinct from the other five Rpt subunits, most notably in its pore loop region. For Rpns, the map reveals two main, previously undetected, features: the C terminus of Rpn3 protrudes into the mouth of the ATPase ring; and Rpn1 and Rpn2, the largest proteasome subunits, are linked by an extended connection. The structural features of the 26S proteasome observed in this study are likely to be important for coordinating the proteasomal subunits during substrate processing. PMID:27342858

  11. Structure of the human 26S proteasome at a resolution of 3.9 Å

    PubMed Central

    Schweitzer, Andreas; Aufderheide, Antje; Rudack, Till; Beck, Florian; Pfeifer, Günter; Plitzko, Jürgen M.; Sakata, Eri; Schulten, Klaus; Förster, Friedrich; Baumeister, Wolfgang

    2016-01-01

    Protein degradation in eukaryotic cells is performed by the Ubiquitin-Proteasome System (UPS). The 26S proteasome holocomplex consists of a core particle (CP) that proteolytically degrades polyubiquitylated proteins, and a regulatory particle (RP) containing the AAA-ATPase module. This module controls access to the proteolytic chamber inside the CP and is surrounded by non-ATPase subunits (Rpns) that recognize substrates and deubiquitylate them before unfolding and degradation. The architecture of the 26S holocomplex is highly conserved between yeast and humans. The structure of the human 26S holocomplex described here reveals previously unidentified features of the AAA-ATPase heterohexamer. One subunit, Rpt6, has ADP bound, whereas the other five have ATP in their binding pockets. Rpt6 is structurally distinct from the other five Rpt subunits, most notably in its pore loop region. For Rpns, the map reveals two main, previously undetected, features: the C terminus of Rpn3 protrudes into the mouth of the ATPase ring; and Rpn1 and Rpn2, the largest proteasome subunits, are linked by an extended connection. The structural features of the 26S proteasome observed in this study are likely to be important for coordinating the proteasomal subunits during substrate processing. PMID:27342858

  12. Re-analysis of cryoEM data on HCV IRES bound to 40S subunit of human ribosome integrated with recent structural information suggests new contact regions between ribosomal proteins and HCV RNA

    PubMed Central

    Joseph, Agnel Praveen; Bhat, Prasanna; Das, Saumitra; Srinivasan, Narayanaswamy

    2014-01-01

    In this study, we combine available high resolution structural information on eukaryotic ribosomes with low resolution cryo-EM data on the Hepatitis C Viral RNA (IRES) human ribosome complex. Aided further by the prediction of RNA-protein interactions and restrained docking studies, we gain insights on their interaction at the residue level. We identified the components involved at the major and minor contact regions, and propose that there are energetically favorable local interactions between 40S ribosomal proteins and IRES domains. Domain II of the IRES interacts with ribosomal proteins S5 and S25 while the pseudoknot and the downstream domain IV region bind to ribosomal proteins S26, S28 and S5. We also provide support using UV cross-linking studies to validate our proposition of interaction between the S5 and IRES domains II and IV. We found that domain IIIe makes contact with the ribosomal protein S3a (S1e). Our model also suggests that the ribosomal protein S27 interacts with domain IIIc while S7 has a weak contact with a single base RNA bulge between junction IIIabc and IIId. The interacting residues are highly conserved among mammalian homologs while IRES RNA bases involved in contact do not show strict conservation. IRES RNA binding sites for S25 and S3a show the best conservation among related viral IRESs. The new contacts identified between ribosomal proteins and RNA are consistent with previous independent studies on RNA-binding properties of ribosomal proteins reported in literature, though information at the residue level is not available in previous studies. PMID:25268799

  13. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  14. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  15. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses.

    PubMed

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng; Song, Rentao

    2016-02-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  16. A putative precursor for the small ribosomal RNA from mitochondria of Saccharomyces cerevisiae.

    PubMed Central

    Osinga, K A; Evers, R F; Van der Laan, J C; Tabak, H F

    1981-01-01

    We have characterized a putative precursor RNA (15.5S) for the 15S ribosomal RNA in mitochondria of Saccharomyces cerevisiae. Hybrids were formed with mitochondrial RNA and mtDNA fragments terminally labelled at restriction sites located within the gene coding for 15S ribosomal RNA and treated with S1 nuclease (Berk, A.J. and Sharp, J.A. (1977) 12, 721-732). Sites of resistant hybrids were measured by agarose gel electrophoresis and end points of RNAs determined. The 15.5S RNA is approximately 80 nucleotides longer than the 15S ribosomal RNA, with the extra sequences being located at the 5'-end. Both 15S ribosomal RNA and 15.5S RNA are fully localised within a 2000 base pair HapII fragment. This putative precursor and the mature 15S ribosomal RNA are also found in petite mutants which retain the 15S ribosomal RNA gene. The petite mutant with the smallest genetic complexity has its end point of deletion (junction) just outside the HapII site located in the 5' flank of the 15S ribosomal RNA genes as determined by S1 nuclease analysis. This leaves a DNA stretch approximately 300 base pairs long where an initiation signal for mitochondrial transcription may be present. Images PMID:6262728

  17. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  18. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  19. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  20. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  1. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex.

    PubMed

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5' end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  2. Studies on the activation by ATP of the 26 S proteasome complex from rat skeletal muscle.

    PubMed Central

    Dahlmann, B; Kuehn, L; Reinauer, H

    1995-01-01

    The 26 S proteasome complex is thought to catalyse the breakdown of ubiquitinated proteins within eukaryotic cells. In addition it has been found that the complex also degrades short-lived proteins such as ornithine decarboxylase in a ubiquitin-independent manner. Both proteolytic processes are paralleled by the hydrolysis of ATP. Here we show that ATP also affects the hydrolytic activity towards fluorigenic peptide substrates by the 26 S proteasome complex from rat skeletal muscle tissue. Low concentrations of ATP (about 25 microM) optimally activate the so-called chymotryptic and tryptic activity by increasing the rate of peptide hydrolysis but not peptidylglutamylpeptide hydrolysis. Activation of the enzyme by ATP is transient but this effect can be enhanced and prolonged by including in the assay an ATP-regenerating system, indicating that ATP is hydrolysed by the 26 S proteasome complex. Although ATP cannot be substituted for by adenosine 5'-[beta,gamma-methylene]triphosphate or AMP, hydrolysis of the phosphoanhydride bond of ATP seems not to be necessary for the activation process of the proteasome complex, a conclusion drawn from the findings that ATP analogues such as adenosine 5'-[beta,gamma-imido]triphosphate, adenosine 5'-O-[gamma-thio]triphosphate, adenosine 5'-O-[beta-thio]-diphosphate and adenosine 5'-[alpha,beta-methylene]triphosphate give the same effect as ATP, and vanadate does not prevent ATP activation. These effects are independent of the presence of Mg2+. Thus, ATP and other nucleotides may act as allosteric activators of peptide-hydrolysing activities of the 26 S proteasome complex as has also been found with the lon protease from Escherichia coli. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:7619056

  3. Structural characterization of the interaction of Ubp6 with the 26S proteasome.

    PubMed

    Aufderheide, Antje; Beck, Florian; Stengel, Florian; Hartwig, Michaela; Schweitzer, Andreas; Pfeifer, Günter; Goldberg, Alfred L; Sakata, Eri; Baumeister, Wolfgang; Förster, Friedrich

    2015-07-14

    In eukaryotic cells, the 26S proteasome is responsible for the regulated degradation of intracellular proteins. Several cofactors interact transiently with this large macromolecular machine and modulate its function. The deubiquitylating enzyme ubiquitin C-terminal hydrolase 6 [Ubp6; ubiquitin-specific protease (USP) 14 in mammals] is the most abundant proteasome-interacting protein and has multiple roles in regulating proteasome function. Here, we investigate the structural basis of the interaction between Ubp6 and the 26S proteasome in the presence and absence of the inhibitor ubiquitin aldehyde. To this end we have used single-particle electron cryomicroscopy in combination with cross-linking and mass spectrometry. Ubp6 binds to the regulatory particle non-ATPase (Rpn) 1 via its N-terminal ubiquitin-like domain, whereas its catalytic USP domain is positioned variably. Addition of ubiquitin aldehyde stabilizes the binding of the USP domain in a position where it bridges the proteasome subunits Rpn1 and the regulatory particle triple-A ATPase (Rpt) 1. The USP domain binds to Rpt1 in the immediate vicinity of the Ubp6 active site, which may effect its activation. The catalytic triad is positioned in proximity to the mouth of the ATPase module and to the deubiquitylating enzyme Rpn11, strongly implying their functional linkage. On the proteasome side, binding of Ubp6 favors conformational switching of the 26S proteasome into an intermediate-energy conformational state, in particular upon the addition of ubiquitin aldehyde. This modulation of the conformational space of the 26S proteasome by Ubp6 explains the effects of Ubp6 on the kinetics of proteasomal degradation. PMID:26130806

  4. Structural characterization of the interaction of Ubp6 with the 26S proteasome

    PubMed Central

    Aufderheide, Antje; Beck, Florian; Stengel, Florian; Hartwig, Michaela; Schweitzer, Andreas; Pfeifer, Günter; Goldberg, Alfred L.; Sakata, Eri; Baumeister, Wolfgang; Förster, Friedrich

    2015-01-01

    In eukaryotic cells, the 26S proteasome is responsible for the regulated degradation of intracellular proteins. Several cofactors interact transiently with this large macromolecular machine and modulate its function. The deubiquitylating enzyme ubiquitin C-terminal hydrolase 6 [Ubp6; ubiquitin-specific protease (USP) 14 in mammals] is the most abundant proteasome-interacting protein and has multiple roles in regulating proteasome function. Here, we investigate the structural basis of the interaction between Ubp6 and the 26S proteasome in the presence and absence of the inhibitor ubiquitin aldehyde. To this end we have used single-particle electron cryomicroscopy in combination with cross-linking and mass spectrometry. Ubp6 binds to the regulatory particle non-ATPase (Rpn) 1 via its N-terminal ubiquitin-like domain, whereas its catalytic USP domain is positioned variably. Addition of ubiquitin aldehyde stabilizes the binding of the USP domain in a position where it bridges the proteasome subunits Rpn1 and the regulatory particle triple-A ATPase (Rpt) 1. The USP domain binds to Rpt1 in the immediate vicinity of the Ubp6 active site, which may effect its activation. The catalytic triad is positioned in proximity to the mouth of the ATPase module and to the deubiquitylating enzyme Rpn11, strongly implying their functional linkage. On the proteasome side, binding of Ubp6 favors conformational switching of the 26S proteasome into an intermediate-energy conformational state, in particular upon the addition of ubiquitin aldehyde. This modulation of the conformational space of the 26S proteasome by Ubp6 explains the effects of Ubp6 on the kinetics of proteasomal degradation. PMID:26130806

  5. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments

    PubMed Central

    Ingolia, Nicholas T.; Brar, Gloria A.; Rouskin, Silvia; McGeachy, Anna M.; Weissman, Jonathan S.

