Science.gov

Sample records for 3-methyladenine dna glycosylase

  1. Release of 3-methyladenine from nucleosomal DNA by a 3-methyladenine DNA glycosylase

    SciTech Connect

    Price, J.A.; Heller, E.; Goldthwait, D.A.

    1983-01-01

    Nucleosomes from chicken erythrocytes, with DNA containing an average of 144 base pairs, were alkylated with (/sup 3/H)methylnitrosourea. The level of alkylation of the nucleosomal DNA was 48% of that of free DNA. The histones had approximately one tenth the radioactivity of the DNA. There was no statistically significant difference between alkylation of nucleosome bases in the major vs. minor groove. When the first 50 residues of the alkylated nucleosomal DNA were examined on sequencing gels, the 7-methylguanine and 3-methyladenine (3-MeA) residues were distributed randomly. The 3-MeA DNA glycosylase I of E. coli was used to measure the release of 3-MeA groups of the nucleosomal DNA. A partially purified 3-MeA DNA glycosylase from rat liver gave similar results. The limited enzymatic release is most likely due to steric hindrance of the enzyme by the DNA-Histone interactions on the surface of the core particle. An alteration of nucleosomal conformation has been suggested as an explanation for repair of nucleosomal DNA. Two model systems have been examined. The addition of ethidium bromide to alkylated nucleosomes increased the enzymatic release of 3-MeA to approx.75% and altered the electron microscopic appearance. The chemical alkylation of nucleosomes also increased the enzymatic release of 3-MeA as well as decreased the sedimentation coefficient. All of these experiments indicate a limited availability of 3-MeA residues to the glycosylase and suggest that some conformational change must occur in vivo for complete repair. 52 references, 6 figures, 4 tables.

  2. Two DNA glycosylases in Esherichia coli which release primarily 3-methyladenine

    SciTech Connect

    Thomas, L.; Yang, C.; Goldthwait, D.A.

    1982-01-01

    Two enzymes have been partially purified from Escherichia coli and designated 3-methyladenine DNA glycosylases I and II. The apparent molecular weight of glycosylase I is 20,000, and that of II is 27,000. Glycosylase I releases 3-methyladenine (3-MeA) while II releases 3-MeA, 3-methylguanine (3-MeG), 7-methylguanine (7-MeG), and 7-methyladenine (7-MeA). The rate of release of 3-MeA by glycosylase II is 30 times that of 7-MeG. Glycosylase I is missing in mutants tag 1 and tag 2. In crude extracts, the 3-MeA activity of II is approximately 10% of the total 3-MeA activity. A 50% inactivation at 48/sup 0/C required 5 min for I and 65 min for II. The 3-MeA and 7-MeG activities of the glycosylase II preparation could not be separated by isoelectric focusing, by chromatography of DEAE, Sephadex G-100, phosphocellulose, DNA-cellulose, or carboxymethylcellulose, or by heating at 50/sup 0/C.

  3. Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase

    SciTech Connect

    Heller, E.P.; Goldthwait, D.A.

    1983-12-01

    Oligonucleosomes were isolated from (/sub 14/C)thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with (/sub 3/H)methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of /sub 3/H-labeled methyl groups in the linker versus the core DNA was established by a determination of /sub 3/H:/sub 14/C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of /sub 3/H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the /sub 3/H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair.

  4. Crystal structures of 3-methyladenine DNA glycosylase MagIII and the recognition of alkylated bases

    PubMed Central

    Eichman, Brandt F.; O’Rourke, Eyleen J.; Radicella, J.Pablo; Ellenberger, Tom

    2003-01-01

    DNA glycosylases catalyze the excision of chemically modified bases from DNA. Although most glycosylases are specific to a particular base, the 3-methyladenine (m3A) DNA glycosylases include both highly specific enzymes acting on a single modified base, and enzymes with broader specificity for alkylation-damaged DNA. Our structural understanding of these different enzymatic specificities is currently limited to crystal and NMR structures of the unliganded enzymes and complexes with abasic DNA inhibitors. Presented here are high-resolution crystal structures of the m3A DNA glycosylase from Helicobacter pylori (MagIII) in the unliganded form and bound to alkylated bases 3,9-dimethyladenine and 1,N6-ethenoadenine. These are the first structures of a nucleobase bound in the active site of a m3A glycosylase belonging to the helix–hairpin–helix superfamily. MagIII achieves its specificity for positively-charged m3A not by direct interactions with purine or methyl substituent atoms, but rather by stacking the base between two aromatic side chains in a pocket that excludes 7-methylguanine. We report base excision and DNA binding activities of MagIII active site mutants, together with a structural comparison of the HhH glycosylases. PMID:14517230

  5. Substrate specificity and sequence-dependent activity of the Saccharomyces cerevisiae 3-methyladenine DNA glycosylase (Mag).

    PubMed

    Lingaraju, Gondichatnahalli M; Kartalou, Maria; Meira, Lisiane B; Samson, Leona D

    2008-06-01

    DNA glycosylases initiate base excision repair by first binding, then excising aberrant DNA bases. Saccharomyces cerevisiae encodes a 3-methyladenine (3MeA) DNA glycosylase, Mag, that recognizes 3MeA and various other DNA lesions including 1,N6-ethenoadenine (epsilon A), hypoxanthine (Hx) and abasic (AP) sites. In the present study, we explore the relative substrate specificity of Mag for these lesions and in addition, show that Mag also recognizes cisplatin cross-linked adducts, but does not catalyze their excision. Through competition binding and activity studies, we show that in the context of a random DNA sequence Mag binds epsilon A and AP-sites the most tightly, followed by the cross-linked 1,2-d(ApG) cisplatin adduct. While epsilon A binding and excision by Mag was robust in this sequence context, binding and excision of Hx was extremely poor. We further studied the recognition of epsilon A and Hx by Mag, when these lesions are present at different positions within A:T and G:C tracts. Overall, epsilon A was slightly less well excised from each position within the A:T and G:C tracts compared to excision from the random sequence, whereas Hx excision was greatly increased in these sequence contexts (by up to 7-fold) compared to the random sequence. However, given most sequence contexts, Mag had a clear preference for epsilon A relative to Hx, except in the TTXTT (X=epsilon A or Hx) sequence context from which Mag removed both lesions with almost equal efficiency. We discuss how DNA sequence context affects base excision by various 3MeA DNA glycosylases.

  6. 3-Methyladenine-DNA glycosylase (MPG protein) interacts with human RAD23 proteins.

    PubMed

    Miao, F; Bouziane, M; Dammann, R; Masutani, C; Hanaoka, F; Pfeifer, G; O'Connor, T R

    2000-09-15

    Human 3-methyladenine-DNA glycosylase (MPG protein) initiates base excision repair by severing the glycosylic bond of numerous damaged bases. In comparison, homologues of the Rad23 proteins (hHR23) and the hXPC protein are involved in the recognition of damaged bases in global genome repair, a subset of nucleotide excision repair. In this report, we show that the hHR23A and -B also interact with the MPG protein and can serve as accessory proteins for DNA damage recognition in base excision repair. Furthermore, the MPG.hHR23 protein complex elevates the rate of MPG protein-catalyzed excision from hypoxanthine-containing substrates. This increased excision rate is correlated with a greater binding affinity of the MPG protein-hHR23 protein complex for damaged DNA. These data suggest that the hHR23 proteins function as universal DNA damage recognition accessory proteins in both of these major excision repair pathways.

  7. Interplay between base excision repair activity and toxicity of 3-methyladenine DNA glycosylases in an E. coli complementation system.

    PubMed

    Troll, Christopher J; Adhikary, Suraj; Cueff, Marie; Mitra, Ileena; Eichman, Brandt F; Camps, Manel

    2014-01-01

    DNA glycosylases carry out the first step of base excision repair by removing damaged bases from DNA. The N3-methyladenine (3MeA) DNA glycosylases specialize in alkylation repair and are either constitutively expressed or induced by exposure to alkylating agents. To study the functional and evolutionary significance of constitutive versus inducible expression, we expressed two closely related yeast 3MeA DNA glycosylases - inducible Saccharomyces cerevisiae MAG and constitutive S. pombe Mag1 - in a glycosylase-deficient Escherichia coli strain. In both cases, constitutive expression conferred resistance to alkylating agent exposure. However, in the absence of exogenous alkylation, high levels of expression of both glycosylases were deleterious. We attribute this toxicity to excessive glycosylase activity, since suppressing spMag1 expression correlated with improved growth in liquid culture, and spMag1 mutants exhibiting decreased glycosylase activity showed improved growth and viability. Selection of a random spMag1 mutant library for increased survival in the presence of exogenous alkylation resulted in the selection of hypomorphic mutants, providing evidence for the presence of a genetic barrier to the evolution of enhanced glycosylase activity when constitutively expressed. We also show that low levels of 3MeA glycosylase expression improve fitness in our glycosylase-deficient host, implying that 3MeA glycosylase activity is likely necessary for repair of endogenous lesions. These findings suggest that 3MeA glycosylase activity is evolutionarily conserved for repair of endogenously produced alkyl lesions, and that inducible expression represents a common strategy to rectify deleterious effects of excessive 3MeA activity in the absence of exogenous alkylation challenge.

  8. Cloning and characterization of a 3-methyladenine DNA glycosylase cDNA from human cells whose gene maps to chromosome 16

    SciTech Connect

    Samson, L.; Derfler, B.; Boosalis, M.; Call, K. )

    1991-10-15

    The authors described previously the isolation of a Saccharomyces cerevisiae 3-methyladenine (3-MeAde) DNA glycosylase repair gene (MAG) by its expression in glycosylase-deficient Escherichia coli alkA tag mutant cells and its ability to rescue these cells from the toxic effects of alkylating agents. Here they extend this cross-species functional complementation approach to the isolation of a full-length human 3-MeAde DNA glycosylase cDNA that rescues alkA tag E coli from killing by methyl methanesulfonate, and they have mapped the gene to human chromosome 16. Surprisingly, the predicted human protein does not share significant amino acid sequence homology with the bacterial AlkA and Tag glycosylases or the yeast MAG glycosylase, but it does share extensive amino acid sequence homology with a rat 3-MeAde DNA glycosylase and significant DNA sequence homology with genes from several mammalian species. The cloning of a human 3-MeAde DNA glycosylase cDNA represents a key step in generating 3-MeAde repair-deficient cells and the determination of the in vivo role of this DNA repair enzyme in protecting against the toxic and carcinogenic effects of alkylating agents.

  9. Increase of O6-methylguanine-DNA-methyltransferase and N3-methyladenine glycosylase RNA transcripts in rat hepatoma cells treated with DNA-damaging agents

    SciTech Connect

    Laval, F. )

    1991-05-15

    A variety of DNA-damaging agents increase the O6-methylguanine-DNA-methyltransferase (transferase) and the N3-methyladenine (3-meAde)-DNA-glycosylase activities in a rat hepatoma cell line (H4 cells). Using two cDNA expressing either the rat 3-meAde-DNA-glycosylase or the transferase, the level of mRNA transcripts was measured by hybridization in H4 cells treated with three different inducing agents, gamma-rays, cis-dichlorodiammine platinum II or N-methyl-9-hydroxy ellipticinium. The two mRNA increased 24 hours after the cell treatments but this enhanced transcription was a transient phenomenon, as it was no longer observed after 96 hours. No significant DNA amplification was detectable in the treated cells.

  10. DNA alkylation lesions and their repair in human cells: modification of the comet assay with 3-methyladenine DNA glycosylase (AlkD).

    PubMed

    Hašplová, Katarína; Hudecová, Alexandra; Magdolénová, Zuzana; Bjøras, Magnar; Gálová, Eliška; Miadoková, Eva; Dušinská, Mária

    2012-01-05

    3-methyladenine DNA glycosylase (AlkD) belongs to a new family of DNA glycosylases; it initiates repair of cytotoxic and promutagenic alkylated bases (its main substrates being 3-methyladenine and 7-methylguanine). The modification of the comet assay (single cell gel electrophoresis) using AlkD enzyme thus allows assessment of specific DNA alkylation lesions. The resulting baseless sugars are alkali-labile, and under the conditions of the alkaline comet assay they appear as DNA strand breaks. The alkylating agent methyl methanesulfonate (MMS) was used to induce alkylation lesions and to optimize conditions for the modified comet assay method with AlkD on human lymphoblastoid (TK6) cells. We also studied cellular and in vitro DNA repair of alkylated bases in DNA in TK6 cells after treatment with MMS. Results from cellular repair indicate that 50% of DNA alkylation is repaired in the first 60 min. The in vitro repair assay shows that while AlkD recognises most alkylation lesions after 60 min, a cell extract from TK6 cells recognises most of the MMS-induced DNA adducts already in the first 15 min of incubation, with maximum detection of lesions after 60 min' incubation. Additionally, we tested the in vitro repair capacity of human lymphocyte extracts from 5 individuals and found them to be able to incise DNA alkylations in the same range as AlkD. The modification of the comet assay with AlkD can be useful for in vitro and in vivo genotoxicity studies to detect alkylation damage and repair and also for human biomonitoring and molecular epidemiology studies.

  11. Interactions of the human, rat, Saccharomyces cerevisiae and Escherichia coli 3-methyladenine-DNA glycosylases with DNA containing dIMP residues

    PubMed Central

    Saparbaev, Murat; Mani, Jean-Claude; Laval, Jacques

    2000-01-01

    In DNA, the deamination of dAMP generates 2′-deoxyinosine 5′-monophosphate (dIMP). Hypoxanthine (HX) residues are mutagenic since they give rise to A·T→G·C transition. They are excised, although with different efficiencies, by an activity of the 3-methyladenine (3-meAde)-DNA glycosylases from Escherichia coli (AlkA protein), human cells (ANPG protein), rat cells (APDG protein) and yeast (MAG protein). Comparison of the kinetic constants for the excision of HX residues by the four enzymes shows that the E.coli and yeast enzymes are quite inefficient, whereas for the ANPG and the APDG proteins they repair the HX residues with an efficiency comparable to that of alkylated bases, which are believed to be the primary substrates of these DNA glycosylases. Since the use of various substrates to monitor the activity of HX-DNA glycosylases has generated conflicting results, the efficacy of the four 3-meAde-DNA glycosylases of different origin was compared using three different substrates. Moreover, using oligonucleotides containing a single dIMP residue, we investigated a putative sequence specificity of the enzymes involving the bases next to the HX residue. We found up to 2–5-fold difference in the rates of HX excision between the various sequences of the oligonucleotides studied. When the dIMP residue was placed opposite to each of the four bases, a preferential recognition of dI:T over dI:dG, dI:dC and dI:dA mismatches was observed for both human (ANPG) and E.coli (AlkA) proteins. At variance, the yeast MAG protein removed more efficiently HX from a dI:dG over dI:dC, dI:T and dI:dA mismatches. PMID:10684927

  12. Biomarkers of cigarette smoking and DNA methylating agents: Raman, SERS and DFT study of 3-methyladenine and 7-methyladenine

    NASA Astrophysics Data System (ADS)

    Harroun, Scott G.; Zhang, Yaoting; Chen, Tzu-Heng; Ku, Ching-Rong; Chang, Huan-Tsung

    2017-04-01

    3-Methyladenine and 7-methyladenine are biomarkers of DNA damage from exposure to methylating agents. For example, the concentration of 3-methyladenine increases significantly in the urine of cigarette smokers. Surface-enhanced Raman spectroscopy (SERS) has shown much potential for detection of biomolecules, including DNA. Much work has been dedicated to the canonical nucleobases, with comparatively fewer investigations of modified DNA and modified DNA nucleobases. Herein, Raman spectroscopy and SERS are used to examine the adsorption orientations of 3-methyladenine and 7-methyladenine on Ag nanoparticles. Density functional theory (DFT) calculations at the B3LYP level are used to support the conclusions via simulated spectra of the nucleobases and of Ag+/nucleobase complexes. The results herein show that 7-methyladenine adsorbs upright via its N3 and N9 atoms side, similarly to adenine. 3-Methyladenine adsorbs in a very tilted or flat orientation on the Ag nanoparticles. These findings will be useful for future SERS or other nanoparticle-based bioanalytical assays for detection of these methyladenines or other modified nucleobases.

  13. The enigmatic thymine DNA glycosylase.

    PubMed

    Cortázar, Daniel; Kunz, Christophe; Saito, Yusuke; Steinacher, Roland; Schär, Primo

    2007-04-01

    When it was first isolated from extracts of HeLa cells in Josef Jiricny's laboratory, the thymine DNA glycosylase (TDG) attracted attention because of its ability to remove thymine, i.e. a normal DNA base, from G.T mispairs. This implicated a function of DNA base excision repair in the restoration of G.C base pairs following the deamination of a 5-methylcytosine. TDG turned out to be the founding member of a newly emerging family of mismatch-directed uracil-DNA glycosylases, the MUG proteins, that act on a comparably broad spectrum of base lesion including G.U as the common, most efficiently processed substrate. However, because of its apparent catalytic inefficiency, some have considered TDG a poor DNA repair enzyme without an important biological function. Others have reported 5-meC DNA glycosylase activity to be associated with TDG, thrusting the enzyme into limelight as a possible DNA demethylase. Yet others have found the glycosylase to interact with transcription factors, implicating a function in gene regulation, which appears to be critically important in developmental processes. This article reviews all these developments in view of possible biological functions of this multifaceted DNA glycosylase.

  14. Hydroxymethyluracil DNA glycosylase in mammalian cells

    SciTech Connect

    Hollstein, M.C.; Brooks, P.; Linn, S.; Ames, B.N.

    1984-07-01

    An activity has been purified 350-fold from extracts of mouse plasmacytoma cells that forms 5-hydroxymethyluracil (..cap alpha..-hydroxythymine) and apyrimidinic sites with phage SPO1 DNA, which contains this base in place of thymine. This DNA glycosylase presumably functions to eliminate hydroxymethyluracil, a major thymine-derived DNA lesion produced by ionizing radiation and oxidative damage. The enzyme has no cofactor requirement and is active in EDTA. Neither intermediate formation nor hydrolysis of hydroxymethyldeoxyuridine or hydroxymethyldeoxyuridine monophosphate was detected. The enzyme does not cleave apyrimidinic sites in DNA. It does release uracil from the uracil-containing DNA of phage PBS2, but this acitivity is less than 2% of the predominant uracil DNA glycosytase activity of the cell, which is separated by phosphocellulose chromatography. The major uracil DNA glycosylase does not release hydroxymethyluracil from SPO1 DNA. The hydroxymethyluracil glycosylase is also separated upon phosphocelluose chromatography from a thymine glycol DNA glycosylase activity that is accompanied by an apyrimidinic endonuclease activity. 33 references, 2 figures, 2 tables.

  15. Strandwise translocation of a DNA glycosylase on undamaged DNA

    SciTech Connect

    Qi, Yan; Nam, Kwangho; Spong, Marie C.; Banerjee, Anirban; Sung, Rou-Jia; Zhang, Michael; Karplus, Martin; Verdine, Gregory L.

    2012-05-14

    Base excision repair of genotoxic nucleobase lesions in the genome is critically dependent upon the ability of DNA glycosylases to locate rare sites of damage embedded in a vast excess of undamaged DNA, using only thermal energy to fuel the search process. Considerable interest surrounds the question of how DNA glycosylases translocate efficiently along DNA while maintaining their vigilance for target damaged sites. Here, we report the observation of strandwise translocation of 8-oxoguanine DNA glycosylase, MutM, along undamaged DNA. In these complexes, the protein is observed to translocate by one nucleotide on one strand while remaining untranslocated on the complementary strand. We further report that alterations of single base-pairs or a single amino acid substitution (R112A) can induce strandwise translocation. Molecular dynamics simulations confirm that MutM can translocate along DNA in a strandwise fashion. These observations reveal a previously unobserved mode of movement for a DNA-binding protein along the surface of DNA.

  16. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer.

    PubMed

    Crosbie, Philip A J; Watson, Amanda J; Agius, Raymond; Barber, Philip V; Margison, Geoffrey P; Povey, Andrew C

    2012-04-01

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCTɛAGCGGGTACCGAGCTCGAAT; ɛA=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67 fmol/μg DNA/h vs 3.47±1.35 fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Recent Advances in the Structural Mechanisms of DNA Glycosylases

    PubMed Central

    Brooks, Sonja C.; Adhikary, Suraj; Rubinson, Emily H.; Eichman, Brandt F.

    2012-01-01

    DNA glycosylases safeguard the genome by locating and excising a diverse array of aberrant nucleobases created from oxidation, alkylation, and deamination of DNA. Since the discovery 28 years ago that these enzymes employ a base flipping mechanism to trap their substrates, six different protein architectures have been identified to perform the same basic task. Work over the past several years has unraveled details for how the various DNA glycosylases survey DNA, detect damage within the duplex, select for the correct modification, and catalyze base excision. Here, we provide a broad overview of these latest advances in glycosylase mechanisms gleaned from structural enzymology, highlighting features common to all glycosylases as well as key differences that define their particular substrate specificities. PMID:23076011

  18. Thymine DNA glycosylase specifically recognizes 5-carboxylcytosine-modified DNA

    SciTech Connect

    Zhang, Liang; Lu, Xingyu; Lu, Junyan; Liang, Haihua; Dai, Qing; Xu, Guo-Liang; Luo, Cheng; Jiang, Hualiang; He, Chuan

    2012-04-24

    Human thymine DNA glycosylase (hTDG) efficiently excises 5-carboxylcytosine (5caC), a key oxidation product of 5-methylcytosine in genomic DNA, in a recently discovered cytosine demethylation pathway. We present here the crystal structures of the hTDG catalytic domain in complex with duplex DNA containing either 5caC or a fluorinated analog. These structures, together with biochemical and computational analyses, reveal that 5caC is specifically recognized in the active site of hTDG, supporting the role of TDG in mammalian 5-methylcytosine demethylation.

  19. Expansion Mechanisms and Evolutionary History on Genes Encoding DNA Glycosylases and Their Involvement in Stress and Hormone Signaling.

    PubMed

    Jiang, Shu-Ye; Ramachandran, Srinivasan

    2016-04-25

    DNA glycosylases catalyze the release of methylated bases. They play vital roles in the base excision repair pathway and might also function in DNA demethylation. At least three families of DNA glycosylases have been identified, which included 3'-methyladenine DNA glycosylase (MDG) I, MDG II, and HhH-GPD (Helix-hairpin-Helix and Glycine/Proline/aspartate (D)). However, little is known on their genome-wide identification, expansion, and evolutionary history as well as their expression profiling and biological functions. In this study, we have genome-widely identified and evolutionarily characterized these family members. Generally, a genome encodes only one MDG II gene in most of organisms. No MDG I or MDG II gene was detected in green algae. However, HhH-GPD genes were detectable in all available organisms. The ancestor species contain small size of MDG I and HhH-GPD families. These two families were mainly expanded through the whole-genome duplication and segmental duplication. They were evolutionarily conserved and were generally under purifying selection. However, we have detected recent positive selection among the Oryza genus, which might play roles in species divergence. Further investigation showed that expression divergence played important roles in gene survival after expansion. All of these family genes were expressed in most of developmental stages and tissues in rice plants. High ratios of family genes were downregulated by drought and fungus pathogen as well as abscisic acid (ABA) and jasmonic acid (JA) treatments, suggesting a negative regulation in response to drought stress and pathogen infection through ABA- and/or JA-dependent hormone signaling pathway.

  20. Poxvirus uracil-DNA glycosylase-An unusual member of the family I uracil-DNA glycosylases: Poxvirus Uracil-DNA Glycosylase

    SciTech Connect

    Schormann, Norbert; Zhukovskaya, Natalia; Bedwell, Gregory; Nuth, Manunya; Gillilan, Richard; Prevelige, Peter E.; Ricciardi, Robert P.; Banerjee, Surajit; Chattopadhyay, Debasish

    2016-11-02

    We report that uracil-DNA glycosylases are ubiquitous enzymes, which play a key role repairing damages in DNA and in maintaining genomic integrity by catalyzing the first step in the base excision repair pathway. Within the superfamily of uracil-DNA glycosylases family I enzymes or UNGs are specific for recognizing and removing uracil from DNA. These enzymes feature conserved structural folds, active site residues and use common motifs for DNA binding, uracil recognition and catalysis. Within this family the enzymes of poxviruses are unique and most remarkable in terms of amino acid sequences, characteristic motifs and more importantly for their novel non-enzymatic function in DNA replication. UNG of vaccinia virus, also known as D4, is the most extensively characterized UNG of the poxvirus family. D4 forms an unusual heterodimeric processivity factor by attaching to a poxvirus-specific protein A20, which also binds to the DNA polymerase E9 and recruits other proteins necessary for replication. D4 is thus integrated in the DNA polymerase complex, and its DNA-binding and DNA scanning abilities couple DNA processivity and DNA base excision repair at the replication fork. In conclusion, the adaptations necessary for taking on the new function are reflected in the amino acid sequence and the three-dimensional structure of D4. We provide an overview of the current state of the knowledge on the structure-function relationship of D4.

  1. N-methylpurine DNA glycosylase and DNA polymerase β modulate BER inhibitor potentiation of glioma cells to temozolomide

    PubMed Central

    Tang, Jiang-bo; Svilar, David; Trivedi, Ram N.; Wang, Xiao-hong; Goellner, Eva M.; Moore, Briana; Hamilton, Ronald L.; Banze, Lauren A.; Brown, Ashley R.; Sobol, Robert W.

    2011-01-01

    Temozolomide (TMZ) is the preferred chemotherapeutic agent in the treatment of glioma following surgical resection and/or radiation. Resistance to TMZ is attributed to efficient repair and/or tolerance of TMZ-induced DNA lesions. The majority of the TMZ-induced DNA base adducts are repaired by the base excision repair (BER) pathway and therefore modulation of this pathway can enhance drug sensitivity. N-methylpurine DNA glycosylase (MPG) initiates BER by removing TMZ-induced N3-methyladenine and N7-methylguanine base lesions, leaving abasic sites (AP sites) in DNA for further processing by BER. Using the human glioma cell lines LN428 and T98G, we report here that potentiation of TMZ via BER inhibition [methoxyamine (MX), the PARP inhibitors PJ34 and ABT-888 or depletion (knockdown) of PARG] is greatly enhanced by over-expression of the BER initiating enzyme MPG. We also show that methoxyamine-induced potentiation of TMZ in MPG expressing glioma cells is abrogated by elevated-expression of the rate-limiting BER enzyme DNA polymerase β (Polβ), suggesting that cells proficient for BER readily repair AP sites in the presence of MX. Further, depletion of Polβ increases PARP inhibitor-induced potentiation in the MPG over-expressing glioma cells, suggesting that expression of Polβ modulates the cytotoxic effect of combining increased repair initiation and BER inhibition. This study demonstrates that MPG overexpression, together with inhibition of BER, sensitizes glioma cells to the alkylating agent TMZ in a Polβ-dependent manner, suggesting that the expression level of both MPG and Polβ might be used to predict the effectiveness of MX and PARP-mediated potentiation of TMZ in cancer treatment. PMID:21377995

  2. Interaction of the recombinant human methylpurine-DNA glycosylase (MPG protein) with oligodeoxyribonucleotides containing either hypoxanthine or abasic sites.

    PubMed

    Miao, F; Bouziane, M; O'Connor, T R

    1998-09-01

    Methylpurine-DNA glycosylases (MPG proteins, 3-methyladenine-DNA glycosylases) excise numerous damaged bases from DNA during the first step of base excision repair. The damaged bases removed by these proteins include those induced by both alkylating agents and/or oxidizing agents. The intrinsic kinetic parameters (k(cat) and K(m)) for the excision of hypoxanthine by the recombinant human MPG protein from a 39 bp oligodeoxyribonucleotide harboring a unique hypoxanthine were determined. Comparison with other reactions catalyzed by the human MPG protein suggests that the differences in specificity are primarily in product release and not binding. Analysis of MPG protein binding to the 39 bp oligodeoxyribonucleotide revealed that the apparent dissociation constant is of the same order of magnitude as the K(m) and that a 1:1 complex is formed. The MPG protein also forms a strong complex with the product of excision, an abasic site, as well as with a reduced abasic site. DNase I footprinting experiments with the MPG protein on an oligodeoxyribonucleotide with a unique hypoxanthine at a defined position indicate that the protein protects 11 bases on the strand with the hypoxanthine and 12 bases on the complementary strand. Competition experiments with different length, double-stranded, hypoxanthine-containing oligodeoxyribonucleotides show that the footprinted region is relatively small. Despite the small footprint, however, oligodeoxyribonucleotides comprising <15 bp with a hypoxanthine have a 10-fold reduced binding capacity compared with hypoxanthine-containing oligodeoxyribonucleotides >20 bp in length. These results provide a basis for other structural studies of the MPG protein with its targets.

  3. A DNA enzyme with N-glycosylase activity

    NASA Technical Reports Server (NTRS)

    Sheppard, T. L.; Ordoukhanian, P.; Joyce, G. F.

    2000-01-01

    In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 10(6)-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of the reaction was confirmed by analysis of the cleavage products by using HPLC and mass spectrometry. The isolation and characterization of an N-glycosylase DNA enzyme demonstrates that single-stranded DNA, like RNA and proteins, can form a complex tertiary structure and catalyze a difficult biochemical transformation. This DNA enzyme provides a new approach for the site-specific cleavage of DNA molecules.

  4. A DNA enzyme with N-glycosylase activity

    NASA Technical Reports Server (NTRS)

    Sheppard, T. L.; Ordoukhanian, P.; Joyce, G. F.

    2000-01-01

    In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 10(6)-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of the reaction was confirmed by analysis of the cleavage products by using HPLC and mass spectrometry. The isolation and characterization of an N-glycosylase DNA enzyme demonstrates that single-stranded DNA, like RNA and proteins, can form a complex tertiary structure and catalyze a difficult biochemical transformation. This DNA enzyme provides a new approach for the site-specific cleavage of DNA molecules.

  5. Molecular crowding enhances facilitated diffusion of two human DNA glycosylases

    PubMed Central

    Cravens, Shannen L.; Schonhoft, Joseph D.; Rowland, Meng M.; Rodriguez, Alyssa A.; Anderson, Breeana G.; Stivers, James T.

    2015-01-01

    Intracellular space is at a premium due to the high concentrations of biomolecules and is expected to have a fundamental effect on how large macromolecules move in the cell. Here, we report that crowded solutions promote intramolecular DNA translocation by two human DNA repair glycosylases. The crowding effect increases both the efficiency and average distance of DNA chain translocation by hindering escape of the enzymes to bulk solution. The increased contact time with the DNA chain provides for redundant damage patrolling within individual DNA chains at the expense of slowing the overall rate of damaged base removal from a population of molecules. The significant biological implication is that a crowded cellular environment could influence the mechanism of damage recognition as much as any property of the enzyme or DNA. PMID:25845592

  6. Molecular crowding enhances facilitated diffusion of two human DNA glycosylases.

    PubMed

    Cravens, Shannen L; Schonhoft, Joseph D; Rowland, Meng M; Rodriguez, Alyssa A; Anderson, Breeana G; Stivers, James T

    2015-04-30

    Intracellular space is at a premium due to the high concentrations of biomolecules and is expected to have a fundamental effect on how large macromolecules move in the cell. Here, we report that crowded solutions promote intramolecular DNA translocation by two human DNA repair glycosylases. The crowding effect increases both the efficiency and average distance of DNA chain translocation by hindering escape of the enzymes to bulk solution. The increased contact time with the DNA chain provides for redundant damage patrolling within individual DNA chains at the expense of slowing the overall rate of damaged base removal from a population of molecules. The significant biological implication is that a crowded cellular environment could influence the mechanism of damage recognition as much as any property of the enzyme or DNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Repair of DNA treated with. gamma. -irradiation and chemical carcinogens. Progress report, 1980-1983

    SciTech Connect

    Goldthwait, D.A.

    1984-02-01

    We have studied in vitro DNA repair with the isolation and characterization of DNA glycosylases active in the removable of 3-methyladenine and the problem of repair of DNA in chromatin. The second area of focus has been on transposable elements and carcinogen action. The work on DNA adducts with ..beta..-propiolactone was done to define potential new substrates useful in a search for new glycosylases.

  8. The presence of nuclear and mitochondrial uracil-DNA glycosylase in extracts of human KB cells.

    PubMed Central

    Anderson, C T; Friedberg, E C

    1980-01-01

    Extracts of human KB cells contain detectable uracil-DNA glycosylase activity. The majority of the activity is located within the nuclear fraction, however we present evidence for the presence of identifiable uracil-DNA glycosylase activity associated with the mitochondrial fraction of these cells. PMID:6253928

  9. Release of 7-methylguanine residues from alkylated DNA by extracts of Micrococcus luteus and Escherichia coli.

    PubMed Central

    Laval, J; Pierre, J; Laval, F

    1981-01-01

    Cell extracts from Micrococcus luteus release both free 3-methyladenine and free 7-methylguanine from alkylated DNA. The glycosylase activity responsible for the liberation of 7-methylguanine is not 3-methyladenine-DNA glycosylase, which, when purified, does not liberate it. Furthermore, the heat inactivation rates of the two enzymatic activities are different. The release of 7-methylguanine by chemical depurination of ethanol-soluble oligonucleotides has been ruled out. A similar activity releasing 7-methylguanine is also found in Escherichia coli. PMID:7015333

  10. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE PAGES

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

    2015-06-02

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  11. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    SciTech Connect

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; Chattopadhyay, Debasish

    2015-06-02

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This also represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.

  12. Glycosylases utilize ``stop and go'' motion to locate DNA damage

    NASA Astrophysics Data System (ADS)

    Nelson, Shane

    2015-03-01

    Oxidative damage to DNA results in alterations that are mutagenic or even cytotoxic. Base excision repair is a mechanism that functions to identify and correct these lesions, and is present in organisms ranging from bacteria to humans. DNA glycosylases are the first enzymes in this pathway and function to locate and remove oxidatively damaged bases, and do so utilizing only thermal energy. However, the question remains of how these enzymes locate and recognize a damaged base among millions of undamaged bases. Utilizing fluorescence video microscopy with high spatial and temporal resolution, we have observed a number of different fluorescently labeled glycosylases (including bacterial FPG, NEI, and NTH as well as mammalian MutyH and OGG). These enzymes diffuse along DNA tightropes at approximately 0.01 +/- 0.005 μm2/s with binding lifetimes ranging from one second to several minutes. Chemically induced damage to the DNA substrate causes a ~ 50% reduction in diffusion coefficients and a ~ 400% increase in binding lifetimes, while mutation of the key ``wedge residue'' - which has been shown to be responsible for damage detection - results in a 200% increase in the diffusion coefficient. Utilizing a sliding window approach to measure diffusion coefficients within individual trajectories, we observe that distributions of diffusion coefficients are bimodal, consistent with periods of diffusive motion interspersed with immobile periods. Utilizing a unique chemo-mechanical simulation approach, we demonstrate that the motion of these glycosylases can be explained as free diffusion along the helical pitch of the DNA, punctuated with two different types of pauses: 1) rapid, short-lived pauses as the enzyme rapidly probes DNA bases to interrogate for damage and, 2) less frequent, longer lived pauses that reflect the enzyme bound to and catalytically removing a damaged base. These simulations also indicate that the wedge residue is critical for interrogation and recognition of

  13. 5-Hydroxy-5-methylhydantoin DNA lesion, a molecular trap for DNA glycosylases

    PubMed Central

    Le Bihan, Yann-Vaï; Angeles Izquierdo, Maria; Coste, Franck; Aller, Pierre; Culard, Françoise; Gehrke, Tim H.; Essalhi, Kadija; Carell, Thomas; Castaing, Bertrand

    2011-01-01

    DNA base-damage recognition in the base excision repair (BER) is a process operating on a wide variety of alkylated, oxidized and degraded bases. DNA glycosylases are the key enzymes which initiate the BER pathway by recognizing and excising the base damages guiding the damaged DNA through repair synthesis. We report here biochemical and structural evidence for the irreversible entrapment of DNA glycosylases by 5-hydroxy-5-methylhydantoin, an oxidized thymine lesion. The first crystal structure of a suicide complex between DNA glycosylase and unrepaired DNA has been solved. In this structure, the formamidopyrimidine-(Fapy) DNA glycosylase from Lactococcus lactis (LlFpg/LlMutM) is covalently bound to the hydantoin carbanucleoside-containing DNA. Coupling a structural approach by solving also the crystal structure of the non-covalent complex with site directed mutagenesis, this atypical suicide reaction mechanism was elucidated. It results from the nucleophilic attack of the catalytic N-terminal proline of LlFpg on the C5-carbon of the base moiety of the hydantoin lesion. The biological significance of this finding is discussed. PMID:21486746

  14. Excision of 5-hydroxymethylcytosine by DEMETER family DNA glycosylases

    PubMed Central

    Jang, Hosung; Shin, Hosub; Eichman, Brandt F.; Huh, Jin Hoe

    2016-01-01

    In plants and animals, 5-methylcytosine (5mC) serves as an epigenetic mark to repress gene expression, playing critical roles for cellular differentiation and transposon silencing. Mammals also have 5-hydroxymethylcytosine (5hmC), resulting from hydroxylation of 5mC by TET family-enzymes. 5hmC is abundant in mouse Purkinje neurons and embryonic stem cells, and regarded as an important intermediate for active DNA demethylation in mammals. However, the presence of 5hmC in plants has not been clearly demonstrated. In Arabidopsis, the DEMETER (DME) family DNA glycosylases efficiently remove 5mC, which results in DNA demethylation and transcriptional activation of target genes. Here we show that DME and ROS1 have a significant 5hmC excision activity in vitro, although we detected no 5hmC in Arabidopsis, suggesting that it is very unlikely for plants to utilize 5hmC as a DNA demethylation intermediate. Our results indicate that both plants and animals have 5mC in common but DNA demethylation systems have independently evolved with distinct mechanisms. PMID:24661881

  15. An evolutionary analysis of the helix-hairpin-helix superfamily of DNA repair glycosylases.

    PubMed

    Denver, Dee R; Swenson, Stephanie L; Lynch, Michael

    2003-10-01

    The helix-hairpin-helix (HhH) superfamily of base excision repair DNA glycosylases is composed of multiple phylogenetically diverse enzymes that are capable of excising varying spectra of oxidatively and methyl-damaged bases. Although these DNA repair glycosylases have been widely studied through genetic, biochemical, and biophysical approaches, the evolutionary relationships of different HhH homologs and the extent to which they are conserved across phylogeny remain enigmatic. We provide an evolutionary framework for this pervasive and versatile superfamily of DNA glycosylases. Six HhH gene families (named AlkA: alkyladenine glycosylase; MpgII: N-methylpurine glycosylase II; MutY/Mig: A/G-specific adenine glycosylase/mismatch glycosylase; Nth: endonuclease III; OggI: 8-oxoguanine glycosylase I; and OggII: 8-oxoguanine glycosylase II) are identified through phylogenetic analysis of 234 homologs found in 94 genomes (16 archaea, 64 bacteria, and 14 eukaryotes). The number of homologs in each gene family varies from 117 in the Nth family (nearly every genome surveyed harbors at least one Nth homolog) to only five in the divergent OggII family (all from archaeal genomes). Sequences from all three domains of life are included in four of the six gene families, suggesting that the HhH superfamily diversified very early in evolution. The phylogeny provides evidence for multiple lineage-specific gene duplication events, most of which involve eukaryotic homologs in the Nth and AlkA gene families. We observe extensive variation in the number of HhH superfamily glycosylase genes present in different genomes, possibly reflecting major differences among species in the mechanisms and pathways by which damaged bases are repaired and/or disparities in the basic rates and spectra of mutation experienced by different genomes.

  16. Role of the Arabidopsis DNA glycosylase/lyase ROS1 in active DNA demethylation

    PubMed Central

    Agius, Fernanda; Kapoor, Avnish; Zhu, Jian-Kang

    2006-01-01

    DNA methylation is a stable epigenetic mark for transcriptional gene silencing in diverse organisms including plants and many animals. In contrast to the well characterized mechanism of DNA methylation by methyltransferases, the mechanisms and function of active DNA demethylation have been controversial. Genetic evidence suggested that the DNA glycosylase domain-containing protein ROS1 of Arabidopsis is a putative DNA demethylase, because loss-of-function ros1 mutations cause DNA hypermethylation and enhance transcriptional gene silencing. We report here the biochemical characterization of ROS1 and the effect of its overexpression on the DNA methylation of target genes. Our data suggest that the DNA glycosylase activity of ROS1 removes 5-methylcytosine from the DNA backbone and then its lyase activity cleaves the DNA backbone at the site of 5-methylcytosine removal by successive β- and δ-elimination reactions. Overexpression of ROS1 in transgenic plants led to a reduced level of cytosine methylation and increased expression of a target gene. These results demonstrate that ROS1 is a 5-methylcytosine DNA glycosylase/lyase important for active DNA demethylation in Arabidopsis. PMID:16864782

  17. Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation

    PubMed Central

    Arab, Khelifa; Kienhöfer, Sabine; von Seggern, Annika; Niehrs, Christof

    2016-01-01

    DNA 5-methylcytosine is a dynamic epigenetic mark which plays important roles in development and disease. In the Tet-Tdg demethylation pathway, methylated cytosine is iteratively oxidized by Tet dioxygenases and unmodified cytosine is restored via thymine DNA glycosylase (Tdg). Here we show that human NEIL1 and NEIL2 DNA glycosylases coordinate abasic site processing during TET–TDG DNA demethylation. NEIL1 and NEIL2 cooperate with TDG during base excision: TDG occupies the abasic site and is displaced by NEILs, which further process the baseless sugar, thereby stimulating TDG substrate turnover. In early Xenopus embryos Neil2 cooperates with Tdg to remove oxidized methylcytosines and to specify neural crest development together with Tet3. Thus, Neils function as AP lyases in the coordinated AP site hand-over during oxidative DNA demethylation. PMID:26751644

  18. Lesion search and recognition by thymine DNA glycosylase revealed by single molecule imaging.

    PubMed

    Buechner, Claudia N; Maiti, Atanu; Drohat, Alexander C; Tessmer, Ingrid

    2015-03-11

    The ability of DNA glycosylases to rapidly and efficiently detect lesions among a vast excess of nondamaged DNA bases is vitally important in base excision repair (BER). Here, we use single molecule imaging by atomic force microscopy (AFM) supported by a 2-aminopurine fluorescence base flipping assay to study damage search by human thymine DNA glycosylase (hTDG), which initiates BER of mutagenic and cytotoxic G:T and G:U mispairs in DNA. Our data reveal an equilibrium between two conformational states of hTDG-DNA complexes, assigned as search complex (SC) and interrogation complex (IC), both at target lesions and undamaged DNA sites. Notably, for both hTDG and a second glycosylase, hOGG1, which recognizes structurally different 8-oxoguanine lesions, the conformation of the DNA in the SC mirrors innate structural properties of their respective target sites. In the IC, the DNA is sharply bent, as seen in crystal structures of hTDG lesion recognition complexes, which likely supports the base flipping required for lesion identification. Our results support a potentially general concept of sculpting of glycosylases to their targets, allowing them to exploit the energetic cost of DNA bending for initial lesion sensing, coupled with continuous (extrahelical) base interrogation during lesion search by DNA glycosylases. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Lesion search and recognition by thymine DNA glycosylase revealed by single molecule imaging

    PubMed Central

    Buechner, Claudia N.; Maiti, Atanu; Drohat, Alexander C.; Tessmer, Ingrid

    2015-01-01

    The ability of DNA glycosylases to rapidly and efficiently detect lesions among a vast excess of nondamaged DNA bases is vitally important in base excision repair (BER). Here, we use single molecule imaging by atomic force microscopy (AFM) supported by a 2-aminopurine fluorescence base flipping assay to study damage search by human thymine DNA glycosylase (hTDG), which initiates BER of mutagenic and cytotoxic G:T and G:U mispairs in DNA. Our data reveal an equilibrium between two conformational states of hTDG–DNA complexes, assigned as search complex (SC) and interrogation complex (IC), both at target lesions and undamaged DNA sites. Notably, for both hTDG and a second glycosylase, hOGG1, which recognizes structurally different 8-oxoguanine lesions, the conformation of the DNA in the SC mirrors innate structural properties of their respective target sites. In the IC, the DNA is sharply bent, as seen in crystal structures of hTDG lesion recognition complexes, which likely supports the base flipping required for lesion identification. Our results support a potentially general concept of sculpting of glycosylases to their targets, allowing them to exploit the energetic cost of DNA bending for initial lesion sensing, coupled with continuous (extrahelical) base interrogation during lesion search by DNA glycosylases. PMID:25712093

  20. Identification of a prototypical single-stranded uracil DNA glycosylase from Listeria innocua.

    PubMed

    Li, Jing; Yang, Ye; Guevara, Jose; Wang, Liangjiang; Cao, Weiguo

    2017-09-01

    A recent phylogenetic study on UDG superfamily estimated a new clade of family 3 enzymes (SMUG1-like), which shares a lower homology with canonic SMUG1 enzymes. The enzymatic properties of the newly found putative DNA glycosylase are unknown. To test the potential UDG activity and evaluate phylogenetic classification, we isolated one SMUG1-like glycosylase representative from Listeria innocua (Lin). A biochemical screening of DNA glycosylase activity in vitro indicates that Lin SMUG1-like glycosylase is a single-strand selective uracil DNA glycosylase. The UDG activity on DNA bubble structures provides clue to its physiological significance in vivo. Mutagenesis and molecular modeling analyses reveal that Lin SMUG1-like glycosylase has similar functional motifs with SMUG1 enzymes; however, it contains a distinct catalytic doublet S67-S68 in motif 1 that is not found in any families in the UDG superfamily. Experimental investigation shows that the S67M-S68N double mutant is catalytically more active than either S67M or S68N single mutant. Coupled with mutual information analysis, the results indicate a high degree of correlation in the evolution of SMUG1-like enzymes. This study underscores the functional and catalytic diversity in the evolution of enzymes in UDG superfamily. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Uracil DNA glycosylase uses DNA hopping and short-range sliding to trap extrahelical uracils.

    PubMed

    Porecha, Rishi H; Stivers, James T

    2008-08-05

    The astonishingly efficient location and excision of damaged DNA bases by DNA repair glycosylases is an especially intriguing problem in biology. One example is the enzyme uracil DNA glycosylase (UNG), which captures and excises rare extrahelical uracil bases that have emerged from the DNA base stack by spontaneous base pair breathing motions. Here, we explore the efficiency and mechanism by which UNG executes intramolecular transfer and excision of two uracil sites embedded on the same or opposite DNA strands at increasing site spacings. The efficiency of intramolecular site transfer decreased from 41 to 0% as the base pair spacing between uracil sites on the same DNA strand increased from 20 to 800 bp. The mechanism of transfer is dominated by DNA hopping between landing sites of approximately 10 bp size, over which rapid 1D scanning likely occurs. Consistent with DNA hopping, site transfer at 20- and 56-bp spacings was unaffected by whether the uracils were placed on the same or opposite strands. Thus, UNG uses hopping and 3D diffusion through bulk solution as the principal pathways for efficient patrolling of long genomic DNA sequences for damage. Short-range sliding over the range of a helical turn allows for redundant inspection of very local DNA sequences and trapping of spontaneously emerging extrahelical uracils.

  2. Synergistic Actions of Ogg1 and Mutyh DNA Glycosylases Modulate Anxiety-like Behavior in Mice.

    PubMed

    Bjørge, Monica D; Hildrestrand, Gunn A; Scheffler, Katja; Suganthan, Rajikala; Rolseth, Veslemøy; Kuśnierczyk, Anna; Rowe, Alexander D; Vågbø, Cathrine B; Vetlesen, Susanne; Eide, Lars; Slupphaug, Geir; Nakabeppu, Yusaku; Bredy, Timothy W; Klungland, Arne; Bjørås, Magnar

    2015-12-29

    Ogg1 and Mutyh DNA glycosylases cooperate to prevent mutations caused by 8-oxoG, a major premutagenic DNA lesion associated with cognitive decline. We have examined behavior and cognitive function in mice deficient of these glycosylases. Ogg1(-/-)Mutyh(-/-) mice were more active and less anxious, with impaired learning ability. In contrast, Mutyh(-/-) mice showed moderately improved memory. We observed no apparent change in genomic 8-oxoG levels, suggesting that Ogg1 and Mutyh play minor roles in global repair in adult brain. Notably, transcriptome analysis of hippocampus revealed that differentially expressed genes in the mutants belong to pathways known to be involved in anxiety and cognition. Esr1 targets were upregulated, suggesting a role of Ogg1 and Mutyh in repression of Esr1 signaling. Thus, beyond their involvement in DNA repair, Ogg1 and Mutyh regulate hippocampal gene expression related to cognition and behavior, suggesting a role for the glycosylases in regulating adaptive behavior.

  3. Repair of oxidatively induced DNA damage by DNA glycosylases: Mechanisms of action, substrate specificities and excision kinetics.

    PubMed

    Dizdaroglu, Miral; Coskun, Erdem; Jaruga, Pawel

    Endogenous and exogenous reactive species cause oxidatively induced DNA damage in living organisms by a variety of mechanisms. As a result, a plethora of mutagenic and/or cytotoxic products are formed in cellular DNA. This type of DNA damage is repaired by base excision repair, although nucleotide excision repair also plays a limited role. DNA glycosylases remove modified DNA bases from DNA by hydrolyzing the glycosidic bond leaving behind an apurinic/apyrimidinic (AP) site. Some of them also possess an accompanying AP-lyase activity that cleaves the sugar-phosphate chain of DNA. Since the first discovery of a DNA glycosylase, many studies have elucidated the mechanisms of action, substrate specificities and excision kinetics of these enzymes present in all living organisms. For this purpose, most studies used single- or double-stranded oligodeoxynucleotides with a single DNA lesion embedded at a defined position. High-molecular weight DNA with multiple base lesions has been used in other studies with the advantage of the simultaneous investigation of many DNA base lesions as substrates. Differences between the substrate specificities and excision kinetics of DNA glycosylases have been found when these two different substrates were used. Some DNA glycosylases possess varying substrate specificities for either purine-derived lesions or pyrimidine-derived lesions, whereas others exhibit cross-activity for both types of lesions. Laboratory animals with knockouts of the genes of DNA glycosylases have also been used to provide unequivocal evidence for the substrates, which had previously been found in in vitro studies, to be the actual substrates in vivo as well. On the basis of the knowledge gained from the past studies, efforts are being made to discover small molecule inhibitors of DNA glycosylases that may be used as potential drugs in cancer therapy. Published by Elsevier B.V.

  4. Structural and mutation studies of two DNA demethylation related glycosylases: MBD4 and TDG.

    PubMed

    Hashimoto, Hideharu

    2014-01-01

    Two mammalian DNA glycosylases, methyl-CpG binding domain protein 4 (MBD4) and thymine DNA glycosylase (TDG), are involved in active DNA demethylation via the base excision repair pathway. Both MBD4 and TDG excise the mismatch base from G:X, where X is uracil, thymine, and 5-hydroxymethyluracil (5hmU). In addition, TDG excises 5mC oxidized bases i.e. when X is 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) not 5-hydroxymethylcytosine (5hmC). A MBD4 inactive mutant and substrate crystal structure clearly explains how MBD4 glycosylase discriminates substrates: 5mC are not able to be directly excised, but a deamination process from 5mC to thymine is required. On the other hand, TDG is much more complicated; in this instance, crystal structures show that TDG recognizes G:X mismatch DNA containing DNA and G:5caC containing DNA from the minor groove of DNA, which suggested that TDG might recognize 5mC oxidized product 5caC like mismatch DNA. In mutation studies, a N157D mutation results in a more 5caC specific glycosylase, and a N191A mutation inhibits 5caC activity while that when X=5fC or T remains. Here I revisit the recent MBD4 glycos ylase domain co-crystal structures with DNA, as well as TDG glycosylase domain co-crystal structures with DNA in conjunction with its mutation studies.

  5. Repair of DNA treated with. gamma. -irradiation and chemical carcinogens. Progress report, March 15, 1979-March 15, 1980

    SciTech Connect

    Goldthwait, D.A.

    1980-01-01

    The identification and purification of 3-methyladenine glycosylase from the cell nuclei of rat liver was completed. The characterization of 7-methylguanine N-glycosylase activity in E. coli is currently under investigation. Alkylated DNA in chromatin structures as a substrate for 3-methyladenine N-glycosylase is discussed. An enzyme from E. coli and mammalian tissue active on 2,6-diamino-4-hydroxy-5-N-methyldormamido-pyrimide is isolated and characterized. Studies are proceeding on the correlation of x-ray sensitivity with removal of alkylated bases from DNA in x-ray sensitive and x-ray resistant lines of lymphoma cells. The reaction of ..beta..-propiolactone with derivatives of adenine and with DNA is discussed.

  6. The NEIL glycosylases remove oxidized guanine lesions from telomeric and promoter quadruplex DNA structures

    PubMed Central

    Zhou, Jia; Fleming, Aaron M.; Averill, April M.; Burrows, Cynthia J.; Wallace, Susan S.

    2015-01-01

    G-quadruplex is a four-stranded G-rich DNA structure that is highly susceptible to oxidation. Despite the important roles that G-quadruplexes play in telomere biology and gene transcription, neither the impact of guanine lesions on the stability of quadruplexes nor their repair are well understood. Here, we show that the oxidized guanine lesions 8-oxo-7,8-dihydroguanine (8-oxoG), guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp) reduce the thermostability and alter the folding of telomeric quadruplexes in a location-dependent manner. Also, the NEIL1 and NEIL3 DNA glycosylases can remove hydantoin lesions but none of the glycosylases, including OGG1, are able to remove 8-oxoG from telomeric quadruplexes. Interestingly, a hydantoin lesion at the site most prone to oxidation in quadruplex DNA is not efficiently removed by NEIL1 or NEIL3. However, NEIL1, NEIL2 and NEIL3 remove hydantoins from telomeric quadruplexes formed by five TTAGGG repeats much more rapidly than the commonly studied four-repeat quadruplex structures. We also show that APE1 cleaves furan in selected positions in Na+-coordinated telomeric quadruplexes. In promoter G-quadruplex DNA, the NEIL glycosylases primarily remove Gh from Na+-coordinated antiparallel quadruplexes but not K+-coordinated parallel quadruplexes containing VEGF or c-MYC promoter sequences. Thus, the NEIL DNA glycosylases may be involved in both telomere maintenance and in gene regulation. PMID:25813041

  7. 5-Methylcytosine DNA glycosylase activity is also present in the human MBD4 (G/T mismatch glycosylase) and in a related avian sequence.

    PubMed

    Zhu, B; Zheng, Y; Angliker, H; Schwarz, S; Thiry, S; Siegmann, M; Jost, J P

    2000-11-01

    A 1468 bp cDNA coding for the chicken homolog of the human MBD4 G/T mismatch DNA glycosylase was isolated and sequenced. The derived amino acid sequence (416 amino acids) shows 46% identity with the human MBD4 and the conserved catalytic region at the C-terminal end (170 amino acids) has 90% identity. The non-conserved region of the avian protein has no consensus sequence for the methylated DNA binding domain. The recombinant proteins from human and chicken have G/T mismatch as well as 5-methylcytosine (5-MeC) DNA glycosylase activities. When tested by gel shift assays, human recombinant protein with or without the methylated DNA binding domain binds equally well to symmetrically, hemimethylated DNA and non-methylated DNA. However, the enzyme has only 5-MeC DNA glycosylase activity with the hemimethylated DNA. Footprinting of human MBD4 and of an N-terminal deletion mutant with partially depurinated and depyrimidinated substrate reveal a selective binding of the proteins to the modified substrate around the CpG. As for 5-MeC DNA glycosylase purified from chicken embryos, MBD4 does not use oligonucleotides containing mCpA, mCpT or mCpC as substrates. An mCpG within an A+T-rich oligonucleotide is a much better substrate than an A+T-poor sequence. The K:(m) of human MBD4 for hemimethylated DNA is approximately 10(-7) M with a V:(max) of approximately 10(-11) mol/h/microgram protein. Deletion mutations show that G/T mismatch and 5-MeC DNA glycosylase are located in the C-terminal conserved region. In sharp contrast to the 5-MeC DNA glycosylase isolated from the chicken embryo DNA demethylation complex, the two enzymatic activities of MBD4 are strongly inhibited by RNA. In situ hybridization with antisense RNA indicate that MBD4 is only located in dividing cells of differentiating embryonic tissues.

  8. Structural Investigation of a Viral Ortholog of Human NEIL2/3 DNA Glycosylases

    PubMed Central

    Prakash, Aishwarya; Eckenroth, Brian E.; Averill, April M.; Imamura, Kayo; Wallace, Susan S.; Doublié, Sylvie

    2013-01-01

    Assault to DNA that leads to oxidative base damage is repaired by the base excision repair (BER) pathway with specialized enzymes called DNA glycosylases catalyzing the first step of this pathway. These glycosylases can be categorized into two families: the HhH superfamily, which includes endonuclease III (or Nth), and the Fpg/Nei family, which comprises formamidopyrimidine DNA glycosylase (or Fpg) and endonuclease VIII (or Nei). In humans there are three Nei-like (NEIL) glycosylases: NEIL1, 2, and 3. Here we present the first crystal structure of a viral ortholog of the human NEIL2/NEIL3 proteins, Mimivirus Nei2 (MvNei2), determined at 2.04 Å resolution. The C-terminal region of the MvNei2 enzyme comprises two conserved DNA binding motifs: the helix-two-turns-helix (H2TH) motif and a C-H-C-C type zinc-finger similar to that of human NEIL2. The N-terminal region of MvNei2 is most closely related to NEIL3. Like NEIL3, MvNei2 bears a valine at position 2 instead of the usual proline and it lacks two of the three conserved void-filling residues present in other members of the Fpg/Nei family. Mutational analysis of the only conserved void-filling residue methionine 72 to alanine yields an MvNei2 variant with impaired glycosylase activity. Mutation of the adjacent His73 causes the enzyme to be more productive thereby suggesting a plausible role for this residue in the DNA lesion search process. PMID:24120312

  9. The carboxy-terminal domain of ROS1 is essential for 5-methylcytosine DNA glycosylase activity

    PubMed Central

    Hong, Samuel; Hashimoto, Hideharu; Kow, Yoke Wah; Zhang, Xing; Cheng, Xiaodong

    2014-01-01

    Arabidopsis thaliana Repressor of silencing 1 (ROS1) is a multi-domain bifunctional DNA glycosylase/lyase, which excises 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) as well as thymine and 5-hydroxymethyluracil (i.e., the deamination products of 5mC and 5hmC) when paired with a guanine, leaving an apyrimidinic (AP) site that is subsequently incised by the lyase activity. ROS1 is slow in base excision and fast in AP lyase activity, indicating that the recognition of pyrimidine modifications might be a rate-limiting step. In the C-terminal half, the enzyme harbors a Helix-hairpin-Helix DNA glycosylase domain followed by a unique C-terminal domain. We show that the isolated glycosylase domain is inactive for base excision, but retains partial AP lyase activity. Addition of the C-terminal domain restores the base excision activity and increases the AP lyase activity as well. Furthermore, the two domains remain tightly associated and can be co-purified by chromatography. We suggest that the C-terminal domain of ROS1 is indispensable for the 5mC DNA glycosylase activity of ROS1. PMID:25240767

  10. Structure of a DNA glycosylase that unhooks interstrand cross-links.

    PubMed

    Mullins, Elwood A; Warren, Garrett M; Bradley, Noah P; Eichman, Brandt F

    2017-04-10

    DNA glycosylases are important editing enzymes that protect genomic stability by excising chemically modified nucleobases that alter normal DNA metabolism. These enzymes have been known only to initiate base excision repair of small adducts by extrusion from the DNA helix. However, recent reports have described both vertebrate and microbial DNA glycosylases capable of unhooking highly toxic interstrand cross-links (ICLs) and bulky minor groove adducts normally recognized by Fanconi anemia and nucleotide excision repair machinery, although the mechanisms of these activities are unknown. Here we report the crystal structure of Streptomyces sahachiroi AlkZ (previously Orf1), a bacterial DNA glycosylase that protects its host by excising ICLs derived from azinomycin B (AZB), a potent antimicrobial and antitumor genotoxin. AlkZ adopts a unique fold in which three tandem winged helix-turn-helix motifs scaffold a positively charged concave surface perfectly shaped for duplex DNA. Through mutational analysis, we identified two glutamine residues and a β-hairpin within this putative DNA-binding cleft that are essential for catalytic activity. Additionally, we present a molecular docking model for how this active site can unhook either or both sides of an AZB ICL, providing a basis for understanding the mechanisms of base excision repair of ICLs. Given the prevalence of this protein fold in pathogenic bacteria, this work also lays the foundation for an emerging role of DNA repair in bacteria-host pathogenesis.

  11. Functional changes in a novel uracil-DNA glycosylase determined by mutational analyses.

    PubMed

    Im, E K; Han, Y S; Chung, J H

    2008-01-01

    Uracil-DNA glycosylase (UDG) is a ubiquitous enzyme found in bacteria and eukaryotes, which removes uracil residues from DNA strands. Methanococcus jannaschii UDG (MjUDG), a novel monofunctional glycosylase, contains a helix-hairpin-helix (HhH) motif and Gly/Pro rich loop (GPD region), which is important for catalytic activity; it shares these features with other glycosylases such as endonuclease III. First, to examine the role of two conserved amino acid residues (Asp150 and Tyr152) in the HhH-GPD region of MjUDG, mutant MjUDG proteins were constructed, in which Asp 150 was replaced with either Glu or Trp (D150E and D150W), Tyr152 was replaced with either Glu or Asn (Y152E and Y152N). Mutant D150W completely lacked DNA glycosylase activity, whereas D150E displayed reduced activity of about 70% of the wild type value. However, the mutants Y152E and Y152N retained unchanged levels of UDG activity. We also replaced Glu132 in the HhH motif with a lysine residue equivalent to Lys120 in endonuclease III. This mutation converted the enzyme into a bifunctional glycosylase/AP lyase capable of both removing uracil at a glycosylic bond and cleaving the phosphodiester backbone at an AP site. Mutant E132K catalyzes a beta-elimination reaction at the AP site via uracil excision and forms a Schiff base intermediate in the form of a protein-DNA complex.

  12. Atomic substitution reveals the structural basis for substrate adenine recognition and removal by adenine DNA glycosylase

    SciTech Connect

    Lee, Seongmin; Verdine, Gregory L.

    2010-01-14

    Adenine DNA glycosylase catalyzes the glycolytic removal of adenine from the promutagenic A {center_dot} oxoG base pair in DNA. The general features of DNA recognition by an adenine DNA glycosylase, Bacillus stearothermophilus MutY, have previously been revealed via the X-ray structure of a catalytically inactive mutant protein bound to an A:oxoG-containing DNA duplex. Although the structure revealed the substrate adenine to be, as expected, extruded from the DNA helix and inserted into an extrahelical active site pocket on the enzyme, the substrate adenine engaged in no direct contacts with active site residues. This feature was paradoxical, because other glycosylases have been observed to engage their substrates primarily through direct contacts. The lack of direct contacts in the case of MutY suggested that either MutY uses a distinctive logic for substrate recognition or that the X-ray structure had captured a noncatalytically competent state in lesion recognition. To gain further insight into this issue, we crystallized wild-type MutY bound to DNA containing a catalytically inactive analog of 2'-deoxyadenosine in which a single 2'-H atom was replaced by fluorine. The structure of this fluorinated lesion-recognition complex (FLRC) reveals the substrate adenine buried more deeply into the active site pocket than in the prior structure and now engaged in multiple direct hydrogen bonding and hydrophobic interactions. This structure appears to capture the catalytically competent state of adenine DNA glycosylases, and it suggests a catalytic mechanism for this class of enzymes, one in which general acid-catalyzed protonation of the nucleobase promotes glycosidic bond cleavage.

  13. Isolating Contributions from Intersegmental Transfer to DNA Searching by Alkyladenine DNA Glycosylase*

    PubMed Central

    Hedglin, Mark; Zhang, Yaru; O'Brien, Patrick J.

    2013-01-01

    Large genomes pose a challenge to DNA repair pathways because rare sites of damage must be efficiently located from among a vast excess of undamaged sites. Human alkyladenine DNA glycosylase (AAG) employs nonspecific DNA binding interactions and facilitated diffusion to conduct a highly redundant search of adjacent sites. This ensures that every site is searched, but could be a detriment if the protein is trapped in a local segment of DNA. Intersegmental transfer between DNA segments that are transiently in close proximity provides an elegant solution that balances global and local searching processes. It has been difficult to detect intersegmental transfer experimentally; therefore, we developed biochemical assays that allowed us to observe and measure the rates of intersegmental transfer by AAG. AAG has a flexible amino terminus that tunes its affinity for nonspecific DNA, but we find that it is not required for intersegmental transfer. As AAG has only a single DNA binding site, this argues against the bridging model for intersegmental transfer. The rates of intersegmental transfer are strongly dependent on the salt concentration, supporting a jumping mechanism that involves microscopic dissociation and capture by a proximal DNA site. As many DNA-binding proteins have only a single binding site, jumping may be a common mechanism for intersegmental transfer. PMID:23839988

  14. 5-Methylcytosine Recognition by Arabidopsis thaliana DNA Glycosylases DEMETER and DML3

    PubMed Central

    2015-01-01

    Methylation of cytosine to 5-methylcytosine (5mC) is important for gene expression, gene imprinting, X-chromosome inactivation, and transposon silencing. Active demethylation in animals is believed to proceed by DNA glycosylase removal of deaminated or oxidized 5mC. In plants, 5mC is removed from the genome directly by the DEMETER (DME) family of DNA glycosylases. Arabidopsis thaliana DME excises 5mC to activate expression of maternally imprinted genes. Although the related Repressor of Silencing 1 (ROS1) enzyme has been characterized, the molecular basis for 5mC recognition by DME has not been investigated. Here, we present a structure–function analysis of DME and the related DME-like 3 (DML3) glycosylases for 5mC and its oxidized derivatives. Relative to 5mC, DME and DML3 exhibited robust activity toward 5-hydroxymethylcytosine, limited activity for 5-carboxylcytosine, and no activity for 5-formylcytosine. We used homology modeling and mutational analysis of base excision and DNA binding to identify residues important for recognition of 5mC within the context of DNA and inside the enzyme active site. Our results indicate that the 5mC binding pocket is composed of residues from discrete domains and is responsible for discrimination against 5mC derivatives, and suggest that DME, ROS1, and DML3 utilize subtly different mechanisms to probe the DNA duplex for cytosine modifications. PMID:24678721

  15. A discontinuous DNA glycosylase domain in a family of enzymes that excise 5-methylcytosine

    PubMed Central

    Ponferrada-Marín, María Isabel; Parrilla-Doblas, Jara Teresa; Roldán-Arjona, Teresa; Ariza, Rafael R.

    2011-01-01

    DNA cytosine methylation (5-meC) is a widespread epigenetic mark associated to gene silencing. In plants, DEMETER-LIKE (DML) proteins typified by Arabidopsis REPRESSOR OF SILENCING 1 (ROS1) initiate active DNA demethylation by catalyzing 5-meC excision. DML proteins belong to the HhH-GPD superfamily, the largest and most functionally diverse group of DNA glycosylases, but the molecular properties that underlie their capacity to specifically recognize and excise 5-meC are largely unknown. We have found that sequence similarity to HhH-GPD enzymes in DML proteins is actually distributed over two non-contiguous segments connected by a predicted disordered region. We used homology-based modeling to locate candidate residues important for ROS1 function in both segments, and tested our predictions by site-specific mutagenesis. We found that amino acids T606 and D611 are essential for ROS1 DNA glycosylase activity, whereas mutations in either of two aromatic residues (F589 and Y1028) reverse the characteristic ROS1 preference for 5-meC over T. We also found evidence suggesting that ROS1 uses Q607 to flip out 5-meC, while the contiguous N608 residue contributes to sequence-context specificity. In addition to providing novel insights into the molecular basis of 5-meC excision, our results reveal that ROS1 and its DML homologs possess a discontinuous catalytic domain that is unprecedented among known DNA glycosylases. PMID:21036872

  16. Activation of cellular signaling by 8-oxoguanine DNA glycosylase-1-initiated DNA base excision repair.

    PubMed

    German, Peter; Szaniszlo, Peter; Hajas, Gyorgy; Radak, Zsolt; Bacsi, Attila; Hazra, Tapas K; Hegde, Muralidhar L; Ba, Xueqing; Boldogh, Istvan

    2013-10-01

    Accumulation of 8-oxo-7,8-dihydroguanine (8-oxoG) in the DNA results in genetic instability and mutagenesis, and is believed to contribute to carcinogenesis, aging processes and various aging-related diseases. 8-OxoG is removed from the DNA via DNA base excision repair (BER), initiated by 8-oxoguanine DNA glycosylase-1 (OGG1). Our recent studies have shown that OGG1 binds its repair product 8-oxoG base with high affinity at a site independent from its DNA lesion-recognizing catalytic site and the OGG1•8-oxoG complex physically interacts with canonical Ras family members. Furthermore, exogenously added 8-oxoG base enters the cells and activates Ras GTPases; however, a link has not yet been established between cell signaling and DNA BER, which is the endogenous source of the 8-oxoG base. In this study, we utilized KG-1 cells expressing a temperature-sensitive mutant OGG1, siRNA ablation of gene expression, and a variety of molecular biological assays to define a link between OGG1-BER and cellular signaling. The results show that due to activation of OGG1-BER, 8-oxoG base is released from the genome in sufficient quantities for activation of Ras GTPase and resulting in phosphorylation of the downstream Ras targets Raf1, MEK1,2 and ERK1,2. These results demonstrate a previously unrecognized mechanism for cellular responses to OGG1-initiated DNA BER.

  17. A New Protein Architecture for Processing Alkylation Damaged DNA: The Crystal Structure of DNA Glycosylase AlkD

    SciTech Connect

    Rubinson, Emily H.; Metz, Audrey H.; O'Quin, Jami; Eichman, Brandt F.

    2008-12-15

    DNA glycosylases safeguard the genome by locating and excising chemically modified bases from DNA. AlkD is a recently discovered bacterial DNA glycosylase that removes positively charged methylpurines from DNA, and was predicted to adopt a protein fold distinct from from those of other DNA repair proteins. The crystal structure of Bacillus cereus AlkD presented here shows that the protein is composed exclusively of helical HEAT-like repeats, which form a solenoid perfectly shaped to accommodate a DNA duplex on the concave surface. Structural analysis of the variant HEAT repeats in AlkD provides a rationale for how this protein scaffolding motif has been modified to bind DNA. We report 7mG excision and DNA binding activities of AlkD mutants, along with a comparison of alkylpurine DNA glycosylase structures. Together, these data provide important insight into the requirements for alkylation repair within DNA and suggest that AlkD utilizes a novel strategy to manipulate DNA in its search for alkylpurine bases.

  18. Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase

    PubMed Central

    Ormeño, Fernando; Barrientos, Camila; Ramirez, Santiago; Ponce, Iván; Valenzuela, Lucía; Sepúlveda, Sofía; Bitar, Mainá; Kemmerling, Ulrike; Machado, Carlos Renato; Cabrera, Gonzalo; Galanti, Norbel

    2016-01-01

    Trypanosoma cruzi, the etiological agent of Chagas’ disease, presents three cellular forms (trypomastigotes, epimastigotes and amastigotes), all of which are submitted to oxidative species in its hosts. However, T. cruzi is able to resist oxidative stress suggesting a high efficiency of its DNA repair machinery.The Base Excision Repair (BER) pathway is one of the main DNA repair mechanisms in other eukaryotes and in T. cruzi as well. DNA glycosylases are enzymes involved in the recognition of oxidative DNA damage and in the removal of oxidized bases, constituting the first step of the BER pathway. Here, we describe the presence and activity of TcNTH1, a nuclear T. cruzi DNA glycosylase. Surprisingly, purified recombinant TcNTH1 does not remove the thymine glycol base, but catalyzes the cleavage of a probe showing an AP site. The same activity was found in epimastigote and trypomastigote homogenates suggesting that the BER pathway is not involved in thymine glycol DNA repair. TcNTH1 DNA-binding properties assayed in silico are in agreement with the absence of a thymine glycol removing function of that parasite enzyme. Over expression of TcNTH1 decrease parasite viability when transfected epimastigotes are submitted to a sustained production of H2O2.Therefore, TcNTH1 is the only known NTH1 orthologous unable to eliminate thymine glycol derivatives but that recognizes and cuts an AP site, most probably by a beta-elimination mechanism. We cannot discard that TcNTH1 presents DNA glycosylase activity on other DNA base lesions. Accordingly, a different DNA repair mechanism should be expected leading to eliminate thymine glycol from oxidized parasite DNA. Furthermore, TcNTH1 may play a role in the AP site recognition and processing. PMID:27284968

  19. Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase.

    PubMed

    Ormeño, Fernando; Barrientos, Camila; Ramirez, Santiago; Ponce, Iván; Valenzuela, Lucía; Sepúlveda, Sofía; Bitar, Mainá; Kemmerling, Ulrike; Machado, Carlos Renato; Cabrera, Gonzalo; Galanti, Norbel

    2016-01-01

    Trypanosoma cruzi, the etiological agent of Chagas' disease, presents three cellular forms (trypomastigotes, epimastigotes and amastigotes), all of which are submitted to oxidative species in its hosts. However, T. cruzi is able to resist oxidative stress suggesting a high efficiency of its DNA repair machinery.The Base Excision Repair (BER) pathway is one of the main DNA repair mechanisms in other eukaryotes and in T. cruzi as well. DNA glycosylases are enzymes involved in the recognition of oxidative DNA damage and in the removal of oxidized bases, constituting the first step of the BER pathway. Here, we describe the presence and activity of TcNTH1, a nuclear T. cruzi DNA glycosylase. Surprisingly, purified recombinant TcNTH1 does not remove the thymine glycol base, but catalyzes the cleavage of a probe showing an AP site. The same activity was found in epimastigote and trypomastigote homogenates suggesting that the BER pathway is not involved in thymine glycol DNA repair. TcNTH1 DNA-binding properties assayed in silico are in agreement with the absence of a thymine glycol removing function of that parasite enzyme. Over expression of TcNTH1 decrease parasite viability when transfected epimastigotes are submitted to a sustained production of H2O2.Therefore, TcNTH1 is the only known NTH1 orthologous unable to eliminate thymine glycol derivatives but that recognizes and cuts an AP site, most probably by a beta-elimination mechanism. We cannot discard that TcNTH1 presents DNA glycosylase activity on other DNA base lesions. Accordingly, a different DNA repair mechanism should be expected leading to eliminate thymine glycol from oxidized parasite DNA. Furthermore, TcNTH1 may play a role in the AP site recognition and processing.

  20. Physical and functional interaction of human nuclear uracil-DNA glycosylase with proliferating cell nuclear antigen☆

    PubMed Central

    Ko, Rinkei; Bennett, Samuel E.

