Sample records for 3-phenoxybenzoic acid 3-pba

  1. [Microbial degradation of 3-phenoxybenzoic acid--A review].


    Deng, Weiqin; Liu, Shuliang; Yao, Kai


    3-phenoxybenzoic acid (3-PBA) with estrogen toxicity is one of the intermediate products of most pyrethroid pesticides. 3-PBA is difficult to degrade in the natural environment, and threatens food safety and human health. Microbial degradation of pyrethroids and their intermediate product (3-PBA) has become a hot topic in recent years. Here, we reviewed microbial species, degrading enzymes and degradation genes, degradation pathways of 3-PBA degrading and the application of 3-PBA degradation strains. This article provides references for the study of 3-PBA degradation by microorganisms. PMID:26762020

  2. Biological Monitoring of 3-Phenoxybenzoic Acid in Urine by an Enzyme -Linked Immunosorbent Assay

    EPA Science Inventory

    An enzyme-linked immunosorbent assay (ELISA) method was employed for determination of the pyrethroid biomarker, 3-phenoxybenzoic acid (3-PBA) in human urine samples. The optimized coating antigen concentration was 0.5 ng/mL with a dilution of 1:4000 for the 3-PBA antibody and 1:6...

  3. Urinary concentration of 3-phenoxybenzoic acid in elementary students in South Korea

    PubMed Central

    Jo, Hye Mi; Ha, Mina; Lee, Won Jin


    Objectives Pyrethroid pesticides are among the most commonly using insecticides in South Korean households and have been the subject of considerable interest among public health professionals for their potential health effects. The objective of this study is to examine the level of urinary 3-phenoxybenzoic acid (3-PBA) among elementary students in South Korea. Methods We conducted a cross-sectional study to evaluate pyrethroid pesticide exposure levels by measuring the urinary metabolites of 3-PBA using a gas chromatography-mass spectrometry method in March 2011. Study participants were 70 Asan-area and Incheon-area elementary students. Results All respondents had values above the detection limit, and the geometric means of 3-PBA in all children were 1.85 μg/L and 1.46 μg/g creatinine. Children with the top 10% urinary levels of 3-PBA were more likely to be girls, under nine years of age, living in a rural area, and living in a residential type apartment. Conclusions South Korean children have a higher concentration of urinary 3-PBA compared with those of other countries. Further research identifying exposure pathways and intervention efforts to reduce environmental pesticide use are needed in South Korea. PMID:26602560

  4. Diet and Nondiet Predictors of Urinary 3-Phenoxybenzoic Acid in NHANES 1999–2002

    PubMed Central

    Riederer, Anne M.; Bartell, Scott M.; Barr, Dana B.; Ryan, P. Barry


    Background 3-Phenoxybenzoic acid (3PBA), a pyrethroid metabolite, was detected in 75% of urine samples analyzed for pesticides in the U.S. National Health and Nutrition Examination Survey (NHANES) 1999–2002. NHANES also includes 24-hr diet data and information on household pesticide use, activities, occupation, demographics, and other exposure factors. Objectives The objective of our study was to explore the relative importance of diet versus nondiet predictors in explaining variability in urinary 3PBA. A secondary objective was to explore whether the NHANES data could be used to identify particular foods driving 3PBA levels. Methods We divided subjects into child (6–10 years of age), teen (11–18 years), and adult (≥ 19 years) age groups and restricted our analyses to subjects in the morning sampling session who fasted for ≥ 8 hr beforehand. Regression modeling consisted of several model-building steps and a final Tobit regression on the left-censored log 3PBA measurements. We also conducted bootstrap analyses to evaluate the stability of the regression parameters. Results Reported household pesticide use was not significantly associated with urinary 3PBA in any age group. Diet was significant for all three groups, and certain foods appeared to contribute more than others. Among adults, tobacco use was positively associated with 3PBA (p = 0.0326), and positive associations were suggested with the number of cytochrome p450–inhibiting medications taken (p = 0.0652) and minutes spent gardening (p = 0.0613) in the past month. Conclusions Although exploratory, our findings underline the importance of collecting accurate data on household pesticide use and dietary intake when evaluating pyrethroid exposure–biomarker relationships. PMID:18709153

  5. [Study on cooperating degradation of cypermethrin and 3-phenoxybenzoic acid by two bacteria strains].


    Xu, Yu-Xin; Sun, Ji-Quan; Li, Xiao-Hui; Li, Shun-Peng; Chen, Yi


    The microbial cooperated reaction is one of the most important forms of microbial degradation of organic pollutants. Although there were many research reports of cooperating degradation, less report on the microbial cooperated of pyrethroid degradation to be found. We have isolated one degrading-bacteria strain named CDT3 for degradation of cypermethrin, which can degraded the cypermethrin into 3-PBA and DCVA. At the same time, we also isolated another degrading-bacteria strain named as PBM11, which could get multiplication on 3-PBA as its C source and energy source. The cooperative degradation process of cypermethrin and 3-Phenoxybenzoic acid (3-PBA) using the two degrading-bacteria strain CDT3 and PBM11 was investigated. An obvious inhibition to the cypermethrin degrading-bacterium strain CDT3 (Rhodococcus sp.) by its metabolic mediate 3-PBA was found; meanwhile there is no effect on the growth of 3-PBA degrading-bacterium strain PBM11 (Pesudomonas sp.) when the concentration of cypermethrin was lower than 200 mg/L. The degradation rate of cypermethrin by both strain CDT3 and PBM11 was higher than that by CDT3 alone. The biomass of PBM11 increased along with the degradation of cypermethrin and 3-PBA, but that of CDT3 not. There was no the accumulation of 3-PBA when the simultaneous addition of strain CDT3 and PBM11, however, an obvious one within 24h if inoculation of strain PBM11 was later 24h after inoculation of strain CDT3, Subsequently the 3-PBA was degraded rapidly by strain PBM11. The strains CDT3 and PBM11 showed some characteristics of co-metabolism, however it is not actual degradation form of co-metabolism. For examples, although the degrading sub product of cypermethrin by CDT3 could be utilized, the multiplication of PBM11 could not enhance the multiplication of CDT3, implied there is no obvious relationship between the two strains. Also, to add PBM11 could eliminate the inhibition of 3-PBA to CDT3. Thus, the cooperating degradation of strains CDT3

  6. An enzyme-linked immunosorbent assay for detecting 3-phenoxybenzoic acid in plasma and its application in farmers and consumers

    PubMed Central

    Thiphom, Sarunya; Prapamontol, Tippawan; Chantara, Somporn; Mangklabruks, Ampica; Suphavilai, Chaisuree; Ahn, Ki Chang; Gee, Shirley J.; Hammock, Bruce D.


    The aim of this study was to identify a plasma biomarker of exposure to pyrethroid insecticides. A major metabolite, 3-phenoxybenzoic acid (3-PBA), can be detected in urine but urinary 3-PBA cannot be used to assess the active dose. The 3-PBA-adduct represents a much more persistent class of biomarkers than metabolites excreted into urine, having half lives up to several weeks or months. We developed an enzyme-linked immunosorbent assay (ELISA) for total 3-PBA including adduct formed after alkaline hydrolysis, liquid-liquid extraction (LLE) and solid phase extraction (SPE) of the sample. The developed ELISA had an IC50 value of 26.7 ng/mL. The intra- and inter-assay coefficients of variation (%CV) were lower than 5% and were within the optimum condition variance (OCV) range. The LLE cleanup technique satisfactorily eliminated the matrix effect from plasma samples before SPE and ELISA analysis yielding good recoveries (85.9–99.4%) with a limit of quantitation (LOQ, 5 ng/mL) that was 30- to 47-fold more sensitive than previous studies. Moreover, the developed method could separate more than 80% of 3-PBA from adduct form. The method was successfully applied to the detection of the target in real samples obtained from consumers (n=50) and farmers (n=50). To our knowledge, this is the first ELISA method for detecting 3-PBA in human plasma and applied to a field study. PMID:23667388

  7. Immunochemical analysis of 3-phenoxybenzoic acid, a biomarker of forestry worker exposure to pyrethroid insecticides

    PubMed Central

    Ahn, Ki Chang; Gee, Shirley J.; Kim, Hee-Joo; Aronov, Pavel A.; Vega, Helen; Krieger, Robert I.