    2012-01-01

    Recent studies highlight the importance of translational control in determining protein abundance, underscoring the value of measuring gene expression at the level of translation. We present a protocol for genome-wide, quantitative analysis of in vivo translation by deep sequencing. This ribosome profiling approach maps the exact positions of ribosomes on transcripts by nuclease footprinting. The nuclease-protected mRNA fragments are converted into a DNA library suitable for deep sequencing using a strategy that minimizes bias. The abundance of different footprint fragments in deep sequencing data reports on the amount of translation of a gene. Additionally, footprints reveal the exact regions of the transcriptome that are translated. To better define translated reading frames, we describe an adaptation that reveals the sites of translation initiation by pre-treating cells with harringtonine to immobilize initiating ribosomes. The protocol we describe requires 5–7 days to generate a completed ribosome profiling sequencing library. Sequencing and data analysis requires a further 4 – 5 days. PMID:22836135

  6. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  7. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  8. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  9. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  10. The Lysine 48 and Lysine 63 Ubiquitin Conjugates Are Processed Differently by the 26 S Proteasome*

    PubMed Central

    Jacobson, Andrew D.; Zhang, Nan-Yan; Xu, Ping; Han, Ke-Jun; Noone, Seth; Peng, Junmin; Liu, Chang-Wei

    2009-01-01

    The role of Lys-63 ubiquitin chains in targeting proteins for proteasomal degradation is still obscure. We systematically compared proteasomal processing of Lys-63 ubiquitin chains with that of the canonical proteolytic signal, Lys-48 ubiquitin chains. Quantitative mass spectrometric analysis of ubiquitin chains in HeLa cells determines that the levels of Lys-63 ubiquitin chains are insensitive to short-time proteasome inhibition. Also, the Lys-48/Lys-63 ratio in the 26 S proteasome-bound fraction is 1.7-fold more than that in the cell lysates, likely because some cellular Lys-63 ubiquitin conjugates are sequestered by Lys-63 chain-specific binding proteins. In vitro, Lys-48 and Lys-63 ubiquitin chains bind the 26 S proteasome comparably, whereas Lys-63 chains are deubiquitinated 6-fold faster than Lys-48 chains. Also, Lys-63 tetraubiquitin-conjugated UbcH10 is rapidly deubiquitinated into the monoubiquitinated form, whereas Lys-48 tetraubiquitin targets UbcH10 for degradation. Furthermore, we found that both the ubiquitin aldehyde- and 1,10-phenanthroline-sensitive deubiquitinating activities of the 26 S proteasome contribute to Lys-48- and Lys-63-linkage deubiquitination, albeit the inhibitory extents are different. Together, our findings suggest that compared with Lys-48 chains, cellular Lys-63 chains have less proteasomal accessibility, and proteasome-bound Lys-63 chains are more rapidly deubiquitinated, which could cause inefficient degradation of Lys-63 conjugates. PMID:19858201

  11. Molecular architecture of the 26S proteasome holocomplex determined by an integrative approach

    PubMed Central

    Lasker, Keren; Förster, Friedrich; Bohn, Stefan; Walzthoeni, Thomas; Villa, Elizabeth; Unverdorben, Pia; Beck, Florian; Aebersold, Ruedi; Sali, Andrej; Baumeister, Wolfgang

    2012-01-01

    The 26S proteasome is at the executive end of the ubiquitin-proteasome pathway for the controlled degradation of intracellular proteins. While the structure of its 20S core particle (CP) has been determined by X-ray crystallography, the structure of the 19S regulatory particle (RP), which recruits substrates, unfolds them, and translocates them to the CP for degradation, has remained elusive. Here, we describe the molecular architecture of the 26S holocomplex determined by an integrative approach based on data from cryoelectron microscopy, X-ray crystallography, residue-specific chemical cross-linking, and several proteomics techniques. The “lid” of the RP (consisting of Rpn3/5/6/7/8/9/11/12) is organized in a modular fashion. Rpn3/5/6/7/9/12 form a horseshoe-shaped heterohexamer, which connects to the CP and roofs the AAA-ATPase module, positioning the Rpn8/Rpn11 heterodimer close to its mouth. Rpn2 is rigid, supporting the lid, while Rpn1 is conformationally variable, positioned at the periphery of the ATPase ring. The ubiquitin receptors Rpn10 and Rpn13 are located in the distal part of the RP, indicating that they were recruited to the complex late in its evolution. The modular structure of the 26S proteasome provides insights into the sequence of events prior to the degradation of ubiquitylated substrates. PMID:22307589

  12. Localization of the regulatory particle subunit Sem1 in the 26S proteasome

    SciTech Connect

    Bohn, Stefan; Sakata, Eri; Beck, Florian; Pathare, Ganesh R.; Schnitger, Jérôme; Nágy, Istvan; Baumeister, Wolfgang Förster, Friedrich

    2013-05-31

    Highlights: •26S proteasome subunit Sem1 was mapped using cryo-EM and cross-linking data. •C-terminal helix of Sem1 located near winged helix motif of Rpn7. •N-terminal part of Sem1 tethers Rpn7, Rpn3 and lid helical bundle. •Sem1 binds differently to PCI-domains of proteasome subunit Rpn7 and TREX-2 subunit Thp1. -- Abstract: The ubiquitin–proteasome system is responsible for regulated protein degradation in the cell with the 26S proteasome acting as its executive arm. The molecular architecture of this 2.5 MDa complex has been established recently, with the notable exception of the small acidic subunit Sem1. Here, we localize the C-terminal helix of Sem1 binding to the PCI domain of the subunit Rpn7 using cryo-electron microscopy single particle reconstruction of proteasomes purified from yeast cells with sem1 deletion. The approximate position of the N-terminal region of Sem1 bridging the cleft between Rpn7 and Rpn3 was inferred based on site-specific cross-linking data of the 26S proteasome. Our structural studies indicate that Sem1 can assume different conformations in different contexts, which supports the idea that Sem1 functions as a molecular glue stabilizing the Rpn3/Rpn7 heterodimer.

  13. Indirect inhibition of 26S proteasome activity in a cellular model of Huntington’s disease

    PubMed Central

    Hipp, Mark S.; Patel, Chetan N.; Bersuker, Kirill; Riley, Brigit E.; Kaiser, Stephen E.; Shaler, Thomas A.; Brandeis, Michael

    2012-01-01

    Pathognomonic accumulation of ubiquitin (Ub) conjugates in human neurodegenerative diseases, such as Huntington’s disease, suggests that highly aggregated proteins interfere with 26S proteasome activity. In this paper, we examine possible mechanisms by which an N-terminal fragment of mutant huntingtin (htt; N-htt) inhibits 26S function. We show that ubiquitinated N-htt—whether aggregated or not—did not choke or clog the proteasome. Both Ub-dependent and Ub-independent proteasome reporters accumulated when the concentration of mutant N-htt exceeded a solubility threshold, indicating that stabilization of 26S substrates is not linked to impaired Ub conjugation. Above this solubility threshold, mutant N-htt was rapidly recruited to cytoplasmic inclusions that were initially devoid of Ub. Although synthetically polyubiquitinated N-htt competed with other Ub conjugates for access to the proteasome, the vast majority of mutant N-htt in cells was not Ub conjugated. Our data confirm that proteasomes are not directly impaired by aggregated N-terminal fragments of htt; instead, our data suggest that Ub accumulation is linked to impaired function of the cellular proteostasis network. PMID:22371559

  14. Nucleotide sequence of the tcml gene (ribosomal protein L3) of Saccharomyces cerevisiae.

    PubMed Central

    Schultz, L D; Friesen, J D

    1983-01-01

    The yeast tcml gene, which codes for ribosomal protein L3, has been isolated by using recombinant DNA and genetic complementation. The DNA fragment carrying this gene has been subcloned and we have determined its DNA sequence. The 20 amino acid residues at the amino terminus as inferred from the nucleotide sequence agreed exactly with the amino acid sequence data. The amino acid composition of the encoded protein agreed with that determined for purified ribosomal protein L3. Codon usage in the tcml gene was strongly biased in the direction found for several other abundant Saccharomyces cerevisiae proteins. The tcml gene has no introns, which appears to be atypical of ribosomal protein structural genes. PMID:6305925

  15. The porcine gene TBP10 encodes a protein homologous to the human tat-binding protein/26S protease subunit family.

    PubMed

    Leeb, T; Rettenberger, G; Breech, J; Hameister, H; Brenig, B

    1996-03-01

    We have cloned a porcine gene, designated TBP1O, that belongs to the Tat-binding protein/26S protease subunit family. The genomic structure of the porcine TBP1O gene was analyzed after isolation of three overlapping genomic phage lambda clones. The TBP10 gene harbors 12 exons spanning 4.5 kb of chromosomal DNA. The TBP1O gene was assigned to Chromosome (Chr) 12 by fluorescence in situ hybridization (FISH) on metaphase chromosomes. The chromosomal location was confirmed by PCR analysis of a porcine-rodent hybrid cell panel. The TBP1O protein is encoded by a 1221 nucleotide cDNA and has a molecular mass of 45.6 kDa. The predicted amino acid sequence has highest similarity to the human and bovine p45 subunit of the 26S protease and the human transcription factor TRIP1. Further similarities were detected to the slime mold protein DdTBP1O and the Schizosaccharomyces pombe and Saccharomyces cerevisiae protein SUG1. Like DdTBP1O and other members of the protein family, the porcine TBP1O harbors a leucine zipper motif in the N-terminal region and a domain characteristics of ATP-dependent proteases in the C-terminal region. PMID:8833236

  16. The First Attested Extraction of Ancient DNA in Legumes (Fabaceae).

    PubMed

    Mikić, Aleksandar M

    2015-01-01

    Ancient DNA (aDNA) is any DNA extracted from ancient specimens, important for diverse evolutionary researches. The major obstacles in aDNA studies are mutations, contamination and fragmentation. Its studies may be crucial for crop history if integrated with human aDNA research and historical linguistics, both general and relating to agriculture. Legumes (Fabaceae) are one of the richest end economically most important plant families, not only from Neolithic onwards, since they were used as food by Neanderthals and Paleolithic modern man. The idea of extracting and analyzing legume aDNA was considered beneficial for both basic science and applied research, with an emphasis on genetic resources and plant breeding. The first reported successful and attested extraction of the legume aDNA was done from the sample of charred seeds of pea (Pisum sativum) and bitter vetch (Vicia ervilia) from Hissar, southeast Serbia, dated to 1,350-1,000 Before Christ. A modified version of cetyltrimethylammonium bromide (CTAB) method and the commercial kit for DNA extraction QIAGEN DNAesy yielded several ng μl(-1) of aDNA of both species and, after the whole genome amplification and with a fragment of nuclear ribosomal DNA gene 26S rDNA, resulted in the detection of the aDNA among the PCR products. A comparative analysis of four informative chloroplast DNA regions (trnSG, trnK, matK, and rbcL) among the modern wild and cultivated pea taxa demonstrated not only that the extracted aDNA was genuine, on the basis of mutation rate, but also that the ancient Hissar pea was most likely an early domesticated crop, related to the modern wild pea of a neighboring region. It is anticipated that this premier extraction of legume aDNA may provide taxonomists with the answers to diverse questions, such as leaf development in legumes, as well as with novel data on the single steps in domesticating legume crops worldwide. PMID:26635833

  17. The First Attested Extraction of Ancient DNA in Legumes (Fabaceae)

    PubMed Central

    Mikić, Aleksandar M.