    2011-01-01

    Uracil residues arise in DNA by the misincorporation of dUMP in place of dTMP during DNA replication or by the deamination of cytosine in DNA. Uracil-DNA glycosylase initiates DNA base excision repair of uracil residues by catalyzing the hydrolysis of the N-glycosylic bond linking the uracil base to deoxyribose. In human cells, the nuclear form of uracil-DNA glycosylase (UNG2) contains a conserved PCNA-binding motif located at the N-terminus that has been implicated experimentally in binding PCNA. Here we use purified preparations of UNG2 and PCNA to demonstrate that UNG2 physically associates with PCNA. UNG2 co-eluted with PCNA during size exclusion chromatography and bound to a PCNA affinity column. Association of UNG2 with PCNA was abolished by the addition of 100 mM NaCl, and significantly decreased in the presence of 10 mM MgCl2. The functional significance of the UNG2·PCNA association was demonstrated by UNG2 activity assays. Addition of PCNA (30–810 pmol) to standard uracil-DNA glycosylase reactions containing linear [uracil-3H]DNA stimulated UNG2 catalytic activity up to 2.6-fold. UNG2 activity was also stimulated by 7.5 mM MgCl2. The stimulatory effect of PCNA was increased by the addition of MgCl2; however, the dependence on PCNA concentration was the same, indicating that the effects of MgCl2 and PCNA on UNG2 activity occurred by independent mechanisms. Loading of PCNA onto the DNA substrate was required for stimulation, as the activity of UNG2 on circular DNA substrates was not affected by the addition of PCNA. Addition of replication factor C and ATP to reactions containing 90 pmol of PCNA resulted in two-fold stimulation of UNG2 activity on circular DNA. PMID:16216562

  1. Excised damaged base determines the turnover of human N-methylpurine-DNA glycosylase.

    PubMed

    Adhikari, Sanjay; Uren, Aykut; Roy, Rabindra

    2009-10-02

    N-Methylpurine-DNA glycosylase (MPG) initiates base excision repair in DNA by removing a wide variety of alkylated, deaminated, and lipid peroxidation-induced purine adducts. In this study, we tested the role of excised base on MPG enzymatic activity. After the reaction, MPG produced two products: free damaged base and AP-site containing DNA. Our results showed that MPG excises 1,N(6)-ethenoadenine (varepsilonA) from varepsilonA-containing oligonucleotide (varepsilonA-DNA) at a similar or slightly increased efficiency than it does hypoxanthine (Hx) from Hx-containing oligonucleotide (Hx-DNA) under similar conditions. Real-time binding experiments by surface plasmon resonance (SPR) spectroscopy suggested that both the substrate DNAs have a similar equilibrium binding constant (K(D)) towards MPG, but under single-turnover (STO) condition there is apparently no effect on catalytic chemistry; however, the turnover of the enzyme under multiple-turnover (MTO) condition is higher for varepsilonA-DNA than it is for Hx-DNA. Real-time binding experiments by SPR spectroscopy further showed that the dissociation of MPG from its product, AP-site containing DNA, is faster than the overall turnover of either Hx- or varepsilonA-DNA reaction. We thereby conclude that the excised base plays a critical role in product inhibition and, hence, is essential for MPG glycosylase activity. Thus, the results provide the first evidence that the excised base rather than AP-site could be rate-limiting for DNA-glycosylase reactions.

  2. Loss of Caenorhabditis elegans UNG-1 uracil-DNA glycosylase affects apoptosis in response to DNA damaging agents.

    PubMed

    Skjeldam, Hanne K; Kassahun, Henok; Fensgård, Oyvind; SenGupta, Tanima; Babaie, Eshrat; Lindvall, Jessica M; Arczewska, Katarzyna; Nilsen, Hilde

    2010-08-05

    The nematode Caenorhabditis elegans has been used extensively to study responses to DNA damage. In contrast, little is known about DNA repair in this organism. C. elegans is unusual in that it encodes few DNA glycosylases and the uracil-DNA glycosylase (UDG) encoded by the ung-1 gene is the only known UDG. C. elegans could therefore become a valuable model organism for studies of the genetic interaction networks involving base excision repair (BER). As a first step towards characterization of BER in C. elegans, we show that the UNG-1 protein is an active uracil-DNA glycosylase. We demonstrate that an ung-1 mutant has reduced ability to repair uracil-containing DNA but that an alternative Ugi-inhibited activity is present in ung-1 nuclear extracts. Finally, we demonstrate that ung-1 mutants show altered levels of apoptotic cell corpses formed in response to DNA damaging agents. Increased apoptosis in the ung-1 mutant in response to ionizing radiation (IR) suggests that UNG-1 contributes to repair of IR-induced DNA base damage in vivo. Following treatment with paraquat however, the apoptotic corpse-formation was reduced. Gene expression profiling suggests that this phenotype is a consequence of compensatory transcriptomic shifts that modulate oxidative stress responses in the mutant and not an effect of reduced DNA damage signaling. 2010 Elsevier B.V. All rights reserved.

  3. A unique uracil-DNA binding protein of the uracil DNA glycosylase superfamily

    PubMed Central

    Sang, Pau Biak; Srinath, Thiruneelakantan; Patil, Aravind Goud; Woo, Eui-Jeon; Varshney, Umesh

    2015-01-01

    Uracil DNA glycosylases (UDGs) are an important group of DNA repair enzymes, which pioneer the base excision repair pathway by recognizing and excising uracil from DNA. Based on two short conserved sequences (motifs A and B), UDGs have been classified into six families. Here we report a novel UDG, UdgX, from Mycobacterium smegmatis and other organisms. UdgX specifically recognizes uracil in DNA, forms a tight complex stable to sodium dodecyl sulphate, 2-mercaptoethanol, urea and heat treatment, and shows no detectable uracil excision. UdgX shares highest homology to family 4 UDGs possessing Fe-S cluster. UdgX possesses a conserved sequence, KRRIH, which forms a flexible loop playing an important role in its activity. Mutations of H in the KRRIH sequence to S, G, A or Q lead to gain of uracil excision activity in MsmUdgX, establishing it as a novel member of the UDG superfamily. Our observations suggest that UdgX marks the uracil-DNA for its repair by a RecA dependent process. Finally, we observed that the tight binding activity of UdgX is useful in detecting uracils in the genomes. PMID:26304551

  4. Small Molecule Inhibitors of 8-Oxoguanine DNA Glycosylase-1 (OGG1).

    PubMed

    Donley, Nathan; Jaruga, Pawel; Coskun, Erdem; Dizdaroglu, Miral; McCullough, Amanda K; Lloyd, R Stephen

    2015-10-16

    The DNA base excision repair (BER) pathway, which utilizes DNA glycosylases to initiate repair of specific DNA lesions, is the major pathway for the repair of DNA damage induced by oxidation, alkylation, and deamination. Early results from clinical trials suggest that inhibiting certain enzymes in the BER pathway can be a useful anticancer strategy when combined with certain DNA-damaging agents or tumor-specific genetic deficiencies. Despite this general validation of BER enzymes as drug targets, there are many enzymes that function in the BER pathway that have few, if any, specific inhibitors. There is a growing body of evidence that suggests inhibition of 8-oxoguanine DNA glycosylase-1 (OGG1) could be useful as a monotherapy or in combination therapy to treat certain types of cancer. To identify inhibitors of OGG1, a fluorescence-based screen was developed to analyze OGG1 activity in a high-throughput manner. From a primary screen of ∼50,000 molecules, 13 inhibitors were identified, 12 of which were hydrazides or acyl hydrazones. Five inhibitors with an IC50 value of less than 1 μM were chosen for further experimentation and verified using two additional biochemical assays. None of the five OGG1 inhibitors reduced DNA binding of OGG1 to a 7,8-dihydro-8-oxoguanine (8-oxo-Gua)-containing substrate, but all five inhibited Schiff base formation during OGG1-mediated catalysis. All of these inhibitors displayed a >100-fold selectivity for OGG1 relative to several other DNA glycosylases involved in repair of oxidatively damaged bases. These inhibitors represent the most potent and selective OGG1 inhibitors identified to date.

  5. Demonstration of pyrimidine dimer-DNA glycosylase activity in vivo: bacteriophage T4-infected Escherichia coli as a model system

    SciTech Connect

    Radany, E.H.; Friedberg, E.C.

    1982-01-01

    An approach to the detection of pyrimidine dimer-DNA glycosylase activity in living cells is presented. Mutants of Escherichia coli defective in uvr functions required for incision of UV-irradiated DNA were infected with phage T4 denV+ or denV- (defective in the T4 pyrimidine dimer-DNA glycosylase activity). In the former case the denV gene product catalyzed the incision of UV-irradiated host DNA, facilitating the subsequent excision of thymine-containing pyrimidine dimers. Isolation of these dimers from the acid-soluble fraction of infected cells was achieved by a multistep thin-layer chromatographic system. Exposure of the dimers to irradiation that monomerizes pyrimidine dimers (direct photoreversal) resulted in the stoichiometric formation of free thymine. Thus, in vivo incision of UV-irradiated DNA dependent on a pyrimidine dimer-DNA glycosylase can be demonstrated.

  6. Demonstration of pyrimidine dimer-DNA glycosylase activity in vivo: Bacteriophage T4-infected Escherichia coli as a model system

    SciTech Connect

    Radany, E.H.; Friedberg, E.C.

    1982-01-01

    An approach to the detection of pyrimidine dimer-DNA glycosylase activity in living cells is presented. Mutants of Escherichia coli defective in uvr functions required for incision of UV-irradiated DNA were infected with phage T4 denV/sup +/ or den V/sup -/ (defective in the T4 pyrimidine dimer-DNA glycosylase activity). In the former case the denV gene product catalyzed the incision of UV-irradiated host DNA, facilitating the subsequent excision of thymine-containing pyrimidine dimers. Isolation of these dimers from the acid-soluble fraction of infected cells was achieved by a multistep thin-layer chromatographic system. Exposure of the dimers to irradiation that monomerizes pyrimidine dimers (direct photoreversal) resulted in the stoichiometric formation of free thymine. Thus, in vivo incision of UV-irradiated DNA dependent on a pyrimidine dimer-DNA glycosylase can be demonstrated.

  7. Human immunodeficiency virus type 1 Vpr protein binds to the uracil DNA glycosylase DNA repair enzyme.

    PubMed Central

    Bouhamdan, M; Benichou, S; Rey, F; Navarro, J M; Agostini, I; Spire, B; Camonis, J; Slupphaug, G; Vigne, R; Benarous, R; Sire, J

    1996-01-01

    The role of the accessory gene product Vpr during human immunodeficiency virus type 1 infection remains unclear. We have used the yeast two-hybrid system to identify cellular proteins that interact with Vpr and could be involved in its function. A cDNA clone which encodes the human uracil DNA glycosylase (UNG), a DNA repair enzyme involved in removal of uracil in DNA, has been isolated. Interaction between Vpr and UNG has been demonstrated by in vitro protein-protein binding assays using translated, radiolabeled Vpr and UNG recombinant proteins expressed as a glutathione S-transferase fusion protein. Conversely, purified UNG has been demonstrated to interact with Vpr recombinant protein expressed as a glutathione S-transferase fusion protein. Coimmunoprecipitation experiments confirmed that Vpr and UNG are associated within cells expressing Vpr. By using a panel of C- and N-terminally deleted Vpr mutants, we have determined that the core protein of Vpr, spanning amino acids 15 to 77, is involved in the interaction with UNG. We also demonstrate by in vitro experiments that the enzymatic activity of UNG is retained upon interaction with Vpr. PMID:8551605

  8. Thymine DNA Glycosylase Is Essential for Active DNA Demethylation by Linked Deamination-Base Excision Repair

    PubMed Central

    Cortellino, Salvatore; Xu, Jinfei; Sannai, Mara; Moore, Robert; Caretti, Elena; Cigliano, Antonio; Le Coz, Madeleine; Devarajan, Karthik; Wessels, Andy; Soprano, Dianne; Abramowitz, Lara K.; Bartolomei, Marisa S.; Rambow, Florian; Bassi, Maria Rosaria; Bruno, Tiziana; Fanciulli, Maurizio; Renner, Catherine; Klein-Szanto, Andres J.; Matsumoto, Yoshihiro; Kobi, Dominique; Davidson, Irwin; Alberti, Christophe; Larue, Lionel; Bellacosa, Alfonso

    2011-01-01

    Summary DNA methylation is a major epigenetic mechanism for gene silencing. While methyltransferases mediate cytosine methylation, it is less clear how unmethylated regions in mammalian genomes are protected from de novo methylation and whether an active demethylating activity is involved. Here we show that either knockout or catalytic inactivation of the DNA repair enzyme Thymine DNA Glycosylase (TDG) leads to embryonic lethality in mice. TDG is necessary for recruiting p300 to retinoic acid (RA)-regulated promoters, protection of CpG islands from hypermethylation, and active demethylation of tissue-specific, developmentally- and hormonally-regulated promoters and enhancers. TDG interacts with the deaminase AID and the damage-response protein GADD45a. These findings highlight a dual role for TDG in promoting proper epigenetic states during development and suggest a two-step mechanism for DNA demethylation in mammals, whereby 5-methylcytosine and 5-hydroxymethylcytosine are first deaminated by AID to thymine and 5-hydroxymethyluracil, respectively, followed by TDG-mediated thymine and 5-hydroxymethyluracil excision repair. PMID:21722948

  9. Zinc finger oxidation of Fpg/Nei DNA glycosylases by 2-thioxanthine: biochemical and X-ray structural characterization

    PubMed Central

    Biela, Artur; Coste, Franck; Culard, Françoise; Guerin, Martine; Goffinont, Stéphane; Gasteiger, Karola; Cieśla, Jarosław; Winczura, Alicja; Kazimierczuk, Zygmunt; Gasparutto, Didier; Carell, Thomas; Tudek, Barbara; Castaing, Bertrand

    2014-01-01

    DNA glycosylases from the Fpg/Nei structural superfamily are base excision repair enzymes involved in the removal of a wide variety of mutagen and potentially lethal oxidized purines and pyrimidines. Although involved in genome stability, the recent discovery of synthetic lethal relationships between DNA glycosylases and other pathways highlights the potential of DNA glycosylase inhibitors for future medicinal chemistry development in cancer therapy. By combining biochemical and structural approaches, the physical target of 2-thioxanthine (2TX), an uncompetitive inhibitor of Fpg, was identified. 2TX interacts with the zinc finger (ZnF) DNA binding domain of the enzyme. This explains why the zincless hNEIL1 enzyme is resistant to 2TX. Crystal structures of the enzyme bound to DNA in the presence of 2TX demonstrate that the inhibitor chemically reacts with cysteine thiolates of ZnF and induces the loss of zinc. The molecular mechanism by which 2TX inhibits Fpg may be generalized to all prokaryote and eukaryote ZnF-containing Fpg/Nei-DNA glycosylases. Cell experiments show that 2TX can operate in cellulo on the human Fpg/Nei DNA glycosylases. The atomic elucidation of the determinants for the interaction of 2TX to Fpg provides the foundation for the future design and synthesis of new inhibitors with high efficiency and selectivity. PMID:25143530

  10. Uncoupling of nucleotide flipping and DNA bending by the t4 pyrimidine dimer DNA glycosylase.

    PubMed

    Walker, Randall K; McCullough, Amanda K; Lloyd, R Stephen

    2006-11-28

    Bacteriophage T4 pyrimidine dimer glycosylase (T4-Pdg) is a base excision repair protein that incises DNA at cyclobutane pyrimidine dimers that are formed as a consequence of exposure to ultraviolet light. Cocrystallization of T4-Pdg with substrate DNA has shown that the adenosine opposite the 5'-thymine of a thymine-thymine (TT) dimer is flipped into an extrahelical conformation and that the DNA backbone is kinked 60 degrees in the enzyme-substrate (ES) complex. To examine the kinetic details of the precatalytic events in the T4-Pdg reaction mechanism, investigations were designed to separately assess nucleotide flipping and DNA bending. The fluorescent adenine base analogue, 2-aminopurine (2-AP), placed opposite an abasic site analogue, tetrahydrofuran, exhibited a 2.8-fold increase in emission intensity when flipped in the ES complex. Using the 2-AP fluorescence signal for nucleotide flipping, kon and koff pre-steady-state kinetic measurements were determined. DNA bending was assessed by fluorescence resonance energy transfer using fluorescent donor-acceptor pairs located at the 5'-ends of oligonucleotides in duplex DNA. The fluorescence intensity of the donor fluorophore was quenched by 15% in the ES complex as a result of an increased efficiency of energy transfer between the labeled ends of the DNA in the bent conformation. Kinetic analyses of the bending signal revealed an off rate that was 2.5-fold faster than the off rate for nucleotide flipping. These results demonstrate that the nucleotide flipping step can be uncoupled from the bending of DNA in the formation of an ES complex.

  11. Induction of NEIL1 and NEIL2 DNA glycosylases in aniline-induced splenic toxicity

    SciTech Connect

    Ma Huaxian; Wang Jianling; Abdel-Rahman, Sherif Z.; Hazra, Tapas K.; Boor, Paul J.; Khan, M. Firoze

    2011-02-15

    The mechanisms by which aniline exposure elicits splenotoxic response, especially the tumorigenic response, are not well-understood. Earlier, we have shown that aniline-induced oxidative stress is associated with increased oxidative DNA damage in rat spleen. The base excision repair (BER) pathway is the major mechanism for the repair of oxidative DNA base lesions, and we have shown an up-regulation of 8-oxoguanine glycosylase 1 (OGG1), a specific DNA glycosylase involved in the removal of 8-hydroxy-2'-deoxyguanosine (8-OHdG) adducts, following aniline exposure. Nei-like DNA glycosylases (NEIL1/2) belong to a family of BER proteins that are distinct from other DNA glycosylases, including OGG1. However, contribution of NEIL1/2 in the repair of aniline-induced oxidative DNA damage in the spleen is not known. This study was, therefore, focused on evaluating if NEILs also contribute to the repair of oxidative DNA lesions in the spleen following aniline exposure. To achieve that, male SD rats were subchronically exposed to aniline (0.5 mmol/kg/day via drinking water for 30 days), while controls received drinking water only. The BER activity of NEIL1/2 was assayed using a bubble structure substrate containing 5-OHU (preferred substrates for NEIL1 and NEIL2) and by quantitating the cleavage products. Aniline treatment led to a 1.25-fold increase in the NEIL1/2-associated BER activity in the nuclear extracts of spleen compared to the controls. Real-time PCR analysis for NEIL1 and NEIL2 mRNA expression in the spleen revealed 2.7- and 3.9-fold increases, respectively, in aniline-treated rats compared to controls. Likewise, Western blot analysis showed that protein expression of NEIL1 and NEIL2 in the nuclear extract of spleens from aniline-treated rats was 2.0- and 3.8-fold higher than controls, respectively. Aniline treatment also led to stronger immunoreactivity for NEIL1 and NEIL2 in the spleens, confined to the red pulp areas. These studies, thus, show that aniline

  12. Induction of NEIL1 and NEIL2 DNA glycosylases in aniline-induced splenic toxicity.

    PubMed

    Ma, Huaxian; Wang, Jianling; Abdel-Rahman, Sherif Z; Hazra, Tapas K; Boor, Paul J; Khan, M Firoze

    2011-02-15

    The mechanisms by which aniline exposure elicits splenotoxic response, especially the tumorigenic response, are not well-understood. Earlier, we have shown that aniline-induced oxidative stress is associated with increased oxidative DNA damage in rat spleen. The base excision repair (BER) pathway is the major mechanism for the repair of oxidative DNA base lesions, and we have shown an up-regulation of 8-oxoguanine glycosylase 1 (OGG1), a specific DNA glycosylase involved in the removal of 8-hydroxy-2'-deoxyguanosine (8-OHdG) adducts, following aniline exposure. Nei-like DNA glycosylases (NEIL1/2) belong to a family of BER proteins that are distinct from other DNA glycosylases, including OGG1. However, contribution of NEIL1/2 in the repair of aniline-induced oxidative DNA damage in the spleen is not known. This study was, therefore, focused on evaluating if NEILs also contribute to the repair of oxidative DNA lesions in the spleen following aniline exposure. To achieve that, male SD rats were subchronically exposed to aniline (0.5 mmol/kg/day via drinking water for 30 days), while controls received drinking water only. The BER activity of NEIL1/2 was assayed using a bubble structure substrate containing 5-OHU (preferred substrates for NEIL1 and NEIL2) and by quantitating the cleavage products. Aniline treatment led to a 1.25-fold increase in the NEIL1/2-associated BER activity in the nuclear extracts of spleen compared to the controls. Real-time PCR analysis for NEIL1 and NEIL2 mRNA expression in the spleen revealed 2.7- and 3.9-fold increases, respectively, in aniline-treated rats compared to controls. Likewise, Western blot analysis showed that protein expression of NEIL1 and NEIL2 in the nuclear extract of spleens from aniline-treated rats was 2.0- and 3.8-fold higher than controls, respectively. Aniline treatment also led to stronger immunoreactivity for NEIL1 and NEIL2 in the spleens, confined to the red pulp areas. These studies, thus, show that aniline

  13. Induction of NEIL1 and NEIL2 DNA glycosylases in aniline-induced splenic toxicity

    PubMed Central

    Ma, Huaxian; Wang, Jianling; Abdel-Rahman, Sherif Z.; Hazra, Tapas K.; Boor, Paul J.; Khan, M. Firoze

    2011-01-01

    The mechanisms by which aniline exposure elicits splenotoxic response, especially the tumorigenic response, are not well-understood. Earlier, we have shown that aniline-induced oxidative stress is associated with increased oxidative DNA damage in rat spleen. The base excision repair (BER) pathway is the major mechanism for the repair of oxidative DNA base lesions, and we have shown an up-regulation of 8-oxoguanine glycosylase 1 (OGG1), a specific DNA glycosylase involved in the removal of 8-hydroxy-2′-deoxyguanosine (8-OHdG) adducts, following aniline exposure. Nei-like DNA glycosylases (NEIL1/2) belong to a family of BER proteins that are distinct from other DNA glycosylases, including OGG1. However, contribution of NEIL1/2 in the repair of aniline-induced oxidative DNA damage in the spleen is not known. This study was, therefore, focused on evaluating if NEILs also contribute to the repair of oxidative DNA lesions in the spleen following aniline exposure. To achieve that, male SD rats were subchronically exposed to aniline (0.5 mmol/kg/day via drinking water for 30 days), while controls received drinking water only. The BER activity of NEIL1/2 was assayed using a bubble structure substrate containing 5-OHU (preferred substrates for NEIL1 and NEIL2) and by quantitating the cleavage products. Aniline treatment led to a 1.25-fold increase in the NEIL1/2-associated BER activity in the nuclear extracts of spleen compared to the controls. Real-time PCR analysis for NEIL1 and NEIL2 mRNA expression in the spleen revealed 2.7- and 3.9-fold increases, respectively, in aniline-treated rats compared to controls. Likewise, Western blot analysis showed that protein expression of NEIL1 and NEIL2 in the nuclear extract of spleens from aniline-treated rats was 2.0- and 3.8-fold higher than controls, respectively. Aniline treatment also led to stronger immunoreactivity for NEIL1 and NEIL2 in the spleens, confined to the red pulp areas. These studies, thus, show that aniline

  14. DENV gene of bacteriophage T4 codes for both pyrimidine dimer-DNA glycosylase and apyrimidinic endonuclease activities

    SciTech Connect

    McMillan, S.; Edenberg, H.J.; Radany, E.H.; Friedberg, R.C.; Friedberg, E.C.

    1981-10-01

    Recent studies have shown that purified preparations of phage T4 UV DNA-incising activity (T4 UV endonuclease or endonuclease V of phase T4) contain a pyrimidine dimer-DNA glycosylase activity that catalyzes hydrolysis of the 5' glycosyl bond of dimerized pyrimidines in UV-irradiated DNA. Such enzyme preparations have also been shown to catalyze the hydrolysis of phosphodiester bonds in UV-irradiated DNA at a neutral pH, presumably reflecting the action of an apurinic/apyrimidinic endonuclease at the apyrimidinic sites created by the pyrimidine dimer-DNA glycosylase. In this study we found that preparations of T4 UV DNA-incising activity contained apurinic/apyrimidinic endonuclease activity that nicked depurinated form I simian virus 40 DNA. Apurinic/apyrimidinic endonuclease activity was also found in extracts of Escherichia coli infected with T4 denV/sup +/ phage. Extracts of cells infected with T4 denV mutants contained significantly lower levels of apurinic/apyrimidinic endonuclease activity; these levels were no greater than the levels present in extracts of uninfected cells. Furthermore, the addition of DNA containing UV-irradiated DNA and T4 enzyme resulted in competition for pyrimidine dimer-DNA glycosylase activity against the UV-irradiated DNA. On the basis of these results, we concluded that apurinic/apyrimidinic endonuclease activity is encoded by the denV gene of phage T4, the same gene that codes for pyrimidine dimer-DNA glycosylase activity.

  15. Excision of uracil residues in DNA: mechanism of action of Escherichia coli and Micrococcus luteus uracil-DNA glycosylases.

    PubMed Central

    Delort, A M; Duplaa, A M; Molko, D; Teoule, R; Leblanc, J P; Laval, J

    1985-01-01

    Various octadeoxynucleotides containing uracil at different positions were synthesized and submitted to the action of Escherichia coli and Micrococcus luteus uracil-DNA glycosylases. A uracil residue situated at the 5'-end was excised by the M.luteus enzyme but not by the E.coli one. Uracil residues located at the ultimate and penultimate positions at the 3'-end were not cleaved by either enzymes. At the other central positions, uracil was eliminated with different initial velocities. Single stranded phi X 174 DNA fragments were used to study the influence of the sequence. Cytosine bases were deaminated to give uracil by bisulfite treatment. It was shown that the initial excision velocity of two vicinal uracil residues was decreased. The same observation was made for two uracils separated by one base. A hypothetical scheme is suggested to explain the mechanism of action of uracil-DNA glycosylases. Images PMID:3889834

  16. Altered expression of the DNA repair protein, N-methylpurine-DNA glycosylase (MPG) in human gonads.

    PubMed

    Kim, Nam Keun; An, Hee Jung; Kim, Hyun Joo; Sohn, Tae Jong; Roy, Rabindra; Oh, Doyeun; Ahn, Jung Yong; Hwang, Tae Sun; Cha, Kwang Yul

    2002-01-01

    The multifunctional mammalian MPG is responsible for a damaged DNA base in the nucleus. The DNA repair enzyme is transported from the cytoplasm to nucleus to repair the DNA base when it is damaged. If the enzyme does not work properly, the damaged DNA may lead to carcinogenesis, cell death, aging or infertility. This study was performed to determine mRNA expression and intracellular localization of the DNA repair protein, N-methylpurine-DNA glycosylase (MPG), in human ovary and testicular tissues, particularly in epithelial ovarian tumor and spermatogenic (maturation) arrest infertile patients, by RT-PCR and immunohistochemical staining using human MPG monoclonal antibody. MPG mRNA expression in epithelial ovarian tumor and spermatogenic arrest testis tissues was slightly higher than in normal ovarian and testicular tissues, respectively. The present study demonstrated new and unexpected patterns of cellular and subcellular localization of this enzyme. In a normal ovary, immunostaining for MPG was observed in the nucleus of oocyte, granulosa and stromal cells. MPG was stained mostly in the nucleus and faintly-stained in the cytoplasm of normal coelomic epithelium as well as in benign epithelial ovarian tumors. However, the MPG expression of the nucleus in malignant epithelial tumors, both serous and mucinous type, disappeared. The spermatocyte and Leydig cells in normal testis were immunostained only in the cytoplasm. The spermatocyte and Leydig cells in spermatogenic arrest testis tissues showed up both in the nucleus and cytoplasm. The subcellular localization of MPG in the tissues tested was heterogeneous, while the altered MPG expression was found in ovarian tumor and spermatogenic arrest testis. These results suggest MPG's role in human gonadal tissues and raise the possibility that the altered mRNA level and intracellular localization could be associated with ovarian tumorigenesis and male infertility.

  17. The novel DNA glycosylase, NEIL1, protects mammalian cells from radiation-mediated cell death.

    PubMed

    Rosenquist, Thomas A; Zaika, Elena; Fernandes, Andrea S; Zharkov, Dmitry O; Miller, Holly; Grollman, Arthur P

    2003-05-13

    DNA damage mediated by reactive oxygen species generates miscoding and blocking lesions that may lead to mutations or cell death. Base excision repair (BER) constitutes a universal mechanism for removing oxidatively damaged bases and restoring the integrity of genomic DNA. In Escherichia coli, the DNA glycosylases Nei, Fpg, and Nth initiate BER of oxidative lesions; OGG1 and NTH1 proteins fulfill a similar function in mammalian cells. Three human genes, designated NEIL1, NEIL2 and NEIL3, encode proteins that contain sequence homologies to Nei and Fpg. We have cloned the corresponding mouse genes and have overexpressed and purified mNeil1, a DNA glycosylase that efficiently removes a wide spectrum of mutagenic and cytotoxic DNA lesions. These lesions include the two cis-thymineglycol(Tg) stereoisomers, guanine- and adenine-derived formamidopyrimidines, and 5,6-dihydrouracil. Two of these lesions, fapyA and 5S,6R thymine glycol, are not excised by mOgg1 or mNth1. We have also used RNA interference technology to establish embryonic stem cell lines deficient in Neil1 protein and showed them to be sensitive to low levels of gamma-irradiation. The results of these studies suggest that Neil1 is an essential component of base excision repair in mammalian cells; its presence may contribute to the redundant repair capacity observed in Ogg1 -/- and Nth1 -/- mice.

  18. Listeria monocytogenes DNA Glycosylase AdlP Affects Flagellar Motility, Biofilm Formation, Virulence, and Stress Responses

    PubMed Central

    Zhang, Ting; Bae, Dongryeoul

    2016-01-01

    ABSTRACT The temperature-dependent alteration of flagellar motility gene expression is critical for the foodborne pathogen Listeria monocytogenes to respond to a changing environment. In this study, a genetic determinant, L. monocytogenes f2365_0220 (lmof2365_0220), encoding a putative protein that is structurally similar to the Bacillus cereus alkyl base DNA glycosylase (AlkD), was identified. This determinant was involved in the transcriptional repression of flagellar motility genes and was named adlP (encoding an AlkD-like protein [AdlP]). Deletion of adlP activated the expression of flagellar motility genes at 37°C and disrupted the temperature-dependent inhibition of L. monocytogenes motility. The adlP null strains demonstrated decreased survival in murine macrophage-like RAW264.7 cells and less virulence in mice. Furthermore, the deletion of adlP significantly decreased biofilm formation and impaired the survival of bacteria under several stress conditions, including the presence of a DNA alkylation compound (methyl methanesulfonate), an oxidative agent (H2O2), and aminoglycoside antibiotics. Our findings strongly suggest that adlP may encode a bifunctional protein that transcriptionally represses the expression of flagellar motility genes and influences stress responses through its DNA glycosylase activity. IMPORTANCE We discovered a novel protein that we named AlkD-like protein (AdlP). This protein affected flagellar motility, biofilm formation, and virulence. Our data suggest that AdlP may be a bifunctional protein that represses flagellar motility genes and influences stress responses through its DNA glycosylase activity. PMID:27316964

  19. Expression of the DNA repair enzyme, N-methylpurine-DNA glycosylase (MPG) in astrocytic tumors.

    PubMed

    Kim, Nam Keun; Ahn, Jung Yong; Song, Jihwan; Kim, Jin Kyeoung; Han, Jin Hee; An, Hee Jung; Chung, Hyung Min; Joo, Jin Yang; Choi, Joong Uhn; Lee, Kyu Sung; Roy, Rabindra; Oh, Doyeun

    2003-01-01

    DNA is continuously damaged due to exposure to alkylating compounds or oxygen free radicals generated during normal cellular metabolism as well as to environmental mutagens. Several studies have shown that N-methylpurine-DNA-glycosylase (MPG) mRNA levels were lower in adult brain than in other tissues. Terminally differentiated and nonproliferating cells have a lower DNA repair capacity than proliferating cells from various organs, embryo, ovary and testis. If the DNA repair are not efficient, the damaged DNA may lead to tumorigenesis or cell death. This study was designed to investigate the association of tumorigenesis with MPG in astrocytic tumors. MPG mRNA expression and localization in astrocytic tumors and tumor-adjacent brain tissues was examined by reverse transcriptase-polymerase chain reaction (RT-PCR) and RNA in situ hybridization. The expression and intracellular localization of MPG protein was determined by immunohistochemistry. MPG mRNA expression in RT-PCR was slightly higher in astrocytic tumor tissues than in brain tissues adjacent to tumor and in astrocytic tumor tissues, regardless of the tumor grades. MPG protein localization in immunohistochemical study was detected only in the nucleus of all tumor tissues. Interestingly, in brain tissues adjacent to tumor, immunohistochemical staining for MPG was not observed either in the nucleus or the cytoplasm. However, we could not detect MPG protein in the brain tissues adjacent to the tumor although MPG mRNA was detected in the tissues. These results suggest an MPG's role in human astrocytic tumors and raise the possibility that the altered MPG expression and intracellular localization could be associated with astrocytic tumorigenesis.

  20. Cadmium(II) inhibition of human uracil-DNA glycosylase by catalytic water supplantation

    NASA Astrophysics Data System (ADS)

    Gokey, Trevor; Hang, Bo; Guliaev, Anton B.

    2016-12-01

    Toxic metals are known to inhibit DNA repair but the underlying mechanisms of inhibition are still not fully understood. DNA repair enzymes such as human uracil-DNA glycosylase (hUNG) perform the initial step in the base excision repair (BER) pathway. In this work, we showed that cadmium [Cd(II)], a known human carcinogen, inhibited all activity of hUNG at 100 μM. Computational analyses based on 2 μs equilibrium, 1.6 μs steered molecular dynamics (SMD), and QM/MM MD determined that Cd(II) ions entered the enzyme active site and formed close contacts with both D145 and H148, effectively replacing the catalytic water normally found in this position. Geometry refinement by density functional theory (DFT) calculations showed that Cd(II) formed a tetrahedral structure with D145, P146, H148, and one water molecule. This work for the first time reports Cd(II) inhibition of hUNG which was due to replacement of the catalytic water by binding the active site D145 and H148 residues. Comparison of the proposed metal binding site to existing structural data showed that D145:H148 followed a general metal binding motif favored by Cd(II). The identified motif offered structural insights into metal inhibition of other DNA repair enzymes and glycosylases.

  1. Active destabilization of base pairs by a DNA glycosylase wedge initiates damage recognition.

    PubMed

    Kuznetsov, Nikita A; Bergonzo, Christina; Campbell, Arthur J; Li, Haoquan; Mechetin, Grigory V; de los Santos, Carlos; Grollman, Arthur P; Fedorova, Olga S; Zharkov, Dmitry O; Simmerling, Carlos

    2015-01-01

    Formamidopyrimidine-DNA glycosylase (Fpg) excises 8-oxoguanine (oxoG) from DNA but ignores normal guanine. We combined molecular dynamics simulation and stopped-flow kinetics with fluorescence detection to track the events in the recognition of oxoG by Fpg and its mutants with a key phenylalanine residue, which intercalates next to the damaged base, changed to either alanine (F110A) or fluorescent reporter tryptophan (F110W). Guanine was sampled by Fpg, as evident from the F110W stopped-flow traces, but less extensively than oxoG. The wedgeless F110A enzyme could bend DNA but failed to proceed further in oxoG recognition. Modeling of the base eversion with energy decomposition suggested that the wedge destabilizes the intrahelical base primarily through buckling both surrounding base pairs. Replacement of oxoG with abasic (AP) site rescued the activity, and calculations suggested that wedge insertion is not required for AP site destabilization and eversion. Our results suggest that Fpg, and possibly other DNA glycosylases, convert part of the binding energy into active destabilization of their substrates, using the energy differences between normal and damaged bases for fast substrate discrimination.

  2. Cadmium(II) inhibition of human uracil-DNA glycosylase by catalytic water supplantation

    PubMed Central

    Gokey, Trevor; Hang, Bo; Guliaev, Anton B.

    2016-01-01

    Toxic metals are known to inhibit DNA repair but the underlying mechanisms of inhibition are still not fully understood. DNA repair enzymes such as human uracil-DNA glycosylase (hUNG) perform the initial step in the base excision repair (BER) pathway. In this work, we showed that cadmium [Cd(II)], a known human carcinogen, inhibited all activity of hUNG at 100 μM. Computational analyses based on 2 μs equilibrium, 1.6 μs steered molecular dynamics (SMD), and QM/MM MD determined that Cd(II) ions entered the enzyme active site and formed close contacts with both D145 and H148, effectively replacing the catalytic water normally found in this position. Geometry refinement by density functional theory (DFT) calculations showed that Cd(II) formed a tetrahedral structure with D145, P146, H148, and one water molecule. This work for the first time reports Cd(II) inhibition of hUNG which was due to replacement of the catalytic water by binding the active site D145 and H148 residues. Comparison of the proposed metal binding site to existing structural data showed that D145:H148 followed a general metal binding motif favored by Cd(II). The identified motif offered structural insights into metal inhibition of other DNA repair enzymes and glycosylases. PMID:27974818

  3. Search for DNA damage by human alkyladenine DNA glycosylase involves early intercalation by an aromatic residue.

    PubMed

    Hendershot, Jenna M; O'Brien, Patrick J

    2017-09-29

    DNA repair enzymes recognize and remove damaged bases that are embedded in the duplex. To gain access, most enzymes use nucleotide flipping, whereby the target nucleotide is rotated 180° into the active site. In human alkyladenine DNA glycosylase (AAG), the enzyme that initiates base excision repair of alkylated bases, the flipped-out nucleotide is stabilized by intercalation of the side chain of tyrosine 162 that replaces the lesion nucleobase. Previous kinetic studies provided evidence for the formation of a transient complex that precedes the stable flipped-out complex, but it is not clear how this complex differs from nonspecific complexes. We used site-directed mutagenesis and transient-kinetic approaches to investigate the timing of Tyr(162) intercalation for AAG. The tryptophan substitution (Y162W) appeared to be conservative, because the mutant protein retained a highly favorable equilibrium constant for flipping the 1,N(6)-ethenoadenine (ϵA) lesion, and the rate of N-glycosidic bond cleavage was identical to that of the wild-type enzyme. We assigned the tryptophan fluorescence signal from Y162W by removing two native tryptophan residues (W270A/W284A). Stopped-flow experiments then demonstrated that the change in tryptophan fluorescence of the Y162W mutant is extremely rapid upon binding to either damaged or undamaged DNA, much faster than the lesion-recognition and nucleotide flipping steps that were independently determined by monitoring the ϵA fluorescence. These observations suggest that intercalation by this aromatic residue is one of the earliest steps in the search for DNA damage and that this interaction is important for the progression of AAG from nonspecific searching to specific-recognition complexes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Crystal Structure of Human Thymine DNA Glycosylase Bound to DNA Elucidates Sequence-Specific Mismatch Recognition

    SciTech Connect

    Maiti, A.; Morgan, M.T.; Pozharski, E.; Drohat, A.C.

    2009-05-19

    Cytosine methylation at CpG dinucleotides produces m{sup 5}CpG, an epigenetic modification that is important for transcriptional regulation and genomic stability in vertebrate cells. However, m{sup 5}C deamination yields mutagenic G{center_dot}T mispairs, which are implicated in genetic disease, cancer, and aging. Human thymine DNA glycosylase (hTDG) removes T from G{center_dot}T mispairs, producing an abasic (or AP) site, and follow-on base excision repair proteins restore the G{center_dot}C pair. hTDG is inactive against normal A{center_dot}T pairs, and is most effective for G{center_dot}T mispairs and other damage located in a CpG context. The molecular basis of these important catalytic properties has remained unknown. Here, we report a crystal structure of hTDG (catalytic domain, hTDG{sup cat}) in complex with abasic DNA, at 2.8 {angstrom} resolution. Surprisingly, the enzyme crystallized in a 2:1 complex with DNA, one subunit bound at the abasic site, as anticipated, and the other at an undamaged (nonspecific) site. Isothermal titration calorimetry and electrophoretic mobility-shift experiments indicate that hTDG and hTDG{sup cat} can bind abasic DNA with 1:1 or 2:1 stoichiometry. Kinetics experiments show that the 1:1 complex is sufficient for full catalytic (base excision) activity, suggesting that the 2:1 complex, if adopted in vivo, might be important for some other activity of hTDG, perhaps binding interactions with other proteins. Our structure reveals interactions that promote the stringent specificity for guanine versus adenine as the pairing partner of the target base and interactions that likely confer CpG sequence specificity. We find striking differences between hTDG and its prokaryotic ortholog (MUG), despite the relatively high (32%) sequence identity.

  5. Analysis of the tet repressor-operator interactions using the uracil-DNA glycosylase footprinting system

    SciTech Connect

    Devchand, P.R.; McGhee, J.D.; Sande, J.H. Van De

    1994-12-31

    The tet repressor regulated expression of the Tn-10-encoded tetracycline resistance determinant in a tetracycline-dependent manner. In the absence of tetracycline, the tet repressor binds as a dimer to the 19-base-pair palindromic tet operator sequence. Amino acid homologies and genetic studies with trans-dominant mutants suggest that sequence-specific recognition of the tet operator involves the extensively studied helix-turn-helix motif. We have used the uracil-DNA glycosylase (UDG) footprinting systems to identify thymine contacts in the tet operator that are essential for the formation of tet repressor-operator complexes.

  6. Molecular genetic and biochemical analyses of a DNA repair gene from Serratia marcescens

    SciTech Connect

    Murphy, K.E.

    1989-01-01

    In Escherichia coli, the SOS response and two 3-methyladenine DNA glycosylases (TagI and TagII) are required for repair of DNA damaged by alkylating agents such as methyl methanesulfonate (MMS). Mutations of the recA gene eliminate the SOS response. TagI and TagII are encoded by the tag and alkA genes, respectively. A gene (rpr) encoding 3-methyladenine DNA glycosylase activity was isolated from the Gram-negative bacterium Serratia marcescens. The gene, localized to a 1.5-kilobase pair SmaI-HindIII restriction fragment, was cloned into plasmid pUC18. The clone complemented E. coli tag alkA and recA mutations for MMS resistance. The rpr gene did not, however, complement recA mutations for resistance to ultraviolet light or the ability to perform homologous recombination reactions, nor did it complement E. coli ada or alkB mutations. Two proteins of molecular weights 42,000 and 16,000 were produced from the rpr locus. Analysis of deletion and insertion mutants of rpr suggested that the 42kD molecule is the active protein. The 16kD protein may either be a breakdown product of the 42kD species or may be encoded by another gene overlapping the reading frame of the rpr gene. Biochemical assays showed that the rpr gene product (Rpr) possesses 3-methyladenine DNA glycosylase activity.

  7. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization.

  8. Synthesis and Characterization of DNA Minor Groove Binding Alkylating Agents

    PubMed Central

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K.; Mascara, Gerard P.; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W.; Bobola, Michael S.; Silber, John R.; Gold, Barry

    2012-01-01

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases the N-terminus was appended with a O-methyl sulfonate ester while the C-terminus group was varied with non-polar and polar sidechains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) vs. major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is > 10-fold higher than the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells over-expressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  9. Correlated Mutation in the Evolution of Catalysis in Uracil DNA Glycosylase Superfamily

    PubMed Central

    Xia, Bo; Liu, Yinling; Guevara, Jose; Li, Jing; Jilich, Celeste; Yang, Ye; Wang, Liangjiang; Dominy, Brian N.; Cao, Weiguo

    2017-01-01

    Enzymes in Uracil DNA glycosylase (UDG) superfamily are essential for the removal of uracil. Family 4 UDGa is a robust uracil DNA glycosylase that only acts on double-stranded and single-stranded uracil-containing DNA. Based on mutational, kinetic and modeling analyses, a catalytic mechanism involving leaving group stabilization by H155 in motif 2 and water coordination by N89 in motif 3 is proposed. Mutual Information analysis identifies a complexed correlated mutation network including a strong correlation in the EG doublet in motif 1 of family 4 UDGa and in the QD doublet in motif 1 of family 1 UNG. Conversion of EG doublet in family 4 Thermus thermophilus UDGa to QD doublet increases the catalytic efficiency by over one hundred-fold and seventeen-fold over the E41Q and G42D single mutation, respectively, rectifying the strong correlation in the doublet. Molecular dynamics simulations suggest that the correlated mutations in the doublet in motif 1 position the catalytic H155 in motif 2 to stabilize the leaving uracilate anion. The integrated approach has important implications in studying enzyme evolution and protein structure and function. PMID:28397787

  10. Correlated Mutation in the Evolution of Catalysis in Uracil DNA Glycosylase Superfamily.

    PubMed

    Xia, Bo; Liu, Yinling; Guevara, Jose; Li, Jing; Jilich, Celeste; Yang, Ye; Wang, Liangjiang; Dominy, Brian N; Cao, Weiguo

    2017-04-11

    Enzymes in Uracil DNA glycosylase (UDG) superfamily are essential for the removal of uracil. Family 4 UDGa is a robust uracil DNA glycosylase that only acts on double-stranded and single-stranded uracil-containing DNA. Based on mutational, kinetic and modeling analyses, a catalytic mechanism involving leaving group stabilization by H155 in motif 2 and water coordination by N89 in motif 3 is proposed. Mutual Information analysis identifies a complexed correlated mutation network including a strong correlation in the EG doublet in motif 1 of family 4 UDGa and in the QD doublet in motif 1 of family 1 UNG. Conversion of EG doublet in family 4 Thermus thermophilus UDGa to QD doublet increases the catalytic efficiency by over one hundred-fold and seventeen-fold over the E41Q and G42D single mutation, respectively, rectifying the strong correlation in the doublet. Molecular dynamics simulations suggest that the correlated mutations in the doublet in motif 1 position the catalytic H155 in motif 2 to stabilize the leaving uracilate anion. The integrated approach has important implications in studying enzyme evolution and protein structure and function.

  11. Correlated Mutation in the Evolution of Catalysis in Uracil DNA Glycosylase Superfamily

    NASA Astrophysics Data System (ADS)

    Xia, Bo; Liu, Yinling; Guevara, Jose; Li, Jing; Jilich, Celeste; Yang, Ye; Wang, Liangjiang; Dominy, Brian N.; Cao, Weiguo

    2017-04-01

    Enzymes in Uracil DNA glycosylase (UDG) superfamily are essential for the removal of uracil. Family 4 UDGa is a robust uracil DNA glycosylase that only acts on double-stranded and single-stranded uracil-containing DNA. Based on mutational, kinetic and modeling analyses, a catalytic mechanism involving leaving group stabilization by H155 in motif 2 and water coordination by N89 in motif 3 is proposed. Mutual Information analysis identifies a complexed correlated mutation network including a strong correlation in the EG doublet in motif 1 of family 4 UDGa and in the QD doublet in motif 1 of family 1 UNG. Conversion of EG doublet in family 4 Thermus thermophilus UDGa to QD doublet increases the catalytic efficiency by over one hundred-fold and seventeen-fold over the E41Q and G42D single mutation, respectively, rectifying the strong correlation in the doublet. Molecular dynamics simulations suggest that the correlated mutations in the doublet in motif 1 position the catalytic H155 in motif 2 to stabilize the leaving uracilate anion. The integrated approach has important implications in studying enzyme evolution and protein structure and function.

  12. DEMETER and REPRESSOR OF SILENCING 1 encode 5-methylcytosine DNA glycosylases

    PubMed Central

    Morales-Ruiz, Teresa; Ortega-Galisteo, Ana Pilar; Ponferrada-Marín, María Isabel; Martínez-Macías, María Isabel; Ariza, Rafael R.; Roldán-Arjona, Teresa

    2006-01-01

    Cytosine methylation is an epigenetic mark that promotes gene silencing and plays important roles in development and genome defense against transposons. Methylation patterns are established and maintained by DNA methyltransferases that catalyze transfer of a methyl group from S-adenosyl-l-methionine to cytosine bases in DNA. Erasure of cytosine methylation occurs during development, but the enzymatic basis of active demethylation remains controversial. In Arabidopsis thaliana, DEMETER (DME) activates the maternal expression of two imprinted genes silenced by methylation, and REPRESSOR OF SILENCING 1 (ROS1) is required for release of transcriptional silencing of a hypermethylated transgene. DME and ROS1 encode two closely related DNA glycosylase domain proteins, but it is unknown whether they participate directly in a DNA demethylation process or counteract silencing through an indirect effect on chromatin structure. Here we show that DME and ROS1 catalyze the release of 5-methylcytosine (5-meC) from DNA by a glycosylase/lyase mechanism. Both enzymes also remove thymine, but not uracil, mismatched to guanine. DME and ROS1 show a preference for 5-meC over thymine in the symmetric dinucleotide CpG context, where most plant DNA methylation occurs. Nevertheless, they also have significant activity on both substrates at CpApG and asymmetric sequences, which are additional methylation targets in plant genomes. These findings suggest that a function of ROS1 and DME is to initiate erasure of 5-meC through a base excision repair process and provide strong biochemical evidence for the existence of an active DNA demethylation pathway in plants. PMID:16624880

  13. The oxidative DNA glycosylases of Mycobacterium tuberculosis exhibit different substrate preferences from their Escherichia coli counterparts

    PubMed Central

    Guo, Yin; Bandaru, Viswanath; Jaruga, Pawel; Zhao, Xiaobei; Burrows, Cynthia J.; Iwai, Shigenori; Dizdaroglu, Miral; Bond, Jeffrey P.; Wallace, Susan S.

    2010-01-01

    The DNA glycosylases that remove oxidized DNA bases fall into two general families: the Fpg/Nei family and the Nth superfamily. Based on protein sequence alignments, we identified four putative Fpg/Nei family members, as well as a putative Nth protein in Mycobacterium tuberculosis H37Rv. All four Fpg/Nei proteins were successfully overexpressed using a bicistronic vector created in our laboratory. The MtuNth protein was also overexpressed in soluble form. The substrate specificities of the purified enzymes were characterized in vitro with oligodeoxynucleotide substrates containing single lesions. Some were further characterized by gas chromatography/mass spectrometry (GC/MS) analysis of products released from γ-irradiated DNA. MtuFpg1 has a substrate specificity similar to that of EcoFpg. Both EcoFpg and MtuFpg1 are more efficient at removing spiroiminodihydantoin (Sp) than 7,8-dihydro-8-oxoguanine (8-oxoG). However, MtuFpg1 shows a substantially increased opposite base discrimination compared to EcoFpg. MtuFpg2 contains only the C-terminal domain of an Fpg protein and has no detectable DNA binding activity or DNA glycosylase/lyase activity and thus appears to be a pseudogene. MtuNei1 recognizes oxidized pyrimidines on both double-stranded and single-stranded DNA and exhibits uracil DNA glycosylase activity. MtuNth recognizes a variety of oxidized bases, including urea, 5,6-dihydrouracil (DHU), 5-hydroxyuracil (5-OHU), 5-hydroxycytosine (5-OHC) and methylhydantoin (MeHyd). Both MtuNei1 and MtuNth excise thymine glycol (Tg); however, MtuNei1 strongly prefers the (5R) isomers, whereas MtuNth recognizes only the (5S) isomers. MtuNei2 did not demonstrate activity in vitro as a recombinant protein, but like MtuNei1 when expressed in Escherichia coli, it decreased the spontaneous mutation frequency of both the fpg mutY nei triple and nei nth double mutants, suggesting that MtuNei2 is functionally active in vivo recognizing both guanine and cytosine oxidation products

  14. Protein X of Hepatitis B Virus: Origin and Structure Similarity with the Central Domain of DNA Glycosylase

    PubMed Central

    van Hemert, Formijn J.; van de Klundert, Maarten A. A.; Lukashov, Vladimir V.; Kootstra, Neeltje A.; Berkhout, Ben; Zaaijer, Hans L.

    2011-01-01

    Orthohepadnavirus (mammalian hosts) and avihepadnavirus (avian hosts) constitute the family of Hepadnaviridae and differ by their capability and inability for expression of protein X, respectively. Origin and functions of X are unclear. The evolutionary analysis at issue of X indicates that present strains of orthohepadnavirus started to diverge about 25,000 years ago, simultaneously with the onset of avihepadnavirus diversification. These evolutionary events were preceded by a much longer period during which orthohepadnavirus developed a functional protein X while avihepadnavirus evolved without X. An in silico generated 3D-model of orthohepadnaviral X protein displayed considerable similarity to the tertiary structure of DNA glycosylases (key enzymes of base excision DNA repair pathways). Similarity is confined to the central domain of MUG proteins with the typical DNA-binding facilities but without the capability of DNA glycosylase enzymatic activity. The hypothetical translation product of a vestigial X reading frame in the genome of duck hepadnavirus could also been folded into a DNA glycosylase-like 3D-structure. In conclusion, the most recent common ancestor of ortho- and avihepadnavirus carried an X sequence with orthology to the central domain of DNA glycosylase. PMID:21850270

  15. DEMETER DNA glycosylase establishes MEDEA polycomb gene self-imprinting by allele-specific demethylation.

    PubMed

    Gehring, Mary; Huh, Jin Hoe; Hsieh, Tzung-Fu; Penterman, Jon; Choi, Yeonhee; Harada, John J; Goldberg, Robert B; Fischer, Robert L

    2006-02-10

    MEDEA (MEA) is an Arabidopsis Polycomb group gene that is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. Here we show that DME is responsible for endosperm maternal-allele-specific hypomethylation at the MEA gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. Abasic sites opposite 5-methylcytosine inhibit DME activity and might prevent DME from generating double-stranded DNA breaks. Unexpectedly, paternal-allele silencing is not controlled by DNA methylation. Rather, Polycomb group proteins that are expressed from the maternal genome, including MEA, control paternal MEA silencing. Thus, DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. MEA imprinting is subsequently maintained in the endosperm by maternal MEA silencing the paternal allele.

  16. Structural basis of damage recognition by thymine DNA glycosylase: Key roles for N-terminal residues

    PubMed Central

    Coey, Christopher T.; Malik, Shuja S.; Pidugu, Lakshmi S.; Varney, Kristen M.; Pozharski, Edwin; Drohat, Alexander C.

    2016-01-01

    Thymine DNA Glycosylase (TDG) is a base excision repair enzyme functioning in DNA repair and epigenetic regulation. TDG removes thymine from mutagenic G·T mispairs arising from deamination of 5-methylcytosine (mC), and it processes other deamination-derived lesions including uracil (U). Essential for DNA demethylation, TDG excises 5-formylcytosine and 5-carboxylcytosine, derivatives of mC generated by Tet (ten-eleven translocation) enzymes. Here, we report structural and functional studies of TDG82-308, a new construct containing 29 more N-terminal residues than TDG111-308, the construct used for previous structures of DNA-bound TDG. Crystal structures and NMR experiments demonstrate that most of these N-terminal residues are disordered, for substrate- or product-bound TDG82-308. Nevertheless, G·T substrate affinity and glycosylase activity of TDG82-308 greatly exceeds that of TDG111-308 and is equivalent to full-length TDG. We report the first high-resolution structures of TDG in an enzyme-substrate complex, for G·U bound to TDG82-308 (1.54 Å) and TDG111-308 (1.71 Å), revealing new enzyme-substrate contacts, direct and water-mediated. We also report a structure of the TDG82-308 product complex (1.70 Å). TDG82-308 forms unique enzyme–DNA interactions, supporting its value for structure-function studies. The results advance understanding of how TDG recognizes and removes modified bases from DNA, particularly those resulting from deamination. PMID:27580719

  17. Tetrameric structure of the restriction DNA glycosylase R.PabI in complex with nonspecific double-stranded DNA

    PubMed Central

    Wang, Delong; Miyazono, Ken-ichi; Tanokura, Masaru

    2016-01-01

    R.PabI is a type II restriction enzyme that recognizes the 5′-GTAC-3′ sequence and belongs to the HALFPIPE superfamily. Although most restriction enzymes cleave phosphodiester bonds at specific sites by hydrolysis, R.PabI flips the guanine and adenine bases of the recognition sequence out of the DNA helix and hydrolyzes the N-glycosidic bond of the flipped adenine in a similar manner to DNA glycosylases. In this study, we determined the structure of R.PabI in complex with double-stranded DNA without the R.PabI recognition sequence by X-ray crystallography. The 1.9 Å resolution structure of the complex showed that R.PabI forms a tetrameric structure to sandwich the double-stranded DNA and the tetrameric structure is stabilized by four salt bridges. DNA binding and DNA glycosylase assays of the R.PabI mutants showed that the residues that form the salt bridges (R70 and D71) are essential for R.PabI to find the recognition sequence from the sea of nonspecific sequences. R.PabI is predicted to utilize the tetrameric structure to bind nonspecific double-stranded DNA weakly and slide along it to find the recognition sequence. PMID:27731370

  18. Mechanism of translocation of uracil-DNA glycosylase from Escherichia coli between distributed lesions.

    PubMed

    Mechetin, Grigory V; Zharkov, Dmitry O

    2011-10-22

    Uracil-DNA glycosylase (Ung) is a DNA repair enzyme that excises uracil bases from DNA, where they appear through deamination of cytosine or incorporation from a cellular dUTP pool. DNA repair enzymes often use one-dimensional diffusion along DNA to accelerate target search; however, this mechanism remains poorly investigated mechanistically. We used oligonucleotide substrates containing two uracil residues in defined positions to characterize one-dimensional search of DNA by Escherichia coli Ung. Mg(2+) ions suppressed the search in double-stranded DNA to a higher extent than K(+) likely due to tight binding of Mg(2+) to DNA phosphates. Ung was able to efficiently overcome short single-stranded gaps within double-stranded DNA. Varying the distance between the lesions and fitting the data to a theoretical model of DNA random walk, we estimated the characteristic one-dimensional search distance of ~100 nucleotides and translocation rate constant of ~2×10(6) s(-1). Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Characterization of a Thermostable 8-Oxoguanine DNA Glycosylase Specific for GO/N Mismatches from the Thermoacidophilic Archaeon Thermoplasma volcanium

    PubMed Central

    Fujii, Miki; Hata, Chieri; Ukita, Munetada; Fukushima, Chie; Matsuura, Chihiro; Kawashima-Ohya, Yoshie; Tomobe, Koji

    2016-01-01

    The oxidation of guanine (G) to 7,8-dihydro-8-oxoguanine (GO) forms one of the major DNA lesions generated by reactive oxygen species (ROS). The GO can be corrected by GO DNA glycosylases (Ogg), enzymes involved in base excision repair (BER). Unrepaired GO induces mismatched base pairing with adenine (A); as a result, the mismatch causes a point mutation, from G paired with cytosine (C) to thymine (T) paired with adenine (A), during DNA replication. Here, we report the characterization of a putative Ogg from the thermoacidophilic archaeon Thermoplasma volcanium. The 204-amino acid sequence of the putative Ogg (TVG_RS00315) shares significant sequence homology with the DNA glycosylases of Methanocaldococcus jannaschii (MjaOgg) and Sulfolobus solfataricus (SsoOgg). The six histidine-tagged recombinant TVG_RS00315 protein gene was expressed in Escherichia coli and purified. The Ogg protein is thermostable, with optimal activity near a pH of 7.5 and a temperature of 60°C. The enzyme displays DNA glycosylase, and apurinic/apyrimidinic (AP) lyase activities on GO/N (where N is A, T, G, or C) mismatch; yet it cannot eliminate U from U/G or T from T/G, as mismatch glycosylase (MIG) can. These results indicate that TvoOgg-encoding TVG_RS00315 is a member of the Ogg2 family of T. volcanium. PMID:27799846

  20. The nucleoid-associated protein HU enhances 8-oxoguanine base excision by the formamidopyrimidine-DNA glycosylase.

    PubMed

    Le Meur, Rémy; Culard, Françoise; Nadan, Virginie; Goffinont, Stéphane; Coste, Franck; Guerin, Martine; Loth, Karine; Landon, Céline; Castaing, Bertrand

    2015-10-01

    The nucleoid-associated protein HU is involved in numerous DNA transactions and thus is essential in DNA maintenance and bacterial survival. The high affinity of HU for SSBs (single-strand breaks) has suggested its involvement in DNA protection, repair and recombination. SSB-containing DNA are major intermediates transiently generated by bifunctional DNA N-glycosylases that initiate the BER (base excision repair) pathway. Enzyme kinetics and DNA-binding experiments demonstrate that HU enhances the 8-oxoguanine-DNA glycosylase activity of Fpg (formamidopyrimidine-DNA glycosylase) by facilitating the release of the enzyme from its final DNA product (one nucleoside gap). We propose that the displacement of Fpg from its end-DNA product by HU is an active mechanism in which HU recognizes the product when it is still bound by Fpg. Through DNA binding, the two proteins interplay to form a transient ternary complex Fpg/DNA/HU which results in the release of Fpg and the molecular entrapment of SSBs by HU. These results support the involvement of HU in BER in vivo.

  1. Structural Characterization of Human 8-Oxoguanine DNA Glycosylase Variants Bearing Active Site Mutations

    SciTech Connect

    Radom,C.; Banerjee, A.; Verdine, G.

    2007-01-01

    The human 8-oxoguanine DNA glycosylase (hOGG1) protein is responsible for initiating base excision DNA repair of the endogenous mutagen 8-oxoguanine. Like nearly all DNA glycosylases, hOGG1 extrudes its substrate from the DNA helix and inserts it into an extrahelical enzyme active site pocket lined with residues that participate in lesion recognition and catalysis. Structural analysis has been performed on mutant versions of hOGG1 having changes in catalytic residues but not on variants having altered 7,8-dihydro-8-oxoguanine (oxoG) contact residues. Here we report high resolution structural analysis of such recognition variants. We found that Ala substitution at residues that contact the phosphate 5 to the lesion (H270A mutation) and its Watson-Crick face (Q315A mutation) simply removed key functionality from the contact interface but otherwise had no effect on structure. Ala substitution at the only residue making an oxoG-specific contact (G42A mutation) introduced torsional stress into the DNA contact surface of hOGG1, but this was overcome by local interactions within the folded protein, indicating that this oxoG recognition motif is 'hardwired'. Introduction of a side chain intended to sterically obstruct the active site pocket (Q315F mutation) led to two different structures, one of which (Q315F{sup *149}) has the oxoG lesion in an exosite flanking the active site and the other of which (Q315F{sup *292}) has the oxoG inserted nearly completely into the lesion recognition pocket. The latter structure offers a view of the latest stage in the base extrusion pathway yet observed, and its lack of catalytic activity demonstrates that the transition state for displacement of the lesion base is geometrically demanding.

  2. Repair of Alkylation Damage in Eukaryotic Chromatin Depends on Searching Ability of Alkyladenine DNA Glycosylase.

    PubMed

    Zhang, Yaru; O'Brien, Patrick J

    2015-11-20

    Human alkyladenine DNA glycosylase (AAG) initiates the base excision repair pathway by excising alkylated and deaminated purine lesions. In vitro biochemical experiments demonstrate that AAG uses facilitated diffusion to efficiently search DNA to find rare sites of damage and suggest that electrostatic interactions are critical to the searching process. However, it remains an open question whether DNA searching limits the rate of DNA repair in vivo. We constructed AAG mutants with altered searching ability and measured their ability to protect yeast from alkylation damage in order to address this question. Each of the conserved arginine and lysine residues that are near the DNA binding interface were mutated, and the functional impacts were evaluated using kinetic and thermodynamic analysis. These mutations do not perturb catalysis of N-glycosidic bond cleavage, but they decrease the ability to capture rare lesion sites. Nonspecific and specific DNA binding properties are closely correlated, suggesting that the electrostatic interactions observed in the specific recognition complex are similarly important for DNA searching complexes. The ability of the mutant proteins to complement repair-deficient yeast cells is positively correlated with the ability of the proteins to search DNA in vitro, suggesting that cellular resistance to DNA alkylation is governed by the ability to find and efficiently capture cytotoxic lesions. It appears that chromosomal access is not restricted and toxic sites of alkylation damage are readily accessible to a searching protein.

  3. Crystal structure of the Lactococcus lactis formamidopyrimidine-DNA glycosylase bound to an abasic site analogue-containing DNA

    PubMed Central

    Serre, Laurence; Pereira de Jésus, Karine; Boiteux, Serge; Zelwer, Charles; Castaing, Bertrand

    2002-01-01

    The formamidopyrimidine-DNA glycosylase (Fpg, MutM) is a bifunctional base excision repair enzyme (DNA glycosylase/AP lyase) that removes a wide range of oxidized purines, such as 8-oxoguanine and imidazole ring-opened purines, from oxidatively damaged DNA. The structure of a non-covalent complex between the Lactoccocus lactis Fpg and a 1,3-propanediol (Pr) abasic site analogue-containing DNA has been solved. Through an asymmetric interaction along the damaged strand and the intercalation of the triad (M75/R109/F111), Fpg pushes out the Pr site from the DNA double helix, recognizing the cytosine opposite the lesion and inducing a 60° bend of the DNA. The specific recognition of this cytosine provides some structural basis for understanding the divergence between Fpg and its structural homologue endo nuclease VIII towards their substrate specificities. In addition, the modelling of the 8-oxoguanine residue allows us to define an enzyme pocket that may accommodate the extrahelical oxidized base. PMID:12065399

  4. N-Methylpurine DNA Glycosylase and OGG1 DNA Repair Activities: Opposite Associations With Lung Cancer Risk

    PubMed Central

    2012-01-01

    Only a minority of smokers develop lung cancer, possibly due to genetic predisposition, including DNA repair deficiencies. To examine whether inter-individual variations in DNA repair activity of N-methylpurine DNA glycosylase (MPG) are associated with lung cancer, we conducted a blinded, population-based, case–control study with 100 lung cancer case patients and 100 matched control subjects and analyzed the data with conditional logistic regression. All statistical tests were two-sided. MPG enzyme activity in peripheral blood mononuclear cells from case patients was higher than in control subjects, results opposite that of 8-oxoguanine DNA glycosylase (OGG1) DNA repair enzyme activity. For lung cancer associated with one standard deviation increase in MPG activity, the adjusted odds ratio was 1.8 (95% confidence interval [CI] = 1.2 to 2.6; P = .006). A combined MPG and OGG1 activities score was more strongly associated with lung cancer risk than either activity alone, with an odds ratio of 2.3 (95% CI = 1.4 to 3.6; P < .001). These results form a basis for a future panel of risk biomarkers for lung cancer risk assessment and prevention. PMID:23104324

  5. Inhibition of uracil-DNA glycosylase increases SCEs in BrdU-treated and visible light-irradiated cells

    SciTech Connect

    Maldonado, A.; Hernandez, P.; Gutierrez, C.

    1985-11-01

    The authors have approached the study of the ability of different types of lesions produced by DNA-damaging agents to develop sister-chromatid exchanges (SCEs) by analyzing SCE levels observed in Allium cepa L cells with BrdU-substituted DNA and exposed to visible light (VL), an irradiation which produces uracil residues in DNA after debromination of bromouracil and enhances SCE levels but only above a certain dose. They have partially purified an uracil-DNA glycosylase activity from A. cepa L root meristem cells, which removes uracil from DNA, the first step in the excision repair of this lesion. This enzyme was inhibited in vitro by 6-amino-uracil and uracil but not by thymine. When cells exposed to VL, at a dose that did not produce per se an SCE increase, were immediately post-treated with these inhibitors of uracil-DNA glycosylase, a significant increase in SCE levels was obtained. Moreover, SCE levels in irradiated cells dropped to control level when a short holding time elapsed between exposure to VL and the beginning of post-treatment with the inhibitor. Thus, our results showed that inhibitors of uracil-DNA glycosylase enhanced SCE levels in cells with unifilarly BrdU-substituted DNA exposed to visible light; and indicated the existence of a very rapid repair of SCE-inducing lesions produced by visible light irradiation of cells with unifilarly BrdU-containing DNA.

  6. Demethylation initiated by ROS1 glycosylase involves random sliding along DNA

    PubMed Central

    Ponferrada-Marín, María Isabel; Roldán-Arjona, Teresa; Ariza, Rafael R.

    2012-01-01

    Active DNA demethylation processes play a critical role in shaping methylation patterns, yet our understanding of the mechanisms involved is still fragmented and incomplete. REPRESSOR OF SILENCING 1 (ROS1) is a prototype member of a family of plant 5-methylcytosine DNA glycosylases that initiate active DNA demethylation through a base excision repair pathway. As ROS1 binds DNA non-specifically, we have critically tested the hypothesis that facilitated diffusion along DNA may contribute to target location by the enzyme. We have found that dissociation of ROS1 from DNA is severely restricted when access to both ends is obstructed by tetraloops obstacles. Unblocking any end facilitates protein dissociation, suggesting that random surface sliding is the main route to a specific target site. We also found that removal of the basic N-terminal domain of ROS1 significantly impairs the sliding capacity of the protein. Finally, we show that sliding increases the catalytic efficiency of ROS1 on 5-meC:G pairs, but not on T:G mispairs, thus suggesting that the enzyme achieves recognition and excision of its two substrate bases by different means. A model is proposed to explain how ROS1 finds its potential targets on DNA. PMID:23034804

  7. Demethylation initiated by ROS1 glycosylase involves random sliding along DNA.

    PubMed

    Ponferrada-Marín, María Isabel; Roldán-Arjona, Teresa; Ariza, Rafael R

    2012-12-01

    Active DNA demethylation processes play a critical role in shaping methylation patterns, yet our understanding of the mechanisms involved is still fragmented and incomplete. REPRESSOR OF SILENCING 1 (ROS1) is a prototype member of a family of plant 5-methylcytosine DNA glycosylases that initiate active DNA demethylation through a base excision repair pathway. As ROS1 binds DNA non-specifically, we have critically tested the hypothesis that facilitated diffusion along DNA may contribute to target location by the enzyme. We have found that dissociation of ROS1 from DNA is severely restricted when access to both ends is obstructed by tetraloops obstacles. Unblocking any end facilitates protein dissociation, suggesting that random surface sliding is the main route to a specific target site. We also found that removal of the basic N-terminal domain of ROS1 significantly impairs the sliding capacity of the protein. Finally, we show that sliding increases the catalytic efficiency of ROS1 on 5-meC:G pairs, but not on T:G mispairs, thus suggesting that the enzyme achieves recognition and excision of its two substrate bases by different means. A model is proposed to explain how ROS1 finds its potential targets on DNA.

  8. Tetracycline-dependent regulation of formamidopyrimidine DNA glycosylase in transgenic mice conditionally reduces oxidative DNA damage in vivo.

    PubMed

    Laposa, Rebecca R; Henderson, Jeffrey T; Wells, Peter G

    2003-07-01

    8-Oxo-deoxyguanosine (8-oxo-dG) is a pervasive oxidative DNA lesion formed by endogenous oxidative stress and enhanced by drugs and environmental chemicals. This lesion results in transcriptional errors and mutations and is linked to neurodegeneration, teratogenesis, cancer, and other pathologies. We demonstrate that the neonatal central nervous system of transgenic mice carrying the tetracycline-regulable DNA repair gene formamidopyrimidine DNA glycosylase (fpg) has a 50% reduction in 8-oxo-dG levels. This enhanced DNA repair is suppressed by treatment with doxycycline. For the first time, this murine model permits the level of a specific DNA oxidation product to be regulated in a temporally and spatially specific manner, allowing its role as a primary or secondary factor in neurodegenerative disease to be determined in vivo.

  9. The DNA glycosylase AlkD uses a non-base-flipping mechanism to excise bulky lesions

    NASA Astrophysics Data System (ADS)

    Mullins, Elwood A.; Shi, Rongxin; Parsons, Zachary D.; Yuen, Philip K.; David, Sheila S.; Igarashi, Yasuhiro; Eichman, Brandt F.

    2015-11-01

    Threats to genomic integrity arising from DNA damage are mitigated by DNA glycosylases, which initiate the base excision repair pathway by locating and excising aberrant nucleobases. How these enzymes find small modifications within the genome is a current area of intensive research. A hallmark of these and other DNA repair enzymes is their use of base flipping to sequester modified nucleotides from the DNA helix and into an active site pocket. Consequently, base flipping is generally regarded as an essential aspect of lesion recognition and a necessary precursor to base excision. Here we present the first, to our knowledge, DNA glycosylase mechanism that does not require base flipping for either binding or catalysis. Using the DNA glycosylase AlkD from Bacillus cereus, we crystallographically monitored excision of an alkylpurine substrate as a function of time, and reconstructed the steps along the reaction coordinate through structures representing substrate, intermediate and product complexes. Instead of directly interacting with the damaged nucleobase, AlkD recognizes aberrant base pairs through interactions with the phosphoribose backbone, while the lesion remains stacked in the DNA duplex. Quantum mechanical calculations revealed that these contacts include catalytic charge-dipole and CH-π interactions that preferentially stabilize the transition state. We show in vitro and in vivo how this unique means of recognition and catalysis enables AlkD to repair large adducts formed by yatakemycin, a member of the duocarmycin family of antimicrobial natural products exploited in bacterial warfare and chemotherapeutic trials. Bulky adducts of this or any type are not excised by DNA glycosylases that use a traditional base-flipping mechanism. Hence, these findings represent a new model for DNA repair and provide insights into catalysis of base excision.

  10. The DNA glycosylase AlkD uses a non-base-flipping mechanism to excise bulky lesions

    DOE PAGES

    Mullins, Elwood A.; Shi, Rongxin; Parsons, Zachary D.; ...

    2015-10-28

    Threats to genomic integrity arising from DNA damage are mitigated by DNA glycosylases, which initiate the base excision repair pathway by locating and excising aberrant nucleobases. How these enzymes find small modifications within the genome is a current area of intensive research. A hallmark of these and other DNA repair enzymes is their use of base flipping to sequester modified nucleotides from the DNA helix and into an active site pocket. Consequently, base flipping is generally regarded as an essential aspect of lesion recognition and a necessary precursor to base excision. In this paper, we present the first, to ourmore » knowledge, DNA glycosylase mechanism that does not require base flipping for either binding or catalysis. Using the DNA glycosylase AlkD from Bacillus cereus, we crystallographically monitored excision of an alkylpurine substrate as a function of time, and reconstructed the steps along the reaction coordinate through structures representing substrate, intermediate and product complexes. Instead of directly interacting with the damaged nucleobase, AlkD recognizes aberrant base pairs through interactions with the phosphoribose backbone, while the lesion remains stacked in the DNA duplex. Quantum mechanical calculations revealed that these contacts include catalytic charge–dipole and CH–π interactions that preferentially stabilize the transition state. We show in vitro and in vivo how this unique means of recognition and catalysis enables AlkD to repair large adducts formed by yatakemycin, a member of the duocarmycin family of antimicrobial natural products exploited in bacterial warfare and chemotherapeutic trials. Bulky adducts of this or any type are not excised by DNA glycosylases that use a traditional base-flipping mechanism. Finally and hence, these findings represent a new model for DNA repair and provide insights into catalysis of base excision.« less

  11. The DNA glycosylase AlkD uses a non-base-flipping mechanism to excise bulky lesions

    SciTech Connect

    Mullins, Elwood A.; Shi, Rongxin; Parsons, Zachary D.; Yuen, Philip K.; David, Sheila S.; Igarashi, Yasuhiro; Eichman, Brandt F.