    Pyrethroid insecticides widely used in forestry, agricultural, industrial, and residential applications have potential for human exposure. Short sample preparation time and sensitive, economical high-throughput assays are needed for biomonitoring studies that analyze a large number of samples. An enzyme-linked immunosorbent assay (ELISA) was used for determining 3-phenoxybenzoic acid (3-PBA), a general urinary biomarker of exposure to some pyrethroid insecticides. A mixed-mode solid-phase extraction reduced interferences from acid hydrolyzed urine and gave 110±6% recoveries from spiked samples. The method limit of quantification was 2 μg/L. Urine samples were collected from forestry workers that harvest pine cone seeds where pyrethroid insecticides were applied at ten different orchards. At least four samples for each worker were collected in a 1-week period. The 3-PBA in workers classified as high, low, or no exposure based on job analysis over all sampling days was 6.40± 9.60 (n=200), 5.27±5.39 (n=52), and 3.56±2.64 ng/mL (n=34), respectively. Pair-wise comparison of the differences in least squares means of 3-PBA concentrations among groups only showed a significant difference between high and no exposure. Although this difference was not significant when 3-PBA excretion was normalized by creatinine excretion, the general trend was still apparent. No significant differences were observed among days or orchards. This ELISA method using a 96-well plate was performed as a high-throughput tool for analyzing around 300 urine samples measured in triplicate to provide data for workers exposure assessment. PMID:21717113

  8. Concentrations of the urinary pyrethroid metabolite 3-phenoxybenzoic acid in farm worker families in the MICASA study

    SciTech Connect

    Trunnelle, Kelly J.; Bennett, Deborah H.; Ahn, Ki Chang; Schenker, Marc B.; Tancredi, Daniel J.; Gee, Shirley J.; Stoecklin-Marois, Maria T.; Hammock, Bruce D.


    Indoor pesticide exposure is a growing concern, particularly from pyrethroids, a commonly used class of pesticides. Pyrethroid concentrations may be especially high in homes of immigrant farm worker families who often live in close proximity to agricultural fields, and are faced with poor housing conditions, causing higher pest infestation and more pesticide use. We investigate exposure of farm worker families to pyrethroids in a study of mothers and children living in Mendota, CA within the population-based Mexican Immigration to California: Agricultural Safety and Acculturation (MICASA) Study. We present pyrethroid exposure based on an ELISA analysis of urinary metabolite 3-phenoxybenzoic acid (3PBA) levels among 105 women and 103 children. The median urinary 3PBA levels (children=2.56 ug/g creatinine, mothers=1.46 ug/g creatinine) were higher than those reported in population based studies for the United States general population, but similar to or lower than studies with known high levels of pyrethroid exposure. A positive association was evident between poor housing conditions and the urinary metabolite levels, showing that poor housing conditions are a contributing factor to the higher levels of 3PBA seen in the urine of these farm worker families. Further research is warranted to fully investigate sources of exposure. - Highlights: • We investigate exposure of farm worker families to pyrethroids. • We present pyrethroid exposure based on an ELISA analysis of urinary 3PBA levels. • 3PBA levels were higher than those reported for the U.S. general population. • Poor housing conditions may be associated with pyrethroid exposure.

  9. Association of urinary 3-phenoxybenzoic acid levels with self-reported depression symptoms in a rural elderly population in Asan, South Korea

    PubMed Central

    Kim, Bokyeong; Jung, Ara; Yun, Dongmin; Lee, Mira; Lee, Mee-Ri; Choi, Yoon-Hyeong; Kim, Yongbae; Park, Choonghee; Hong, Yun-Chul; Kim, Sungroul


    Objectives: This study aimed to evaluate the association between presence of depression symptoms and the exposure level to insecticides among aged population in rural area, determined via measured levels of urinary 3-phenoxybenzoic acid (3-PBA), after controlling for socioeconomic confounding factors. Methods: Using a cross-sectional study design, we randomly recruited participants for our study (161 male and 239 female) from rural areas of Asan, Chungnam, Korea. Environmental risk factor exposure was assessed using a questionnaire, and gas chromatography- mass spectrometry was used to analyze urinary 3-PBA levels. We used a logistic regression analysis to assess the association of urinary 3-PBA levels with the presence of self-reported depression symptoms. Results: After controlling for creatinine levels, the median (interquartile range) concentration of 3-PBA was approximately 1.5 times (p<0.05) higher among female (1.54 [0.90 to 2.35]) μg/g) than among male (1.06 [0.64 to 1.81] μg/g). Our study found that among female participants, the unit increase in 3-PBA levels exhibited a likely positive association (odds ratio, 1.12; 95% confidence interval, 1.00 to 1.25) with an increased risk of presence of self-reported depression symptoms, after adjusting for socioeconomic insurance type, daily physical condition, marital status, smoking status, and age. Conclusions: Given our finding of a potential association between the presence of selfreported depression symptoms and 3-PBA levels, precautions should be considered to minimize exposure to insecticides and thus protect the health of aged residents in rural areas. PMID:25997450

  10. Predictors of urinary levels of 2,4-dichlorophenoxyacetic acid, 3,5,6-trichloro-2-pyridinol, 3-phenoxybenzoic acid, and pentachlorophenol in 121 adults in Ohio.


    Morgan, Marsha K


    Limited data exist on the driving factors that influence the non-occupational exposures of adults to pesticides using urinary biomonitoring. In this work, the objectives were to quantify the urinary levels of 2,4-dichlorophenoxyacetic acid (2,4-D), 3,5,6-trichloro-2-pyridinol (TCP), 3-phenoxybenzoic acid (3-PBA), and pentachlorophenol (PCP) in 121 adults over a 48-h monitoring period and to examine the associations between selected sociodemographic and lifestyle factors and urinary levels of each pesticide biomarker. Adults, ages 20-49 years old, were recruited from six counties in Ohio (OH) in 2001. The participants collected 4-6 spot urine samples and completed questionnaires and diaries at home over a 48-h monitoring period. Urine samples were analyzed for 2,4-D, TCP, 3-PBA, and PCP by gas chromatography/mass spectrometry. Multiple regression modeling was used to determine the impact of selected sociodemographic and lifestyle factors on the log-transformed (ln) levels of each pesticide biomarker in adults. The pesticide biomarkers were detected in ≥ 89% of the urine samples, except for 3-PBA (66%). Median urinary levels of 2,4-D, TCP, 3-PBA, and PCP were 0.7, 3.4, 0.3, and 0.5 ng/mL, respectively. Results showed that 48-h sweet/salty snack consumption, 48-h time spend outside at home, and ln(creatinine) levels were significant predictors (p < 0.05), and race was a marginally significant predictor (p = 0.093) of the adults' ln(urinary 2,4-D) concentrations. Strong predictors (p < 0.05) of the adults' ln(urinary TCP) concentrations were urbanicity, employment status, sampling season, and ln(creatinine) levels. For 3-PBA, sampling season, pet ownership and removal of shoes before entering the home were significant predictors (p < 0.05) of the adults' ln(urinary 3-PBA) levels. Finally for PCP, removal of shoes before entering the home and ln(creatinine) levels were significant predictors (p < 0.05), and pet ownership was a marginally significant predictor (p = 0

  11. Monitoring of Total Type II Pyrethroid Pesticides in Citrus Oils and Water by Converting to a Common Product 3-Phenoxybenzoic Acid

    PubMed Central

    McCoy, Mark R.; Yang, Zheng; Fu, Xun; Ahn, Ki Chang; Gee, Shirley J.; Bom, David C.; Zhong, Ping; Chang, Dan; Hammock, Bruce D.


    Pyrethroids are a class of insecticides that are becoming increasingly popular in agricultural and home use applications. Sensitive assays for pyrethroid insecticides in complex matrices are difficult both with instrumental and immunochemical methods. Environmental analysis of the pyrethroids by immunoassay requires either knowing which pyrethroids contaminate the source or the use of non-specific antibodies with cross reactivities to a class of compounds. We describe an alternative method that converts the type-II-pyrethroids to a common chemical product, 3-phenoxybenzoic acid (3-PBA), prior to analysis. This method is much more sensitive than detecting the parent compound, and it is much easier to detect a single compound rather than an entire class of compounds. This is useful in screening for pyrethroids as a class or in situations where a single type of pyrethroid is used. We demonstrated this technique in both citrus oils and environmental water samples with conversion rates of the pyrethroid to 3-PBA that range from 45%-75% and methods that require no extraction steps for either the immunoassay or LC-MS/MS techniques. Limits of detection for this technique applied to orange oil are 5 nM, 2 μM, and 0.8 μM when detected by LC-MS/MS, GC-MS, and immunoassay respectively. The limit of detection for pyrethroids in water when detected by immunoassay was 2 nM. PMID:22486225

  12. PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.


    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng; Jiang, Jiandong


    The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  13. PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

    PubMed Central

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng


    The 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1T by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  14. Predictors of urinary levels of 2,4-dichlorophenoxyacetic acid, 3,5,6-trichloro-2-pyridinol, 3-phenoxybenzoic acid, and pentachlorophenol in 121 adults in Ohio

    EPA Science Inventory

    Limited data exist on the driving factors that influence the non-occupational exposures of adults to pesticides using urinary biomonitoring. In this work, the objectives were to quantify the urinary levels of 2,4-dichlorophenoxyacetic acid (2,4-D), 3,5,6-trichloro-2-pyridinol (TC...