    2015-01-01

    Ancient DNA (aDNA) is any DNA extracted from ancient specimens, important for diverse evolutionary researches. The major obstacles in aDNA studies are mutations, contamination and fragmentation. Its studies may be crucial for crop history if integrated with human aDNA research and historical linguistics, both general and relating to agriculture. Legumes (Fabaceae) are one of the richest end economically most important plant families, not only from Neolithic onwards, since they were used as food by Neanderthals and Paleolithic modern man. The idea of extracting and analyzing legume aDNA was considered beneficial for both basic science and applied research, with an emphasis on genetic resources and plant breeding. The first reported successful and attested extraction of the legume aDNA was done from the sample of charred seeds of pea (Pisum sativum) and bitter vetch (Vicia ervilia) from Hissar, southeast Serbia, dated to 1,350–1,000 Before Christ. A modified version of cetyltrimethylammonium bromide (CTAB) method and the commercial kit for DNA extraction QIAGEN DNAesy yielded several ng μl-1 of aDNA of both species and, after the whole genome amplification and with a fragment of nuclear ribosomal DNA gene 26S rDNA, resulted in the detection of the aDNA among the PCR products. A comparative analysis of four informative chloroplast DNA regions (trnSG, trnK, matK, and rbcL) among the modern wild and cultivated pea taxa demonstrated not only that the extracted aDNA was genuine, on the basis of mutation rate, but also that the ancient Hissar pea was most likely an early domesticated crop, related to the modern wild pea of a neighboring region. It is anticipated that this premier extraction of legume aDNA may provide taxonomists with the answers to diverse questions, such as leaf development in legumes, as well as with novel data on the single steps in domesticating legume crops worldwide. PMID:26635833

  18. Molecular mechanisms of ribosomal protein gene coregulation.

    PubMed

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  19. Alveolate phylogeny inferred using concatenated ribosomal proteins.

    PubMed

    Bachvaroff, Tsvetan R; Handy, Sara M; Place, Allen R; Delwiche, Charles F

    2011-01-01

    Dinoflagellates and apicomplexans are a strongly supported monophyletic group in rDNA phylogenies, although this phylogeny is not without controversy, particularly between the two groups. Here we use concatenated protein-coding genes from expressed sequence tags or genomic data to construct phylogenies including "typical" dinophycean dinoflagellates, a parasitic syndinian dinoflagellate, Amoebophrya sp., and two related species, Oxyrrhis marina, and Perkinsus marinus. Seventeen genes encoding proteins associated with the ribosome were selected for phylogenetic analysis. The dataset was limited for the most part by data availability from the dinoflagellates. Forty-five taxa from four major lineages were used: the heterokont outgroup, ciliates, dinoflagellates, and apicomplexans. Amoebophrya sp. was included in this phylogeny as a sole representative of the enigmatic marine alveolate or syndinian lineage. The atypical dinoflagellate O. marina, usually excluded from rDNA analyses due to long branches, was also included. The resulting phylogenies were well supported in concatenated analyses with only a few unstable or weakly supported branches; most features were consistent when different lineages were pruned from the tree or different genes were concatenated. The least stable branches involved the placement of Cryptosporidium spp. within the Apicomplexa and the relationships between P. marinus, Amoebophrya sp., and O. marina. Both bootstrap and approximately unbiased test results confirmed that P. marinus, Amoebophrya sp., O. marina, and the remaining dinoflagellates form a monophyletic lineage to the exclusion of Apicomplexa. PMID:21518081

  20. Functional study of hot pepper 26S proteasome subunit RPN7 induced by Tobacco mosaic virus from nuclear proteome analysis

    SciTech Connect

    Lee, Boo-Ja; Kwon, Sun Jae; Kim, Sung-Kyu; Kim, Ki-Jeong; Park, Chang-Jin; Kim, Young-Jin; Park, Ohkmae K.; Paek, Kyung-Hee . E-mail: khpaek95@korea.ac.kr

    2006-12-15

    Two-dimensional gel electrophoresis (2-DE) was applied for the screening of Tobacco mosaic virus (TMV)-induced hot pepper (Capsicum annuum cv. Bugang) nuclear proteins. From differentially expressed protein spots, we acquired the matched peptide mass fingerprint (PMF) data, analyzed by MALDI-TOF MS, from the non-redundant hot pepper EST protein FASTA database using the VEMS 2.0 software. Among six identified nuclear proteins, the hot pepper 26S proteasome subunit RPN7 (CaRPN7) was subjected to further study. The level of CaRPN7 mRNA was specifically increased during incompatible TMV-P{sub 0} interaction, but not during compatible TMV-P{sub 1.2} interaction. When CaRPN7::GFP fusion protein was targeted in onion cells, the nuclei had been broken into pieces. In the hot pepper leaves, cell death was exacerbated and genomic DNA laddering was induced by Agrobacterium-mediated transient overexpression of CaPRN7. Thus, this report presents that the TMV-induced CaRPN7 may be involved in programmed cell death (PCD) in the hot pepper plant.

  1. Activation of the tumor suppressor p53 upon impairment of ribosome biogenesis.

    PubMed

    Bursac, Sladana; Brdovcak, Maja Cokaric; Donati, Giulio; Volarevic, Sinisa

    2014-06-01

    Errors in ribosome biogenesis can result in quantitative or qualitative defects in protein synthesis and consequently lead to improper execution of the genetic program and the development of specific diseases. Evidence has accumulated over the last decade suggesting that perturbation of ribosome biogenesis triggers a p53-activating checkpoint signaling pathway, often referred to as the ribosome biogenesis stress checkpoint pathway. Although it was originally suggested that p53 has a prominent role in preventing diseases by monitoring the fidelity of ribosome biogenesis, recent work has demonstrated that p53 activation upon impairment of ribosome biogenesis also mediates pathological manifestations in humans. Perturbations of ribosome biogenesis can trigger a p53-dependent checkpoint signaling pathway independent of DNA damage and the tumor suppressor ARF through inhibitory interactions of specific ribosomal components with the p53 negative regulator, Mdm2. Here we review the recent advances made toward understanding of this newly-recognized checkpoint signaling pathway, its role in health and disease, and discuss possible future directions in this exciting research field. This article is part of a Special Issue entitled: Role of the Nucleolus in Human Disease. PMID:24514102

  2. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  3. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  4. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  5. Comparative cytogenetics of giant trahiras Hoplias aimara and H. intermedius (Characiformes, Erythrinidae): chromosomal characteristics of minor and major ribosomal DNA and cross-species repetitive centromeric sequences mapping differ among morphologically identical karyotypes.

    PubMed

    Blanco, D R; Lui, R L; Vicari, M R; Bertollo, L A C; Moreira-Filho, O

    2011-01-01

    Karyotype and cytogenetic characteristics of 2 species of giant trahiras, Hopliasintermedius, São Francisco river basin, and Hopliasaimara, Arinos river (Amazon basin), were examined by conventional (C-banding, Ag-NOR, DAPI/CMA(3) double-staining) and fluorescent in situ hybridization (FISH) with 5S, 18S rDNA probes and cross-species Cot-1 DNA probing. Both species invariably had diploid chromosome number 2n = 50 and identical karyotypes composed of 10 pairs of metacentric and 15 pairs of submetacentric chromosomes. On the other hand, staining with base-specific fluorochromes (CMA(3), DAPI) and FISH mapping of repetitive DNA sequences showed extensive interspecific differences: while the genome of H. aimara had one submetacentric pair bearing CMA(3)-positive (DAPI-negative) sites, that of H. intermedius had 4 such pairs; while FISH with a 5S rDNA probe showed one (likely homologous) signal-bearing pair, that with 18S rDNA displayed one signal-bearing pair in H. intermedius and 2 such pairs in H. aimara. Cross-species FISH probing with Cot-1 DNA prepared from total DNA of both species showed no signals of Cot-1 DNA from H. aimara on chromosomes of H. intermedius but reciprocally (Cot-1 DNA from H. intermedius on chromosomes of H. aimara) displayed signals on at least 4 chromosome pairs. Present findings indicate (i) different composition of repetitive sequences around centromeres, (ii) different NOR phenotypes and (iii) distinct taxonomic status of both giant trahira species. PMID:20924165

  6. Visualizing ribosome biogenesis: parallel assembly pathways for the 30S subunit.

    PubMed

    Mulder, Anke M; Yoshioka, Craig; Beck, Andrea H; Bunner, Anne E; Milligan, Ronald A; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2010-10-29

    Ribosomes are self-assembling macromolecular machines that translate DNA into proteins, and an understanding of ribosome biogenesis is central to cellular physiology. Previous studies on the Escherichia coli 30S subunit suggest that ribosome assembly occurs via multiple parallel pathways rather than through a single rate-limiting step, but little mechanistic information is known about this process. Discovery single-particle profiling (DSP), an application of time-resolved electron microscopy, was used to obtain more than 1 million snapshots of assembling 30S subunits, identify and visualize the structures of 14 assembly intermediates, and monitor the population flux of these intermediates over time. DSP results were integrated with mass spectrometry data to construct the first ribosome-assembly mechanism that incorporates binding dependencies, rate constants, and structural characterization of populated intermediates. PMID:21030658

  7. Expression of the 26S proteasome subunit RPN10 is upregulated by salt stress in Dunaliella viridis.

    PubMed

    Sun, Xiaobin; Meng, Xiangzong; Xu, Zhengkai; Song, Rentao

    2010-08-15

    Green algae of the genus Dunaliella can adapt to hypersaline environments and are considered model organisms for salinity tolerance. In an EST analysis in Dunaliella viridis under salt stress, we isolated a salt-inducible cDNA coding for the 26S proteasome subunit RPN10, designated DvRPN10. The DvRPN10 cDNA is 1472 bp and encodes a polypeptide of 377 amino acids. The DvRPN10 protein shares a high similarity to orthologs from other species. The function of DvRPN10 was confirmed by complementation of the yeast Deltarpn10 mutant. Q-PCR analysis of D. viridis cells grown in different salinities revealed that the transcript level of DvRPN10 increased in proportion to the external salinity within a range of 0.5-3 M NaCl, but decreased significantly at extremely high salinities (4-5 M NaCl). When a salinity shock of 1-3 M NaCl was applied to D. viridis cells, DvRPN10 mRNA levels remained steady during the first 36 h, and then gradually elevated to the level observed at 3 M NaCl. The gene structure of DvRPN10 was revealed by sequencing of a BAC clone containing this gene. Possible transcription factor binding sites related to stress tolerance were found in the promoter region of DvRPN10. The expression of DvRPN10 in response to the external salinity suggests that RPN10-mediated protein degradation plays a role in the salinity tolerance of D. viridis. PMID:20430475

  8. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  9. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  10. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  11. Uncommon functional properties of the first piscine 26S proteasome from the Antarctic notothenioid Trematomus bernacchii

    PubMed Central

    Gogliettino, Marta; Balestrieri, Marco; Riccio, Alessia; Facchiano, Angelo; Fusco, Carmela; Palazzo, Vincenzo Cecere; Rossi, Mosè; Cocca, Ennio; Palmieri, Gianna

    2016-01-01

    Protein homoeostasis is a fundamental process allowing the preservation of functional proteins and it has a great impact on the life of the Antarctic organisms. However, the effect of low temperatures on protein turnover is poorly understood and the cold-adaptation of the degradation machinery remains an unresolved issue. As the 26S proteasome represents the main proteolytic system devoted to the controlled degradation of intracellular proteins, the purpose of the present study was to investigate the functions of this complex in the notothenioid Trematomus bernacchii, in order to better understand its role in the physiology of Antarctic fish. To this aim, we purified and characterized the 26S proteasome from T. bernacchii and isolated the cDNAs codifying seven of the 14 subunits belonging to the proteasome 20S core particle. Results provided evidences of the high resistance of the piscine 26S proteasome to oxidative agents and of its ‘uncommon’ ability to efficiently hydrolyse oxidized bovine serum albumin (BSA), suggesting that this enzymatic complex could play a key role in the antioxidant defense systems in fish inhabiting permanently cold marine environments. These unique properties were also reflected by the 3D model analysis, which revealed a higher structural stability of the piscine complex respect to the murine template. Finally, a comparative analysis, performed in a variety of tissues collected from T. bernacchii and the temperate fish Dicentrarchus labrax, showed a lower protein retention in the cold-adapted fish, possibly due to a better efficiency of its degradation machinery. PMID:26933238

  12. [Structures and functions of the 26S proteasome Rpn10 family].