    2015-10-28

    Threats to genomic integrity arising from DNA damage are mitigated by DNA glycosylases, which initiate the base excision repair pathway by locating and excising aberrant nucleobases. How these enzymes find small modifications within the genome is a current area of intensive research. A hallmark of these and other DNA repair enzymes is their use of base flipping to sequester modified nucleotides from the DNA helix and into an active site pocket. Consequently, base flipping is generally regarded as an essential aspect of lesion recognition and a necessary precursor to base excision. In this paper, we present the first, to our knowledge, DNA glycosylase mechanism that does not require base flipping for either binding or catalysis. Using the DNA glycosylase AlkD from Bacillus cereus, we crystallographically monitored excision of an alkylpurine substrate as a function of time, and reconstructed the steps along the reaction coordinate through structures representing substrate, intermediate and product complexes. Instead of directly interacting with the damaged nucleobase, AlkD recognizes aberrant base pairs through interactions with the phosphoribose backbone, while the lesion remains stacked in the DNA duplex. Quantum mechanical calculations revealed that these contacts include catalytic charge–dipole and CH–π interactions that preferentially stabilize the transition state. We show in vitro and in vivo how this unique means of recognition and catalysis enables AlkD to repair large adducts formed by yatakemycin, a member of the duocarmycin family of antimicrobial natural products exploited in bacterial warfare and chemotherapeutic trials. Bulky adducts of this or any type are not excised by DNA glycosylases that use a traditional base-flipping mechanism. Finally and hence, these findings represent a new model for DNA repair and provide insights into catalysis of base excision.

  12. The DNA glycosylase AlkD uses a non-base-flipping mechanism to excise bulky lesions.

    PubMed

    Mullins, Elwood A; Shi, Rongxin; Parsons, Zachary D; Yuen, Philip K; David, Sheila S; Igarashi, Yasuhiro; Eichman, Brandt F

    2015-11-12

    Threats to genomic integrity arising from DNA damage are mitigated by DNA glycosylases, which initiate the base excision repair pathway by locating and excising aberrant nucleobases. How these enzymes find small modifications within the genome is a current area of intensive research. A hallmark of these and other DNA repair enzymes is their use of base flipping to sequester modified nucleotides from the DNA helix and into an active site pocket. Consequently, base flipping is generally regarded as an essential aspect of lesion recognition and a necessary precursor to base excision. Here we present the first, to our knowledge, DNA glycosylase mechanism that does not require base flipping for either binding or catalysis. Using the DNA glycosylase AlkD from Bacillus cereus, we crystallographically monitored excision of an alkylpurine substrate as a function of time, and reconstructed the steps along the reaction coordinate through structures representing substrate, intermediate and product complexes. Instead of directly interacting with the damaged nucleobase, AlkD recognizes aberrant base pairs through interactions with the phosphoribose backbone, while the lesion remains stacked in the DNA duplex. Quantum mechanical calculations revealed that these contacts include catalytic charge-dipole and CH-π interactions that preferentially stabilize the transition state. We show in vitro and in vivo how this unique means of recognition and catalysis enables AlkD to repair large adducts formed by yatakemycin, a member of the duocarmycin family of antimicrobial natural products exploited in bacterial warfare and chemotherapeutic trials. Bulky adducts of this or any type are not excised by DNA glycosylases that use a traditional base-flipping mechanism. Hence, these findings represent a new model for DNA repair and provide insights into catalysis of base excision.

  13. [An effective scheme to produce recombinant uracil-DNA glycosylase of Escherichia coli for PCR diagnostics].

    PubMed

    Dmitrochenko, A E; Turiianskaia, O M; Gilep, A A; Usanov, S A; Iantsevich, A V

    2014-01-01

    An effective scheme has been developed to produce recombinant uracil-DNA glycosylase of Escherichia coli K12 intended to be used for PCR diagnostics, making it possible to achieve a high yield of the end product using a two-stage purification. The gene encoding this enzyme was cloned into the pCWori vector within the same reading frame with six residues of histidine in the C-erminal sequence. Using this vector and the E. coli DH5alpha, a host-vector expression system has been developed and conditions for protein synthesis have been optimized. To purify the protein, metal affinity chromatography with further dialysis was used to remove imidazole. The enzyme yield was no less than 60 mg of the end protein per 1 L of the culture medium. The concordance between amino acid sequences of the recombinant and native enzymes was proved by peptide mass fingerprinting and mass spectrometry. A rapid test to determine the activity of the enzyme preparation was suggested. It was found that the activity of 1.0 mg of the recombinant protein is no less than 3 x 10(3) units. The recombinant enzyme was most stable at pH 8.0 and an ionic strength of the solution equal to 200 mM; it lost its activity completely for 10 min at 60 degrees C. Storage during 1 h at 20 degrees C resulted in the loss of no more than 30% of activity. In the enzyme preparation, the activity of DNase was absent. The free energy of the unfolding of the protein globule of the recombinant uracil-DNA glycosylase is 23.1 +/- 0.2 kJ/mol. The data obtained indicate that the recombinant enzyme may be recommended for use in PCR diagnostics to prevent the appearance of false positive results caused by pollution of the reaction mixture by products of the preceding reactions.

  14. Chloroethyinitrosourea-derived ethano cytosine and adenine adducts are substrates for escherichia coli glycosylases excising analogous etheno adducts

    SciTech Connect

    Guliaev, Anton B.; Singer, B.; Hang, Bo

    2004-05-05

    Exocyclic ethano DNA adducts are saturated etheno ring derivatives formed mainly by therapeutic chloroethylnitrosoureas (CNUs), which are also mutagenic and carcinogenic. In this work, we report that two of the ethano adducts, 3,N{sup 4}-ethanocytosine (EC) and 1,N{sup 6}-ethanoadenine (EA), are novel substrates for the Escherichia coli mismatch-specific uracil-DNA glycosylase (Mug) and 3-methyladenine DNA glycosylase II (AlkA), respectively. It has been shown previously that Mug excises 3,N{sup 4}-ethenocytosine ({var_epsilon}C) and AlkA releases 1,N{sup 6}-ethenoadenine ({var_epsilon}A). Using synthetic oligonucleotides containing a single ethano or etheno adduct, we found that both glycosylases had a {approx}20-fold lower excision activity toward EC or EA than that toward their structurally analogous {var_epsilon}C or {var_epsilon}A adduct. Both enzymes were capable of excising the ethano base paired with any of the four natural bases, but with varying efficiencies. The Mug activity toward EC could be stimulated by E. coli endonuclease IV and, more efficiently, by exonuclease III. Molecular dynamics (MD) simulations showed similar structural features of the etheno and ethano derivatives when present in DNA duplexes. However, also as shown by MD, the stacking interaction between the EC base and Phe 30 in the Mug active site is reduced as compared to the {var_epsilon}C base, which could account for the lower EC activity observed in this study.

  15. Structural Characterization of Clostridium acetobutylicum 8-Oxoguanine DNA Glycosylase in Its Apo Form and in Complex with 8-Oxodeoxyguanosine

    SciTech Connect

    Faucher, Frédérick; Robey-Bond, Susan M.; Wallace, Susan S.; Doublié, Sylvie

    2009-06-30

    DNA is subject to a multitude of oxidative damages generated by oxidizing agents from metabolism and exogenous sources and by ionizing radiation. Guanine is particularly vulnerable to oxidation, and the most common oxidative product 8-oxoguanine (8-oxoG) is the most prevalent lesion observed in DNA molecules. 8-OxoG can form a normal Watson-Crick pair with cytosine (8-oxoG:C), but it can also form a stable Hoogsteen pair with adenine (8-oxoG:A), leading to a G:C {yields} T:A transversion after replication. Fortunately, 8-oxoG is recognized and excised by either of two DNA glycosylases of the base excision repair pathway: formamidopyrimidine-DNA glycosylase and 8-oxoguanine DNA glycosylase (Ogg). While Clostridium acetobutylicum Ogg (CacOgg) DNA glycosylase can specifically recognize and remove 8-oxoG, it displays little preference for the base opposite the lesion, which is unusual for a member of the Ogg1 family. This work describes the crystal structures of CacOgg in its apo form and in complex with 8-oxo-2'-deoxyguanosine. A structural comparison between the apo form and the liganded form of the enzyme reveals a structural reorganization of the C-terminal domain upon binding of 8-oxoG, similar to that reported for human OGG1. A structural comparison of CacOgg with human OGG1, in complex with 8-oxoG containing DNA, provides a structural rationale for the lack of opposite base specificity displayed by CacOgg.

  16. A DNA machine-based fluorescence amplification strategy for sensitive detection of uracil-DNA glycosylase activity.

    PubMed

    Wu, Yushu; Wang, Lei; Zhu, Jing; Jiang, Wei

    2015-06-15

    Sensitive detection of uracil-DNA glycosylase (UDG) activity is critical for function study of UDG and clinical diagnosis. Here, we developed a novel fluorescent strategy for sensitive detection of UDG activity based on the signal amplification by a label-free and enzyme-free DNA machine. A double-strand DNA (dsDNA) probe P1-P2 with uracil bases and trigger sequence was designed for UDG recognition and signal transduction. Two hairpin probes H1 and H2 which were partially complementary were employed to construct the label-free and enzyme-free DNA machine. Under the action of UDG, uracil bases were removed from the P1-P2 dsDNA probe, and then a strand P2' with abasic sites was released. Subsequently, the liberated P2' activated the DNA machine and generated numerous H1-H2 complexes containing G-quadruplex (G4) structures in the end. Finally, the G4 structures could bind with N-methylmesoporphyrin IX (NMM) to form G4-NMM complexes with the enhanced fluorescence responses. This strategy could detect UDG activity as low as 0.00044 U/mL. In addition, the strategy was also applied for the analysis of UDG activity in HeLa cells lysate with low effect of cellular components. Moreover, this strategy was successfully applied for assaying the inhibition of UDG using uracil glycosylase inhibitor (UGI). This strategy provided a potential tool for sensitive quantification of UDG activity in UDG functional study and clinical diagnosis.

  17. Analysis of substrate specificity of Schizosaccharomyces pombe Mag1 alkylpurine DNA glycosylase

    SciTech Connect

    Adhikary, Suraj; Eichman, Brandt F.

    2014-10-02

    DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity, although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.

  18. Factors that influence telomeric oxidative base damage and repair by DNA glycosylase OGG1.

    PubMed

    Rhee, David B; Ghosh, Avik; Lu, Jian; Bohr, Vilhelm A; Liu, Yie

    2011-01-02

    Telomeres are nucleoprotein complexes at the ends of linear chromosomes in eukaryotes, and are essential in preventing chromosome termini from being recognized as broken DNA ends. Telomere shortening has been linked to cellular senescence and human aging, with oxidative stress as a major contributing factor. 7,8-Dihydro-8-oxogaunine (8-oxodG) is one of the most abundant oxidative guanine lesions, and 8-oxoguanine DNA glycosylase (OGG1) is involved in its removal. In this study, we examined if telomeric DNA is particularly susceptible to oxidative base damage and if telomere-specific factors affect the incision of oxidized guanines by OGG1. We demonstrated that telomeric TTAGGG repeats were more prone to oxidative base damage and repaired less efficiently than non-telomeric TG repeats in vivo. We also showed that the 8-oxodG-incision activity of OGG1 is similar in telomeric and non-telomeric double-stranded substrates. In addition, telomere repeat binding factors TRF1 and TRF2 do not impair OGG1 incision activity. Yet, 8-oxodG in some telomere structures (e.g., fork-opening, 3'-overhang, and D-loop) were less effectively excised by OGG1, depending upon its position in these substrates. Collectively, our data indicate that the sequence context of telomere repeats and certain telomere configurations may contribute to telomere vulnerability to oxidative DNA damage processing.

  19. Germ-line variant of human NTH1 DNA glycosylase induces genomic instability and cellular transformation.

    PubMed

    Galick, Heather A; Kathe, Scott; Liu, Minmin; Robey-Bond, Susan; Kidane, Dawit; Wallace, Susan S; Sweasy, Joann B

    2013-08-27

    Base excision repair (BER) removes at least 20,000 DNA lesions per human cell per day and is critical for the maintenance of genomic stability. We hypothesize that aberrant BER, resulting from mutations in BER genes, can lead to genomic instability and cancer. The first step in BER is catalyzed by DNA N-glycosylases. One of these, n(th) endonuclease III-like (NTH1), removes oxidized pyrimidines from DNA, including thymine glycol. The rs3087468 single nucleotide polymorphism of the NTH1 gene is a G-to-T base substitution that results in the NTH1 D239Y variant protein that occurs in ∼6.2% of the global population and is found in Europeans, Asians, and sub-Saharan Africans. In this study, we functionally characterize the effect of the D239Y variant expressed in immortal but nontransformed human and mouse mammary epithelial cells. We demonstrate that expression of the D239Y variant in cells also expressing wild-type NTH1 leads to genomic instability and cellular transformation as assessed by anchorage-independent growth, focus formation, invasion, and chromosomal aberrations. We also show that cells expressing the D239Y variant are sensitive to ionizing radiation and hydrogen peroxide and accumulate double strand breaks after treatment with these agents. The DNA damage response is also activated in D239Y-expressing cells. In combination, our data suggest that individuals possessing the D239Y variant are at risk for genomic instability and cancer.

  20. Identification of UHRF1/2 as new N-methylpurine DNA glycosylase-interacting proteins.

    PubMed

    Liang, Chao; Zhang, Xueli; Song, Shanshan; Tian, Chunyan; Yin, Yuxin; Xing, Guichun; He, Fuchu; Zhang, Lingqiang

    2013-04-19

    N-methylpurine DNA glycosylase (MPG), a DNA repair enzyme, functions in the DNA base excision repair (BER) pathway. Aberrant over-expression of MPG in various cancers suggests an important role of MPG in carcinogenesis. Identification of MPG-interacting proteins will help to dissect the molecular link between MPG and cancer development. In the present study, using immunoprecipitation coupled with mass spectrometry (IP/MS), we screened ubiquitin-like, containing PHD and RING finger domains 1 (UHRF1), an essential protein required for the maintenance of DNA methylation, as a MPG-interacting protein. Endogenous co-immunoprecipitation assay in cancer cells confirmed that UHRF1 interacted with MPG in a p53 status-independent manner. Confocal microscopy showed that endogenous MPG and UHRF1 were co-localized in the nucleoplasm. Furthermore, co-immunoprecipitation assay indicated that UHRF2, the homolog of UHRF1, could also interact with MPG. These results show that MPG and the UHRF family of proteins interact, thus providing a functional linkage between MPG and UHRF1/2. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. DNA bending and a flip-out mechanism for base excision by the helix–hairpin–helix DNA glycosylase, Escherichia coli AlkA

    PubMed Central

    Hollis, Thomas; Ichikawa, Yoshitaka; Ellenberger, Tom

    2000-01-01

    The Escherichia coli AlkA protein is a base excision repair glycosylase that removes a variety of alkylated bases from DNA. The 2.5 Å crystal structure of AlkA complexed to DNA shows a large distortion in the bound DNA. The enzyme flips a 1–azaribose abasic nucleotide out of DNA and induces a 66° bend in the DNA with a marked widening of the minor groove. The position of the 1–azaribose in the enzyme active site suggests an SN1-type mechanism for the glycosylase reaction, in which the essential catalytic Asp238 provides direct assistance for base removal. Catalytic selectivity might result from the enhanced stacking of positively charged, alkylated bases against the aromatic side chain of Trp272 in conjunction with the relative ease of cleaving the weakened glycosylic bond of these modified nucleotides. The structure of the AlkA–DNA complex offers the first glimpse of a helix–hairpin–helix (HhH) glycosylase complexed to DNA. Modeling studies suggest that other HhH glycosylases can bind to DNA in a similar manner. PMID:10675345

  2. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    PubMed

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair.

  3. The alpha/beta fold uracil DNA glycosylases: a common origin with diverse fates

    PubMed Central

    Aravind, L; Koonin, Eugene V

    2000-01-01

    Background: Uracil DNA glycosylases (UDGs) are major repair enzymes that protect DNA from mutational damage caused by uracil incorporated as a result of a polymerase error or deamination of cytosine. Four distinct families of UDGs have been identified, which show very limited sequence similarity to each other, although two of them have been shown to possess the same structural fold. The structural and evolutionary relationships between the rest of the UDGs remain uncertain. Results: Using sequence profile searches, multiple alignment analysis and protein structure comparisons, we show here that all known UDGs possess the same fold and must have evolved from a common ancestor. Although all UDGs catalyze essentially the same reaction, significant changes in the configuration of the catalytic residues were detected within their common fold, which probably results in differences in the biochemistry of these enzymes. The extreme sequence divergence of the UDGs, which is unusual for enzymes with the same principal activity, is probably due to the major role of the uracil-flipping caused by the conformational strain enacted by the enzyme on uracil-containing DNA, as compared with the catalytic action of individual polar residues. We predict two previously undetected families of UDGs and delineate a hypothetical scenario for their evolution. Conclusions: UDGs form a single protein superfamily with a distinct structural fold and a common evolutionary origin. Differences in the catalytic mechanism of the different families combined with the construction of the catalytic pocket have, however, resulted in extreme sequence divergence of these enzymes. PMID:11178247

  4. Inroads into base excision repair II. The discovery of DNA glycosylases. "An N-glycosidase from Escherichia coli that releases free uracil from DNA containing deaminated cytosine residues," Proc. Nat. Acad. Sci. USA, 1974.

    PubMed

    Friedberg, Errol C; Lindahl, Tomas

    2004-11-02

    The discovery of a DNA glycosylase that specifically removes uracil from DNA, opened the door for uncovering a large class of such enzymes that are fundamental to the process of base excision repair of DNA.

  5. Cell cycle regulation as a mechanism for functional separation of the apparently redundant uracil DNA glycosylases TDG and UNG2

    PubMed Central

    Hardeland, Ulrike; Kunz, Christophe; Focke, Frauke; Szadkowski, Marta; Schär, Primo

    2007-01-01

    Human Thymine-DNA Glycosylase (TDG) is a member of the uracil DNA glycosylase (UDG) superfamily. It excises uracil, thymine and a number of chemical base lesions when mispaired with guanine in double-stranded DNA. These activities are not unique to TDG; at least three additional proteins with similar enzymatic properties are present in mammalian cells. The successful co-evolution of these enzymes implies the existence of non-redundant biological functions that must be coordinated. Here, we report cell cycle regulation as a mechanism for the functional separation of apparently redundant DNA glycosylases. We show that cells entering S-phase eliminate TDG through the ubiquitin–proteasome system and then maintain a TDG-free condition until G2. Incomplete degradation of ectopically expressed TDG impedes S-phase progression and cell proliferation. The mode of cell cycle regulation of TDG is strictly inverse to that of UNG2, which peaks in and throughout S-phase and then declines to undetectable levels until it appears again just before the next S-phase. Thus, TDG- and UNG2-dependent base excision repair alternates throughout the cell cycle, and the ubiquitin–proteasome pathway constitutes the underlying regulatory system. PMID:17526518

  6. Genetic mapping of nth, a gene affecting endonuclease III (thymine glycol-DNA glycosylase) in Escherichia coli K-12.

    PubMed Central

    Weiss, B; Cunningham, R P

    1985-01-01

    The nth gene of Escherichia coli affects the production of endonuclease III, a glycosylase-endonuclease that attacks DNA damaged by oxidizing agents or by ionizing radiation. An nth insertion mutant and a deletion mutant were studied. nth is located between add and tyrS on the linkage map of E. coli K-12 and was 97% linked to tyrS in a transduction with phage P1. PMID:3886628

  7. ATM regulates 3-Methylpurine-DNA glycosylase and promotes therapeutic resistance to alkylating agents

    PubMed Central

    Agnihotri, Sameer; Burrell, Kelly; Buczkowicz, Pawel; Remke, Marc; Golbourn, Brian; Chornenkyy, Yevgen; Gajadhar, Aaron; Fernandez, Nestor A.; Clarke, Ian D.; Barszczyk, Mark S.; Pajovic, Sanja; Ternamian, Christian; Head, Renee; Sabha, Nesrin; Sobol, Robert W.; Taylor, Michael D; Rutka, James T.; Jones, Chris; Dirks, Peter B.; Zadeh, Gelareh; Hawkins, Cynthia

    2014-01-01

    Alkylating agents are a frontline therapy for the treatment of several aggressive cancers including pediatric glioblastoma, a lethal tumor in children. Unfortunately, many tumors are resistant to this therapy. We sought to identify ways of sensitizing tumor cells to alkylating agents while leaving normal cells unharmed; increasing therapeutic response while minimizing toxicity. Using a siRNA screen targeting over 240 DNA damage response genes, we identified novel sensitizers to alkylating agents. In particular the base excision repair (BER) pathway, including 3-methylpurine-DNA glycosylase (MPG), as well as ataxia telangiectasia mutated (ATM) were identified in our screen. Interestingly, we identified MPG as a direct novel substrate of ATM. ATM-mediated phosphorylation of MPG was required for enhanced MPG function. Importantly, combined inhibition or loss of MPG and ATM resulted in increased alkylating agent-induced cytotoxicity in vitro and prolonged survival in vivo. The discovery of the ATM-MPG axis will lead to improved treatment of alkylating agent-resistant tumors. PMID:25100205

  8. ATM regulates 3-methylpurine-DNA glycosylase and promotes therapeutic resistance to alkylating agents.

    PubMed

    Agnihotri, Sameer; Burrell, Kelly; Buczkowicz, Pawel; Remke, Marc; Golbourn, Brian; Chornenkyy, Yevgen; Gajadhar, Aaron; Fernandez, Nestor A; Clarke, Ian D; Barszczyk, Mark S; Pajovic, Sanja; Ternamian, Christian; Head, Renee; Sabha, Nesrin; Sobol, Robert W; Taylor, Michael D; Rutka, James T; Jones, Chris; Dirks, Peter B; Zadeh, Gelareh; Hawkins, Cynthia

    2014-10-01

    Alkylating agents are a first-line therapy for the treatment of several aggressive cancers, including pediatric glioblastoma, a lethal tumor in children. Unfortunately, many tumors are resistant to this therapy. We sought to identify ways of sensitizing tumor cells to alkylating agents while leaving normal cells unharmed, increasing therapeutic response while minimizing toxicity. Using an siRNA screen targeting over 240 DNA damage response genes, we identified novel sensitizers to alkylating agents. In particular, the base excision repair (BER) pathway, including 3-methylpurine-DNA glycosylase (MPG), as well as ataxia telangiectasia mutated (ATM), were identified in our screen. Interestingly, we identified MPG as a direct novel substrate of ATM. ATM-mediated phosphorylation of MPG was required for enhanced MPG function. Importantly, combined inhibition or loss of MPG and ATM resulted in increased alkylating agent-induced cytotoxicity in vitro and prolonged survival in vivo. The discovery of the ATM-MPG axis will lead to improved treatment of alkylating agent-resistant tumors. Inhibition of ATM and MPG-mediated BER cooperate to sensitize tumor cells to alkylating agents, impairing tumor growth in vitro and in vivo with no toxicity to normal cells, providing an ideal therapeutic window. ©2014 American Association for Cancer Research.

  9. Replication-Dependent Unhooking of DNA Interstrand Cross-Links by the NEIL3 Glycosylase.

    PubMed

    Semlow, Daniel R; Zhang, Jieqiong; Budzowska, Magda; Drohat, Alexander C; Walter, Johannes C

    2016-10-06

    During eukaryotic DNA interstrand cross-link (ICL) repair, cross-links are resolved ("unhooked") by nucleolytic incisions surrounding the lesion. In vertebrates, ICL repair is triggered when replication forks collide with the lesion, leading to FANCI-FANCD2-dependent unhooking and formation of a double-strand break (DSB) intermediate. Using Xenopus egg extracts, we describe here a replication-coupled ICL repair pathway that does not require incisions or FANCI-FANCD2. Instead, the ICL is unhooked when one of the two N-glycosyl bonds forming the cross-link is cleaved by the DNA glycosylase NEIL3. Cleavage by NEIL3 is the primary unhooking mechanism for psoralen and abasic site ICLs. When N-glycosyl bond cleavage is prevented, unhooking occurs via FANCI-FANCD2-dependent incisions. In summary, we identify an incision-independent unhooking mechanism that avoids DSB formation and represents the preferred pathway of ICL repair in a vertebrate cell-free system.

  10. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.

    PubMed

    Calvo, Jennifer A; Moroski-Erkul, Catherine A; Lake, Annabelle; Eichinger, Lindsey W; Shah, Dharini; Jhun, Iny; Limsirichai, Prajit; Bronson, Roderick T; Christiani, David C; Meira, Lisiane B; Samson, Leona D

    2013-04-01

    Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER) is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG) mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  11. Crystal structure and functional insights into uracil-DNA glycosylase inhibition by phage ϕ29 DNA mimic protein p56

    PubMed Central

    Baños-Sanz, José Ignacio; Mojardín, Laura; Sanz-Aparicio, Julia; Lázaro, José M.; Villar, Laurentino; Serrano-Heras, Gemma; González, Beatriz; Salas, Margarita

    2013-01-01

    Uracil-DNA glycosylase (UDG) is a key repair enzyme responsible for removing uracil residues from DNA. Interestingly, UDG is the only enzyme known to be inhibited by two different DNA mimic proteins: p56 encoded by the Bacillus subtilis phage ϕ29 and the well-characterized protein Ugi encoded by the B. subtilis phage PBS1/PBS2. Atomic-resolution crystal structures of the B. subtilis UDG both free and in complex with p56, combined with site-directed mutagenesis analysis, allowed us to identify the key amino acid residues required for enzyme activity, DNA binding and complex formation. An important requirement for complex formation is the recognition carried out by p56 of the protruding Phe191 residue from B. subtilis UDG, whose side-chain is inserted into the DNA minor groove to replace the flipped-out uracil. A comparative analysis of both p56 and Ugi inhibitors enabled us to identify their common and distinctive features. Thereby, our results provide an insight into how two DNA mimic proteins with different structural and biochemical properties are able to specifically block the DNA-binding domain of the same enzyme. PMID:23671337

  12. Crystal structure and functional insights into uracil-DNA glycosylase inhibition by phage Φ29 DNA mimic protein p56.

    PubMed

    Baños-Sanz, José Ignacio; Mojardín, Laura; Sanz-Aparicio, Julia; Lázaro, José M; Villar, Laurentino; Serrano-Heras, Gemma; González, Beatriz; Salas, Margarita

    2013-07-01

    Uracil-DNA glycosylase (UDG) is a key repair enzyme responsible for removing uracil residues from DNA. Interestingly, UDG is the only enzyme known to be inhibited by two different DNA mimic proteins: p56 encoded by the Bacillus subtilis phage 29 and the well-characterized protein Ugi encoded by the B. subtilis phage PBS1/PBS2. Atomic-resolution crystal structures of the B. subtilis UDG both free and in complex with p56, combined with site-directed mutagenesis analysis, allowed us to identify the key amino acid residues required for enzyme activity, DNA binding and complex formation. An important requirement for complex formation is the recognition carried out by p56 of the protruding Phe191 residue from B. subtilis UDG, whose side-chain is inserted into the DNA minor groove to replace the flipped-out uracil. A comparative analysis of both p56 and Ugi inhibitors enabled us to identify their common and distinctive features. Thereby, our results provide an insight into how two DNA mimic proteins with different structural and biochemical properties are able to specifically block the DNA-binding domain of the same enzyme.

  13. Physical association of the 2,6-diamino-4-hydroxy-5N-formamidopyrimidine-DNA glycosylase of Escherichia coli and an activity nicking DNA at apurinic/apyrimidinic sites.

    PubMed Central

    O'Connor, T R; Laval, J

    1989-01-01

    The 2,6-diamino-4-hydroxy-5N-formamidopyrimidine (Fapy)-DNA glycosylase of Escherichia coli, which is coded for by the fpg gene, excises purine bases with ring-opened imidazoles. In addition to the DNA glycosylase activity, we report that the Fapy-DNA glycosylase of E. coli has an associated activity, resistant to EDTA, that nicks DNA at apurinic/apyrimidinic (AP) sites. The levels of Fapy-DNA glycosylase and AP-nicking activity were parallel in crude lysates of E. coli HB101 harboring different plasmids constructed from the fpg gene. The fpg gene is different from the xth, nth, and nfo genes of E. coli, whose gene products also cleave DNA at AP sites. The Fapy-DNA glycosylase was purified to electrophoretic homogeneity. During this purification, the Fapy-DNA glycosylase copurified with an AP-nicking activity using chromatographic separations based on ion-exchange, molecular weight exclusion, and hydrophobicity. The cleavage at AP sites by the Fapy-DNA glycosylase left a 5'-phosphomonoester nucleotide at one terminus. In addition, DNA containing reduced AP sites was not nicked by the Fapy-DNA glycosylase. These data suggest that the mechanism of cleavage involved beta elimination. Therefore, this activity of the Fapy-DNA glycosylase nicking DNA at AP sites should be referred to as an AP lyase. The 3' terminus did not prime nick-translation by E. coli DNA polymerase I. However, the 3' terminus becomes a substrate for nick-translation if first allowed to react with calf intestine phosphatase or the E. coli exonuclease III. These data suggest that the repair of the Fapy lesion at least to some extent results in the formation of both 5'- and 3'-phosphomonoester nucleotides and the release of the deoxyribose. Images PMID:2664776

  14. The effect of Msh2 knockdown on methylating agent induced toxicity in DNA glycosylase deficient cells.

    PubMed

    Cooley, N; Elder, R H; Povey, A C

    2010-01-31

    The DNA structure recognition protein MSH2 is an important protein in DNA mismatch repair due to its role in initiating the repair process. To examine the potential interactions between mismatch repair and base excision repair (BER) we have examined the effect of MSH2 knockdown on 6-thioguanine (6-TG), temozolomide (TMZ) and methylmethane sulphonate (MMS) induced toxicity in BER proficient and deficient cell lines. An shRNA expression vector containing Msh2 target sequences was designed and used to transfect mouse embryonic fibroblasts lacking either alkylpurine DNA N-glycosylase (Mpg) or endonuclease III homologue (Nth1). Significant knockdown of Msh2 gene expression was achieved with three different target sequences, with the highest level being shown by Msh2(283). Clonal selection resulted in differing levels of knockdown in Mpg(-/-) cells: (69.0+/-12.1% from 5 cell clones). Transfection of the Msh2(283) sequence in Mpg+/+, Nth1+/+ and Nth1(-/-) cells resulted in average knockdowns of 45.1+/-40.5% (3 clones), 58.0+/-21.4% (5 clones) and 74.9+/-14.8% (3 clones), respectively. Msh2 knockdown resulted in increased resistance to 6-TG in BER (MPG and NTH1) proficient and deficient cell lines with similar levels of knockdown (84+/-4%) but increased resistance to TMZ only in Mpg+/+ and Nth1(-/-) cell lines and not Mpg(-/-) or Nth1+/+ cells as assessed by an MTT assay. Msh2 knockdown had no effect on sensitivity to MMS induced toxicity. In a clonogenic assay, Msh2 silenced Mpg+/+, Mpg(-/-), Nth1+/+ and Nth1(-/-) cells were more resistant to TMZ. These results confirm previous studies showing that MSH2 is a key protein in influencing 6-TG and O(6)-methylguanine induced toxicity but also suggest that the effect of this protein depends upon the presence of other proteins in different DNA repair pathways. 2009 Elsevier Ireland Ltd. All rights reserved.

  15. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity.

    PubMed

    Zhao, Jingjin; Ma, Yefei; Kong, Rongmei; Zhang, Liangliang; Yang, Wen; Zhao, Shulin

    2015-08-05

    Herein, we introduced a tungsten disulfide (WS2) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3'-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS2 nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS2 nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics.

  16. Spatial expression of a DNA repair gene, N-methylpurine-DNA glycosylase (MPG) during development in mice.

    PubMed

    Kim, N K; Lee, S H; Sohn, T J; Roy, R; Mitra, S; Chung, H M; Ko, J J; Cha, K Y

    2000-01-01

    DNA repair is a crucial phenomenon that maintains the chromosome integrity of genome which are continuously damaged by endogenous and exogenous alkylating agents. If the damaged DNA is not repaired, it may lead to mutation, chromosomal aberration, aging and cancer. N-methylpurine-DNA glycosylase (MPG), a ubiquitous DNA repair enzyme, removes N-methylpurine and other damaged purines in DNA. MPG mRNA expression was revealed at various stages of mouse development from day 7.5 p.c. (post coitum) embryo to day 400 mature adult by Northern blot hybridization or RT-PCR. MPG transcripts were abundant in the mouse embryo during pregnancy and in adult testis and ovary. The MPG mRNA level in the testis was low in 1-week-old mice, but the level showed its maximum among the organs tested in 4-week-old young adults. In placenta, the level of MPG mRNA continuously decreased from day 7.5 p.c. to day 17.5 p.c. The spatial expression of MPG gene is highly regulated. Transcription of MPG is maximum in rapidly dividing and growing tissues during development. These data suggest that an elevated rate of MPG transcription is required for DNA replication.

  17. DNA Base Excision Repair (BER) and Cancer Gene Therapy: Use of the Human N-mythlpurien DNA Glycosylase (MPG) to Sensitize Breast Cancer Cells to Low Dose Chemotherapy

    DTIC Science & Technology

    2003-06-01

    has found that the overexpression of this DNA repair protein is cytotoxic to tumor cells in response to the classic alkylating agent, methyl...SUBJECT TERMS 15. NUMBER OF PAGES DNA repair, methylpurine DNA glycosylase, breast cancer 5 16. PRICE CODE 17. SECURITY CLASSIFICATION 18 . SECURITY...NSN 7540-01-280-5500 Standard Form 298 (Rev. 2-89) Prescribed by ANSI Std. Z39- 18 298-102 BEST AVAILABLE COPY Table of Contents Cover

  18. Folate deficiency induces neurodegeneration and brain dysfunction in mice lacking uracil DNA glycosylase.

    PubMed

    Kronenberg, Golo; Harms, Christoph; Sobol, Robert W; Cardozo-Pelaez, Fernando; Linhart, Heinz; Winter, Benjamin; Balkaya, Mustafa; Gertz, Karen; Gay, Shanna B; Cox, David; Eckart, Sarah; Ahmadi, Michael; Juckel, Georg; Kempermann, Gerd; Hellweg, Rainer; Sohr, Reinhard; Hörtnagl, Heide; Wilson, Samuel H; Jaenisch, Rudolf; Endres, Matthias

    2008-07-09

    Folate deficiency and resultant increased homocysteine levels have been linked experimentally and epidemiologically with neurodegenerative conditions like stroke and dementia. Moreover, folate deficiency has been implicated in the pathogenesis of psychiatric disorders, most notably depression. We hypothesized that the pathogenic mechanisms include uracil misincorporation and, therefore, analyzed the effects of folate deficiency in mice lacking uracil DNA glycosylase (Ung-/-) versus wild-type controls. Folate depletion increased nuclear mutation rates in Ung-/- embryonic fibroblasts, and conferred death of cultured Ung-/- hippocampal neurons. Feeding animals a folate-deficient diet (FD) for 3 months induced degeneration of CA3 pyramidal neurons in Ung-/- but not Ung+/+ mice along with decreased hippocampal expression of brain-derived neurotrophic factor protein and decreased brain levels of antioxidant glutathione. Furthermore, FD induced cognitive deficits and mood alterations such as anxious and despair-like behaviors that were aggravated in Ung-/- mice. Independent of Ung genotype, FD increased plasma homocysteine levels, altered brain monoamine metabolism, and inhibited adult hippocampal neurogenesis. These results indicate that impaired uracil repair is involved in neurodegeneration and neuropsychiatric dysfunction induced by experimental folate deficiency.

  19. Aberrant expression of N-methylpurine-DNA glycosylase influences patient survival in malignant gliomas.

    PubMed

    Liu, Ce; Tu, Yanyang; Yuan, Jun; Mao, Xinggang; He, Shiming; Wang, Liang; Fu, Guoqiang; Zong, Jianhai; Zhang, Yongsheng

    2012-01-01

    To examine the expression of N-methylpurine-DNA glycosylase (MPG) gene and protein in glioma samples with different WHO grades and its association with patients' survival. Immunohistochemistry assay, quantitative real-time PCR and Western blot analysis were carried out to investigate the expression of MPG gene and protein in 128 glioma and 10 non-neoplastic brain tissues. MPG gene expression level in glioma tissues was significantly higher than that in non-neoplastic brain tissues (P < 0.001). Immunohistochemistry also showed that MPG protein was over-expressed in glioma tissues, which was consistent with the resutls of Western blot analysis. Additionally, the expression levels of MPG gene and protein both increase from grade I to grade IV glioma according to the results of real-time PCR, immunohistochemistry and western blot analysis. Moreover, the survival rate of MPG-positive patients was significantly lower than that of MPG-negative patients (P < 0.001). We further confirmed that the over-expression of MPG was a significant and independent prognostic indicator in glioma by multivariate analysis (P < 0.001). Our data showed the over-expression of MPG gene and protein in human gliomas, and also suggested for the first time that MPG be an unfavorable independent prognostic indicator for glioma patients.

  20. Aberrant Expression of N-Methylpurine-DNA Glycosylase Influences Patient Survival in Malignant Gliomas

    PubMed Central

    Liu, Ce; Tu, Yanyang; Yuan, Jun; Mao, Xinggang; He, Shiming; Wang, Liang; Fu, Guoqiang; Zong, Jianhai; Zhang, Yongsheng

    2012-01-01

    Aim. To examine the expression of N-methylpurine-DNA glycosylase (MPG) gene and protein in glioma samples with different WHO grades and its association with patients' survival. Methods. Immunohistochemistry assay, quantitative real-time PCR and Western blot analysis were carried out to investigate the expression of MPG gene and protein in 128 glioma and 10 non-neoplastic brain tissues. Results. MPG gene expression level in glioma tissues was significantly higher than that in non-neoplastic brain tissues (P < 0.001). Immunohistochemistry also showed that MPG protein was over-expressed in glioma tissues, which was consistent with the resutls of Western blot analysis. Additionally, the expression levels of MPG gene and protein both increase from grade I to grade IV glioma according to the results of real-time PCR, immunohistochemistry and western blot analysis. Moreover, the survival rate of MPG-positive patients was significantly lower than that of MPG-negative patients (P < 0.001). We further confirmed that the over-expression of MPG was a significant and independent prognostic indicator in glioma by multivariate analysis (P < 0.001). Conclusions. Our data showed the over-expression of MPG gene and protein in human gliomas, and also suggested for the first time that MPG be an unfavorable independent prognostic indicator for glioma patients. PMID:22496614

  1. Selective excision of 5-carboxylcytosine by a thymine DNA glycosylase mutant

    PubMed Central

    Hashimoto, Hideharu; Zhang, Xing; Cheng, Xiaodong

    2013-01-01

    The mammalian thymine DNA glycosylase (TDG) excises the mismatched base, uracil, thymine, or 5-hydroxymethyluracil (5hmU), as well as removes 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) when paired with a guanine. In the previously solved structure of TDG in complex with DNA containing 5caC, the side chain of asparagine 157 (N157) contacts the 5-carboxyl moiety of 5caC via a weak hydrogen bond. We examined the role of N157 in recognition of 5caC by mutagenesis. The asparagine-to-alanine (N157A) mutant has no detectable base excision activity for a G:T mismatch, and its excision activity is reduced for other substrates including G:5caC. Unexpectedly, the asparagine-to-aspartate (N157D) mutant has a comparable base excision rate for G:5caC substrate to that of wild type, but it only has residual activity for G:U and no detectable activity for other substrates. We further show that the N157D mutant has higher activity for 5caC at a lower pH (6.0), suggesting that increased protonation of the carboxylate of 5caC and the aspartate facilitates base excision. The N157D mutant remains highly specific for 5caC even in the presence of large excess of genomic DNA, a property that can potentially be used for mapping the very low amount of 5caC in genomes. PMID:23337108

  2. Base excision of oxidative purine and pyrimidine DNA damage in Saccharomyces cerevisiae by a DNA glycosylase with sequence similarity to endonuclease III from Escherichia coli.

    PubMed

    Eide, L; Bjørås, M; Pirovano, M; Alseth, I; Berdal, K G; Seeberg, E

    1996-10-01

    One gene locus on chromosome I in Saccharomyces cerevisiae encodes a protein (YAB5_YEAST; accession no. P31378) with local sequence similarity to the DNA repair glycosylase endonuclease III from Escherichia coli. We have analyzed the function of this gene, now assigned NTG1 (endonuclease three-like glycosylase 1), by cloning, mutant analysis, and gene expression in E. coli. Targeted gene disruption of NTG1 produces a mutant that is sensitive to H2O2 and menadione, indicating that NTG1 is required for repair of oxidative DNA damage in vivo. Northern blot analysis and expression studies of a NTG1-lacZ gene fusion showed that NTG1 is induced by cell exposure to different DNA damaging agents, particularly menadione, and hence belongs to the DNA damage-inducible regulon in S. cerevisiae. When expressed in E. coli, the NTG1 gene product cleaves plasmid DNA damaged by osmium tetroxide, thus, indicating specificity for thymine glycols in DNA similarly as is the case for EndoIII. However, NTG1 also releases formamidopyrimidines from DNA with high efficiency and, hence, represents a glycosylase with a novel range of substrate recognition. Sequences similar to NTG1 from other eukaryotes, including Caenorhabditis elegans, Schizosaccharomyces pombe, and mammals, have recently been entered in the GenBank suggesting the universal presence of NTG1-like genes in higher organisms. S. cerevisiae NTG1 does not have the [4Fe-4S] cluster DNA binding domain characteristic of the other members of this family.

  3. The DNA glycosylases OGG1 and NEIL3 influence differentiation potential, proliferation, and senescence-associated signs in neural stem cells

    SciTech Connect

    Reis, Amilcar; Hermanson, Ola

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer DNA glycosylases OGG1 and NEIL3 are required for neural stem cell state. Black-Right-Pointing-Pointer No effect on cell viability by OGG1 or NEIL3 knockdown in neural stem cells. Black-Right-Pointing-Pointer OGG1 or NEIL3 RNA knockdown result in decreased proliferation and differentiation. Black-Right-Pointing-Pointer Increased HP1{gamma} immunoreactivity after NEIL3 knockdown suggests premature senescence. -- Abstract: Embryonic neural stem cells (NSCs) exhibit self-renewal and multipotency as intrinsic characteristics that are key parameters for proper brain development. When cells are challenged by oxidative stress agents the resulting DNA lesions are repaired by DNA glycosylases through the base excision repair (BER) pathway as a means to maintain the fidelity of the genome, and thus, proper cellular characteristics. The functional roles for DNA glycosylases in NSCs have however remained largely unexplored. Here we demonstrate that RNA knockdown of the DNA glycosylases OGG1 and NEIL3 decreased NSC differentiation ability and resulted in decreased expression of both neuronal and astrocytic genes after mitogen withdrawal, as well as the stem cell marker Musashi-1. Furthermore, while cell survival remained unaffected, NEIL3 deficient cells displayed decreased cell proliferation rates along with an increase in HP1{gamma} immunoreactivity, a sign of premature senescence. Our results suggest that DNA glycosylases play multiple roles in governing essential neural stem cell characteristics.

  4. Staphylococcus aureus Sepsis and Mitochondrial Accrual of the 8-Oxoguanine DNA Glycosylase DNA Repair Enzyme in Mice

    PubMed Central

    Bartz, Raquel R.; Suliman, Hagir B.; Fu, Ping; Welty-Wolf, Karen; Carraway, Martha Sue; MacGarvey, Nancy Chou; Withers, Crystal M.; Sweeney, Timothy E.; Piantadosi, Claude A.

    2011-01-01

    Rationale: Damage to mitochondrial DNA (mtDNA) by the production of reactive oxygen species during inflammatory states, such as sepsis, is repaired by poorly understood mechanisms. Objectives: To test the hypothesis that the DNA repair enzyme, 8-oxoguanine DNA glycosylase (OGG1), contributes to mtDNA repair in sepsis. Methods: Using a well-characterized mouse model of Staphylococcus aureus sepsis, we analyzed molecular markers for mitochondrial biogenesis and OGG1 translocation into liver mitochondria as well as OGG1 mRNA expression at 0, 24, 48, and 72 hours after infection. The effects of OGG1 RNA silencing on mtDNA content were determined in control, tumor necrosis factor-α, and peptidoglycan-exposed rat hepatoma cells. Based on in situ analysis of the OGG1 promoter region, chromatin immunoprecipitation assays were performed for nuclear respiratory factor (NRF)-1 and NRF-2α GA-binding protein (GABP) binding to the promoter of OGG1. Measurements and Main Results: Mice infected with 107 cfu S. aureus intraperitoneally demonstrated hepatic oxidative mtDNA damage and significantly lower hepatic mtDNA content as well as increased mitochondrial OGG1 protein and enzyme activity compared with control mice. The infection also caused increases in hepatic OGG1 transcript levels and NRF-1 and NRF-2α transcript and protein levels. A bioinformatics analysis of the Ogg1 gene locus identified several promoter sites containing NRF-1 and NRF-2α DNA binding motifs, and chromatin immunoprecipitation assays confirmed in situ binding of both transcription factors to the Ogg1 promoter within 24 hours of infection. Conclusions: These studies identify OGG1 as an early mitochondrial response protein during sepsis under regulation by the NRF-1 and NRF-2α transcription factors that regulate mitochondrial biogenesis. PMID:20732986

  5. Increased Risk of Lung Cancer Associated with a Functionally Impaired Polymorphic Variant of the Human DNA Glycosylase NEIL2

    PubMed Central

    Dey, Sanjib; Maiti, Amit K; Hegde, Muralidhar L; Hegde, Pavana M; Boldogh, Istvan; Sarkar, Partha S; Abdel-Rahman, Sherif Z; Sarker, Altaf H.; Hang, Bo; Xie, Jingwu; Tomkinson, Alan E; Zhou, Mian; Shen, Binghui; Wang, Guanghai; Wu, Chen; Yu, Dianke; Lin, Dongxin; Cardenas, Victor; Hazra, Tapas K

    2012-01-01

    Human NEIL2, one of five oxidized base-specific DNA glycosylases, is unique in preferentially repairing oxidative damage in transcribed genes. Here we show that depletion of NEIL2 causes a 6- to 7-fold increase in spontaneous mutation frequency in the HPRT gene of the V79 Chinese hamster lung cell line. This prompted us to screen for NEIL2 variants in lung cancer patients’ genomic DNA. We identified several polymorphic variants, among which R103Q and R257L were frequently observed in lung cancer patients. We then characterized these variants biochemically, and observed a modest decrease in DNA glycosylase activity relative to the wild type (WT) only with the R257L mutant protein. However, in reconstituted repair assays containing WT NEIL2 or its R257L and R103Q variants together with other DNA base excision repair (BER) proteins (PNKP, Polβ, Lig IIIα and XRCC1) or using NEIL2-FLAG immunocomplexes, an ~ 5-fold decrease in repair was observed with the R257L variant compared to WT or R103Q NEIL2, apparently due to the R257L mutant’s lower affinity for other repair proteins, particularly Polβ. Notably, increased endogenous DNA damage was observed in NEIL2 variant (R257L)-expressing cells relative to WT cells. Taken together, our results suggest that the decreased DNA repair capacity of the R257L variant can induce mutations that lead to lung cancer development. PMID:22497777

  6. Arabidopsis uracil DNA glycosylase (UNG) is required for base excision repair of uracil and increases plant sensitivity to 5-fluorouracil.

    PubMed

    Córdoba-Cañero, Dolores; Dubois, Emeline; Ariza, Rafael R; Doutriaux, Marie-Pascale; Roldán-Arjona, Teresa

    2010-03-05

    Uracil in DNA arises by misincorporation of dUMP during replication and by hydrolytic deamination of cytosine. This common lesion is actively removed through a base excision repair (BER) pathway initiated by a uracil DNA glycosylase (UDG) activity that excises the damage as a free base. UDGs are classified into different families differentially distributed across eubacteria, archaea, yeast, and animals, but remain to be unambiguously identified in plants. We report here the molecular characterization of AtUNG (Arabidopsis thaliana uracil DNA glycosylase), a plant member of the Family-1 of UDGs typified by Escherichia coli Ung. AtUNG exhibits the narrow substrate specificity and single-stranded DNA preference that are characteristic of Ung homologues. Cell extracts from atung(-/-) mutants are devoid of UDG activity, and lack the capacity to initiate BER on uracil residues. AtUNG-deficient plants do not display any apparent phenotype, but show increased resistance to 5-fluorouracil (5-FU), a cytostatic drug that favors dUMP misincorporation into DNA. The resistance of atung(-/-) mutants to 5-FU is accompanied by the accumulation of uracil residues in DNA. These results suggest that AtUNG excises uracil in vivo but generates toxic AP sites when processing abundant U:A pairs in dTTP-depleted cells. Altogether, our findings point to AtUNG as the major UDG activity in Arabidopsis.

  7. Characterization of Trypanosoma cruzi MutY DNA glycosylase ortholog and its role in oxidative stress response.

    PubMed

    Kunrath-Lima, Marianna; Repolês, Bruno Marçal; Alves, Ceres Luciana; Furtado, Carolina; Rajão, Matheus Andrade; Macedo, Andrea Mara; Franco, Glória Regina; Pena, Sérgio Danilo Junho; Valenzuela, Lucía; Wisnovsky, Simon; Kelley, Shana O; Galanti, Norbel; Cabrera, Gonzalo; Machado, Carlos Renato

    2017-09-29

    Trypanosoma cruzi is a protozoan parasite and the causative agent of Chagas disease. Like most living organisms, it is susceptible to oxidative stress, and must adapt to distinct environments. Hence, DNA repair is essential for its survival and the persistence of infection. Therefore, we studied whether T. cruzi has a homolog counterpart of the MutY enzyme (TcMYH), important in the DNA Base Excision Repair (BER) mechanism. Analysis of T. cruzi genome database showed that this parasite has a putative MutY DNA glycosylase sequence. We performed heterologous complementation assays using this genomic sequence. TcMYH complemented the Escherichia coli MutY- strain, reducing the mutation rate to a level similar to wild type. In in vitro assays, TcMYH was able to remove an adenine that was opposite to 8-oxoguanine. We have also constructed a T. cruzi lineage that overexpresses MYH. Although in standard conditions this lineage has similar growth to control cells, the overexpressor is more sensitive to hydrogen peroxide and glucose oxidase than the control, probably due to accumulation of AP sites in its DNA. Localization experiments with GFP-fused TcMYH showed this enzyme is present in both nucleus and mitochondrion. QPCR and MtOX results reinforce the presence and function of TcMYH in these two organelles. Our data suggest T. cruzi has a functional MYH DNA glycosylase, which participates in nuclear and mitochondrial DNA Base Excision Repair. Copyright © 2017. Published by Elsevier B.V.

  8. Repeated inhalations of diesel exhaust particles and oxidatively damaged DNA in young oxoguanine DNA glycosylase (OGG1) deficient mice.

    PubMed

    Risom, Lotte; Dybdahl, Marianne; Møller, Peter; Wallin, Håkan; Haug, Terje; Vogel, Ulla; Klungland, Arne; Loft, Steffen

    2007-02-01

    DNA repair may prevent increased levels of oxidatively damaged DNA from prolonged oxidative stress induced by, e.g. exposure to diesel exhaust particles (DEP). We studied oxidative damage to DNA in broncho-alveolar lavage cells, lungs, and liver after 4 x 1.5 h inhalations of DEP (20 mg/m3) in Ogg1-/- and wild type (WT) mice with similar extent of inflammation. DEP exposure increased lung levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) in Ogg1-/- mice, whereas no effect on 8-oxodG or oxidized purines in terms of formamidopyrimidine DNA glycosylase (FPG) sites was observed in WT mice. In both unexposed and exposed Ogg1-/- mice the level of FPG sites in the lungs was 3-fold higher than in WT mice. The high basal level of FPG sites in Ogg1-/- mice probably saturated the assay and prevented detection of DEP-generated damage. In conclusion, Ogg1-/- mice have elevated pulmonary levels of FPG sites and accumulate genomic 8-oxodG after repeated inhalations of DEP.

  9. Uracil DNA Glycosylase BKRF3 Contributes to Epstein-Barr Virus DNA Replication through Physical Interactions with Proteins in Viral DNA Replication Complex

    PubMed Central

    Su, Mei-Tzu; Liu, I-Hua; Wu, Chia-Wei; Chang, Shu-Ming; Tsai, Ching-Hwa; Yang, Pei-Wen; Chuang, Yu-Chia; Lee, Chung-Pei

    2014-01-01

    ABSTRACT Epstein-Barr virus (EBV) BKRF3 shares sequence homology with members of the uracil-N-glycosylase (UNG) protein family and has DNA glycosylase activity. Here, we explored how BKRF3 participates in the DNA replication complex and contributes to viral DNA replication. Exogenously expressed Flag-BKRF3 was distributed mostly in the cytoplasm, whereas BKRF3 was translocated into the nucleus and colocalized with the EBV DNA polymerase BALF5 in the replication compartment during EBV lytic replication. The expression level of BKRF3 increased gradually during viral replication, coupled with a decrease of cellular UNG2, suggesting BKRF3 enzyme activity compensates for UNG2 and ensures the fidelity of viral DNA replication. In immunoprecipitation-Western blotting, BKRF3 was coimmunoprecipitated with BALF5, the polymerase processivity factor BMRF1, and the immediate-early transactivator Rta. Coexpression of BMRF1 appeared to facilitate the nuclear targeting of BKRF3 in immunofluorescence staining. Residues 164 to 255 of BKRF3 were required for interaction with Rta and BALF5, whereas residues 81 to 166 of BKRF3 were critical for BMRF1 interaction in glutathione S-transferase (GST) pulldown experiments. Viral DNA replication was defective in cells harboring BKRF3 knockout EBV bacmids. In complementation assays, the catalytic mutant BKRF3(Q90L,D91N) restored viral DNA replication, whereas the leucine loop mutant BKRF3(H213L) only partially rescued viral DNA replication, coupled with a reduced ability to interact with the viral DNA polymerase and Rta. Our data suggest that BKRF3 plays a critical role in viral DNA synthesis predominantly through its interactions with viral proteins in the DNA replication compartment, while its enzymatic activity may be supplementary for uracil DNA glycosylase (UDG) function during virus replication. IMPORTANCE Catalytic activities of both cellular UDG UNG2 and viral UDGs contribute to herpesviral DNA replication. To ensure that the enzyme

  10. Structure of the E. coli DNA Glycosylase AlkA Bound to the Ends of Duplex DNA: A System for the Structure Determination of Lesion-Containing DNA

    SciTech Connect

    Bowman, B.R.; Lee, S.; Wang, S.; Verdine, G.L.

    2008-10-24

    The constant attack on DNA by endogenous and exogenous agents gives rise to nucleobase modifications that cause mutations, which can lead to cancer. Visualizing the effects of these lesions on the structure of duplex DNA is key to understanding their biologic consequences. The most definitive method of obtaining such structures, X-ray crystallography, is troublesome to employ owing to the difficulty of obtaining diffraction-quality crystals of DNA. Here, we present a crystallization system that uses a protein, the DNA glycosylase AlkA, as a scaffold to mediate the crystallization of lesion-containing duplex DNA. We demonstrate the use of this system to facilitate the rapid structure determination of DNA containing the lesion 8-oxoguanine in several different sequence contexts, and also deoxyinosine and 1,N{sup 6}-ethenoadenine, each stabilized as the corresponding 2{prime}-flouro analog. The structures of 8-oxoguanine provide a correct atomic-level view of this important endogenous lesion in DNA.

  11. O-GlcNAcylation of 8-Oxoguanine DNA Glycosylase (Ogg1) Impairs Oxidative Mitochondrial DNA Lesion Repair in Diabetic Hearts.

    PubMed

    Cividini, Federico; Scott, Brian T; Dai, Anzhi; Han, Wenlong; Suarez, Jorge; Diaz-Juarez, Julieta; Diemer, Tanja; Casteel, Darren E; Dillmann, Wolfgang H

    2016-12-16

    mtDNA damage in cardiac myocytes resulting from increased oxidative stress is emerging as an important factor in the pathogenesis of diabetic cardiomyopathy. A prevalent lesion that occurs in mtDNA damage is the formation of 8-hydroxy-2'-deoxyguanosine (8-OHdG), which can cause mutations when not repaired properly by 8-oxoguanine DNA glycosylase (Ogg1). Although the mtDNA repair machinery has been described in cardiac myocytes, the regulation of this repair has been incompletely investigated. Here we report that the hearts of type 1 diabetic mice, despite having increased Ogg1 protein levels, had significantly lower Ogg1 activity than the hearts of control, non-type 1 diabetic mice. In diabetic hearts, we further observed increased levels of 8-OHdG and an increased amount of mtDNA damage. Interestingly, Ogg1 was found to be highly O-GlcNAcylated in diabetic mice compared with controls. In vitro experiments demonstrated that O-GlcNAcylation inhibits Ogg1 activity, which could explain the mtDNA lesion accumulation observed in vivo Reducing Ogg1 O-GlcNAcylation in vivo by introducing a dominant negative O-GlcNAc transferase mutant (F460A) restored Ogg1 enzymatic activity and, consequently, reduced 8-OHdG and mtDNA damage despite the adverse hyperglycemic milieu. Taken together, our results implicate hyperglycemia-induced O-GlcNAcylation of Ogg1 in increased mtDNA damage and, therefore, provide a new plausible biochemical mechanism for diabetic cardiomyopathy.

  12. Physical association of pyrimidine dimer DNA glycosylase and apurinic/apyrimidinic DNA endonuclease essential for repair of ultraviolet-damaged DNA

    SciTech Connect

    Nakabeppu, Y.; Sekiguchi, M.

    1981-05-01

    T4 endonuclease, which is involved in repair of uv-damaged DNA, has been purified to apparent physical homogeneity. Incubation of uv-irradiated poly(dA).poly(dT) with the purified enzyme preparations resulted in production of alkali-labile apyrimidinic sites, followed by formation of nicks in the polymer. By performing a limited reaction with T4 endonuclease V at pH 8.5, irradiated polymer was converted to an intermediate form that carried a large number of alkali-labile sites but only a few nicks. The intermediate was used as substrate for the assay of apurinic/apyrimidinic DNA endonuclease activity. The two activities, a pyrimidine dimer DNA glycosylase and an apurinic/apyrimidinic DNA endonuclease, were copurified and found in enzyme preparations that contained only a 16,000-dalton polypeptide. These results strongly suggested that a DNA glycosylase specific for pyrimidine dimers and an apurinic/apyrimidinic DNA endonuclease reside in a single polypeptide chain coded by the denV gene of bacteriophage T4.

  13. A Catalytic Role for C-H/π Interactions in Base Excision Repair by Bacillus cereus DNA Glycosylase AlkD.

    PubMed

    Parsons, Zachary D; Bland, Joshua M; Mullins, Elwood A; Eichman, Brandt F

    2016-09-14

    DNA glycosylases protect genomic integrity by locating and excising aberrant nucleobases. Substrate recognition and excision usually take place in an extrahelical conformation, which is often stabilized by π-stacking interactions between the lesion nucleobase and aromatic side chains in the glycosylase active site. Bacillus cereus AlkD is the only DNA glycosylase known to catalyze base excision without extruding the damaged nucleotide from the DNA helix. Instead of contacting the nucleobase itself, the AlkD active site interacts with the lesion deoxyribose through a series of C-H/π interactions. These interactions are ubiquitous in protein structures, but evidence for their catalytic significance in enzymology is lacking. Here, we show that the C-H/π interactions between AlkD and the lesion deoxyribose participate in catalysis of glycosidic bond cleavage. This is the first demonstration of a catalytic role for C-H/π interactions as intermolecular forces important to DNA repair.

  14. Expansion Mechanisms and Evolutionary History on Genes Encoding DNA Glycosylases and Their Involvement in Stress and Hormone Signaling

    PubMed Central

    Jiang, Shu-Ye; Ramachandran, Srinivasan

    2016-01-01

    DNA glycosylases catalyze the release of methylated bases. They play vital roles in the base excision repair pathway and might also function in DNA demethylation. At least three families of DNA glycosylases have been identified, which included 3′-methyladenine DNA glycosylase (MDG) I, MDG II, and HhH-GPD (Helix–hairpin–Helix and Glycine/Proline/aspartate (D)). However, little is known on their genome-wide identification, expansion, and evolutionary history as well as their expression profiling and biological functions. In this study, we have genome-widely identified and evolutionarily characterized these family members. Generally, a genome encodes only one MDG II gene in most of organisms. No MDG I or MDG II gene was detected in green algae. However, HhH-GPD genes were detectable in all available organisms. The ancestor species contain small size of MDG I and HhH-GPD families. These two families were mainly expanded through the whole-genome duplication and segmental duplication. They were evolutionarily conserved and were generally under purifying selection. However, we have detected recent positive selection among the Oryza genus, which might play roles in species divergence. Further investigation showed that expression divergence played important roles in gene survival after expansion. All of these family genes were expressed in most of developmental stages and tissues in rice plants. High ratios of family genes were downregulated by drought and fungus pathogen as well as abscisic acid (ABA) and jasmonic acid (JA) treatments, suggesting a negative regulation in response to drought stress and pathogen infection through ABA- and/or JA-dependent hormone signaling pathway. PMID:27026054

  15. Inhibition of uracil DNA glycosylase sensitizes cancer cells to 5-fluorodeoxyuridine through replication fork collapse-induced DNA damage

    PubMed Central

    Yan, Yan; Han, Xiangzi; Qing, Yulan; Condie, Allison G.; Gorityala, Shashank; Yang, Shuming; Xu, Yan; Zhang, Youwei; Gerson, Stanton L.

    2016-01-01

    5-fluorodeoxyuridine (5-FdU, floxuridine) is active against multiple cancers through the inhibition of thymidylate synthase, which consequently introduces uracil and 5-FU incorporation into the genome. Uracil DNA glycosylase (UDG) is one of the main enzymes responsible for the removal of uracil and 5-FU. However, how exactly UDG mediates cellular sensitivity to 5-FdU, and if so whether it is through its ability to remove uracil and 5-FU have not been well characterized. In this study, we report that UDG depletion led to incorporation of uracil and 5-FU in DNA following 5-FdU treatment and significantly enhanced 5-FdU's cytotoxicity in cancer cell lines. Co-treatment, but not post-treatment with thymidine prevented cell death of UDG depleted cells by 5-FdU, indicating that the enhanced cytotoxicity is due to the retention of uracil and 5-FU in genomic DNA in the absence of UDG. Furthermore, UDG depleted cells were arrested at late G1 and early S phase by 5-FdU, followed by accumulation of sub-G1 population indicating cell death. Mechanistically, 5-FdU dramatically reduced DNA replication speed in UDG depleted cells. UDG depletion also greatly enhanced DNA damage as shown by γH2AX foci formation. Notably, the increased γH2AX foci formation was not suppressed by caspase inhibitor treatment, suggesting that DNA damage precedes cell death induced by 5-FdU. Together, these data provide novel mechanistic insights into the roles of UDG in DNA replication, damage repair, and cell death in response to 5-FdU and suggest that UDG is a target for improving the anticancer effect of this agent. PMID:27517750

  16. ROS1 5-methylcytosine DNA glycosylase is a slow-turnover catalyst that initiates DNA demethylation in a distributive fashion

    PubMed Central

    Ponferrada-Marín, María Isabel; Roldán-Arjona, Teresa; Ariza, Rafael R.

    2009-01-01

    Arabidopsis ROS1 belongs to a family of plant 5-methycytosine DNA glycosylases that initiate DNA demethylation through base excision. ROS1 displays the remarkable capacity to excise 5-meC, and to a lesser extent T, while retaining the ability to discriminate effectively against C and U. We found that replacement of the C5-methyl group by halogen substituents greatly decreased excision of the target base. Furthermore, 5-meC was excised more efficiently from mismatches, whereas excision of T only occurred when mispaired with G. These results suggest that ROS1 specificity arises by a combination of selective recognition at the active site and thermodynamic stability of the target base. We also found that ROS1 is a low-turnover catalyst because it binds tightly to the abasic site left after 5-meC removal. This binding leads to a highly distributive behaviour of the enzyme on DNA substrates containing multiple 5-meC residues, and may help to avoid generation of double-strand breaks during processing of bimethylated CG dinucleotides. We conclude that the biochemical properties of ROS1 are consistent with its proposed role in protecting the plant genome from excess methylation. PMID:19443451

  17. The Potential Role of 8-Oxoguanine DNA Glycosylase-Driven DNA Base Excision Repair in Exercise-Induced Asthma

    PubMed Central

    Belanger, KarryAnne K.; Ameredes, Bill T.; Boldogh, Istvan

    2016-01-01

    Asthma is characterized by reversible airway narrowing, shortness of breath, wheezing, coughing, and other symptoms driven by chronic inflammatory processes, commonly triggered by allergens. In 90% of asthmatics, most of these symptoms can also be triggered by intense physical activities and severely exacerbated by environmental factors. This condition is known as exercise-induced asthma (EIA). Current theories explaining EIA pathogenesis involve osmotic and/or thermal alterations in the airways caused by changes in respiratory airflow during exercise. These changes, along with existing airway inflammatory conditions, are associated with increased cellular levels of reactive oxygen species (ROS) affecting important biomolecules including DNA, although the underlying molecular mechanisms have not been completely elucidated. One of the most abundant oxidative DNA lesions is 8-oxoguanine (8-oxoG), which is repaired by 8-oxoguanine DNA glycosylase 1 (OGG1) during the base excision repair (BER) pathway. Whole-genome expression analyses suggest a cellular response to OGG1-BER, involving genes that may have a role in the pathophysiology of EIA leading to mast cell degranulation, airway hyperresponsiveness, and bronchoconstriction. Accordingly, this review discusses a potential new hypothesis in which OGG1-BER-induced gene expression is associated with EIA symptoms. PMID:27524866

  18. ROS1 5-methylcytosine DNA glycosylase is a slow-turnover catalyst that initiates DNA demethylation in a distributive fashion.

    PubMed

    Ponferrada-Marín, María Isabel; Roldán-Arjona, Teresa; Ariza, Rafael R

    2009-07-01

    Arabidopsis ROS1 belongs to a family of plant 5-methycytosine DNA glycosylases that initiate DNA demethylation through base excision. ROS1 displays the remarkable capacity to excise 5-meC, and to a lesser extent T, while retaining the ability to discriminate effectively against C and U. We found that replacement of the C5-methyl group by halogen substituents greatly decreased excision of the target base. Furthermore, 5-meC was excised more efficiently from mismatches, whereas excision of T only occurred when mispaired with G. These results suggest that ROS1 specificity arises by a combination of selective recognition at the active site and thermodynamic stability of the target base. We also found that ROS1 is a low-turnover catalyst because it binds tightly to the abasic site left after 5-meC removal. This binding leads to a highly distributive behaviour of the enzyme on DNA substrates containing multiple 5-meC residues, and may help to avoid generation of double-strand breaks during processing of bimethylated CG dinucleotides. We conclude that the biochemical properties of ROS1 are consistent with its proposed role in protecting the plant genome from excess methylation.

  19. The human Werner syndrome protein stimulates repair of oxidative DNA base damage by the DNA glycosylase NEIL1.

    PubMed

    Das, Aditi; Boldogh, Istvan; Lee, Jae Wan; Harrigan, Jeanine A; Hegde, Muralidhar L; Piotrowski, Jason; de Souza Pinto, Nadja; Ramos, William; Greenberg, Marc M; Hazra, Tapas K; Mitra, Sankar; Bohr, Vilhelm A

    2007-09-07

    The mammalian DNA glycosylase, NEIL1, specific for repair of oxidatively damaged bases in the genome via the base excision repair pathway, is activated by reactive oxygen species and prevents toxicity due to radiation. We show here that the Werner syndrome protein (WRN), a member of the RecQ family of DNA helicases, associates with NEIL1 in the early damage-sensing step of base excision repair. WRN stimulates NEIL1 in excision of oxidative lesions from bubble DNA substrates. The binary interaction between NEIL1 and WRN (K(D) = 60 nM) involves C-terminal residues 288-349 of NEIL1 and the RecQ C-terminal (RQC) region of WRN, and is independent of the helicase activity WRN. Exposure to oxidative stress enhances the NEIL-WRN association concomitant with their strong nuclear co-localization. WRN-depleted cells accumulate some prototypical oxidized bases (e.g. 8-oxoguanine, FapyG, and FapyA) indicating a physiological function of WRN in oxidative damage repair in mammalian genomes. Interestingly, WRN deficiency does not have an additive effect on in vivo damage accumulation in NEIL1 knockdown cells suggesting that WRN participates in the same repair pathway as NEIL1.

  20. Sequence-dependent Structural Variation in DNA Undergoing Intrahelical Inspection by the DNA glycosylase MutM

    SciTech Connect

    Sung, Rou-Jia; Zhang, Michael; Qi, Yan; Verdine, Gregory L.

    2012-08-31

    MutM, a bacterial DNA-glycosylase, plays a critical role in maintaining genome integrity by catalyzing glycosidic bond cleavage of 8-oxoguanine (oxoG) lesions to initiate base excision DNA repair. The task faced by MutM of locating rare oxoG residues embedded in an overwhelming excess of undamaged bases is especially challenging given the close structural similarity between oxoG and its normal progenitor, guanine (G). MutM actively interrogates the DNA to detect the presence of an intrahelical, fully base-paired oxoG, whereupon the enzyme promotes extrusion of the target nucleobase from the DNA duplex and insertion into the extrahelical active site. Recent structural studies have begun to provide the first glimpse into the protein-DNA interactions that enable MutM to distinguish an intrahelical oxoG from G; however, these initial studies left open the important question of how MutM can recognize oxoG residues embedded in 16 different neighboring sequence contexts (considering only the 5'- and 3'-neighboring base pairs). In this study we set out to understand the manner and extent to which intrahelical lesion recognition varies as a function of the 5'-neighbor. Here we report a comprehensive, systematic structural analysis of the effect of the 5'-neighboring base pair on recognition of an intrahelical oxoG lesion. These structures reveal that MutM imposes the same extrusion-prone ('extrudogenic') backbone conformation on the oxoG lesion irrespective of its 5'-neighbor while leaving the rest of the DNA relatively free to adjust to the particular demands of individual sequences.

  1. The C-terminal Lysine of Ogg2 DNA Glycosylases is a Major Molecular Determinant for Guanine/8-Oxoguanine Distinction

    SciTech Connect

    Faucher, Frédérick; Wallace, Susan S.; Doublié, Sylvie

    2010-08-12

    7,8-Dihydro-8-oxoguanine (8-oxoG) is a major oxidative lesion found in DNA. The 8-oxoguanine DNA glycosylases (Ogg) responsible for the removal of 8-oxoG are divided into three families Ogg1, Ogg2 and AGOG. The Ogg2 members are devoid of the recognition loop used by Ogg1 to discriminate between 8-oxoG and guanine and it was unclear until recently how Ogg2 enzymes recognize the oxidized base. We present here the first crystallographic structure of an Ogg2 member, Methanocaldococcus janischii Ogg, in complex with a DNA duplex containing the 8-oxoG lesion. This structure highlights the crucial role of the C-terminal lysine, strictly conserved in Ogg2, in the recognition of 8-oxoG. The structure also reveals that Ogg2 undergoes a conformational change upon DNA binding similar to that observed in Ogg1 glycosylases. Furthermore, this work provides a structural rationale for the lack of opposite base specificity in this family of enzymes.

  2. The human oxidative DNA glycosylase NEIL1 excises psoralen-induced interstrand DNA cross-links in a three-stranded DNA structure.

    PubMed

    Couvé, Sophie; Macé-Aimé, Gaëtane; Rosselli, Filippo; Saparbaev, Murat K

    2009-05-01

    Previously, we have demonstrated that human oxidative DNA glycosylase NEIL1 excises photoactivated psoralen-induced monoadducts but not genuine interstrand cross-links (ICLs) in duplex DNA. It has been postulated that the repair of ICLs in mammalian cells is mainly linked to DNA replication and proceeds via dual incisions in one DNA strand that bracket the cross-linked site. This process, known as "unhooking," enables strand separation and translesion DNA synthesis through the gap, yielding a three-stranded DNA repair intermediate composed of a short unhooked oligomer covalently bound to the duplex. At present, the detailed molecular mechanism of ICL repair in mammalian cells remains unclear. Here, we constructed and characterized three-stranded DNA structures containing a single ICL as substrates for the base excision repair proteins. We show that NEIL1 excises with high efficiency the unhooked ICL fragment within a three-stranded DNA structure. Complete reconstitution of the repair of unhooked ICL shows that it can be processed in a short patch base excision repair pathway. The new substrate specificity of NEIL1 points to a preferential involvement in the replication-associated repair of ICLs. Based on these data, we propose a model for the mechanism of ICL repair in mammalian cells that implicates the DNA glycosylase activity of NEIL1 downstream of Xeroderma Pigmentosum group F/Excision Repair Cross-Complementing 1 endonuclease complex (XPF/ERCC1) and translesion DNA synthesis repair steps. Finally, our data demonstrate that Nei-like proteins from Escherichia coli to human cells can excise bulky unhooked psoralen-induced ICLs via hydrolysis of glycosidic bond between cross-linked base and deoxyribose sugar, thus providing an alternative heuristic solution for the removal of complex DNA lesions.

  3. Crystallization and preliminary X-ray diffraction analysis of three recombinant mutants of Vaccinia virus uracil DNA glycosylase

    PubMed Central

    Sartmatova, Darika; Nash, Taishayla; Schormann, Norbert; Nuth, Manunya; Ricciardi, Robert; Banerjee, Surajit; Chattopadhyay, Debasish

    2013-01-01

    Amino-acid residues located at a highly flexible area in the uracil DNA glycosylase of Vaccinia virus were mutated. In the crystal structure of wild-type D4 these residues lie at the dimer interface. Specifically, three mutants were generated: (i) residue Arg167 was replaced with an alanine (R167AD4), (ii) residues Glu171, Ser172 and Pro173 were substituted with three glycine residues (3GD4) and (iii) residues Glu171 and Ser172 were deleted (Δ171-172D4). Mutant proteins were expressed, purified and crystallized in order to investigate the effects of these mutations on the structure of the protein. PMID:23519808

  4. Crystallization and preliminary X-ray diffraction analysis of three recombinant mutants of Vaccinia virus uracil DNA glycosylase.