  15. A Novel Angular Dioxygenase Gene Cluster Encoding 3-Phenoxybenzoate 1′,2′-Dioxygenase in Sphingobium wenxiniae JZ-1

    PubMed Central

    Wang, Chenghong; Chen, Qing; Wang, Rui; Shi, Chao; Yan, Xin; Li, Shunpeng


    Sphingobium wenxiniae JZ-1 utilizes a wide range of pyrethroids and their metabolic product, 3-phenoxybenzoate, as sources of carbon and energy. A mutant JZ-1 strain, MJZ-1, defective in the degradation of 3-phenoxybenzoate was obtained by successive streaking on LB agar. Comparison of the draft genomes of strains JZ-1 and MJZ-1 revealed that a 29,366-bp DNA fragment containing a putative angular dioxygenase gene cluster (pbaA1A2B) is missing in strain MJZ-1. PbaA1, PbaA2, and PbaB share 65%, 52%, and 10% identity with the corresponding α and β subunits and the ferredoxin component of dioxin dioxygenase from Sphingomonas wittichii RW1, respectively. Complementation of pbaA1A2B in strain MJZ-1 resulted in the active 3-phenoxybenzoate 1′,2′-dioxygenase, but the enzyme activity in Escherichia coli was achieved only through the coexpression of pbaA1A2B and a glutathione reductase (GR)-type reductase gene, pbaC, indicating that the 3-phenoxybenzoate 1′,2′-dioxygenase belongs to a type IV Rieske non-heme iron aromatic ring-hydroxylating oxygenase system consisting of a hetero-oligomeric oxygenase, a [2Fe-2S]-type ferredoxin, and a GR-type reductase. The pbaC gene is not located in the immediate vicinity of pbaA1A2B. 3-Phenoxybenzoate 1′,2′-dioxygenase catalyzes the hydroxylation in the 1′ and 2′ positions of the benzene moiety of 3-phenoxybenzoate, yielding 3-hydroxybenzoate and catechol. Transcription of pbaA1A2B and pbaC was induced by 3-phenoxybenzoate, but the transcriptional level of pbaC was far less than that of pbaA1A2B, implying the possibility that PbaC may not be the only reductase that can physiologically transfer electrons to PbaA1A2B in strain JZ-1. Some GR-type reductases from other sphingomonad strains could also transfer electrons to PbaA1A2B, suggesting that PbaA1A2B has a low specificity for reductase. PMID:24747891

  16. Dachtal Isomers and Acidic Herbicides and Pesticides in Eggs of Osprey (Pandion haliaetus) from the Seattle and Everett Areas, Washington, U.S.A

    USGS Publications Warehouse

    Chu, S.; Henny, Charles J.; Kaiser, James L.; Drouillard, K.G.; Haffner, G.D.; Letcher, R.J.


    Current-use chlorophenoxy herbicides including 2,4-dichlorophenoxyacetic acid, dicamba, triclopyr, dicamba, dimethyl tetrachloroterephthalate (DCPA or dacthal), and the metabolite of pyrethroids, 3-phenoxybenzoic acid (3-PBA), and the fungicide, chlorothalonil, were investigated in the eggs of osprey (Pandion haliaetus) that were collected from 15 sites from five study areas Puget Sound/Seattle area of Washington State, USA. DCPA differs from acidic chlorophenoxy herbicides, and is not readily hydrolyzed to free acid or acid metabolites, and thus we developed a new method. Of the 12 chlorophenoxy herbicides and chlorothalonil analyzed only DCPA could be quantified at six of these sites (2.0 to 10.3 pg/g fresh weight). However, higher levels (6.9 to 85.5 pg/g fresh weight) of the unexpected DCPA structural isomer, dimethyl tetrachlorophthalate (diMe-TCP) were quantified in eggs from all sites. diMe-TCP concentrations tended to be higher in eggs from the Everett Harbor area. As diMe-TCP is not an industrial product, and not commercially available, the source of diMe-TCP is unclear. Regardless, these findings indicate that DCPA and diMe-TCP can be accumulated in the food chain of fish-eating osprey, and transferred in ovo to eggs, and thus may be of concern to the health of the developing chick and the general reproductive health of this osprey population.

  17. Determination of the pyrethroid insecticide metabolite 3-PBA in plasma and urine samples from farmer and consumer groups in northern Thailand

    PubMed Central



    In this study, the enzyme-linked immunosorbent assays (ELISA) were modified to detect 3-PBA in plasma (including the adducted form) and urine among a large group of consumers and farmers in an agricultural area. The samples were collected on the same day in the morning from 100 consumers (50 females, 50 males) and 100 farmers (50 females, 50 males) in the Fang district, Chiang Mai province, northern Thailand. The ELISA was very sensitive having an IC50 value of 26.7 and 15.3 ng/mL, a limit of quantitation of 5 and 2.5 ng/mL and a limit of detection of 1.08 and 1.94 ng/mL for plasma and urine, respectively. These methods had low (< 5%) intra- and inter-assay coefficients of variation. The extraction technique satisfactorily eliminated the matrix effect from samples before ELISA analysis, yielding good recoveries (85.9–99.4% and 87.3–98.0%, respectively). For the volunteer study, the detection rate for plasma 3-PBA was 24% in consumers and 42% in farmers, but the median and range values were similar (median 5.87 ng/mL, range 5.16–8.44 ng/mL in consumers and 6.27 ng/mL, range 4.29–9.57 ng/mL in farmers). The rate of detection in the urine was similar (76% and 69%, in consumers and in farmers), yet the median concentration was significantly higher in farmers (8.86 μg/g creatinine in consumers vs 16.1 μg/g creatinine in farmers) and the range also much wider in farmers (1.62–80.5 μg/g creatinine in consumers and 0.80–256.2 μg/g creatinine in farmers). There was no correlation between plasma 3-PBA and urinary 3-PBA concentrations in the study presumably because plasma 3-PBA is a measure of cumulative exposures while urinary 3-PBA reflects acute exposures. In addition, metabolism and excretion of pyrethroids varies by individual. Nevertheless, this study demonstrated that these volunteers were exposed to pyrethroids. To our knowledge, this is the first report that compared plasma 3-PBA and urinary 3-PBA in a large group of volunteers. The ELISA method

  18. Exposure of flight attendants to pyrethroid insecticides on commercial flights: urinary metabolite levels and implications

    PubMed Central

    Wei, Binnian; Mohan, Krishnan R.; Weisel, Clifford P.


    Pyrethroid insecticides have been used for disinsection of commercial aircrafts. However, little is known about the pyrethroids exposure of flight attendants. The objective of the study was to assess pyrethroids exposure of flight attendants working on commercial aircrafts through monitoring the urinary pyrethroids metabolite levels. Eighty four urine samples were collected from 28 flight attendants, 18 – 65 years of age, with seventeen working on planes that were non-disinsected, and eleven working on planes that had been disinsected. Five urinary metabolites of pyrethroids were measured using gas chromatographic–mass spectrometric method: 3-phenoxybenzoic acid (3-PBA), cis-/trans-3-(2,2-Dichlorovinyl)-2,2-dimethylcyclo-propane carboxylic acid (cis-/trans-Cl2CA), cis-3-(2,2-dibromovinyl)-2,2-dimethylcyclo-propane-1-carboxylic acid (cis-Br2CA) and 4-fluoro-3-phenoxybenzoic acid (4F-3-PBA). Flight attendants working on disinsected planes had significantly higher urinary levels of 3-PBA, cis- and trans-Cl2CA in pre, post- and 24hr-post flight samples than those on planes which did not report having been disinsected. Urinary levels of cis-Br2CA and 4F-3-PBA did not show significant differences between the two groups. Flight attendants working on international flights connected to Australia had higher urinary levels of 3-PBA, cis- and trans-Cl2CA than those on either domestic and other international flights flying among Asia, Europe and North America. Post-disinsection duration (number of days from disinsection date to flight date) was the most significant factor affecting the urinary pyrethroid metabolites levels of 3-PBA, cis- and trans-Cl2CA of the group flying on disinsected aircraft. It was concluded that working on commercial aircrafts disinsected by pyrethroids resulted in elevated body burden of 3-PBA, cis- and trans-Cl2CA. PMID:21937269

  19. Production of Insecticide Degradates in Juices: Implications for Risk Assessment.


    Radford, Samantha A; Panuwet, Parinya; Hunter, Ronald E; Barr, Dana Boyd; Ryan, P Barry


    This study was designed to observe the production of degradates of two organophosphorus insecticides and one pyrethroid insecticide in beverages. Purified water, white grape juice, apple juice, and red grape juice were fortified with 500 ng/g malathion, chlorpyrifos, and permethrin, and aliquots were extracted for malathion dicarboxylic acid (MDA), 3,5,6-trichloro-2-pyridinol (TCPy), and 3-phenoxybenzoic acid (3-PBA) several times over a 15 day period of being stored in the dark at 2.5 °C. Overall, first-order kinetics were observed for production of MDA, and statistically significant production of TCPy was also observed. Statistically significant production of 3-phenoxybenzoic acid was not observed. Results indicate that insecticides degrade in food and beverages, and this degradation may lead to preexisting insecticide metabolites in the beverages. Therefore, it is suggested that caution should be exercised when using urinary insecticide metabolites to assess exposure and risk. PMID:27213611

  20. Characterization of a novel β-cypermethrin-degrading Aspergillus niger YAT strain and the biochemical degradation pathway of β-cypermethrin.