    PubMed

    Kawahara, Hiroyuki

    2002-09-01

    The ubiquitin-dependent proteolytic pathway is thought to be one of the vital systems for cellular regulations, including control of the cell cycle, differentiation and apoptosis. In this pathway, poly-ubiquitinated proteins are selectively degraded by the 26S proteasome, a multisubunit proteolytic machinery. Recognition of the poly-ubiquitin chain by the 26S proteasome should be a key step leading to the selective degradation of target proteins, and the Rpn10 subunit of the 26S proteasome has been shown to preferentially bind the poly-ubiquitin chain in vitro. We previously reported that the mouse Rpn10 mRNA family is generated from a single gene by developmentally regulated, alternative splicing. To determine whether such alternative splicing mechanisms occur in organisms other than the mouse, we searched for Rpn10 isoforms in various species. Here we summarize the gene organization of the Rpn10 in lower species and provide evidence that the competence for generating all distinct forms of Rpn10 alternative splicing has expanded through evolution. Some of the Rpn10 family genes were found to be expressed in distinct developmental stages, suggesting that they have distinct functions during embryogenesis. For example, Rpn10c and Rpn10e were exclusively expressed at specific developmental stages and in specific tissues, while Rpn10a was expressed constitutively. Our experimental results indicate that the respective Rpn10 proteins possess distinct roles in the progression of development. Furthermore, some of the Rpn10 variants specifically interacted with important developmental regulators. PMID:12235853

  13. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  14. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  15. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  16. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  17. Time-dependent Effects of Transcription- and Translation-halting Drugs on the Spatial Distributions of the E. coli Chromosome and Ribosomes

    PubMed Central

    Bakshi, Somenath; Choi, Heejun; Mondal, Jagannath; Weisshaar, James C.

    2014-01-01

    Summary Previously observed effects of rifampicin and chloramphenicol indicate that transcription and translation activity strongly affect the coarse spatial organization of the bacterial cytoplasm. Single-cell, time-resolved, quantitative imaging of chromosome and ribosome spatial distributions and ribosome diffusion in live E. coli provides insight into the underlying mechanisms. Monte Carlo simulations of model DNA-ribosome mixtures support a novel nucleoid-ribosome mixing hypothesis. In normal conditions, 70S-polysomes and the chromosomal DNA segregate, while 30S and 50S ribosomal subunits are able to penetrate the nucleoids. Growth conditions and drug treatments determine the partitioning of ribosomes into 70S-polysomes vs free 30S and 50S subunits. Entropic and excluded volume effects then dictate the resulting chromosome and ribosome spatial distributions. Direct observation of radial contraction of the nucleoids 0-5 min after treatment with either transcription- or translation-halting drugs supports the hypothesis that simultaneous transcription, translation, and insertion of proteins into the membrane (“transertion”) exerts an expanding force on the chromosomal DNA. Breaking of the DNA-RNA polymerase-mRNA-ribosome-membrane chain in either of two ways causes similar nucleoid contraction on a similar timescale. We suggest that chromosomal expansion due to transertion enables co-transcriptional translation throughout the nucleoids. PMID:25250841

  18. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  19. Near-atomic resolution structural model of the yeast 26S proteasome

    PubMed Central

    Beck, Florian; Unverdorben, Pia; Bohn, Stefan; Schweitzer, Andreas; Pfeifer, Günter; Sakata, Eri; Nickell, Stephan; Plitzko, Jürgen M.; Villa, Elizabeth; Baumeister, Wolfgang; Förster, Friedrich

    2012-01-01

    The 26S proteasome operates at the executive end of the ubiquitin-proteasome pathway. Here, we present a cryo-EM structure of the Saccharomyces cerevisiae 26S proteasome at a resolution of 7.4 Å or 6.7 Å (Fourier-Shell Correlation of 0.5 or 0.3, respectively). We used this map in conjunction with molecular dynamics-based flexible fitting to build a near-atomic resolution model of the holocomplex. The quality of the map allowed us to assign α-helices, the predominant secondary structure element of the regulatory particle subunits, throughout the entire map. We were able to determine the architecture of the Rpn8/Rpn11 heterodimer, which had hitherto remained elusive. The MPN domain of Rpn11 is positioned directly above the AAA-ATPase N-ring suggesting that Rpn11 deubiquitylates substrates immediately following commitment and prior to their unfolding by the AAA-ATPase module. The MPN domain of Rpn11 dimerizes with that of Rpn8 and the C-termini of both subunits form long helices, which are integral parts of a coiled-coil module. Together with the C-terminal helices of the six PCI-domain subunits they form a very large coiled-coil bundle, which appears to serve as a flexible anchoring device for all the lid subunits. PMID:22927375

  20. Autoubiquitination of the 26S proteasome on Rpn13 regulates breakdown of ubiquitin conjugates.

    PubMed

    Besche, Henrike C; Sha, Zhe; Kukushkin, Nikolay V; Peth, Andreas; Hock, Eva-Maria; Kim, Woong; Gygi, Steven; Gutierrez, Juan A; Liao, Hua; Dick, Lawrence; Goldberg, Alfred L

    2014-05-16

    Degradation rates of most proteins in eukaryotic cells are determined by their rates of ubiquitination. However, possible regulation of the proteasome's capacity to degrade ubiquitinated proteins has received little attention, although proteasome inhibitors are widely used in research and cancer treatment. We show here that mammalian 26S proteasomes have five associated ubiquitin ligases and that multiple proteasome subunits are ubiquitinated in cells, especially the ubiquitin receptor subunit, Rpn13. When proteolysis is even partially inhibited in cells or purified 26S proteasomes with various inhibitors, Rpn13 becomes extensively and selectively poly-ubiquitinated by the proteasome-associated ubiquitin ligase, Ube3c/Hul5. This modification also occurs in cells during heat-shock or arsenite treatment, when poly-ubiquitinated proteins accumulate. Rpn13 ubiquitination strongly decreases the proteasome's ability to bind and degrade ubiquitin-conjugated proteins, but not its activity against peptide substrates. This autoinhibitory mechanism presumably evolved to prevent binding of ubiquitin conjugates to defective or stalled proteasomes, but this modification may also be useful as a biomarker indicating the presence of proteotoxic stress and reduced proteasomal capacity in cells or patients. PMID:24811749

  1. Atomic structure of the 26S proteasome lid reveals the mechanism of deubiquitinase inhibition

    PubMed Central

    Dambacher, Corey M; Worden, Evan J; Herzik, Mark A; Martin, Andreas; Lander, Gabriel C

    2016-01-01

    The 26S proteasome is responsible for the selective, ATP-dependent degradation of polyubiquitinated cellular proteins. Removal of ubiquitin chains from targeted substrates at the proteasome is a prerequisite for substrate processing and is accomplished by Rpn11, a deubiquitinase within the ‘lid’ sub-complex. Prior to the lid’s incorporation into the proteasome, Rpn11 deubiquitinase activity is inhibited to prevent unwarranted deubiquitination of polyubiquitinated proteins. Here we present the atomic model of the isolated lid sub-complex, as determined by cryo-electron microscopy at 3.5 Å resolution, revealing how Rpn11 is inhibited through its interaction with a neighboring lid subunit, Rpn5. Through mutagenesis of specific residues, we describe the network of interactions that are required to stabilize this inhibited state. These results provide significant insight into the intricate mechanisms of proteasome assembly, outlining the substantial conformational rearrangements that occur during incorporation of the lid into the 26S holoenzyme, which ultimately activates the deubiquitinase for substrate degradation. DOI: http://dx.doi.org/10.7554/eLife.13027.001 PMID:26744777

  2. Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss) B. Fedtsch,1915 (Apiaceae)

    PubMed Central

    Chahota, R. K.; Mukai, Y.; Chaudhary, H.K.; Kishore, Naval; Sharma, T.R.

    2011-01-01

    Abstract The fluorescent in situ hybridization (FISH) technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in Bunium persicum, an endangered medicinal plant of North Western Himalayas. PMID:24260640

  3. ATP-dependent incorporation of 20S protease into the 26S complex that degrades proteins conjugated to ubiquitin.

    PubMed Central

    Eytan, E; Ganoth, D; Armon, T; Hershko, A

    1989-01-01

    Previous studies have indicated that the ATP-dependent 26S protease complex that degrades proteins conjugated to ubiquitin is formed by the assembly of three factors in an ATP-requiring process. We now identify one of the factors as the 20S "multicatalytic" protease, a complex of low molecular weight subunits widely distributed in eukaryotic cells. Comparison of the subunit compositions of purified 20S and 26S complexes indicates that the former is an integral part of the latter. By the use of detergent treatment to activate latent protease activity, we show that the 20S protease becomes incorporated into the 26S complex in the ATP-dependent assembly process. It thus seems that the 20S protease is the "catalytic core" of the 26S complex of the ubiquitin proteolytic pathway. Images PMID:2554287

  4. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  5. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    PubMed Central

    Dedduwa-Mudalige, Gayani N. P.; Chow, Christine S.