    PubMed

    Sartmatova, Darika; Nash, Taishayla; Schormann, Norbert; Nuth, Manunya; Ricciardi, Robert; Banerjee, Surajit; Chattopadhyay, Debasish

    2013-03-01

    Amino-acid residues located at a highly flexible area in the uracil DNA glycosylase of Vaccinia virus were mutated. In the crystal structure of wild-type D4 these residues lie at the dimer interface. Specifically, three mutants were generated: (i) residue Arg167 was replaced with an alanine (R167AD4), (ii) residues Glu171, Ser172 and Pro173 were substituted with three glycine residues (3GD4) and (iii) residues Glu171 and Ser172 were deleted (Δ171-172D4). Mutant proteins were expressed, purified and crystallized in order to investigate the effects of these mutations on the structure of the protein.

  5. Structural and Biochemical Analysis of DNA Helix Invasion by the Bacterial 8-Oxoguanine DNA Glycosylase MutM*

    PubMed Central

    Sung, Rou-Jia; Zhang, Michael; Qi, Yan; Verdine, Gregory L.

    2013-01-01

    MutM is a bacterial DNA glycosylase that serves as the first line of defense against the highly mutagenic 8-oxoguanine (oxoG) lesion, catalyzing glycosidic bond cleavage of oxoG to initiate base excision DNA repair. Previous work has shown that MutM actively interrogates DNA for the presence of an intrahelical oxoG lesion. This interrogation process involves significant buckling and bending of the DNA to promote extrusion of oxoG from the duplex. Structural snapshots have revealed several different highly conserved residues that are prominently inserted into the duplex in the vicinity of the target oxoG before and after base extrusion has occurred. However, the roles of these helix-invading residues during the lesion recognition and base extrusion process remain unclear. In this study, we set out to probe the function of residues Phe114 and Met77 in oxoG recognition and repair. Here we report a detailed biochemical and structural characterization of MutM variants containing either a F114A or M77A mutation, both of which showed significant decreases in the efficiency of oxoG repair. These data reveal that Met77 plays an important role in stabilizing the lesion-extruded conformation of the DNA. Phe114, on the other hand, appears to destabilize the intrahelical state of the oxoG lesion, primarily by buckling the target base pair. We report the observation of a completely unexpected interaction state, in which the target base pair is ruptured but remains fully intrahelical; this structure vividly illustrates the disruptive influence of MutM on the target base pair. PMID:23404556

  6. Uracil DNA glycosylase initiates degradation of HIV-1 cDNA containing misincorporated dUTP and prevents viral integration

    PubMed Central

    Weil, Amy F.; Ghosh, Devlina; Zhou, Yan; Seiple, Lauren; McMahon, Moira A.; Spivak, Adam M.; Siliciano, Robert F.; Stivers, James T.

    2013-01-01

    HIV-1 reverse transcriptase discriminates poorly between dUTP and dTTP, and accordingly, viral DNA products become heavily uracilated when viruses infect host cells that contain high ratios of dUTP:dTTP. Uracilation of invading retroviral DNA is thought to be an innate immunity barrier to retroviral infection, but the mechanistic features of this immune pathway and the cellular fate of uracilated retroviral DNA products is not known. Here we developed a model system in which the cellular dUTP:dTTP ratio can be pharmacologically increased to favor dUTP incorporation, allowing dissection of this innate immunity pathway. When the virus-infected cells contained elevated dUTP levels, reverse transcription was found to proceed unperturbed, but integration and viral protein expression were largely blocked. Furthermore, successfully integrated proviruses lacked detectable uracil, suggesting that only nonuracilated viral DNA products were integration competent. Integration of the uracilated proviruses was restored using an isogenic cell line that had no detectable human uracil DNA glycosylase (hUNG2) activity, establishing that hUNG2 is a host restriction factor in cells that contain high dUTP. Biochemical studies in primary cells established that this immune pathway is not operative in CD4+ T cells, because these cells have high dUTPase activity (low dUTP), and only modest levels of hUNG activity. Although monocyte-derived macrophages have high dUTP levels, these cells have low hUNG activity, which may diminish the effectiveness of this restriction pathway. These findings establish the essential elements of this pathway and reconcile diverse observations in the literature. PMID:23341616

  7. 8-oxoguanine DNA glycosylase 1-deficiency modifies allergic airway inflammation by regulating STAT6 and IL-4 in cells and in mice

    USDA-ARS?s Scientific Manuscript database

    Background: 8-oxoguanine-DNA glycosylase (OGG-1) is an enzyme involved in DNA repair. OGG-1 has a potential role in regulating inflammation but its function in modulating allergic diseases remains undefined. Objectives: To investigate the role of OGG-1 in mediating allergic inflammation, we used OGG...

  8. Analysis of the impact of a uracil DNA glycosylase attenuated in AP-DNA binding in maintenance of the genomic integrity in Escherichia coli

    PubMed Central

    Bharti, Sanjay Kumar; Varshney, Umesh

    2010-01-01

    Uracil DNA glycosylase (Ung) initiates the uracil excision repair pathway. We have earlier characterized the Y66W and Y66H mutants of Ung and shown that they are compromised by ∼7- and ∼170-fold, respectively in their uracil excision activities. In this study, fluorescence anisotropy measurements show that compared with the wild-type, the Y66W protein is moderately compromised and attenuated in binding to AP-DNA. Allelic exchange of ung in Escherichia coli with ung::kan, ungY66H:amp or ungY66W:amp alleles showed ∼5-, ∼3.0- and ∼2.0-fold, respectively increase in mutation frequencies. Analysis of mutations in the rifampicin resistance determining region of rpoB revealed that the Y66W allele resulted in an increase in A to G (or T to C) mutations. However, the increase in A to G mutations was mitigated upon expression of wild-type Ung from a plasmid borne gene. Biochemical and computational analyses showed that the Y66W mutant maintains strict specificity for uracil excision from DNA. Interestingly, a strain deficient in AP-endonucleases also showed an increase in A to G mutations. We discuss these findings in the context of a proposal that the residency of DNA glycosylase(s) onto the AP-sites they generate shields them until recruitment of AP-endonucleases for further repair. PMID:20056657

  9. N-methylpurine DNA glycosylase overexpression increases alkylation sensitivity by rapidly removing non-toxic 7-methylguanine adducts

    PubMed Central

    Rinne, M. L.; He, Y.; Pachkowski, B. F.; Nakamura, J.; Kelley, M. R.

    2005-01-01

    Previous studies indicate that overexpression of N-methylpurine DNA glycosylase (MPG) dramatically sensitizes cells to alkylating agent-induced cytotoxicity. We recently demonstrated that this sensitivity is preceded by an increased production of AP sites and strand breaks, confirming that overexpression of MPG disrupts normal base excision repair and causes cell death through overproduction of toxic repair intermediates. Here we establish through site-directed mutagenesis that MPG-induced sensitivity to alkylation is dependent on enzyme glycosylase activity. However, in contrast to the sensitivity seen to heterogeneous alkylating agents, MPG overexpression generates no cellular sensitivity to MeOSO2(CH2)2-lexitropsin, an alkylator which exclusively induces 3-meA lesions. Indeed, MPG overexpression has been shown to increase the toxicity of alkylating agents that produce 7-meG adducts, and here we demonstrate that MPG-overexpressing cells have dramatically increased removal of 7-meG from their DNA. These data suggest that the mechanism of MPG-induced cytotoxicity involves the conversion of non-toxic 7-meG lesions into highly toxic repair intermediates. This study establishes a mechanism by which a benign DNA modification can be made toxic through the overexpression of an otherwise well-tolerated gene product, and the application of this principle could lead to improved chemotherapeutic strategies that reduce the peripheral toxicity of alkylating agents. PMID:15905475

  10. Metal inhibition of human alkylpurine-DNA-N-glycosylase activityin base excision repair

    SciTech Connect

    Wang, Ping; Guliaev, Anton B.; Hang, Bo

    2006-02-28

    Cadmium (Cd{sup 2+}), nickel (Ni{sup 2+}) and cobalt (Co{sup 2+}) are human and/or animal carcinogens. Zinc (Zn{sup 2+}) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (var epsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1000 {micro}M, both Cd{sup 2+} and Zn{sup 2+} showed metal-dependent inhibition of the MPG catalytic activity. Ni{sup 2+} also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co{sup 2+} and Mg{sup 2+} did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the var epsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd{sup 2+}, Zn{sup 2+}, and Ni{sup 2+} at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn{sup 2+} showed that the MPG active site has a potential binding site for Zn{sup 2+}, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  11. Structure of T4 pyrimidine dimer glycosylase in a reduced imine covalent complex with abasic site-containing DNA.

    PubMed

    Golan, Gali; Zharkov, Dmitry O; Grollman, Arthur P; Dodson, M L; McCullough, Amanda K; Lloyd, R Stephen; Shoham, Gil

    2006-09-15

    The base excision repair (BER) pathway for ultraviolet light (UV)-induced cyclobutane pyrimidine dimers is initiated by DNA glycosylases that also possess abasic (AP) site lyase activity. The prototypical enzyme known to catalyze these reactions is the T4 pyrimidine dimer glycosylase (T4-Pdg). The fundamental chemical reactions and the critical amino acids that lead to both glycosyl and phosphodiester bond scission are known. Catalysis proceeds via a protonated imine covalent intermediate between the alpha-amino group of the N-terminal threonine residue and the C1' of the deoxyribose sugar of the 5' pyrimidine at the dimer site. This covalent complex can be trapped as an irreversible, reduced cross-linked DNA-protein complex by incubation with a strong reducing agent. This active site trapping reaction is equally efficient on DNA substrates containing pyrimidine dimers or AP sites. Herein, we report the co-crystal structure of T4-Pdg as a reduced covalent complex with an AP site-containing duplex oligodeoxynucleotide. This high-resolution structure reveals essential precatalytic and catalytic features, including flipping of the nucleotide opposite the AP site, a sharp kink (approximately 66 degrees ) in the DNA at the dimer site and the covalent bond linking the enzyme to the DNA. Superposition of this structure with a previously published co-crystal structure of a catalytically incompetent mutant of T4-Pdg with cyclobutane dimer-containing DNA reveals new insights into the structural requirements and the mechanisms involved in DNA bending, nucleotide flipping and catalytic reaction.

  12. Effect of the multifunctional proteins RPA, YB-1, and XPC repair factor on AP site cleavage by DNA glycosylase NEIL1.

    PubMed

    Pestryakov, Pavel; Zharkov, Dmitry O; Grin, Inga; Fomina, Elizaveta E; Kim, Ekaterina R; Hamon, Loïc; Eliseeva, Irina A; Petruseva, Irina O; Curmi, Patrick A; Ovchinnikov, Lev P; Lavrik, Olga I

    2012-04-01

    DNA glycosylases are key enzymes in the first step of base excision DNA repair, recognizing DNA damage and catalyzing the release of damaged nucleobases. Bifunctional DNA glycosylases also possess associated apurinic/apyrimidinic (AP) lyase activity that nick the damaged DNA strand at an abasic (or AP) site, formed either spontaneously or at the first step of repair. NEIL1 is a bifunctional DNA glycosylase capable of processing lesions, including AP sites, not only in double-stranded but also in single-stranded DNA. Here, we show that proteins participating in DNA damage response, YB-1 and RPA, affect AP site cleavage by NEIL1. Stimulation of the AP lyase activity of NEIL1 was observed when an AP site was located in a 60 nt-long double-stranded DNA. Both RPA and YB-1 inhibited AP site cleavage by NEIL1 when the AP site was located in single-stranded DNA. Taking into account a direct interaction of YB-1 with the AP site, located in single-stranded DNA, and the high affinity of both YB-1 and RPA for single-stranded DNA, this behavior is presumably a consequence of a competition with NEIL1 for the DNA substrate. Xeroderma pigmentosum complementation group C protein (XPC), a key protein of another DNA repair pathway, was shown to interact directly with AP sites but had no effect on AP site cleavage by NEIL1.

  13. Partial uracil-DNA-glycosylase treatment for screening of ancient DNA.

    PubMed

    Rohland, Nadin; Harney, Eadaoin; Mallick, Swapan; Nordenfelt, Susanne; Reich, David

    2015-01-19

    The challenge of sequencing ancient DNA has led to the development of specialized laboratory protocols that have focused on reducing contamination and maximizing the number of molecules that are extracted from ancient remains. Despite the fact that success in ancient DNA studies is typically obtained by screening many samples to identify a promising subset, ancient DNA protocols have not, in general, focused on reducing the time required to screen samples. We present an adaptation of a popular ancient library preparation method that makes screening more efficient. First, the DNA extract is treated using a protocol that causes characteristic ancient DNA damage to be restricted to the terminal nucleotides, while nearly eliminating it in the interior of the DNA molecules, allowing a single library to be used both to test for ancient DNA authenticity and to carry out population genetic analysis. Second, the DNA molecules are ligated to a unique pair of barcodes, which eliminates undetected cross-contamination from this step onwards. Third, the barcoded library molecules include incomplete adapters of short length that can increase the specificity of hybridization-based genomic target enrichment. The adapters are completed just before sequencing, so the same DNA library can be used in multiple experiments, and the sequences distinguished. We demonstrate this protocol on 60 ancient human samples.

  14. Phosphorylation Sites Identified in the NEIL1 DNA Glycosylase Are Potential Targets for the JNK1 Kinase

    PubMed Central

    Prakash, Aishwarya; Cao, Vy Bao; Doublié, Sylvie

    2016-01-01

    The NEIL1 DNA glycosylase is one of eleven mammalian DNA glycosylases that partake in the first step of the base excision repair (BER) pathway. NEIL1 recognizes and cleaves mainly oxidized pyrimidines from DNA. The past decade has witnessed the identification of an increasing number of post-translational modifications (PTMs) in BER enzymes including phosphorylation, acetylation, and sumoylation, which modulate enzyme function. In this work, we performed the first comprehensive analysis of phosphorylation sites in human NEIL1 expressed in human cells. Mass spectrometry (MS) analysis revealed phosphorylation at three serine residues: S207, S306, and a third novel site, S61. We expressed, purified, and characterized phosphomimetic (glutamate) and phosphoablating (alanine) mutants of the three phosphorylation sites in NEIL1 revealed by the MS analysis. All mutant enzymes were active and bound tightly to DNA, indicating that phosphorylation does not affect DNA binding and enzyme activity at these three serine sites. We also characterized phosphomimetic mutants of two other sites of phosphorylation, Y263 and S269, reported previously, and observed that mutation of Y263 to E yielded a completely inactive enzyme. Furthermore, based on sequence motifs and kinase prediction algorithms, we identified the c-Jun N-terminal kinase 1 (JNK1) as the kinase involved in the phosphorylation of NEIL1. JNK1, a member of the mitogen activated protein kinase (MAPK) family, was detected in NEIL1 immunoprecipitates, interacted with NEIL1 in vitro, and was able to phosphorylate the enzyme at residues S207, S306, and S61. PMID:27518429

  15. Down-regulation of 8-oxoguanine DNA glycosylase 1 expression in the airway epithelium ameliorates allergic lung inflammation.

    PubMed

    Bacsi, Attila; Aguilera-Aguirre, Leopoldo; Szczesny, Bartosz; Radak, Zsolt; Hazra, Tapas K; Sur, Sanjiv; Ba, Xueqing; Boldogh, Istvan

    2013-01-01

    Allergic airway inflammation is characterized by increased expression of pro-inflammatory mediators, inflammatory cell infiltration, mucus hypersecretion, and airway hyperresponsiveness, in parallel with oxidative DNA base and strand damage, whose etiological role is not understood. Our goal was to establish the role of 8-oxoguanine (8-oxoG), a common oxidatively damaged base, and its repair by 8-oxoguanine DNA glycosylase 1 (Ogg1) in allergic airway inflammatory processes. Airway inflammation was induced by intranasally administered ragweed (Ambrosia artemisiifolia) pollen grain extract (RWPE) in sensitized BALB/c mice. We utilized siRNA technology to deplete Ogg1 from airway epithelium; 8-oxoG and DNA strand break levels were quantified by Comet assays. Inflammatory cell infiltration and epithelial methaplasia were determined histologically, mucus and cytokines levels biochemically and enhanced pause was used as the main index of airway hyperresponsiveness. Decreased Ogg1 expression and thereby 8-oxoG repair in the airway epithelium conveyed a lower inflammatory response after RWPE challenge of sensitized mice, as determined by expression of Th2 cytokines, eosinophilia, epithelial methaplasia, and airway hyperresponsiveness. In contrast, 8-oxoG repair in Ogg1-proficient airway epithelium was coupled to an increase in DNA single-strand break (SSB) levels and exacerbation of allergen challenge-dependent inflammation. Decreased expression of the Nei-like glycosylases Neil1 and Neil2 that preferentially excise ring-opened purines and 5-hydroxyuracil, respectively, did not alter the above parameters of allergic immune responses to RWPE. These results show that DNA SSBs formed during Ogg1-mediated repair of 8-oxoG augment antigen-driven allergic immune responses. A transient modulation of OGG1 expression/activity in airway epithelial cells could have clinical benefits.

  16. Arabidopsis ZDP DNA 3'-phosphatase and ARP endonuclease function in 8-oxoG repair initiated by FPG and OGG1 DNA glycosylases.

    PubMed

    Córdoba-Cañero, Dolores; Roldán-Arjona, Teresa; Ariza, Rafael R

    2014-09-01

    Oxidation of guanine in DNA generates 7,8-dihydro-8-oxoguanine (8-oxoG), an ubiquitous lesion with mutagenic properties. 8-oxoG is primarily removed by DNA glycosylases distributed in two families, typified by bacterial Fpg proteins and eukaryotic Ogg1 proteins. Interestingly, plants possess both Fpg and Ogg1 homologs but their relative contributions to 8-oxoG repair remain uncertain. In this work we used Arabidopsis cell-free extracts to monitor 8-oxoG repair in wild-type and mutant plants. We found that both FPG and OGG1 catalyze excision of 8-oxoG in Arabidopsis cell extracts by a DNA glycosylase/lyase mechanism, and generate repair intermediates with blocked 3'-termini. An increase in oxidative damage is detected in both nuclear and mitochondrial DNA from double fpg ogg1 mutants, but not in single mutants, which suggests that a single deficiency in one of these DNA glycosylases may be compensated by the other. We also found that the DNA 3'-phosphatase ZDP (zinc finger DNA 3'-phosphoesterase) and the AP(apurinic/apyirmidinic) endonuclease ARP(apurinic endonuclease redox protein) are required in the 8-oxoG repair pathway to process the 3'-blocking ends generated by FPG and OGG1. Furthermore, deficiencies in ZDP and/or ARP decrease germination ability after seed deteriorating conditions. Altogether, our results suggest that Arabidopsis cells use both FPG and OGG1 to repair 8-oxoG in a pathway that requires ZDP and ARP in downstream steps.

  17. Structure of Escherichia coli AlkA in Complex with Undamaged DNA

    DOE PAGES

    Bowman, Brian R.; Lee, Seongmin; Wang, Shuyu; ...

    2010-11-22

    Because DNA damage is so rare, DNA glycosylases interact for the most part with undamaged DNA. Whereas the structural basis for recognition of DNA lesions by glycosylases has been studied extensively, less is known about the nature of the interaction between these proteins and undamaged DNA. Here we report the crystal structures of the DNA glycosylase AlkA in complex with undamaged DNA. The structures revealed a recognition mode in which the DNA is nearly straight, with no amino acid side chains inserted into the duplex, and the target base pair is fully intrahelical. A comparison of the present structures withmore » that of AlkA recognizing an extrahelical lesion revealed conformational changes in both the DNA and protein as the glycosylase transitions from the interrogation of undamaged DNA to catalysis of nucleobase excision. Modeling studies with the cytotoxic lesion 3-methyladenine and accompanying biochemical experiments suggested that AlkA actively interrogates the minor groove of the DNA while probing for the presence of lesions.« less

  18. Structure of Escherichia coli AlkA in Complex with Undamaged DNA

    SciTech Connect

    Bowman, Brian R.; Lee, Seongmin; Wang, Shuyu; Verdine, Gregory L

    2010-11-22

    Because DNA damage is so rare, DNA glycosylases interact for the most part with undamaged DNA. Whereas the structural basis for recognition of DNA lesions by glycosylases has been studied extensively, less is known about the nature of the interaction between these proteins and undamaged DNA. Here we report the crystal structures of the DNA glycosylase AlkA in complex with undamaged DNA. The structures revealed a recognition mode in which the DNA is nearly straight, with no amino acid side chains inserted into the duplex, and the target base pair is fully intrahelical. A comparison of the present structures with that of AlkA recognizing an extrahelical lesion revealed conformational changes in both the DNA and protein as the glycosylase transitions from the interrogation of undamaged DNA to catalysis of nucleobase excision. Modeling studies with the cytotoxic lesion 3-methyladenine and accompanying biochemical experiments suggested that AlkA actively interrogates the minor groove of the DNA while probing for the presence of lesions.

  19. Structure of Escherichia coli AlkA in Complex with Undamaged DNA*

    PubMed Central

    Bowman, Brian R.; Lee, Seongmin; Wang, Shuyu; Verdine, Gregory L.

    2010-01-01

    Because DNA damage is so rare, DNA glycosylases interact for the most part with undamaged DNA. Whereas the structural basis for recognition of DNA lesions by glycosylases has been studied extensively, less is known about the nature of the interaction between these proteins and undamaged DNA. Here we report the crystal structures of the DNA glycosylase AlkA in complex with undamaged DNA. The structures revealed a recognition mode in which the DNA is nearly straight, with no amino acid side chains inserted into the duplex, and the target base pair is fully intrahelical. A comparison of the present structures with that of AlkA recognizing an extrahelical lesion revealed conformational changes in both the DNA and protein as the glycosylase transitions from the interrogation of undamaged DNA to catalysis of nucleobase excision. Modeling studies with the cytotoxic lesion 3-methyladenine and accompanying biochemical experiments suggested that AlkA actively interrogates the minor groove of the DNA while probing for the presence of lesions. PMID:20843803

  20. Clostridium acetobutylicum 8-Oxoguanine DNA Glycosylase (Ogg) Differs from Eukaryotic Oggs with Respect to Opposite Base Discrimination†

    PubMed Central

    Robey-Bond, Susan M.; Barrantes-Reynolds, Ramiro; Bond, Jeffrey P.; Wallace, Susan S.; Bandaru, Viswanath

    2008-01-01

    During repair of damaged DNA, the oxidized base 8-oxoguanine (8-oxoG) is removed by 8-oxoguanine—DNA glycosylase (Ogg) in eukaryotes and most archaea, whereas in most bacteria it is removed by formamidopyrimidine—DNA glycosylase (Fpg). We report the first characterization of a bacterial Ogg, Clostridium acetobutylicum Ogg (CacOgg). Like human OGG1 and Escherichia coli Fpg (EcoFpg), CacOgg excised 8-oxoguanine. However, unlike hOGG1 and EcoFpg, CacOgg showed little preference for the base opposite the damage during base excision and removed 8-oxoguanine from single-stranded DNA. Thus, our results showed unambiguous qualitative functional differences in vitro between CacOgg and both hOGG1 and EcoFpg. CacOgg differs in sequence from the eukaryotic enzymes at two sequence positions, M132 and F179, which align with amino acids (R154 and Y203) in human OGG1 (hOGG1) found to be involved in opposite base interaction. To address the sequence basis for functional differences with respect to opposite base interactions, we prepared three CacOgg variants, M132R, F179Y, and M132R/F179Y. All three variants showed a substantial increase in specificity for 8-oxoG·C relative to 8-oxoG·A. While we were unable to definitively associate these qualitative functional differences with differences in selective pressure between eukaryotes, Clostridia, and other bacteria, our results are consistent with the idea that evolution of Ogg function is based on kinetic control of repair. PMID:18578506

  1. Solution-state NMR Investigation of DNA Binding Interactions in Escherichia coli Formamidopyrimidine-DNA Glycosylase (Fpg): A Dynamic Description of the DNA/Protein Interface

    SciTech Connect

    Buchko, Garry W.; McAteer, Kathleen; Wallace, Susan S.; Kennedy, Michael A.

    2005-03-02

    Formamidopyrimidine-DNA glycosylase (Fpg) is a base excision repair protein that removes oxidative DNA lesions. Recent crystal structures of Fpg bound to DNA revealed residues involved in damage recognition and enzyme catalysis, but failed to shed light on the dynamic nature of the processes. To examine the structural and dynamic changes that occur in solution when Fpg binds DNA, NMR spectroscopy was used to study Escherichia coli Fpg free and bound to a double-stranded DNA oligomer (13-PD) containing propanediol, a non-hydrolyzable abasic-site analogue. Only 209 out of a possible 252 (83%) free-precession HSQC cross peaks were observed and 180 of these were assignable, indicating that ~30% of the residues undergo intermediate timescale motion that makes them intractable in backbone assignment experiments. DNA titration experiments revealed line broadening and chemical shift perturbations for backbone amides nearby and distant from the DNA binding surface, but failed to quench the intermediate time-scale motion observed for free Fpg. CPMG-HSQC experiments revealed millisecond to microsecond motion for the backbone amides of D91 and H92 that was quenched upon binding 13-PD. Collectively, these observations reveal that, in solution, Fpg contains highly flexible regions. The dynamic nature of Fpg, especially at the DNA binding surface, may be key to its processive search mechanism.

  2. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

    PubMed Central

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

    2012-01-01

    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  3. Using structural-based protein engineering to modulate the differential inhibition effects of SAUGI on human and HSV uracil DNA glycosylase.

    PubMed

    Wang, Hao-Ching; Ho, Chun-Han; Chou, Chia-Cheng; Ko, Tzu-Ping; Huang, Ming-Fen; Hsu, Kai-Cheng; Wang, Andrew H-J

    2016-05-19

    Uracil-DNA glycosylases (UDGs) are highly conserved proteins that can be found in a wide range of organisms, and are involved in the DNA repair and host defense systems. UDG activity is controlled by various cellular factors, including the uracil-DNA glycosylase inhibitors, which are DNA mimic proteins that prevent the DNA binding sites of UDGs from interacting with their DNA substrate. To date, only three uracil-DNA glycosylase inhibitors, phage UGI, p56, and Staphylococcus aureus SAUGI, have been determined. We show here that SAUGI has differential inhibitory effects on UDGs from human, bacteria, Herpes simplex virus (HSV; human herpesvirus 1) and Epstein-Barr virus (EBV; human herpesvirus 4). Newly determined crystal structures of SAUGI/human UDG and a SAUGI/HSVUDG complex were used to explain the differential binding activities of SAUGI on these two UDGs. Structural-based protein engineering was further used to modulate the inhibitory ability of SAUGI on human UDG and HSVUDG. The results of this work extend our understanding of DNA mimics as well as potentially opening the way for novel therapeutic applications for this kind of protein.

  4. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    PubMed Central

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  5. Rat MYH, a glycosylase for repair of oxidatively damaged DNA, has brain-specific isoforms that localize to neuronal mitochondria.

    PubMed

    Englander, Ella W; Hu, Zhaoyong; Sharma, Abha; Lee, Heung-Man; Wu, Zhao-Hui; Greeley, George H

    2002-12-01

    Mitochondrial genomes are exposed to a heavy load of reactive oxygen species (ROS) that damage DNA. Since in neurons, mitochondrial DNA integrity must be maintained over the entire mammalian life span, neuronal mitochondria most likely repair oxidatively damaged DNA. We show that the Escherichia coli MutY DNA glycosylase homolog (MYH) in rat (rMYH) involved in repair of oxidative damage is abundantly expressed in the rat brain, with isoforms that are exclusive to brain tissue. Confocal microscopy and western analyses reveal localization of rMYH in neuronal mitochondria. To assess involvement of MYH in the neuronal response to oxidative DNA damage, we used a rat model of respiratory hypoxia, in which acutely reduced blood oxygenation leads to generation of superoxide, and formation and subsequent removal of 8-hydroxy-2'-deoxyguanosine (8OHdG). Removal of 8OHdG is accompanied by a spatial increase in rMYH immunoreactivity in the brain and an increase in levels of one of the three mitochondrial MYH isoforms, suggesting that inducible and non-inducible MYH isoforms exist in the brain. The mitochondrial localization of oxidative DNA damage repair enzymes in neurons may represent a specialized neuronal mechanism that safeguards mitochondrial genomes in the face of routine and accidental exposures to heavy loads of injurious ROS.

  6. Actions of the Klenow fragment of DNA polymerase I and some DNA glycosylases on chemically stable analogues of N7-methyl-2'-deoxyguanosine.

    PubMed

    Rana, Jagruti; Huang, Haidong

    2013-11-15

    N7-methyl-9-deaza-dG was synthesized and incorporated into oligonucleotides. Thermal melting studies showed that replacement of dG by N7-methyl-9-deaza-dG only slightly decreased DNA duplex stability. Replication of DNA templates containing N7-methyl-9-deaza-dG and the related 7-methyl-7-deaza-dG and 7-deaza-dG by the Klenow fragment of Escherichia coli DNA polymerase I was examined. The dNTP misinsertion frequencies on all three templates were comparably low, although the 7-methyl group significantly slowed down the turnover rates of the polymerase when dCTP was incorporated. The stabilities of N7-methyl-9-deaza-dG and 7-methyl-7-deaza-dG against the actions of formamidopyrimidine DNA glycosylase (Fpg) and human alkyladenine DNA glycosylase (hAAG) were also examined. N7-methyl-9-deaza-dG was stable in the presence of both enzymes. In contrast, 7-methyl-7-deaza-dG was cleaved by Fpg, and possibly by hAAG but at an extremely slow rate. This study suggests that N7-alkyl-9-deaza-dG is a better analogue than 7-alkyl-7-deaza-dG for cellular studies. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Opinion: uracil DNA glycosylase (UNG) plays distinct and non-canonical roles in somatic hypermutation and class switch recombination.

    PubMed

    Yousif, Ashraf S; Stanlie, Andre; Begum, Nasim A; Honjo, Tasuku

    2014-10-01

    Activation-induced cytidine deaminase (AID) is essential to class switch recombination (CSR) and somatic hypermutation (SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair complex, is required for CSR. The role of UNG in CSR and SHM is extremely controversial. AID deficiency in mice abolishes both CSR and SHM, while UNG-deficient mice have drastically reduced CSR but augmented SHM raising a possibility of differential functions of UNG in CSR and SHM. Interestingly, UNG has been associated with a CSR-specific repair adapter protein Brd4, which interacts with acetyl histone 4, γH2AX and 53BP1 to promote non-homologous end joining during CSR. A non-canonical scaffold function of UNG, but not the catalytic activity, can be attributed to the recruitment of essential repair proteins associated with the error-free repair during SHM, and the end joining during CSR.

  8. Uracil DNA glycosylase (UDG) activities in Bradyrhizobium diazoefficiens: characterization of a new class of UDG with broad substrate specificity

    PubMed Central

    Chembazhi, Ullas Valiya; Patil, Vinod Vikas; Sah, Shivjee; Reeve, Wayne; Tiwari, Ravi P.

    2017-01-01

    Abstract Repair of uracils in DNA is initiated by uracil DNA glycosylases (UDGs). Family 1 UDGs (Ung) are the most efficient and ubiquitous proteins having an exquisite specificity for uracils in DNA. Ung are characterized by motifs A (GQDPY) and B (HPSPLS) sequences. We report a novel dimeric UDG, Blr0248 (BdiUng) from Bradyrhizobium diazoefficiens. Although BdiUng contains the motif A (GQDPA), it has low sequence identity to known UDGs. BdiUng prefers single stranded DNA and excises uracil, 5-hydroxymethyl-uracil or xanthine from it. BdiUng is impervious to inhibition by AP DNA, and Ugi protein that specifically inhibits family 1 UDGs. Crystal structure of BdiUng shows similarity with the family 4 UDGs in its overall fold but with family 1 UDGs in key active site residues. However, instead of a classical motif B, BdiUng has a uniquely extended protrusion explaining the lack of Ugi inhibition. Structural and mutational analyses of BdiUng have revealed the basis for the accommodation of diverse substrates into its substrate binding pocket. Phylogenetically, BdiUng belongs to a new UDG family. Bradyrhizobium diazoefficiens presents a unique scenario where the presence of at least four families of UDGs may compensate for the absence of an efficient family 1 homologue. PMID:28369586

  9. 8-oxoG DNA glycosylase-1 inhibition sensitizes Neuro-2a cells to oxidative DNA base damage induced by 900 MHz radiofrequency electromagnetic radiation.

    PubMed

    Wang, Xiaoya; Liu, Chuan; Ma, Qinglong; Feng, Wei; Yang, Lingling; Lu, Yonghui; Zhou, Zhou; Yu, Zhengping; Li, Wei; Zhang, Lei

    2015-01-01

    The purpose of this study was to explore the in vitro putative genotoxicity during exposure of Neuro-2a cells to radiofrequency electromagnetic fields (RF-EMFs) with or without silencing of 8-oxoG DNA glycosylase-1 (OGG1). Neuro-2a cells treated with or without OGG1 siRNA were exposed to 900 MHz Global System for Mobile Communication (GSM) Talk signals continuously at a specific absorption rate (SAR) of 0, 0.5, 1 or 2 W/kg for 24 h. DNA strand breakage and DNA base damage were measured by the alkaline comet assay and a modified comet assay using formamidopyrimidine DNA glycosylase (FPG), respectively. Reactive oxygen species (ROS) levels and cell viability were monitored using the non-fluorescent probe 2, 7-dichlorofluorescein diacetate (DCFH-DA) and CCK-8 assay. Exposure to 900 MHz RF-EMFs with insufficient energy could induce oxidative DNA base damage in Neuro-2a cells. These increases were concomitant with similar increases in the generation of reactive oxygen species (ROS). Without OGG1 siRNA, 2 W/kg RF-EMFs induced oxidative DNA base damage in Neuro-2a cells. Interestingly, with OGG1 siRNA, RF-EMFs could cause DNA base damage in Neuro-2a cells as low as 1 W/kg. However, neither DNA strand breakage nor altered cell viability was observed. Even if further studies remain conducted we support the hypothesis that OGG1 is involved in the process of DNA base repair and may play a pivotal role in protecting DNA bases from RF-EMF induced oxidative damage. © 2015 The Author(s) Published by S. Karger AG, Basel.

  10. Toehold-mediated strand displacement reaction-dependent fluorescent strategy for sensitive detection of uracil-DNA glycosylase activity.

    PubMed

    Wu, Yushu; Wang, Lei; Jiang, Wei

    2017-03-15

    Sensitive detection of uracil-DNA glycosylase (UDG) activity is beneficial for evaluating the repairing process of DNA lesions. Here, toehold-mediated strand displacement reaction (TSDR)-dependent fluorescent strategy was constructed for sensitive detection of UDG activity. A single-stranded DNA (ssDNA) probe with two uracil bases and a trigger sequence were designed. A hairpin probe with toehold domain was designed, and a reporter probe was also designed. Under the action of UDG, two uracil bases were removed from ssDNA probe, generating apurinic/apyrimidinic (AP) sites. Then, the AP sites could inhibit the TSDR between ssDNA probe and hairpin probe, leaving the trigger sequence in ssDNA probe still free. Subsequently, the trigger sequence was annealed with the reporter probe, initiating the polymerization and nicking amplification reaction. As a result, numerous G-quadruplex (G4) structures were formed, which could bind with N-methyl-mesoporphyrin IX (NMM) to generate enhanced fluorescent signal. In the absence of UDG, the ssDNA probe could hybridize with the toehold domain of the hairpin probe to initiate TSDR, blocking the trigger sequence, and then the subsequent amplification reaction would not occur. The proposed strategy was successfully implemented for detecting UDG activity with a detection limit of 2.7×10(-5)U/mL. Moreover, the strategy could distinguish UDG well from other interference enzymes. Furthermore, the strategy was also applied for detecting UDG activity in HeLa cells lysate with low effect of cellular components. These results indicated that the proposed strategy offered a promising tool for sensitive quantification of UDG activity in UDG-related function study and disease prognosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Early steps of active DNA demethylation initiated by ROS1 glycosylase require three putative helix-invading residues

    PubMed Central

    Parrilla-Doblas, Jara Teresa; Ponferrada-Marín, María Isabel; Roldán-Arjona, Teresa; Ariza, Rafael R.

    2013-01-01

    Active DNA demethylation is crucial for epigenetic control, but the underlying enzymatic mechanisms are incompletely understood. REPRESSOR OF SILENCING 1 (ROS1) is a 5-methylcytosine (5-meC) DNA glycosylase/lyase that initiates DNA demethylation in plants through a base excision repair process. The enzyme binds DNA nonspecifically and slides along the substrate in search of 5-meC. In this work, we have used homology modelling and biochemical analysis to gain insight into the mechanism of target location and recognition by ROS1. We have found that three putative helix-intercalating residues (Q607, R903 and M905) are required for processing of 5-meC:G pairs, but dispensable for excision of mismatched 5-meC. Mutant proteins Q607A, R903A and M905G retain the capacity to process an abasic site opposite G, thus suggesting that all three residues play a critical role in early steps of the base extrusion process and likely contribute to destabilization of 5-meC:G pairs. While R903 and M905 are not essential for DNA binding, mutation of Q607 abrogates stable binding to both methylated and nonmethylated DNA. However, the mutant protein Q607A can form stable complexes with DNA substrates containing blocked ends, which suggests that Q607 intercalates into the helix and inhibits sliding. Altogether, our results suggest that ROS1 uses three predicted helix-invading residues to actively interrogate DNA in search for 5-meC. PMID:23868090

  12. Early steps of active DNA demethylation initiated by ROS1 glycosylase require three putative helix-invading residues.

    PubMed

    Parrilla-Doblas, Jara Teresa; Ponferrada-Marín, María Isabel; Roldán-Arjona, Teresa; Ariza, Rafael R

    2013-10-01

    Active DNA demethylation is crucial for epigenetic control, but the underlying enzymatic mechanisms are incompletely understood. REPRESSOR OF SILENCING 1 (ROS1) is a 5-methylcytosine (5-meC) DNA glycosylase/lyase that initiates DNA demethylation in plants through a base excision repair process. The enzyme binds DNA nonspecifically and slides along the substrate in search of 5-meC. In this work, we have used homology modelling and biochemical analysis to gain insight into the mechanism of target location and recognition by ROS1. We have found that three putative helix-intercalating residues (Q607, R903 and M905) are required for processing of 5-meC:G pairs, but dispensable for excision of mismatched 5-meC. Mutant proteins Q607A, R903A and M905G retain the capacity to process an abasic site opposite G, thus suggesting that all three residues play a critical role in early steps of the base extrusion process and likely contribute to destabilization of 5-meC:G pairs. While R903 and M905 are not essential for DNA binding, mutation of Q607 abrogates stable binding to both methylated and nonmethylated DNA. However, the mutant protein Q607A can form stable complexes with DNA substrates containing blocked ends, which suggests that Q607 intercalates into the helix and inhibits sliding. Altogether, our results suggest that ROS1 uses three predicted helix-invading residues to actively interrogate DNA in search for 5-meC.

  13. An invariant aspartic acid in the DNA glycosylase domain of DEMETER is necessary for transcriptional activation of the imprinted MEDEA gene

    PubMed Central

    Choi, Yeonhee; Harada, John J.; Goldberg, Robert B.; Fischer, Robert L.

    2004-01-01

    Helix-hairpin-helix DNA glycosylases are typically small proteins that initiate repair of DNA by excising damaged or mispaired bases. An invariant aspartic acid in the active site is involved in catalyzing the excision reaction. Replacement of this critical residue with an asparagine severely reduces catalytic activity but preserves enzyme stability and structure. The Arabidopsis DEMETER (DME) gene encodes a large 1,729-aa polypeptide with a 200-aa DNA glycosylase domain. DME is expressed primarily in the central cell of the female gametophyte. DME activates maternal allele expression of the imprinted MEDEA (MEA) gene in the central cell and is required for seed viability. We mutated the invariant aspartic acid at position 1304 in DME to asparagine (D1304N) to determine whether the catalytic activity of the DNA glycosylase domain is required for DME function in vivo. Transgenes expressing wild-type DME in the central cell rescue seed abortion caused by a mutation in the endogenous DME gene and activate maternal MEA:GFP transcription. However, transgenes expressing the D1304N mutant DME do not rescue seed abortion or activate maternal MEA:GFP transcription. Whereas ectopic expression of the wild-type DME polypeptide in pollen is sufficient to activate ectopic paternal MEA and MEA:GUS expression, equivalent expression of the D1304N mutant DME in pollen failed to do so. These results show that the conserved aspartic acid residue is necessary for DME to function in vivo and suggest that an active DNA glycosylase domain, normally associated with DNA repair, promotes gene transcription that is essential for gene imprinting. PMID:15128940

  14. Single-turnover and pre-steady-state kinetics of the reaction of the adenine glycosylase MutY with mismatch-containing DNA substrates.

    PubMed

    Porello, S L; Leyes, A E; David, S S

    1998-10-20

    The DNA repair enzyme MutY plays an important role in the prevention of DNA mutations resulting from the presence of the oxidatively damaged lesion 7,8-dihydro-8-oxo-2'-deoxyguanosine (OG) in DNA by the removal of misincorporated adenine residues in OG:A mispairs. MutY also exhibits adenine glycosylase activity toward adenine in G:A and C:A mismatches, although the importance of this activity in vivo has not been established. We have investigated the kinetic properties of MutY's glycosylase activity with OG:A and G:A containing DNA duplexes. Our results indicate that MutY's processing of these two substrates is distinctly different. By using single-turnover experiments, the intrinsic rate for adenine removal by MutY from an OG:A substrate was found to be at least 6-fold faster than that from the corresponding G:A substrate. However, under conditions where [MutY] < [DNA], OG:A substrates are not quantitatively converted to product due to the inefficient turnover resulting from slow product release. In contrast, with a G:A substrate MutY's dissociation from the corresponding product is more facile, such that complete conversion of the substrate to product can be achieved under similar conditions. The kinetic results illustrate that the glycosylase reaction catalyzed by MutY has significant differences depending on the characteristics of the substrate. The lingering of MutY with the product of its reaction with OG:A mispairs may be biologically significant to prevent premature removal of OG. Thus, this approach is providing insight into factors that may be influencing the repair of damaged and mismatched DNA in vivo by base-excision repair glycosylases.

  15. An invariant aspartic acid in the DNA glycosylase domain of DEMETER is necessary for transcriptional activation of the imprinted MEDEA gene.

    PubMed

    Choi, Yeonhee; Harada, John J; Goldberg, Robert B; Fischer, Robert L

    2004-05-11

    Helix-hairpin-helix DNA glycosylases are typically small proteins that initiate repair of DNA by excising damaged or mispaired bases. An invariant aspartic acid in the active site is involved in catalyzing the excision reaction. Replacement of this critical residue with an asparagine severely reduces catalytic activity but preserves enzyme stability and structure. The Arabidopsis DEMETER (DME) gene encodes a large 1,729-aa polypeptide with a 200-aa DNA glycosylase domain. DME is expressed primarily in the central cell of the female gametophyte. DME activates maternal allele expression of the imprinted MEDEA (MEA) gene in the central cell and is required for seed viability. We mutated the invariant aspartic acid at position 1304 in DME to asparagine (D1304N) to determine whether the catalytic activity of the DNA glycosylase domain is required for DME function in vivo. Transgenes expressing wild-type DME in the central cell rescue seed abortion caused by a mutation in the endogenous DME gene and activate maternal MEA:GFP transcription. However, transgenes expressing the D1304N mutant DME do not rescue seed abortion or activate maternal MEA:GFP transcription. Whereas ectopic expression of the wild-type DME polypeptide in pollen is sufficient to activate ectopic paternal MEA and MEA:GUS expression, equivalent expression of the D1304N mutant DME in pollen failed to do so. These results show that the conserved aspartic acid residue is necessary for DME to function in vivo and suggest that an active DNA glycosylase domain, normally associated with DNA repair, promotes gene transcription that is essential for gene imprinting.

  16. Expression and function of AtMBD4L, the single gene encoding the nuclear DNA glycosylase MBD4L in Arabidopsis.

    PubMed

    Nota, Florencia; Cambiagno, Damián A; Ribone, Pamela; Alvarez, María E

    2015-06-01

    DNA glycosylases recognize and excise damaged or incorrect bases from DNA initiating the base excision repair (BER) pathway. Methyl-binding domain protein 4 (MBD4) is a member of the HhH-GPD DNA glycosylase superfamily, which has been well studied in mammals but not in plants. Our knowledge on the plant enzyme is limited to the activity of the Arabidopsis recombinant protein MBD4L in vitro. To start evaluating MBD4L in its biological context, we here characterized the structure, expression and effects of its gene, AtMBD4L. Phylogenetic analysis indicated that AtMBD4L belongs to one of the seven families of HhH-GPD DNA glycosylase genes existing in plants, and is unique on its family. Two AtMBD4L transcripts coding for active enzymes were detected in leaves and flowers. Transgenic plants expressing the AtMBD4L:GUS gene confined GUS activity to perivascular leaf tissues (usually adjacent to hydathodes), flowers (anthers at particular stages of development), and the apex of immature siliques. MBD4L-GFP fusion proteins showed nuclear localization in planta. Interestingly, overexpression of the full length MBD4L, but not a truncated enzyme lacking the DNA glycosylase domain, induced the BER gene LIG1 and enhanced tolerance to oxidative stress. These results suggest that endogenous MBD4L acts on particular tissues, is capable of activating BER, and may contribute to repair DNA damage caused by oxidative stress. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Structure/Function Analysis of DNA-glycosylases That Repair Oxidized Purines and Pyrimidines and the Influence of Surrounding DNA Sequence on Their Interactions

    SciTech Connect

    Wallace, Susan S.

    2005-08-22

    The overall goal of this project was to elucidate the structure/function relationships between oxidized DNA bases and the DNA repair enzymes that recognize and remove them. The NMR solution structure of formamidopyrimidine DNA glycosylase (Fpg) that recognizes oxidized DNA purines was to be determined. Furthermore, the solution structures of DNA molecules containing specific lesions recognized by Fpg was to be determined in sequence contexts that either facilitate or hinder this recognition. These objectives were in keeping with the long-term goals of the Principal Investigator's laboratory, that is, to understand the basic mechanisms that underpin base excision repair processing of oxidative DNA lesions and to elucidate the interactions of unrepaired lesions with DNA polymerases. The results of these two DNA transactions can ultimately determine the fate of the cell. These objectives were also in keeping with the goals of our collaborator, Dr. Michael Kennedy, who is studying the repair and recognition of damaged DNA. Overall the goals of this project were congruent with those of the Department of Energy's Health Effects and Life Sciences Research Program, especially to the Structural Biology, the Human Genome and the Health Effects Programs. The mission of the latter Program includes understanding the biological effects and consequences of DNA damages produced by toxic agents in the many DOE waste sites so that cleanup can be accomplished in a safe, effective and timely manner.

  18. Mechanism of the Glycosidic Bond Cleavage of Mismatched Thymine in Human Thymine DNA Glycosylase Revealed by Classical Molecular Dynamics and Quantum Mechanical/Molecular Mechanical Calculations.

    PubMed

    Kanaan, Natalia; Crehuet, Ramon; Imhof, Petra

    2015-09-24

    Base excision of mismatched or damaged nucleotides catalyzed by glycosylase enzymes is the first step of the base excision repair system, a machinery preserving the integrity of DNA. Thymine DNA glycosylase recognizes and removes mismatched thymine by cleaving the C1'-N1 bond between the base and the sugar ring. Our quantum mechanical/molecular mechanical calculations of this reaction in human thymine DNA glycosylase reveal a requirement for a positive charge in the active site to facilitate C1'-N1 bond scission: protonation of His151 significantly lowers the free energy barrier for C1'-N1 bond dissociation compared to the situation with neutral His151. Shuttling a proton from His151 to the thymine base further reduces the activation free energy for glycosidic bond cleavage. Classical molecular dynamics simulations of the H151A mutant suggest that the mutation to the smaller, neutral, residue increases the water accessibility of the thymine base, rendering direct proton transfer from the bulk feasible. Quantum mechanical/molecular mechanical calculations of the glycosidic bond cleavage reaction in the H151A mutant show that the activation free energy is slightly lower than in the wild-type enzyme, explaining the experimentally observed higher reaction rates in this mutant.

  19. Triphlorethol-A from Ecklonia cava Up-Regulates the Oxidant Sensitive 8-Oxoguanine DNA Glycosylase 1

    PubMed Central

    Kim, Ki Cheon; Lee, In Kyung; Kang, Kyoung Ah; Piao, Mei Jing; Ryu, Min Ju; Kim, Jeong Mi; Lee, Nam Ho; Hyun, Jin Won

    2014-01-01

    This study investigated the protective mechanisms of triphlorethol-A, isolated from Ecklonia cava, against oxidative stress-induced DNA base damage, especially 8-oxoguanine (8-oxoG), in Chinese hamster lung fibroblast V79-4 cells. 8-Oxoguanine DNA glycosylase-1 (OGG1) plays an important role in the removal of 8-oxoG during the cellular response to DNA base damage. Triphlorethol-A significantly decreased the levels of 8-oxoG induced by H2O2, and this correlated with increases in OGG1 mRNA and OGG1 protein levels. Furthermore, siOGG1-transfected cell attenuated the protective effect of triphlorethol-A against H2O2 treatment. Nuclear factor erythroid 2–related factor 2 (Nrf2) is a transcription factor for OGG1, and Nrf2 combines with small Maf proteins in the nucleus to bind to antioxidant response elements (ARE) in the upstream promoter region of the OGG1 gene. Triphlorethol-A restored the expression of nuclear Nrf2, small Maf protein, and the Nrf2-Maf complex, all of which were reduced by oxidative stress. Furthermore, triphlorethol-A increased Nrf2 binding to ARE sequences and the resulting OGG1 promoter activity, both of which were also reduced by oxidative stress. The levels of the phosphorylated forms of Akt kinase, downstream of phosphatidylinositol 3-kinase (PI3K), and Erk, which are regulators of OGG1, were sharply decreased by oxidative stress, but these decreases were prevented by triphlorethol-A. Specific PI3K, Akt, and Erk inhibitors abolished the cytoprotective effects of triphlorethol-A, suggesting that OGG1 induction by triphlorethol-A involves the PI3K/Akt and Erk pathways. Taken together, these data indicate that by activating the DNA repair system, triphlorethol-A exerts protective effects against DNA base damage induced by oxidative stress. PMID:25353254

  20. Reducing Artifactual EGFR T790M Mutations in DNA from Formalin-Fixed Paraffin-Embedded Tissue by Use of Thymine-DNA Glycosylase.

    PubMed

    Do, Hongdo; Molania, Ramyar; Mitchell, Paul L; Vaiskunaite, Rita; Murdoch, John D; Dobrovic, Alexander

    2017-09-01

    False-positive EGFR T790M mutations have been reported in formalin-fixed lung tumors, but the cause of the false positives has not been identified. The T790M mutation results from a C>T change at the cytosine of a CpG dinucleotide. The presence or absence of methylation at this cytosine has different consequences following deamination, resulting in a thymine or uracil, respectively, both of which however result in an artifactual change. Uracil-DNA glycosylase (UDG) can be used to eliminate DNA templates with uracil residues but is not active against artifactual thymines. We therefore investigated the use of thymine-DNA glycosylase (TDG) to reduce artifactual T790M mutations. Formalin-fixed normal lung tissues and lung squamous cell carcinomas were tested to measure the frequency of false-positive EGFR mutations by use of droplet digital PCR before and after treatment with either UDG or TDG. Methylation at the cytosine at EGFR T790 was assessed by pyrosequencing and by analysis of public databases. Artifactual EGFR T790M mutations were detected in all of the archival formalin-fixed normal lung and lung squamous cell carcinomas at mutant allele frequencies of 1% or lower. The cytosine at EGFR T790 showed high levels of methylation in all lung cancer samples and normal tissues. Pretreatment of the formalin-fixed DNA with either UDG or TDG reduced the false EGFR T790M mutations, but a greater reduction was seen with the TDG treatment. Both U:G and T:G lesions in formalin-fixed tissue are sources of false-positive EGFR T790M mutations. This is the first report of the use of TDG to reduce sequence artifacts in formalin-fixed DNA and is applicable to the accurate detection of mutations arising at methylated cytosines. © 2017 American Association for Clinical Chemistry.

  1. An unprecedented nucleic acid capture mechanism for excision of DNA damage

    SciTech Connect

    Rubinson, Emily H.; Prakasha Gowda, A.S.; Spratt, Thomas E.; Gold, Barry; Eichmanbrand, Brandt F.

    2010-11-18

    DNA glycosylases that remove alkylated and deaminated purine nucleobases are essential DNA repair enzymes that protect the genome, and at the same time confound cancer alkylation therapy, by excising cytotoxic N3-methyladenine bases formed by DNA-targeting anticancer compounds. The basis for glycosylase specificity towards N3- and N7-alkylpurines is believed to result from intrinsic instability of the modified bases and not from direct enzyme functional group chemistry. Here we present crystal structures of the recently discovered Bacillus cereus AlkD glycosylase in complex with DNAs containing alkylated, mismatched and abasic nucleotides. Unlike other glycosylases, AlkD captures the extrahelical lesion in a solvent-exposed orientation, providing an illustration for how hydrolysis of N3- and N7-alkylated bases may be facilitated by increased lifetime out of the DNA helix. The structures and supporting biochemical analysis of base flipping and catalysis reveal how the HEAT repeats of AlkD distort the DNA backbone to detect non-Watson-Crick base pairs without duplex intercalation.

  2. DNA Repair Enzyme Uracil DNA Glycosylase Is Specifically Incorporated into Human Immunodeficiency Virus Type 1 Viral Particles through a Vpr-Independent Mechanism

    PubMed Central

    Willetts, Karen E.; Rey, Françoise; Agostini, Isabelle; Navarro, Jean-Marc; Baudat, Yves; Vigne, Robert; Sire, Joséphine

    1999-01-01

    The Vpr protein, encoded by the human immunodeficiency virus type 1 (HIV-1) genome, is one of the nonstructural proteins packaged in large amounts into viral particles. We have previously reported that Vpr associates with the DNA repair enzyme uracil DNA glycosylase (UDG). In this study, we extended these observations by investigating whether UDG is incorporated into virions and whether this incorporation requires the presence of Vpr. Our results, with highly purified viruses, show that UDG is efficiently incorporated either into wild-type virions or into Vpr-deficient HIV-1 virions, indicating that Vpr is not involved in UDG packaging. Using an in vitro protein-protein binding assay, we reveal a direct interaction between the precursor form of UDG and the viral integrase (IN). Finally, we demonstrate that IN-defective viruses fail to incorporate UDG, indicating that IN is required for packaging of UDG into virions. PMID:9882380

  3. 7,8-Dihydroxyflavone Suppresses Oxidative Stress-Induced Base Modification in DNA via Induction of the Repair Enzyme 8-Oxoguanine DNA Glycosylase-1

    PubMed Central

    Kim, Ki Cheon; Lee, In Kyung; Kang, Kyoung Ah; Cha, Ji Won; Cho, Suk Ju; Na, Soo Young; Chae, Sungwook; Kim, Hye Sun; Hyun, Jin Won

    2013-01-01

    The modified guanine base 8-oxoguanine (8-oxoG) is abundantly produced by oxidative stress, can contribute to carcinogenesis, and can be removed from DNA by 8-oxoguanine DNA glycosylase-1 (OGG1), which acts as an 8-oxoG glycosylase and endonuclease. This study investigated the mechanism by which 7,8-dihydroxyflavone (DHF) inhibits oxidative stress-induced 8-oxoG formation in hamster lung fibroblasts (V79-4). DHF significantly reduced the amount of 8-oxoG induced by hydrogen peroxide (H2O2) and elevated the levels of OGG1 mRNA and protein. DHF increased the binding of nuclear factor erythroid 2-related factor 2 (Nrf2) to antioxidant response element sequences in the upstream promoter region of OGG1. Moreover, DHF increased the nuclear levels of Nrf2, small Maf proteins, and the Nrf2/small Maf complex, all of which are decreased by H2O2 treatment. Likewise, the level of phosphorylated Akt, which activates Nrf2, was decreased by H2O2 treatment but restored by DHF treatment. The levels of OGG1 and nuclear translocation of Nrf2 protein were decreased upon treatment with PI3K inhibitor or Akt inhibitor, and DHF treatment did not restore OGG1 and nuclear Nrf2 levels in these inhibitor-treated cells. Furthermore, PI3K and Akt inhibitors abolished the protective effects of DHF in cells undergoing oxidative stress. These data indicate that DHF induces OGG1 expression via the PI3K-Akt pathway and protects cells against oxidative DNA base damage by activating DNA repair systems. PMID:24151624

  4. 7,8-Dihydroxyflavone suppresses oxidative stress-induced base modification in DNA via induction of the repair enzyme 8-oxoguanine DNA glycosylase-1.

    PubMed

    Kim, Ki Cheon; Lee, In Kyung; Kang, Kyoung Ah; Cha, Ji Won; Cho, Suk Ju; Na, Soo Young; Chae, Sungwook; Kim, Hye Sun; Kim, Suhkmann; Hyun, Jin Won

    2013-01-01

    The modified guanine base 8-oxoguanine (8-oxoG) is abundantly produced by oxidative stress, can contribute to carcinogenesis, and can be removed from DNA by 8-oxoguanine DNA glycosylase-1 (OGG1), which acts as an 8-oxoG glycosylase and endonuclease. This study investigated the mechanism by which 7,8-dihydroxyflavone (DHF) inhibits oxidative stress-induced 8-oxoG formation in hamster lung fibroblasts (V79-4). DHF significantly reduced the amount of 8-oxoG induced by hydrogen peroxide (H₂O₂) and elevated the levels of OGG1 mRNA and protein. DHF increased the binding of nuclear factor erythroid 2-related factor 2 (Nrf2) to antioxidant response element sequences in the upstream promoter region of OGG1. Moreover, DHF increased the nuclear levels of Nrf2, small Maf proteins, and the Nrf2/small Maf complex, all of which are decreased by H₂O₂ treatment. Likewise, the level of phosphorylated Akt, which activates Nrf2, was decreased by H₂O₂ treatment but restored by DHF treatment. The levels of OGG1 and nuclear translocation of Nrf2 protein were decreased upon treatment with PI3K inhibitor or Akt inhibitor, and DHF treatment did not restore OGG1 and nuclear Nrf2 levels in these inhibitor-treated cells. Furthermore, PI3K and Akt inhibitors abolished the protective effects of DHF in cells undergoing oxidative stress. These data indicate that DHF induces OGG1 expression via the PI3K-Akt pathway and protects cells against oxidative DNA base damage by activating DNA repair systems.

  5. Ion pairs and their role in modulating stability of cold- and warm-active uracil DNA glycosylase.

    PubMed

    Olufsen, Magne; Papaleo, Elena; Smalås, Arne Oskar; Brandsdal, Bjørn Olav

    2008-05-15

    MD simulations and continuum electrostatics calculations have been used to study the observed differences in thermostability of cold- and warm-active uracil DNA glycosylase (UDG). The present study focuses on the role of ion pairs and how they affect the thermal stability of the two enzymes. Analysis of the MD generated structural ensembles show that cod UDG (cUDG) and human UDG (hUDG) have 11 and 12 ion pairs which are present in at least 30% of the conformations. The electrostatic contribution of the ion pairs, computed using continuum electrostatics, is slightly more favorable in cUDG at 298 K. This is primarily attributed to more optimized interactions between the ion pairs and nearby dipoles/charges in cUDG. More global salt bridges are found in hUDG and are more stabilizing when compared to cUDG, possibly playing a role in maintaining overall stability and reducing conformational entropy. Both enzymes contain one three-member ionic network, but the one found in hUDG is far more stabilizing. Our results also suggest that care should be taken when performing statistical analysis of crystal structures with respect to ion pairs, and that crystallization conditions must be carefully examined when performing such analysis.

  6. Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase

    PubMed Central

    Guo, Chunguang; Zhang, Xiaodong; Fink, Stephen P; Platzer, Petra; Wilson, Keith; Willson, James K. V.; Wang, Zhenghe; Markowitz, Sanford D

    2008-01-01

    Expression microarrays identified a novel transcript, designated as Ugene, whose expression is absent in normal colon and colon adenomas, but that is commonly induced in malignant colon cancers. These findings were validated by real-time PCR and Northern blot analysis in an independent panel of colon cancer cases. In addition, Ugene expression was found to be elevated in many other common cancer types, including, breast, lung, uterus, and ovary. Immunofluorescence of V5-tagged Ugene revealed it to have a nuclear localization. In a pull-down assay, uracil DNA-glycosylase 2 (UNG2), an important enzyme in the base excision repair pathway, was identified as a partner protein that binds to Ugene. Co-immunoprecipitation and Western blot analysis confirmed the binding between the endogenous Ugene and UNG2 proteins. Using deletion constructs, we find that Ugene binds to the first 25 amino acids of the UNG2 NH2-terminus. We suggest Ugene induction in cancer may contribute to the cancer phenotype by interacting with the base excision repair pathway. PMID:18676834

  7. Evaluating the Substrate Selectivity of Alkyladenine DNA Glycosylase: The Synergistic Interplay of Active Site Flexibility and Water Reorganization.

    PubMed

    Lenz, Stefan A P; Wetmore, Stacey D

    2016-02-09

    Human alkyladenine DNA glycosylase (AAG) functions as part of the base excision repair (BER) pathway by cleaving the N-glycosidic bond that connects nucleobases to the sugar-phosphate backbone in DNA. AAG targets a range of structurally diverse purine lesions using nonspecific DNA-protein π-π interactions. Nevertheless, the enzyme discriminates against the natural purines and is inhibited by pyrimidine lesions. This study uses molecular dynamics simulations and seven different neutral or charged substrates, inhibitors, or canonical purines to probe how the bound nucleotide affects the conformation of the AAG active site, and the role of active site residues in dictating substrate selectivity. The neutral substrates form a common DNA-protein hydrogen bond, which results in a consistent active site conformation that maximizes π-π interactions between the aromatic residues and the nucleobase required for catalysis. Nevertheless, subtle differences in DNA-enzyme contacts for different neutral substrates explain observed differential catalytic efficiencies. In contrast, the exocyclic amino groups of the natural purines clash with active site residues, which leads to catalytically incompetent DNA-enzyme complexes due to significant reorganization of active site water. Specifically, water resides between the A nucleobase and the active site aromatic amino acids required for catalysis, while a shift in the position of the general base (E125) repositions (potentially nucleophilic) water away from G. Despite sharing common amino groups, the methyl substituents in cationic purine lesions (3MeA and 7MeG) exhibit repulsion with active site residues, which repositions the damaged bases in the active site in a manner that promotes their excision. Overall, we provide a structural explanation for the diverse yet discriminatory substrate selectivity of AAG and rationalize key kinetic data available for the enzyme. Specifically, our results highlight the complex interplay of many

  8. Chimeras between single-stranded DNA-binding proteins from Escherichia coli and Mycobacterium tuberculosis reveal that their C-terminal domains interact with uracil DNA glycosylases.

    PubMed

    Handa, P; Acharya, N; Varshney, U

    2001-05-18

    Uracil, a promutagenic base in DNA can arise by spontaneous deamination of cytosine or incorporation of dUMP by DNA polymerase. Uracil is removed from DNA by uracil DNA glycosylase (UDG), the first enzyme in the uracil excision repair pathway. We recently reported that the Escherichia coli single-stranded DNA binding protein (SSB) facilitated uracil excision from certain structured substrates by E. coli UDG (EcoUDG) and suggested the existence of interaction between SSB and UDG. In this study, we have made use of the chimeric proteins obtained by fusion of N- and C-terminal domains of SSBs from E. coli and Mycobacterium tuberculosis to investigate interactions between SSBs and UDGs. The EcoSSB or a chimera containing its C-terminal domain interacts with EcoUDG in a binary (SSB-UDG) or a ternary (DNA-SSB-UDG) complex. However, the chimera containing the N-terminal domain from EcoSSB showed no interactions with EcoUDG. Thus, the C-terminal domain (48 amino acids) of EcoSSB is necessary and sufficient for interaction with EcoUDG. The data also suggest that the C-terminal domain (34 amino acids) of MtuSSB is a predominant determinant for mediating its interaction with MtuUDG. The mechanism of how the interactions between SSB and UDG could be important in uracil excision repair pathway has been discussed.

  9. Excision of the oxidatively formed 5-hydroxyhydantoin and 5-hydroxy-5-methylhydantoin pyrimidine lesions by Escherichia coli and Saccharomyces cerevisiae DNA N-glycosylases.

    PubMed

    Gasparutto, Didier; Muller, Evelyne; Boiteux, Serge; Cadet, Jean

    2009-01-01

    (5R) and (5S) diastereomers of 1-[2-deoxy-beta-D-erythro-pentofuranosyl]-5-hydroxyhydantoin (5-OH-dHyd) and 1-[2-deoxy-beta-D-erythro-pentofuranosyl]-5-hydroxy-5-methylhydantoin (5-OH-5-Me-dHyd) are major oxidation products of 2'-deoxycytidine and thymidine respectively. If not repaired, when present in cellular DNA, these base lesions may be processed by DNA polymerases that induce mutagenic and cell lethality processes. Synthetic oligonucleotides that contained a unique 5-hydroxyhydantoin (5-OH-Hyd) or 5-hydroxy-5-methylhydantoin (5-OH-5-Me-Hyd) nucleobase were used as probes for repair studies involving several E. coli, yeast and human purified DNA N-glycosylases. Enzymatic reaction mixtures were analyzed by denaturing polyacrylamide gel electrophoresis after radiolabeling of DNA oligomers or by MALDI-TOF mass spectrometry measurements. In vitro DNA excision experiments carried out with endo III, endo VIII, Fpg, Ntg1 and Ntg2, show that both base lesions are substrates for these DNA N-glycosylases. The yeast and human Ogg1 proteins (yOgg1 and hOgg1 respectively) and E. coli AlkA were unable to cleave the N-glycosidic bond of the 5-OH-Hyd and 5-OH-5-Me-Hyd lesions. Comparison of the kcat/Km ratio reveals that 8-oxo-7,8-dihydroguanine is only a slightly better substrate than 5-OH-Hyd and 5-OH-5-Me-Hyd. The kinetic results obtained with endo III indicate that 5-OH-Hyd and 5-OH-5-Me-Hyd are much better substrates than 5-hydroxycytosine, a well known oxidized pyrimidine substrate for this DNA N-glycosylase. The present study supports a biological relevance of the base excision repair processes toward the hydantoin lesions, while the removal by the Fpg and endo III proteins are effected at better or comparable rates to that of the removal of 8-oxoGua and 5-OH-Cyt, two established cellular substrates. The study provides new insights into the substrate specificity of DNA N-glycosylases involved in the base excision repair of oxidized bases, together with complementary

  10. HO* radicals induce an unexpected high proportion of tandem base lesions refractory to repair by DNA glycosylases.

    PubMed

    Bergeron, François; Auvré, Frédéric; Radicella, J Pablo; Ravanat, Jean-Luc

    2010-03-23

    Reaction of HO(*) radicals with double-stranded calf thymus DNA produces high levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) and, to a minor extent, 8-oxo-7,8-dihydro-2'-deoxyadenosine (8-oxodAdo). Formation of the hydroxylated purine lesions is explained by addition of HO(*) to the C8 position of the purine moiety. It has been reported that tandem lesions containing a formylamine residue neighboring 8-oxodGuo could be produced through addition of a transiently generated pyrimidine peroxyl radical onto the C8 of an adjacent purine base. Formation of such tandem lesions accounted for approximately 10% of the total 8-oxodGuo. In the present work we show that addition of HO(*) onto the C8 of purine accounts for only approximately 5% of the generated 8-oxodGuo. About 50% of the 8-hydroxylated purine lesions, including 8-oxodGuo and 8-oxodAdo, are involved in tandem damage and are produced by peroxyl addition onto the C8 of a vicinal purine base. In addition, the remaining 45% of the 8-oxodGuo are produced by an electron transfer reaction, providing an explanation for the higher yield of formation of 8-oxodGuo compared to 8-oxodAdo. Interestingly, we show that >40% of the 8-oxodGuo involved in tandem lesions is refractory to excision by DNA glycosylases. Altogether our results demonstrate that, subsequently to a single oxidation event, peroxidation reactions significantly increase the yield of formation of hydroxylated purine modifications, generating a high proportion of tandem lesions partly refractory to base excision repair.

  11. HO• radicals induce an unexpected high proportion of tandem base lesions refractory to repair by DNA glycosylases

    PubMed Central

    Bergeron, François; Auvré, Frédéric; Radicella, J. Pablo; Ravanat, Jean-Luc

    2010-01-01

    Reaction of HO• radicals with double-stranded calf thymus DNA produces high levels of 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodGuo) and, to a minor extent, 8-oxo-7,8-dihydro-2′-deoxyadenosine (8-oxodAdo). Formation of the hydroxylated purine lesions is explained by addition of HO• to the C8 position of the purine moiety. It has been reported that tandem lesions containing a formylamine residue neighboring 8-oxodGuo could be produced through addition of a transiently generated pyrimidine peroxyl radical onto the C8 of an adjacent purine base. Formation of such tandem lesions accounted for ≈10% of the total 8-oxodGuo. In the present work we show that addition of HO• onto the C8 of purine accounts for only ∼5% of the generated 8-oxodGuo. About 50% of the 8-hydroxylated purine lesions, including 8-oxodGuo and 8-oxodAdo, are involved in tandem damage and are produced by peroxyl addition onto the C8 of a vicinal purine base. In addition, the remaining 45% of the 8-oxodGuo are produced by an electron transfer reaction, providing an explanation for the higher yield of formation of 8-oxodGuo compared to 8-oxodAdo. Interestingly, we show that >40% of the 8-oxodGuo involved in tandem lesions is refractory to excision by DNA glycosylases. Altogether our results demonstrate that, subsequently to a single oxidation event, peroxidation reactions significantly increase the yield of formation of hydroxylated purine modifications, generating a high proportion of tandem lesions partly refractory to base excision repair. PMID:20212167

  12. N-terminal extension of N-methylpurine DNA glycosylase is required for turnover in hypoxanthine excision reaction.

    PubMed

    Adhikari, Sanjay; Uren, Aykut; Roy, Rabindra

    2007-10-12

    N-Methylpurine DNA glycosylase (MPG) initiates base excision repair in DNA by removing a wide variety of alkylated, deaminated, and lipid peroxidation-induced purine adducts. In this study we tested the role of N-terminal extension on MPG hypoxanthine (Hx) cleavage activity. Our results showed that MPG lacking N-terminal extension excises hypoxanthine with significantly reduced efficiency, one-third of that exhibited by full-length MPG under similar conditions. Steady-state kinetics showed full-length MPG has higher V(max) and lower K(m) than NDelta100 MPG. Real time binding experiments by surface plasmon resonance spectroscopy suggested that truncation can substantially increase the equilibrium binding constant of MPG toward Hx, but under single-turnover conditions there is apparently no effect on catalytic chemistry; however, the truncation of the N-terminal tail affected the turnover of the enzyme significantly under multiple turnover conditions. Real time binding experiments by surface plasmon resonance spectroscopy further showed that NDelta100 MPG binds approximately six times more tightly toward its product apurinic/apyrimidinic site than the substrate, whereas full-length MPG similarly binds to both the substrate and the product. We thereby conclude that the N-terminal tail in MPG plays a critical role in overcoming the product inhibition, which is achieved by reducing the differences of MPG binding affinity toward Hx and apurinic/apyrimidinic sites and thus is essential for the Hx cleavage reaction of MPG. The results from this study also affirm the need for reinvestigation of full-length MPG for its enzymatic and structural properties, which are currently available mostly for the truncated protein.

  13. Partial uracil–DNA–glycosylase treatment for screening of ancient DNA

    PubMed Central

    Rohland, Nadin; Harney, Eadaoin; Mallick, Swapan; Nordenfelt, Susanne; Reich, David

    2015-01-01

    The challenge of sequencing ancient DNA has led to the development of specialized laboratory protocols that have focused on reducing contamination and maximizing the number of molecules that are extracted from ancient remains. Despite the fact that success in ancient DNA studies is typically obtained by screening many samples to identify a promising subset, ancient DNA protocols have not, in general, focused on reducing the time required to screen samples. We present an adaptation of a popular ancient library preparation method that makes screening more efficient. First, the DNA extract is treated using a protocol that causes characteristic ancient DNA damage to be restricted to the terminal nucleotides, while nearly eliminating it in the interior of the DNA molecules, allowing a single library to be used both to test for ancient DNA authenticity and to carry out population genetic analysis. Second, the DNA molecules are ligated to a unique pair of barcodes, which eliminates undetected cross-contamination from this step onwards. Third, the barcoded library molecules include incomplete adapters of short length that can increase the specificity of hybridization-based genomic target enrichment. The adapters are completed just before sequencing, so the same DNA library can be used in multiple experiments, and the sequences distinguished. We demonstrate this protocol on 60 ancient human samples. PMID:25487342

  14. Whole transcriptome analysis reveals an 8-oxoguanine DNA glycosylase-1-driven DNA repair-dependent gene expression linked to essential biological processes

    PubMed Central

    Aguilera-Aguirre, Leopoldo; Hosoki, Koa; Bacsi, Attila; Radák, Zsolt; Wood, Thomas G.; Widen, Steven G.; Sur, Sanjiv; Ameredes, Bill T.; Saavedra-Molina, Alfredo; Brasier, Allan R.; Ba, Xueqing; Boldogh, Istvan

    2015-01-01

    Reactive oxygen species inflict oxidative modifications on various biological molecules, including DNA. One of the most abundant DNA base lesions 8-oxo-7,8-dihydroguanine (8-oxoG) is repaired by 8-oxoguanine DNA glycosylase-1 (OGG1) during DNA base excision repair (OGG1-BER). 8-OxoG accumulation in DNA has been associated with various pathological and aging processes, while its role is unclear. The lack of OGG1-BER in Ogg1-/- mice resulted in decreased inflammatory responses, increased susceptibility to infections and metabolic disorders. Therefore, we proposed that OGG1 and/or 8-oxoG base may have a role in immune and homeostatic processes. To test our hypothesis, we challenged mouse lungs with OGG1-BER product 8-oxoG base and changes in gene expression were determined by RNA sequencing and data were analyzed by gene ontology and statistical tools. RNA-Seq analysis identified 1592 differentially expressed (≥ 3-fold change) transcripts. The upregulated mRNAs were related to biological processes, including homeostatic, immune-system, macrophage activation, regulation of liquid-surface tension, and response to stimulus. These processes were mediated by chemokines, cytokines, gonadotropin-releasing hormone receptor, integrin and interleukin signaling pathways. Taken together, these findings points to a new paradigm showing that OGG1-BER plays a role in various biological processes that may benefit host, but when is in excess could be implicated in disease and/or aging processes. PMID:25614460

  15. Thermodynamics of the multi-stage DNA lesion recognition and repair by formamidopyrimidine-DNA glycosylase using pyrrolocytosine fluorescence—stopped-flow pre-steady-state kinetics

    PubMed Central

    Kuznetsov, Nikita A.; Vorobjev, Yuri N.; Krasnoperov, Lev N.; Fedorova, Olga S.