    Deng, Weiqin; Lin, Derong; Yao, Kai; Yuan, Huaiyu; Wang, Zhilong; Li, Jianlong; Zou, Likou; Han, Xinfeng; Zhou, Kang; He, Li; Hu, Xinjie; Liu, Shuliang


    Aspergillus niger YAT strain was obtained from Chinese brick tea (Collection number: CGMCC 10,568) and identified on the basis of morphological characteristics and internal transcribed spacer (ITS) sequence. The strain could degrade 54.83 % of β-cypermethrin (β-CY; 50 mg L(-1)) in 7 days and 100 % of 3-phenoxybenzoic acid (3-PBA; 100 mg L(-1)) in 22 h. The half-lives of β-CY and 3-PBA range from 3.573 to 11.748 days and from 5.635 to 12.160 h, respectively. The degradation of β-CY and 3-PBA was further described using first-order kinetic models. The pathway and mechanism of β-CY degraded by YAT were investigated by analyzing the degraded metabolites through high-performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry (LC-MS). Relevant enzymatic activities and substrate utilization were also investigated. β-CY degradation products were analyzed. Results indicated that YAT strain transformed β-CY into 3-PBA. 3-PBA was then gradually transformed into permethric acid, protocatechuic acid, 3-hydroxy-5-phenoxy benzoic acid, gallic acid, and phenol gradually. The YAT strain can also effectively degrade these metabolites. The results indicated that YAT strain has potential applications in bioremediation of pyrethroid insecticide (PI)-contaminated environments and fermented food. PMID:26022858

  1. Review of Pesticide Urinary Biomarker Measurements from Selected US EPA Children’s Observational Exposure Studies

    PubMed Central

    Egeghy, Peter P.; Cohen Hubal, Elaine A.; Tulve, Nicolle S.; Melnyk, Lisa J.; Morgan, Marsha K.; Fortmann, Roy C.; Sheldon, Linda S.


    Children are exposed to a wide variety of pesticides originating from both outdoor and indoor sources. Several studies were conducted or funded by the EPA over the past decade to investigate children’s exposure to organophosphate and pyrethroid pesticides and the factors that impact their exposures. Urinary metabolite concentration measurements from these studies are consolidated here to identify trends, spatial and temporal patterns, and areas where further research is required. Namely, concentrations of the metabolites of chlorpyrifos (3,5,6-trichloro-2-pyridinol or TCPy), diazinon (2-isopropyl-6-methyl-4-pyrimidinol or IMP), and permethrin (3-phenoxybenzoic acid or 3-PBA) are presented. Information on the kinetic parameters describing absorption and elimination in humans is also presented to aid in interpretation. Metabolite concentrations varied more dramatically across studies for 3-PBA and IMP than for TCPy, with TCPy concentrations about an order of magnitude higher than the 3-PBA concentrations. Temporal variability was high for all metabolites with urinary 3-PBA concentrations slightly more consistent over time than the TCPy concentrations. Urinary biomarker levels provided only limited evidence of applications. The observed relationships between urinary metabolite levels and estimates of pesticide intake may be affected by differences in the contribution of each exposure route to total intake, which may vary with exposure intensity and across individuals. PMID:21655147

  2. In vitro human metabolism of permethrin isomers alone or as a mixture and the formation of the major metabolites in cryopreserved primary hepatocytes.


    Willemin, M-E; Kadar, A; de Sousa, G; Leclerc, E; Rahmani, R; Brochot, C


    In vitro metabolism of permethrin, a pyrethroid insecticide, was assessed in primary human hepatocytes. In vitro kinetic experiments were performed to estimate the Michaelis-Menten parameters and the clearances or formation rates of the permethrin isomers (cis- and trans-) and three metabolites, cis- and trans-3-(2,2 dichlorovinyl)-2,2-dimethyl-(1-cyclopropane) carboxylic acid (cis- and trans-DCCA) and 3-phenoxybenzoic acid (3-PBA). Non-specific binding and the activity of the enzymes involved in permethrin's metabolism (cytochromes P450 and carboxylesterases) were quantified. Trans-permethrin was cleared more rapidly than cis-permethrin with a 2.6-factor (25.7±0.6 and 10.1±0.3 μL/min/10(6) cells respectively). A 3-factor was observed between the formation rates of DCCA and 3-PBA obtained from trans- and cis-permethrin. For both isomers, the rate of formation of DCCA was higher than the one of 3-PBA. The metabolism of the isomers in mixture was also quantified. The co-incubation of isomers at different ratios showed the low inhibitory potential of cis- and trans-permethrin on each other. The estimates of the clearances and the formation rates in the co-incubation condition did not differ from the estimates obtained with a separate incubation. These metabolic parameters may be integrated in physiologically based pharmacokinetic (PBPK) models to predict the fate of permethrin and metabolites in the human body. PMID:25765475

  3. Urinary Metabolites of Organophosphate and Pyrethroid Pesticides and Neurobehavioral Effects in Chinese Children.


    Wang, Na; Huang, Mengying; Guo, Xinyan; Lin, Ping


    Organophosphate (OP) and pyrethroid (PYR) pesticides are widely used in China. However, few studies have investigated the neurobehavioral outcomes of Chinese children exposed to low levels of OP and PYR. We investigated urinary metabolite levels and their association with exposure characteristics and the neurobehavior of children. For all children, biomarker measurements were made in the same interval relative to neurobehavioral testing. We analyzed the morning urine samples of 406 children aged 3-6 years from Nanjing, China. The Kruskal-Wallis and Wilcoxon rank sum tests were used to identify the associations between urinary metabolite levels and exposure characteristics. Multiple linear regression models were used to test the associations between urinary metabolite levels and neurobehavioral test scores after adjusting for covariates (e.g., sex, age, and education expense). The detection of 3,5,6-trichloropyridinol (TCP) and 3-phenoxybenzoic acid (3-PBA) in the urine was positively associated with living areas adjacent to agricultural fields and using indoor mosquito repellent incense. These two metabolites were negatively associated with the soaking time of fruits and vegetables. When treated as dichotomous variables, TCP was significantly associated with arithmetic test scores in adjusted models, and 3-PBA was significantly associated with the scores on the Chinese Binet and arithmetic tests. When treated as a continuous variable, higher urinary 3-PBA levels were significantly associated with lower cancellation test scores. Our findings suggest that exposure to organophosphate and pyrethroid pesticides may have a significant impact on children's working memory and verbal comprehension. PMID:27524288

  4. Relationship between Urinary Pesticide Residue Levels and Neurotoxic Symptoms among Women on Farms in the Western Cape, South Africa

    PubMed Central

    Motsoeneng, Portia M.; Dalvie, Mohamed A.


    Background: This cross-sectional study aimed to investigate the relationship between urinary pesticide residue levels and neurotoxic symptoms amongst women working on Western Cape farms in South Africa. Method: A total of 211 women were recruited from farms (n = 121) and neighbouring towns (n = 90). Participant assessment was via a Q16 questionnaire, reporting on pesticide exposures and measurement of urinary OP metabolite concentrations of dialkyl phosphates (DAP) and chlorpyriphos, 3,5,6-trichloropyridinol (TCPY) and of pyrethroid (PYR) metabolite concentrations (3- phenoxybenzoic acid (3PBA), 4-fluoro-3-phenoxybenzoic acid (4F3PBA), cis-2,2-dibromovinyl-2,2-dimethylcyclopropane-1-carboxylic acid (DBCA), and the cis- and trans isomers of 2,2-dichlorovinyl-2,2-dimethylcyclopropane-1-carboxylic acid. Results: Median urinary pesticide metabolites were slightly (6%–49%) elevated in the farm group compared to the town group, with 2 metabolites significantly higher and some lower in the farm group. The prevalence of all Q16 symptoms was higher amongst farm women compared to town women. Three Q16 symptoms (problems with buttoning, reading and notes) were significantly positively associated with three pyrethroid metabolites (cis- and trans-DCCA and DBCA), although associations may due to chance as multiple comparisons were made. The strongest association for a pyrethroid metabolite was between problems with buttoning and DBCA (odds ratio (OR) = 8.93, 95% confidence interval (CI):1.71–46.5. There was no association between Q16 symptoms and OP metabolites. Conclusions: Women farm residents and rural women from neighbouring towns in the Western Cape are exposed to OP and PYR pesticides. The study did not provide strong evidence that pesticides are associated with neurotoxic symptoms but associations found could be explored further. PMID:26042367

  5. Population-Based Biomonitoring of Exposure to Organophosphate and Pyrethroid Pesticides in New York City

    PubMed Central

    Jacobson, J. Bryan; Kass, Daniel; Barr, Dana Boyd; Davis, Mark; Calafat, Antonia M.; Aldous, Kenneth M.