    2015-01-01

    Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA) intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA) including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human. PMID:26370969

  6. Dynamic evolution of mitochondrial ribosomal proteins in Holozoa.

    PubMed

    Scheel, Bettina M; Hausdorf, Bernhard

    2014-07-01

    We studied the highly dynamic evolution of mitochondrial ribosomal proteins (MRPs) in Holozoa. Most major clades within Holozoa are characterized by gains and/or losses of MRPs. The usefulness of gains of MRPs as rare genomic changes in phylogenetics is undermined by the high frequency of secondary losses. However, phylogenetic analyses of the MRP sequences provide evidence for the Acrosomata hypothesis, a sister group relationship between Ctenophora and Bilateria. An extensive restructuring of the mitochondrial genome and, as a consequence, of the mitochondrial ribosomes occurred in the ancestor of metazoans. The last MRP genes encoded in the mitochondrial genome were either moved to the nuclear genome or were lost. The strong decrease in size of the mitochondrial genome was probably caused by selection for rapid replication of mitochondrial DNA during oogenesis in the metazoan ancestor. A phylogenetic analysis of MRPL56 sequences provided evidence for a horizontal gene transfer of the corresponding MRP gene between metazoans and Dictyostelidae (Amoebozoa). The hypothesis that the requisition of additional MRPs compensated for a loss of rRNA segments in the mitochondrial ribosomes is corroborated by a significant negative correlation between the number of MRPs and length of the rRNA. Newly acquired MRPs evolved faster than bacterial MRPs and positions in eukaryote-specific MRPs were more strongly affected by coevolution than positions in prokaryotic MRPs in accordance with the necessity to fit these proteins into the pre-existing structure of the mitoribosome. PMID:24631858

  7. In vitro expression of Escherichia coli ribosomal protein genes: autogenous inhibition of translation.

    PubMed Central

    Yates, J L; Arfsten, A E; Nomura, M

    1980-01-01

    Escherichia coli ribosomal protein L1 (0.5 micro M) was found to inhibit the synthesis of both proteins of the L11 operon, L11 and L1, but not the synthesis of other proteins directed by lambda rifd 18 DNA. Similarly, S4 (1 micro M) selectively inhibited the synthesis of three proteins of the alpha operon, S13, S11, and S4, directed by lambda spcI DNA or a restriction enzyme fragment obtained from this DNA. S8 (3.6 micro M) also showed preferential inhibitory effects on the synthesis of some proteins encoded in the spc operon, L24 and L5 (and probably S14 and S8), directed by lambda spcl DNA or a restriction enzyme fragment carrying the genes for these proteins. The inhibitory effect of L1 was observed only with L1 and not with other proteins examined, including S4 and S8. Similarly, the effect of S4 was not observed with L1 or S8, and that of S8 was not seen with L1 or S4. Inhibition was shown to take place at the level of translation rather than transcription. Thus, at least some ribosomal proteins (L1 S4, and S8) have the ability to cause selective translational inhibition of the synthesis of certain ribosomal proteins whose genes are in the same operon as their own. These results support the hypothesis that certain free ribosomal proteins not assembled into ribosomes act as "autogenous" feedback inhibitors to regulate the synthesis of ribosomal proteins. Images PMID:6445562

  8. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses1[OPEN

    PubMed Central

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng

    2016-01-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  9. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  10. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  11. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  12. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  13. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  14. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  15. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  16. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  17. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  18. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  19. A rapid and simple pipeline for synthesis of mRNA-ribosome-V(H)H complexes used in single-domain antibody ribosome display.

    PubMed

    Bencurova, Elena; Pulzova, Lucia; Flachbartova, Zuzana; Bhide, Mangesh

    2015-06-01

    The single-domain antibody (VHH) is a promising building block for a number of antibody-based applications. Ribosome display can successfully be used in the production of VHH. However, the construction of the expression cassette, confirmation of the translation and proper folding of the nascent chain, and the purification of the ribosome complexes, remain cumbersome tasks. Additionally, selection of the most suitable expression system can be challenging. We have designed primers that will amplify virtually all Camelidae VHH. With the help of a double-overlap extension (OE) polymerase chain reaction (PCR) we have fused VHH with the F1 fragment (T7 promoter and species-independent translation sequence) and the F2 fragment (mCherry, Myc-tag, tether, SecM arrest sequence and 3' stem loop) to generate a full-length DNA cassette. OE-PCR generated fragments were incubated directly with cell-free lysates (Leishmania torentolae, rabbit reticulocyte or E. coli) for the synthesis of mRNA-VHH-mCherry-ribosome complexes in vitro. Alternatively, the cassette was ligated in pQE-30 vector and transformed into E. coli to produce ribosome complexes in vivo. The results showed that the same expression cassette could be used to synthesize ribosome complexes with different expression systems. mCherry reporter served to confirm the synthesis and proper folding of the nascent chain, Myc-tag was useful in the rapid purification of ribosome complexes, and combination of the SecM sequence and 3' stem loop made the cassette universal, both for cells-free and E. coli in vivo. This rapid and universal pipeline can effectively be used in antibody ribosome display and VHH production. PMID:25902394

  20. Ribosomal proteins and expressed sequence tags from Lysiphlebus testaceipes(Hymenoptera: Aphidiidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A dataset containing 101 putative ribosomal protein (RP) sequences is provided for the aphid parasitoid, Lysiphlebus testaceipes. These data were obtained as a subset from a cDNA library constructed from adult L. testaceipes, and represent one of the largest complete sets of cytoplasmic RP sequence...

  1. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    PubMed

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  2. Satratoxin G interaction with 40S and 60S ribosomal subunits precedes apoptosis in the macrophage

    SciTech Connect

    Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul; Pestka, James J.

    2009-06-01

    Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultant fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis.

  3. Structure of an endogenous yeast 26S proteasome reveals two major conformational states

    PubMed Central

    Luan, Bai; Huang, Xiuliang; Wu, Jianping; Mei, Ziqing; Wang, Yiwei; Xue, Xiaobin; Yan, Chuangye; Wang, Jiawei; Finley, Daniel J.; Shi, Yigong; Wang, Feng

    2016-01-01

    The eukaryotic proteasome mediates degradation of polyubiquitinated proteins. Here we report the single-particle cryoelectron microscopy (cryo-EM) structures of the endogenous 26S proteasome from Saccharomyces cerevisiae at 4.6- to 6.3-Å resolution. The fine features of the cryo-EM maps allow modeling of 18 subunits in the regulatory particle and 28 in the core particle. The proteasome exhibits two distinct conformational states, designated M1 and M2, which correspond to those reported previously for the proteasome purified in the presence of ATP-γS and ATP, respectively. These conformations also correspond to those of the proteasome in the presence and absence of exogenous substrate. Structure-guided biochemical analysis reveals enhanced deubiquitylating enzyme activity of Rpn11 upon assembly of the lid. Our structures serve as a molecular basis for mechanistic understanding of proteasome function. PMID:26929360

  4. Selective ribosome profiling as a tool to study the interaction of chaperones and targeting factors with nascent polypeptide chains and ribosomes

    PubMed Central

    Becker, Annemarie H.; Oh, Eugene; Weissman, Jonathan S.; Kramer, Günter; Bukau, Bernd

    2014-01-01

    A plethora of factors is involved in the maturation of newly synthesized proteins, including chaperones, membrane targeting factors, and enzymes. Many factors act cotranslationally through association with ribosome-nascent chain complexes (RNCs), but their target specificities and modes of action remain poorly understood. We developed selective ribosome profiling (SeRP) to identify substrate pools and points of RNC engagement of these factors. SeRP is based on sequencing mRNA fragments covered by translating ribosomes (general ribosome profiling, RP), combined with a procedure to selectively isolate RNCs whose nascent polypeptides are associated with the factor of interest. Factor–RNC interactions are stabilized by crosslinking, the resulting factor–RNC adducts are then nuclease-treated to generate monosomes, and affinity-purified. The ribosome-extracted mRNA footprints are converted to DNA libraries for deep sequencing. The protocol is specified for general RP and SeRP in bacteria. It was first applied to the chaperone trigger factor and is readily adaptable to other cotranslationally acting factors, including eukaryotic factors. Factor–RNC purification and sequencing library preparation takes 7–8 days, sequencing and data analysis can be completed in 5–6 days. PMID:24136347

  5. Early life stress inhibits expression of ribosomal RNA in the developing hippocampus.

    PubMed

    Wei, Lan; Hao, Jin; Kaffman, Arie

    2014-01-01

    Children that are exposed to abuse or neglect show abnormal hippocampal function. However, the developmental mechanisms by which early life stress (ELS) impairs normal hippocampal development have not been elucidated. Here we propose that exposure to ELS blunts normal hippocampal growth by inhibiting the availability of ribosomal RNA (rRNA). In support of this hypothesis, we show that the normal mouse hippocampus undergoes a growth-spurt during the second week of life, followed by a gradual decrease in DNA and RNA content that persists into adulthood. This developmental pattern is associated with accelerated ribosomal RNA (rRNA) synthesis during the second week of life, followed by a gradual decline in rRNA levels that continue into adulthood. Levels of DNA methylation at the ribosomal DNA (rDNA) promoter are lower during the second week of life compared to earlier development or adulthood. Exposure to brief daily separation (BDS), a mouse model of early life stress, increased DNA methylation at the ribosomal DNA promoter, decreased rRNA levels, and blunted hippocampal growth during the second week of life. Exposure to acute (3 hrs) maternal separation decreased rRNA and increased DNA methylation at the rDNA proximal promoter, suggesting that exposure to stress early in life can rapidly regulate the availability of rRNA levels in the developing hippocampus. Given the critical role that rRNA plays in supporting normal growth and development, these findings suggest a novel molecular mechanism to explain how stress early in life impairs hippocampus development in the mouse. PMID:25517398

  6. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  7. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  8. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate.

    PubMed

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M

    2016-02-25

    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931

  9. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  10. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  11. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  12. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  13. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  14. Nuclear and nucleolar targeting of human ribosomal protein S6.

    PubMed Central

    Schmidt, C; Lipsius, E; Kruppa, J

    1995-01-01

    Chimeric proteins were constructed to define the nuclear localization signals (NLSs) of human ribosomal protein S6. The complete cDNA sequence, different cDNA fragments and oligonucleotides of the human ribosomal proteins S6, respectively, were joined to the 5' end of the entire LacZ gene of Escherichia coli by using recombinant techniques. The hybrid genes were transfected into L cells, transiently expressed, and the intracellular location of the fusion proteins was determined by their beta-galactosidase activity. Three NLSs were identified in the C-terminal half of the S6 protein. Deletion mutagenesis demonstrated that a single NLS is sufficient for targeting the corresponding S6-beta-galactosidase chimera into the nucleus. Removal of all three putative NLSs completely blocked the nuclear import of the resulting S6-beta-galactosidase fusion protein, which instead became evenly distributed in the cytoplasm. Chimeras containing deletion mutants of S6 with at least one single NLS or unmodified S6 accumulated in the nucleolus. Analysis of several constructs reveals the existence of a specific domain that is essential but not sufficient for nucleolar accumulation of S6. Images PMID:8590812

  15. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  16. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  17. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  18. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  19. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  20. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  1. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  2. D1 dopamine receptor stimulation impairs striatal proteasome activity in Parkinsonism through 26S proteasome disassembly.