    2012-01-01

    Formamidopyrimidine-DNA glycosylase, Fpg protein from Escherichia coli, initiates base excision repair in DNA by removing a wide variety of oxidized lesions. In this study, we perform thermodynamic analysis of the multi-stage interaction of Fpg with specific DNA-substrates containing 7,8-dihydro-8-oxoguanosine (oxoG), or tetrahydrofuran (THF, an uncleavable abasic site analog) and non-specific (G) DNA-ligand based on stopped-flow kinetic data. Pyrrolocytosine, highly fluorescent analog of the natural nucleobase cytosine, is used to record multi-stage DNA lesion recognition and repair kinetics over a temperature range (10–30°C). The kinetic data were used to obtain the standard Gibbs energy, enthalpy and entropy of the specific stages using van’t Hoff approach. The data suggest that not only enthalpy-driven exothermic oxoG recognition, but also the desolvation-accompanied entropy-driven enzyme-substrate complex adjustment into the catalytically active state play equally important roles in the overall process. PMID:22584623

  16. In vivo treatment with aflatoxin B1 increases DNA oxidation, base excision repair activity and 8-oxoguanine DNA glycosylase 1 levels in mouse lung.

    PubMed

    Guindon-Kezis, Katherine A; Mulder, Jeanne E; Massey, Thomas E

    2014-07-03

    Carcinogenicity of the mycotoxin aflatoxin B1 (AFB1), which is produced by Aspergillus fungi, is associated with bioactivation of AFB1 to AFB1-8,9-exo-epoxide and formation of DNA adducts. However, AFB1 also causes 8-hydroxy-2'-deoxyguanosine (8-OHdG) formation in mouse lung DNA, suggesting that oxidative DNA damage may also contribute to AFB1 carcinogenicity. The oxidative DNA damage 5-hydroxy-2'-deoxycytidine (5-OHdC) may also contribute to AFB1 carcinogenicity. The objective of the present study was to determine the effect of treatment of mice with AFB1 on pulmonary and hepatic: 8-OHdG and 5-OHdC levels; base excision repair (BER, which repairs oxidative DNA damage) activities; and on levels of 8-oxoguanine DNA glycosylase (OGG1, the rate-limiting enzyme in the BER of 8-OHdG). Female A/J mice were treated with vehicle (dimethyl sulfoxide) or 50 mg/kg AFB1 ip. Oxidative DNA damage was measured using HPLC with electrochemical detection, BER activity was assessed using an in vitro assay that employs a substrate plasmid DNA with 8-OHdG lesions, and OGG1 protein levels were determined by immunoblotting. Two hours post treatment, AFB1 increased 8-OHdG levels in mouse lung DNA by approximately 69% relative to control (p<0.05), but did not alter 8-OHdG levels in liver or 5-OHdC levels in lung or liver (p>0.05). AFB1 treatment also increased BER activity in mouse lung by approximately 87% (p<0.05) but did not affect hepatic BER activity (p>0.05). Levels of OGG1 immunoreactive protein were increased in both lung (20%) and liver (60%) (p<0.05). These results are consistent with oxidative DNA damage contributing to the carcinogenicity of AFB1 in this model.

  17. Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR.

    PubMed

    Kleiboeker, Steven B

    2005-04-11

    Although PCR and RT-PCR provided a valuable approach for detection of pathogens, the high level of sensitivity of these assays also makes them prone to false positive results. In addition to cross-contamination with true positive samples, false positive results are also possible due to "carry-over" contamination of samples with amplicon DNA generated by previous reactions. To reduce this source of false positives, amplicon generated by reactions in which dUTP was substituted for dTTP can be degraded by uracil DNA glycosylase (UNG). UNG does not degrade RNA but will cleave contaminating uracil-containing DNA while leaving thymine-containing DNA intact. The availability of heat-labile UNG makes use of this approach feasible for RT-PCR. In this study, real-time RT-PCR was used to quantify UNG degradation of amplicon DNA and the effect of UNG on RNA detection. Using the manufacturers' recommended conditions, complete degradation of DNA was not observed for samples containing 250 copies of amplicon DNA. Doubling the UNG concentration resulted in degradation of the two lowest concentrations of DNA tested, but also resulted in an increase of 1.94 cycles in the CT for RNA detection. To improve DNA degradation while minimizing the effect on RNA detection, a series of time, temperature and enzyme concentrations were evaluated. Optimal conditions were found to be 0.25 U UNG per 25 microl reaction with a 20 min, 30 degrees C incubation prior to RT-PCR. Under these conditions, high concentrations of amplicon DNA could be degraded while the CT for RNA detection was increased by 1.2 cycles.

  18. UV endonuclease of Micrococcus luteus, a cyclobutane pyrimidine dimer–DNA glycosylase/abasic lyase: Cloning and characterization of the gene

    PubMed Central

    Shiota, Susumu; Nakayama, Hiroaki

    1997-01-01

    The gene of Micrococcus luteus UV endonuclease (cyclobutane pyrimidine dimer–DNA glycosylase/abasic lyase) was cloned and characterized. The cloned gene, whose product had a predicted molecular mass of 17,120 Da, was found to be capable of complementing the Escherichia coli uvrA6 mutation in vivo with respect to resistance to acetone-mediated molecular photosensitization, a treatment producing exclusively cyclobutane pyrimidine dimers in DNA. It also generated a nicking activity specific for photosensitization-treated DNA by in vitro transcription/translation. When expressed in E. coli cells, the gene produced a protein structurally identical with UV endonuclease and possessing an activity consistent with cyclobutane pyrimidine dimer–DNA glycosylase/abasic lyase with respect to the effect of inhibitors and the site of the DNA backbone scission. Furthermore, the UV endonuclease-deficient mutant DB7 was shown to regain the enzyme through transformation with the cloned gene. The deduced amino acid sequence of the gene product was at best 27% identical with that of endonuclease V of phage T4, an enzyme strikingly similar to UV endonuclease in molecular and catalytic properties. Despite this marginal overall similarity in amino acid sequence, four of the seven amino acid residues reported to be functionally important in the T4 enzyme were found to be conserved in the M. luteus enzyme. We propose that the gene be called uveA. PMID:9012829

  19. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

    PubMed

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline; Vaclová, Tereza; Pita, Guillermo; Alonso, Rosario; Peterlongo, Paolo; Blanco, Ignacio; de la Hoya, Miguel; Duran, Mercedes; Díez, Orland; Ramón Y Cajal, Teresa; Konstantopoulou, Irene; Martínez-Bouzas, Cristina; Andrés Conejero, Raquel; Soucy, Penny; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; Swe-Brca; Arver, Brita; Rantala, Johanna; Loman, Niklas; Ehrencrona, Hans; Olopade, Olufunmilayo I; Beattie, Mary S; Domchek, Susan M; Nathanson, Katherine; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Walsh, Christine; Lester, Jenny; John, Esther M; Whittemore, Alice S; Daly, Mary B; Southey, Melissa; Hopper, John; Terry, Mary B; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Steele, Linda; Neuhausen, Susan L; Ding, Yuan Chun; Hansen, Thomas V O; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Infante, Mar; Herráez, Belén; Moreno, Leticia Thais; Weitzel, Jeffrey N; Herzog, Josef; Weeman, Kisa; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Bonanni, Bernardo; Mariette, Frederique; Volorio, Sara; Viel, Alessandra; Varesco, Liliana; Papi, Laura; Ottini, Laura; Tibiletti, Maria Grazia; Radice, Paolo; Yannoukakos, Drakoulis; Garber, Judy; Ellis, Steve; Frost, Debra; Platte, Radka; Fineberg, Elena; Evans, Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Cole, Trevor; Eccles, Diana; Cook, Jackie; Hodgson, Shirley; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Porteous, Mary; Side, Lucy; Walker, Lisa; Morrison, Patrick; Donaldson, Alan; Kennedy, John; Foo, Claire; Godwin, Andrew K; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Jörg; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M; Mazoyer, Sylvie; Damiola, Francesca; Poppe, Bruce; Claes, Kathleen; Piedmonte, Marion; Tucker, Kathy; Backes, Floor; Rodríguez, Gustavo; Brewster, Wendy; Wakeley, Katie; Rutherford, Thomas; Caldés, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Rookus, Matti A; van Os, Theo A M; van der Kolk, Lizet; de Lange, J L; Meijers-Heijboer, Hanne E J; van der Hout, A H; van Asperen, Christi J; Gómez Garcia, Encarna B; Hoogerbrugge, Nicoline; Collée, J Margriet; van Deurzen, Carolien H M; van der Luijt, Rob B; Devilee, Peter; Hebon; Olah, Edith; Lázaro, Conxi; Teulé, Alex; Menéndez, Mireia; Jakubowska, Anna; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Johannsson, Oskar Th; Maugard, Christine; Montagna, Marco; Tognazzo, Silvia; Teixeira, Manuel R; Healey, Sue; Investigators, Kconfab; Olswold, Curtis; Guidugli, Lucia; Lindor, Noralane; Slager, Susan; Szabo, Csilla I; Vijai, Joseph; Robson, Mark; Kauff, Noah; Zhang, Liying; Rau-Murthy, Rohini; Fink-Retter, Anneliese; Singer, Christian F; Rappaport, Christine; Geschwantler Kaulich, Daphne; Pfeiler, Georg; Tea, Muy-Kheng; Berger, Andreas; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Lejbkowicz, Flavio; Andrulis, Irene; Mulligan, Anna Marie; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Thomassen, Mads; Kruse, Torben A; Jensen, Uffe Birk; Friedman, Eitan; Laitman, Yael; Shimon, Shani Paluch; Simard, Jacques; Easton, Douglas F; Offit, Kenneth; Couch, Fergus J; Chenevix-Trench, Georgia; Antoniou, Antonis C; Benitez, Javier

    2014-04-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase), and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2). Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2) gene (HR: 1.09, 95% CI (1.03-1.16), p = 2.7 × 10(-3)) for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase) gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3)). DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  20. DNA Glycosylases Involved in Base Excision Repair May Be Associated with Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    PubMed Central

    Osorio, Ana; Milne, Roger L.; Kuchenbaecker, Karoline; Vaclová, Tereza; Pita, Guillermo; Alonso, Rosario; Peterlongo, Paolo; Blanco, Ignacio; de la Hoya, Miguel; Duran, Mercedes; Díez, Orland; Ramón y Cajal, Teresa; Konstantopoulou, Irene; Martínez-Bouzas, Cristina; Andrés Conejero, Raquel; Soucy, Penny; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; SWE-BRCA; Arver, Brita; Rantala, Johanna; Loman, Niklas; Ehrencrona, Hans; Olopade, Olufunmilayo I.; Beattie, Mary S.; Domchek, Susan M.; Nathanson, Katherine; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; John, Esther M.; Whittemore, Alice S.; Daly, Mary B.; Southey, Melissa; Hopper, John; Terry, Mary B.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Steele, Linda; Neuhausen, Susan L.; Ding, Yuan Chun; Hansen, Thomas v. O.; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Infante, Mar; Herráez, Belén; Moreno, Leticia Thais; Weitzel, Jeffrey N.; Herzog, Josef; Weeman, Kisa; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Bonanni, Bernardo; Mariette, Frederique; Volorio, Sara; Viel, Alessandra; Varesco, Liliana; Papi, Laura; Ottini, Laura; Tibiletti, Maria Grazia; Radice, Paolo; Yannoukakos, Drakoulis; Garber, Judy; Ellis, Steve; Frost, Debra; Platte, Radka; Fineberg, Elena; Evans, Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Cole, Trevor; Eccles, Diana; Cook, Jackie; Hodgson, Shirley; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Porteous, Mary; Side, Lucy; Walker, Lisa; Morrison, Patrick; Donaldson, Alan; Kennedy, John; Foo, Claire; Godwin, Andrew K.; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Jörg; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M.; Mazoyer, Sylvie; Damiola, Francesca; Poppe, Bruce; Claes, Kathleen; Piedmonte, Marion; Tucker, Kathy; Backes, Floor; Rodríguez, Gustavo; Brewster, Wendy; Wakeley, Katie; Rutherford, Thomas; Caldés, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Rookus, Matti A.; van Os, Theo A. M.; van der Kolk, Lizet; de Lange, J. L.; Meijers-Heijboer, Hanne E. J.; van der Hout, A. H.; van Asperen, Christi J.; Gómez Garcia, Encarna B.; Hoogerbrugge, Nicoline; Collée, J. Margriet; van Deurzen, Carolien H. M.; van der Luijt, Rob B.; Devilee, Peter; HEBON; Olah, Edith; Lázaro, Conxi; Teulé, Alex; Menéndez, Mireia; Jakubowska, Anna; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Johannsson, Oskar Th.; Maugard, Christine; Montagna, Marco; Tognazzo, Silvia; Teixeira, Manuel R.; Healey, Sue; Investigators, kConFab; Olswold, Curtis; Guidugli, Lucia; Lindor, Noralane; Slager, Susan; Szabo, Csilla I.; Vijai, Joseph; Robson, Mark; Kauff, Noah; Zhang, Liying; Rau-Murthy, Rohini; Fink-Retter, Anneliese; Singer, Christian F.; Rappaport, Christine; Geschwantler Kaulich, Daphne; Pfeiler, Georg; Tea, Muy-Kheng; Berger, Andreas; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Lejbkowicz, Flavio; Andrulis, Irene; Mulligan, Anna Marie; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Thomassen, Mads; Kruse, Torben A.; Jensen, Uffe Birk; Friedman, Eitan; Laitman, Yael; Shimon, Shani Paluch; Simard, Jacques; Easton, Douglas F.; Offit, Kenneth; Couch, Fergus J.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Benitez, Javier

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase), and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2). Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2) gene (HR: 1.09, 95% CI (1.03–1.16), p = 2.7×10−3) for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase) gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03–1.21, p = 4.8×10−3). DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied. PMID:24698998

  1. Structural genes of wheat and barley 5-methylcytosine DNA glycosylases and their potential applications for human health

    PubMed Central

    Wen, Shanshan; Wen, Nuan; Pang, Jinsong; Langen, Gregor; Brew-Appiah, Rhoda A. T.; Mejias, Jaime H.; Osorio, Claudia; Yang, Mingming; Gemini, Richa; Moehs, Charles P.; Zemetra, Robert S.; Kogel, Karl-Heinz; Liu, Bao; Wang, Xingzhi; von Wettstein, Diter; Rustgi, Sachin

    2012-01-01

    Wheat supplies about 20% of the total food calories consumed worldwide and is a national staple in many countries. Besides being a key source of plant proteins, it is also a major cause of many diet-induced health issues, especially celiac disease. The only effective treatment for this disease is a total gluten-free diet. The present report describes an effort to develop a natural dietary therapy for this disorder by transcriptional suppression of wheat DEMETER (DME) homeologs using RNA interference. DME encodes a 5-methylcytosine DNA glycosylase responsible for transcriptional derepression of gliadins and low-molecular-weight glutenins (LMWgs) by active demethylation of their promoters in the wheat endosperm. Previous research has demonstrated these proteins to be the major source of immunogenic epitopes. In this research, barley and wheat DME genes were cloned and localized on the syntenous chromosomes. Nucleotide diversity among DME homeologs was studied and used for their virtual transcript profiling. Functional conservation of DME enzyme was confirmed by comparing the motif and domain structure within and across the plant kingdom. Presence and absence of CpG islands in prolamin gene sequences was studied as a hallmark of hypo- and hypermethylation, respectively. Finally the epigenetic influence of DME silencing on accumulation of LMWgs and gliadins was studied using 20 transformants expressing hairpin RNA in their endosperm. These transformants showed up to 85.6% suppression in DME transcript abundance and up to 76.4% reduction in the amount of immunogenic prolamins, demonstrating the possibility of developing wheat varieties compatible for the celiac patients. PMID:23184965

  2. Structural genes of wheat and barley 5-methylcytosine DNA glycosylases and their potential applications for human health.

    PubMed

    Wen, Shanshan; Wen, Nuan; Pang, Jinsong; Langen, Gregor; Brew-Appiah, Rhoda A T; Mejias, Jaime H; Osorio, Claudia; Yang, Mingming; Gemini, Richa; Moehs, Charles P; Zemetra, Robert S; Kogel, Karl-Heinz; Liu, Bao; Wang, Xingzhi; von Wettstein, Diter; Rustgi, Sachin

    2012-12-11

    Wheat supplies about 20% of the total food calories consumed worldwide and is a national staple in many countries. Besides being a key source of plant proteins, it is also a major cause of many diet-induced health issues, especially celiac disease. The only effective treatment for this disease is a total gluten-free diet. The present report describes an effort to develop a natural dietary therapy for this disorder by transcriptional suppression of wheat DEMETER (DME) homeologs using RNA interference. DME encodes a 5-methylcytosine DNA glycosylase responsible for transcriptional derepression of gliadins and low-molecular-weight glutenins (LMWgs) by active demethylation of their promoters in the wheat endosperm. Previous research has demonstrated these proteins to be the major source of immunogenic epitopes. In this research, barley and wheat DME genes were cloned and localized on the syntenous chromosomes. Nucleotide diversity among DME homeologs was studied and used for their virtual transcript profiling. Functional conservation of DME enzyme was confirmed by comparing the motif and domain structure within and across the plant kingdom. Presence and absence of CpG islands in prolamin gene sequences was studied as a hallmark of hypo- and hypermethylation, respectively. Finally the epigenetic influence of DME silencing on accumulation of LMWgs and gliadins was studied using 20 transformants expressing hairpin RNA in their endosperm. These transformants showed up to 85.6% suppression in DME transcript abundance and up to 76.4% reduction in the amount of immunogenic prolamins, demonstrating the possibility of developing wheat varieties compatible for the celiac patients.

  3. Slow repair of lipid peroxidation-induced DNA damage at p53 mutation hotspots in human cells caused by low turnover of a DNA glycosylase

    PubMed Central

    Woodrick, Jordan; Gupta, Suhani; Khatkar, Pooja; Sarangi, Sanchita; Narasimhan, Ganga; Trehan, Akriti; Adhikari, Sanjay; Roy, Rabindra

    2014-01-01

    Repair of oxidative stress- and inflammation-induced DNA lesions by the base excision repair (BER) pathway prevents mutation, a form of genomic instability which is often observed in cancer as ‘mutation hotspots’. This suggests that some sequences have inherent mutability, possibly due to sequence-related differences in repair. This study has explored intrinsic mutability as a consequence of sequence-specific repair of lipid peroxidation-induced DNA adduct, 1, N6-ethenoadenine (εA). For the first time, we observed significant delay in repair of ϵA at mutation hotspots in the tumor suppressor gene p53 compared to non-hotspots in live human hepatocytes and endothelial cells using an in-cell real time PCR-based method. In-cell and in vitro mechanism studies revealed that this delay in repair was due to inefficient turnover of N-methylpurine-DNA glycosylase (MPG), which initiates BER of εA. We determined that the product dissociation rate of MPG at the hotspot codons was ≈5–12-fold lower than the non-hotspots, suggesting a previously unknown mechanism for slower repair at mutation hotspots and implicating sequence-related variability of DNA repair efficiency to be responsible for mutation hotspot signatures. PMID:25081213

  4. The metabolic syndrome resulting from a knockout of the NEIL1 DNA glycosylase

    PubMed Central

    Vartanian, Vladimir; Lowell, Brian; Minko, Irina G.; Wood, Thomas G.; Ceci, Jeffrey D.; George, Shakeeta; Ballinger, Scott W.; Corless, Christopher L.; McCullough, Amanda K.; Lloyd, R. Stephen

    2006-01-01

    Endogenously formed reactive oxygen species continuously damage cellular constituents including DNA. These challenges, coupled with exogenous exposure to agents that generate reactive oxygen species, are both associated with normal aging processes and linked to cardiovascular disease, cancer, cataract formation, and fatty liver disease. Although not all of these diseases have been definitively shown to originate from mutations in nuclear DNA or mitochondrial DNA, repair of oxidized, saturated, and ring-fragmented bases via the base excision repair pathway is known to be critical for maintaining genomic stability. One enzyme that initiates base excision repair of ring-fragmented purines and some saturated pyrimidines is NEIL1, a mammalian homolog to Escherichia coli endonuclease VIII. To investigate the organismal consequences of a deficiency in NEIL1, a knockout mouse model was created. In the absence of exogenous oxidative stress, neil1 knockout (neil1−/−) and heterozygotic (neil1+/−) mice develop severe obesity, dyslipidemia, and fatty liver disease and also have a tendency to develop hyperinsulinemia. In humans, this combination of clinical manifestations, including hypertension, is known as the metabolic syndrome and is estimated to affect >40 million people in the United States. Additionally, mitochondrial DNA from neil1−/− mice show increased levels of steady-state DNA damage and deletions relative to wild-type controls. These data suggest an important role for NEIL1 in the prevention of the diseases associated with the metabolic syndrome. PMID:16446448

  5. A chicken embryo protein related to the mammalian DEAD box protein p68 is tightly associated with the highly purified protein-RNA complex of 5-MeC-DNA glycosylase.

    PubMed

    Jost, J P; Schwarz, S; Hess, D; Angliker, H; Fuller-Pace, F V; Stahl, H; Thiry, S; Siegmann, M

    1999-08-15

    We have shown previously that DNA demethylation by chick embryo 5-methylcytosine (5-MeC)-DNA glycosylase needs both protein and RNA. Amino acid sequences of nine peptides derived from a highly purified 5-MeC-DNA glycosylase complex were identified by Nanoelectrospray ionisation mass spectrometry to be identical to the mammalian nuclear DEAD box protein p68 RNA helicase. Antibodies directed against human p68 helicase cross-reacted with the purified 5-MeC-DNA glycosylase complex and immunoprecipitated the glycosylase activity. A 2690 bp cDNA coding for the chicken homologue of mammalian p68 was isolated and sequenced. Its derived amino acid sequence is almost identical to the human p68 DEAD box protein up to amino acid position 473 (from a total of 595). This sequence contains all the essential conserved motifs from the DEAD box proteins which are the ATPase, RNA unwinding and RNA binding motifs. The rest of the 122 amino acids in the C-terminal region rather diverge from the human p68 RNA helicase sequence. The recombinant chicken DEAD box protein expressed in Escherichia coli cross-reacts with the same p68 antibodies as the purified chicken embryo 5-MeC-DNA glycosylase complex. The recombinant protein has an RNA-dependent ATPase and an ATP-dependent helicase activity. However, in the presence or absence of RNA the recombinant protein had no 5-MeC-DNA glycosylase activity. In situ hybridisation of 5 day-old chicken embryos with antisense probes of the chicken DEAD box protein shows a high abundance of its transcripts in differentiating embryonic tissues.

  6. Acanthopanax versus 3-Methyladenine Ameliorates Sodium Taurocholate-Induced Severe Acute Pancreatitis by Inhibiting the Autophagic Pathway in Rats

    PubMed Central

    Zhou, Guoxiong; Liu, Chun; Wei, Ronglong; Zhu, Shunxing; Xu, Yuefen; Wu, Mengjie; Miao, Qing

    2016-01-01

    Objectives. To observe the therapeutic effects of Acanthopanax and 3-methyladenine against severe acute pancreatitis (SAP). Methods. Sodium taurocholate-induced SAP rats were equally randomized into a SAP group, an Acanthopanax group, and a 3-methyladenine group. Serum amylase levels were determined by ELISA; protein and mRNA expression levels of nucleus nuclear factor kappa B (NF-κB) p65, light chain 3II (LC3-II), and Beclin-1 and mRNA expression levels of Class III phosphatidylinositol 3-kinase (PI3K-III) in pancreas tissue were detected by Western blot and quantitative real-time PCR, respectively; mortality and pathological change of the pancreas were observed at 3, 12, and 24 h after operation. Results. There was no significant difference in mortality between SAP group and both treatment groups (P > 0.05). Serum amylase levels, protein, and mRNA expression levels of nucleus NF-κB p65, LC3-II, and Beclin-1 protein, mRNA expression levels of PI3K-III, and pathological score of the pancreas in both treatment groups were significantly lower than those in SAP group at 12 and 24 h after operation (P < 0.05 or 0.01). The number of autophagosomes and autophagolysosomes of pancreatic acinar cells in both treatment groups was smaller than that in SAP group at 12 and 24 h. Conclusions. Acanthopanax and 3-methyladenine had similar therapeutic effects against SAP in rats. The mechanism may be through inhibiting abnormal autophagy activation of pancreatic acinar cells. PMID:28115794

  7. Evaluation of the Role of the Vaccinia Virus Uracil DNA Glycosylase and A20 Proteins as Intrinsic Components of the DNA Polymerase Holoenzyme*

    PubMed Central

    Boyle, Kathleen A.; Stanitsa, Eleni S.; Greseth, Matthew D.; Lindgren, Jill K.; Traktman, Paula

    2011-01-01

    The vaccinia virus DNA polymerase is inherently distributive but acquires processivity by associating with a heterodimeric processivity factor comprised of the viral A20 and D4 proteins. D4 is also an enzymatically active uracil DNA glycosylase (UDG). The presence of an active repair protein as an essential component of the polymerase holoenzyme is a unique feature of the replication machinery. We have shown previously that the A20-UDG complex has a stoichiometry of ∼1:1, and our data suggest that A20 serves as a bridge between polymerase and UDG. Here we show that conserved hydrophobic residues in the N′ terminus of A20 are important for its binding to UDG. Our data argue against the assembly of D4 into higher order multimers, suggesting that the processivity factor does not form a toroidal ring around the DNA. Instead, we hypothesize that the intrinsic, processive DNA scanning activity of UDG tethers the holoenzyme to the DNA template. The inclusion of UDG as an essential holoenzyme component suggests that replication and base excision repair may be coupled. Here we show that the DNA polymerase can utilize dUTP as a substrate in vitro. Moreover, uracil moieties incorporated into the nascent strand during holoenzyme-mediated DNA synthesis can be excised by the viral UDG present within this holoenzyme, leaving abasic sites. Finally, we show that the polymerase stalls upon encountering an abasic site in the template strand, indicating that, like many replicative polymerases, the poxviral holoenzyme cannot perform translesion synthesis across an abasic site. PMID:21572084

  8. RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures.

    PubMed

    Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar

    2010-06-04

    The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome.

  9. Naturally occurring polyphenol, morin hydrate, inhibits enzymatic activity of N-methylpurine DNA glycosylase, a DNA repair enzyme with various roles in human disease.

    PubMed

    Dixon, Monica; Woodrick, Jordan; Gupta, Suhani; Karmahapatra, Soumendra Krishna; Devito, Stephen; Vasudevan, Sona; Dakshanamurthy, Sivanesan; Adhikari, Sanjay; Yenugonda, Venkata M; Roy, Rabindra

    2015-03-01

    Interest in the mechanisms of DNA repair pathways, including the base excision repair (BER) pathway specifically, has heightened since these pathways have been shown to modulate important aspects of human disease. Modulation of the expression or activity of a particular BER enzyme, N-methylpurine DNA glycosylase (MPG), has been demonstrated to play a role in carcinogenesis and resistance to chemotherapy as well as neurodegenerative diseases, which has intensified the focus on studying MPG-related mechanisms of repair. A specific small molecule inhibitor for MPG activity would be a valuable biochemical tool for understanding these repair mechanisms. By screening several small molecule chemical libraries, we identified a natural polyphenolic compound, morin hydrate, which inhibits MPG activity specifically (IC50=2.6μM). Detailed mechanism analysis showed that morin hydrate inhibited substrate DNA binding of MPG, and eventually the enzymatic activity of MPG. Computational docking studies with an x-ray derived MPG structure as well as comparison studies with other structurally-related flavonoids offer a rationale for the inhibitory activity of morin hydrate observed. The results of this study suggest that the morin hydrate could be an effective tool for studying MPG function and it is possible that morin hydrate and its derivatives could be utilized in future studies focused on the role of MPG in human disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Naturally occurring polyphenol, morin hydrate, inhibits enzymatic activity of N-methylpurine DNA glycosylase, a DNA repair enzyme with various roles in human disease

    PubMed Central

    Dixon, Monica; Woodrick, Jordan; Gupta, Suhani; Karmahapatra, Soumendra Krishna; Devito, Stephen; Vasudevan, Sona; Dakshanamurthy, Sivanesan; Adhikari, Sanjay; Yenugonda, Venkata M.; Roy, Rabindra

    2015-01-01

    Interest in the mechanisms of DNA repair pathways, including the base excision repair (BER) pathway specifically, has heightened since these pathways have been shown to modulate important aspects of human disease. Modulation of the expression or activity of a particular BER enzyme, N-methylpurine DNA glycosylase (MPG), has been demonstrated to play a role in carcinogenesis and resistance to chemotherapy as well as neurodegenerative diseases, which has intensified the focus on studying MPG-related mechanisms of repair. A specific small molecule inhibitor for MPG activity would be a valuable biochemical tool for understanding these repair mechanisms. By screening several small molecule chemical libraries, we identified a natural polyphenolic compound, morin hydrate, which inhibits MPG activity specifically (IC50 = 2.6 µM). Detailed mechanism analysis showed that morin hydrate inhibited substrate DNA binding of MPG, and eventually the enzymatic activity of MPG. Computational docking studies with an x-ray derived MPG structure as well as comparison studies with other structurally-related flavanoids offer a rationale for the inhibitory activity of morin hydrate observed. The results of this study suggest that the morin hydrate could be an effective tool for studying MPG function and it is possible that morin hydrate and its derivatives could be utilized in future studies focused on the role of MPG in human disease. PMID:25650313

  11. Repair of 8-oxo-7,8-dihydroguanine in prokaryotic and eukaryotic cells: Properties and biological roles of the Fpg and OGG1 DNA N-glycosylases.

    PubMed

    Boiteux, Serge; Coste, Franck; Castaing, Bertrand

    2017-06-01

    Oxidatively damaged DNA results from the attack of sugar and base moieties by reactive oxygen species (ROS), which are formed as byproducts of normal cell metabolism and during exposure to endogenous or exogenous chemical or physical agents. Guanine, having the lowest redox potential, is the DNA base the most susceptible to oxidation, yielding products such as 8-oxo-7,8-dihydroguanine (8-oxoG) and 2-6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG). In DNA, 8-oxoG was shown to be mutagenic yielding GC to TA transversions upon incorporation of dAMP opposite this lesion by replicative DNA polymerases. In prokaryotic and eukaryotic cells, 8-oxoG is primarily repaired by the base excision repair pathway (BER) initiated by a DNA N-glycosylase, Fpg and OGG1, respectively. In Escherichia coli, Fpg cooperates with MutY and MutT to prevent 8-oxoG-induced mutations, the "GO-repair system". In Saccharomyces cerevisiae, OGG1 cooperates with nucleotide excision repair (NER), mismatch repair (MMR), post-replication repair (PRR) and DNA polymerase η to prevent mutagenesis. Human and mouse cells mobilize all these pathways using OGG1, MUTYH (MutY-homolog also known as MYH), MTH1 (MutT-homolog also known as NUDT1), NER, MMR, NEILs and DNA polymerases η and λ, to prevent 8-oxoG-induced mutations. In fact, mice deficient in both OGG1 and MUTYH develop cancer in different organs at adult age, which points to the critical impact of 8-oxoG repair on genetic stability in mammals. In this review, we will focus on Fpg and OGG1 proteins, their biochemical and structural properties as well as their biological roles. Other DNA N-glycosylases able to release 8-oxoG from damaged DNA in various organisms will be discussed. Finally, we will report on the role of OGG1 in human disease and the possible use of 8-oxoG DNA N-glycosylases as therapeutic targets. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Mutation of a unique aspartate residue abolishes the catalytic activity but not substrate binding of the mouse N-methylpurine-DNA glycosylase (MPG).

    PubMed

    Roy, R; Biswas, T; Lee, J C; Mitra, S

    2000-02-11

    N-Methylpurine-DNA glycosylase (MPG) initiates base excision repair in DNA by removing a variety of alkylated purine adducts. Although Asp was identified as the active site residue in various DNA glycosylases based on the crystal structure, Glu-125 in human MPG (Glu-145 in mouse MPG) was recently proposed to be the catalytic residue. Mutational analysis for all Asp residues in a truncated, fully active MPG protein showed that only Asp-152 (Asp-132 in the human protein), which is located near the active site, is essential for catalytic activity. However, the substrate binding was not affected in the inactive Glu-152, Asn-152, and Ala-152 mutants. Furthermore, mutation of Asp-152 did not significantly affect the intrinsic tryptophan fluorescence of the enzyme and the far UV CD spectra, although a small change in the near UV CD spectra of the mutants suggests localized conformational change in the aromatic residues. We propose that in addition to Glu-145 in mouse MPG, which functions as the activator of a water molecule for nucleophilic attack, Asp-152 plays an essential role either by donating a proton to the substrate base and, thus, facilitating its release or by stabilizing the steric configuration of the active site pocket.

  13. Diagnostic correlation between the expression of the DNA repair enzyme N-methylpurine DNA glycosylase and esophageal adenocarcinoma onset: a retrospective pilot study.

    PubMed

    Zaïr, Z M; Johnson, G E; Griffiths, A P; Jenkins, G J

    2013-08-01

    EAC in its early stages, when it can potentially be cured, is rarely symptomatic and is associated with high mortality rates because in part of late-stage diagnosis. Given that DNA repair is an important contributory factor of early-stage malignancy, our study focused on the expression of the base excision repair enzyme N-methylpurine DNA glycosylase (MPG) in EAC disease onset. MPG messenger RNA (mRNA) expression levels were determined using quantitative reverse transcriptase polymerase chain reaction from a maximum of 72 patient samples. Immunohistochemistry was further utilized for the detection of MPG protein, and semiquantitative analysis performed using an H-score approach was carried out on a total of 130 archival tissue samples of different esophageal pathologies. Nuclear localized MPG protein was detected in all nonmalignant tissues derived from the enterohepatic system, with H-score values of 3.9-5.5 ± 0.4-1.0. In cancerous tissues derived from the enterohepatic system, a 9.5-fold increase in the level of MPG mRNA expression was specifically observed in the malignant regions located within the esophagus region. Further analysis revealed a 9- and 14-fold increase in MPG mRNA expression in EAC tumor, node, metastasis stages II and III, respectively, suggesting MPG expression to correlate with EAC disease progression. Immunohistochemistry analysis further showed a sevenfold significant increase in MPG protein expression in EAC tissues. Intriguingly, there was a fivefold significant decrease in nuclear localized MPG protein expression in tissues derived from Barrett's esophagus and low-grade dysplasia. Such findings highlight a complex regulatory pattern governing DNA glycosylase base excision repair initiation, as normal tissue undergoes Barrett's metaplasia and later dedifferentiates to EAC. Indeed, disease-stage-specific alterations in the expression of MPG may highlight a potential role for MPG in determining EAC onset and thus potentially be of clinical

  14. Interplay between DNA N-glycosylases/AP lyases at multiply damaged sites and biological consequences

    PubMed Central

    Éot-Houllier, Grégory; Gonera, Marta; Gasparutto, Didier; Giustranti, Céline; Sage, Evelyne

    2007-01-01

    Evidence has emerged that repair of clustered DNA lesions may be compromised, possibly leading to the formation of double-strand breaks (DSB) and, thus, to deleterious events. The first repair event occurring at a multiply damaged site (MDS) is of major importance and will largely contribute to the hazardousness of MDS. Here, using protein extracts from wild type or hOGG1-overexpressing Chinese hamster ovary cells, we investigated the initial incision rate at base damage and the formation of repair intermediates in various complex MDS. These MDS comprise a 1 nt gap and 3–4 base damage, including 8-oxoguanine (oG) and 5-hydroxyuracil (hU). We report a hierarchy in base excision that mainly depends on the nature and the distribution of the damage. We also show that excision at both oG and hU, and consequently DSB formation, can be modulated by hOGG1 overexpression. Anyhow, for all the MDS analyzed, DSB formation is limited, due to impaired base excision. Interestingly, repair intermediates contain a short single-stranded region carrying a potentially mutagenic base damage. This in vitro study provides new insight into the processing of MDS and suggests that repair intermediates resulting from the processing of such MDS are rather mutagenic than toxic. PMID:17468500

  15. Gene amplification and expression of the DNA repair enzyme, N-methylpurine-DNA glycosylase (MPG) in HPV-infected cervical neoplasias.

    PubMed

    Sohn, T J; Kim, N K; An, H J; Ko, J J; Hahn, T R; Oh, D; Lee, S G; Roy, R; Cha, K Y; Oh, Y K

    2001-01-01

    Lethal and mutagenic damages of DNA is caused by a variety of agents including viruses. It is known that HPV is one of the major causes of cervical carcinogenesis and that cells eliminate DNA lesions with DNA repair enzymes. However, the role of N-methylpurine-DNA glycosylase (MPG) is not known in the development of cervical cancer. Multiplex polymerase chain reaction (PCR) was used for the detection and typing of HPV in the biopsy. Gene amplification of MPG was measured by a PCR-based assay. The mRNA levels of MPG were determined by reverse transcription-PCR using hypoxanthine-guanine phosphoribosyl transferase as the reference gene. An immunohistochemical technique was used to examine the distribution of MPG in the tissues. Of 68 Korean cervical neoplasia patients, 86.8% showed HPV infection. High-risk HPV 16/18 were the most prevalent but positive only in 47.3% of the invasive cancer patients. Gene amplification of MPG was significantly increased in high-risk HPV-infected tissues as compared to low-risk HPV-infected and normal tissues (p < 0.05). The mRNA levels of MPG were higher in HPV-infected invasive carcinoma than normal cervical tissues. Immunohistochemical staining revealed that the intracellular expression and distribution (localization) of MPG altered in the cervical neoplasia. Interestingly, MPG expression in CIN III and invasive carcinoma (IC) was much higher than normal and CIN I. Granular positivity of MPG was notable in the perinuclear regions of the cytoplasm in HPV-infected invasive cancer. This is the first report on MPG expression in cervical neoplasia. Our results indicate that the gene amplification and expression of MPG were increased in high-risk HPV-infected cervical neoplasias and the intracellular distribution of MPG protein was altered, suggesting a role of MPG in carcinogenesis.

  16. Nonenzymatic methylation of DNA by the intracellular methyl group donor S-adenosyl-L-methionine is a potentially mutagenic reaction.

    PubMed Central

    Rydberg, B; Lindahl, T

    1982-01-01

    Incubation of DNA with S-adenosyl-L-methionine (SAM) in neutral aqueous solution leads to base modification, with formation of small amounts of 7-methylguanine and 3-methyladenine. The products have been identified by high performance liquid chromatography of DNA hydrolysates and by the selective release of free 3-methyladenine from SAM-treated DNA by a specific DNA glycosylase. We conclude that SAM acts as a weak DNA-alkylating agent. Several control experiments including extensive purification of [3H-methyl]SAM preparations and elimination of the alkylating activity by pretreatment of SAM with a phage T3-induced SAM cleaving enzyme, have been performed to determine that the activity observed was due to SAM itself and not to a contaminating substance. We estimate that SAM, at an intracellular concentration of 4 X 10(-5) M, causes DNA alkylation at a level similar to that expected from continuous exposure of cells to 2 X 10(-8) M methyl methane-sulphonate. This ability of SAM to act as a methyl donor in a nonenzymatic reaction could result in a background of mutagenesis and carcinogenesis. The data provide an explanation for the apparently universal occurrence of multiple DNA repair enzymes specific for methylation damage. PMID:7188181

  17. Selective inhibition by methoxyamine of the apurinic/apyrimidinic endonuclease activity associated with pyrimidine dimer-DNA glycosylases from Micrococcus luteus and bacteriophage T4

    SciTech Connect

    Liuzzi, M.; Weinfeld, M.; Paterson, M.C.

    1987-06-16

    The UV endonucleases from Micrococcus luteus and bacteriophage T4 possess two catalytic activities specific for the site of cyclobutane pyrimidine dimers in UV-irradiated DNA: a DNA glycosylase that cleaves the 5'-glycosyl bond of the dimerized pyrimidines and an apurinic/apyrimidinic (AP) endonuclease that thereupon incises the phosphodiester bond 3' to the resulting apyrimidinic site. The authors have explored the potential use of methoxyamine, a chemical that reacts at neutral pH with AP sites in DNA, as a selective inhibitor of the AP endonuclease activities residing in the M. luteus and T4 enzymes. The presence of 50 mM methoxyamine during incubation of UV-treated, (/sup 3/H)thymine-labeled poly(dA) x poly(dT) with either enzyme preparation was found to protect completely the irradiated copolymer from endonucleolytic attack at dimer sites, as assayed by yield of acid-soluble radioactivity. In contrast, the dimer-DNA glycosylase activity of each enzyme remained fully functional, as monitored retrospectively by release of free thymine after either photochemical-(5 kJ/m/sup 2/, 254 nm) or photoenzymic- (Escherichia coli photolyase plus visible light) induced reversal of pyrimidine dimers in the UV-damaged substrate. The data demonstrate that the inhibition of the strand-incision reaction arises because of chemical modification of the AP sites and is not due to inactivation of the enzyme by methoxyamine. The results, combined with earlier findings for 5'-acting AP endonucleases, strongly suggest that methoxyamine is a highly specific inhibitor of virtually all AP endonucleases, irrespective of their modes of action, and may therefore prove useful in a wide variety of DNA repair studies.

  18. Kinetic mechanism for the excision of hypoxanthine by Escherichia coli AlkA and evidence for binding to DNA ends.

    PubMed

    Zhao, Boyang; O'Brien, Patrick J

    2011-05-24

    The Escherichia coli 3-methyladenine DNA glycosylase II protein (AlkA) recognizes a broad range of oxidized and alkylated base lesions and catalyzes the hydrolysis of the N-glycosidic bond to initiate the base excision repair pathway. Although the enzyme was one of the first DNA repair glycosylases to be discovered more than 25 years ago and there are multiple crystal structures, the mechanism is poorly understood. Therefore, we have characterized the kinetic mechanism for the AlkA-catalyzed excision of the deaminated purine, hypoxanthine. The multiple-turnover glycosylase assays are consistent with Michaelis-Menten kinetics. However, under single-turnover conditions that are commonly employed for studying other DNA glycosylases, we observe an unusual biphasic protein saturation curve. Initially, the observed rate constant for excision increases with an increasing level of AlkA protein, but at higher protein concentrations, the rate constant decreases. This behavior can be most easily explained by tight binding to DNA ends and by crowding of multiple AlkA protamers on the DNA. Consistent with this model, crystal structures have shown the preferential binding of AlkA to DNA ends. By varying the position of the lesion, we identified an asymmetric substrate that does not show inhibition at higher concentrations of AlkA, and we performed pre-steady state and steady state kinetic analysis. Unlike the situation in other glycosylases, release of the abasic product is faster than N-glycosidic bond cleavage. Nevertheless, AlkA exhibits significant product inhibition under multiple-turnover conditions, and it binds approximately 10-fold more tightly to an abasic site than to a hypoxanthine lesion site. This tight binding could help protect abasic sites when the adaptive response to DNA alkylation is activated and very high levels of AlkA protein are present.

  19. Human DNA glycosylases of the bacterial Fpg/MutM superfamily: an alternative pathway for the repair of 8-oxoguanine and other oxidation products in DNA.

    PubMed

    Morland, Ingrid; Rolseth, Veslemøy; Luna, Luisa; Rognes, Torbjørn; Bjørås, Magnar; Seeberg, Erling

    2002-11-15

    The mild phenotype associated with targeted disruption of the mouse OGG1 and NTH1 genes has been attributed to the existence of back-up activities and/or alternative pathways for the removal of oxidised DNA bases. We have characterised two new genes in human cells that encode DNA glycosylases, homologous to the bacterial Fpg (MutM)/Nei class of enzymes, capable of removing lesions that are substrates for both hOGG1 and hNTH1. One gene, designated HFPG1, showed ubiquitous expression in all tissues examined whereas the second gene, HFPG2, was only expressed at detectable levels in the thymus and testis. Transient transfections of HeLa cells with fusions of the cDNAs to EGFP revealed intracellular sorting to the nucleus with accumulation in the nucleoli for hFPG1, while hFPG2 co-localised with the 30 kDa subunit of RPA. hFPG1 was purified and shown to act on DNA substrates containing 8-oxoguanine, 5-hydroxycytosine and abasic sites. Removal of 8-oxoguanine, but not cleavage at abasic sites, was opposite base-dependent, with 8-oxoG:C being the preferred substrate and negligible activity towards 8-oxoG:A. It thus appears that hFPG1 has properties similar to mammalian OGG1 in preventing mutations arising from misincorporation of A across 8-oxoG and could function as a back-up repair activity for OGG1 in ogg1(-/-) mice.

  20. Uracil-DNA glycosylase-treated reverse transcription loop-mediated isothermal amplification for rapid detection of avian influenza virus preventing carry-over contamination.

    PubMed

    Kim, Eun-Mi; Jeon, Hyo-Sung; Kim, Ji-Jung; Shin, Yeun-Kyung; Lee, Youn-Jeong; Yeo, Sang-Geon; Park, Choi-Kyu

    2016-09-30

    Here, we describe a uracil-DNA glycosylase (UNG)-treated reverse transcription loop-mediated isothermal amplification (uRT-LAMP) for the visual detection of all subtypes of avian influenza A virus (AIV). The uRT-LAMP assay can prevent unwanted amplification by carryover contamination of the previously amplified DNA, although the detection limit of the uRT-LAMP assay is 10-fold lower than that of the RT-LAMP without a UNG treatment. To the best of our knowledge, this is the first successful application of deoxyuridine triphosphate/UNG strategy in RT-LAMP for AIV detection, and the assay can be applied for the rapid, and reliable diagnosis of AIVs, even in contaminated samples.

  1. Uracil-DNA glycosylase-treated reverse transcription loop-mediated isothermal amplification for rapid detection of avian influenza virus preventing carry-over contamination

    PubMed Central

    Kim, Eun-Mi; Jeon, Hyo-Sung; Kim, Ji-Jung; Shin, Yeun-Kyung; Lee, Youn-Jeong; Yeo, Sang-Geon

    2016-01-01

    Here, we describe a uracil-DNA glycosylase (UNG)-treated reverse transcription loop-mediated isothermal amplification (uRT-LAMP) for the visual detection of all subtypes of avian influenza A virus (AIV). The uRT-LAMP assay can prevent unwanted amplification by carryover contamination of the previously amplified DNA, although the detection limit of the uRT-LAMP assay is 10-fold lower than that of the RT-LAMP without a UNG treatment. To the best of our knowledge, this is the first successful application of deoxyuridine triphosphate/UNG strategy in RT-LAMP for AIV detection, and the assay can be applied for the rapid, and reliable diagnosis of AIVs, even in contaminated samples. PMID:26726027

  2. Distinct functional consequences of MUTYH variants associated with colorectal cancer: Damaged DNA affinity, glycosylase activity and interaction with PCNA and Hus1.

    PubMed

    Brinkmeyer, Megan K; David, Sheila S

    2015-10-01

    MUTYH is a base excision repair (BER) enzyme that prevents mutations in DNA associated with 8-oxoguanine (OG) by catalyzing the removal of adenine from inappropriately formed OG:A base-pairs. Germline mutations in the MUTYH gene are linked to colorectal polyposis and a high risk of colorectal cancer, a syndrome referred to as MUTYH-associated polyposis (MAP). There are over 300 different MUTYH mutations associated with MAP and a large fraction of these gene changes code for missense MUTYH variants. Herein, the adenine glycosylase activity, mismatch recognition properties, and interaction with relevant protein partners of human MUTYH and five MAP variants (R295C, P281L, Q324H, P502L, and R520Q) were examined. P281L MUTYH was found to be severely compromised both in DNA binding and base excision activity, consistent with the location of this variation in the iron-sulfur cluster (FCL) DNA binding motif of MUTYH. Both R295C and R520Q MUTYH were found to have low fractions of active enzyme, compromised affinity for damaged DNA, and reduced rates for adenine excision. In contrast, both Q324H and P502L MUTYH function relatively similarly to WT MUTYH in both binding and glycosylase assays. However, P502L and R520Q exhibited reduced affinity for PCNA (proliferation cell nuclear antigen), consistent with their location in the PCNA-binding motif of MUTYH. Whereas, only Q324H, and not R295C, was found to have reduced affinity for Hus1 of the Rad9-Hus1-Rad1 complex, despite both being localized to the same region implicated for interaction with Hus1. These results underscore the diversity of functional consequences due to MUTYH variants that may impact the progression of MAP.

  3. [Utilization of Uracil-DNA glycosylase for combining reverse transcription and anti-contamination with polymerase chain reaction in hepatitis C virus].

    PubMed

    DU, Shao Cai; Zhang, Rui; Li, Jun Qiang; Wei, Lai

    2007-08-18

    To develop a hepatitis C virus(HCV) reverse transcription-polymerase chain reaction (RT-PCR) assay using Uracil-DNA glycosylase (UDG) for amplicon contamination control and evaluate the temperature and UDG concentrations for anti-contamination. In this new HCV RT-PCR assay, reverse transcription, UDG anti-contamination and the first PCR were carried out at the same time. The layer candles were used to prevent the contamination in the second PCR. dU-DNA was used as quality control for UDG anti-contamination and templates to determine the sensitivity of the new HCV RT-PCR assay. HCV cDNA was detected by DNA enzyme immunoassay (DNA-EIA). Complete degradation of amplicon DNA was observed on the conditions of 0.2au UDG per reaction volume respectively at 37 degrees C and 42 degrees C for 40 min. The anti-contamination condition also could eliminate all detectible dU-DNA, including the highest concentration of amplicon DNA.The 1:10(4) dilution of the HCV RNA sample containing 2.110x 10(5)copies /mL copies of RNA could be detected. Our results indicate that this new RT-PCR assay can control the contamination stringently and is sensitive as well.

  4. Profiling base excision repair glycosylases with synthesized transition state analogs.

    PubMed

    Chu, Aurea M; Fettinger, James C; David, Sheila S

    2011-09-01

    Two base excision repair glycosylase (BER) transition state (TS) mimics, (3R,4R)-1-benzyl (hydroxymethyl) pyrrolidin-3-ol (1NBn) and (3R,4R)-(hydroxymethyl) pyrrolidin-3-ol (1N), were synthesized using an improved method. Several BER glycosylases that repair oxidized DNA bases, bacterial formamidopyrimdine glycosylase (Fpg), human OG glycosylase (hOGG1) and human Nei-like glycosylase 1 (hNEIL1) exhibit exceptionally high affinity (K(d)∼pM) with DNA duplexes containing the 1NBn and 1N nucleotide. Notably, comparison of the K(d) values of both TS mimics relative to an abasic analog (THF) in duplex contexts paired opposite C or A suggest that these DNA repair enzymes use distinctly different mechanisms for damaged base recognition and catalysis despite having overlapping substrate specificities.

  5. Aberrant repair initiated by mismatch-specific thymine-DNA glycosylases provides a mechanism for the mutational bias observed in CpG islands

    PubMed Central

    Talhaoui, Ibtissam; Couve, Sophie; Gros, Laurent; Ishchenko, Alexander A.; Matkarimov, Bakhyt; Saparbaev, Murat K.

    2014-01-01

    The human thymine-DNA glycosylase (TDG) initiates the base excision repair (BER) pathway to remove spontaneous and induced DNA base damage. It was first biochemically characterized for its ability to remove T mispaired with G in CpG context. TDG is involved in the epigenetic regulation of gene expressions by protecting CpG-rich promoters from de novo DNA methylation. Here we demonstrate that TDG initiates aberrant repair by excising T when it is paired with a damaged adenine residue in DNA duplex. TDG targets the non-damaged DNA strand and efficiently excises T opposite of hypoxanthine (Hx), 1,N6-ethenoadenine, 7,8-dihydro-8-oxoadenine and abasic site in TpG/CpX context, where X is a modified residue. In vitro reconstitution of BER with duplex DNA containing Hx•T pair and TDG results in incorporation of cytosine across Hx. Furthermore, analysis of the mutation spectra inferred from single nucleotide polymorphisms in human population revealed a highly biased mutation pattern within CpG islands (CGIs), with enhanced mutation rate at CpA and TpG sites. These findings demonstrate that under experimental conditions used TDG catalyzes sequence context-dependent aberrant removal of thymine, which results in TpG, CpA→CpG mutations, thus providing a plausible mechanism for the putative evolutionary origin of the CGIs in mammalian genomes. PMID:24692658

  6. The pH optimum of native uracil-DNA glycosylase of Archaeoglobus fulgidus compared to recombinant enzyme indicates adaption to cytosolic pH.

    PubMed

    Knævelsrud, Ingeborg; Kazazic, Sabina; Birkeland, Nils-Kåre; Bjelland, Svein

    2014-01-01

    Uracil-DNA glycosylase of Archaeoglobus fulgidus (Afung) in cell extracts exhibited maximal activity around pH 6.2 as compared to pH 4.8 for the purified recombinant enzyme expressed in Escherichia coli. Native Afung thus seems to be adapted to the intracellular pH of A. fulgidus, determined to be 7.0±0.1. Both recombinant and native Afung exhibited a broad temperature optimum for activity around 80°C, reflecting the A. fulgidus optimal growth temperature of 83°C. Adaption to the neutral conditions in the A. fulgidus cytoplasm might be due to covalent modifications or accessory factors, or due to a different folding when expressed in the native host.

  7. Structural and biophysical analysis of interactions between cod and human uracil-DNA N-glycosylase (UNG) and UNG inhibitor (Ugi)

    SciTech Connect

    Assefa, Netsanet Gizaw; Niiranen, Laila; Johnson, Kenneth A.; Leiros, Hanna-Kirsti Schrøder; Smalås, Arne Oskar; Willassen, Nils Peder; Moe, Elin

    2014-08-01

    A structural and biophysical study of the interactions between cod and human uracil-DNA N-glycosylase (UNG) and their inhibitor Ugi is presented. The stronger interaction between cod UNG and Ugi can be explained by a greater positive electrostatic surface potential. Uracil-DNA N-glycosylase from Atlantic cod (cUNG) shows cold-adapted features such as high catalytic efficiency, a low temperature optimum for activity and reduced thermal stability compared with its mesophilic homologue human UNG (hUNG). In order to understand the role of the enzyme–substrate interaction related to the cold-adapted properties, the structure of cUNG in complex with a bacteriophage encoded natural UNG inhibitor (Ugi) has been determined. The interaction has also been analyzed by isothermal titration calorimetry (ITC). The crystal structure of cUNG–Ugi was determined to a resolution of 1.9 Å with eight complexes in the asymmetric unit related through noncrystallographic symmetry. A comparison of the cUNG–Ugi complex with previously determined structures of UNG–Ugi shows that they are very similar, and confirmed the nucleotide-mimicking properties of Ugi. Biophysically, the interaction between cUNG and Ugi is very strong and shows a binding constant (K{sub b}) which is one order of magnitude larger than that for hUNG–Ugi. The binding of both cUNG and hUNG to Ugi was shown to be favoured by both enthalpic and entropic forces; however, the binding of cUNG to Ugi is mainly dominated by enthalpy, while the entropic term is dominant for hUNG. The observed differences in the binding properties may be explained by an overall greater positive electrostatic surface potential in the protein–Ugi interface of cUNG and the slightly more hydrophobic surface of hUNG.

  8. Entrapment and Structure of an Extrahelical Guanine Attempting to Enter the Active Site of a Bacterial DNA Glycosylase, MutM

    SciTech Connect

    Qi, Yan; Spong, Marie C.; Nam, Kwangho; Karplus, Martin; Verdine, Gregory L.

    2010-09-21

    MutM, a bacterial DNA glycosylase, protects genome integrity by catalyzing glycosidic bond cleavage of 8-oxoguanine (oxoG) lesions, thereby initiating base excision DNA repair. The process of searching for and locating oxoG lesions is especially challenging, because of the close structural resemblance of oxoG to its million-fold more abundant progenitor, G. Extrusion of the target nucleobase from the DNA double helix to an extrahelical position is an essential step in lesion recognition and catalysis by MutM. Although the interactions between the extruded oxoG and the active site of MutM have been well characterized, little is known in structural detail regarding the interrogation of extruded normal DNA bases by MutM. Here we report the capture and structural elucidation of a complex in which MutM is attempting to present an undamaged G to its active site. The structure of this MutM-extrahelical G complex provides insights into the mechanism MutM employs to discriminate against extrahelical normal DNA bases and into the base extrusion process in general.

  9. The 8-oxoguanine DNA glycosylase 1 (ogg1) decreases the vulnerability of the developing brain to DNA damage.

    PubMed

    Gu, Aihua; Ji, Guixiang; Yan, Lifeng; Zhou, Yong

    2013-12-01

    The developing brain is particularly vulnerable to oxidative DNA damage, which may be the cause of most major congenital mental anomalies. The repair enzyme ogg1 initiates the highly conserved base-excision repair pathway. However, its function in the embryonic brain is largely unknown. This study is the first to validate the function of ogg1 during brain development using zebrafish embryos. Ogg1 was found to be highly expressed in the brain throughout early embryonic development, with particularly enrichment observed in the midbrain. The lack of ogg1 causes severe brain defects including changes in brain volume and integrity, destruction of the midbrain-hindbrain boundary, and balance and motor impairment, while overexpression of ogg1 can partially rescue these defects. Multiple cellular and molecular events were involved in the manifestation of brain defects due primarily to the lack of ogg1. These included (1) increased apoptosis; (2) decreased proliferation; and (3) aberrant axon distribution and extension from the inner surface towards the outer layers. The results of a microarray analysis showed that the expression of genes involved in cell cycle checkpoint, apoptosis, and neurogenesis were significantly changed in response to ogg1 knockdown. Cmyb was the key downstream gene that responses to DNA damage caused by ogg1 deficiency. Notably, the recruitment of ogg1 mRNA can alleviate the effects on the brain due to neural DNA damage. In summary, we introduce here that ogg1 is fundamentally required for protecting the developing brain, which may be helpful in understanding the aetiology of congenital brain deficits. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Advanced loop-mediated isothermal amplification method for sensitive and specific detection of Tomato chlorosis virus using a uracil DNA glycosylase to control carry-over contamination.

    PubMed

    Kil, Eui-Joon; Kim, Sunhoo; Lee, Ye-Ji; Kang, Eun-Ha; Lee, Minji; Cho, Sang-Ho; Kim, Mi-Kyeong; Lee, Kyeong-Yeoll; Heo, Noh-Youl; Choi, Hong-Soo; Kwon, Suk-Tae; Lee, Sukchan

    2015-03-01

    In 2013, Tomato chlorosis virus (ToCV) was identified in symptomatic tomato plants in Korea. In the present study, a loop-mediated isothermal amplification (LAMP) method was developed using four specific primers designed against ORF6 in ToCV RNA2 to detect ToCV rapidly and with high sensitivity. The optimized reaction involved incubation of a reaction mixture containing 2U Bst DNA polymerase and 4mM MgSO4 for 1h at 60-62 °C. Although specific and rapid detection of ToCV by LAMP was confirmed, false-positive reactions caused by carry-over contamination sometimes occurred because of the high sensitivity of LAMP compared with other detection methods. To prevent false-positive reactions, dUTP was substituted for dTTP and uracil-DNA glycosylase (UDG) was added to the LAMP reaction. First, the LAMP reaction was conducted successfully with substitution of dUTP for dTTP. Before the next reaction, LAMP products with incorporated dUTP were cleaved selectively by UDG without any effect on thymine-containing DNA (template DNA). This modified LAMP method complemented with UDG treatment to prevent carry-over contamination offers a potentially powerful method for detecting plant viruses. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Characterizing Requirements for Small Ubiquitin-like Modifier (SUMO) Modification and Binding on Base Excision Repair Activity of Thymine-DNA Glycosylase in Vivo.

    PubMed

    McLaughlin, Dylan; Coey, Christopher T; Yang, Wei-Chih; Drohat, Alexander C; Matunis, Michael J

    2016-04-22

    Thymine-DNA glycosylase (TDG) plays critical roles in DNA base excision repair and DNA demethylation. It has been proposed, based on structural studies and in vitro biochemistry, that sumoylation is required for efficient TDG enzymatic turnover following base excision. However, whether sumoylation is required for TDG activity in vivo has not previously been tested. We have developed an in vivo assay for TDG activity that takes advantage of its recently discovered role in DNA demethylation and selective recognition and repair of 5-carboxylcytosine. Using this assay, we investigated the role of sumoylation in regulating TDG activity through the use of TDG mutants defective for sumoylation and Small Ubiquitin-like Modifier (SUMO) binding and by altering TDG sumoylation through SUMO and SUMO protease overexpression experiments. Our findings indicate that sumoylation and SUMO binding are not essential for TDG-mediated excision and repair of 5-carboxylcytosine bases. Moreover, in vitro assays revealed that apurinic/apyrimidinic nuclease 1 provides nearly maximum stimulation of TDG processing of G·caC substrates. Thus, under our assay conditions, apurinic/apyrimidinic nuclease 1-mediated stimulation or other mechanisms sufficiently alleviate TDG product inhibition and promote its enzymatic turnover in vivo.

  12. Oxidative DNA damage in the in utero initiation of postnatal neurodevelopmental deficits by normal fetal and ethanol-enhanced oxidative stress in oxoguanine glycosylase 1 knockout mice.

    PubMed

    Miller-Pinsler, Lutfiya; Pinto, Daniel J; Wells, Peter G

    2015-01-01

    Studies in mice with deficient antioxidative enzymes have shown that physiological levels of reactive oxygen species (ROS) can adversely affect the developing embryo and fetus. Herein, DNA repair-deficient progeny of oxoguanine glycosylase 1 (ogg1)-knockout mice lacking repair of the oxidative DNA lesion 8-oxo-2'-deoxyguanosine (8-oxodGuo) exhibited enhanced postnatal neurodevelopmental deficits, revealing the pathogenic potential of 8-oxodGuo initiated by physiological ROS production in fetal brain and providing the first evidence of a pathological phenotype for ogg1-knockout mice. Moreover, when exposed in utero to ethanol (EtOH), ogg1-knockout progeny exhibited higher levels of 8-oxodGuo in fetal brain and more severe postnatal neurodevelopmental deficits than wild-type littermates, both of which were blocked by pretreatment with the free radical trapping agent phenylbutylnitrone. These results suggest that ROS-initiated DNA oxidation, as distinct from altered signal transduction, contributes to neurodevelopmental deficits caused by in utero EtOH exposure, and fetal DNA repair is a determinant of risk.

  13. Interfacial structures of 1-methyladenine, 3-methyladenine, 7-methyladenine, and 9-methyladenine on gold nanoparticles by Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Nguyen, Dinh Bao; Joo, Sang-Woo; Choo, Jaebum

    2017-01-01

    Interfacial structures of 1-methyladenine (1 MA), 3-methyladenine (3 MA), 7-methyladenine (7 MA), and 9-methyladenine (9 MA) on gold nanoparticles (AuNPs) were investigated by means of surface-enhanced Raman scattering (SERS). Different positions of the methyl group in the purine ring of adenine were found to result in not only dissimilarity among Raman spectral features but also surface binding schemes. Density functional theory (DFT) calculations predicted that the amino-9H tautomeric form would be most stable among the conformers of 1 MA, 3 MA, 7 MA, and 9 MA including amino and imino tautomeric conformers. SERS spectral features were analyzed with appropriate vibrational assignments based on DFT calculations. After considering the enhancement factors, the Raman spectra of 1 MA, 3 MA, 7 MA, and 9 MA on AuNPs were dissimilar, suggesting the methyl group at the purine ring of methyladenine may be significantly affecting the binding on AuNPs. Our Raman study indicates the position of the methyl group in methyladenine may play a significant role in coordinating metal surfaces.

  14. Hyperosmotic stress memory in Arabidopsis is mediated by distinct epigenetically labile sites in the genome and is restricted in the male germline by DNA glycosylase activity.

    PubMed

    Wibowo, Anjar; Becker, Claude; Marconi, Gianpiero; Durr, Julius; Price, Jonathan; Hagmann, Jorg; Papareddy, Ranjith; Putra, Hadi; Kageyama, Jorge; Becker, Jorg; Weigel, Detlef; Gutierrez-Marcos, Jose

    2016-05-31

    Inducible epigenetic changes in eukaryotes are believed to enable rapid adaptation to environmental fluctuations. We have found distinct regions of the Arabidopsis genome that are susceptible to DNA (de)methylation in response to hyperosmotic stress. The stress-induced epigenetic changes are associated with conditionally heritable adaptive phenotypic stress responses. However, these stress responses are primarily transmitted to the next generation through the female lineage due to widespread DNA glycosylase activity in the male germline, and extensively reset in the absence of stress. Using the CNI1/ATL31 locus as an example, we demonstrate that epigenetically targeted sequences function as distantly-acting control elements of antisense long non-coding RNAs, which in turn regulate targeted gene expression in response to stress. Collectively, our findings reveal that plants use a highly dynamic maternal 'short-term stress memory' with which to respond to adverse external conditions. This transient memory relies on the DNA methylation machinery and associated transcriptional changes to extend the phenotypic plasticity accessible to the immediate offspring.

  15. Hyperosmotic stress memory in Arabidopsis is mediated by distinct epigenetically labile sites in the genome and is restricted in the male germline by DNA glycosylase activity

    PubMed Central

    Wibowo, Anjar; Becker, Claude; Marconi, Gianpiero; Durr, Julius; Price, Jonathan; Hagmann, Jorg; Papareddy, Ranjith; Putra, Hadi; Kageyama, Jorge; Becker, Jorg; Weigel, Detlef; Gutierrez-Marcos, Jose

    2016-01-01

    Inducible epigenetic changes in eukaryotes are believed to enable rapid adaptation to environmental fluctuations. We have found distinct regions of the Arabidopsis genome that are susceptible to DNA (de)methylation in response to hyperosmotic stress. The stress-induced epigenetic changes are associated with conditionally heritable adaptive phenotypic stress responses. However, these stress responses are primarily transmitted to the next generation through the female lineage due to widespread DNA glycosylase activity in the male germline, and extensively reset in the absence of stress. Using the CNI1/ATL31 locus as an example, we demonstrate that epigenetically targeted sequences function as distantly-acting control elements of antisense long non-coding RNAs, which in turn regulate targeted gene expression in response to stress. Collectively, our findings reveal that plants use a highly dynamic maternal ‘short-term stress memory’ with which to respond to adverse external conditions. This transient memory relies on the DNA methylation machinery and associated transcriptional changes to extend the phenotypic plasticity accessible to the immediate offspring. DOI: http://dx.doi.org/10.7554/eLife.13546.001 PMID:27242129

  16. Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

    PubMed Central

    Singh, K K; Samson, L

    1995-01-01

    Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7761422

  17. The formation of catalytically competent enzyme-substrate complex is not a bottleneck in lesion excision by human alkyladenine DNA glycosylase.

    PubMed

    Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S

    2017-04-01

    Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, Tm, and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (Tm(F/T) < Tm(εA/T) < Tm(Hx/T) < Tm(A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.

  18. Label-free and selective photoelectrochemical detection of chemical DNA methylation damage using DNA repair enzymes.

    PubMed

    Wu, Yiping; Zhang, Bintian; Guo, Liang-Hong

    2013-07-16

    Exogenous chemicals may produce DNA methylation that is potentially toxic to living systems. Methylated DNA bases are difficult to detect with biosensors because the methyl group is small and chemically inert. In this report, a label-free photoelectrochemical sensor was developed for the selective detection of chemically methylated bases in DNA films. The sensor employed two DNA repair enzymes, human alkyladenine DNA glycosylase and human apurinic/apyrimidinic endonuclease, to convert DNA methylation sites in DNA films on indium tin oxide electrodes into strand breaks. A DNA intercalator, Ru(bpy)2(dppz)(2+) (bpy=2,2'-bipyridine, dppz = dipyrido[3,2-a:2',3'-c]phenazine) was then used as the photoelectrochemical signal indicator to detect the DNA strand breaks. Its photocurrent signal was found to correlate inversely with the amount of 3-methyladenines (metAde) produced with a methylating agent, methylmethane sulfonate (MMS). The sensor detected the methylated bases produced with as low as 1 mM MMS, at which concentration the amount of metAde on the sensor surface was estimated to be 0.5 pg, or 1 metAde in 1.6 × 10(5) normal bases. Other DNA base modification products, such as 5-methylcytosine and DNA adducts with ethyl and styrene groups did not attenuate the photocurrent, demonstrating good selectivity of the sensor. This strategy can be utilized to develop sensors for the detection of other modified DNA bases with specific DNA repair enzymes.

  19. Uracil DNA glycosylase interacts with the p32 subunit of the replication protein A complex to modulate HIV-1 reverse transcription for optimal virus dissemination.

    PubMed

    Herate, Cecile; Vigne, Clarisse; Guenzel, Carolin A; Lambele, Marie; Rouyez, Marie-Christine; Benichou, Serge

    2016-04-12

    Through incorporation into virus particles, the HIV-1 Vpr protein participates in the early steps of the virus life cycle by influencing the reverse transcription process. We previously showed that this positive impact on reverse transcription was related to Vpr binding to the uracil DNA glycosylase 2 enzyme (UNG2), leading to enhancement of virus infectivity in established CD4-positive cell lines via a nonenzymatic mechanism. We report here that Vpr can form a trimolecular complex with UNG2 and the p32 subunit (RPA32) of the replication protein A (RPA) complex and we explore how these cellular proteins can influence virus replication and dissemination in the primary target cells of HIV-1, which express low levels of both proteins. Virus infectivity and replication in peripheral blood mononuclear cells and monocyte-derived macrophages (MDMs), as well as the efficiency of the viral DNA synthesis, were significantly reduced when viruses were produced from cells depleted of endogenous UNG2 or RPA32. Moreover, viruses produced in macrophages failed to replicate efficiently in UNG2- and RPA32-depleted T lymphocytes. Reciprocally, viruses produced in UNG2-depleted T cells did not replicate efficiently in MDMs confirming the positive role of UNG2 for virus dissemination. Our data show the positive effect of UNG2 and RPA32 on the reverse transcription process leading to optimal virus replication and dissemination between the primary target cells of HIV-1.

  20. [Over-expression of uracil DNA glycosylase 2 (UNG2) enhances the resistance to oxidative damage in HepG2 cells].

    PubMed

    Cao, Liyan; Cheng, Shan; Du, Juan; Guo, Yanhai; Huang, Xiaofeng

    2017-04-01

    Objective To investigate the uracil glycosidic enzyme activity of uracil DNA glycosylase 2 (UNG2) and study the role of UNG2 in the resistance of antioxidant stress of HepG2 cells. Methods The UNG2-expressing vector was built. Western blotting was used to detect the expression of UNG2. Immunofluorescence staining was performed to observe the cellular location of UNG2. Oligonucleotide was used as substrate for the determination of the UNG2 glycosidic enzyme activity. H2O2 toxicity assay was done to study the function of UNG2 in the antioxidant resistance of hepatocellular carcinoma HepG2 cells. Results UNG2 was successfully over-expressed in HEK293FT cells, and UNG2 was found to be mainly located in nucleus. Enzyme activity assay showed that UNG2 had significant oligonucleotide dU glycosidic enzyme activity. H2O2 toxicity assay showed that over-expressed UNG2 could remarkably increase the survival of HepG2 cells after exposed to H2O2. Conclusion UNG2 possesses specific DNA glycosidic enzyme activity, and it can protect HepG2 cells against oxidative stress damage.

  1. Chlorella virus pyrimidine dimer glycosylase excises ultraviolet radiation- and hydroxyl radical-induced products 4,6-diamino-5-formamidopyrimidine and 2,6-diamino-4-hydroxy-5-formamidopyrimidine from DNA.

    PubMed

    Jaruga, Pawel; Jabil, Ritche; McCullough, Amanda K; Rodriguez, Henry; Dizdaroglu, Miral; Lloyd, R Stephen

    2002-02-01

    A DNA glycosylase specific for UV radiation-induced pyrimidine dimers has been identified from the Chlorella virus Paramecium Bursaria Chlorella virus-1. This enzyme (Chlorella virus pyrimidine dimer glycosylase [cv-pdg]) exhibits a 41% amino acid identity with endonuclease V from bacteriophage T4 (T4 pyrimidine dimer glycosylase [T4-pdg]), which is also specific for pyrimidine dimers. However, cv-pdg possesses a higher catalytic efficiency and broader substrate specificity than T4-pdg. The latter excises 4,6-diamino-5-formamidopyrimidine (FapyAde), a UV radiation- and hydroxyl radical-induced monomeric product of adenine in DNA. Using gas chromatography-isotope-dilution mass spectrometry and y-irradiated DNA, we show in this work that cv-pdg also displays a catalytic activity for excision of FapyAde and, in addition, it excises 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). Kinetic data show that FapyAde is a better substrate for cv-pdg than FapyGua. On the other hand, cv-pdg possesses a greater efficiency for the extension of FapyAde than T4-pdg. These two enzymes exhibit different substrate specificities despite substantial structural similarities.

  2. Role of autophagy in the progression of osteoarthritis: The autophagy inhibitor, 3-methyladenine, aggravates the severity of experimental osteoarthritis.

    PubMed

    Cheng, Ni-Tao; Meng, Hai; Ma, Li-Feng; Zhang, Liang; Yu, Hao-Miao; Wang, Zhen-Zhong; Guo, Ai

    2017-03-23

    Accumulating evidence suggests that autophagy is closely related to the pathogenesis of osteoarthritis (OA). The aim of this study was to determine the changes in autophagy during the progression of OA and to elucidate the specific role of autophagy in OA. For this purpose, a cellular model of OA was generated by stimulating SW1353 cells with interleukin (IL)-1β and a rabbit model of OA was also established by an intra-articular injection of collagenase, followed by treatment with the autophagy specific inhibitor, 3-methyladenine (3-MA). Cell viability was analyzed by MTS assay, and the mRNA expression levels of matrix metalloproteinases (MMP)-13 and tissue inhibitor of metalloproteinase (TIMP)-1 were determined by RT-qPCR. Cartilage degeneration was examined under a light microscope, and autophagosome and chondrocyte degeneration was observed by transmission electron microscopy. The protein expression of Beclin-1 and light chain 3 (LC3)B was evaluated by western blot analysis and immunofluorescence staining. We found that the autophagy was enhanced during the early stages and was weakened during the late stages of experimental OA. The inhibition of autophagy by 3-MA significantly aggravated the degeneration of chondrocytes and cartilage in experimental OA. Our results thus determine the changes in autophagy during different stages of OA, as well as the role of impaired autophagy in the development of OA. Our data suggest that the regulation of autophagy may be a potential therapeutic strategy with which to attenuate OA.

  3. The Cys326 allele of the 8-oxoguanine DNA N-glycosylase 1 gene as a risk factor in smoking- and drinking-associated larynx cancer.