    Background: Organophosphates and pyrethroids are the most common classes of insecticides used in the United States. Widespread use of these compounds to control building infestations in New York City (NYC) may have caused higher exposure than in less-urban settings. Objectives: The objectives of our study were to estimate pesticide exposure reference values for NYC and identify demographic and behavioral characteristics that predict exposures. Methods: The NYC Health and Nutrition Examination Survey was a population-based, cross-sectional study conducted in 2004 among adults ≥ 20 years of age. It measured urinary concentrations of organophosphate metabolites [dimethylphosphate (DMP), dimethylthiophosphate (DMTP), dimethyldithiophosphate, diethylphosphate, diethylthiophosphate, and diethyldithiophosphate] in 883 participants, and pyrethroid metabolites [3-phenoxybenzoic acid (3-PBA), trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane-1-carboxylic acid (trans-DCCA), 4-fluoro-3-phenoxybenzoic acid, and cis-3-(2,2-dibromovinyl)-2,2-dimethylcyclopropane-1-carboxylic acid] in 1,452 participants. We used multivariable linear regression to estimate least-squares geometric mean total dialkylphospate (ΣDAP) and 3-PBA concentrations across categories of predictors. Results: The dimethyl organophosphate metabolites had the highest 95th percentile concentrations (87.4 μg/L and 74.7 μg/L for DMP and DMTP, respectively). The highest 95th percentiles among pyrethroid metabolites were measured for 3-PBA and trans-DCCA (5.23 μg/L and 5.94 μg/L, respectively). Concentrations of ΣDAP increased with increasing age, non-Hispanic white or black compared with Hispanic race/ethnicity, professional pesticide use, and increasing frequency of fruit consumption; they decreased with non-green vegetable consumption. Absolute differences in geometric mean urinary 3-PBA concentrations across categories of predictors were too small to be meaningful. Conclusion: Estimates of exposure to

  6. Human semen quality and sperm DNA damage in relation to urinary metabolites of pyrethroid insecticides

    PubMed Central

    Meeker, John D.; Barr, Dana B.; Hauser, Russ


    BACKGROUND Exposure to synthetic pyrethroid insecticides is widespread, and is expected to increase among the general population due to the need to replace other common insecticides following regulatory use restrictions. On the basis of limited studies, there is animal and human evidence for altered reproductive or endocrine function following pyrethroid exposure. METHODS The present study measured urinary pyrethroid metabolites [3-phenoxybenzoic acid (3PBA) and cis- and trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane carboxylic acid (CDCCA and TDCCA)], semen quality, sperm motion parameters and sperm DNA damage with the neutral comet assay in 207 men recruited from an infertility clinic. RESULTS In multivariate analysis, the highest 3PBA quartile was associated with a suggestive 20.2 million sperm/ml reduction (95% confidence interval −37.1 to + 2.6) in sperm concentration compared with men below the 3PBA median. There were significant inverse associations between TDCCA and sperm motility and sperm motion parameters when adjusting for CDCCA and other covariates. The highest TDCCA quartile was associated with a 15.5% decline (95% confidence interval −26.2 to −4.8) in sperm motility compared with men below the median. In multiple logistic analyses, there were dose-dependent increased odds for below reference sperm concentration, motility and morphology in relation to TDCCA. Among the comet assay measures, 3PBA and CDCCA were associated with increased sperm DNA damage, measured as percent DNA in the comet tail. CONCLUSIONS We found evidence for reduced semen quality and increased sperm DNA damage in relation to urinary metabolites of pyrethroid insecticides. These findings may be of concern due to increased pyrethroid use and prevalent human exposure. PMID:18579513

  7. Exposure to pyrethroids insecticides and serum levels of thyroid-related measures in pregnant women

    SciTech Connect

    Zhang, Jie; Hisada, Aya; Yoshinaga, Jun; Shiraishi, Hiroaki; Shimodaira, Kazuhisa; Okai, Takashi; Noda, Yumiko; Shirakawa, Miyako; Kato, Nobumasa


    Possible association between environmental exposure to pyrethroid insecticides and serum thyroid-related measures was explored in 231 pregnant women of 10–12 gestational weeks recruited at a university hospital in Tokyo during 2009–2011. Serum levels of free thyroxine (fT4), thyroid stimulating hormone (TSH) and thyroid biding globulin (TBG) and urinary pyrethroid insecticide metabolite (3-phenoxybenzoic acid, 3-PBA) were measured. Obstetrical information was obtained from medical records and dietary and lifestyle information was collected by self-administered questionnaire. Geometric mean concentration of creatinine-adjusted urinary 3-PBA was 0.363 (geometric standard deviation: 3.06) μg/g cre, which was consistent with the previously reported levels for non-exposed Japanese adult females. The range of serum fT4, TSH and TBG level was 0.83–3.41 ng/dL, 0.01–27.4 μIU/mL and 16.4–54.4 μg/mL, respectively. Multiple regression analysis was carried out by using either one of serum levels of thyroid-related measures as a dependent variable and urinary 3-PBA as well as other potential covariates (age, pre-pregnancy BMI, parity, urinary iodine, smoking and drinking status) as independent variables: 3-PBA was not found as a significant predictor of serum level of thyroid-related measures. Lack of association may be due to lower pyrethroid insecticide exposure level of the present subjects. Taking the ability of pyrethroid insecticides and their metabolite to bind to nuclear thyroid hormone (TH) receptor, as well as their ability of placental transfer, into consideration, it is warranted to investigate if pyrethroid pesticides do not have any effect on TH actions in fetus brain even though maternal circulating TH level is not affected. -- Highlights: • Pyrethroid exposure and thyroid hormone status was examined in pregnant women. • Urinary 3-phenoxybenzoic acid was used as a biomarker of exposure. • Iodine nutrition, age and other covariates were included

  8. Conversion of pesticides to biologically active products on urban hard surfaces.


    Jiang, Weiying; Gan, Jay


    Impervious pavements such as concrete are a dominant feature of urban landscapes, but their role in the fate of environmental contaminants is largely ignored. This study considered the case of urban-use pesticides, and demonstrated for the first time that surfaces such as concrete were capable of converting pesticides to other biologically active intermediates. Rapid transformation of pesticides was observed in both bench and field scale setups. Under outdoor conditions, permethrin, a heavily used pyrethroid insecticide, quickly formed 3-phenoxybenzoic acid (3-PBA) that is a known endocrine disruptor, and the level of 3-PBA was >100μg/L in the runoff water even 3months after the treatment. Fipronil, a product used for termite and ant control, was quickly transformed to desulfinyl and sulfone derivatives, with the desulfinyl level exceeding that of parent in the runoff water only 1week after treatment. Fipronil derivatives have aquatic toxicity similar or even greater than the parent fipronil. Direct sampling of deposited particles from residential exterior pavements revealed widespread presence of fipronil sulfone and desulfinyl and demonstrated their in-situ formation and accumulation on concrete. The extensive transformations were likely caused by the alkalinity and metal oxides in concrete and conducive photolytic conditions at the hard surfaces. The study findings highlight the role of urban pavements and urbanization in the geochemical cycling of anthropogenic contaminants. PMID:26971210

  9. A non-invasive biomonitoring method for assessing levels of urinary pyrethroid metabolites in diapered children by gas chromatography-mass spectrometry.


    Saito, Shun; Ueyama, Jun; Kondo, Takaaki; Saito, Isao; Shibata, Eiji; Gotoh, Masahiro; Nomura, Hiroshi; Wakusawa, Shinya; Nakai, Kunihiko; Kamijima, Michihiro


    The aim of this study was to develop a method for quantitative measurement of urinary metabolites of pyrethroid (PYR) insecticides, trans-chrysanthemumdicarboxylic acid (CDCA) and 3-phenoxybenzoic acid (3-PBA), extracted from disposable diapers. This study was approved by the university ethics committees, and informed consent was obtained from all the parents for their children and from adult volunteers. After extraction of PYR metabolites in the absorber of diapers with 5 ml acetone, the metabolites in the eluents were extracted with tert-butyl methyl ether, derivatized with 1,1,1,3,3,3-hexafluoroisopropanol and analyzed by gas chromatography-mass spectrometry. The limits of quantitation (LOQs) were 0.55 μg/l for CDCA and 0.09 μg/l for 3-PBA in 2 ml urine extracted from diapers. Within-series and between-day precisions were <14% (CV%) over the concentration range of metabolites from 0.4 to 20.4 μg/l urine. When concentrations of each metabolite were measured with the developed method after pouring 2 ml urine, which was obtained from adults both in a general population and pest control operators, on diapers, good correlations were shown between the measured results and the concentrations measured directly for the respective urine with the conventional method (Spearman's rank correlation coefficient 0.889 for CDCA and 0.989 for 3-PBA; n=27-28). The developed method would be applicable to epidemiological studies. PMID:23756699

  10. Characterization of α-cypermethrin Exposure in Egyptian Agricultural Workers

    PubMed Central

    Singleton, Steven T.; Lein, Pamela J.; Farahat, Fayssal M.; Farahat, Taghreed; Bonner, Matthew R.; Knaak, James B.; Olson, James R.