    PubMed

    Barroso-Chinea, Pedro; Thiolat, Marie-Laure; Bido, Simone; Martinez, Audrey; Doudnikoff, Evelyne; Baufreton, Jérôme; Bourdenx, Mathieu; Bloch, Bertrand; Bezard, Erwan; Martin-Negrier, Marie-Laure

    2015-06-01

    Among the mechanisms underlying the development of L-dopa-induced dyskinesia (LID) in Parkinson's disease, complex alterations in dopamine signaling in D1 receptor (D1R)-expressing medium spiny striatal neurons have been unraveled such as, but not limited to, dysregulation of D1R expression, lateral diffusion, intraneuronal trafficking, subcellular localization and desensitization, leading to a pathological anchorage of D1R at the plasma membrane. Such anchorage is partly due to a decreased proteasomal activity that is specific of the L-dopa-exposed dopamine-depleted striatum, results from D1R activation and feeds-back the D1R exaggerated cell surface abundance. The precise mechanisms by which L-dopa affects striatal proteasome activity remained however unknown. We here show, in a series of in vitro ex vivo and in vivo models, that such rapid modulation of striatal proteasome activity intervenes through D1R-mediated disassembly of the 26S proteasome rather than change in transcription or translation of proteasome or proteasome subunits intraneuronal relocalization. PMID:25766677

  3. Gene clusters for ribosomal proteins in the mitochondrial genome of a liverwort, Marchantia polymorpha.

    PubMed Central

    Takemura, M; Oda, K; Yamato, K; Ohta, E; Nakamura, Y; Nozato, N; Akashi, K; Ohyama, K

    1992-01-01

    We detected 16 genes for ribosomal proteins in the complete sequence of the mitochondrial DNA from a liverwort, Marchantia polymorpha. The genes formed two major clusters, rps12-rps7 and rps10-rpl2-rps19-rps3-rpl16-rpl5- rps14-rps8- rpl6-rps13-rps11-rps1, very similar in organization to Escherichia coli ribosomal protein operons (str and S10-spc-alpha operons, respectively). In contrast, rps2 and rps4 genes were located separately in the liverwort mitochondrial genome (the latter was part of the alpha operon in E. coli). Furthermore, several ribosomal proteins encoded by the liverwort mitochondrial genome differed substantially in size from their counterparts in E. coli and liverwort chloroplast. PMID:1620617

  4. Changed in translation: mRNA recoding by -1 programmed ribosomal frameshifting.

    PubMed

    Caliskan, Neva; Peske, Frank; Rodnina, Marina V

    2015-05-01

    Programmed -1 ribosomal frameshifting (-1PRF) is an mRNA recoding event commonly utilized by viruses and bacteria to increase the information content of their genomes. Recent results have implicated -1PRF in quality control of mRNA and DNA stability in eukaryotes. Biophysical experiments demonstrated that the ribosome changes the reading frame while attempting to move over a slippery sequence of the mRNA--when a roadblock formed by a folded downstream segment in the mRNA stalls the ribosome in a metastable conformational state. The efficiency of -1PRF is modulated not only by cis-regulatory elements in the mRNA but also by trans-acting factors such as proteins, miRNAs, and antibiotics. These recent results suggest a molecular mechanism and new important cellular roles for -1PRF. PMID:25850333

  5. Mechanical insights into ribosomal progression overcoming RNA G-quadruplex from periodical translation suppression in cells.

    PubMed

    Endoh, Tamaki; Sugimoto, Naoki

    2016-01-01

    G-quadruplexes formed on DNA and RNA can be roadblocks to movement of polymerases and ribosome on template nucleotides. Although folding and unfolding processes of the G-quadruplexes are deliberately studied in vitro, how the mechanical and physical properties of the G-quadruplexes affect intracellular biological systems is still unclear. In this study, mRNAs with G-quadruplex forming sequences located either in the 5' untranslated region (UTR) or in the open reading frame (ORF) were constructed to evaluate positional effects of the G-quadruplex on translation suppression in cells. Periodic fluctuation of translation suppression was observed at every three nucleotides within the ORF but not within the 5' UTR. The results suggested that difference in motion of ribosome at the 5' UTR and the ORF determined the ability of the G-quadruplex structure to act as a roadblock to translation in cells and provided mechanical insights into ribosomal progression to overcome the roadblock. PMID:26948955

  6. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  7. Mammalian mitochondrial ribosomal small subunit (MRPS) genes: A putative role in human disease.

    PubMed

    Gopisetty, Gopal; Thangarajan, Rajkumar

    2016-09-01

    Mitochondria are prominently understood as power houses producing ATP the primary energy currency of the cell. However, mitochondria are also known to play an important role in apoptosis and autophagy, and mitochondrial dysregulation can lead to pathological outcomes. Mitochondria are known to contain 1500 proteins of which only 13 are coded by mitochondrial DNA and the rest are coded by nuclear genes. Protein synthesis in mitochondria involves mitochondrial ribosomes which are 55-60S particles and are composed of small 28S and large 39S subunits. A feature of mammalian mitoribosome which differentiate it from bacterial ribosomes is the increased protein content. The human mitochondrial ribosomal protein (MRP) gene family comprises of 30 genes which code for mitochondrial ribosomal small subunit and 50 genes for the large subunit. The present review focuses on the mitochondrial ribosomal small subunit genes (MRPS), presents an overview of the literature and data gleaned from publicly available gene and protein expression databases. The survey revealed aberrations in MRPS gene expression patterns in varied human diseases indicating a putative role in their etiology. PMID:27170550

  8. Ribosomal Proteins and Human Diseases: Pathogenesis, Molecular Mechanisms, and Therapeutic Implications

    PubMed Central

    Wang, Wei; Nag, Subhasree; Zhang, Xu; Wang, Ming-Hai; Wang, Hui; Zhou, Jianwei; Zhang, Ruiwen

    2014-01-01

    Ribosomes are essential components of the protein synthesis machinery. The process of ribosome biogenesis is well organized and tightly regulated. Recent studies have shown that ribosomal proteins (RPs) have extraribosomal functions that are involved in cell proliferation, differentiation, apoptosis, DNA repair, and other cellular processes. The dysfunction of RPs has been linked to the development and progression of hematological, metabolic, and cardiovascular diseases and cancer. Perturbation of ribosome biogenesis results in ribosomal stress, which triggers activation of the p53 signaling pathway through RPs-MDM2 interactions, resulting in p53-dependent cell cycle arrest and apoptosis. RPs also regulate cellular functions through p53-independent mechanisms. We herein review the recent advances in several forefronts of RP research, including the understanding of their biological features and roles in regulating cellular functions, maintaining cell homeostasis, and their involvement in the pathogenesis of human diseases. We also highlight the translational potential of this research for the identification of molecular biomarkers, and in the discovery and development of novel treatments for human diseases. PMID:25164622

  9. PTRF/Cavin-1 promotes efficient ribosomal RNA transcription in response to metabolic challenges

    PubMed Central

    Liu, Libin; Pilch, Paul F

    2016-01-01

    Ribosomal RNA transcription mediated by RNA polymerase I represents the rate-limiting step in ribosome biogenesis. In eukaryotic cells, nutrients and growth factors regulate ribosomal RNA transcription through various key factors coupled to cell growth. We show here in mature adipocytes, ribosomal transcription can be acutely regulated in response to metabolic challenges. This acute response is mediated by PTRF (polymerase I transcription and release factor, also known as cavin-1), which has previously been shown to play a critical role in caveolae formation. The caveolae–independent rDNA transcriptional role of PTRF not only explains the lipodystrophy phenotype observed in PTRF deficient mice and humans, but also highlights its crucial physiological role in maintaining adipocyte allostasis. Multiple post-translational modifications of PTRF provide mechanistic bases for its regulation. The role of PTRF in ribosomal transcriptional efficiency is likely relevant to many additional physiological situations of cell growth and organismal metabolism. DOI: http://dx.doi.org/10.7554/eLife.17508.001 PMID:27528195

  10. DNA Barcoding in Fragaria L. (Strawberry) Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    DNA barcoding for species identification using a short DNA sequence has been successful in animals due to rapid mutation rates of the mitochondrial genome where the animal DNA barocode, cytochrome c oxidase 1 gene is located. The chloroplast PsbA-trnH spacer and the nuclear ribosomal internal transc...

  11. The life cycle of the 26S proteasome: from birth, through regulation and function, and onto its death

    PubMed Central

    Livneh, Ido; Cohen-Kaplan, Victoria; Cohen-Rosenzweig, Chen; Avni, Noa; Ciechanover, Aaron

    2016-01-01

    The 26S proteasome is a large, ∼2.5 MDa, multi-catalytic ATP-dependent protease complex that serves as the degrading arm of the ubiquitin system, which is the major pathway for regulated degradation of cytosolic, nuclear and membrane proteins in all eukaryotic organisms. PMID:27444871

  12. Deep classification of a large cryo-EM dataset defines the conformational landscape of the 26S proteasome

    PubMed Central

    Unverdorben, Pia; Beck, Florian; Śledź, Paweł; Schweitzer, Andreas; Pfeifer, Günter; Plitzko, Jürgen M.; Baumeister, Wolfgang; Förster, Friedrich

    2014-01-01

    The 26S proteasome is a 2.5 MDa molecular machine that executes the degradation of substrates of the ubiquitin–proteasome pathway. The molecular architecture of the 26S proteasome was recently established by cryo-EM approaches. For a detailed understanding of the sequence of events from the initial binding of polyubiquitylated substrates to the translocation into the proteolytic core complex, it is necessary to move beyond static structures and characterize the conformational landscape of the 26S proteasome. To this end we have subjected a large cryo-EM dataset acquired in the presence of ATP and ATP-γS to a deep classification procedure, which deconvolutes coexisting conformational states. Highly variable regions, such as the density assigned to the largest subunit, Rpn1, are now well resolved and rendered interpretable. Our analysis reveals the existence of three major conformations: in addition to the previously described ATP-hydrolyzing (ATPh) and ATP-γS conformations, an intermediate state has been found. Its AAA-ATPase module adopts essentially the same topology that is observed in the ATPh conformation, whereas the lid is more similar to the ATP-γS bound state. Based on the conformational ensemble of the 26S proteasome in solution, we propose a mechanistic model for substrate recognition, commitment, deubiquitylation, and translocation into the core particle. PMID:24706844

  13. Deep classification of a large cryo-EM dataset defines the conformational landscape of the 26S proteasome.

    PubMed

    Unverdorben, Pia; Beck, Florian; Śledź, Paweł; Schweitzer, Andreas; Pfeifer, Günter; Plitzko, Jürgen M; Baumeister, Wolfgang; Förster, Friedrich

    2014-04-15

    The 26S proteasome is a 2.5 MDa molecular machine that executes the degradation of substrates of the ubiquitin-proteasome pathway. The molecular architecture of the 26S proteasome was recently established by cryo-EM approaches. For a detailed understanding of the sequence of events from the initial binding of polyubiquitylated substrates to the translocation into the proteolytic core complex, it is necessary to move beyond static structures and characterize the conformational landscape of the 26S proteasome. To this end we have subjected a large cryo-EM dataset acquired in the presence of ATP and ATP-γS to a deep classification procedure, which deconvolutes coexisting conformational states. Highly variable regions, such as the density assigned to the largest subunit, Rpn1, are now well resolved and rendered interpretable. Our analysis reveals the existence of three major conformations: in addition to the previously described ATP-hydrolyzing (ATPh) and ATP-γS conformations, an intermediate state has been found. Its AAA-ATPase module adopts essentially the same topology that is observed in the ATPh conformation, whereas the lid is more similar to the ATP-γS bound state. Based on the conformational ensemble of the 26S proteasome in solution, we propose a mechanistic model for substrate recognition, commitment, deubiquitylation, and translocation into the core particle. PMID:24706844

  14. The 26S proteasome in Schistosoma mansoni: bioinformatics analysis, developmental expression, and RNA interference (RNAi) studies.