    PubMed

    Pawlowska, Elzbieta; Janik-Papis, Katarzyna; Rydzanicz, Malgorzata; Zuk, Karolina; Kaczmarczyk, Dariusz; Olszewski, Jurek; Szyfter, Krzysztof; Blasiak, Janusz; Morawiec-Sztandera, Alina

    2009-12-01

    Tobacco smoke-related products and ethanol would induce oxidative modifications to the DNA bases, thereby contributing to larynx cancer. Human 8-oxoguanine DNA N-glycosylase 1 (hOGG1) deals with oxidative DNA damage, and the base changes in the hOGG1 gene may alter the susceptibility of the human cells to tobacco smoke-related compounds and/or ethanol. In the present work, we investigated the association between smoking, drinking or the Ser326Cys polymorphism of the hOGG1 gene and the risk of larynx cancer in a Polish population. It has been reported that the Ser326 allele exhibits higher activity than the Cys326 variant. In this study, 253 age-matched controls and 253 patients with larynx cancer were enrolled. The polymorphism was determined with DNA from blood lymphocytes by polymerase chain reaction. The frequencies (%) of the genotypes were Ser/Ser 65.6, Ser/Cys 30.4, and Cys/Cys 4.0 in the controls and those in patients were 55.7, 36.0 and 8.3, respectively. Stratification of individuals according to their smoking and drinking habits indicated that these habits might be significant risk factors in larynx cancer. The Ser/Cys and Cys/Cys genotypes are significantly associated with the increased risk of larynx cancer. These genotypes increased the risk ratio of larynx cancer among heavy smokers, but did not change the risk in former smokers and moderate smokers. These genotypes also increased the risk of larynx cancer in moderate and heavy drinkers. Therefore, the Cys326 allele of the hOGG1 gene may increase the risk of larynx cancer associated with smoking or alcohol consumption.

  4. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    PubMed

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  5. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    PubMed Central

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-01-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

  6. Insights into the Glycosylase Search for Damage from Single-Molecule Fluorescence Microscopy

    PubMed Central

    Lee, Andrea J.; Warshaw, David M.

    2014-01-01

    The first step of base excision repair utilizes glycosylase enzymes to find damage within a genome. A persistent question in the field of DNA repair is how glycosylases interact with DNA to specifically find and excise target damaged bases with high efficiency and specificity. Ensemble studies have indicated that glycosylase enzymes rely upon both sliding and distributive modes of search, but ensemble methods are limited in their ability to directly observe these modes. Here we review insights into glycosylase scanning behavior gathered through single-molecule fluorescence studies of enzyme interactions with DNA and provide a context for these results in relation to ensemble experiments. PMID:24560296

  7. Role of exonuclease III and endonuclease IV in repair of pyrimidine dimers initiated by bacteriophage T4 pyrimidine dimer-DNA glycosylase

    SciTech Connect

    Saporito, S.M.; Gedenk, M.; Cunningham, R.P.

    1989-05-01

    The role of exonuclease III and endonuclease IV in the repair of pyrimidine dimers in bacteriophage T4-infected Escherichia coli was examined. UV-irradiated T4 showed reduced survival when plated on an xth nfo double mutant but showed wild-type survival on either single mutant. T4 denV phage were equally sensitive when plated on wild-type E. coli or an xth nfo double mutant, suggesting that these endonucleases function in the same repair pathway as T4 pyrimidine dimer-DNA glycosylase. A uvrA mutant of E. coli in which the repair of pyrimidine dimers was dependent on the T4 denV gene carried on a plasmid was constructed. Neither an xth nor an nfo derivative of this strain was more sensitive than the parental strain to UV irradiation. We were unable to construct a uvrA xth nfo triple mutant. In addition, T4, which turns off the host UvrABC excision nuclease, showed reduced plating efficiency on an xth nfo double mutant.

  8. Abnormal Expressions of DNA Glycosylase Genes NEIL1, NEIL2, and NEIL3 Are Associated with Somatic Mutation Loads in Human Cancer

    PubMed Central

    Shinmura, Kazuya; Kato, Hisami; Kawanishi, Yuichi; Igarashi, Hisaki; Goto, Masanori; Tao, Hong; Inoue, Yusuke; Nakamura, Satoki; Misawa, Kiyoshi; Mineta, Hiroyuki; Sugimura, Haruhiko

    2016-01-01

    The effects of abnormalities in the DNA glycosylases NEIL1, NEIL2, and NEIL3 on human cancer have not been fully elucidated. In this paper, we found that the median somatic total mutation loads and the median somatic single nucleotide mutation loads exhibited significant inverse correlations with the median NEIL1 and NEIL2 expression levels and a significant positive correlation with the median NEIL3 expression level using data for 13 cancer types from the Cancer Genome Atlas (TCGA) database. A subset of the cancer types exhibited reduced NEIL1 and NEIL2 expressions and elevated NEIL3 expression, and such abnormal expressions of NEIL1, NEIL2, and NEIL3 were also significantly associated with the mutation loads in cancer. As a mechanism underlying the reduced expression of NEIL1 in cancer, the epigenetic silencing of NEIL1 through promoter hypermethylation was found. Finally, we investigated the reason why an elevated NEIL3 expression level was associated with an increased number of somatic mutations in cancer and found that NEIL3 expression was positively correlated with the expression of APOBEC3B, a potent inducer of mutations, in diverse cancers. These results suggested that the abnormal expressions of NEIL1, NEIL2, and NEIL3 are involved in cancer through their association with the somatic mutation load. PMID:27042257

  9. Elevated levels of plasma homocysteine, deficiencies in dietary folic acid and uracil-DNA glycosylase impair learning in a mouse model of vascular cognitive impairment.

    PubMed

    Jadavji, Nafisa M; Farr, Tracy D; Lips, Janet; Khalil, Ahmed A; Boehm-Sturm, Philipp; Foddis, Marco; Harms, Christoph; Füchtemeier, Martina; Dirnagl, Ulrich

    2015-04-15

    Dietary deficiencies in folic acid result in elevated levels of plasma homocysteine, which has been associated with the development of dementia and other neurodegenerative disorders. Previously, we have shown that elevated levels of plasma homocysteine in mice deficient for a DNA repair enzyme, uracil-DNA glycosylase (UNG), result in neurodegeneration. The goal of this study was to evaluate how deficiencies in folic acid and UNG along with elevated levels of homocysteine affect vascular cognitive impairment, via chronic hypoperfursion in an animal model. Ung(+/+) and Ung(-/-) mice were placed on either control (CD) or folic acid deficient (FADD) diets. Six weeks later, the mice either underwent implantation of microcoils around both common carotid arteries. Post-operatively, behavioral tests began at 3-weeks, angiography was measured after 5-weeks using MRI to assess vasculature and at completion of study plasma and brain tissue was collected for analysis. Learning impairments in the Morris water maze (MWM) were observed only in hypoperfused Ung(-/-) FADD mice and these mice had significantly higher plasma homocysteine concentrations. Interestingly, Ung(+/+) FADD produced significant remodeling of the basilar artery and arterial vasculature. Increased expression of GFAP was observed in the dentate gyrus of Ung(-/-) hypoperfused and FADD sham mice. Chronic hypoperfusion resulted in increased cortical MMP-9 protein levels of FADD hypoperfused mice regardless of genotypes. These results suggest that elevated levels of homocysteine only, as a result of dietary folic acid deficiency, don't lead to memory impairments and neurobiochemical changes. Rather a combination of either chronic hypoperfusion or UNG deficiency is required.

  10. Polymorphisms of human 8-oxoguanine DNA glycosylase 1 and 8-hydroxydeoxyguanosine increase susceptibility to arsenic methylation capacity-related urothelial carcinoma.

    PubMed

    Huang, Chao-Yuan; Pu, Yeong-Shiau; Shiue, Horng-Sheng; Chen, Wei-Jen; Lin, Ying-Chin; Hsueh, Yu-Mei

    2016-08-01

    Arsenic causes oxidative stress in cultured animal and human cells, and it is a well-documented human carcinogen. We conducted a hospital-based case-control study including 167 cases of urothelial carcinoma (UC) and 334 age- and gender-matched healthy controls to evaluate the relationships between urinary arsenic profiles, urinary 8-hydroxydeoxyguanosine (8-OHdG) levels, and human 8-oxoguanine DNA glycosylase (hOGG1) genotypes and UC. The urinary arsenic species were analyzed by high-performance liquid chromatography and hydride generator-atomic absorption spectrometry. Genotyping for hOGG1 (Ser326Cys) and hOGG1 (-15C>G) was performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Urinary 8-OHdG was measured with high-sensitivity enzyme-linked immunosorbent assay kits. The results indicated that the hOGG1 326 Cys/Cys genotype and the hOGG1 -15C>G G/G genotype were associated with an increased risk of UC (OR [95 % CI] 1.57 [1.04-2.35] and 1.57 [1.04-2.35], respectively). Participants with high urinary total arsenic, regardless of the haplotype of hOGG1 Ser326Cys and the -15C>G polymorphism, had significantly higher urinary 8-OHdG compared to participants with low urinary total arsenic. This is the first study to investigate the joint effects of high urinary total arsenic or inefficient arsenic methylation capacity indices, and the high-risk G-G haplotype of hOGG1 on the risk of UC. The findings are especially meaningful for participants with risk factors such as high urinary total arsenic, inefficient arsenic methylation indices, high urinary 8-OHdG, and the high-risk G-G haplotype of hOGG1 which are all associated with an increased UC risk.

  11. 8-Oxoguanine DNA glycosylase 1 (ogg1) maintains the function of cardiac progenitor cells during heart formation in zebrafish

    SciTech Connect

    Yan, Lifeng; Zhou, Yong; Yu, Shanhe; Ji, Guixiang; Liu, Wei; Gu, Aihua

    2013-11-15

    Genomic damage may devastate the potential of progenitor cells and consequently impair early organogenesis. We found that ogg1, a key enzyme initiating the base-excision repair, was enriched in the embryonic heart in zebrafish. So far, little is known about DNA repair in cardiogenesis. Here, we addressed the critical role of ogg1 in cardiogenesis for the first time. ogg1 mainly expressed in the anterior lateral plate mesoderm (ALPM), the primary heart tube, and subsequently the embryonic myocardium by in situ hybridisation. Loss of ogg1 resulted in severe cardiac morphogenesis and functional abnormalities, including the short heart length, arrhythmia, decreased cardiomyocytes and nkx2.5{sup +} cardiac progenitor cells. Moreover, the increased apoptosis and repressed proliferation of progenitor cells caused by ogg1 deficiency might contribute to the heart phenotype. The microarray analysis showed that the expression of genes involved in embryonic heart tube morphogenesis and heart structure were significantly changed due to the lack of ogg1. Among those, foxh1 is an important partner of ogg1 in the cardiac development in response to DNA damage. Our work demonstrates the requirement of ogg1 in cardiac progenitors and heart development in zebrafish. These findings may be helpful for understanding the aetiology of congenital cardiac deficits. - Highlights: • A key DNA repair enzyme ogg1 is expressed in the embryonic heart in zebrafish. • We found that ogg1 is essential for normal cardiac morphogenesis in zebrafish. • The production of embryonic cardiomyocytes requires appropriate ogg1 expression. • Ogg1 critically regulated proliferation of cardiac progenitor cells in zebrafish. • foxh1 is a partner of ogg1 in the cardiac development in response to DNA damage.

  12. Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

    PubMed

    Rusin, M; Samojedny, A; Harris, C C; Chorazy, M

    1999-09-19

    Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance. Copyright 1999 Wiley-Liss, Inc.

  13. The C-terminal Domain (CTD) of Human DNA Glycosylase NEIL1 Is Required for Forming BERosome Repair Complex with DNA Replication Proteins at the Replicating Genome: DOMINANT NEGATIVE FUNCTION OF THE CTD.

    PubMed

    Hegde, Pavana M; Dutta, Arijit; Sengupta, Shiladitya; Mitra, Joy; Adhikari, Sanjay; Tomkinson, Alan E; Li, Guo-Min; Boldogh, Istvan; Hazra, Tapas K; Mitra, Sankar; Hegde, Muralidhar L

    2015-08-21

    The human DNA glycosylase NEIL1 was recently demonstrated to initiate prereplicative base excision repair (BER) of oxidized bases in the replicating genome, thus preventing mutagenic replication. A significant fraction of NEIL1 in cells is present in large cellular complexes containing DNA replication and other repair proteins, as shown by gel filtration. However, how the interaction of NEIL1 affects its recruitment to the replication site for prereplicative repair was not investigated. Here, we show that NEIL1 binarily interacts with the proliferating cell nuclear antigen clamp loader replication factor C, DNA polymerase δ, and DNA ligase I in the absence of DNA via its non-conserved C-terminal domain (CTD); replication factor C interaction results in ∼8-fold stimulation of NEIL1 activity. Disruption of NEIL1 interactions within the BERosome complex, as observed for a NEIL1 deletion mutant (N311) lacking the CTD, not only inhibits complete BER in vitro but also prevents its chromatin association and reduced recruitment at replication foci in S phase cells. This suggests that the interaction of NEIL1 with replication and other BER proteins is required for efficient repair of the replicating genome. Consistently, the CTD polypeptide acts as a dominant negative inhibitor during in vitro repair, and its ectopic expression sensitizes human cells to reactive oxygen species. We conclude that multiple interactions among BER proteins lead to large complexes, which are critical for efficient BER in mammalian cells, and the CTD interaction could be targeted for enhancing drug/radiation sensitivity of tumor cells.

  14. 3-Methyladenine suppresses cell migration and invasion of HT1080 fibrosarcoma cells through inhibiting phosphoinositide 3-kinases independently of autophagy inhibition.

    PubMed

    Ito, Shingo; Koshikawa, Nobuko; Mochizuki, Shigenobu; Takenaga, Keizo

    2007-08-01

    3-Methyladenine (3-MA) inhibits class III phosphoinositide 3-kinase (PI3K) and is widely used as an inhibitor of autophagy. 3-MA has also been shown to stimulate cell death of tumor cells under nutrient-starved conditions by inhibiting autophagy. To explore the possibility of this type of autophagy inhibitors as anticancer drugs, we examined the effects of 3-MA on the phenotypes of highly metastatic human fibrosarcoma HT1080 cells. We report here that although 3-MA did not markedly affect cell survival of the cells under either normal or amino acid-starved conditions, it strongly inhibited the invasiveness of the cells. 3-MA rapidly suppressed actin rich membrane ruffle and/or lamellipodia formation under normal conditions, leading to inhibition of cell migration and invasion of the cells without substantial inhibitions of small GTPase Rac activity and the production of matrix metalloproteinases MMP-2 and MMP-9. 3-MA abolished class I and class II PI3Ks in in vitro lipid kinase assays, and suppressed cell motility of the cells more strongly than the other PI3K inhibitors wortmannin and LY294002. Downregulation of Beclin 1, a protein required for autophagic body formation, by transfection of Beclin 1 siRNA did not inhibit membrane ruffle formation and cell migration. These results suggest that 3-MA suppresses the invasion of HT1080 cells, independently of autophagy inhibition, through inhibition of type I and II PI3Ks and possibly other molecules.

  15. Systemic application of 3-methyladenine markedly inhibited atherosclerotic lesion in ApoE−/− mice by modulating autophagy, foam cell formation and immune-negative molecules

    PubMed Central

    Dai, Shen; Wang, Bo; Li, Wen; Wang, Liyang; Song, Xingguo; Guo, Chun; Li, Yulan; Liu, Fengming; Zhu, Faliang; Wang, Qun; Wang, Xiaoyan; Shi, Yongyu; Wang, Jianing; Zhao, Wei; Zhang, Lining

    2016-01-01

    A growing body of evidence demonstrates that autophagy, an evolutionarily conserved intracellular degradation process, is involved in the pathogenesis of atherosclerosis and has become a potential therapeutic target. Here we tested the effect of two inhibitors of phosphatidylinositol 3-kinase, 3-methyladenine (3-MA) and 2-(4-morpholinyl)-8-phenyl-chromone (LY294002), commonly used as inhibitors of autophagy, in atherosclerosis in apolipoprotein E−/− mice. Systemic application of 3-MA but not LY294002 markedly reduced the size of atherosclerotic plaque and increased the stability of lesions in high-fat diet-fed mice as compared with controls. Furthermore, 3-MA had multiple atheroprotective effects, including modulating macrophage autophagy and foam cell formation and altering the immune microenvironment. Long-term treatment with 3-MA promoted oxidized low-density lipoprotein (oxLDL)-induced macrophage autophagy and suppressed foam cell formation and cell viability in vitro. Furthermore, systemic application of 3-MA promoted lipid droplet breakdown and decreased apoptosis, most likely associated with autophagy. 3-MA treatment strikingly enhanced the expression of immune-negative molecules such as interleukin 10 (IL-10), transforming growth factor β and IL-35, as well as forkhead box P3 (Foxp3), the specific transcriptional factor for regulatory T cells, but did not affect the level of proinflammatory cytokines in the arterial wall. We provide strong evidence for the potential therapeutic benefit of 3-MA in inhibiting atherosclerosis development and improving plaque stability. PMID:27906187

  16. Down-regulation of the DNA-repair endonuclease 8-oxo-guanine DNA glycosylase 1 (hOGG1) by sodium dichromate in cultured human A549 lung carcinoma cells.

    PubMed

    Hodges, N J; Chipman, J K

    2002-01-01

    Hexavalent chromium is a genotoxic human pulmonary carcinogen that elevates DNA oxidation, apparently through the generation of reactive DNA-damaging intermediates including Cr(V), Cr(IV) and reactive oxygen species. We tested the hypothesis that elevation of DNA oxidation may also be through inhibition of the expression of the repair glycosylase for 8-oxo deoxyguanine (hOGG1) in cultured A549 human lung epithelial cells. Treatment with sodium dichromate (0-100 microM, 16 h) resulted in a concentration-dependent decrease in the levels of OGG1 mRNA as measured by both RT-PCR and RNase protection assay. Sodium dichromate at 25 microM and above gave a marked reduction of OGG1 mRNA expression which was not seen at 1 microM and below. No effect on the expression of the apurinic endonuclease hAPE or the house-keeping gene GAPDH was observed at any of the concentrations of sodium dichromate investigated. Treatment of cells with the pro-oxidant H(2)O(2) (0-200 microM) for 16 h had no detectable effect on the levels of OGG1 mRNA or protein expression suggesting that the effect of sodium dichromate is not mediated by H(2)O(2). Western blotting demonstrated that sodium dichromate (100 microM; 16 h and >25 microM; 28 h) markedly reduced levels of OGG1 protein in nuclear cell extracts. Additionally, treatment of cells with sodium dichromate (>25 microM, 28 h) resulted in a concentration-dependent decrease in the ability of nuclear extracts to nick a synthetic oligonucleotide containing 8-oxo deoxyguanine (8-oxo dG). We conclude that the elevation of 8-oxo dG levels observed in A549 cells treated with sodium dichromate may be, at least in part, due to a reduced capacity to repair endogenous and hexavalent chromium-induced 8-oxo dG.

  17. Compromised incision of oxidized pyrimidines in liver mitochondria of mice deficient in NTH1 and OGG1 glycosylases.

    PubMed

    Karahalil, Bensu; de Souza-Pinto, Nadja C; Parsons, Jason L; Elder, Rhoderick H; Bohr, Vilhelm A

    2003-09-05

    Mitochondrial DNA is constantly exposed to high levels of endogenously produced reactive oxygen species, resulting in elevated levels of oxidative damaged DNA bases. A large spectrum of DNA base alterations can be detected after oxidative stress, and many of these are highly mutagenic. Thus, an efficient repair of these is necessary for survival. Some of the DNA repair pathways involved have been characterized, but others are not yet determined. A DNA repair activity for thymine glycol and other oxidized pyrimidines has been described in mammalian mitochondria, but the nature of the glycosylases involved in this pathway remains unclear. The generation of mouse strains lacking murine thymine glycol-DNA glycosylase (mNTH1) and/or murine 8-oxoguanine-DNA glycosylase (mOGG1), the two major DNA N-glycosylase/apurinic/apyrimidinic (AP) lyases involved in the repair of oxidative base damage in the nucleus, has provided very useful biological model systems for the study of the function of these and other glycosylases in mitochondrial DNA repair. In this study, mouse liver mitochondrial extracts were generated from mNTH1-, mOGG1-, and [mNTH1, mOGG1]-deficient mice to ascertain the role of each of these glycosylases in the repair of oxidized pyrimidine base damage. We also characterized for the first time the incision of various modified bases in mitochondrial extracts from a double-knock-out [mNTH1, mOGG1]-deficient mouse. We show that mNTH1 is responsible for the repair of thymine glycols in mitochondrial DNA, whereas other glycosylase/AP lyases also participate in removing other oxidized pyrimidines, such as 5-hydroxycytosine and 5-hydroxyuracil. We did not detect a backup glycosylase or glycosylase/AP lyase activity for thymine glycol in the mitochondrial mouse extracts.

  18. Ada response - a strategy for repair of alkylated DNA in bacteria.

    PubMed

    Mielecki, Damian; Grzesiuk, Elżbieta

    2014-06-01

    Alkylating agents are widespread in the environment and also occur endogenously. They can be cytotoxic or mutagenic to the cells introducing alkylated bases to DNA or RNA. All organisms have evolved multiple DNA repair mechanisms to counteract the effects of DNA alkylation: the most cytotoxic lesion, N(3)-methyladenine (3meA), is excised by AlkA glycosylase initiating base excision repair (BER); toxic N(1)-methyladenine (1meA) and N(3)-methylcytosine (3meC), induced in DNA and RNA, are removed by AlkB dioxygenase; and mutagenic and cytotoxic O(6)-methylguanine (O(6) meG) is repaired by Ada methyltransferase. In Escherichia coli, Ada response involves the expression of four genes, ada, alkA, alkB, and aidB, encoding respective proteins Ada, AlkA, AlkB, and AidB. The Ada response is conserved among many bacterial species; however, it can be organized differently, with diverse substrate specificity of the particular proteins. Here, an overview of the organization of the Ada regulon and function of individual proteins is presented. We put special effort into the characterization of AlkB dioxygenases, their substrate specificity, and function in the repair of alkylation lesions in DNA/RNA.

  19. A common element involved in transcriptional regulation of two DNA alkylation repair genes (MAG and MGT1) of Saccharomyces cerevisiae.

    PubMed Central

    Xiao, W; Singh, K K; Chen, B; Samson, L

    1993-01-01

    The Saccharomyces cerevisiae MAG gene encodes a 3-methyladenine DNA glycosylase that protects cells from killing by alkylating agents. MAG mRNA levels are induced not only by alkylating agents but also by DNA-damaging agents that do not produce alkylated DNA. We constructed a MAG-lacZ gene fusion to help identify the cis-acting promoter elements involved in regulating MAG expression. Deletion analysis defined the presence of one upstream activating sequence and one upstream repressing sequence (URS) and suggested the presence of a second URS. One of the MAG URS elements matches a decamer consensus sequence present in the promoters of 11 other S. cerevisiae DNA repair and metabolism genes, including the MGT1 gene, which encodes an O6-methylguanine DNA repair methyltransferase. Two proteins of 26 and 39 kDa bind specifically to the MAG and MGT1 URS elements. We suggest that the URS-binding proteins may play an important role in the coordinate regulation of these S. cerevisiae DNA repair genes. Images PMID:8246943

  20. Protective association exhibited by the single nucleotide polymorphism (SNP) rs1052133 in the gene human 8-oxoguanine DNA glycosylase (hOGG1) with the risk of squamous cell carcinomas of the head & neck (SCCHN) among north Indians.

    PubMed

    Mitra, Amit Kumar; Singh, Sarvendra Vikram; Garg, Vivek Kumar; Sharma, Mandira; Chaturvedi, Rashmi; Rath, Srikanta Kumar

    2011-06-01

    Imbalances in compactly regulated DNA repair pathways in the form of single nucleotide polymorphisms (SNPs) within vital DNA repair genes may result in insufficient DNA repair and increase in DNA breaks thus rendering the human system vulnerable to the debilitatory effects of grave diseases like cancers. The present study involves investigation of association of the non-synonymous SNP rs1052133 (C8069G/Ser326Cys) located in the exonic region of the gene human 8-oxoguanine DNA glycosylase (hOGG1) with the risk of squamous cell carcinomas of the head and neck (SCCHN). Case-control based genetic association study was performed among 575 (250 SCCHN cases and 325 normal healthy controls) sub-population cluster-matched (Indo-Europeans linguistic subgroup + Caucasoid morphological subtype) samples from the north Indian States of Uttar Pradesh and Uttarakhand using polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing analysis. Our results demonstrated statistically significant protective association for the heterozygous CG [Odds Ratio (OR) 0.6587, 95% Confidence Interval (CI) 0.4615 to 0.9402, P=0.0238], homozygous mutant GG (OR 0.2570, 95% CI 0.1070 to 0.6175, P=0.0013) and combined mutant CG + GG (OR 0.6057, 95% CI 0.4272 to 0.8586, P=0.0059) genotypes. The results indicate that the polymorphism rs1052133 is strongly associated with SCCHN susceptibility and the mutant (G) allele might be a protective factor for SCCHN among north Indian subpopulations.

  1. Amplified expression of the tag+ and alkA+ genes in Escherichia coli: identification of gene products and effects on alkylation resistance.

    PubMed Central

    Kaasen, I; Evensen, G; Seeberg, E

    1986-01-01

    We have constructed plasmids which overproduce the tag and alkA gene products of Escherichia coli, i.e., 3-methyladenine DNA glycosylases I and II. The tag and alkA gene products were identified radiochemically in maxi- or minicells as polypeptides of 21 and 30 kilodaltons, respectively, which are consistent with the gel filtration molecular weights of the enzyme activities, thus confirming the identity of the cloned genes. High expression of the tag+-coded glycosylase almost completely suppressed the alkylation sensitivity of alkA mutants, indicating that high levels of 3-methyladenine DNA glycosylase I will eliminate the need for 3-methyladenine DNA glycosylase II in repair of alkylated DNA. Furthermore, overproduction of the alkA+-coded glycosylase greatly sensitizes wild-type cells to alkylation, suggesting that only a limited expression of this enzyme will allow efficient DNA repair. Images PMID:3536857

  2. Escherichia coli MutY protein has a guanine-DNA glycosylase that acts on 7,8-dihydro-8-oxoguanine:guanine mispair to prevent spontaneous G:C-->C:G transversions.

    PubMed

    Zhang, Q M; Ishikawa, N; Nakahara, T; Yonei, S

    1998-10-15

    Low rates of spontaneous G:C-->C:G transversions would be achieved not only by the correction of base mismatches during DNA replication but also by the prevention and removal of oxidative base damage in DNA. Escherichia coli must have several pathways to repair such mismatches and DNA modifications. In this study, we attempted to identify mutator loci leading to G:C-->C:G transversions in E.coli. The strain CC103 carrying a specific mutation in lacZ was mutagenized by random miniTn 10 insertion mutagenesis. In this strain, only the G:C-->C:G change can revert the glutamic acid at codon 461, which is essential for sufficient beta-galactosidase activity to allow growth on lactose. Mutator strains were detected as colonies with significantly increased rates of papillae formation on glucose minimal plates containing P-Gal and X-Gal. We screened approximately 40 000 colonies and selected several mutator strains. The strain GC39 showed the highest mutation rate to Lac+. The gene responsible for the mutator phenotypes, mut39 , was mapped at around 67 min on the E.coli chromosome. The sequencing of the miniTn 10 -flanking DNA region revealed that the mut39 was identical to the mutY gene of E.coli. The plasmid carrying the mutY + gene reduced spontaneous G:C-->T:A and G:C-->C:G mutations in both mutY and mut39 strains. Purified MutY protein bound to the oligonucleotides containing 7,8-dihydro-8-oxo-guanine (8-oxoG):G and 8-oxoG:A. Furthermore, we found that the MutY protein had a DNA glycosylase activity which removes unmodified guanine from the 8-oxoG:G mispair. These results demonstrate that the MutY protein prevents the generation of G:C-->C:G transversions by removing guanine from the 8-oxoG:G mispair in E.coli.

  3. Spectroscopic studies of zinc(II)- and cobalt(II)-associated Escherichia coli formamidopyrimidine-DNA glycosylase: extended X-ray absorption fine structure evidence for a metal-binding domain.

    PubMed

    Buchko, G W; Hess, N J; Bandaru, V; Wallace, S S; Kennedy, M A

    2000-10-10

    Formamidopyrimidine-DNA glycosylase (Fpg) is a 30.2 kDa protein that plays an important role in the base excision repair of oxidatively damaged DNA in Escherichia coli. Sequence analysis and genetic evidence suggest that zinc is associated with a C4-type motif, C(244)-X(2)-C(247)-X(16)-C(264)-X(2)-C(267), located at the C-terminus of the protein. The zinc-associated motif has been shown to be essential for damaged DNA recognition. Extended X-ray absorption fine structure (EXAFS) spectra collected on the zinc-associated protein (ZnFpg) in the lyophilized state and in 10% frozen aqueous glycerol solution show directly that the metal is coordinated to the sulfur atom of four cysteine residues. The average Zn-S bond length is 2.33 +/- 0.01 and 2.34 +/- 0.01 A, respectively, in the lyophilized state and in 10% frozen aqueous glycerol solution. Fpg was also expressed in minimal medium supplemented with cobalt nitrate to yield a blue-colored protein that was primarily cobalt-associated (CoFpg). The profiles of the circular dichroism spectra for CoFpg and ZnFpg are identical, suggesting that the substitution of Co(2+) for Zn(2+) does not alter the structure of Fpg. A similar conclusion is reached upon the analysis of two-dimensional (15)N/(1)H HSQC spectra of uniformly (15)N-labeled samples of ZnFpg and CoFpg; the spectra are similar and display features characteristic of a structured protein. Biochemical assays with a 54 nt DNA oligomer containing 7, 8-dihydro-8-oxoguanine at a specific location show that CoFpg and ZnFpg are equally active at cleaving the DNA at the site of the oxidized guanine. EXAFS spectra of CoFpg indicate that the cobalt is coordinated to the sulfur atom of four cysteine residues with an average Co-S bond length of 2.28 +/- 0.01 and 2.29 +/- 0.01 A, respectively, in the lyophilized state and in 10% frozen aqueous glycerol solution. The structural similarity between CoFpg and ZnFpg suggests that it is biologically relevant to use the paramagnetic

  4. Regulation of the angiotensin II-p22phox-reactive oxygen species signaling pathway, apoptosis and 8-oxoguanine-DNA glycosylase 1 retrieval in hyperoxia-induced lung injury and fibrosis in rats

    PubMed Central

    Wang, Yu; Zhu, Yuxi; Zhu, Yudi; Lu, Zhongyi; Xu, Feng

    2017-01-01

    The present study was designed to explore the impact of hyperoxia on lung injury and fibrosis via the angiotensin II (AngII)-p22phox-reactive oxygen species (ROS) signaling pathway, apoptosis and 8-oxoguanine-DNA glycosylase 1 (OGG1) repair enzyme. Newborn Sprague-Dawley rats were randomly divided in the newborn air group, newborn hyperoxia group and newborn intervention group, the latter of which was administered the chymotrypsin inhibitor, 2-(5-formylamino-6-oxo-2-phenyl-1, 6-dihydropyrimidine-1-yl)-N-[4-dioxo-1-phenyl-7-(2-pyridyloxy)] 2-heptyl-acetamide (NK3201). A group of adult rats also received hyperoxic treatment. Histomorphological changes in lung tissues were dynamically observed. AngII, ROS, angiotensin type 1 receptor (AT1R) and p22phox messenger RNA (mRNA) levels, and OGG1 and peroxisome proliferator-activated receptor-γ (PPARγ) protein levels in the lung tissues were detected at various times after hyperoxia. Hyperoxia led to traumatic changes in the lungs of newborn rats that resulted in decreased viability, increased mortality, morphological changes and the apoptosis of alveolar type II epithelial cells (AT-II), as well as increased expression levels of AngII, AT1R and p22phox, which would ultimately lead to secondary diseases. NK3201 significantly inhibited the hyperoxia-induced increased expression of AngII, AT1R and p22phox and further promoted OGG1 and PPARγ protein expression, thus reducing the intrapulmonary ROS level, the apoptotic index and caspase-3 levels. However, the adult hyperoxia group only exhibited tachypnea and reduced viability. This study suggested that the AngII-p22phox-ROS signaling pathway, PPARγ and OGG1 together contributed to the hyperoxia-induced lung injury and that NK3201 was able to reverse the effects of hyperoxia. PMID:28587419

  5. Increased 8-hydroxy-2'-deoxyguanosine in plasma and decreased mRNA expression of human 8-oxoguanine DNA glycosylase 1, anti-oxidant enzymes, mitochondrial biogenesis-related proteins and glycolytic enzymes in leucocytes in patients with systemic lupus erythematosus.

    PubMed

    Lee, H-T; Lin, C-S; Lee, C-S; Tsai, C-Y; Wei, Y-H

    2014-04-01

    We measured plasma levels of the oxidative DNA damage marker 8-hydroxy-2'-deoxyguanosine (8-OHdG) and leucocyte mRNA expression levels of the genes encoding the 8-OHdG repair enzyme human 8-oxoguanine DNA glycosylase 1 (hOGG1), the anti-oxidant enzymes copper/zinc superoxide dismutase (Cu/ZnSOD), manganese superoxide dismutase (MnSOD), catalase, glutathione peroxidase-1 (GPx-1), GPx-4, glutathione reductase (GR) and glutathione synthetase (GS), the mitochondrial biogenesis-related proteins mtDNA-encoded ND 1 polypeptide (ND1), ND6, ATPase 6, mitochondrial transcription factor A (Tfam), nuclear respiratory factor 1(NRF-1), pyruvate dehydrogenase E1 component alpha subunit (PDHA1), pyruvate dehydrogenase kinase isoenzyme 1 (PDK-1) and hypoxia inducible factor-1α (HIF-1α) and the glycolytic enzymes hexokinase-II (HK-II), glucose 6-phosphate isomerase (GPI), phosphofructokinase (PFK), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase A (LDHa). We analysed their relevance to oxidative damage in 85 systemic lupus erythematosus (SLE) patients, four complicated SLE patients undergoing rituximab treatment and 45 healthy individuals. SLE patients had higher plasma 8-OHdG levels (P < 0·01) but lower leucocyte expression of the genes encoding hOGG1(P < 0·01), anti-oxidant enzymes (P < 0·05), mitochondrial biogenesis-related proteins (P < 0·05) and glycolytic enzymes (P < 0·05) than healthy individuals. The increase in plasma 8-OHdG was correlated positively with the elevation of leucocyte expression of the genes encoding hOGG1 (P < 0·05), anti-oxidant enzymes (P < 0·05), several mitochondrial biogenesis-related proteins (P < 0·05) and glycolytic enzymes (P < 0·05) in lupus patients. The patients, whose leucocyte mtDNA harboured D310 heteroplasmy, exhibited a positive correlation between the mtDNA copy number and expression of ND1, ND6 and ATPase 6 (P < 0·05) and a negative correlation between mtDNA

  6. Mechanisms of glycosylase induced genomic instability

    PubMed Central

    2017-01-01

    Human alkyladenine DNA glycosylase (AAG) initiates base excision repair (BER) to guard against mutations by excising alkylated and deaminated purines. Counterintuitively, increased expression of AAG has been implicated in increased rates of spontaneous mutation in microsatellite repeats. This microsatellite mutator phenotype is consistent with a model in which AAG excises bulged (unpaired) bases, altering repeat length. To directly test the role of base excision in AAG-induced mutagenesis, we conducted mutation accumulation experiments in yeast overexpressing different variants of AAG and detected mutations via high-depth genome resequencing. We also developed a new software tool, hp_caller, to perform accurate genotyping at homopolymeric repeat loci. Overexpression of wild-type AAG elevated indel mutations in homopolymeric sequences distributed throughout the genome. However, catalytically inactive variants (E125Q/E125A) caused equal or greater increases in frameshift mutations. These results disprove the hypothesis that base excision is the key step in mutagenesis by overexpressed wild-type AAG. Instead, our results provide additional support for the previously published model wherein overexpressed AAG interferes with the mismatch repair (MMR) pathway. In addition to the above results, we observed a dramatic mutator phenotype for N169S AAG, which has increased rates of excision of undamaged purines. This mutant caused a 10-fold increase in point mutations at G:C base pairs and a 50-fold increase in frameshifts in A:T homopolymers. These results demonstrate that it is necessary to consider the relative activities and abundance of many DNA replication and repair proteins when considering mutator phenotypes, as they are relevant to the development of cancer and its resistance to treatment. PMID:28333944

  7. Site-specific DNA alkylation and repair

    SciTech Connect

    Ezaz-Nikpay, K.

    1993-01-01

    This thesis describes a general method for the site-specific insertion of modified nucleotides into DNA and the application of this method to the study of N7-methyl-2[prime]-deoxyguanosine (m[sup 7]dG) in DNA. This thesis describes the chemical basis for the gap insertion/ligation method (GIL) and the use of this method to generate circularly permuted oligonucleotides. In this method, the synthesis of a single oligonucleotide leads to the formation of a double-stranded multimer with periodically-occurring gaps upon base-pairing in solution. The sequential action of a DNA polymerase and a DNA ligase leads to the insertion of a 2[prime]-deoxynucleoside-5[prime]-triphosphate into the gap, and formation of covalently-closed DNA. Finally, restriction endonucleases are used to generate oligonucleotides which contain the introduced nucleotide at symmetrically-related positions. The author describes the use of the GIL method for the insertion of m[sup 7]dG into various oligonucleotides and the Dickerson/Drew dodecamer respectively. The Dickerson/Drew dodecamer was chosen because it has been extensively studies both in its native and adduct bearing forms. The author describes the biophysical characterization of m[sup 7]dG in DNA, and concludes that the probe moiety in dimethyl-sulfate and template-directed interference footprinting of protein-DNA complexes in m[sup 7]dG and not a product of its decomposition. Further studies of m[sub 7]dG in DNA reveal that over long periods of time, the primary product of decomposition is an apurinic site. This dissertation describes the large-scale synthesis of the Dickerson/Drew dodecamer, and the characterization of its effect on DNA structure using nuclear magnetic resonance spectroscopy. The final chapter describes the overproduction, purification and crystallization of N3-methyladenine DNA glycosylase II (AlkA). AlkA is known to repair m[sup 7]dG residues in DNA.

  8. Both base excision repair and O6-methylguanine-DNA methyltransferase protect against methylation-induced colon carcinogenesis

    PubMed Central

    Wirtz, Stefan; Nagel, Georg; Eshkind, Leonid; Neurath, Markus F.; Samson, Leona D.; Kaina, Bernd

    2010-01-01

    Methylating agents are widely distributed environmental carcinogens. Moreover, they are being used in cancer chemotherapy. The primary target of methylating agents is DNA, and therefore, DNA repair is the first-line barrier in defense against their toxic and carcinogenic effects. Methylating agents induce in the DNA O6-methylguanine (O6MeG) and methylations of the ring nitrogens of purines. The lesions are repaired by O6-methylguanine-DNA methyltransferase (Mgmt) and by enzymes of the base excision repair (BER) pathway, respectively. Whereas O6MeG is well established as a pre-carcinogenic lesion, little is known about the carcinogenic potency of base N-alkylation products such as N3-methyladenine and N3-methylguanine. To determine their role in cancer formation and the role of BER in cancer protection, we checked the response of mice with a targeted gene disruption of Mgmt or N-alkylpurine-DNA glycosylase (Aag) or both Mgmt and Aag, to azoxymethane (AOM)-induced colon carcinogenesis, using non-invasive mini-colonoscopy. We demonstrate that both Mgmt- and Aag-null mice show a higher colon cancer frequency than the wild-type. With a single low dose of AOM (3 mg/kg) Aag-null mice showed an even stronger tumor response than Mgmt-null mice. The data provide evidence that both BER initiated by Aag and O6MeG reversal by Mgmt are required for protection against alkylation-induced colon carcinogenesis. Further, the data indicate that non-repaired N-methylpurines are not only pre-toxic but also pre-carcinogenic DNA lesions. PMID:20732909

  9. Both base excision repair and O6-methylguanine-DNA methyltransferase protect against methylation-induced colon carcinogenesis.

    PubMed

    Wirtz, Stefan; Nagel, Georg; Eshkind, Leonid; Neurath, Markus F; Samson, Leona D; Kaina, Bernd

    2010-12-01

    Methylating agents are widely distributed environmental carcinogens. Moreover, they are being used in cancer chemotherapy. The primary target of methylating agents is DNA, and therefore, DNA repair is the first-line barrier in defense against their toxic and carcinogenic effects. Methylating agents induce in the DNA O(6)-methylguanine (O(6)MeG) and methylations of the ring nitrogens of purines. The lesions are repaired by O(6)-methylguanine-DNA methyltransferase (Mgmt) and by enzymes of the base excision repair (BER) pathway, respectively. Whereas O(6)MeG is well established as a pre-carcinogenic lesion, little is known about the carcinogenic potency of base N-alkylation products such as N3-methyladenine and N3-methylguanine. To determine their role in cancer formation and the role of BER in cancer protection, we checked the response of mice with a targeted gene disruption of Mgmt or N-alkylpurine-DNA glycosylase (Aag) or both Mgmt and Aag, to azoxymethane (AOM)-induced colon carcinogenesis, using non-invasive mini-colonoscopy. We demonstrate that both Mgmt- and Aag-null mice show a higher colon cancer frequency than the wild-type. With a single low dose of AOM (3 mg/kg) Aag-null mice showed an even stronger tumor response than Mgmt-null mice. The data provide evidence that both BER initiated by Aag and O(6)MeG reversal by Mgmt are required for protection against alkylation-induced colon carcinogenesis. Further, the data indicate that non-repaired N-methylpurines are not only pre-toxic but also pre-carcinogenic DNA lesions.

  10. Gas-Phase Studies of Formamidopyrimidine Glycosylase (Fpg) Substrates.

    PubMed

    Kiruba, G S M; Xu, Jiahui; Zelikson, Victoria; Lee, Jeehiun K

    2016-03-07

    Gas-phase thermochemical properties (tautomerism, acidity, and proton affinity) have been measured and calculated for a series of nucleobase derivatives that have not heretofore been examined under vacuum. The studied species are substrates for the enzyme formamidopyrimidine glycosylase (Fpg), which cleaves damaged nucleobases from DNA. The gas-phase results are compared and contrasted to solution-phase data, to afford insight into the Fpg mechanism. Calculations are also used to probe the energetics of various possible mechanisms and to predict isotope effects that could potentially allow for discrimination between different mechanisms. Specifically, (18) O substitution at the ribose O4' is predicted to result in a normal kinetic isotope effect (KIE) for a ring-opening "endocyclic" mechanism and an inverse KIE for a direct base excision "exocyclic" pathway.

  11. Expression of human oxoguanine glycosylase 1 or formamidopyrimidine glycosylase in human embryonic kidney 293 cells exacerbates methylmercury toxicity in vitro

    SciTech Connect

    Ondovcik, Stephanie L.; Preston, Thomas J.; McCallum, Gordon P.; Wells, Peter G.

    2013-08-15

    Exposure to methylmercury (MeHg) acutely at high levels, or via chronic low-level dietary exposure from daily fish consumption, can lead to adverse neurological effects in both the adult and developing conceptus. To determine the impact of variable DNA repair capacity, and the role of reactive oxygen species (ROS) and oxidatively damaged DNA in the mechanism of toxicity, transgenic human embryonic kidney (HEK) 293 cells that stably express either human oxoguanine glycosylase 1 (hOgg1) or its bacterial homolog, formamidopyrimidine glycosylase (Fpg), which primarily repair the oxidative lesion 8-oxo-2′-deoxyguanosine (8-oxodG), were used to assess the in vitro effects of MeHg. Western blotting confirmed the expression of hOgg1 or Fpg in both the nuclear and mitochondrial compartments of their respective cell lines. Following acute (1–2 h) incubations with 0–10 μM MeHg, concentration-dependent decreases in clonogenic survival and cell growth accompanied concentration-dependent increases in lactate dehydrogenase (LDH) release, ROS formation, 8-oxodG levels and apurinic/apyrimidinic (AP) sites, consistent with the onset of cytotoxicity. Paradoxically, hOgg1- and Fpg-expressing HEK 293 cells were more sensitive than wild-type cells stably transfected with the empty vector control to MeHg across all cellular and biochemical parameters, exhibiting reduced clonogenic survival and cell growth, and increased LDH release and DNA damage. Accordingly, upregulation of specific components of the base excision repair (BER) pathway may prove deleterious potentially due to the absence of compensatory enhancement of downstream processes to repair toxic intermediary abasic sites. Thus, interindividual variability in DNA repair activity may constitute an important risk factor for environmentally-initiated, oxidatively damaged DNA and its pathological consequences. - Highlights: • hOgg1 and Fpg repair oxidatively damaged DNA. • hOgg1- and Fpg-expressing cells are more

  12. Processing of MucA protein is required for spontaneous and benzo[a]pyrene-induced reversion of the Escherichia coli trpA23 missense mutation by G.C-T.A transversions: effect of a deficiency in the MutY DNA glycosylase.

    PubMed

    Urios, A; Herrera, G; Aleixandre, V; Blanco, M

    1994-12-01

    We have studied the influence of the processing of MucA protein on the occurrence of base substitution mutations. Escherichia coli strains carrying the trpA23 missense mutation and having a full deletion of the chromosomal umuD/C operon were transformed with plasmids encoding the MucB protein together with either wild-type MucA or the nonprocessable MucA202 protein. The efficient reversion of the trpA23 allele by G.C-T.A transversions in benzo[a]pyrene (B[a]P)-treated cells required the function of a matured MucA protein. This processed protein was also necessary for the occurrence of G.C-T.A transversions targeted at spontaneous DNA lesions and for the SOS mutator effect dependent on the constitutive coprotease activity of the RecA730 protein. In contrast, G.C-T.A transversions reverting trpA23 were spontaneously generated by an SOS-independent mechanism in cells deficient in the MutY DNA glycosylase.

  13. Imprinting of the MEA Polycomb gene is controlled by antagonism between MET1 methyltransferase and DME glycosylase.

    PubMed

    Xiao, Wenyan; Gehring, Mary; Choi, Yeonhee; Margossian, Linda; Pu, Hong; Harada, John J; Goldberg, Robert B; Pennell, Roger I; Fischer, Robert L

    2003-12-01

    The MEA Polycomb gene is imprinted in the Arabidopsis endosperm. DME DNA glycosylase activates maternal MEA allele expression in the central cell of the female gametophyte, the progenitor of the endosperm. Maternal mutant dme or mea alleles result in seed abortion. We identified mutations that suppress dme seed abortion and found that they reside in the MET1 methyltransferase gene, which maintains cytosine methylation. Seeds with maternal dme and met1 alleles survive, indicating that suppression occurs in the female gametophyte. Suppression requires a maternal wild-type MEA allele, suggesting that MET1 functions upstream of, or at, MEA. DME activates whereas MET1 suppresses maternal MEA::GFP allele expression in the central cell. MET1 is required for DNA methylation of three regions in the MEA promoter in seeds. Our data suggest that imprinting is controlled in the female gametophyte by antagonism between the two DNA-modifying enzymes, MET1 methyltransferase and DME DNA glycosylase.

  14. Effects of ethylene oxide and ethylene inhalation on DNA adducts, apurinic/apyrimidinic sites and expression of base excision DNA repair genes in rat brain, spleen, and liver.

    PubMed

    Rusyn, Ivan; Asakura, Shoji; Li, Yutai; Kosyk, Oksana; Koc, Hasan; Nakamura, Jun; Upton, Patricia B; Swenberg, James A

    2005-09-28

    Ethylene oxide (EO) is an important industrial chemical that is classified as a known human carcinogen (IARC, Group 1). It is also a metabolite of ethylene (ET), a compound that is ubiquitous in the environment and is the most used petrochemical. ET has not produced evidence of cancer in laboratory animals and is "not classifiable as to its carcinogenicity to humans" (IARC, Group 3). The mechanism of carcinogenicity of EO is not well characterized, but is thought to involve the formation of DNA adducts. EO is mutagenic in a variety of in vitro and in vivo systems, whereas ET is not. Apurinic/apyrimidinic sites (AP) that result from chemical or glycosylase-mediated depurination of EO-induced DNA adducts could be an additional mechanism leading to mutations and chromosomal aberrations. This study tested the hypothesis that EO exposure results in the accumulation of AP sites and induces changes in expression of genes for base excision DNA repair (BER). Male Fisher 344 rats were exposed to EO (100 ppm) or ET (40 or 3000 ppm) by inhalation for 1, 3 or 20 days (6h/day, 5 days a week). Animals were sacrificed 2h after exposure for 1, 3 or 20 days as well as 6, 24 and 72 h after a single-day exposure. Experiments were performed with tissues from brain and spleen, target sites for EO-induced carcinogenesis, and liver, a non-target organ. Exposure to EO resulted in time-dependent increases in N7-(2-hydroxyethyl)guanine (7-HEG) in brain, spleen, and liver and N7-(2-hydroxyethyl)valine (7-HEVal) in globin. Ethylene exposure also induced 7-HEG and 7-HEVal, but the numbers of adducts were much lower. No increase in the number of aldehydic DNA lesions, an indicator of AP sites, was detected in any of the tissues between controls and EO-, or ET-exposed animals, regardless of the duration or strength of exposure. EO exposure led to a 3-7-fold decrease in expression of 3-methyladenine-DNA glycosylase (Mpg) in brain and spleen in rats exposed to EO for 1 day. Expression of 8

  15. Dimerization and opposite base-dependent catalytic impairment of polymorphic S326C OGG1 glycosylase

    PubMed Central

    Hill, Jeff W.; Evans, Michele K.

    2006-01-01

    Human 8-oxoguanine-DNA glycosylase (OGG1) is the major enzyme for repairing 8-oxoguanine (8-oxoG), a mutagenic guanine base lesion produced by reactive oxygen species (ROS). A frequently occurring OGG1 polymorphism in human populations results in the substitution of serine 326 for cysteine (S326C). The 326 C/C genotype is linked to numerous cancers, although the mechanism of carcinogenesis associated with the variant is unclear. We performed detailed enzymatic studies of polymorphic OGG1 and found functional defects in the enzyme. S326C OGG1 excised 8-oxoG from duplex DNA and cleaved abasic sites at rates 2- to 6-fold lower than the wild-type enzyme, depending upon the base opposite the lesion. Binding experiments showed that the polymorphic OGG1 binds DNA damage with significantly less affinity than the wild-type enzyme. Remarkably, gel shift, chemical cross-linking and gel filtration experiments showed that S326C both exists in solution and binds damaged DNA as a dimer. S326C OGG1 enzyme expressed in human cells was also found to have reduced activity and a dimeric conformation. The glycosylase activity of S326C OGG1 was not significantly stimulated by the presence of AP-endonuclease. The altered substrate specificity, lack of stimulation by AP-endonuclease 1 (APE1) and anomalous DNA binding conformation of S326C OGG1 may contribute to its linkage to cancer incidence. PMID:16549874

  16. Surprising Repair Activities of Nonpolar Analogs of 8-oxoG Expose Features of Recognition and Catalysis by Base Excision Repair Glycosylases

    PubMed Central

    McKibbin, Paige L.; Kobori, Akio; Taniguchi, Yosuke

    2012-01-01

    Repair glycosylases locate and excise damaged bases from DNA, playing central roles in preservation of the genome and prevention of disease. Two key glycosylases, Fpg and hOGG1, function to remove the mutagenic oxidized base 8-oxoG (OG) from DNA. To investigate the relative contributions of conformational preferences, leaving group ability, enzyme-base hydrogen bonding and nucleobase shape on damage recognition by these glycosylases, a series of four substituted indole nucleosides, based on the parent OG nonpolar isostere 2Cl-4F-indole, were tested as possible direct substrates of these enzymes in the context of 30 base pair duplexes paired with C. Surprisingly, single-turnover experiments revealed that Fpg-catalyzed base removal activity of two of the nonpolar analogs was superior to the native OG substrate. The hOGG1 glycosylase was also found to catalyze removal of three of the nonpolar analogs, albeit considerably less efficiently than removal of OG. Of note, the analog that was completely resistant to hOGG1-catalyzed excision has a chloro-substituent at the position of NH7 of OG implicating the importance of recognition of this position in catalysis. Both hOGG1 and Fpg retained high affinity for the duplexes containing the nonpolar isosteres. These studies show that hydrogen bonds between base and enzyme are not needed for efficient damage recognition and repair by Fpg and underscore the importance of facile extrusion from the helix in its damaged base selection. In contrast, damage removal by hOGG1 is sensitive both to hydrogen bonding groups and nucleobase shape. The relative rates of excision of the analogs with the two glycosylases highlight key differences in their mechanisms of damaged base recognition and removal. PMID:22175854

  17. Surprising repair activities of nonpolar analogs of 8-oxoG expose features of recognition and catalysis by base excision repair glycosylases.

    PubMed

    McKibbin, Paige L; Kobori, Akio; Taniguchi, Yosuke; Kool, Eric T; David, Sheila S

    2012-01-25

    Repair glycosylases locate and excise damaged bases from DNA, playing central roles in preservation of the genome and prevention of disease. Two key glycosylases, Fpg and hOGG1, function to remove the mutagenic oxidized base 8-oxoG (OG) from DNA. To investigate the relative contributions of conformational preferences, leaving group ability, enzyme-base hydrogen bonding, and nucleobase shape on damage recognition by these glycosylases, a series of four substituted indole nucleosides, based on the parent OG nonpolar isostere 2Cl-4F-indole, were tested as possible direct substrates of these enzymes in the context of 30 base pair duplexes paired with C. Surprisingly, single-turnover experiments revealed that Fpg-catalyzed base removal activity of two of the nonpolar analogs was superior to the native OG substrate. The hOGG1 glycosylase was also found to catalyze removal of three of the nonpolar analogs, albeit considerably less efficiently than removal of OG. Of note, the analog that was completely resistant to hOGG1-catalyzed excision has a chloro-substituent at the position of NH7 of OG, implicating the importance of recognition of this position in catalysis. Both hOGG1 and Fpg retained high affinity for the duplexes containing the nonpolar isosteres. These studies show that hydrogen bonds between base and enzyme are not needed for efficient damage recognition and repair by Fpg and underscore the importance of facile extrusion from the helix in its damaged base selection. In contrast, damage removal by hOGG1 is sensitive to both hydrogen bonding groups and nucleobase shape. The relative rates of excision of the analogs with the two glycosylases highlight key differences in their mechanisms of damaged base recognition and removal.

  18. Dispensability of the [4Fe-4S] cluster in novel homologues of adenine glycosylase MutY.

    PubMed

    Trasviña-Arenas, Carlos H; Lopez-Castillo, Laura M; Sanchez-Sandoval, Eugenia; Brieba, Luis G

    2016-02-01

    7,8-Dihydro-8-deoxyguanine (8oG) is one of the most common oxidative lesions in DNA. DNA polymerases misincorporate an adenine across from this lesion. Thus, 8oG is a highly mutagenic lesion responsible for G:C→T:A transversions. MutY is an adenine glycosylase, part of the base excision repair pathway that removes adenines, when mispaired with 8oG or guanine. Its catalytic domain includes a [4Fe-4S] cluster motif coordinated by cysteinyl ligands. When this cluster is absent, MutY activity is depleted and several studies concluded that the [4Fe-4S] cluster motif is an indispensable component for DNA binding, substrate recognition and enzymatic activity. In the present study, we identified 46 MutY homologues that lack the canonical cysteinyl ligands, suggesting an absence of the [4Fe-4S] cluster. A phylogenetic analysis groups these novel MutYs into two different clades. One clade is exclusive of the order Lactobacillales and another clade has a mixed composition of anaerobic and microaerophilic bacteria and species from the protozoan genus Entamoeba. Structural modeling and sequence analysis suggests that the loss of the [4Fe-4S] cluster is compensated by a convergent solution in which bulky amino acids substitute the [4Fe-4S] cluster. We functionally characterized MutYs from Lactobacillus brevis and Entamoeba histolytica as representative members from each clade and found that both enzymes are active adenine glycosylases. Furthermore, chimeric glycosylases, in which the [4Fe-4S] cluster of Escherichia coli MutY is replaced by the corresponding amino acids of LbY and EhY, are also active. Our data indicates that the [4Fe-4S] cluster plays a structural role in MutYs and evidences the existence of alternative functional solutions in nature.

  19. The 8-oxo-deoxyguanosine glycosylase increases its migration to mitochondria in compensated cardiac hypertrophy.

    PubMed

    Vela-Guajardo, Jorge E; Pérez-Treviño, Perla; Rivera-Álvarez, Irais; González-Mondellini, Fabio A; Altamirano, Julio; García, Noemí

    2017-08-24

    Cardiac hypertrophy is a compensatory mechanism maladapted because it presents an increase in the oxidative stress which could be associated with the development of the heart failure. A mechanism proposed is by mitochondrial DNA (mtDNA) oxidation, which evolved to a vicious cycle because of the synthesis of proteins encoded in the genome is committed. Therefore, the aim of the present work was to evaluate the mtDNA damage and enzyme repairing the 8-oxo-deoxyguanosine glycosylase mitochondrial isoform 1-2a (OGG1-2a) in the early stage of compensated cardiac hypertrophy induced by abdominal aortic constriction (AAC). Results showed that after 6 weeks of AAC, hearts presented a compensated hypertrophy (22%), with an increase in the cell volume (35%), mitochondrial mass (12%), and mitochondrial membrane potential (94%). However, the increase of oxidative stress did not affect mtDNA most probably because OGG1-2a was found to increase 3.2 times in the mitochondrial fraction. Besides, mitochondrial function was not altered by the cardiac hypertrophy condition but in vitro mitochondria from AAC heart showed an increased sensibility to stress induced by the high Ca(2+) concentration. The increase in the oxidative stress in compensated cardiac hypertrophy induced the OGG1-2a migration to mitochondria to repair mtDNA oxidation, as a mechanism that allows maintaining the cardiac function in the compensatory stage. Copyright © 2017 American Society of Hypertension. Published by Elsevier Inc. All rights reserved.

  20. Visualizing the search for radiation-damaged DNA bases in real time

    NASA Astrophysics Data System (ADS)

    Lee, Andrea J.; Wallace, Susan S.

    2016-11-01

    The Base Excision Repair (BER) pathway removes the vast majority of damages produced by ionizing radiation, including the plethora of radiation-damaged purines and pyrimidines. The first enzymes in the BER pathway are DNA glycosylases, which are responsible for finding and removing the damaged base. Although much is known about the biochemistry of DNA glycosylases, how these enzymes locate their specific damage substrates among an excess of undamaged bases has long remained a mystery. Here we describe the use of single molecule fluorescence to observe the bacterial DNA glycosylases, Nth, Fpg and Nei, scanning along undamaged and damaged DNA. We show that all three enzymes randomly diffuse on the DNA molecule and employ a wedge residue to search for and locate damage. The search behavior of the Escherichia coli DNA glycosylases likely provides a paradigm for their homologous mammalian counterparts.

  1. Structure and stereochemistry of the base excision repair glycosylase MutY reveal a mechanism similar to retaining glycosidases.

    PubMed

    Woods, Ryan D; O'Shea, Valerie L; Chu, Aurea; Cao, Sheng; Richards, Jody L; Horvath, Martin P; David, Sheila S

    2016-01-29

    MutY adenine glycosylases prevent DNA mutations by excising adenine from promutagenic 8-oxo-7,8-dihydroguanine (OG):A mismatches. Here, we describe structural features of the MutY active site bound to an azaribose transition state analog which indicate a catalytic role for Tyr126 and approach of the water nucleophile on the same side as the departing adenine base. The idea that Tyr126 participates in catalysis, recently predicted by modeling calculations, is strongly supported by mutagenesis and by seeing close contact between the hydroxyl group of this residue and the azaribose moiety of the transition state analog. NMR analysis of MutY methanolysis products corroborates a mechanism for adenine removal with retention of stereochemistry. Based on these results, we propose a revised mechanism for MutY that involves two nucleophilic displacement steps akin to the mechanisms accepted for 'retaining' O-glycosidases. This new-for-MutY yet familiar mechanism may also be operative in related base excision repair glycosylases and provides a critical framework for analysis of human MutY (MUTYH) variants associated with inherited colorectal cancer.

  2. Structure and stereochemistry of the base excision repair glycosylase MutY reveal a mechanism similar to retaining glycosidases

    PubMed Central

    Woods, Ryan D.; O'Shea, Valerie L.; Chu, Aurea; Cao, Sheng; Richards, Jody L.; Horvath, Martin P.; David, Sheila S.

    2016-01-01

    MutY adenine glycosylases prevent DNA mutations by excising adenine from promutagenic 8-oxo-7,8-dihydroguanine (OG):A mismatches. Here, we describe structural features of the MutY active site bound to an azaribose transition state analog which indicate a catalytic role for Tyr126 and approach of the water nucleophile on the same side as the departing adenine base. The idea that Tyr126 participates in catalysis, recently predicted by modeling calculations, is strongly supported by mutagenesis and by seeing close contact between the hydroxyl group of this residue and the azaribose moiety of the transition state analog. NMR analysis of MutY methanolysis products corroborates a mechanism for adenine removal with retention of stereochemistry. Based on these results, we propose a revised mechanism for MutY that involves two nucleophilic displacement steps akin to the mechanisms accepted for ‘retaining’ O-glycosidases. This new-for-MutY yet familiar mechanism may also be operative in related base excision repair glycosylases and provides a critical framework for analysis of human MutY (MUTYH) variants associated with inherited colorectal cancer. PMID:26673696

  3. Protection of pulmonary epithelial cells from oxidative stress by hMYH adenine glycosylase

    PubMed Central

    Kremer, Ted M; Rinne, Mikael L; Xu, Yi; Chen, Xian Ming; Kelley, Mark R

    2004-01-01

    Background Oxygen toxicity is a major cause of lung injury. The base excision repair pathway is one of the most important cellular protection mechanisms that responds to oxidative DNA damage. Lesion-specific DNA repair enzymes include hOgg1, hMYH, hNTH and hMTH. Methods The above lesion-specific DNA repair enzymes were expressed in human alveolar epithelial cells (A549) using the pSF91.1 retroviral vector. Cells were exposed to a 95% oxygen environment, ionizing radiation (IR), or H2O2. Cell growth analysis was performed under non-toxic conditions. Western blot analysis was performed to verify over-expression and assess endogenous expression under toxic and non-toxic conditions. Statistical analysis was performed using the paired Student's t test with significance being accepted for p < 0.05. Results Cell killing assays demonstrated cells over-expressing hMYH had improved survival to both increased oxygen and IR. Cell growth analysis of A549 cells under non-toxic conditions revealed cells over-expressing hMYH also grow at a slower rate. Western blot analysis demonstrated over-expression of each individual gene and did not result in altered endogenous expression of the others. However, it was observed that O2 toxicity did lead to a reduced endogenous expression of hNTH in A549 cells. Conclusion Increased expression of the DNA glycosylase repair enzyme hMYH in A549 cells exposed to O2 and IR leads to improvements in cell survival. DNA repair through the base excision repair pathway may provide an alternative way to offset the damaging effects of O2 and its metabolites. PMID:15450125

  4. Enforced Presentation of an Extrahelical Guanine to the Lesion Recognition Pocket of Human 8-Oxoguanine Glycosylase, hOGG1

    SciTech Connect

    Crenshaw, Charisse M.; Nam, Kwangho; Oo, Kimberly; Kutchukian, Peter S.; Bowman, Brian R.; Karplus, Martin; Verdine, Gregory L.

    2012-09-05

    A poorly understood aspect of DNA repair proteins is their ability to identify exceedingly rare sites of damage embedded in a large excess of nearly identical undamaged DNA, while catalyzing repair only at the damaged sites. Progress toward understanding this problem has been made by comparing the structures and biochemical behavior of these enzymes when they are presented with either a target lesion or a corresponding undamaged nucleobase. Trapping and analyzing such DNA-protein complexes is particularly difficult in the case of base extrusion DNA repair proteins because of the complexity of the repair reaction, which involves extrusion of the target base from DNA followed by its insertion into the active site where glycosidic bond cleavage is catalyzed. Here we report the structure of a human 8-oxoguanine (oxoG) DNA glycosylase, hOGG1, in which a normal guanine from DNA has been forcibly inserted into the enzyme active site. Although the interactions of the nucleobase with the active site are only subtly different for G versus oxoG, hOGG1 fails to catalyze excision of the normal nucleobase. This study demonstrates that even if hOGG1 mistakenly inserts a normal base into its active site, the enzyme can still reject it on the basis of catalytic incompatibility.

  5. Near ultraviolet radiation (UVA and UVB) causes a formamidopyrimidine glycosylase-dependent increase in G to T transversions.

    PubMed

    Palmer, C M; Serafini, D M; Schellhorn, H E

    1997-03-01

    In contrast to far-UV (< 290 nm) DNA damage, a large fraction of the DNA damage caused by near-UV is oxygen-dependent, suggesting the involvement of reactive oxygen species (ROS). The oxidized base 8-oxo-7,8-dihydroguanine (GO) is characteristic of ROS-induced DNA damage and is removed by Fapy (formamidopyrimidine) glycosylase. We have recently shown that Escherichia coli strains deficient in Fapy glycosylase (fpg) are hypersensitive to the lethal effects of UVA but not far-UV (UVC), suggesting lesions recognized by this enzyme may be important premutagenic or lethal lesions generated by near-UV radiation. In this study, we have found that while the far-UV-induced mutation rates of Fapy-deficient and wild-type strains were similar, near-UV (UVA and UVB) was hypermutagenic to a Fapy-deficient strain, causing a dose-dependent increase in induced mutation relative to wild type (up to five-fold at 200 kJ/m2). Using a plasmid back mutation assay, the predominant near-UV-induced mutations in both wild-type and Fapy-deficient strains were found to be C-->T transitions and G -->T transversions. The former is probably due to replicative bypass of pyrimidine dimers or (6-4) photoproducts that are known to be generated by near-UV, whereas the latter may be due to mispairing of GO lesions with adenine during replication. Consistent with this, the frequency of near-UV-induced G-->T transversions was 16-fold higher in a Fapy-deficient strain than a wild-type strain.

  6. Mechanism of ultraviolet-induced mutagenesis: the coding properties of ultraviolet-irradiated poly(dC) replicated by E. coli DNA polymerase I.

    PubMed Central

    Lecomte, P; Boiteux, S; Doubleday, O

    1981-01-01

    We have identified three lesions rather than cyclobutane dimers which alter the properties of UV-irradiated poly(dC) as a template for E.coli DNA polymerase I, and have characterised these lesions with respect to their coding properties, rates of formation and decay, and their sensitivity to uracil DNA glycosylase. Our results lead us to conclude that these lesions are (1) cytosine hydrates, which code for cytosine and to a lesser extent thymine, (2) uracil hydrates, which code for adenine and are not sensitive to uracil DNA glycosylase, and (3) uracils, which code for adenine and are removed by uracil DNA glycosylase. PMID:7024915

  7. Poxvirus DNA Replication

    PubMed Central

    Moss, Bernard

    2013-01-01

    Poxviruses are large, enveloped viruses that replicate in the cytoplasm and encode proteins for DNA replication and gene expression. Hairpin ends link the two strands of the linear, double-stranded DNA genome. Viral proteins involved in DNA synthesis include a 117-kDa polymerase, a helicase–primase, a uracil DNA glycosylase, a processivity factor, a single-stranded DNA-binding protein, a protein kinase, and a DNA ligase. A viral FEN1 family protein participates in double-strand break repair. The DNA is replicated as long concatemers that are resolved by a viral Holliday junction endonuclease. PMID:23838441

  8. Modulation of the processive abasic site lyase activity of a pyrimidine dimer glycosylase.

    PubMed

    Ryabinina, Olga P; Minko, Irina G; Lasarev, Michael R; McCullough, Amanda K; Lloyd, R Stephen

    2011-10-10

    The repair of cis-syn cyclobutane pyrimidine dimers (CPDs) can be initiated via the base excision repair (BER) pathway, utilizing pyrimidine dimer-specific DNA glycosylase/lyase enzymes (pdgs). However, prior to incision at lesion sites, these enzymes bind to non-damaged DNAs through charge-charge interactions. Following initial binding to DNA containing multiple lesions, the enzyme incises at most of these sites prior to dissociation. If a subset of these lesions are in close proximity, clustered breaks may be produced that could lead to decreased cell viability or increased mutagenesis. Based on the co-crystal structures of bacteriophage T4-pdg and homology modeling of a related enzyme from Paramecium bursaria Chlorella virus-1, the structure-function basis for the processive incision activity for both enzymes was investigated using site-directed mutagenesis. An assay was developed that quantitatively measured the rates of incision by these enzymes at clustered apurinic/apyrimidinic (AP) sites. Mathematical modeling of random (distributive) versus processive incisions predicted major differences in the rate and extent of the accumulation of singly nicked DNAs between these two mechanisms. Comparisons of these models with biochemical nicking data revealed significant changes in the damage search mechanisms between wild-type pdgs and most of the mutant enzymes. Several conserved arginine residues were shown to be critical for the processivity of the incision activity, without interfering with catalysis at AP sites. Comparable results were measured for incision at clustered CPD sites in plasmid DNAs. These data reveal that pdgs can be rationally engineered to retain full catalytic activity, while dramatically altering mechanisms of target site location. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Catalytic contributions of key residues in the adenine glycosylase MutY revealed by pH dependent kinetics and cellular repair assays

    PubMed Central

    Brinkmeyer, Megan K.; Pope, Mary Ann Miles; David, Sheila S.

    2012-01-01

    Summary MutY enzymes prevent mutations in DNA associated with 8-oxoguanine (OG) by catalyzing the removal of adenines opposite OG. pH dependence analyses of the adenine glycosylase activity establish that Asp 138 of MutY must be deprotonated for maximal catalytic activity consistent with the role of this residue in stabilizing the oxacarbenium ion transition state in an SN1 mechanism. Use of a cellular OG:A repair assay allowed further validation of the critical role of Asp 138. Conservative substitutions of the catalytic residues Asp 138 and Glu 37 resulted in enzymes with a range of activity that were used to correlate the efficiency of adenine excision with overall OG:A repair and suppression of DNA mutations in vivo. The results indicate that MutY variations that reduce glycosylase activity as a consequence of reduced mismatch affinity result in more dramatic reductions in cellular OG:A repair than those that only compromise adenine excision catalysis. PMID:22365610

  10. Measurement of oxidative damage at individual gene levels by quantitative PCR using 8-hydroxyguanine glycosylase (OGG1).

    PubMed

    Choi, Jinhee; Kim, Dae-Yong; Hyun, Jin-Won; Yoon, Sun-Hee; Choi, Eun-Mi; Hahm, Ki-Baik; Rhee, Kwang-Ho; Chung, Myung-Hee

    2003-01-01

    In this study, an attempt was made to develop a method to estimate oxidative damage of individual genes for assessing chemopreventive potential of dietary or medicinal plants. Oxidative damage was investigated on the two genes in gastric mucosal tissue infected with Helicobacter pylori, which were genes of glyceraldehydes-3-phosphate dehydrogenase (GAPDH), a house-keeping gene, and gene of insulin-like growth factor II receptor (IGFIIR), a gene known to be mutated frequently in gastric carcinoma. The oxidative damage in genomic DNA in the above tissue was confirmed by immunohistochemical study using monoclonal antibody to 8-hydroxyguanine (oh(8)G), which showed much higher degree of staining in their nuclei. Using the method we developed, it was demonstrated that the number of oh(8)G (indicated by 8-hydroxyguanine glycosylase (OGG1) sensitive sites) in GAPDH was almost not changed in H. pylori-infected tissue but in IGFIIR, it increased significantly. These results indicate that this method is valid for the estimate of oxidative damage of individual genes and also showed that the susceptibility of genomic DNA to attack of reactive oxygen species is not homogeneous but different depending upon the region of DNA. We expect to use this method in studies of carcinogenic mechanism and chemoprevention since it can provide more specific information pertaining to individual genes we are interested in. Copyright 2003 Elsevier Science B.V.

  11. Chlorella virus pyrimidine dimer glycosylase and Escherichia coli endonucleases IV and V have incision activity on 2,2,4-triamino-5(2H)-oxazolone.

    PubMed

    Kino, Katsuhito; Suzuki, Masayo; Morikawa, Masayuki; Kobayashi, Takanobu; Iwai, Shigenori; Miyazawa, Hiroshi

    2015-01-01

    2,2,4-Triamino-5(2H)-oxazolone (Oz) in a DNA strand is an oxidation product of guanine and 8-oxo-7, 8-dihydroguanine, and such a lesion can cause G-to-C transversions. Previously, Fpg/Nei and Nth were shown to have incision activity on Oz. We investigated the activities of chlorella virus pyrimidine dimer glycosylase (cvPDG) and Escherichia coli endonucleases IV (Nfo) and V (Nfi) on Oz. Although the three enzymes have different repair mechanisms from Fpg/Nei and Nth, they still had incision activity on Oz. Given the incision activities of cvPDG, Nfo and Nfi on Oz in addition to Fpg/Nei and Nth, Oz is DNA damage that can be repaired by diverse enzymes.

  12. Mechanisms for enzymatic cleavage of the N-glycosidic bond in DNA

    PubMed Central

    Drohat, Alexander C.; Maiti, Atanu

    2014-01-01

    DNA glycosylases remove damaged or enzymatically modified nucleobases from DNA, thereby initiating the base excision repair (BER) pathway, which is found in all forms of life. These ubiquitous enzymes promote genomic integrity by initiating repair of mutagenic and/or cytotoxic lesions that arise continuously due to alkylation, deamination, or oxidation of the normal bases in DNA. Glycosylases also perform essential roles in epigenetic regulation of gene expression, by targeting enzymatically-modified forms of the canonical DNA bases. Monofunctional DNA glycosylases hydrolyze the N-glycosidic bond to liberate the target base, while bifunctional glycosylases mediate glycosyl transfer using an amine group of the enzyme, generating a Schiff base intermediate that facilitates their second activity, cleavage of the DNA backbone. Here we review recent advances in understanding the chemical mechanism of monofunctional DNA glycosylases, with an emphasis on how the reactions are influenced by properties of the nucleobase leaving-group, the moiety that varies across the vast range of substrates targeted by these enzymes. PMID:25181003

  13. Active DNA Demethylation in Plants and Animals

    PubMed Central

    Zhang, H.; Zhu, J.-K.