    Pyrethroids are neurotoxic insecticides that exert their effects by prolonging the open time of sodium channels, which increases the duration of neuronal excitation. α-cypermethrin (αCM) is derived from the 8-stereoisomers that together make up the pyrethroid cypermethrin, which is one of the most common pyrethroids being used in agriculture throughout the world. The objective of this study was to characterize the occupational exposure to αCM in a cohort of Egyptian agriculture workers (n=37) before, during and after 6 to 10 consecutive days of application of αCM to cotton fields. Daily spot urine specimens were collected and analyzed by GC-MS NCI for the αCM metabolites 3-phenoxybenzoic acid (3-PBA) and cis-3-(2’,2’-dichlorovinyl)-2,2-dimethylcyclopropane carboxylic acid (cis-DCCA). Prior to αCM application, median urinary levels of 3-PBA (4.59 nmol/g creatinine) were greater than cis-DCCA (0.33 nmole/g creatinine) demonstrating low background exposures to pyrethroids. During the application period for αCM, median urinary levels of both biomarkers increased (13.44 nmol 3-PBA/g creatinine and 7.76 nmol cis-DCCA/g creatinine) and ranged from 2.3–93.96 nmol 3-PBA/g creatinine and 0.09–90.94 nmol cis-DCCA/g creatinine, demonstrating that workers had a wide range of exposures to αCM. The data also demonstrate that pesticide applicators had greater exposures to αCM than workers who play a supporting role in the seasonal application of pesticides on the cotton crop. Urinary cis-DCCA and 3-PBA concentrations were elevated at 7–11 days after the cessation of αCM application, compared to baseline levels. This study is the first to use these biomarkers to quantify occupational exposures specifically to αCM. This urinary biomarker data will be useful for estimating daily internal dose, comparing exposures across job categories within the Egyptian pesticide application teams, and for modeling human exposures to αCM. PMID:24269189

  11. A method for the simultaneous quantification of eight metabolites of synthetic pyrethroids in urine of the general population using gas chromatography-tandem mass spectrometry.


    Schettgen, Thomas; Dewes, Petra; Kraus, Thomas


    Synthetic pyrethroids are highly effective, widespread insecticides applied worldwide for different purposes. Among the possible sources of exposure for the general population, pyrethroid residues in food and their prominent use for the conservation of wool carpets or in indoor pest control might play a major role. On the basis of previous works, we have developed and validated a highly sensitive and specific GC/MS/MS-method to simultaneously quantify the metabolites of the most common synthetic pyrethroids in urine, namely cis- and trans-(2,2-dichlorovinyl)-2,2-dimethylcyclopropanecarboxylic acid (DCCA), cis-(2,2-dibromovinyl)-2,2-dimethylcyclopropanecarboxylic acid (DBCA), 4-fluoro-3-phenoxybenzoic acid (F-PBA), 3-phenoxybenzoic acid (3-PBA) as well as the metabolites cis-3-(2-chloro-3,3,3-trifluoroprop-1-enyl)-2,2-dimethyl-cyclopropanecarboxylic acid (ClF3CA, λ-cyhalothrin/bifenthrin), 4-chloro-α-isopropylbenzene acetic acid (CPBA, esfenvalerate), and 2-methyl-3-phenylbenzoic acid (MPB, bifenthrin). After acidic hydrolysis to cleave conjugates in urine, the analytes are subjected to a pH-controlled extraction into n-hexane. After concentration, the analytes are derivatised using MTBSTFA and finally quantified by GC/MS/MS in EI-mode using d6-trans-DCCA and (13)C6-3-PBA as internal standards. The limit of quantification for these metabolites was 0.01 μg/L urine. Precision within and between series was determined to range between 1.6 and 10.7 % using a native quality control sample as well as a urine sample spiked with 0.3 μg/L of the analytes. To investigate possible background excretions, we analysed spot urine samples of 38 persons of the general population in a pilot study. cis- and trans-DCCA as well as 3-PBA could be quantified in every urine sample investigated, while MPB and F-PBA could only be detected in two samples. The median levels for excretion of cis-DCCA, trans-DCCA, 3-PBA, ClF3CA, DBCA, CPBA, F-PBA and MPA were 0.08, 0.17, 0.22, 0.04, 0

  12. New gas chromatographic-mass spectrometric method for the determination of urinary pyrethroid metabolites in environmental medicine.


    Schettgen, T; Koch, H M; Drexler, H; Angerer, J


    We have developed and validated a new, reliable and very sensitive method for the determination of the urinary metabolites of the most common pyrethroids in one analytical run. After acidic hydrolysis for the cleavage of conjugates, the analytes cis-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane-1-carboxylic acid (cis-Cl(2)CA), trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane-1-carboxylic acid (trans-Cl(2)CA), cis-3-(2,2-dibromovinyl)-2,2-dimethylcyclopropane-1-carboxylic acid (Br(2)CA), 4-fluoro-3-phenoxybenzoic acid (F-PBA) and 3-phenoxybenzoic acid (3-PBA) were extracted from the matrix with a liquid-liquid extraction procedure using n-hexane under acidic conditions. For further clean-up, NaOH was added to the organic phase and the carboxylic acids were re-extracted into the aqueous phase. After acidification and extraction into n-hexane again, the metabolites were then derivatised to volatile esters using N-tert.-butyldimethylsilyl-N-methyltrifluoroacetamid (MTBSTFA). Separation and detection were carried out using capillary gas chromatography with mass-selective detection (GC-MS). 2-Phenoxybenzoic acid (2-PBA) served as internal standard for the quantification of the pyrethroid metabolites. The limit of detection for all analytes was 0.05 microg/l urine. The RSD of the within-series imprecision was between 2.0 and 5.4% at a spiked concentration of 0.4 microg/l and the relative recovery was between 79.3 and 93.4%, depending on the analyte. This method was used for the analysis of urine samples of 46 persons from the general population without known exposure to pyrethroids. The metabolites cis-Cl(2)CA, trans-Cl(2)CA and 3-PBA could be found in 52, 72 and 70% of all samples with median values of 0.06, 0.11 and 0.16 microg/l, respectively. Br(2)CA and F-PBA could also be detected in 13 and 4% of the urine samples. PMID:12376120

  13. Determination of cis-permethrin, trans-permethrin and associated metabolites in rat blood and organs by gas chromatography-ion trap mass spectrometry.


    Lestremau, F; Willemin, M-E; Chatellier, C; Desmots, S; Brochot, C


    An analytical method was developed to measure cis-permethrin and trans-permethrin in different biological rat matrices and fluids (whole blood, red blood cells, plasma, brain, liver, muscle, testes, kidneys, fat and faeces). The method was also suitable for the simultaneous quantification of their associated metabolites [cis-3-(2,2-dichlorovinyl)-2,2-dimethyl-(1-cyclopropane) carboxylic acid (cis-DCCA), trans-3-(2,2-dichlorovinyl)-2,2-dimethyl-(1-cyclopropane) carboxylic acid (trans-DCCA) and 3-phenoxybenzoic acid (3-PBA)] in blood (whole blood, red blood cells, plasma) and liver. The target analytes were derivatised in samples using a methanolic/hydrochloric acid solution and then extracted with toluene. The analysis was performed by gas chromatography, and detection using ion trap tandem mass spectrometry. The selectivity obtained for complex matrices such as rat organs allowed the use of a purification step to be avoided for most of the matrices investigated. In the case of fat, where permethrin is suspected to accumulate, a dedicated purification step was developed. In fluids, the limits of quantification were at the 50 ng/mL level for the parent compounds and 3-PBA and at 25 ng/mL for cis-DCCA and trans-DCCA. For solid matrices excluding fat, the limits of quantification ranged from 50 ng/g for muscle to 100 ng/g for brain and testes for both cis-permethrin and trans-permethrin. The extraction recoveries ranged primarily between 80 and 120% for the matrix tested. The stability of blood samples was tested through the addition of 1% v/v formic acid. The methods developed were applied in a toxicokinetic study in adult rats. cis-Permethrin and the metabolites were detected in all corresponding matrices, whereas trans-permethrin was detected only in blood, plasma and faeces. PMID:24718437

  14. Dacthal and chlorophenoxy herbicides and chlorothalonil fungicide in eggs of osprey (Pandion haliaetus) from the Duwamish-Lake Washington-Puget Sound area of Washington state, USA

    USGS Publications Warehouse

    Chu, S.; Henny, C.J.; Kaiser, J.L.; Drouillard, K.G.; Haffner, G.D.; Letcher, R.J.