    PubMed

    Nabhan, Joseph F; El-Shehabi, Fouad; Patocka, Nicholas; Ribeiro, Paula

    2007-11-01

    The 26S proteasome is a proteolytic complex responsible for the degradation of the vast majority of eukaryotic proteins. Regulated proteolysis by the proteasome is thought to influence cell cycle progression, transcriptional control, and other critical cellular processes. Here, we used a bioinformatics approach to identify the proteasomal constituents of the parasitic trematode Schistosoma mansoni. A detailed search of the S. mansoni genome database identified a total of 31 putative proteasomal subunits, including 17 subunits of the regulatory (19S) complex and 14 predicted catalytic (20S) subunits. A quantitative real-time RT-PCR analysis of subunit expression levels revealed that the S. mansoni proteasome components are differentially expressed among cercaria, schistosomula, and adult worms. In particular, the data suggest that the proteasome may be downregulated during the early stages of schistosomula development and is subsequently upregulated as the parasite matures to the adult stage. To test for biological relevance, we developed a transfection-based RNA interference method to knockdown the expression of the proteasome subunit, SmRPN11/POH1. Transfection of in vitro transformed S. mansoni schistosomula with specific short-interfering RNAs (siRNAs) diminished SmRPN11/POH1 expression nearly 80%, as determined by quantitative RT-PCR analysis, and also decreased parasite viability 78%, whereas no significant effect could be seen after treatment with the same amount of an irrelevant siRNA. These results indicate that the subunit SmRPN11/POH1 is an essential gene in schistosomes and further suggest an important role for the proteasome in parasite development and survival. PMID:17892869

  15. The ATP costs and time required to degrade ubiquitinated proteins by the 26 S proteasome.

    PubMed

    Peth, Andreas; Nathan, James A; Goldberg, Alfred L

    2013-10-01

    The degradation of ubiquitinated proteins by 26 S proteasomes requires ATP hydrolysis. To investigate if the six proteasomal ATPases function independently or in a cyclic manner, as proposed recently, we used yeast mutants that prevent ATP binding to Rpt3, Rpt5, or Rpt6. Although proteasomes contain six ATPase subunits, each of these single mutations caused a 66% reduction in basal ATP hydrolysis, and each blocked completely the 2-3-fold stimulation of ATPase activity induced by ubiquitinated substrates. Therefore, the ATPase subunits must function in a ordered manner, in which each is required for the stimulation of ATPase activity by substrates. Although ATP is essential for multiple steps in proteasome function, when the rate of ATP hydrolysis was reduced incrementally, the degradation of Ub5-DHFR (where Ub is ubiquitin and DHFR is dihydrofolate reductase) decreased exactly in parallel. This direct proportionality implies that a specific number of ATPs is consumed in degrading a ubiquitinated protein. When the ubiquitinated DHFR was more tightly folded (upon addition of the ligand folate), the rate of ATP hydrolysis was unchanged, but the time to degrade a Ub5-DHFR molecule (∼13 s) and the energy expenditure (50-80 ATPs/Ub5-DHFR) both increased by 2-fold. With a mutation in the ATPase C terminus that reduced gate opening into the 20 S proteasome, the energy costs and time required for conjugate degradation also increased. Thus, different ubiquitin conjugates activate similarly the ATPase subunit cycle that drives proteolysis, but polypeptide structure determines the time required for degradation and thus the energy cost. PMID:23965995

  16. Regulation of Sperm Capacitation by the 26S Proteasome: An Emerging New Paradigm in Spermatology.

    PubMed

    Kerns, Karl; Morales, Patricio; Sutovsky, Peter

    2016-05-01

    The ubiquitin proteasome system (UPS) participates in many biological processes ranging from cell cycle and antigen processing to cellular defense and signaling. Work of the last decade has made it evident that the UPS is involved in many sperm-related processes leading up to and as part of fertilization. The current knowledge of UPS involvement and changes during sperm capacitation are reviewed together with a list of known proteasome-associated sperm proteins and a discussion of the relationships between these proteins and the proteasome. Proteasomal inhibitors such as MG-132 and epoxomicin significantly alter capacitation and prevent acrosome reaction. The 26S proteasome degrades AKAP3, an A-kinase anchoring protein, partially regulating the release of protein-kinase A (PKA), a vital component necessary for the steps leading up to capacitation. Further, changes occur in 20S core subunit localization and abundance throughout capacitation. Proteasome-interacting valosine-containing protein (VCP) undergoes tyrosine phosphorylation; however, its physiological roles in capacitation and fertilization remain unknown. The E1-type ubiquitin-activating enzyme (UBA1) inhibitor PYR-41 also alters acrosomal membrane remodeling during capacitation. Furthermore, after capacitation, the acrosomal proteasomes facilitate the degradation of zona pellucida glycoproteins leading up to fertilization. Methods to modulate the sperm proteasome activity during sperm storage and capacitation may translate to increased reproductive efficiency in livestock animals. Human male infertility diagnostics may benefit from incorporation of research outcomes built upon relationships between UPS and capacitation. Altogether, the studies reviewed here support the involvement of UPS in sperm capacitation and present opportunities for new discoveries. PMID:27053366

  17. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  18. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  19. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  20. Phylogeny of Porphyromonas gingivalis by Ribosomal Intergenic Spacer Region Analysis

    PubMed Central

    Rumpf, Robert W.; Griffen, Ann L.; Leys, Eugene J.

    2000-01-01

    Periodontitis has been associated with the presence of Porphyromonas gingivalis, and previous studies have shown phenotypic differences in the pathogenicities of strains of P. gingivalis. An accurate and comprehensive phylogeny of strains of P. gingivalis would be useful in determining if there is an evolutionary basis to pathogenicity in this species. Previous phylogenies of P. gingivalis strains based on random amplified polymorphic DNA (RAPD) analysis and multilocus enzyme electrophoresis (MLEE) show little agreement. While the 16S ribosomal gene is the standard for phylogenetic reconstruction among bacterial species, it is insufficiently variable for this purpose. In the present study, the phylogeny of P. gingivalis was constructed on the basis of the sequence of the most variable region of the ribosomal operon, the intergenic spacer region (ISR). Heteroduplex analysis of the ISR has been used to study the variability of P. gingivalis strains in periodontitis. In the present study, typing by heteroduplex analysis was compared to ISR sequence-based phylogeny and close agreement was observed. The two strains of P. gingivalis whose heteroduplex types are strongly associated with periodontitis were found to be closely related and were well separated from strains whose heteroduplex types are less strongly associated with disease, suggesting a relationship between pathogenicity and phylogeny. PMID:10790104

  1. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  2. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    SciTech Connect

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional.

  3. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  4. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  5. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  6. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  7. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  8. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  9. An atomic model AAA-ATPase/20S core particle sub-complex of the 26S proteasome.

    PubMed

    Förster, Friedrich; Lasker, Keren; Beck, Florian; Nickell, Stephan; Sali, Andrej; Baumeister, Wolfgang

    2009-10-16

    The 26S proteasome is the most downstream element of the ubiquitin-proteasome pathway of protein degradation. It is composed of the 20S core particle (CP) and the 19S regulatory particle (RP). The RP consists of 6 AAA-ATPases and at least 13 non-ATPase subunits. Based on a cryo-EM map of the 26S proteasome, structures of homologs, and physical protein-protein interactions we derive an atomic model of the AAA-ATPase-CP sub-complex. The ATPase order in our model (Rpt1/Rpt2/Rpt6/Rpt3/Rpt4/Rpt5) is in excellent agreement with the recently identified base-precursor complexes formed during the assembly of the RP. Furthermore, the atomic CP-AAA-ATPase model suggests that the assembly chaperone Nas6 facilitates CP-RP association by enhancing the shape complementarity between Rpt3 and its binding CP alpha subunits partners. PMID:19653995

  10. Autophagic Degradation of the 26S Proteasome Is Mediated by the Dual ATG8/Ubiquitin Receptor RPN10 in Arabidopsis.

    PubMed

    Marshall, Richard S; Li, Faqiang; Gemperline, David C; Book, Adam J; Vierstra, Richard D

    2015-06-18

    Autophagic turnover of intracellular constituents is critical for cellular housekeeping, nutrient recycling, and various aspects of growth and development in eukaryotes. Here we show that autophagy impacts the other major degradative route involving the ubiquitin-proteasome system by eliminating 26S proteasomes, a process we termed proteaphagy. Using Arabidopsis proteasomes tagged with GFP, we observed their deposition into vacuoles via a route requiring components of the autophagy machinery. This transport can be initiated separately by nitrogen starvation and chemical or genetic inhibition of the proteasome, implying distinct induction mechanisms. Proteasome inhibition stimulates comprehensive ubiquitylation of the complex, with the ensuing proteaphagy requiring the proteasome subunit RPN10, which can simultaneously bind both ATG8 and ubiquitin. Collectively, we propose that Arabidopsis RPN10 acts as a selective autophagy receptor that targets inactive 26S proteasomes by concurrent interactions with ubiquitylated proteasome subunits/targets and lipidated ATG8 lining the enveloping autophagic membranes. PMID:26004230

  11. An atomic model AAA-ATPase/20S core particle sub-complex of the 26S proteasome

    SciTech Connect

    Foerster, Friedrich; Lasker, Keren; Beck, Florian; Nickell, Stephan; Sali, Andrej; Baumeister, Wolfgang

    2009-10-16

    The 26S proteasome is the most downstream element of the ubiquitin-proteasome pathway of protein degradation. It is composed of the 20S core particle (CP) and the 19S regulatory particle (RP). The RP consists of 6 AAA-ATPases and at least 13 non-ATPase subunits. Based on a cryo-EM map of the 26S proteasome, structures of homologs, and physical protein-protein interactions we derive an atomic model of the AAA-ATPase-CP sub-complex. The ATPase order in our model (Rpt1/Rpt2/Rpt6/Rpt3/Rpt4/Rpt5) is in excellent agreement with the recently identified base-precursor complexes formed during the assembly of the RP. Furthermore, the atomic CP-AAA-ATPase model suggests that the assembly chaperone Nas6 facilitates CP-RP association by enhancing the shape complementarity between Rpt3 and its binding CP alpha subunits partners.

  12. Protein interaction mapping with ribosome-displayed using PLATO ORF libraries

    PubMed Central

    Zhu, Jian; Larman, H. Benjamin; Gao, Geng; Somwar, Romel; Zhang, Zijuan; Laserson, Uri; Ciccia, Alberto; Pavlova, Natalya; Church, George; Zhang, Wei; Kesari, Santosh; Elledge, Stephen J.