    2013-01-01

    Active DNA demethylation regulates many vital biological processes, including early development and locus-specific gene expression in plants and animals. In Arabidopsis, bifunctional DNA glycosylases directly excise the 5-methylcytosine base and then cleave the DNA backbone at the abasic site. Recent evidence suggests that mammals utilize DNA glycosylases after 5-methylcytosine is oxidized and/or deaminated. In both cases, the resultant single-nucleotide gap is subsequently filled with an unmodified cytosine through the DNA base excision repair pathway. The enzymatic removal of 5-methylcytosine is tightly integrated with histone modifications and possibly noncoding RNAs. Future research will increase our understanding of the mechanisms and critical roles of active DNA demethylation in various cellular processes as well as inspire novel genetic and chemical therapies for epigenetic disorders. PMID:23197304

  14. Initiation of the ATM-Chk2 DNA damage response through the base excision repair pathway.

    PubMed

    Chou, Wen-Cheng; Hu, Ling-Yueh; Hsiung, Chia-Ni; Shen, Chen-Yang

    2015-08-01

    The DNA damage response (DDR) is activated by various genotoxic stresses. Base lesions, which are structurally simple and predominantly fixed by base excision repair (BER), can trigger the ataxia telangiectasia mutated (ATM)-checkpoint kinase 2 (Chk2) pathway, a DDR component. How these lesions trigger DDR remains unclear. Here we show that, for alkylation damage, methylpurine-DNA glycosylase (MPG) and apurinic/apyrimidinic endonuclease 1, both of which function early in BER, are required for ATM-Chk2-dependent DDR. In addition, other DNA glycosylases, including uracil-DNA glycosylase and 8-oxoguanine glycosylase, which are involved in repairing deaminated bases and oxidative damage, also induced DDR. The early steps of BER therefore play a vital role in modulating the ATM-Chk2 DDR in response to base lesions, facilitating downstream BER processing for repair, in which the formation of a single-strand break was shown to play a critical role. Moreover, MPG knockdown rescued cell lethality, its overexpression led to cell death triggered by DNA damage and, more interestingly, higher MPG expression in breast and ovarian cancers corresponded with a greater probability of relapse-free survival after chemotherapy, underscoring the importance of glycosylase-dependent DDR. This study highlights the crosstalk between BER and DDR that contributes to maintaining genomic integrity and may have clinical applications in cancer therapy.

  15. Direct repair of 3,N(4)-ethenocytosine by the human ALKBH2 dioxygenase is blocked by the AAG/MPG glycosylase.

    PubMed

    Fu, Dragony; Samson, Leona D

    2012-01-02

    Exocyclic ethenobases are highly mutagenic DNA lesions strongly implicated in inflammation and vinyl chloride-induced carcinogenesis. While the alkyladenine DNA glycosylase, AAG (or MPG), binds the etheno lesions 1,N(6)-ethenoadenine (ɛA) and 3,N(4)-ethenocytosine (ɛC) with high affinity, only ɛA can be excised to initiate base excision repair. Here, we discover that the human AlkB homolog 2 (ALKBH2) dioxygenase enzyme catalyzes direct reversal of ɛC lesions in both double- and single-stranded DNA with comparable efficiency to canonical ALKBH2 substrates. Notably, we find that in vitro, the non-enzymatic binding of AAG to ɛC specifically blocks ALKBH2-catalyzed repair of ɛC but not that of methylated ALKBH2 substrates. These results identify human ALKBH2 as a repair enzyme for mutagenic ɛC lesions and highlight potential consequences for substrate-binding overlap between the base excision and direct reversal DNA repair pathways. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Catalysts of DNA Strand Cleavage at Apurinic/Apyrimidinic Sites

    PubMed Central

    Minko, Irina G.; Jacobs, Aaron C.; de Leon, Arnie R.; Gruppi, Francesca; Donley, Nathan; Harris, Thomas M.; Rizzo, Carmelo J.; McCullough, Amanda K.; Lloyd, R. Stephen

    2016-01-01

    Apurinic/apyrimidinic (AP) sites are constantly formed in cellular DNA due to instability of the glycosidic bond, particularly at purines and various oxidized, alkylated, or otherwise damaged nucleobases. AP sites are also generated by DNA glycosylases that initiate DNA base excision repair. These lesions represent a significant block to DNA replication and are extremely mutagenic. Some DNA glycosylases possess AP lyase activities that nick the DNA strand at the deoxyribose moiety via a β- or β,δ-elimination reaction. Various amines can incise AP sites via a similar mechanism, but this non-enzymatic cleavage typically requires high reagent concentrations. Herein, we describe a new class of small molecules that function at low micromolar concentrations as both β- and β,δ-elimination catalysts at AP sites. Structure-activity relationships have established several characteristics that appear to be necessary for the formation of an iminium ion intermediate that self-catalyzes the elimination at the deoxyribose ring. PMID:27363485

  17. Isolation of exons from cloned DNA by exon trapping.

    PubMed

    Nisson, P E; Watkins, P C; Krizman, D B

    2001-05-01

    Exon trapping is an RNA polymerase chain reaction (PCR) method to clone expressed sequences or exons directly from mammalian genomic DNA. The basic protocol in this unit describes the method for trapping internal exons from cosmid clones and the second basic protocol describes trapping of 3 terminal exons. An describes 3 terminal exon trapping, which avoids subcloning of target DNA by ligating it to the vector for direct transfection. A describes a rapid cloning procedure using uracil DNA glycosylase.

  18. Uracil-DNA glycosylases—Structural and functional perspectives on an essential family of DNA repair enzymes

    PubMed Central

    Schormann, N; Ricciardi, R; Chattopadhyay, D

    2014-01-01

    Uracil-DNA glycosylases (UDGs) are evolutionarily conserved DNA repair enzymes that initiate the base excision repair pathway and remove uracil from DNA. The UDG superfamily is classified into six families based on their substrate specificity. This review focuses on the family I enzymes since these are the most extensively studied members of the superfamily. The structural basis for substrate specificity and base recognition as well as for DNA binding, nucleotide flipping and catalytic mechanism is discussed in detail. Other topics include the mechanism of lesion search and molecular mimicry through interaction with uracil-DNA glycosylase inhibitors. The latest studies and findings detailing structure and function in the UDG superfamily are presented. PMID:25252105

  19. Listeria monocytogenes DNA glycosylase AdiP affects flagellar motility, biofilm formation, virulence, and stress responses

    USDA-ARS?s Scientific Manuscript database

    The temperature-dependent alteration of flagellar motility gene expression is critical for the foodborne pathogen Listeria monocytogenes to respond to a changing environment. In this study, a genetic determinant, L. monocytogenes f2365_0220 (lmof2365_0220), encoding a putative protein that is struct...

  20. Base excision DNA repair in the embryonic development of the sea urchin, Strongylocentrotus intermedius.

    PubMed

    Torgasheva, Natalya A; Menzorova, Natalya I; Sibirtsev, Yurii T; Rasskazov, Valery A; Zharkov, Dmitry O; Nevinsky, Georgy A

    2016-06-21

    In actively proliferating cells, such as the cells of the developing embryo, DNA repair is crucial for preventing the accumulation of mutations and synchronizing cell division. Sea urchin embryo growth was analyzed and extracts were prepared. The relative activity of DNA polymerase, apurinic/apyrimidinic (AP) endonuclease, uracil-DNA glycosylase, 8-oxoguanine-DNA glycosylase, and other glycosylases was analyzed using specific oligonucleotide substrates of these enzymes; the reaction products were resolved by denaturing 20% polyacrylamide gel electrophoresis. We have characterized the profile of several key base excision repair activities in the developing embryos (2 blastomers to mid-pluteus) of the grey sea urchin, Strongylocentrotus intermedius. The uracil-DNA glycosylase specific activity sharply increased after blastula hatching, whereas the specific activity of 8-oxoguanine-DNA glycosylase steadily decreased over the course of the development. The AP-endonuclease activity gradually increased but dropped at the last sampled stage (mid-pluteus 2). The DNA polymerase activity was high at the first cleavage division and then quickly decreased, showing a transient peak at blastula hatching. It seems that the developing sea urchin embryo encounters different DNA-damaging factors early in development within the protective envelope and later as a free-floating larva, with hatching necessitating adaptation to the shift in genotoxic stress conditions. No correlation was observed between the dynamics of the enzyme activities and published gene expression data from developing congeneric species, S. purpuratus. The results suggest that base excision repair enzymes may be regulated in the sea urchin embryos at the level of covalent modification or protein stability.

  1. 3CAPS – a structural AP–site analogue as a tool to investigate DNA base excision repair

    PubMed Central

    Schuermann, David; Scheidegger, Simon P.; Weber, Alain R.; Bjørås, Magnar; Leumann, Christian J.; Schär, Primo

    2016-01-01

    Abasic sites (AP-sites) are frequent DNA lesions, arising by spontaneous base hydrolysis or as intermediates of base excision repair (BER). The hemiacetal at the anomeric centre renders them chemically reactive, which presents a challenge to biochemical and structural investigation. Chemically more stable AP-site analogues have been used to avoid spontaneous decay, but these do not fully recapitulate the features of natural AP–sites. With its 3′–phosphate replaced by methylene, the abasic site analogue 3CAPS was suggested to circumvent some of these limitations. Here, we evaluated the properties of 3CAPS in biochemical BER assays with mammalian proteins. 3CAPS-containing DNA substrates were processed by APE1, albeit with comparably poor efficiency. APE1-cleaved 3CAPS can be extended by DNA polymerase β but repaired only by strand displacement as the 5′–deoxyribophosphate (dRP) cannot be removed. DNA glycosylases physically and functionally interact with 3CAPS substrates, underlining its structural integrity and biochemical reactivity. The AP lyase activity of bifunctional DNA glycosylases (NTH1, NEIL1, FPG), however, was fully inhibited. Notably, 3CAPS-containing DNA also effectively inhibited the activity of bifunctional glycosylases on authentic substrates. Hence, the chemically stable 3CAPS with its preserved hemiacetal functionality is a potent tool for BER research and a potential inhibitor of bifunctional DNA glycosylases. PMID:26733580

  2. 3CAPS - a structural AP-site analogue as a tool to investigate DNA base excision repair.

    PubMed

    Schuermann, David; Scheidegger, Simon P; Weber, Alain R; Bjørås, Magnar; Leumann, Christian J; Schär, Primo

    2016-03-18

    Abasic sites (AP-sites) are frequent DNA lesions, arising by spontaneous base hydrolysis or as intermediates of base excision repair (BER). The hemiacetal at the anomeric centre renders them chemically reactive, which presents a challenge to biochemical and structural investigation. Chemically more stable AP-site analogues have been used to avoid spontaneous decay, but these do not fully recapitulate the features of natural AP-sites. With its 3'-phosphate replaced by methylene, the abasic site analogue 3CAPS was suggested to circumvent some of these limitations. Here, we evaluated the properties of 3CAPS in biochemical BER assays with mammalian proteins. 3CAPS-containing DNA substrates were processed by APE1, albeit with comparably poor efficiency. APE1-cleaved 3CAPS can be extended by DNA polymerase β but repaired only by strand displacement as the 5'-deoxyribophosphate (dRP) cannot be removed. DNA glycosylases physically and functionally interact with 3CAPS substrates, underlining its structural integrity and biochemical reactivity. The AP lyase activity of bifunctional DNA glycosylases (NTH1, NEIL1, FPG), however, was fully inhibited. Notably, 3CAPS-containing DNA also effectively inhibited the activity of bifunctional glycosylases on authentic substrates. Hence, the chemically stable 3CAPS with its preserved hemiacetal functionality is a potent tool for BER research and a potential inhibitor of bifunctional DNA glycosylases.

  3. Regulation and function of DNA methylation in plants and animals

    PubMed Central

    He, Xin-Jian; Chen, Taiping; Zhu, Jian-Kang

    2011-01-01

    DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. PMID:21321601

  4. Finding and Producing Probiotic Glycosylases for the Biocatalysis of Ginsenosides: A Mini Review.

    PubMed

    Ku, Seockmo

    2016-05-16

    Various microorganisms have been widely applied in nutraceutical industries for the processing of phytochemical conversion. Specifically, in the Asian food industry and academia, notable attention is paid to the biocatalytic process of ginsenosides (ginseng saponins) using probiotic bacteria that produce high levels of glycosyl-hydrolases. Multiple groups have conducted experiments in order to determine the best conditions to produce more active and stable enzymes, which can be applicable to produce diverse types of ginsenosides for commercial applications. In this sense, there are various reviews that cover the biofunctional effects of multiple types of ginsenosides and the pathways of ginsenoside deglycosylation. However, little work has been published on the production methods of probiotic enzymes, which is a critical component of ginsenoside processing. This review aims to investigate current preparation methods, results on the discovery of new glycosylases, the application potential of probiotic enzymes and their use for biocatalysis of ginsenosides in the nutraceutical industry.

  5. Conformational Dynamics of DNA Repair by Escherichia coli Endonuclease III*

    PubMed Central

    Kuznetsov, Nikita A.; Kladova, Olga A.; Kuznetsova, Alexandra A.; Ishchenko, Alexander A.; Saparbaev, Murat K.; Zharkov, Dmitry O.; Fedorova, Olga S.

    2015-01-01

    Escherichia coli endonuclease III (Endo III or Nth) is a DNA glycosylase with a broad substrate specificity for oxidized or reduced pyrimidine bases. Endo III possesses two types of activities: N-glycosylase (hydrolysis of the N-glycosidic bond) and AP lyase (elimination of the 3′-phosphate of the AP-site). We report a pre-steady-state kinetic analysis of structural rearrangements of the DNA substrates and uncleavable ligands during their interaction with Endo III. Oligonucleotide duplexes containing 5,6-dihydrouracil, a natural abasic site, its tetrahydrofuran analog, and undamaged duplexes carried fluorescent DNA base analogs 2-aminopurine and 1,3-diaza-2-oxophenoxazine as environment-sensitive reporter groups. The results suggest that Endo III induces several fast sequential conformational changes in DNA during binding, lesion recognition, and adjustment to a catalytically competent conformation. A comparison of two fluorophores allowed us to distinguish between the events occurring in the damaged and undamaged DNA strand. Combining our data with the available structures of Endo III, we conclude that this glycosylase uses a multistep mechanism of damage recognition, which likely involves Gln41 and Leu81 as DNA lesion sensors. PMID:25869130

  6. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  7. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  8. Hippocampal adult neurogenesis is maintained by Neil3-dependent repair of oxidative DNA lesions in neural progenitor cells.

    PubMed

    Regnell, Christine Elisabeth; Hildrestrand, Gunn Annette; Sejersted, Yngve; Medin, Tirill; Moldestad, Olve; Rolseth, Veslemøy; Krokeide, Silje Zandstra; Suganthan, Rajikala; Luna, Luisa; Bjørås, Magnar; Bergersen, Linda H

    2012-09-27

    Accumulation of oxidative DNA damage has been proposed as a potential cause of age-related cognitive decline. The major pathway for removal of oxidative DNA base lesions is base excision repair, which is initiated by DNA glycosylases. In mice, Neil3 is the main DNA glycosylase for repair of hydantoin lesions in single-stranded DNA of neural stem/progenitor cells, promoting neurogenesis. Adult neurogenesis is crucial for maintenance of hippocampus-dependent functions involved in behavior. Herein, behavioral studies reveal learning and memory deficits and reduced anxiety-like behavior in Neil3(-/-) mice. Neural stem/progenitor cells from aged Neil3(-/-) mice show impaired proliferative capacity and reduced DNA repair activity. Furthermore, hippocampal neurons in Neil3(-/-) mice display synaptic irregularities. It appears that Neil3-dependent repair of oxidative DNA damage in neural stem/progenitor cells is required for maintenance of adult neurogenesis to counteract the age-associated deterioration of cognitive performance.

  9. Loss of an apurinic/apyrimidinic site endonuclease increases the mutagencity of N-methyl-N'-nitro-N-nitrosoguanidine to Escherichia coli

    SciTech Connect

    Foster, P.L.; Davis, E.F.

    1987-05-01

    xthA/sup -/ Escherichia coli, which are missing a major cellular apurinic/apyrimidinic (AP) endonuclease, are 5- to 10-fold more sensitive than xthA/sup +/ bacteria to mutagenesis by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) under conditions that induce the adaptive response. The xthA/sup -/-dependent mutations are also dependent on SOS mutagenic processing and consists of both transversion and transition base substitutions. When MNNG-adapted xthA/sup -/ bacteria are challenged with a high dose of MNNG, more xthA/sup -/-dependent SOS-dependent mutations are induced, and transversions are enhanced relative to transitions. The mutations induced by challenge are eliminated in xthA/sup -/ alkA/sup -/ bacteria, which are also deficient for 3-methyladenine glycosylase II activity. these data are consistent with the hypothesis that AP sites, at least some of which are produced by glycosylase activity, are mutagenic intermediates following cellular DNA alkylation.

  10. The mechanism of the glycosylase reaction with hOGG1 base-excision repair enzyme: concerted effect of Lys249 and Asp268 during excision of 8-oxoguanine

    PubMed Central

    Šebera, Jakub; Hattori, Yoshikazu; Sato, Daichi; Řeha, David; Nencka, Radim; Kohno, Takashi

    2017-01-01

    Abstract The excision of 8-oxoguanine (oxoG) by the human 8-oxoguanine DNA glycosylase 1 (hOGG1) base-excision repair enzyme was studied by using the QM/MM (M06-2X/6-31G(d,p):OPLS2005) calculation method and nuclear magnetic resonance (NMR) spectroscopy. The calculated glycosylase reaction included excision of the oxoG base, formation of Lys249-ribose enzyme–substrate covalent adduct and formation of a Schiff base. The formation of a Schiff base with ΔG# = 17.7 kcal/mol was the rate-limiting step of the reaction. The excision of the oxoG base with ΔG# = 16.1 kcal/mol proceeded via substitution of the C1΄-N9 N-glycosidic bond with an H-N9 bond where the negative charge on the oxoG base and the positive charge on the ribose were compensated in a concerted manner by NH3+(Lys249) and CO2−(Asp268), respectively. The effect of Asp268 on the oxoG excision was demonstrated with 1H NMR for WT hOGG1 and the hOGG1(D268N) mutant: the excision of oxoG was notably suppressed when Asp268 was mutated to Asn. The loss of the base-excision function was rationalized with QM/MM calculations and Asp268 was confirmed as the electrostatic stabilizer of ribose oxocarbenium through the initial base-excision step of DNA repair. The NMR experiments and QM/MM calculations consistently illustrated the base-excision reaction operated by hOGG1. PMID:28334993

  11. Probing the DNA Structural Requirements for Facilitated Diffusion

    PubMed Central

    2015-01-01

    DNA glycosylases perform a genome-wide search to locate damaged nucleotides among a great excess of undamaged nucleotides. Many glycosylases are capable of facilitated diffusion, whereby multiple sites along the DNA are sampled during a single binding encounter. Electrostatic interactions between positively charged amino acids and the negatively charged phosphate backbone are crucial for facilitated diffusion, but the extent to which diffusing proteins rely on the double-helical structure DNA is not known. Kinetic assays were used to probe the DNA searching mechanism of human alkyladenine DNA glycosylase (AAG) and to test the extent to which diffusion requires B-form duplex DNA. Although AAG excises εA lesions from single-stranded DNA, it is not processive on single-stranded DNA because dissociation is faster than N-glycosidic bond cleavage. However, the AAG complex with single-stranded DNA is sufficiently stable to allow for DNA annealing when a complementary strand is added. This observation provides evidence of nonspecific association of AAG with single-stranded DNA. Single-strand gaps, bubbles, and bent structures do not impede the search by AAG. Instead, these flexible or bent structures lead to the capture of a nearby site of damage that is more efficient than that of a continuous B-form duplex. The ability of AAG to negotiate these helix discontinuities is inconsistent with a sliding mode of diffusion but can be readily explained by a hopping mode that involves microscopic dissociation and reassociation. These experiments provide evidence of relatively long-range hops that allow a searching protein to navigate around DNA binding proteins that would serve as obstacles to a sliding protein. PMID:25495964

  12. Probing the DNA structural requirements for facilitated diffusion.

    PubMed

    Hedglin, Mark; Zhang, Yaru; O'Brien, Patrick J

    2015-01-20

    DNA glycosylases perform a genome-wide search to locate damaged nucleotides among a great excess of undamaged nucleotides. Many glycosylases are capable of facilitated diffusion, whereby multiple sites along the DNA are sampled during a single binding encounter. Electrostatic interactions between positively charged amino acids and the negatively charged phosphate backbone are crucial for facilitated diffusion, but the extent to which diffusing proteins rely on the double-helical structure DNA is not known. Kinetic assays were used to probe the DNA searching mechanism of human alkyladenine DNA glycosylase (AAG) and to test the extent to which diffusion requires B-form duplex DNA. Although AAG excises εA lesions from single-stranded DNA, it is not processive on single-stranded DNA because dissociation is faster than N-glycosidic bond cleavage. However, the AAG complex with single-stranded DNA is sufficiently stable to allow for DNA annealing when a complementary strand is added. This observation provides evidence of nonspecific association of AAG with single-stranded DNA. Single-strand gaps, bubbles, and bent structures do not impede the search by AAG. Instead, these flexible or bent structures lead to the capture of a nearby site of damage that is more efficient than that of a continuous B-form duplex. The ability of AAG to negotiate these helix discontinuities is inconsistent with a sliding mode of diffusion but can be readily explained by a hopping mode that involves microscopic dissociation and reassociation. These experiments provide evidence of relatively long-range hops that allow a searching protein to navigate around DNA binding proteins that would serve as obstacles to a sliding protein.

  13. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  14. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  15. Sensitivity to methylmercury toxicity is enhanced in oxoguanine glycosylase 1 knockout murine embryonic fibroblasts and is dependent on cellular proliferation capacity

    SciTech Connect

    Ondovcik, Stephanie L.; Tamblyn, Laura; McPherson, John Peter; Wells, Peter G.

    2013-07-01

    Methylmercury (MeHg) is a persistent environmental contaminant with potent neurotoxic action for which the underlying molecular mechanisms remain to be conclusively delineated. Our objectives herein were twofold: first, to corroborate our previous findings of an increased sensitivity of spontaneously-immortalized oxoguanine glycosylase 1-null (Ogg1{sup −/−}) murine embryonic fibroblasts (MEFs) to MeHg through generation of Simian virus 40 (SV40) large T antigen-immortalized wild-type and Ogg1{sup −/−} MEFs; and second, to determine whether MeHg toxicity is proliferation-dependent. As with the spontaneously-immortalized cells used previously, the SV40 large T antigen-immortalized cells exhibited similar tendencies to undergo MeHg-initiated cell cycle arrest, with increased sensitivity in the Ogg1{sup −/−} MEFs as measured by clonogenic survival and DNA damage. Compared to exponentially growing cells, those seeded at a higher density exhibited compromised proliferation, which proved protective against MeHg-mediated cell cycle arrest and induction of DNA double strand breaks (DSBs), measured by phosphorylation of the core histone H2A variant (H2AX) on serine 139 (γH2AX), and by its functional confirmation by micronucleus assessment. This enhanced sensitivity of Ogg1{sup −/−} MEFs to MeHg toxicity using discrete SV40 immortalization corroborates our previous studies, and suggests a novel role for OGG1 in minimizing MeHg-initiated DNA lesions that trigger replication-associated DSBs. Furthermore, proliferative capacity may determine MeHg toxicity in vivo and in utero. Accordingly, variations in cellular proliferative capacity and interindividual variability in repair activity may modulate the risk of toxicological consequences following MeHg exposure. - Highlights: • SV40 large T antigen-immortalized Ogg1{sup −/−} cells are more sensitive to MeHg. • Sensitivity to MeHg is dependent on cellular proliferation capacity. • OGG1 maintains genomic

  16. Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA

    PubMed Central

    Briggs, Adrian W.; Stenzel, Udo; Meyer, Matthias; Krause, Johannes; Kircher, Martin; Pääbo, Svante

    2010-01-01

    DNA sequences determined from ancient organisms have high error rates, primarily due to uracil bases created by cytosine deamination. We use synthetic oligonucleotides, as well as DNA extracted from mammoth and Neandertal remains, to show that treatment with uracil–DNA–glycosylase and endonuclease VIII removes uracil residues from ancient DNA and repairs most of the resulting abasic sites, leaving undamaged parts of the DNA fragments intact. Neandertal DNA sequences determined with this protocol have greatly increased accuracy. In addition, our results demonstrate that Neandertal DNA retains in vivo patterns of CpG methylation, potentially allowing future studies of gene inactivation and imprinting in ancient organisms. PMID:20028723

  17. Comparative Effects of Ions, Molecular Crowding, and Bulk DNA on the Damage Search Mechanisms of hOGG1 and hUNG.

    PubMed

    Cravens, Shannen L; Stivers, James T

    2016-09-20

    The energetic nature of the interactions of DNA base excision repair glycosylases with undamaged and damaged DNA and the nuclear environment are expected to significantly impact the time it takes for these enzymes to search for damaged DNA bases. In particular, the high concentration of monovalent ions, macromolecule crowding, and densely packed DNA chains in the cell nucleus could alter the search mechanisms of these enzymes as compared to findings in dilute buffers typically used in in vitro experiments. Here we utilize an in vitro system where the concerted effects of monovalent ions, macromolecular crowding, and high concentrations of bulk DNA chains on the activity of two paradigm human DNA glycosylases can be determined. We find that the energetic nature of the observed binding free energies of human 8-oxoguanine DNA glycosylase (hOGG1) and human uracil DNA glycosylase (hUNG) for undamaged DNA are derived from different sources. Although hOGG1 uses primarily nonelectrostatic binding interactions with nonspecific DNA, hUNG uses a salt-dependent electrostatic binding mode. Both enzymes turn to a nonelectrostatic mode in their specific complexes with damaged bases in DNA, which enhances damage site specificity at physiological ion concentrations. Neither enzyme was capable of efficiently locating and removing their respective damaged bases in the combined presence of physiological ions and a bulk DNA chain density approximating that found in the nucleus. However, the addition of an inert crowding agent to mimic macromolecular crowding in the nucleus largely restored their ability to track DNA chains and locate damaged sites. These findings suggest how the concerted action of monovalent ions and crowding could contribute to efficient DNA damage recognition in cells.

  18. A re-investigation of the ribonuclease sensitivity of a DNA demethylation reaction in chicken embryo and G8 mouse myoblasts.

    PubMed

    Jost, J P; Siegmann, M; Thiry, S; Jost, Y C; Benjamin, D; Schwarz, S

    1999-04-23

    Recently published results (Nucleic Acids Res. 26, 5573-5580, 1998) suggest that the ribonuclease sensitivity of the DNA demethylation reaction may be an experimental artifact due to the possible tight binding of the nucleases to the methylated DNA substrate. Using an improved protocol we show for two different systems that demethylation of hemimethylated DNA is indeed sensitive to micrococcal nuclease, requires RNA and is not an experimental artifact. The purified 5-MeC-DNA glycosylase from chicken embryos and G8 mouse myoblasts was first incubated for 5 min at 37 degrees C with micrococcal nuclease in the presence of Ca2+ in the absence of the DNA substrate. Upon blocking the nuclease activity by the addition of 25 mM EGTA, the DNA demethylation reaction was initiated by adding the labeled hemimethylated DNA substrate to the reaction mixture. Under these conditions the DNA demethylation reaction was abolished. In parallel controls, where the purified 5-MeC-DNA glycosylase was pre-incubated at 37 degrees C with the nuclease, Ca2+ and EGTA or with the nuclease and EGTA, RNA was not degraded and no inhibition of the demethylation reaction was obtained. As has already been shown for chicken embryos, the loss of 5-MeC-DNA glycosylase activity from G8 myoblasts following nuclease treatment can also be restored by the addition of synthetic RNA complementary to the methylated strand of the substrate DNA. No reactivation of 5-MeC-DNA glycosylase is obtained by complementation with a random RNA sequence, the RNA sequence complementary to the non-methylated strand or DNA, thus ruling out a non-specific competition of the RNA for the binding of the nuclease to the labeled DNA substrate.

  19. Human endonuclease VIII-like (NEIL) proteins in the giant DNA Mimivirus

    PubMed Central

    Bandaru, Viswanath; Zhao, Xiaobei; Newton, Michael R.; Burrows, Cynthia J.; Wallace, Susan S.

    2007-01-01

    Endonuclease VIII (Nei), which recognizes and repairs oxidized pyrimidines in the Base Excision Repair (BER) pathway, is sparsely distributed among both the prokaryotes and eukaryotes. Recently, we and others identified three homologs of E. coli endonuclease VIII-like (NEIL) proteins in humans. Here, we report identification of human NEIL homologs in Mimivirus, a giant DNA virus that infects Acanthamoeba. Characterization of the two mimiviral homologs, MvNei1 and MvNei2, showed that they share not only sequence homology but also substrate specificity to the human NEIL proteins, that is, they recognize oxidized pyrimidines in duplex DNA and in bubble substrates and as well show 5′2-deoxyribose-5-phosphate lyase (dRP lyase) activity. However, unlike MvNei1 and the human NEIL proteins, MvNei2 preferentially cleaves oxidized pyrimidines in single stranded DNA forming products with a different end chemistry. Interestingly, opposite base specificity of MvNei1 resembles human NEIL proteins for pyrimidine base damages whereas it resembles E. coli formamidopyrimidine DNA glycosylase (Fpg) for guanidinohydantoin (Gh), an oxidation product of 8-oxoguanine. Finally, a conserved arginine residue in the “zincless finger” motif, previously identified in human NEIL1, is required for the DNA glycosylase activity of MvNeil. Thus, Mimivirus represents the first example of a virus to carry oxidative DNA glycosylases with substrate specificities that resemble human NEIL proteins. Based on the sequence homology to the human NEIL homologs and novel bacterial NEIL homologs identified here, we predict that Mimivirus may have acquired the DNA glycosylases through the host-mediated lateral transfer from either a bacterium or from vertebrates. PMID:17627905

  20. Tautomerization-dependent recognition and excision of oxidation damage in base-excision DNA repair

    PubMed Central

    Zhu, Chenxu; Lu, Lining; Zhang, Jun; Yue, Zongwei; Song, Jinghui; Zong, Shuai; Liu, Menghao; Stovicek, Olivia; Gao, Yi Qin; Yi, Chengqi

    2016-01-01

    NEIL1 (Nei-like 1) is a DNA repair glycosylase guarding the mammalian genome against oxidized DNA bases. As the first enzymes in the base-excision repair pathway, glycosylases must recognize the cognate substrates and catalyze their excision. Here we present crystal structures of human NEIL1 bound to a range of duplex DNA. Together with computational and biochemical analyses, our results suggest that NEIL1 promotes tautomerization of thymine glycol (Tg)—a preferred substrate—for optimal binding in its active site. Moreover, this tautomerization event also facilitates NEIL1-catalyzed Tg excision. To our knowledge, the present example represents the first documented case of enzyme-promoted tautomerization for efficient substrate recognition and catalysis in an enzyme-catalyzed reaction. PMID:27354518

  1. Establishing, maintaining and modifying DNA methylation patterns in plants and animals.

    PubMed

    Law, Julie A; Jacobsen, Steven E

    2010-03-01

    Cytosine DNA methylation is a stable epigenetic mark that is crucial for diverse biological processes, including gene and transposon silencing, imprinting and X chromosome inactivation. Recent findings in plants and animals have greatly increased our understanding of the pathways used to accurately target, maintain and modify patterns of DNA methylation and have revealed unanticipated mechanistic similarities between these organisms. Key roles have emerged for small RNAs, proteins with domains that bind methylated DNA and DNA glycosylases in these processes. Drawing on insights from both plants and animals should deepen our understanding of the regulation and biological significance of DNA methylation.

  2. Establishing, maintaining and modifying DNA methylation patterns in plants and animals

    PubMed Central

    Law, Julie A.; Jacobsen, Steven E.

    2010-01-01

    Cytosine DNA methylation is a stable epigenetic mark that is critical for diverse biological processes including gene and transposon silencing, imprinting, and X chromosome inactivation. Recent findings in plants and animals have greatly increased our understanding of the pathways utilized to accurately target, maintain, and modify patterns of DNA methylation and have revealed unanticipated mechanistic similarities between these organisms. Key roles for small RNAs, proteins with methylated DNA binding domains and DNA glycosylases in these processes have emerged. Drawing on insights from both plants and animals should deepen our understanding of the regulation and biological significance of DNA methylation. PMID:20142834

  3. PTEN Activation by DNA Damage Induces Protective Autophagy in Response to Cucurbitacin B in Hepatocellular Carcinoma Cells

    PubMed Central

    Niu, Yanan; Sun, Wen; Lu, Jin-Jian; Pei, Lixia

    2016-01-01

    Cucurbitacin B (Cuc B), a natural product, induced both protective autophagy and DNA damage mediated by ROS while the detailed mechanisms remain unclear. This study explored the mechanism of Cuc B-induced DNA damage and autophagy. Cuc B decreased cell viability in concentration- and time-dependent manners. Cuc B caused long comet tails and increased expression of γ-H2AX, phosphorylation of ATM/ATR, and Chk1/Chk2. Cuc B induced autophagy as evidenced by monodansylcadaverine (MDC) staining, increased expression of LC3II, phosphorylated ULK1, and decreased expression of phosphorylated AKT, mTOR. Cuc B induced apoptosis mediated by Bcl-2 family proteins and caspase activation. Furthermore, Cuc B induced ROS formation, which was inhibited by N-acetyl-L-cysteine (NAC). NAC pretreatment dramatically reversed Cuc B-induced DNA damage, autophagy, and apoptosis. Cuc B-induced apoptosis was reversed by NAC but enhanced by 3-methyladenine (3-MA), chloroquine (CQ), and silencing phosphatase and tensin homolog (PTEN). 3-MA and CQ showed no effect on Cuc B-induced DNA damage. In addition, Cuc B increased PTEN phosphorylation and silence PTEN restored Cuc B-induced autophagic protein expressions without affecting DNA damage. In summary, Cuc B induced DNA damage, apoptosis, and protective autophagy mediated by ROS. PTEN activation in response to DNA damage bridged DNA damage and prosurvival autophagy. PMID:28042385

  4. A potential impact of DNA repair on ageing and lifespan in the ageing model organism Podospora anserina: decrease in mitochondrial DNA repair activity during ageing.

    PubMed

    Soerensen, Mette; Gredilla, Ricardo; Müller-Ohldach, Mathis; Werner, Alexandra; Bohr, Vilhelm A; Osiewacz, Heinz D; Stevnsner, Tinna

    2009-08-01

    The free radical theory of ageing states that ROS play a key role in age-related decrease in mitochondrial function via the damage of mitochondrial DNA (mtDNA), proteins and lipids. In the sexually reproducing ascomycete Podospora anserina ageing is, as in other eukaryotes, associated with mtDNA instability and mitochondrial dysfunction. Part of the mtDNA instabilities may arise due to accumulation of ROS induced mtDNA lesions, which, as previously suggested for mammals, may be caused by an age-related decrease in base excision repair (BER). Alignments of known BER protein sequences with the P. anserina genome revealed high homology. We report for the first time the presence of BER activities in P. anserina mitochondrial extracts. DNA glycosylase activities decrease with age, suggesting that the increased mtDNA instability with age may be caused by decreased ability to repair mtDNA damage and hence contribute to ageing and lifespan control in this ageing model. Additionally, we find low DNA glycosylase activities in the long-lived mutants grisea and DeltaPaCox17::ble, which are characterized by low mitochondrial ROS generation. Overall, our data identify a potential role of mtDNA repair in controlling ageing and life span in P. anserina, a mechanism possibly regulated in response to ROS levels.

  5. A potential impact of DNA repair on ageing and lifespan in the ageing model organism Podospora anserina: Decrease in mitochondrial DNA repair activity during ageing

    PubMed Central

    Soerensen, Mette; Gredilla, Ricardo; Müller-Ohldach, Mathis; Werner, Alexandra; Bohr, Vilhelm A.; Osiewacz, Heinz D.; Stevnsner, Tinna

    2009-01-01

    Summary The free radical theory of ageing states that ROS play a key role in age-related decrease in mitochondrial function via the damage of mitochondrial DNA (mtDNA), proteins and lipids. In the sexually reproducing ascomycete Podospora anserina ageing is, as in other eukaryotes, associated with mtDNA instability and mitochondrial dysfunction. Part of the mtDNA instabilities may arise due to accumulation of ROS induced mtDNA lesions, which, as previously suggested for mammals, may be caused by an age-related decrease in base excision repair (BER). Alignments of known BER protein sequences with the P. anserina genome revealed high homology. We report for the first time the presence of BER activities in P. anserina mitochondrial extracts. DNA glycosylase activities decrease with age, suggesting that the increased mtDNA instability with age may be caused by decreased ability to repair mtDNA damage and hence contribute to ageing and lifespan control in this ageing model. Additionally, we find low DNA glycosylase activities in the long-lived mutants grisea and ΔPaCox17∷ble, which are characterized by among others low mitochondrial ROS generation. Overall, our data identify a potential role of mtDNA repair in controlling ageing and life span in P. anserina, a mechanism possibly regulated in response to ROS levels. PMID:19486911

  6. Helix–hairpin–helix protein MJ1434 from Methanocaldococcus jannaschii and EndoIV homologue TTC0482 from Thermus thermophilus HB27 do not process DNA uracil residues

    PubMed Central

    Schomacher, Lars; Smolorz, Sabine; Ciirdaeva, Elena; Ber, Svetlana; Kramer, Wilfried; Fritz, Hans-Joachim

    2010-01-01

    The mutagenic threat of hydrolytic DNA cytosine deamination is met mostly by uracil DNA glycosylases (UDG) initiating base excision repair. However, several sequenced genomes of archaeal organisms are devoid of genes coding for homologues of the otherwise ubiquitous UDG superfamily of proteins. Previously, two possible solutions to this problem were offered by (i) a report of a newly discovered family of uracil DNA glycosylases exemplified by MJ1434, a protein found in the hyperthermophilic archaeon Methanocaldococcus jannaschii, and (ii) the description of TTC0482, an EndoIV homologue from the hyperthermophilic bacterium Thermus thermophilus HB27, as being able to excise uracil from DNA. Sequence homologues of both proteins can be found throughout the archaeal domain of life. Three proteins orthologous to MJ1434 and the family founder itself were tested for but failed to exhibit DNA uracil glycosylase activity when produced in an Ung-deficient Escherichia coli host. Likewise, no DNA uracil processing activity could be detected to be associated with TTC0482, while the protein was fully active as an AP endonuclease. We propose that the uracil processing activities formerly found were due to contaminations with Ung enzyme. Use of Δung-strains as hosts for production of putatively DNA-U processing enzymes provides a simple safeguard. PMID:20410075

  7. Rational Inhibitors of DNA Base Excision Repair (BER) Enzymes: New Tools for Elucidating the Role of the BER in Cancer Chemotherapy

    DTIC Science & Technology

    2005-05-01

    right of the bars. (B) Incremental change in binding free energy as UDG (Figure 2) (5). The 2’ fluorinated deoxyuridine each hydrogen bond is removed from...1996) Naphthalene, phenanthrene, and pyrene as DNA h187q Escherichia coli uracil DNA glycosylase: Electrophilic base analogues: Synthesis, structure...solution, Biochemistry 32. Drohat, A. C., Jagadeesh, J., Ferguson, E., and Stivers, J. T. (1999) 26, 5646-5650. Role of electrophilic and general base

  8. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.

    PubMed

    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao

    2014-06-09

    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  9. Solution structure and intramolecular exchange of methyl-cytosine binding domain protein 4 (MBD4) on DNA suggests a mechanism to scan for mCpG/TpG mismatches

    PubMed Central

    Walavalkar, Ninad M.; Cramer, Jason M.; Buchwald, William A.; Scarsdale, J. Neel; Williams, David C.

    2014-01-01

    Unlike other members of the methyl-cytosine binding domain (MBD) family, MBD4 serves as a potent DNA glycosylase in DNA mismatch repair specifically targeting mCpG/TpG mismatches arising from spontaneous deamination of methyl-cytosine. The protein contains an N-terminal MBD (MBD4MBD) and a C-terminal glycosylase domain (MBD4GD) separated by a long linker. This arrangement suggests that the MBD4MBD either directly augments enzymatic catalysis by the MBD4GD or targets the protein to regions enriched for mCpG/TpG mismatches. Here we present structural and dynamic studies of MBD4MBD bound to dsDNA. We show that MBD4MBD binds with a modest preference formCpG as compared to mismatch, unmethylated and hydroxymethylated DNA. We find that while MBD4MBD exhibits slow exchange between molecules of DNA (intermolecular exchange), the domain exhibits fast exchange between two sites in the same molecule of dsDNA (intramolecular exchange). Introducing a single-strand defect between binding sites does not greatly reduce the intramolecular exchange rate, consistent with a local hopping mechanism for moving along the DNA. These results support a model in which the MBD4MBD4 targets the intact protein to mCpG islands and promotes scanning by rapidly exchanging between successive mCpG sites which facilitates repair of nearby mCpG/TpG mismatches by the glycosylase domain. PMID:25183517

  10. Methods for Efficient Elimination of Mitochondrial DNA from Cultured Cells

    PubMed Central

    Spadafora, Domenico; Kozhukhar, Nataliya; Chouljenko, Vladimir N.; Kousoulas, Konstantin G.; Alexeyev, Mikhail F.

    2016-01-01

    Here, we document that persistent mitochondria DNA (mtDNA) damage due to mitochondrial overexpression of the Y147A mutant uracil-N-glycosylase as well as mitochondrial overexpression of bacterial Exonuclease III or Herpes Simplex Virus protein UL12.5M185 can induce a complete loss of mtDNA (ρ0 phenotype) without compromising the viability of cells cultured in media supplemented with uridine and pyruvate. Furthermore, we use these observations to develop rapid, sequence-independent methods for the elimination of mtDNA, and demonstrate utility of these methods for generating ρ0 cells of human, mouse and rat origin. We also demonstrate that ρ0 cells generated by each of these three methods can serve as recipients of mtDNA in fusions with enucleated cells. PMID:27136098

  11. Endonucleases involved in repair and recombination of DNA

    SciTech Connect

    Linn, S.M.

    1988-01-01

    When our DOE support began as a contract in 1970, from the AEC, it was our intent to begin to understand how several enzymes which we had detected in E. coli might be involved in DNA recombination and repair. These studies led to our characterization of the recBC DNase (exonuclease 5) as well as endonucleases 3 and 5. As research supported by that contract progressed, we expanded our interests to include mammalian enzymes involved in base excision repair, most notably AP endonucleases, DNA glycosylases and DNA purine insertase. A logical next step involved the inclusion of DNA polymerases into our studies of repair. Current progress includes research on: isolation of xeroderma pigmentosum correction factors; isolation of ultraviolet (UV) endonucleases; mitochondrial repair enzymes; alkylation damage repair; comparisons of repair in normal diploid, transformed, and non-mitotic cells; and repair reactions by DNA polymerases.

  12. DNA base excision repair of uracil residues in reconstituted nucleosome core particles

    PubMed Central

    Nilsen, Hilde; Lindahl, Tomas; Verreault, Alain

    2002-01-01

    The human base excision repair machinery must locate and repair DNA base damage present in chromatin, of which the nucleosome core particle is the basic repeating unit. Here, we have utilized fragments of the Lytechinus variegatus 5S rRNA gene containing site-specific U:A base pairs to investigate the base excision repair pathway in reconstituted nucleosome core particles in vitro. The human uracil-DNA glycosylases, UNG2 and SMUG1, were able to remove uracil from nucleosomes. Efficiency of uracil excision from nucleosomes was reduced 3- to 9-fold when compared with naked DNA, and was essentially uniform along the length of the DNA substrate irrespective of rotational position on the core particle. Furthermore, we demonstrate that the excision repair pathway of an abasic site can be reconstituted on core particles using the known repair enzymes, AP-endonuclease 1, DNA polymerase β and DNA ligase III. Thus, base excision repair can proceed in nucleosome core particles in vitro, but the repair efficiency is limited by the reduced activity of the uracil-DNA glycosylases and DNA polymerase β on nucleosome cores. PMID:12411511

  13. Regulation of DNA repair in serum-stimulated xeroderma pigmentosum cells

    SciTech Connect

    Gupta, P.K.; Sirover, M.A.

    1984-10-01

    The regulation of DNA repair during serum stimulation of quiescent cells was examined in normal human cells, in fibroblasts from three xeroderma pigmentosum complementation groups (A, C, and D), in xeroderma pigmentosum variant cells, and in ataxia telangiectasia cells. The regulation of nucleotide excision repair was examined by exposing cells to ultraviolet irradiation at discrete intervals after cell stimulation. Similarly, base excision repair was quantitated after exposure to methylmethane sulfonate. WI-38 normal human diploid fibroblasts, xeroderma pigmentosum variant cells, as well as ataxia telangiectasia cells enhanced their capacity for both nucleotide excision repair and for base excision repair prior to their enhancement of DNA synthesis. Further, in each cell strain, the base excision repair enzyme uracil DNA glycosylase was increased prior to the induction of DNA polymerase using the identical cells to quantitate each activity. In contrast, each of the three xeroderma complementation groups that were examined failed to increase their capacity for nucleotide excision repair above basal levels at any interval examined. This result was observed using either unscheduled DNA synthesis in the presence of 10 mM hydroxyurea or using repair replication in the absence of hydroxyurea to quantitate DNA repair. However, each of the three complementation groups normally regulated the enhancement of base excision repair after methylmethane sulfonate exposure and each induced the uracil DNA glycosylase prior to DNA synthesis. 62 references, 3 figures, 2 tables.

  14. Base Excision Repair and Lesion-Dependent Subpathways for Repair of Oxidative DNA Damage

    PubMed Central

    Svilar, David; Goellner, Eva M.; Almeida, Karen H.

    2011-01-01

    Abstract Nuclear and mitochondrial genomes are under continuous assault by a combination of environmentally and endogenously derived reactive oxygen species, inducing the formation and accumulation of mutagenic, toxic, and/or genome-destabilizing DNA lesions. Failure to resolve these lesions through one or more DNA-repair processes is associated with genome instability, mitochondrial dysfunction, neurodegeneration, inflammation, aging, and cancer, emphasizing the importance of characterizing the pathways and proteins involved in the repair of oxidative DNA damage. This review focuses on the repair of oxidative damage–induced lesions in nuclear and mitochondrial DNA mediated by the base excision repair (BER) pathway in mammalian cells. We discuss the multiple BER subpathways that are initiated by one of 11 different DNA glycosylases of three subtypes: (a) bifunctional with an associated β-lyase activity; (b) monofunctional; and (c) bifunctional with an associated β,δ-lyase activity. These three subtypes of DNA glycosylases all initiate BER but yield different chemical intermediates and hence different BER complexes to complete repair. Additionally, we briefly summarize alternate repair events mediated by BER proteins and the role of BER in the repair of mitochondrial DNA damage induced by ROS. Finally, we discuss the relation of BER and oxidative DNA damage in the onset of human disease. Antioxid. Redox Signal. 14, 2491–2507. PMID:20649466

  15. Alkylation Induced DNA Repair and Mutagenesis in Escherichia coli.

    DTIC Science & Technology

    1987-11-23

    the other is inducible and encoded by alkA (TaglI). The tag gly- cosylase is identified radiochemically as a 21 kdal protein whereas the alkA product... alkA mutants can be ascribed to more rapid induction of the SOS reponse by-persisting 3-methylpurines. UNCLASSIFIED SECURITY CLASSIFICATION OF THIS PAGE...th- induction of a DNA glycosylase. Nature 296:773-775. Paper 2 Kaasen, I., G. Evensen and E. Se~berg. 1986, Amplified expression of thp e and alkA

  16. The Methanothermobacter thermautotrophicus ExoIII homologue Mth212 is a DNA uridine endonuclease

    PubMed Central

    Georg, Jens; Schomacher, Lars; Chong, James P. J.; Majerník, Alan I.; Raabe, Monika; Urlaub, Henning; Müller, Sabine; Ciirdaeva, Elena; Kramer, Wilfried; Fritz, Hans-Joachim

    2006-01-01

    The genome of Methanothermobacter thermautotrophicus, as a hitherto unique case, is apparently devoid of genes coding for general uracil DNA glycosylases, the universal mediators of base excision repair following hydrolytic deamination of DNA cytosine residues. We have now identified protein Mth212, a member of the ExoIII family of nucleases, as a possible initiator of DNA uracil repair in this organism. This enzyme, in addition to bearing all the enzymological hallmarks of an ExoIII homologue, is a DNA uridine endonuclease (U-endo) that nicks double-stranded DNA at the 5′-side of a 2′-d-uridine residue, irrespective of the nature of the opposing nucleotide. This type of activity has not been described before; it is absent from the ExoIII homologues of Escherichia coli, Homo sapiens and Methanosarcina mazei, all of which are equipped with uracil DNA repair glycosylases. The U-endo activity of Mth212 is served by the same catalytic center as its AP-endo activity. PMID:17012282

  17. A DNA 3′-phosphatase functions in active DNA demethylation in Arabidopsis

    PubMed Central

    Martínez-Macías, María Isabel; Qian, Weiqiang; Miki, Daisuke; Pontes, Olga; Liu, Yunhua; Tang, Kai; Liu, Renyi; Morales-Ruiz, Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa; Zhu, Jian-Kang

    2012-01-01

    SUMMARY DNA methylation is an important epigenetic mark established by the combined actions of methylation and demethylation reactions. Plants use a base excision repair pathway for active DNA demethylation. After 5-methylcytosine removal, the Arabidopsis DNA glycosylase/lyase ROS1 incises the DNA backbone and part of the product has a single-nucleotide gap flanked by 3′- and 5′-phosphate termini. Here we show that the DNA phosphatase ZDP removes the blocking 3′-phosphate, allowing subsequent DNA polymerization and ligation steps needed to complete the repair reactions. ZDP and ROS1 interact in vitro and co-localize in vivo in nucleoplasmic foci. Extracts from zdp mutant plants are unable to complete DNA demethylation in vitro, and the mutations cause DNA hypermethylation and transcriptional silencing of a reporter gene. Genome-wide methylation analysis in zdp mutant plants identified hundreds of hypermethylated endogenous loci. Our results show that ZDP functions downstream of ROS1 in one branch of the active DNA demethylation pathway. PMID:22325353

  18. Nucleosomes Suppress the Formation of Double-strand DNA Breaks during Attempted Base Excision Repair of Clustered Oxidative Damages*

    PubMed Central

    Cannan, Wendy J.; Tsang, Betty P.; Wallace, Susan S.; Pederson, David S.

    2014-01-01

    Exposure to ionizing radiation can produce multiple, clustered oxidative lesions in DNA. The near simultaneous excision of nearby lesions in opposing DNA strands by the base excision repair (BER) enzymes can produce double-strand DNA breaks (DSBs). This attempted BER accounts for many of the potentially lethal or mutagenic DSBs that occur in vivo. To assess the impact of nucleosomes on the frequency and pattern of BER-dependent DSB formation, we incubated nucleosomes containing oxidative damages in opposing DNA strands with selected DNA glycosylases and human apurinic/apyrimidinic endonuclease 1. Overall, nucleosomes substantially suppressed DSB formation. However, the degree of suppression varied as a function of (i) the lesion type and DNA glycosylase tested, (ii) local sequence context and the stagger between opposing strand lesions, (iii) the helical orientation of oxidative lesions relative to the underlying histone octamer, and (iv) the distance between the lesion cluster and the nucleosome edge. In some instances the binding of a BER factor to one nucleosomal lesion appeared to facilitate binding to the opposing strand lesion. DSB formation did not invariably lead to nucleosome dissolution, and in some cases, free DNA ends resulting from DSB formation remained associated with the histone octamer. These observations explain how specific structural and dynamic properties of nucleosomes contribute to the suppression of BER-generated DSBs. These studies also suggest that most BER-generated DSBs will occur in linker DNA and in genomic regions associated with elevated rates of nucleosome turnover or remodeling. PMID:24891506

  19. Infrared laser effects at fluences used for treatment of dentin hypersensitivity on DNA repair in Escherichia coli and plasmids

    NASA Astrophysics Data System (ADS)

    Rocha Teixeira, Gleica; da Silva Marciano, Roberta; da Silva Sergio, Luiz Philippe; Castanheira Polignano, Giovanni Augusto; Roberto Guimarães, Oscar; Geller, Mauro; de Paoli, Flavia; de Souza da Fonseca, Adenilson

    2014-12-01

    Low-intensity infrared lasers are proposed in clinical protocols based on biostimulative effects, yet dosimetry is inaccurate and their effects on DNA at therapeutic doses are controversial. The aim of this work was to evaluate the effects of low-intensity infrared laser on survival and induction of filamentation of Escherichia coli cells, and induction of DNA lesions in bacterial plasmids. E. coli cultures were exposed to laser (808 nm, 100 mW, 40 and 60 J/cm2) to study bacterial survival and filamentation. Also, bacterial plasmids were exposed to laser to study DNA lesions by electrophoretic profile and action of DNA repair enzymes. Data indicate low-intensity infrared laser has no effect on survival of E. coli wild type and exonuclease III, but decreases the survival of formamidopyrimidine DNA glycosylase/MutM protein and endonuclease III deficient cells in stationary growth phase, induces bacterial filamentation, does not alter the electrophoretic profile of plasmids in agarose gels and does not alter the electrophoretic profile of plasmids incubated with endonuclease III, formamidopyrimidine DNA glycosylase/MutM protein and exonuclease III. Our findings show that low-intensity laser exposure causes DNA lesions at sub-lethal level and induces cellular mechanisms involved in repair of oxidative lesions in DNA. Studies about laser dosimetry and safety strategies are necessary for professionals and patients exposed to low-intensity lasers at therapeutic doses.

  20. Assessment of DNA Binding and Oxidative DNA Damage by Acrylonitrile in Two Rat Target Tissues of Carcinogenicity: Implications for the Mechanism of Action.

    PubMed

    Williams, Gary M; Kobets, Tetyana; Duan, Jian-Dong; Iatropoulos, Michael J

    2017-07-17

    Exposure to acrylonitrile induces formation of tumors at multiple sites in rats, with females being more sensitive. The present study assessed possible mechanisms of acrylonitrile tumorigenicity, covalent DNA binding, DNA breakage, and oxidative DNA damage, in two target tissues, the brain and Zymbal's glands, of sensitive female Fischer (F344) and Sprague-Dawley (SD) rats. One group received acrylonitrile in drinking water at 100 ppm for 28 days. Two other groups were administered either acrylonitrile in drinking water at 100 ppm or drinking water alone for 27 days, followed by a single oral gavage dose of 11 mg/kg bw (14)C-acrylonitrile on day 28. A positive control group received a single dose of 5 mg/kg bw of 7-(14)C-benzo[a]pyrene, on day 27 following the administration of drinking water for 26 days. Using liquid scintillation counting, no association of radiolabeled acrylonitrile with brain DNA was found. In accelerator mass spectrometry analysis, the association of (14)C of acrylonitrile with DNA in brains was detected and was similar in both strains, which may reflect acrylonitrile binding to protein as well as to DNA. Nucleotide (32)P-postlabeling assay analysis of brain samples from rats of both strains yielded no evidence of acrylonitrile DNA adducts. Negative conventional comet assay results indicate the absence of direct DNA strand breaks in the brain and Zymbal's gland in both strains of rats dosed with acrylonitrile. In both rat strains, positive results in an enhanced comet assay were found only in brain samples digested with formamidopyrimidine-DNA glycosylase but not with human 8-hydroxyguanine-DNA glycosylase, indicating possible oxidative DNA damage, other than 8-oxodG formation. In conclusion, definitive evidence of DNA binding of acrylonitrile in the brain and Zymbal's gland was not obtained under the test conditions. A role for oxidative stress in tumorigenesis in the brain but not Zymbal's gland may exist.

  1. Oxidative DNA adducts and DNA-protein cross-links are the major DNA lesions induced by arsenite.

    PubMed Central

    Bau, Da-Tian; Wang, Tsu-Shing; Chung, Chiao-Hui; Wang, Alexander S S; Wang, Alexander S S; Jan, Kun-Yan

    2002-01-01

    Arsenic is recognized to be a nonmutagenic carcinogen because it induces DNA damage only at very high concentrations. However, many more DNA strand breaks could be detected by digesting the DNA of arsenite-treated cells with endonuclease III, formamidopyrimidine-DNA glycosylase, and proteinase K. By doing so, arsenite could be shown to induce DNA damage in human cells within a pathologically meaningful concentration range. Oxidized guanine products were detected in all arsenite-treated human cells examined. DNA-protein cross-links were also detected in arsenite-treated NB4 and HL60 cells. In human umbilical vein endothelial cells, the induction of oxidized guanine products by arsenite was sensitive to inhibitors of nitric oxide (NO) synthase but not to oxidant modulators, whereas the opposite result was obtained in vascular smooth muscle cells. On the other hand, the arsenite-induced oxidized guanine products and DNA-protein cross-links in NB4 and HL60 cells were sensitive to modulators of calcium, NO synthase, oxidant, and myeloperoxidase. Therefore, although oxidized guanine products were detected in all the human cells treated with arsenite, the pathways could be different in different cell types. Because the sensitivity and the mechanism of arsenic intoxication are cell specific, it is important that target tissues and target cells are used for investigations. It is also important that pathologically or pharmacologically meaningful concentrations of arsenic are used. This is because in most cases we are dealing with the chronic effect rather than acute toxicity. PMID:12426126

  2. Repair of oxidative DNA base damage in the host genome influences the HIV integration site sequence preference.

    PubMed

    Bennett, Geoffrey R; Peters, Ryan; Wang, Xiao-hong; Hanne, Jeungphill; Sobol, Robert W; Bundschuh, Ralf; Fishel, Richard; Yoder, Kristine E

    2014-01-01

    Host base excision repair (BER) proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1) and mutY homolog (MYH) as well as DNA polymerase beta (Polβ). While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.

  3. Impact of ribonucleotide incorporation by DNA polymerases β and λ on oxidative base excision repair

    PubMed Central

    Crespan, Emmanuele; Furrer, Antonia; Rösinger, Marcel; Bertoletti, Federica; Mentegari, Elisa; Chiapparini, Giulia; Imhof, Ralph; Ziegler, Nathalie; Sturla, Shana J.; Hübscher, Ulrich; van Loon, Barbara; Maga, Giovanni

    2016-01-01

    Oxidative stress is a very frequent source of DNA damage. Many cellular DNA polymerases (Pols) can incorporate ribonucleotides (rNMPs) during DNA synthesis. However, whether oxidative stress-triggered DNA repair synthesis contributes to genomic rNMPs incorporation is so far not fully understood. Human specialized Pols β and λ are the important enzymes involved in the oxidative stress tolerance, acting both in base excision repair and in translesion synthesis past the very frequent oxidative lesion 7,8-dihydro-8-oxoguanine (8-oxo-G). We found that Pol β, to a greater extent than Pol λ can incorporate rNMPs opposite normal bases or 8-oxo-G, and with a different fidelity. Further, the incorporation of rNMPs opposite 8-oxo-G delays repair by DNA glycosylases. Studies in Pol β- and λ-deficient cell extracts suggest that Pol β levels can greatly affect rNMP incorporation opposite oxidative DNA lesions. PMID:26917111

  4. Using Arabidopsis cell extracts to monitor repair of DNA base damage in vitro.

    PubMed

    Córdoba-Cañero, Dolores; Roldán-Arjona, Teresa; Ariza, Rafael R

    2012-01-01

    Base excision repair (BER) is a major pathway for the removal of endogenous and exogenous DNA damage. This repair mechanism is initiated by DNA glycosylases that excise the altered base, and continues through alternative routes that culminate in DNA resynthesis and ligation. In contrast to the information available for microbes and animals, our knowledge about this important DNA repair pathway in plants is very limited, partially due to a lack of biochemical approaches. Here we describe an in vitro assay to monitor BER in cell-free extracts from the model plant Arabidopsis thaliana. The assay uses labeled DNA substrates containing a single damaged base within a restriction site, and allows detection of fully repaired molecules as well as DNA repair intermediates. The method is easily applied to measure the repair activity of purified proteins and can be successfully used in combination with the extensive array of biological resources available for Arabidopsis.

  5. Single-molecule visualization of ROS-induced DNA damage in large DNA molecules.

    PubMed

    Lee, Jinyong; Kim, Yongkyun; Lim, Sangyong; Jo, Kyubong

    2016-02-07

    We present a single molecule visualization approach for the quantitative analysis of reactive oxygen species (ROS) induced DNA damage, such as base oxidation and single stranded breaks in large DNA molecules. We utilized the Fenton reaction to generate DNA damage with subsequent enzymatic treatment using a mixture of three types of glycosylases to remove oxidized bases, and then fluorescent labeling on damaged lesions via nick translation. This single molecule analytical platform provided the capability to count one or two damaged sites per λ DNA molecule (48.5 kb), which were reliably dependent on the concentrations of hydrogen peroxide and ferrous ion at the micromolar level. More importantly, the labeled damaged sites that were visualized under a microscope provided positional information, which offered the capability of comparing DNA damaged sites with the in silico genomic map to reveal sequence specificity that GTGR is more sensitive to oxidative damage. Consequently, single DNA molecule analysis provides a sensitive analytical platform for ROS-induced DNA damage and suggests an interesting biochemical insight that the genome primarily active during the lysogenic cycle may have less probability for oxidative DNA damage.

  6. OGG1-DNA interactions facilitate NF-κB binding to DNA targets

    PubMed Central

    Pan, Lang; Hao, Wenjing; Zheng, Xu; Zeng, Xianlu; Ahmed Abbasi, Adeel; Boldogh, Istvan; Ba, Xueqing

    2017-01-01

    DNA repair protein counteracting oxidative promoter lesions may modulate gene expression. Oxidative DNA bases modified by reactive oxygen species (ROS), primarily as 7, 8-dihydro-8-oxo-2′-deoxyguanosine (8-oxoG), which is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair (BER) pathway. Because cellular response to oxidative challenge is accompanied by DNA damage repair, we tested whether the repair by OGG1 is compatible with transcription factor binding and gene expression. We performed electrophoretic mobility shift assay (EMSA) using wild-type sequence deriving from Cxcl2 gene promoter and the same sequence bearing a single synthetic 8-oxoG at defined 5′ or 3′ guanine in runs of guanines to mimic oxidative effects. We showed that DNA occupancy of NF-κB present in nuclear extracts from tumour necrosis factor alpha (TNFα) exposed cells is OGG1 and 8-oxoG position dependent, importantly, OGG1 counteracting 8-oxoG outside consensus motif had a profound influence on purified NF-κB binding to DNA. Furthermore, OGG1 is essential for NF-κB dependent gene expression, prior to 8-oxoG excised from DNA. These observations imply that pre-excision step(s) during OGG1 initiated BER evoked by ROS facilitates NF-κB DNA occupancy and gene expression. PMID:28266569

  7. Human AP Endonuclease I Stimulates Multiple-Turnover Base Excision by Alkyladenine DNA Glycosylase†

    PubMed Central

    Baldwin, Michael R.; O’Brien, Patrick J.

    2009-01-01

    Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of damaged purine bases from DNA, including hypoxanthine that is formed by the oxidative deamination of adenine. We used steady state, pre-steady state, and single-turnover kinetic assays to show that the multiple-turnover excision of hypoxanthine in vitro is limited by release of the abasic DNA product. This suggests the possibility that the product release step is regulated in vivo by interactions with other base excision repair (BER) proteins. Such coordination of BER activities would protect the abasic DNA repair intermediate and ensure its correct processing. AP endonuclease 1 (APE1) is the predominant enzyme for processing abasic DNA sites in human cells. Therefore, we have investigated the functional effects of added APE1 on the base excision activity of AAG. We find that APE1 stimulates the multiple-turnover excision of hypoxanthine by AAG, but has no effect on single-turnover excision. Since the amino terminus of AAG has been implicated in other protein-protein interactions we also characterize the deletion mutant lacking the first 79 amino acids. We find that APE1 fully stimulates the multiple-turnover glycosylase activity of this mutant, demonstrating that the amino terminus of AAG is not strictly required for this functional interaction. These results are consistent with a model whereby APE1 displaces AAG from the abasic site, thereby coordinating the first two steps of the base excision repair pathway. PMID:19449863

  8. Molecular pathophysiology of impaired glucose metabolism, mitochondrial dysfunction, and oxidative DNA damage in Alzheimer's disease brain.

    PubMed

    Abolhassani, Nona; Leon, Julio; Sheng, Zijing; Oka, Sugako; Hamasaki, Hideomi; Iwaki, Toru; Nakabeppu, Yusaku

    2017-01-01

    In normal brain, neurons in the cortex and hippocampus produce insulin, which modulates glucose metabolism and cognitive functions. It has been shown that insulin resistance impairs glucose metabolism and mitochondrial function, thus increasing production of reactive oxygen species. Recent progress in Alzheimer's disease (AD) research revealed that insulin production and signaling are severely impaired in AD brain, thereby resulting in mitochondrial dysfunction and increased oxidative stress. Among possible oxidative DNA lesions, 8-oxoguanine (8-oxoG) is highly accumulated in the brain of AD patients. Previously we have shown that incorporating 8-oxoG in nuclear and mitochondrial DNA promotes MUTYH (adenine DNA glycosylase) dependent neurodegeneration. Moreover, cortical neurons prepared from MTH1 (8-oxo-dGTPase)/OGG1 (8-oxoG DNA glycosylase)-double deficient adult mouse brains is shown to exhibit significantly poor neuritogenesis in vitro with increased 8-oxoG accumulation in mitochondrial DNA in the absence of antioxidants. Therefore, 8-oxoG can be considered involved in the neurodegenerative process in AD brain. In mild cognitive impairment, mitochondrial dysfunction and oxidative damage may induce synaptic dysfunction due to energy failures in neurons thus resulting in impaired cognitive function. If such abnormality lasts long, it can lead to vicious cycles of oxidative damage, which may then trigger the neurodegenerative process seen in Alzheimer type dementia. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. The elemental role of iron in DNA synthesis and repair.

    PubMed

    Puig, Sergi; Ramos-Alonso, Lucía; Romero, Antonia María; Martínez-Pastor, María Teresa

    2017-09-07

    Iron is an essential redox element that functions as a cofactor in many metabolic pathways. Critical enzymes in DNA metabolism, including multiple DNA repair enzymes (helicases, nucleases, glycosylases, demethylases) and ribonucleotide reductase, use iron as an indispensable cofactor to function. Recent striking results have revealed that the catalytic subunit of DNA polymerases also contains conserved cysteine-rich motifs that bind iron-sulfur (Fe/S) clusters that are essential for the formation of stable and active complexes. In line with this, mitochondrial and cytoplasmic defects in Fe/S cluster biogenesis and insertion into the nuclear iron-requiring enzymes involved in DNA synthesis and repair lead to DNA damage and genome instability. Recent studies have shown that yeast cells possess multi-layered mechanisms that regulate the ribonucleotide reductase function in response to fluctuations in iron bioavailability to maintain optimal deoxyribonucleotide concentrations. Finally, a fascinating DNA charge transport model indicates how the redox active Fe/S centers present in DNA repair machinery components are critical for detecting and repairing DNA mismatches along the genome by long-range charge transfers through double-stranded DNA. These unexpected connections between iron and DNA replication and repair have to be considered to properly understand cancer, aging and other DNA-related diseases.

  10. [Ionizing radiation-induced DNA damage and its repair in human cells]. Progress report, [April 1, 1993--February 28, 1994

    SciTech Connect

    Not Available

    1994-07-01

    The excision of radiation-induced lesions in DNA by a DNA repair enzyme complex, namely the UvrABC nuclease complex, has been investigated. Irradiated DNA was treated with the enzyme complex. DNA fractions were analyzed by gas chromatography/isotope-dilution mass spectrometry. The results showed that a number pyrimidine- and purine-derived lesions in DNA were excised by the UvrABC nuclease complex and that the enzyme complex does not act on radiation-induced DNA lesions as a glycosylase. This means that it does not excise individual base products, but it excises oligomers containing these lesions. A number of pyrimidine-derived lesions that were no substrates for other DNA repair enzymes investigated in our laboratory were substrates for the UvrABC nuclease complex.

  11. CUX2 protein functions as an accessory factor in the repair of oxidative DNA damage.

    PubMed

    Pal, Ranjana; Ramdzan, Zubaidah M; Kaur, Simran; Duquette, Philippe M; Marcotte, Richard; Leduy, Lam; Davoudi, Sayeh; Lamarche-Vane, Nathalie; Iulianella, Angelo; Nepveu, Alain

    2015-09-11

    CUX1 and CUX2 proteins are characterized by the presence of three highly similar regions called Cut repeats 1, 2, and 3. Although CUX1 is ubiquitously expressed, CUX2 plays an important role in the specification of neuronal cells and continues to be expressed in postmitotic neurons. Cut repeats from the CUX1 protein were recently shown to stimulate 8-oxoguanine DNA glycosylase 1 (OGG1), an enzyme that removes oxidized purines from DNA and introduces a single strand break through its apurinic/apyrimidinic lyase activity to initiate base excision repair. Here, we investigated whether CUX2 plays a similar role in the repair of oxidative DNA damage. Cux2 knockdown in embryonic cortical neurons increased levels of oxidative DNA damage. In vitro, Cut repeats from CUX2 increased the binding of OGG1 to 7,8-dihydro-8-oxoguanine-containing DNA and stimulated both the glycosylase and apurinic/apyrimidinic lyase activities of OGG1. Genetic inactivation in mouse embryo fibroblasts or CUX2 knockdown in HCC38 cells delayed DNA repair and increased DNA damage. Conversely, ectopic expression of Cut repeats from CUX2 accelerated DNA repair and reduced levels of oxidative DNA damage. These results demonstrate that CUX2 functions as an accessory factor that stimulates the repair of oxidative DNA damage. Neurons produce a high level of reactive oxygen species because of their dependence on aerobic oxidation of glucose as their source of energy. Our results suggest that the persistent expression of CUX2 in postmitotic neurons contributes to the maintenance of genome integrity through its stimulation of oxidative DNA damage repair. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. The effect of Pot1 binding on the repair of thymine analogs in a telomeric DNA sequence.

    PubMed

    Theruvathu, Jacob A; Darwanto, Agus; Hsu, Chia Wei; Sowers, Lawrence C

    2014-08-01

    Telomeric DNA can form duplex regions or single-stranded loops that bind multiple proteins, preventing it from being processed as a DNA repair intermediate. The bases within these regions are susceptible to damage; however, mechanisms for the repair of telomere damage are as yet poorly understood. We have examined the effect of three thymine (T) analogs including uracil (U), 5-fluorouracil (5FU) and 5-hydroxymethyluracil (5hmU) on DNA-protein interactions and DNA repair within the GGTTAC telomeric sequence. The replacement of T with U or 5FU interferes with Pot1 (Pot1pN protein of Schizosaccharomyces pombe) binding. Surprisingly, 5hmU substitution only modestly diminishes Pot1 binding suggesting that hydrophobicity of the T-methyl group likely plays a minor role in protein binding. In the GGTTAC sequence, all three analogs can be cleaved by DNA glycosylases; however, glycosylase activity is blocked if Pot1 binds. An abasic site at the G or T positions is cleaved by the endonuclease APE1 when in a duplex but not when single-stranded. Abasic site formation thermally destabilizes the duplex that could push a damaged DNA segment into a single-stranded loop. The inability to enzymatically cleave abasic sites in single-stranded telomere regions would block completion of the base excision repair cycle potentially causing telomere attrition.

  13. Study of DNA damage via the comet assay and base excision repair activities in rat brain neurons and astrocytes during aging.

    PubMed

    Swain, Umakanta; Subba Rao, Kalluri

    2011-08-01

    Earlier we have used biochemical approach to assess the number of single (SSBs) and double (DSBs) strand breaks in brain cellular DNA. However, a quick method to obtain a reliable measure of DNA damage in cells was in need for population studies. Therefore, single cell gel electrophoresis technique (popularly known as "comet" assay) has been standardized using the Trevigen protocol. DNA damage was assessed in isolated neurons and astrocytes from the cortex of young (7 days), adult (6 months) and old (2 years). Marked increase is seen in DNA damage in terms SSBs and DSBs in both types of cells by 6 months of age, which increased further by 2 years of age. The number of 8-oxoguanine DNA glycosylase (OGG1) and uracil DNA glycosylase (UDG) sensitive sites also increased in DNA with age with the simultaneous decrease in OGG1, UDG and AP endonuclease (APE1) activities. Thus the comet assay adapted to our lab conditions has proven to be useful for a quick assessment of DNA damage in a large number of samples that constitute our future studies.

  14. Fluorogenic DNA ligase and base excision repair enzyme assays using substrates labeled with single fluorophores.

    PubMed

    Nikiforov, Theo T; Roman, Steven

    2015-05-15

    Continuing our work on fluorogenic substrates labeled with single fluorophores for nucleic acid modifying enzymes, here we describe the development of such substrates for DNA ligases and some base excision repair enzymes. These substrates are hairpin-type synthetic DNA molecules with a single fluorophore located on a base close to the 3' ends, an arrangement that results in strong fluorescence quenching. When such substrates are subjected to an enzymatic reaction, the position of the dyes relative to that end of the molecules is altered, resulting in significant fluorescence intensity changes. The ligase substrates described here were 5' phosphorylated and either blunt-ended or carrying short, self-complementary single-stranded 5' extensions. The ligation reactions resulted in the covalent joining of the ends of the molecules, decreasing the quenching effect of the terminal bases on the dyes. To generate fluorogenic substrates for the base excision repair enzymes formamido-pyrimidine-DNA glycosylase (FPG), human 8-oxo-G DNA glycosylase/AP lyase (hOGG1), endonuclease IV (EndoIV), and apurinic/apyrimidinic endonuclease (APE1), we introduced abasic sites or a modified nucleotide, 8-oxo-dG, at such positions that their enzymatic excision would result in the release of a short fluorescent fragment. This was also accompanied by strong fluorescence increases. Overall fluorescence changes ranged from approximately 4-fold (ligase reactions) to more than 20-fold (base excision repair reactions).

  15. Enzymatic DNA oxidation: mechanisms and biological significance.

    PubMed

    Xu, Guo-Liang; Walsh, Colum P

    2014-11-01

    DNA methylation at cytosines (5mC) is a major epigenetic modification involved in the regulation of multiple biological processes in mammals. How methylation is reversed was until recently poorly understood. The family of dioxygenases commonly known as Ten-eleven translocation (Tet) proteins are responsible for the oxidation of 5mC into three new forms, 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC). Current models link Tet-mediated 5mC oxidation with active DNA demethylation. The higher oxidation products (5fC and 5caC) are recognized and excised by the DNA glycosylase TDG via the base excision repair pathway. Like DNA methyltransferases, Tet enzymes are important for embryonic development. We will examine the mechanism and biological significance of Tet-mediated 5mC oxidation in the context of pronuclear DNA demethylation in mouse early embryos. In contrast to its role in active demethylation in the germ cells and early embryo, a number of lines of evidence suggest that the intragenic 5hmC present in brain may act as a stable mark instead. This short review explores mechanistic aspects of TET oxidation activity, the impact Tet enzymes have on epigenome organization and their contribution to the regulation of early embryonic and neuronal development.