    Current-use chlorophenoxy herbicides including 2,4-dichlorophenoxyacetic acid, dicamba, triclopyr, dicamba, dimethyl tetrachloroterephthalate (DCPA or dacthal), and the metabolite of pyrethroids, 3-phenoxybenzoic acid (3-PBA), and the fungicide, chlorothalonil, were investigated in the eggs of osprey (Pandion haliaetus) that were collected from 15 sites from five study areas Puget Sound/Seattle area of Washington State, USA. DCPA differs from acidic chlorophenoxy herbicides, and is not readily hydrolyzed to free acid or acid metabolites, and thus we developed a new method. Of the 12 chlorophenoxy herbicides and chlorothalonil analyzed only DCPA could be quantified at six of these sites (2.0 to 10.3 pg/g fresh weight). However, higher levels (6.9 to 85.5 pg/g fresh weight) of the unexpected DCPA structural isomer, dimethyl tetrachlorophthalate (diMe-TCP) were quantified in eggs from all sites. diMe-TCP concentrations tended to be higher in eggs from the Everett Harbor area. As diMe-TCP is not an industrial product, and not commercially available, the source of diMe-TCP is unclear. Regardless, these findings indicate that DCPA and diMe-TCP can be accumulated in the food chain of fish-eating osprey, and transferred in ovo to eggs, and thus may be of concern to the health of the developing chick and the general reproductive health of this osprey population. ?? 2006 Elsevier Ltd. All rights reserved.

  15. Dacthal and chlorophenoxy herbicides and chlorothalonil fungicide in eggs of osprey (Pandion haliaetus) from the Duwamish-Lake Washington-Puget Sound area of Washington state, USA.


    Chu, Shaogang; Henny, Charles J; Kaiser, James L; Drouillard, Ken G; Haffner, G Douglas; Letcher, Robert J


    Current-use chlorophenoxy herbicides including 2,4-dichlorophenoxyacetic acid, dicamba, triclopyr, dicamba, dimethyl tetrachloroterephthalate (DCPA or dacthal), and the metabolite of pyrethroids, 3-phenoxybenzoic acid (3-PBA), and the fungicide, chlorothalonil, were investigated in the eggs of osprey (Pandion haliaetus) that were collected from 15 sites from five study areas Puget Sound/Seattle area of Washington State, USA. DCPA differs from acidic chlorophenoxy herbicides, and is not readily hydrolyzed to free acid or acid metabolites, and thus we developed a new method. Of the 12 chlorophenoxy herbicides and chlorothalonil analyzed only DCPA could be quantified at six of these sites (2.0 to 10.3 pg/g fresh weight). However, higher levels (6.9 to 85.5 pg/g fresh weight) of the unexpected DCPA structural isomer, dimethyl tetrachlorophthalate (diMe-TCP) were quantified in eggs from all sites. diMe-TCP concentrations tended to be higher in eggs from the Everett Harbor area. As diMe-TCP is not an industrial product, and not commercially available, the source of diMe-TCP is unclear. Regardless, these findings indicate that DCPA and diMe-TCP can be accumulated in the food chain of fish-eating osprey, and transferred in ovo to eggs, and thus may be of concern to the health of the developing chick and the general reproductive health of this osprey population. PMID:16707197

  16. PBPK modeling of the cis- and trans-permethrin isomers and their major urinary metabolites in rats.


    Willemin, Marie-Emilie; Desmots, Sophie; Le Grand, Rozenn; Lestremau, François; Zeman, Florence A; Leclerc, Eric; Moesch, Christian; Brochot, Céline


    Permethrin, a pyrethroid insecticide, is suspected to induce neuronal and hormonal disturbances in humans. The widespread exposure of the populations has been confirmed by the detection of the urinary metabolites of permethrin in biomonitoring studies. Permethrin is a chiral molecule presenting two forms, the cis and the trans isomers. Because in vitro studies indicated a metabolic interaction between the trans and cis isomers of permethrin, we adapted and calibrated a PBPK model for trans- and cis-permethrin separately in rats. The model also describes the toxicokinetics of three urinary metabolites, cis- and trans-3-(2,2 dichlorovinyl)-2,2-dimethyl-(1-cyclopropane) carboxylic acid (cis- and trans-DCCA), 3-phenoxybenzoic acid (3-PBA) and 4'OH-phenoxybenzoic acid (4'-OH-PBA). In vivo experiments performed in Sprague-Dawley rats were used to calibrate the PBPK model in a Bayesian framework. The model captured well the toxicokinetics of permethrin isomers and their metabolites including the rapid absorption, the accumulation in fat, the extensive metabolism of the parent compounds, and the rapid elimination of metabolites in urine. Average hepatic clearances in rats were estimated to be 2.4 and 5.7 L/h/kg for cis- and trans-permethrin, respectively. High concentrations of the metabolite 4'-OH-PBA were measured in urine compared to cis- and trans-DCCA and 3-PBA. The confidence in the extended PBPK model was then confirmed by good predictions of published experimental data obtained using the isomers mixture. The extended PBPK model could be extrapolated to humans to predict the internal dose of exposure to permethrin from biomonitoring data in urine. PMID:26802525

  17. Environmental exposure to pyrethroids and sperm sex chromosome disomy: a cross-sectional study

    PubMed Central


    Background The role of environmental pesticide exposures, such as pyrethroids, and their relationship to sperm abnormalities are not well understood. This study investigated whether environmental exposure to pyrethroids was associated with altered frequency of sperm sex chromosome disomy in adult men. Methods A sample of 75 subjects recruited through a Massachusetts infertility clinic provided urine and semen samples. Individual exposures were measured as urinary concentrations of three pyrethroid metabolites ((3-phenoxybenzoic acid (3PBA), cis- and trans- 3-(2,2-Dichlorovinyl)-1-methylcyclopropane-1,2-dicarboxylic acid (CDCCA and TDCCA)). Multiprobe fluorescence in situ hybridization for chromosomes X, Y, and 18 was used to determine XX, YY, XY, 1818, and total sex chromosome disomy in sperm nuclei. Poisson regression analysis was used to examine the association between aneuploidy rates and pyrethroid metabolites while adjusting for covariates. Results Between 25-56% of the sample were above the limit of detection (LOD) for the pyrethroid metabolites. All sex chromosome disomies were increased by 7-30% when comparing men with CDCCA and TDCCA levels above the LOD to those below the LOD. For 3PBA, compared to those below the LOD, those above the LOD had YY18 disomy rates 1.28 times higher (95% CI: 1.15, 1.42) whereas a reduced rate was seen for XY18 and total disomy (IRR = 0.82; 95% CI: 0.77, 0.87; IRR = 0.93; 95% CI: 0.87-0.97), and no association was seen for XX18 and 1818. Conclusions Our findings suggest that urinary concentrations of CDCCA and TDCCA above the LOD were associated with increased rates of aneuploidy. However the findings for 3BPA were not consistent. This is the first study to examine these relationships, and replication of our findings is needed before the association between pyrethroid metabolites and aneuploidy can be fully defined. PMID:24345058

  18. Minimizing geometric isomerization of α-cypermethrin in the residue analysis.


    Liu, Xueke; Shen, Zhigang; Wang, Peng; Liu, Chang; Yao, Guojun; He, Jiayuan; Liu, Donghui; Zhou, Zhiqiang


    Isomerization of chiral pesticides in residue analysis has not drawn much attention which can cause wrong decisions on the enantioselective environmental behavior. A residue analysis method for α-cypermethrin and its three acid metabolites, cis/trans-3-(2,2-dichlorovinyl)-2,2-dimethyl cyclopropanecarboxylic acid (cis/trans-DCVA) and 3-phenoxybenzoic acid (3-PBA), in foods such as chicken, honey, milk and pork has been established, in which the isomerization of α-cypermethrin was minimized. The target compounds were determined by GC-ECD after a derivatization reaction with 1,1,1,3,3,3-hexafluoroisopropanol. The conditions of the method were optimized by Taguchi orthogonal experiment. Under the optimized conditions, good linearity was obtained with correlation coefficients ranging from 0.9964 to 0.9998. The limits of detection were 0.001-0.005 mg kg(-1). The recoveries were 70.9-114.9% with relative standard deviations of 0.6-15%. In addition, ratios of isomerization ranged only from 2.3% to 7.0%. This method was applied in commercial animal food products. PMID:26593561

  19. Temporal variability of pyrethroid metabolite levels in bedtime, morning, and 24-h urine samples for 50 adults in North Carolina.