    2013-01-01

    Identifying physical interactions between proteins and other molecules is a critical aspect of biological analysis. Here we describe PLATO, an in vitro method for mapping such interactions by affinity enrichment of a library of full-length open reading frames displayed on ribosomes, followed by massively parallel analysis using DNA sequencing. We demonstrate the broad utility of the method by identifying known and new interacting partners of LYN kinase, patient autoantibodies and the small molecules gefitinib and dasatinib. PMID:24336473

  13. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae)

    PubMed Central

    Yang, Mingsheng; Zhang, Yalin

    2015-01-01

    Abstract Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA) and four protein-coding genes (EF-1α, COI, COII and Cytb). We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML) and Bayesian inference (BI) trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa. PMID:25878526

  14. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  15. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    SciTech Connect

    Ostrup, Olga; Hyttel, Poul; Klaerke, Dan A.; Collas, Philippe

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  16. An assay for 26S proteasome activity based on fluorescence anisotropy measurements of dye-labeled protein substrates.

    PubMed

    Bhattacharyya, Sucharita; Renn, Jonathan P; Yu, Houqing; Marko, John F; Matouschek, Andreas

    2016-09-15

    The 26S proteasome is the molecular machine at the center of the ubiquitin proteasome system and is responsible for adjusting the concentrations of many cellular proteins. It is a drug target in several human diseases, and assays for the characterization of modulators of its activity are valuable. The 26S proteasome consists of two components: a core particle, which contains the proteolytic sites, and regulatory caps, which contain substrate receptors and substrate processing enzymes, including six ATPases. Current high-throughput assays of proteasome activity use synthetic fluorogenic peptide substrates that report directly on the proteolytic activity of the proteasome, but not on the activities of the proteasome caps that are responsible for protein recognition and unfolding. Here, we describe a simple and robust assay for the activity of the entire 26S proteasome using fluorescence anisotropy to follow the degradation of fluorescently labeled protein substrates. We describe two implementations of the assay in a high-throughput format and show that it meets the expected requirement of ATP hydrolysis and the presence of a canonical degradation signal or degron in the target protein. PMID:27296635

  17. Degradation of oxidized proteins by the proteasome: Distinguishing between the 20S, 26S, and immunoproteasome proteolytic pathways.

    PubMed

    Raynes, Rachel; Pomatto, Laura C D; Davies, Kelvin J A

    2016-08-01

    The proteasome is a ubiquitous and highly plastic multi-subunit protease with multi-catalytic activity that is conserved in all eukaryotes. The most widely known function of the proteasome is protein degradation through the 26S ubiquitin-proteasome system, responsible for the vast majority of protein degradation during homeostasis. However, the proteasome also plays an important role in adaptive immune responses and adaptation to oxidative stress. The unbound 20S proteasome, the core common to all proteasome conformations, is the main protease responsible for degrading oxidized proteins. During periods of acute stress, the 19S regulatory cap of the 26S proteasome disassociates from the proteolytic core, allowing for immediate ATP/ubiquitin-independent protein degradation by the 20S proteasome. Despite the abundance of unbound 20S proteasome compared to other proteasomal conformations, many publications fail to distinguish between the two proteolytic systems and often regard the 26S proteasome as the dominant protease. Further confounding the issue are the differential roles these two proteolytic systems have in adaptation and aging. In this review, we will summarize the increasing evidence that the 20S core proteasome constitutes the major conformation of the proteasome system and that it is far from a latent protease requiring activation by binding regulators. PMID:27155164

  18. Efficient Detection of Pathogenic Leptospires Using 16S Ribosomal RNA

    PubMed Central

    Lindow, Janet; Wunder, Elsio A.; Reis, Mitermayer G.; Usmani-Brown, Sahar; Ledizet, Michel; Ko, Albert; Pal, Utpal

    2015-01-01

    Pathogenic Leptospira species cause a prevalent yet neglected zoonotic disease with mild to life-threatening complications in a variety of susceptible animals and humans. Diagnosis of leptospirosis, which primarily relies on antiquated serotyping methods, is particularly challenging due to presentation of non-specific symptoms shared by other febrile illnesses, often leading to misdiagnosis. Initiation of antimicrobial therapy during early infection to prevent more serious complications of disseminated infection is often not performed because of a lack of efficient diagnostic tests. Here we report that specific regions of leptospiral 16S ribosomal RNA molecules constitute a novel and efficient diagnostic target for PCR-based detection of pathogenic Leptospira serovars. Our diagnostic test using spiked human blood was at least 100-fold more sensitive than corresponding leptospiral DNA-based quantitative PCR assays, targeting the same 16S nucleotide sequence in the RNA and DNA molecules. The sensitivity and specificity of our RNA assay against laboratory-confirmed human leptospirosis clinical samples were 64% and 100%, respectively, which was superior then an established parallel DNA detection assay. Remarkably, we discovered that 16S transcripts remain appreciably stable ex vivo, including untreated and stored human blood samples, further highlighting their use for clinical detection of L. interrogans. Together, these studies underscore a novel utility of RNA targets, specifically 16S rRNA, for development of PCR-based modalities for diagnosis of human leptospirosis, and also may serve as paradigm for detection of additional bacterial pathogens for which early diagnosis is warranted. PMID:26091292

  19. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  20. Ribosome Synthesis and MAPK Activity Modulate Ionizing Radiation-Induced Germ Cell Apoptosis in Caenorhabditis elegans

    PubMed Central

    Eberhard, Ralf; Stergiou, Lilli; Hofmann, E. Randal; Hofmann, Jen; Haenni, Simon; Teo, Youjin; Furger, André; Hengartner, Michael O.

    2013-01-01

    Synthesis of ribosomal RNA by RNA polymerase I (RNA pol I) is an elemental biological process and is key for cellular homeostasis. In a forward genetic screen in C. elegans designed to identify DNA damage-response factors, we isolated a point mutation of RNA pol I, rpoa-2(op259), that leads to altered rRNA synthesis and a concomitant resistance to ionizing radiation (IR)-induced germ cell apoptosis. This weak apoptotic IR response could be phenocopied when interfering with other factors of ribosome synthesis. Surprisingly, despite their resistance to DNA damage, rpoa-2(op259) mutants present a normal CEP-1/p53 response to IR and increased basal CEP-1 activity under normal growth conditions. In parallel, rpoa-2(op259) leads to reduced Ras/MAPK pathway activity, which is required for germ cell progression and physiological germ cell death. Ras/MAPK gain-of-function conditions could rescue the IR response defect in rpoa-2(op259), pointing to a function for Ras/MAPK in modulating DNA damage-induced apoptosis downstream of CEP-1. Our data demonstrate that a single point mutation in an RNA pol I subunit can interfere with multiple key signalling pathways. Ribosome synthesis and growth-factor signalling are perturbed in many cancer cells; such an interplay between basic cellular processes and signalling might be critical for how tumours evolve or respond to treatment. PMID:24278030

  1. FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  2. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  3. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  4. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  5. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  6. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    PubMed Central

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  7. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  8. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  9. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  10. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  11. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  12. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  13. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    PubMed

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. PMID:27530925

  14. Runx1 deficiency decreases ribosome biogenesis and confers stress resistance to hematopoietic stem and progenitor cells

    PubMed Central

    Cai, Xiongwei; Gao, Long; Teng, Li; Ge, Jingping; Oo, Zaw Min; Kumar, Ashish R.; Gilliland, D. Gary; Mason, Philip J.; Tan, Kai; Speck, Nancy A.

    2015-01-01

    Summary The transcription factor RUNX1 is frequently mutated in myelodysplastic syndrome and leukemia. RUNX1 mutations can be early events, creating pre-leukemic stem cells that expand in the bone marrow. Here we show, counter-intuitively, that Runx1 deficient hematopoietic stem and progenitor cells (HSPCs) have a slow growth, low biosynthetic, small cell phenotype and markedly reduced ribosome biogenesis (Ribi). The reduced Ribi involved decreased levels of rRNA and many mRNAs encoding ribosome proteins. Runx1 appears to directly regulate Ribi; Runx1 is enriched on the promoters of genes encoding ribosome proteins, and binds the ribosomal DNA repeats. Runx1 deficient HSPCs have lower p53 levels, reduced apoptosis, an attenuated unfolded protein response, and accordingly are resistant to genotoxic and endoplasmic reticulum stress. The low biosynthetic activity and corresponding stress resistance provides a selective advantage to Runx1 deficient HSPCs, allowing them to expand in the bone marrow and outcompete normal HSPCs. PMID:26165925

  15. [Effect of ribosome engineering on butenyl-spinosyns synthesis of Saccharopolyspora pogona].

    PubMed

    Luo, Lin'gen; Yang, Yan; Wei, Hui; Rang, Jie; Tang, Qiong; Hu, Shengbiao; Sun, Yunjun; Yu, Ziquan; Ding, Xuezhi; Xia, Liqiu

    2016-02-01

    Through introducing mutations into ribosomes by obtaining spontaneous drug resistance of microorganisms, ribosome engineering technology is an effective approach to develop mutant strains that overproduce secondary metabolites. In this study, ribosome engineering was used to improve the yield of butenyl-spinosyns produced by Saccharopolyspora pogona by screening streptomycin resistant mutants. The yields of butenyl-spinosyns were then analyzed and compared with the parent strain. Among the mutants, S13 displayed the greatest increase in the yield of butenyl-spinosyns, which was 1.79 fold higher than that in the parent strain. Further analysis of the metabolite profile of S13 by mass spectrometry lead to the discovery of Spinosyn α1, which was absent from the parent strain. DNA sequencing showed that there existed two point mutations in the conserved regions of rpsL gene which encodes ribosomal protein S12 in S13. The mutations occurred a C to A and a C to T transversion mutations occurred at nucleotide pair 314 and 320 respectively, which resulted in the mutations of Proline (105) to Gultamine and Alanine (107) to Valine. It also demonstrated that S13 exhibited genetic stability even after five passages. PMID:27382776

  16. The role of ribosomal proteins in the regulation of cell proliferation, tumorigenesis, and genomic integrity.

    PubMed

    Xu, Xilong; Xiong, Xiufang; Sun, Yi

    2016-07-01

    Ribosomal proteins (RPs), the essential components of the ribosome, are a family of RNA-binding proteins, which play prime roles in ribosome biogenesis and protein translation. Recent studies revealed that RPs have additional extra-ribosomal functions, independent of protein biosynthesis, in regulation of diverse cellular processes. Here, we review recent advances in our understanding of how RPs regulate apoptosis, cell cycle arrest, cell proliferation, neoplastic transformation, cell migration and invasion, and tumorigenesis through both MDM2/p53-dependent and p53-independent mechanisms. We also discuss the roles of RPs in the maintenance of genome integrity via modulating DNA damage response and repair. We further discuss mutations or deletions at the somatic or germline levels of some RPs in human cancers as well as in patients of Diamond-Blackfan anemia and 5q- syndrome with high susceptibility to cancer development. Moreover, we discuss the potential clinical application, based upon abnormal levels of RPs, in biomarker development for