  16. Quantitative and qualitative analysis of DNA methylation at N3-adenine by N-methyl-N-nitrosourea.

    PubMed

    Kelly, J D; Shah, D; Chen, F X; Wurdeman, R; Gold, B

    1998-12-01

    The sequence-specific alkylation of DNA by N-methyl-N-nitrosourea (MNU) has been demonstrated for the minor groove N3-methyladenine (N3-MeAde) adduct using neutral thermal hydrolysis and polyacrylamide sequencing gels. The ratio of relative yields of N7- and N3-MeAde and N7-methylguanine (N7-MeGua) is approximately 0.03:0. 15:1.00, respectively, on the basis of the gel data, and these values are comparable to relative yields determined by bulk digestion of MNU-methylated DNA when HPLC was used to analyze the individual adducts. In contrast to the methylation at N7-guanine (N7-Gua) by MNU, alkylation at Ade shows minimal sequence selectivity. Similar to the methylation at N7-Gua, formation of N3-MeAde by MNU is inhibited by 50-200 mM concentrations of NaCl and DNA binding cations, including distamycin and spermine. However, N3-MeAde formation at Ade residues within methidiumpropyl-EDTA-Fe(II) footprinted distamycin DNA affinity binding regions is selectively inhibited at low concentrations of distamycin relative to Ade sites outside of ligand binding regions, and N7-Gua within or outside the distamycin binding regions. HPLC analysis shows that distamycin also quantitatively inhibits the production of N3-methylguanine when calf thymus DNA is treated with MNU or methyl methanesulfonate. The specific inhibitory effect of distamycin, which binds in the minor groove at Ade/Thy-rich sequences, provides additional evidence that the predominant DNA lesion detected at Ade by sequencing gel analysis involves minor groove N3-MeAde modifications.

  17. Inhibition of autophagy enhances DNA damage-induced apoptosis by disrupting CHK1-dependent S phase arrest

    SciTech Connect

    Liou, Jong-Shian; Wu, Yi-Chen; Yen, Wen-Yen; Tang, Yu-Shuan; Kakadiya, Rajesh B.; Su, Tsann-Long; Yih, Ling-Huei

    2014-08-01

    DNA damage has been shown to induce autophagy, but the role of autophagy in the DNA damage response and cell fate is not fully understood. BO-1012, a bifunctional alkylating derivative of 3a-aza-cyclopenta[a]indene, is a potent DNA interstrand cross-linking agent with anticancer activity. In this study, BO-1012 was found to reduce DNA synthesis, inhibit S phase progression, and induce phosphorylation of histone H2AX on serine 139 (γH2AX) exclusively in S phase cells. Both CHK1 and CHK2 were phosphorylated in response to BO-1012 treatment, but only depletion of CHK1, but not CHK2, impaired BO-1012-induced S phase arrest and facilitated the entry of γH2AX-positive cells into G2 phase. CHK1 depletion also significantly enhanced BO-1012-induced cell death and apoptosis. These results indicate that BO-1012-induced S phase arrest is a CHK1-dependent pro-survival response. BO-1012 also resulted in marked induction of acidic vesicular organelle (AVO) formation and microtubule-associated protein 1 light chain 3 (LC3) processing and redistribution, features characteristic of autophagy. Depletion of ATG7 or co-treatment of cells with BO-1012 and either 3-methyladenine or bafilomycin A1, two inhibitors of autophagy, not only reduced CHK1 phosphorylation and disrupted S phase arrest, but also increased cleavage of caspase-9 and PARP, and cell death. These results suggest that cells initiate S phase arrest and autophagy as pro-survival responses to BO-1012-induced DNA damage, and that suppression of autophagy enhances BO-1012-induced apoptosis via disruption of CHK1-dependent S phase arrest. - Highlights: • Autophagy inhibitors enhanced the cytotoxicity of a DNA alkylating agent, BO-1012. • BO-1012-induced S phase arrest was a CHK1-dependent pro-survival response. • Autophagy inhibition enhanced BO-1012 cytotoxicity via disrupting the S phase arrest.

  18. Turn-on DNA Damage Sensors for the Direct Detection of 8-Oxoguanine and Photoproducts in Native DNA

    PubMed Central

    Furman, Jennifer L.; Mok, Pui-Wing; Badran, Ahmed H.; Ghosh, Indraneel

    2011-01-01

    The integrity of the genetic information in all living organisms is constantly threatened by a variety of endogenous and environmental insults. To counter this risk, the DNA-damage response is employed for repairing lesions and maintaining genomic integrity. However, an aberrant DNA-damage response can potentially lead to genetic instability and mutagenesis, carcinogenesis, or cell death. To directly monitor DNA damage events in the context of native DNA, we have designed two new sensors utilizing genetically fragmented firefly luciferase (split luciferase). The sensors are comprised of a methyl-CpG binding domain (MBD) attached to one fragment of split luciferase for localizing the sensor to DNA (50–80% of the CpG dinucleotide sites in the genome are symmetrically methylated at cytosines), while a damage-recognition domain is attached to the complementary fragment of luciferase to probe adjacent nucleotides for lesions. Specifically, we utilized oxoguanine glycosylase 1 (OGG1) to detect 8-oxoguanine caused by exposure to reactive oxygen species and employed the damaged-DNA binding protein 2 (DDB2) for detection of pyrimidine dimer photoproducts induced by UVC light. These two sensors were optimized and validated using oligonucleotides, plasmids, and mammalian genomic DNA, as well as HeLa cells that were systematically exposed to a variety of environmental insults, demonstrating that this methodology utilizing MBD-directed DNA localization provides a simple, sensitive, and potentially general approach for the rapid profiling of specific chemical modifications associated with DNA damage and repair. PMID:21520929

  19. Guanine oxidation product 5-carboxamido-5-formamido-2-iminohydantoin induces mutations when bypassed by DNA polymerases and is a substrate for base excision repair.

    PubMed

    Alshykhly, Omar R; Fleming, Aaron M; Burrows, Cynthia J

    2015-09-21

    Guanine (G) is a target for oxidation by reactive oxygen species in DNA, RNA, and the nucleotide pool. Damage to DNA yields products with alternative properties toward DNA processing enzymes compared to those of the parent nucleotide. A new lesion, 5-carboxamido-5-formamido-2-iminohydantoin (2Ih), bearing a stereocenter in the base was recently identified from the oxidation of G. DNA polymerase and base excision repair processing of this new lesion has now been evaluated. Single nucleotide insertion opposite (S)-2Ih and (R)-2Ih in the template strand catalyzed by the DNA polymerases Klenow fragment exo(-), DPO4, and Hemo KlenTaq demonstrates these lesions to cause point mutations. Specifically, they promote 3-fold more G·C → C·G transversion mutations than G·C → T·A, and (S)-2Ih was 2-fold more blocking for polymerase bypass than (R)-2Ih. Both diastereomer lesions were found to be substrates for the DNA glycosylases NEIL1 and Fpg, and poorly excised by endonuclease III (Nth). The activity was independent of the base pair partner. Thermal melting, CD spectroscopy, and density functional theory geometric optimization calculations were conducted to provide insight into these polymerase and DNA glycosylase studies. These results identify that formation of the 2Ih lesions in a cell would be mutagenic in the event that they were not properly repaired.

  20. Natural history of eukaryotic DNA methylation systems.

    PubMed

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2011-01-01

    Methylation of cytosines and adenines in DNA is a widespread epigenetic mark in both prokaryotes and eukaryotes. In eukaryotes, it has a profound influence on chromatin structure and dynamics. Recent advances in genomics and biochemistry have considerably elucidated the functions and provenance of these DNA modifications. DNA methylases appear to have emerged first in bacterial restriction-modification (R-M) systems from ancient RNA-modifying enzymes, in transitions that involved acquisition of novel catalytic residues and DNA-recognition features. DNA adenine methylases appear to have been acquired by ciliates, heterolobosean amoeboflagellates, and certain chlorophyte algae. Six distinct clades of cytosine methylases, including the DNMT1, DNMT2, and DNMT3 clades, were acquired by eukaryotes through independent lateral transfer of their precursors from bacteria or bacteriophages. In addition to these, multiple adenine and cytosine methylases were acquired by several families of eukaryotic transposons. In eukaryotes, the DNA-methylase module was often combined with distinct modified and unmodified peptide recognition domains and other modules mediating specialized interactions, for example, the RFD module of DNMT1 which contains a permuted Sm domain linked to a helix-turn-helix domain. In eukaryotes, the evolution of DNA methylases appears to have proceeded in parallel to the elaboration of histone-modifying enzymes and the RNAi system, with functions related to counter-viral and counter-transposon defense, and regulation of DNA repair and differential gene expression being their primary ancestral functions. Diverse DNA demethylation systems that utilize base-excision repair via DNA glycosylases and cytosine deaminases appear to have emerged in multiple eukaryotic lineages. Comparative genomics suggests that the link between cytosine methylation and DNA glycosylases probably emerged first in a novel R-M system in bacteria. Recent studies suggest that the 5mC is not

  1. Regulation of DNA repair in serum-stimulated xeroderma pigmentosum cells

    PubMed Central

    1984-01-01

    The regulation of DNA repair during serum stimulation of quiescent cells was examined in normal human cells, in fibroblasts from three xeroderma pigmentosum complementation groups (A, C, and D), in xeroderma pigmentosum variant cells, and in ataxia telangiectasia cells. The regulation of nucleotide excision repair was examined by exposing cells to ultraviolet irradiation at discrete intervals after cell stimulation. Similarly, base excision repair was quantitated after exposure to methylmethane sulfonate. WI-38 normal human diploid fibroblasts, xeroderma pigmentosum variant cells, as well as ataxia telangiectasia cells enhanced their capacity for both nucleotide excision repair and for base excision repair prior to their enhancement of DNA synthesis. Further, in each cell strain, the base excision repair enzyme uracil DNA glycosylase was increased prior to the induction of DNA polymerase using the identical cells to quantitate each activity. In contrast, each of the three xeroderma complementation groups that were examined failed to increase their capacity for nucleotide excision repair above basal levels at any interval examined. This result was observed using either unscheduled DNA synthesis in the presence of 10 mM hydroxyurea or using repair replication in the absence of hydroxyurea to quantitate DNA repair. However, each of the three complementation groups normally regulated the enhancement of base excision repair after methylmethane sulfonate exposure and each induced the uracil DNA glycosylase prior to DNA synthesis. These results suggest that there may be a relationship between the sensitivity of xeroderma pigmentosum cells from each complementation group to specific DNA damaging agents and their inability to regulate nucleotide excision repair during cell stimulation. PMID:6480691

  2. Inhibition of autophagy enhances DNA damage-induced apoptosis by disrupting CHK1-dependent S phase arrest.

    PubMed

    Liou, Jong-Shian; Wu, Yi-Chen; Yen, Wen-Yen; Tang, Yu-Shuan; Kakadiya, Rajesh B; Su, Tsann-Long; Yih, Ling-Huei

    2014-08-01

    DNA damage has been shown to induce autophagy, but the role of autophagy in the DNA damage response and cell fate is not fully understood. BO-1012, a bifunctional alkylating derivative of 3a-aza-cyclopenta[a]indene, is a potent DNA interstrand cross-linking agent with anticancer activity. In this study, BO-1012 was found to reduce DNA synthesis, inhibit S phase progression, and induce phosphorylation of histone H2AX on serine 139 (γH2AX) exclusively in S phase cells. Both CHK1 and CHK2 were phosphorylated in response to BO-1012 treatment, but only depletion of CHK1, but not CHK2, impaired BO-1012-induced S phase arrest and facilitated the entry of γH2AX-positive cells into G2 phase. CHK1 depletion also significantly enhanced BO-1012-induced cell death and apoptosis. These results indicate that BO-1012-induced S phase arrest is a CHK1-dependent pro-survival response. BO-1012 also resulted in marked induction of acidic vesicular organelle (AVO) formation and microtubule-associated protein 1 light chain 3 (LC3) processing and redistribution, features characteristic of autophagy. Depletion of ATG7 or co-treatment of cells with BO-1012 and either 3-methyladenine or bafilomycin A1, two inhibitors of autophagy, not only reduced CHK1 phosphorylation and disrupted S phase arrest, but also increased cleavage of caspase-9 and PARP, and cell death. These results suggest that cells initiate S phase arrest and autophagy as pro-survival responses to BO-1012-induced DNA damage, and that suppression of autophagy enhances BO-1012-induced apoptosis via disruption of CHK1-dependent S phase arrest.

  3. Repair of DNA-containing pyrimidine dimers

    SciTech Connect

    Grossman, L.; Caron, P.R.; Mazur, S.J.; Oh, E.Y.

    1988-08-01

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references.

  4. Selenium-Mediated Dehalogenation of Halogenated Nucleosides and its Relevance to the DNA Repair Pathway.

    PubMed

    Mondal, Santanu; Manna, Debasish; Mugesh, Govindasamy

    2015-08-03

    Halogenated nucleosides can be incorporated into the newly synthesized DNA of replicating cells and therefore are commonly used in the detection of proliferating cells in living tissues. Dehalogenation of these modified nucleosides is one of the key pathways involved in DNA repair mediated by the uracil-DNA glycosylase. Herein, we report the first example of a selenium-mediated dehalogenation of halogenated nucleosides. We also show that the mechanism for the debromination is remarkably different from that of deiodination and that the presence of a ribose or deoxyribose moiety in the nucleosides facilitates the deiodination. The results described herein should help in understanding the metabolism of halogenated nucleosides in DNA and RNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Enzymatic Capture of an Extrahelical Thymine in the Search for Uracil in DNA

    SciTech Connect

    Parker,J.; Bianchet, M.; Krosky, D.; Friedman, J.; Amzel, L.; Stivers, J.

    2007-01-01

    The enzyme uracil DNA glycosylase (UNG) excises unwanted uracil bases in the genome using an extrahelical base recognition mechanism. Efficient removal of uracil is essential for prevention of C-to-T transition mutations arising from cytosine deamination, cytotoxic U{single_bond}A pairs arising from incorporation of dUTP in DNA, and for increasing immunoglobulin gene diversity during the acquired immune response. A central event in all of these UNG-mediated processes is the singling out of rare U{single_bond}A or U{single_bond}G base pairs in a background of approximately 109 T{single_bond}A or C{single_bond}G base pairs in the human genome. Here we establish for the human and Escherichia coli enzymes that discrimination of thymine and uracil is initiated by thermally induced opening of T{single_bond}A and U{single_bond}A base pairs and not by active participation of the enzyme. Thus, base-pair dynamics has a critical role in the genome-wide search for uracil, and may be involved in initial damage recognition by other DNA repair glycosylases.

  6. Acrylonitrile-induced oxidative DNA damage in rat astrocytes.

    PubMed

    Pu, Xinzhu; Kamendulis, Lisa M; Klaunig, James E

    2006-10-01

    Chronic administration of acrylonitrile results in a dose-related increase in astrocytomas in rat brain, but the mechanism of acrylonitrile carcinogenicity is not fully understood. The potential of acrylonitrile or its metabolites to induce direct DNA damage as a mechanism for acrylonitrile carcinogenicity has been questioned, and recent studies indicate that the mechanism involves the induction of oxidative stress in rat brain. The present study examined the ability of acrylonitrile to induce DNA damage in the DI TNC1 rat astrocyte cell line using the alkaline Comet assay. Oxidized DNA damage also was evaluated using formamidopyrimidine DNA glycosylase treatment in the modified Comet assay. No increase in direct DNA damage was seen in astrocytes exposed to sublethal concentrations of acrylonitrile (0-1.0 mM) for 24 hr. However, acrylonitrile treatment resulted in a concentration-related increase in oxidative DNA damage after 24 hr. Antioxidant supplementation in the culture media (alpha-tocopherol, (-)-epigallocathechin-3 gallate, or trolox) reduced acrylonitrile-induced oxidative DNA damage. Depletion of glutathione using 0.1 mM DL-buthionine-[S,R]-sulfoximine increased acrylonitrile-induced oxidative DNA damage (22-46%), while cotreatment of acrylonitrile with 2.5 mM L-2-oxothiazolidine-4-carboxylic acid, a precursor for glutathione biosynthesis, significantly reduced acrylonitrile-induced oxidative DNA damage (7-47%). Cotreatment of acrylonitrile with 0.5 mM 1-aminobenzotriazole, a suicidal inhibitor of cytochrome P450, prevented the oxidative DNA damage produced by acrylonitrile. Cyanide (0.1-0.5 mM) increased oxidative DNA damage (44-160%) in astrocytes. These studies demonstrate that while acrylonitrile does not directly damage astrocyte DNA, it does increase oxidative DNA damage. The oxidative DNA damage following acrylonitrile exposure appears to arise mainly through the P450 metabolic pathway; moreover, glutathione depletion may contribute to the

  7. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.

    PubMed

    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A

    2013-09-01

    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity.

  8. Minimal role of base excision repair in TET-induced global DNA demethylation in HEK293T cells

    PubMed Central

    Jin, Chunlei; Qin, Taichun; Barton, Michelle Craig; Jelinek, Jaroslav; Issa, Jean-Pierre J

    2015-01-01

    Oxidation of 5-methylcytosine by TET family proteins can induce DNA replication-dependent (passive) DNA demethylation and base excision repair (BER)-based (active) DNA demethylation. The balance of active vs. passive TET-induced demethylation remains incompletely determined. In the context of large scale DNA demethylation, active demethylation may require massive induction of the DNA repair machinery and thus compromise genome stability. To study this issue, we constructed a tetracycline-controlled TET-induced global DNA demethylation system in HEK293T cells. Upon TET overexpression, we observed induction of DNA damage and activation of a DNA damage response; however, BER genes are not upregulated to promote DNA repair. Depletion of TDG (thymine DNA glycosylase) or APEX1 (apurinic/apyrimidinic endonuclease 1), two key BER enzymes, enhances rather than impairs global DNA demethylation, which can be explained by stimulated proliferation. By contrast, growth arrest dramatically blocks TET-induced global DNA demethylation. Thus, in the context of TET-induction in HEK293T cells, the DNA replication-dependent passive mechanism functions as the predominant pathway for global DNA demethylation. In the same context, BER-based active demethylation is markedly restricted by limited BER upregulation, thus potentially preventing a disastrous DNA damage response to extensive active DNA demethylation. PMID:26440216

  9. Characterization of DNA with an 8-oxoguanine modification.

    PubMed

    Singh, Sreelekha K; Szulik, Marta W; Ganguly, Manjori; Khutsishvili, Irine; Stone, Michael P; Marky, Luis A; Gold, Barry

    2011-08-01

    The oxidation of DNA resulting from reactive oxygen species generated during aerobic respiration is a major cause of genetic damage that, if not repaired, can lead to mutations and potentially an increase in the incidence of cancer and aging. A major oxidation product generated in cells is 8-oxoguanine (oxoG), which is removed from the nucleotide pool by the enzymatic hydrolysis of 8-oxo-2'-deoxyguanosine triphosphate and from genomic DNA by 8-oxoguanine-DNA glycosylase. Finding and repairing oxoG in the midst of a large excess of unmodified DNA requires a combination of rapid scanning of the DNA for the lesion followed by specific excision of the damaged base. The repair of oxoG involves flipping the lesion out of the DNA stack and into the active site of the 8-oxoguanine-DNA glycosylase. This would suggest that thermodynamic stability, in terms of the rate for local denaturation, could play a role in lesion recognition. While prior X-ray crystal and NMR structures show that DNA with oxoG lesions appears virtually identical to the corresponding unmodified duplex, thermodynamic studies indicate that oxoG has a destabilizing influence. Our studies show that oxoG destabilizes DNA (ΔΔG of 2-8 kcal mol(-1) over a 16-116 mM NaCl range) due to a significant reduction in the enthalpy term. The presence of oxoG has a profound effect on the level and nature of DNA hydration indicating that the environment around an oxoG•C is fundamentally different than that found at G•C. The temperature-dependent imino proton NMR spectrum of oxoG modified DNA confirms the destabilization of the oxoG•C pairing and those base pairs that are 5' of the lesion. The instability of the oxoG modification is attributed to changes in the hydrophilicity of the base and its impact on major groove cation binding.

  10. Synthesis and structure of duplex DNA containing the genotoxic nucleobase lesion N7-methylguanine

    SciTech Connect

    Lee, S.; Bowman, B.R.; Ueno, Y.; Wang, S.; Verdine, G.L.

    2008-11-03

    The predominant product of aberrant DNA methylation is the genotoxic lesion N7-methyl-2{prime}-deoxyguanosine (m{sup 7}dG). M{sup 7}dG is recognized and excised by lesion-specific DNA glycosylases, namely AlkA in E. coli and Aag in humans. Structural studies of m{sup 7}dG recognition and catalysis by these enzymes have been hampered due to a lack of efficient means by which to incorporate the chemically labile m{sup 7}dG moiety site-specifically into DNA on a preparative scale. Here we report a solution to this problem. We stabilized the lesion toward acid-catalyzed and glycosylase-catalyzed depurination by 2{prime}-fluorination and toward base-catalyzed degradation using mild, nonaqueous conditions in the DNA deprotection reaction. Duplex DNA containing 2{prime}-fluoro-m{sup 7}dG (Fm{sup 7}dG) cocrystallized with AlkA as a host-guest complex in which the lesion-containing segment of DNA was nearly devoid of protein contacts, thus enabling the first direct visualization of the N7-methylguanine lesion nucleobase in DNA. The structure reveals that the base-pairing mode of Fm{sup 7}dG:C is nearly identical to that of G:C, and Fm{sup 7}dG does not induce any apparent structural disturbance of the duplex structure. These observations suggest that AlkA and Aag must perform a structurally invasive interrogation of DNA in order to detect the presence of intrahelical m{sup 7}dG lesions.

  11. Oxidatively Generated Guanine(C8)-Thymine(N3) Intrastrand Cross-links in Double-stranded DNA Are Repaired by Base Excision Repair Pathways.

    PubMed

    Talhaoui, Ibtissam; Shafirovich, Vladimir; Liu, Zhi; Saint-Pierre, Christine; Akishev, Zhiger; Matkarimov, Bakhyt T; Gasparutto, Didier; Geacintov, Nicholas E; Saparbaev, Murat

    2015-06-05

    Oxidatively generated guanine radical cations in DNA can undergo various nucleophilic reactions including the formation of C8-guanine cross-links with adjacent or nearby N3-thymines in DNA in the presence of O2. The G*[C8-N3]T* lesions have been identified in the DNA of human cells exposed to oxidative stress, and are most likely genotoxic if not removed by cellular defense mechanisms. It has been shown that the G*[C8-N3]T* lesions are substrates of nucleotide excision repair in human cell extracts. Cleavage at the sites of the lesions was also observed but not further investigated (Ding et al. (2012) Nucleic Acids Res. 40, 2506-2517). Using a panel of eukaryotic and prokaryotic bifunctional DNA glycosylases/lyases (NEIL1, Nei, Fpg, Nth, and NTH1) and apurinic/apyrimidinic (AP) endonucleases (Apn1, APE1, and Nfo), the analysis of cleavage fragments by PAGE and MALDI-TOF/MS show that the G*[C8-N3]T* lesions in 17-mer duplexes are incised on either side of G*, that none of the recovered cleavage fragments contain G*, and that T* is converted to a normal T in the 3'-fragment cleavage products. The abilities of the DNA glycosylases to incise the DNA strand adjacent to G*, while this base is initially cross-linked with T*, is a surprising observation and an indication of the versatility of these base excision repair proteins.

  12. DNA oxidation as triggered by H3K9me2 demethylation drives estrogen-induced gene expression.

    PubMed

    Perillo, Bruno; Ombra, Maria Neve; Bertoni, Alessandra; Cuozzo, Concetta; Sacchetti, Silvana; Sasso, Annarita; Chiariotti, Lorenzo; Malorni, Antonio; Abbondanza, Ciro; Avvedimento, Enrico V

    2008-01-11

    Modifications at the N-terminal tails of nucleosomal histones are required for efficient transcription in vivo. We analyzed how H3 histone methylation and demethylation control expression of estrogen-responsive genes and show that a DNA-bound estrogen receptor directs transcription by participating in bending chromatin to contact the RNA polymerase II recruited to the promoter. This process is driven by receptor-targeted demethylation of H3 lysine 9 at both enhancer and promoter sites and is achieved by activation of resident LSD1 demethylase. Localized demethylation produces hydrogen peroxide, which modifies the surrounding DNA and recruits 8-oxoguanine-DNA glycosylase 1 and topoisomeraseIIbeta, triggering chromatin and DNA conformational changes that are essential for estrogen-induced transcription. Our data show a strategy that uses controlled DNA damage and repair to guide productive transcription.

  13. DNA uracil repair initiated by the archaeal ExoIII homologue Mth212 via direct strand incision

    PubMed Central

    Schomacher, Lars; Chong, James P. J.; McDermott, Paul; Kramer, Wilfried; Fritz, Hans-Joachim

    2009-01-01

    No genes for any of the known uracil DNA glycosylases of the UDG superfamily are present in the genome of Methanothermobacter thermautotrophicus ΔH, making it difficult to imagine how DNA-U repair might be initiated in this organism. Recently, Mth212, the ExoIII homologue of M. thermautotrophicus ΔH has been characterized as a DNA uridine endonuclease, which suggested the possibility of a novel endonucleolytic entry mechanism for DNA uracil repair. With no system of genetic experimentation available, the problem was approached biochemically. Assays of DNA uracil repair in vitro, promoted by crude cellular extracts, provide unequivocal confirmation that this mechanism does indeed operate in M. thermautotrophicus ΔH. PMID:19240141

  14. Oxidative damage to DNA during aging: 8-hydroxy-2'-deoxyguanosine in rat organ DNA and urine.

    PubMed Central

    Fraga, C G; Shigenaga, M K; Park, J W; Degan, P; Ames, B N

    1990-01-01

    Oxidative damage to DNA is shown to be extensive and could be a major cause of the physiological changes associated with aging and the degenerative diseases related to aging such as cancer. The oxidized nucleoside, 8-hydroxy-2'-deoxyguanosine (oh8dG), one of the approximately 20 known oxidative DNA damage products, has been measured in DNA isolated from various organs of Fischer 344 rats of different ages. oh8dG was present in the DNA isolated from all the organs studied: liver, brain, kidney, intestine, and testes. Steady-state levels of oh8dG ranged from 8 to 73 residues per 10(6) deoxyguanosine residues or 0.2-2.0 x 10(5) residues per cell. Levels of oh8dG in DNA increased with age in liver, kidney, and intestine but remained unchanged in brain and testes. The urinary excretion of oh8dG, which presumably reflects its repair from DNA by nuclease activity, decreased with age from 481 to 165 pmol per kg of body weight per day for urine obtained from 2-month- and 25-month-old rats, respectively. 8-Hydroxyguanine, the proposed repair product of a glycosylase activity, was also assayed in the urine. We estimate approximately 9 x 10(4) oxidative hits to DNA per cell per day in the rat. The results suggest that the age-dependent accumulation of oh8dG residues observed in DNA from liver, kidney, and intestine is principally due to the slow loss of DNA nuclease activity; however, an increase in the rate of oxidative DNA damage cannot be ruled out. PMID:2352934

  15. DNA damage in Fabry patients: An investigation of oxidative damage and repair.

    PubMed

    Biancini, Giovana Brondani; Moura, Dinara Jaqueline; Manini, Paula Regina; Faverzani, Jéssica Lamberty; Netto, Cristina Brinckmann Oliveira; Deon, Marion; Giugliani, Roberto; Saffi, Jenifer; Vargas, Carmen Regla

    2015-06-01

    Fabry disease (FD) is a lysosomal storage disorder associated with loss of activity of the enzyme α-galactosidase A. In addition to accumulation of α-galactosidase A substrates, other mechanisms may be involved in FD pathophysiology, such as inflammation and oxidative stress. Higher levels of oxidative damage to proteins and lipids in Fabry patients were previously reported. However, DNA damage by oxidative species in FD has not yet been studied. We investigated basal DNA damage, oxidative DNA damage, DNA repair capacity, and reactive species generation in Fabry patients and controls. To measure oxidative damage to purines and pyrimidines, the alkaline version of the comet assay was used with two endonucleases, formamidopyrimidine DNA-glycosylase (FPG) and endonuclease III (EndoIII). To evaluate DNA repair, a challenge assay with hydrogen peroxide was performed. Patients presented significantly higher levels of basal DNA damage and oxidative damage to purines. Oxidative DNA damage was induced in both DNA bases by H2O2 in patients. Fabry patients presented efficient DNA repair in both assays (with and without endonucleases) as well as significantly higher levels of oxidative species (measured by dichlorofluorescein content). Even if DNA repair be induced in Fabry patients (as a consequence of continuous exposure to oxidative species), the repair is not sufficient to reduce DNA damage to control levels.

  16. B cells from hyper-IgM patients carrying UNG mutations lack ability to remove uracil from ssDNA and have elevated genomic uracil.

    PubMed

    Kavli, Bodil; Andersen, Sonja; Otterlei, Marit; Liabakk, Nina B; Imai, Kohsuke; Fischer, Alain; Durandy, Anne; Krokan, Hans E; Slupphaug, Geir

    2005-06-20

    The generation of high-affinity antibodies requires somatic hypermutation (SHM) and class switch recombination (CSR) at the immunoglobulin (Ig) locus. Both processes are triggered by activation-induced cytidine deaminase (AID) and require UNG-encoded uracil-DNA glycosylase. AID has been suggested to function as an mRNA editing deaminase or as a single-strand DNA deaminase. In the latter model, SHM may result from replicative incorporation of dAMP opposite U or from error-prone repair of U, whereas CSR may be triggered by strand breaks at abasic sites. Here, we demonstrate that extracts of UNG-proficient human B cell lines efficiently remove U from single-stranded DNA. In B cell lines from hyper-IgM patients carrying UNG mutations, the single-strand-specific uracil-DNA glycosylase, SMUG1, cannot complement this function. Moreover, the UNG mutations lead to increased accumulation of genomic uracil. One mutation results in an F251S substitution in the UNG catalytic domain. Although this UNG form was fully active and stable when expressed in Escherichia coli, it was mistargeted to mitochondria and degraded in mammalian cells. Our results may explain why SMUG1 cannot compensate the UNG2 deficiency in human B cells, and are fully consistent with the DNA deamination model that requires active nuclear UNG2. Based on our findings and recent information in the literature, we present an integrated model for the initiating steps in CSR.

  17. Methylation-independent DNA Binding Modulates Specificity of Repressor of Silencing 1 (ROS1) and Facilitates Demethylation in Long Substrates*

    PubMed Central

    Ponferrada-Marín, María Isabel; Martínez-Macías, María Isabel; Morales-Ruiz, Teresa; Roldán-Arjona, Teresa; Ariza, Rafael R.

    2010-01-01

    DNA cytosine methylation is an epigenetic mark that promotes gene silencing and performs critical roles during reproduction and development in both plants and animals. The genomic distribution of DNA methylation is the dynamic outcome of opposing methylation and demethylation processes. In plants, active demethylation occurs through a base excision repair pathway initiated by 5-methycytosine (5-meC) DNA glycosylases of the REPRESSOR OF SILENCING 1 (ROS1)/DEMETER (DME) family. To gain insight into the mechanism by which Arabidopsis ROS1 recognizes and excises 5-meC, we have identified those protein regions that are required for efficient DNA binding and catalysis. We have found that a short N-terminal lysine-rich domain conserved in members of the ROS1/DME family mediates strong methylation-independent binding of ROS1 to DNA and is required for efficient activity on 5-meC·G, but not for T·G processing. Removal of this domain does not significantly affect 5-meC excision from short molecules, but strongly decreases ROS1 activity on long DNA substrates. This region is not required for product binding and is not involved in the distributive behavior of the enzyme on substrates containing multiple 5-meC residues. Altogether, our results suggest that methylation-independent DNA binding allows ROS1 to perform a highly redundant search for efficient excision of a nondamaged, correctly paired base such as 5-meC in long stretches of DNA. These findings may have implications for understanding the evolution of structure and target specificity in DNA glycosylases. PMID:20489198

  18. Uracil-Containing DNA in Drosophila: Stability, Stage-Specific Accumulation, and Developmental Involvement

    PubMed Central

    Békési, Angéla; Pukáncsik, Mária; Hodoscsek, Barbara; Merényi, Gábor; Róna, Gergely; Batki, Júlia; Kiss, István; Jankovics, Ferenc; Vilmos, Péter; Erdélyi, Miklós; Vértessy, Beáta G.

    2012-01-01

    Base-excision repair and control of nucleotide pools safe-guard against permanent uracil accumulation in DNA relying on two key enzymes: uracil–DNA glycosylase and dUTPase. Lack of the major uracil–DNA glycosylase UNG gene from the fruit fly genome and dUTPase from fruit fly larvae prompted the hypotheses that i) uracil may accumulate in Drosophila genomic DNA where it may be well tolerated, and ii) this accumulation may affect development. Here we show that i) Drosophila melanogaster tolerates high levels of uracil in DNA; ii) such DNA is correctly interpreted in cell culture and embryo; and iii) under physiological spatio-temporal control, DNA from fruit fly larvae, pupae, and imago contain greatly elevated levels of uracil (200–2,000 uracil/million bases, quantified using a novel real-time PCR–based assay). Uracil is accumulated in genomic DNA of larval tissues during larval development, whereas DNA from imaginal tissues contains much less uracil. Upon pupation and metamorphosis, uracil content in DNA is significantly decreased. We propose that the observed developmental pattern of uracil–DNA is due to the lack of the key repair enzyme UNG from the Drosophila genome together with down-regulation of dUTPase in larval tissues. In agreement, we show that dUTPase silencing increases the uracil content in DNA of imaginal tissues and induces strong lethality at the early pupal stages, indicating that tolerance of highly uracil-substituted DNA is also stage-specific. Silencing of dUTPase perturbs the physiological pattern of uracil–DNA accumulation in Drosophila and leads to a strongly lethal phenotype in early pupal stages. These findings suggest a novel role of uracil-containing DNA in Drosophila development and metamorphosis and present a novel example for developmental effects of dUTPase silencing in multicellular eukaryotes. Importantly, we also show lack of the UNG gene in all available genomes of other Holometabola insects, indicating a potentially

  19. Measurement of oxidatively generated base damage in cellular DNA.

    PubMed

    Cadet, Jean; Douki, Thierry; Ravanat, Jean-Luc

    2011-06-03

    This survey focuses on the critical evaluation of the main methods that are currently available for monitoring single and complex oxidatively generated damage to cellular DNA. Among chromatographic methods, HPLC-ESI-MS/MS and to a lesser extent HPLC-ECD which is restricted to a few electroactive nucleobases and nucleosides are appropriate for measuring the formation of single and clustered DNA lesions. Such methods that require optimized protocols for DNA extraction and digestion are sensitive enough for measuring base lesions formed under conditions of severe oxidative stress including exposure to ionizing radiation, UVA light and high intensity UVC laser pulses. In contrast application of GC-MS and HPLC-MS methods that are subject to major drawbacks have been shown to lead to overestimated values of DNA damage. Enzymatic methods that are based on the use of DNA repair glycosylases in order to convert oxidized bases into strand breaks are suitable, even if they are far less specific than HPLC methods, to deal with low levels of single modifications. Several other methods including immunoassays and (32)P-postlabeling methods that are still used suffer from drawbacks and therefore are not recommended. Another difficult topic is the measurement of oxidatively generated clustered DNA lesions that is currently achieved using enzymatic approaches and that would necessitate further investigations.

  20. Oxidative DNA damage and repair in teratogenesis and neurodevelopmental deficits.

    PubMed

    Wells, Peter G; McCallum, Gordon P; Lam, Kyla C H; Henderson, Jeffrey T; Ondovcik, Stephanie L

    2010-06-01

    Several teratogenic agents, including ionizing radiation and xenobiotics such as phenytoin, benzo[a]pyrene, thalidomide, and methamphetamine, can initiate the formation of reactive oxygen species (ROS) that oxidatively damage cellular macromolecules including DNA. Oxidative DNA damage, and particularly the most prevalent 8-oxoguanine lesion, may adversely affect development, likely via alterations in gene transcription rather than via a mutational mechanism. Contributions from oxidative DNA damage do not exclude roles for alternative mechanisms of initiation like receptor-mediated processes or the formation of covalent xenobiotic-macromolecular adducts, damage to other macromolecular targets like proteins and lipids, and other effects of ROS like altered signal transduction. Even in the absence of teratogen exposure, endogenous developmental oxidative stress can have embryopathic consequences in the absence of key pathways for detoxifying ROS or repairing DNA damage. Critical proteins in pathways for DNA damage detection/repair signaling, like p53 and ataxia telangiectasia mutated, and DNA repair itself, like oxoguanine glycosylase 1 and Cockayne syndrome B, can often, but not always, protect the embryo from ROS-initiating teratogens. Protection may be variably dependent upon such factors as the nature of the teratogen and its concentration within the embryo, the stage of development, the species, strain, gender, target tissue and cell type, among other factors.

  1. 5-Formylcytosine alters the structure of the DNA double helix.

    PubMed

    Raiber, Eun-Ang; Murat, Pierre; Chirgadze, Dimitri Y; Beraldi, Dario; Luisi, Ben F; Balasubramanian, Shankar

    2015-01-01

    The modified base 5-formylcytosine (5fC) was recently identified in mammalian DNA and might be considered to be the 'seventh' base of the genome. This nucleotide has been implicated in active demethylation mediated by the base excision repair enzyme thymine DNA glycosylase. Genomics and proteomics studies have suggested an additional role for 5fC in transcription regulation through chromatin remodeling. Here we propose that 5fC might affect these processes through its effect on DNA conformation. Biophysical and structural analysis revealed that 5fC alters the structure of the DNA double helix and leads to a conformation unique among known DNA structures including those comprising other cytosine modifications. The 1.4-Å-resolution X-ray crystal structure of a DNA dodecamer comprising three 5fCpG sites shows how 5fC changes the geometry of the grooves and base pairs associated with the modified base, leading to helical underwinding.

  2. Modular Nuclease-Responsive DNA Three-Way Junction-Based Dynamic Assembly of a DNA Device and Its Sensing Application.

    PubMed

    Zhu, Jing; Wang, Lei; Xu, Xiaowen; Wei, Haiping; Jiang, Wei

    2016-04-05

    Here, we explored a modular strategy for rational design of nuclease-responsive three-way junctions (TWJs) and fabricated a dynamic DNA device in a "plug-and-play" fashion. First, inactivated TWJs were designed, which contained three functional domains: the inaccessible toehold and branch migration domains, the specific sites of nucleases, and the auxiliary complementary sequence. The actions of different nucleases on their specific sites in TWJs caused the close proximity of the same toehold and branch migration domains, resulting in the activation of the TWJs and the formation of a universal trigger for the subsequent dynamic assembly. Second, two hairpins (H1 and H2) were introduced, which could coexist in a metastable state, initially to act as the components for the dynamic assembly. Once the trigger initiated the opening of H1 via TWJs-driven strand displacement, the cascade hybridization of hairpins immediately switched on, resulting in the formation of the concatemers of H1/H2 complex appending numerous integrated G-quadruplexes, which were used to obtain label-free signal readout. The inherent modularity of this design allowed us to fabricate a flexible DNA dynamic device and detect multiple nucleases through altering the recognition pattern slightly. Taking uracil-DNA glycosylase and CpG methyltransferase M.SssI as models, we successfully realized the butt joint between the uracil-DNA glycosylase and M.SssI recognition events and the dynamic assembly process. Furthermore, we achieved ultrasensitive assay of nuclease activity and the inhibitor screening. The DNA device proposed here will offer an adaptive and flexible tool for clinical diagnosis and anticancer drug discovery.

  3. Base flip in DNA studied by molecular dynamics simulationsof differently-oxidized forms of methyl-Cytosine.

    PubMed

    Helabad, Mahdi Bagherpoor; Kanaan, Natalia; Imhof, Petra

    2014-07-03

    Distortions in the DNA sequence, such as damage or mispairs, are specifically recognized and processed by DNA repair enzymes. Many repair proteins and, in particular, glycosylases flip the target base out of the DNA helix into the enzyme's active site. Our molecular dynamics simulations of DNA with intact and damaged (oxidized) methyl-cytosine show that the probability of being flipped is similar for damaged and intact methyl-cytosine. However, the accessibility of the different 5-methyl groups allows direct discrimination of the oxidized forms. Hydrogen-bonded patterns that vary between methyl-cytosine forms carrying a carbonyl oxygen atom are likely to be detected by the repair enzymes and may thus help target site recognition.

  4. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities.

    PubMed

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier

    2014-02-17

    DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes' activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL(-1) and 50 μg mL(-1) of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities.

  5. Formamidopyrimidines in DNA: mechanisms of formation, repair, and biological effects.

    PubMed

    Dizdaroglu, Miral; Kirkali, Güldal; Jaruga, Pawel

    2008-12-15

    Oxidatively induced damage to DNA results in a plethora of lesions comprising modified bases and sugars, DNA-protein cross-links, tandem lesions, strand breaks, and clustered lesions. Formamidopyrimidines, 4,6-diamino-5-formamidopyrimidine (FapyAde) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua), are among the major lesions generated in DNA by hydroxyl radical attack, UV radiation, or photosensitization under numerous in vitro and in vivo conditions. They are formed by one-electron reduction of C8-OH-adduct radicals of purines and thus have a common precursor with 8-hydroxypurines generated upon one-electron oxidation. Methodologies using mass spectrometry exist to accurately measure FapyAde and FapyGua in vitro and in vivo. Formamidopyrimidines are repaired by base excision repair. Numerous prokaryotic and eukaryotic DNA glycosylases are highly specific for removal of these lesions from DNA in the first step of this repair pathway, indicating their biological importance. FapyAde and FapyGua are bypassed by DNA polymerases with the insertion of the wrong intact base opposite them, leading to mutagenesis. In mammalian cells, the mutagenicity of FapyGua exceeds that of 8-hydroxyguanine, which is thought to be the most mutagenic of the oxidatively induced lesions in DNA. The background and formation levels of the former in vitro and in vivo equal or exceed those of the latter under various conditions. FapyAde and FapyGua exist in living cells at significant background levels and are abundantly generated upon exposure to oxidative stress. Mice lacking the genes that encode specific DNA glycosylases accumulate these lesions in different organs and, in some cases, exhibit a series of pathological conditions including metabolic syndrome and cancer. Animals exposed to environmental toxins accumulate formamidopyrimidines in their organs. Here, we extensively review the mechanisms of formation, measurement, repair, and biological effects of formamidopyrimidines

  6. The Ser(326)Cys polymorphism of 8-oxoguanine glycosylase 1 (OGG1) is associated with type 2 diabetes in Mexican Americans.

    PubMed

    Thameem, Farook; Puppala, Sobha; Lehman, Donna M; Stern, Michael P; Blangero, John; Abboud, Hanna E; Duggirala, Ravindranath; Habib, Samy L

    2010-01-01

    Human 8-oxoguanine glycosylase 1 (OGG1) excises oxidatively damaged promutagenic base 8-oxoguanine, a lesion previously observed in a rat model of type 2 diabetes (T2DM). The objective of the present study is to determine whether genetic variation in OGG1 is associated with type 2 diabetes (T2DM) in a Mexican American cohort. Ten SNPs including two tagging SNPs (rs1052133, rs2072668) across the OGG1 gene region were selected from the Hapmap database and genotyped in the entire cohort (n = 670; 29% diabetes; 39 families) by TaqMan assay. Association analyses between the SNPs and T2DM were performed using the measured genotype approach as implemented in the program SOLAR. Of the ten SNPs genotyped, only five were polymorphic. The minor allele frequencies of these 5 SNPs ranged from 1-38%. Of the SNPs examined for association, the Ser(326)Cys (rs1052133) exhibited significant association with T2DM (p = 0.016) after accounting for age and sex effects. Another intronic variant (rs2072668), which was in strong linkage disequilibrium (r(2) = 0.96) with Ser(326)Cys also exhibited significant association with T2DM (p = 0.031). These results suggest for the first time that the variants in OGG1 could influence diabetes risk in these Mexican American families and support a role for alterations of OGG1 in the pathogenesis of T2DM. Copyright © 2010 S. Karger AG, Basel.

  7. The Ser(326)Cys Polymorphism of 8-Oxoguanine Glycosylase 1 (OGG1) Is Associated with Type 2 Diabetes in Mexican Americans

    PubMed Central

    Thameem, Farook; Puppala, Sobha; Lehman, Donna M.; Stern, Michael P.; Blangero, John; Abboud, Hanna E.; Duggirala, Ravindranath; Habib, Samy L.

    2010-01-01

    Objective Human 8-oxoguanine glycosylase 1 (OGG1) excises oxidatively damaged promutagenic base 8-oxoguanine, a lesion previously observed in a rat model of type 2 diabetes (T2DM). The objective of the present study is to determine whether genetic variation in OGG1 is associated with type 2 diabetes (T2DM) in a Mexican American cohort. Methods Ten SNPs including two tagging SNPs (rs1052133, rs2072668) across the OGG1 gene region were selected from the Hapmap database and genotyped in the entire cohort (n = 670; 29% diabetes; 39 families) by TaqMan assay. Association analyses between the SNPs and T2DM were performed using the measured genotype approach as implemented in the program SOLAR. Results Of the ten SNPs genotyped, only five were polymorphic. The minor allele frequencies of these 5 SNPs ranged from 1–38%. Of the SNPs examined for association, the Ser(326)Cys (rs1052133) exhibited significant association with T2DM (p = 0.016) after accounting for age and sex effects. Another intronic variant (rs2072668), which was in strong linkage disequilibrium (r2 = 0.96) with Ser(326)Cys also exhibited significant association with T2DM (p = 0.031). Conclusions These results suggest for the first time that the variants in OGG1 could influence diabetes risk in these Mexican American families and support a role for alterations of OGG1 in the pathogenesis of T2DM. PMID:20606456

  8. Mechanism of maltal hydration catalyzed by. beta. -amylase: Role of protein structure in controlling the steric outcome of reactions catalyzed by a glycosylase

    SciTech Connect

    Kitahata, Sumio ); Chiba, S. ); Brewer, C.F.; Hehre, E.J. )

    1991-07-09

    Crystalline (monomeric) soybean and (tetrameric) sweet potato {beta}-amylase were shown to catalyze the cis hydration of maltal ({alpha}-D-glucopyranosyl-2-deoxy-D-arabino-hex-1-enitol) to form {beta}-2-deoxymaltose. As reported earlier with the sweet potato enzyme, maltal hydration in D{sub 2}O by soybean {beta}-amylase was found to exhibit an unusually large solvent deuterium kinetic isotope effect (V{sub H}/V{sub D}=6.5), a reaction rate linearly dependent on the mole fraction of deuterium, and 2-deoxy-(2(a)-{sup 2}H)maltose as product. These results indicate (for each {beta}-amylase) that protonation is the rate-limiting step in a reaction involving a nearly symmetric one-proton transition state and that maltal is specifically protonated from above the double bond. That maltal undergoes cis hydration provides evidence in support of a general-acid-catalyzed, carbonium ion mediated reaction. Of fundamental significance is that {beta}-amylase protonates maltal from a direction opposite that assumed for protonating strach, yet creates products of the same anomeric configuration from both. Such stereochemical dichotomy argues for the overriding role of protein structures is dictating the steric outcome of reactions catalyzed by a glycosylase, by limiting the approach and orientation of water or other acceptors to the reaction center.

  9. Unraveling DNA repair in human: molecular mechanisms and consequences of repair defect.

    PubMed

    Tuteja, N; Tuteja, R

    2001-01-01

    Cellular genomes are vulnerable to an array of DNA-damaging agents, of both endogenous and environmental origin. Such damage occurs at a frequency too high to be compatible with life. As a result cell death and tissue degeneration, aging and cancer are caused. To avoid this and in order for the genome to be reproduced, these damages must be corrected efficiently by DNA repair mechanisms. Eukaryotic cells have multiple mechanisms for the repair of damaged DNA. These repair systems in humans protect the genome by repairing modified bases, DNA adducts, crosslinks and double-strand breaks. The lesions in DNA are eliminated by mechanisms such as direct reversal, base excision and nucleotide excision. The base excision repair eliminates single damaged-base residues by the action of specialized DNA glycosylases and AP endonucleases. Nucleotide excision repair excises damage within oligomers that are 25 to 32 nucleotides long. This repair utilizes many proteins to remove the major UV-induced photoproducts from DNA, as well as other types of modified nucleotides. Different DNA polymerases and ligases are utilized to complete the separate pathways. The double-strand breaks in DNA are repaired by mechanisms that involve DNA protein kinase and recombination proteins. The defect in one of the repair protein results in three rare recessive syndromes: xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. This review describes the biochemistry of various repair processes and summarizes the clinical features and molecular mechanisms underlying these disorders.

  10. DNA repair genes polymorphisms and genetic susceptibility to Philadelphia-negative myeloproliferative neoplasms in a Portuguese population: The role of base excision repair genes polymorphisms.

    PubMed

    Azevedo, Ana P; Silva, Susana N; De Lima, João P; Reichert, Alice; Lima, Fernando; Júnior, Esmeraldina; Rueff, José

    2017-06-01

    The role of base excision repair (BER) genes in Philadelphia-negative (PN)-myeloproliferative neoplasms (MPNs) susceptibility was evaluated by genotyping eight polymorphisms [apurinic/apyrimidinic endodeoxyribonuclease 1, mutY DNA glycosylase, earlier mutY homolog (E. coli) (MUTYH), 8-oxoguanine DNA glycosylase 1, poly (ADP-ribose) polymerase (PARP) 1, PARP4 and X-ray repair cross-complementing 1 (XRCC1)] in a case-control study involving 133 Caucasian Portuguese patients. The results did not reveal a correlation between individual BER polymorphisms and PN-MPNs when considered as a whole. However, stratification for essential thrombocythaemia revealed i) borderline effect/tendency to increased risk when carrying at least one variant allele for XRCC1_399 single-nucleotide polymorphism (SNP); ii) decreased risk for Janus kinase 2-positive patients carrying at least one variant allele for XRCC1_399 SNP; and iii) decreased risk in females carrying at least one variant allele for MUTYH SNP. Combination of alleles demonstrated an increased risk to PN-MPNs for one specific haplogroup. These findings may provide evidence for gene variants in susceptibility to MPNs. Indeed, common variants in DNA repair genes may hamper the capacity to repair DNA, thus increasing cancer susceptibility.

  11. DNA repair genes polymorphisms and genetic susceptibility to Philadelphia-negative myeloproliferative neoplasms in a Portuguese population: The role of base excision repair genes polymorphisms

    PubMed Central

    Azevedo, Ana P.; Silva, Susana N.; De Lima, João P.; Reichert, Alice; Lima, Fernando; Júnior, Esmeraldina; Rueff, José

    2017-01-01

    The role of base excision repair (BER) genes in Philadelphia-negative (PN)-myeloproliferative neoplasms (MPNs) susceptibility was evaluated by genotyping eight polymorphisms [apurinic/apyrimidinic endodeoxyribonuclease 1, mutY DNA glycosylase, earlier mutY homolog (E. coli) (MUTYH), 8-oxoguanine DNA glycosylase 1, poly (ADP-ribose) polymerase (PARP) 1, PARP4 and X-ray repair cross-complementing 1 (XRCC1)] in a case-control study involving 133 Caucasian Portuguese patients. The results did not reveal a correlation between individual BER polymorphisms and PN-MPNs when considered as a whole. However, stratification for essential thrombocythaemia revealed i) borderline effect/tendency to increased risk when carrying at least one variant allele for XRCC1_399 single-nucleotide polymorphism (SNP); ii) decreased risk for Janus kinase 2-positive patients carrying at least one variant allele for XRCC1_399 SNP; and iii) decreased risk in females carrying at least one variant allele for MUTYH SNP. Combination of alleles demonstrated an increased risk to PN-MPNs for one specific haplogroup. These findings may provide evidence for gene variants in susceptibility to MPNs. Indeed, common variants in DNA repair genes may hamper the capacity to repair DNA, thus increasing cancer susceptibility. PMID:28599464

  12. Structural basis of the versatile DNA recognition ability of the methyl-CpG binding domain of methyl-CpG binding domain protein 4.

    PubMed

    Otani, Junji; Arita, Kyohei; Kato, Tsuyoshi; Kinoshita, Mariko; Kimura, Hironobu; Suetake, Isao; Tajima, Shoji; Ariyoshi, Mariko; Shirakawa, Masahiro

    2013-03-01

    The methyl-CpG binding domain (MBD) protein MBD4 participates in DNA repair as a glycosylase that excises mismatched thymine bases in CpG sites and also functions in transcriptional repression. Unlike other MBD proteins, MBD4 recognizes not only methylated CpG dinucleotides ((5m)CG/(5m)CG) but also T/G mismatched sites generated by spontaneous deamination of 5-methylcytosine ((5m)CG/TG). The glycosylase activity of MBD4 is also implicated in active DNA demethylation initiated by the deaminase-catalyzed conversion of 5-methylcytosine to thymine. Here, we report the crystal structures of the MBD of MBD4 (MBDMBD4) complexed with (5m)CG/(5m)CG and (5m)CG/TG. The crystal structures show that the DNA interface of MBD4 has flexible structural features and harbors an extensive water network that supports its dual base specificities. Combined with the results of biochemical analyses, the crystal structure of MBD4 bound to 5-hydroxymethylcytosine further demonstrates that MBDMBD4 is able to recognize a wide range of 5-methylcytosine modifications through the unique water network. The versatile base recognition ability of MBDMBD4 implies multifunctional roles for MBD4 in the regulation of dynamic DNA methylation patterns coupled with deamination and/or oxidation of 5-methylcytosine.

  13. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.

    PubMed

    Komor, Alexis C; Kim, Yongjoo B; Packer, Michael S; Zuris, John A; Liu, David R

    2016-05-19

    Current genome-editing technologies introduce double-stranded (ds) DNA breaks at a target locus as the first step to gene correction. Although most genetic diseases arise from point mutations, current approaches to point mutation correction are inefficient and typically induce an abundance of random insertions and deletions (indels) at the target locus resulting from the cellular response to dsDNA breaks. Here we report the development of 'base editing', a new approach to genome editing that enables the direct, irreversible conversion of one target DNA base into another in a programmable manner, without requiring dsDNA backbone cleavage or a donor template. We engineered fusions of CRISPR/Cas9 and a cytidine deaminase enzyme that retain the ability to be programmed with a guide RNA, do not induce dsDNA breaks, and mediate the direct conversion of cytidine to uridine, thereby effecting a C→T (or G→A) substitution. The resulting 'base editors' convert cytidines within a window of approximately five nucleotides, and can efficiently correct a variety of point mutations relevant to human disease. In four transformed human and murine cell lines, second- and third-generation base editors that fuse uracil glycosylase inhibitor, and that use a Cas9 nickase targeting the non-edited strand, manipulate the cellular DNA repair response to favour desired base-editing outcomes, resulting in permanent correction of ~15-75% of total cellular DNA with minimal (typically ≤1%) indel formation. Base editing expands the scope and efficiency of genome editing of point mutations.

  14. Clustered DNA damage induced by γ radiation in human fibroblasts (HF19), hamster (V79-4) cells and plasmid DNA is revealed as Fpg and Nth sensitive sites

    PubMed Central

    Gulston, Melanie; Fulford, Jonathan; Jenner, Terry; de Lara, Catherine; O’Neill, Peter

    2002-01-01

    The signature DNA lesion induced by ionizing radiation is clustered DNA damage. Gamma radiation-induced clustered DNA damage containing base lesions was investigated in plasmid DNA under cell mimetic conditions and in two cell lines, V79-4 (hamster) and HF19 (human), using bacterial endonucleases Nth (endonuclease III) and Fpg (formamidopyrimidine DNA glycosylase). Following irradiation with 60Co γ-rays, induction of double-strand breaks (DSB) and clustered DNA damage, revealed as DSB by the proteins, was determined in plasmid using the plasmid-nicking assay and in cells by either conventional pulsed field gel electrophoresis or a hybridization assay, in which a 3 Mb restriction fragment of the X chromosome is used as a radioactive labeled probe. Enzyme concentrations (30–60 ng/µg DNA) were optimized to minimize visualization of background levels of endogenous DNA damage and DSB produced by non-specific cutting by Fpg and Nth in cellular DNA. 60Co γ- radiation produces a 1.8-fold increase in the yields of both types of enzyme sensitive sites, visualized as DSB compared with that of prompt DSB in plasmid DNA. In mammalian cells, the increase in yields of clustered DNA damage containing either Fpg or Nth sensitive sites compared with that of prompt DSB is 1.4–2.0- and 1.8-fold, respectively. Therefore, clustered DNA damage is induced in cells by sparsely ionizing radiation and their yield is significantly greater than that of prompt DSB. PMID:12140332

  15. Antagonistic role of tea against sodium arsenite-induced oxidative DNA damage and inhibition of DNA repair in Swiss albino mice.

    PubMed

    Sinha, Dona; Roy, Madhumita

    2011-01-01

    Arsenic (As) contamination in groundwater is of increasing health concern in West Bengal, India. Arsenic has been associated with various human cancers, but the precise mechanism of its co-carcinogenic action is not clearly elucidated. Oxidative stress and defective repair mechanisms may promote accumulation of mutations and may be a stepping stone for carcinogenesis. Prevention of arsenic-induced oxidative stress and repair inhibition may reduce the chances of initiation of cancer. Tea polyphenols are reported to have excellent chemopreventive properties against cancer. This study aimed to elucidate the role of tea against arsenic-induced formation of 8-hydroxy-2'-deoxyguanosine (8OHdG) and arsenic-suppressed DNA repair in Swiss albino mice. Both green and black tea gave fruitful results in the reduction of 8OHdG and 8-oxoguanine DNA glycosylase (OGG1) in Swiss albino mice administered sodium arsenite (As III). DNA repair enzymes--such as PARP1, DNA β-polymerase, XRCC1, DNA ligase III, DNA protein kinase (catalytic subunit), XRCC 4, DNA ligase IV, and DNA topoisomerase IIβ--were induced by the phytochemicals at both the protein and genetic levels. Thus, tea polyphenols may prove effective in treating arsenic-induced carcinogenesis.

  16. MPG — EDRN Public Portal

    Cancer.gov

    MPG is a DNA repair enzyme that repairs hypoxanthine, which is formed by spontaneous or oxidative deamination of adenine. MPG also repairs secondary oxidative lesions such as 1,N6-ethenoadenine alkylated bases, and 3-methyladenine and 7-methylguanine.

  17. Methotrexate-induced misincorporation of uracil into DNA

    PubMed Central

    Goulian, M.; Bleile, B.; Tseng, B. Y.

    1980-01-01

    A line of human lymphoid cells was tested for the presence of dUMP in DNA with or without treatment with the dihydrofolate reductase inhibitor, methotrexate. Cells treated with methotrexate and labeled with [3H]dUrd contained dUMP in DNA in readily detectable amounts (≈0.8 pmol of dUMP per μmol of total DNA nucleotide), and this was increased ≈3-fold if the cells were also treated with Ura at the same time. No dUMP (<1 fmol/μmol of DNA) could be detected by these methods in DNA from cells not treated with methotrexate, regardless of whether Ura was present or absent. The presence of dUMP in DNA from cells treated with methotrexate is a result of the great increase in intracellular concentration of dUTP and the fall in dTTP that accompany inhibition of thymidylate synthetase (5,10-methylenetetrahydrofolate:dUMP C-methyltransferase; EC 2.1.1.45) by the drug. These changes are apparently sufficient to overcome the normal mechanisms that exclude dUMP from DNA, and the enhancement by Ura reflects suppression of one of the mechanisms, Ura removal from DNA by the enzyme Ura-DNA glycosylase. The results suggest an active lesion of DNA in cells in which thymidylate synthetase is inhibited. Under these conditions there appears to be a cyclic incorporation and removal of dUMP resulting from reinsertion of dUMP during gap repair at sites of Ura removal. This consequence of the normal excision-repair process, which occurs when intracellular levels of dUTP approach those of dTTP, may have effects related to the cytotoxicity of drug inhibitors of thymidylate synthetase, clinical deficiencies of folate and vitamin B-12, and thymineless death, in general. Images PMID:6929529

  18. In vitro measurement of DNA base excision repair in isolated mitochondria.

    PubMed

    Page, Melissa M; Stuart, Jeffrey A

    2009-01-01

    Mitochondrial DNA (mtDNA) is in relatively close proximity to reactive oxygen species (ROS) arising from spontaneous superoxide formation during respiration. As a result, it sustains oxidative damage that may include base modifications, base loss, and strand breaks. mtDNA replication past sites of oxidative damage can result in the introduction of mutations. mtDNA mutations are associated with various human diseases and can manifest as loss of bioenergetic function. DNA repair processes exist in mitochondria from apparently all metazoans. A fully functional DNA base excision repair (BER) pathway is present in mitochondria of vertebrates. This pathway is catalyzed by a number of DNA glycosylases, an AP endonuclease, polymerase gamma, and a DNA ligase. This chapter outlines the step-by-step protocols for isolating mitochondrial fractions, from a number of different model organisms, of sufficient purity to allow mtDNA repair activities to be measured. It details in vitro assays for the measurement of BER enzyme activities in lysates prepared from isolated mitochondria.

  19. Impaired dynamics and function of mitochondria caused by mtDNA toxicity leads to heart failure.

    PubMed

    Lauritzen, Knut H; Kleppa, Liv; Aronsen, Jan Magnus; Eide, Lars; Carlsen, Harald; Haugen, Øyvind P; Sjaastad, Ivar; Klungland, Arne; Rasmussen, Lene Juel; Attramadal, Håvard; Storm-Mathisen, Jon; Bergersen, Linda H

    2015-08-01

    Cardiac mitochondrial dysfunction has been implicated in heart failure of diverse etiologies. Generalized mitochondrial disease also leads to cardiomyopathy with various clinical manifestations. Impaired mitochondrial homeostasis may over time, such as in the aging heart, lead to cardiac dysfunction. Mitochondrial DNA (mtDNA), close to the electron transport chain and unprotected by histones, may be a primary pathogenetic site, but this is not known. Here, we test the hypothesis that cumulative damage of cardiomyocyte mtDNA leads to cardiomyopathy and heart failure. Transgenic mice with Tet-on inducible, cardiomyocyte-specific expression of a mutant uracil-DNA glycosylase 1 (mutUNG1) were generated. The mutUNG1 is known to remove thymine in addition to uracil from the mitochondrial genome, generating apyrimidinic sites, which obstruct mtDNA function. Following induction of mutUNG1 in cardiac myocytes by administering doxycycline, the mice developed hypertrophic cardiomyopathy, leading to congestive heart failure and premature death after ∼2 mo. The heart showed reduced mtDNA replication, severely diminished mtDNA transcription, and suppressed mitochondrial respiration with increased Pgc-1α, mitochondrial mass, and antioxidative defense enzymes, and finally failing mitochondrial fission/fusion dynamics and deteriorating myocardial contractility as the mechanism of heart failure. The approach provides a model with induced cardiac-restricted mtDNA damage for investigation of mtDNA-based heart disease.

  20. An immunochemical approach to the study of DNA damage and repair

    SciTech Connect

    Wallace, S.S.; Erlanger, B.F. . Dept. of Microbiology and Molecular Genetics; Columbia Univ., New York, NY . Dept. of Microbiology)

    1989-01-01

    The most studied radiation-induced modified DNA base is thymine glycol. Thymine glycols are produced in relatively high yields in irradiated DNA and are also formed as a consequence of oxidative stress. Thymine glycol has been shown to be an in vitro replicative block to DNA polymerases as well as a cytotoxic lesion. DNA glycosylases that remove thymine glycol from damaged DNA are found in both prokaryotes an deukaryotes. Thus this lesion provides a good model for studying the potential biological consequences of pyrimidine ring saturation products. In order to elicit antibodies that would react with unique modified base on a damaged DNA molecule, we have chosen to chemically synthesize the hapten of interest and conjugate it to a protein carrier. Thymine glycol monophosphate was synthesized, conjugated by the carbodiimide method to bovine serum albumin (BSA), and used as an immunogen. Initially, polyclonal antibodies were produced in rabbits. These antibodies had high affinity and specificity as measured by both albumin (RSA) and by enzyme immunoassay using either the conjugate or DNA oxidized inhibited by thymine glycol, thymidine glycol and thymine glycol monophosphate determinants for the phosphate group in addition to the thymidine glycol. In both the direct and competitive assays, this antibody reacts with osmium tetroxide-treated DNA containing cis-thymine glycols and DNA X-irradiated in vitro at a femtomole level of sensitivity. 24 refs.

  1. Global deformation facilitates flipping of damaged 8-oxo-guanine and guanine in DNA

    PubMed Central

    La Rosa, Giuseppe; Zacharias, Martin

    2016-01-01

    Oxidation of guanine (Gua) to form 7,8-dihydro-8-oxoguanine (8oxoG) is a frequent mutagenic DNA lesion. DNA repair glycosylases such as the bacterial MutM can effciently recognize and eliminate the 8oxoG damage by base excision. The base excision requires a 8oxoG looping out (flipping) from an intrahelical base paired to an extrahelical state where the damaged base is in the enzyme active site. It is still unclear how the damage is identified and flipped from an energetically stable stacked and paired state without any external energy source. Free energy simulations have been employed to study the flipping process for globally deformed DNA conformational states. DNA deformations were generated by systematically untwisting the DNA to mimic its conformation in repair enzyme encounter complex. The simulations indicate that global DNA untwisting deformation toward the enzyme bound form alone (without protein) significantly reduces the penalty for damage flipping to about half of the penalty observed in regular DNA. The finding offers a mechanistic explanation how binding free energy that is transformed to binding induced DNA deformation facilitates flipping and helps to rapidly detect a damaged base. It is likely of general relevance since repair enzyme binding frequently results in significant deformation of the target DNA. PMID:27651459

  2. Use of the comet assay to measure DNA damage in cells exposed to photosensitizers and gamma radiation

    NASA Astrophysics Data System (ADS)

    Pouget, J.-P.; Ravanat, J.-L.; Douki, T.; Richard, M.-J.; Cadet, J.

    1999-01-01

    We used the comet assay associated with DNA-glycosylases to estimate DNA damage in cells exposed to gamma irradiation or photosensitized either with methylene blue or orange acridine. A calibration performed using irradiation allowed the measurement of the steady-state level and the yield of 8-oxodGuo as well as strand breaks and alkali-labile sites. Nous avons utilisé la méthode des comètes associée à des ADN-glycosylases, pour estimer les dommages de l'ADN dans des cellules après l'exposition à un rayonnement gamma ou après photosensibilisation par le bleu de méthylène ou l'acridine orange. Une calibration de la méthode des comètes a permis de mesurer le niveau basal et les taux de formation de 8-oxodGuo ainsi que le nombre de cassures de brins et de sites alcali labiles.

  3. Base excision repair in Archaea: back to the future in DNA repair.

    PubMed

    Grasso, Stefano; Tell, Gianluca

    2014-09-01

    Together with Bacteria and Eukarya, Archaea represents one of the three domain of life. In contrast with the morphological difference existing between Archaea and Eukarya, these two domains are closely related. Phylogenetic analyses confirm this evolutionary relationship showing that most of the proteins involved in DNA transcription and replication are highly conserved. On the contrary, information is scanty about DNA repair pathways and their mechanisms. In the present review the most important proteins involved in base excision repair, namely glycosylases, AP lyases, AP endonucleases, polymerases, sliding clamps, flap endonucleases, and ligases, will be discussed and compared with bacterial and eukaryotic ones. Finally, possible applications and future perspectives derived from studies on Archaea and their repair pathways, will be taken into account.

  4. Role of inducible nitrogen oxide synthase in benzene-induced oxidative DNA damage in the bone marrow of mice.

    PubMed

    Vestergaard, Sys; Loft, Steffen; Møller, Peter

    2002-03-01

    We investigated the interaction of BZ and lipolysaccharide (LPS), a well-known inflammation-promoting agent, in wild-type and inducible nitrogen oxide synthase (iNOS) knockout mice. BZ generated DNA strand breaks (SB) in the liver of both wild-type and iNOS-deficient mice. In the bone marrow (BM) BZ and LPS generated SB only in wild-type mice. The effects were additive, suggesting that both a redox cycling and an iNOS-dependent pathway may be involved. Formamidopyrimidine DNA glycosylase sensitive sites were elevated by BZ in the BM in both types of mice, whereas endonuclease III sensitive sites were not affected by any treatment. Since BZ is associated with leukemia in humans, it suggests that oxidative DNA base damage rather than SB may be important in the development of leukemia.

  5. A differential autophagy dependent response to DNA-double strand breaks in bone marrow mesenchymal stem cells from sporadic ALS patients.

    PubMed

    Wald-Altman, Shane; Pichinuk, Edward; Kakhlon, Or; Weil, Miguel

    2017-02-16

    Amyotrophic Lateral Sclerosis (ALS) is an incurable motor neurodegenerative disease caused by a diversity of genetic and environmental factors leading to neuromuscular degeneration and pathophysiological implications in non-neural systems. Our previous work showed abnormal transcriptional expression levels of biomarker genes in non-neuronal cell samples from ALS patients. The same genes proved to be differentially expressed in brain, spinal cord and muscle of the SOD1(G93A) ALS mouse model. These observations support the pathophysiological relevance of the ALS biomarkers discovered in human mesenchymal stem cells (hMSC) isolated from bone marrow samples of ALS patients (ALS-hMSC). Here we demonstrate that ALS-hMSC are also a useful patient based model to study intrinsic cell molecular mechanisms of the disease. We investigated the ALS-hMSC response to oxidative DNA damage exerted by neocarzinostatin (NCS)-mediated DNA double-strand breaks (DSB). We found that the ALS-hMSC responded to this stress differently than cells from healthy controls (HC-hMSC). Interestingly, we found that ALS-hMSC cell death, in response to DSB, was dependent on autophagy, initialized by an increase of p-AMPK and blocked by the class III PI3K and autophagy inhibitor 3-methyladenine (3MeA). ALS-hMSC cell death in response to DSB was not apoptotic as it was caspase independent. This unique ALS-hMSC specific response to DNA damage emphasizes the possibility that an intrinsic abnormal regulatory mechanism controlling autophagy initiation exists in ALS-patient derived hMSC. This mechanism may also be relevant to the most affected tissues in ALS. Hence, our approach might be opening avenues for new therapies at the personalized level for ALS.

  6. The Role of Mitochondrial DNA in Mediating Alveolar Epithelial Cell Apoptosis and Pulmonary Fibrosis

    PubMed Central

    Kim, Seok-Jo; Cheresh, Paul; Jablonski, Renea P.; Williams, David B.; Kamp, David W.

    2015-01-01

    Convincing evidence has emerged demonstrating that impairment of mitochondrial function is critically important in regulating alveolar epithelial cell (AEC) programmed cell death (apoptosis) that may contribute to aging-related lung diseases, such as idiopathic pulmonary fibrosis (IPF) and asbestosis (pulmonary fibrosis following asbestos exposure). The mammalian mitochondrial DNA (mtDNA) encodes for 13 proteins, including several essential for oxidative phosphorylation. We review the evidence implicating that oxidative stress-induced mtDNA damage promotes AEC apoptosis and pulmonary fibrosis. We focus on the emerging role for AEC mtDNA damage repair by 8-oxoguanine DNA glycosylase (OGG1) and mitochondrial aconitase (ACO-2) in maintaining mtDNA integrity which is important in preventing AEC apoptosis and asbestos-induced pulmonary fibrosis in a murine model. We then review recent studies linking the sirtuin (SIRT) family members, especially SIRT3, to mitochondrial integrity and mtDNA damage repair and aging. We present a conceptual model of how SIRTs modulate reactive oxygen species (ROS)-driven mitochondrial metabolism that may be important for their tumor suppressor function. The emerging insights into the pathobiology underlying AEC mtDNA damage and apoptosis is suggesting novel therapeutic targets that may prove useful for the management of age-related diseases, including pulmonary fibrosis and lung cancer. PMID:26370974

  7. Mitochondrial DNA damage and a hypoxic response are induced by CoCl2 in rat neuronal PC12 cells

    PubMed Central

    Wang, Guichun; Hazra, Tapas K.; Mitra, Sankar; Lee, Heung-Man; Englander, Ella W.

    2000-01-01

    Generation of reactive oxygen species (ROS) and activation of a transcriptional program that mimics the hypoxic response have been documented in cultured cells in the presence of cobalt chloride. We found that in the presence of hypoxia-mimicking concentrations of CoCl2, mitochondrial but not nuclear DNA damage is induced in rat neuronal, PC12 cells. To our knowledge, this is the first documentation of induction of mitochondrial DNA (mtDNA) damage under these conditions. Likewise, we provide the first evidence for elevation of MYH, the mammalian homolog of the Escherichia coli MutY DNA glycosylase, in mammalian cells. Recently, the human MYH was implicated in repair of oxidative DNA damage and shown to carry a mitochondrial localization sequence. Here, an induction of mtDNA damage and a time-dependent increase in the MYH level were detected with exposure of cells to 100 µM CoCl2. In addition, the levels of proteins involved in cellular responses to hypoxia, ROS and nuclear DNA damage; hypoxia-inducible factor 1α (HIF-1α), p53, p21 and PCNA were also modulated temporally. Earlier studies suggested that the mtDNA is a primary target for oxidative damage. Our findings extend these observations and suggest that activation of DNA repair processes is associated with the presence of mtDNA damage. PMID:10773083

  8. Mitochondrial DNA damage and a hypoxic response are induced by CoCl(2) in rat neuronal PC12 cells.

    PubMed

    Wang, G; Hazra, T K; Mitra, S; Lee, H M; Englander, E W

    2000-05-15

    Generation of reactive oxygen species (ROS) and activation of a transcriptional program that mimics the hypoxic response have been documented in cultured cells in the presence of cobalt chloride. We found that in the presence of hypoxia-mimicking concentrations of CoCl(2), mitochondrial but not nuclear DNA damage is induced in rat neuronal, PC12 cells. To our knowledge, this is the first documentation of induction of mitochondrial DNA (mtDNA) damage under these conditions. Likewise, we provide the first evidence for elevation of MYH, the mammalian homolog of the Escherichia coli MutY DNA glycosylase, in mammalian cells. Recently, the human MYH was implicated in repair of oxidative DNA damage and shown to carry a mitochondrial localization sequence. Here, an induction of mtDNA damage and a time-dependent increase in the MYH level were detected with exposure of cells to 100 microM CoCl(2). In addition, the levels of proteins involved in cellular responses to hypoxia, ROS and nuclear DNA damage; hypoxia-inducible factor 1alpha(HIF-1alpha), p53, p21 and PCNA were also modulated temporally. Earlier studies suggested that the mtDNA is a primary target for oxidative damage. Our findings extend these observations and suggest that activation of DNA repair processes is associated with the presence of mtDNA damage.

  9. Artifacts associated with the measurement of oxidized DNA bases.

    PubMed

    Cadet, J; Douki, T; Ravanat, J L

    1997-10-01

    In this paper we review recent aspects of the measurement of oxidized DNA bases, currently a matter of