    Morgan, Marsha K; Sobus, Jon R; Barr, Dana Boyd; Croghan, Carry W; Chen, Fu-Lin; Walker, Richard; Alston, Lillian; Andersen, Erik; Clifton, Matthew S


    Pyrethroid insecticides are widely used to control insects in both agricultural and residential settings worldwide. Few data are available on the temporal variability of pyrethroid metabolites in the urine of non-occupationally exposed adults. In this work, we describe the study design and sampling methodology for the Pilot Study to Estimate Human Exposures to Pyrethroids using an Exposure Reconstruction Approach (Ex-R study). Two major objectives were to quantify the concentrations of several pyrethroid metabolites in bedtime, first morning void (FMV), and 24-h urine samples as concentration (wet weight), specific-gravity (SG) corrected, creatinine (CR) corrected, and excretion rate values for 50 Ex-R adults over a six-week monitoring period and to determine if these correction approaches for urine dilution reduced the variability of the biomarker levels. The Ex-R study was conducted at the United States Environmental Protection Agency's Human Studies Facility in Chapel Hill, North Carolina USA and at participants' homes within a 40-mile radius of this facility. Recruitment of participants and field activities occurred between October 2009 and May 2011. Participants, ages 19-50 years old, provided daily food, activity, and pesticide-use diaries and collected their own urine samples (bedtime, FMV, and 24-h) during weeks 1, 2, and 6 of a six-week monitoring period. A total of 2503 urine samples were collected from the study participants. These samples were analyzed for the pyrethroid metabolites 3-phenoxybenzoic acid (3-PBA), cis/trans-3-(2,2-dichlorovinyl)-2,2-dimethyl-cyclopropane carboxylic acid (cis/trans-DCCA), and 2-methyl-3-phenylbenzoic acid (MPA) using high performance liquid chromatography/tandem mass spectrometry. Only 3-PBA was frequently detected (>50%) in the adult urine samples. Median urinary 3-PBA levels were 0.88 ng/mL, 0.96 ng/mL-SG, 1.04 ng/mg, and 1.04 ng/min for concentration, SG-corrected, CR-corrected, and excretion rate values, respectively

  20. Pyrethroid Pesticide Exposure and Parental Report of Learning Disability and Attention Deficit/Hyperactivity Disorder in U.S. Children: NHANES 1999–2002

    PubMed Central

    Mehta, Suril; Eskenazi, Brenda


    Background: Use of pyrethroid insecticides has increased dramatically over the past decade; however, data on their potential health effects, particularly on children, are limited. Objective: We examined the cross-sectional association between postnatal pyrethroid exposure and parental report of learning disability (LD) and attention deficit/hyperactivity disorder (ADHD) in children 6–15 years of age. Methods: Using logistic regression, we estimated associations of urinary metabolites of pyrethroid insecticides with parent-reported LD, ADHD, and both LD and ADHD in 1,659–1,680 children participating in the National Health and Nutrition Examination Survey (1999–2002). Results: The prevalence rates of parent-reported LD, ADHD, and both LD and ADHD were 12.7%, 10.0%, and 5.4%, respectively. Metabolite detection frequencies for 3-PBA [3-phenoxybenzoic acid], cis-DCCA [cis-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane-1-carboxylic acid], and trans-DCCA [trans-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane-1-carboxylic acid] were 77.1%, 35.6%, and 33.9%, respectively. The geometric mean 3-PBA concentration was 0.32 μg/L (median = 0.31 μg/L; interquartile rage = 0.10–0.89 μg/L). cis- and trans-DCCA 75th-percentile concentrations were 0.21 μg/L and 0.68 μg/L, respectively. Log10-transformed 3-PBA concentrations were associated with adjusted odds ratios (ORs) of 1.18 (95% CI: 0.92, 1.51) for parent-reported LD, 1.16 (95% CI: 0.85, 1.58) for ADHD, and 1.45 (95% CI: 0.92, 2.27) for both LD and ADHD. Adjusted ORs remained nonsignificant and decreased after controlling for creatinine and other environmental chemicals previously linked to altered neurodevelopment. Similarly, no significant associations were observed for cis- and trans-DCCA. Conclusions: Postnatal pyrethroid exposure was not associated with parental report of LD and/or ADHD. Given the widespread and increasing use of pyrethroids, future research should evaluate exposures at current levels, particularly

  1. Urinary pesticide metabolites in school students from northern Thailand.


    Panuwet, Parinya; Prapamontol, Tippawan; Chantara, Somporn; Barr, Dana B


    We evaluated exposure to pesticides among secondary school students aged 12-13 years old in Chiang Mai Province, Thailand. Pesticide-specific urinary metabolites were used as biomarkers of exposure for a variety of pesticides, including organophosphorus insecticides, synthetic pyrethroid insecticides and selected herbicides. We employed a simple solid-phase extraction with analysis using isotope dilution high-performance liquid chromatography tandem mass spectrometry (HPLC-MS/MS). A total of 207 urine samples from Thai students were analyzed for 18 specific pesticide metabolites. We found 14 metabolites in the urine samples tested; seven of them were detected with a frequency > or=17%. The most frequently detected metabolites were 2-[(dimethoxyphosphorothioyl) sulfanyl] succinic acid (malathion dicarboxylic acid), para-nitrophenol (PNP), 3,5,6-trichloro-2-pyridinol (TPCY; metabolite of chlorpyrifos), 2,4-dichlorophenoxyacetic acid (2,4-D), cis- and trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane-1-carboxylic acids (c-DCCA and t-DCCA; metabolite of permethrin) and 3-phenoxybenzoic acid (3-PBA; metabolite of pyrethroids). The students were classified into 4 groups according to their parental occupations: farmers (N=60), merchants and traders (N=39), government and company employees (N=52), and laborers (N=56). Children of farmers had significantly higher urinary concentrations of pyrethroid insecticide metabolites than did other children (p<0.05). Similarly, children of agricultural families had significantly higher pyrethroid metabolite concentrations. Males had significantly higher values of PNP (Mann-Whitney test, p=0.009); however, no other sex-related differences were observed. Because parental occupation and agricultural activities seemed to have little influence on pesticide levels, dietary sources were the likely contributors to the metabolite levels observed. PMID:18760967

  2. Pyrethroid insecticide exposure in school-aged children living in rice and aquacultural farming regions of Thailand

    PubMed Central

    Rohitrattana, Juthasiri; Siriwong, Wattasit; Robson, Mark; Panuwet, Parinya; Barr, Dana Boyd; Fiedler, Nancy


    Background Pyrethroid insecticides (PYR) are commonly used in rice farms and household pest control in Thailand. No investigative study has yet been made regarding factors associated with PYR exposure among Thai children. Objective This study aimed to compare the levels of PYR exposure between children living in rice farms (high-intensity PYR used) and aquacultural areas (low-intensity PYR used) during the wet and dry seasons in Thailand, during which different amounts of PYR are applied. Environmental conditions and common activities of children were used to identify factors associated with PYR exposure. Methods A cross-sectional study was done during the wet and dry seasons, respectively. A total of 53 participants aged between 6 and 8 years old were recruited from rice farms and aquacultural areas. A parental-structured interview was used to gather information about PYR use, household environments, and participants’ activities. First voided morning urine samples were collected for PYR urinary metabolites (ie, 3-phenoxybenzoic acid [3-PBA] and cis/trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane carboxylic acid [DCCA]) measurements. Hand wipe samples were collected during home visits, to measure PYR residues on the hands. Results and discussion The concentrations of urinary PYR metabolites were not significantly different between participants who lived in rice farming and those who lived in aquacultural areas, during both wet and dry seasons. Both participant groups had slightly increased urinary PYR metabolites during the wet season compared with the dry season. The results from linear regression analysis revealed that some environmental conditions and activities or practices may be used to predict trends of PYR exposure. Frequency of PYR use in farms (β=0.004) and households (β=0.07), proximity to rice farms (β=0.09), playing in rice farms (β=0.11), and oral exposure from objects exposed to PYR (β=0.08) were likely to be related to increased

  3. Simultaneous determination of pyrethroid and pyrethrin metabolites in human urine by gas chromatography-high resolution mass spectrometry.


    Leng, Gabriele; Gries, Wolfgang


    A new developed gas chromatographic-high resolution mass spectrometric method for the sensitive simultaneous determination of trans-chrysanthemumdicarboxylic acid, cis- and trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane carboxylic acid, cis-3-(2,2-dibromovinyl)-2,2-dimethylcyclopropane carboxylic acid, 3-phenoxybenzoic acid and 4-fluoro-3-phenoxybenzoic acid in human urine is presented. These metabolites are biomarkers for an exposure to pyrethrum, allethrin, resmethrin, phenothrin, tetramethrin, cyfluthrin, cypermethrin, deltamethrin or permethrin. Therefore, with the help of this method for the first time a complete assessment of exposure to pyrethroid and pyrethrin insecticides is possible. After acid hydrolysis and extraction with tert-butyl-methyl-ether the residue is derivatized with 1,1,1,3,3,3-hexafluoroisopropanol and analyzed by GC/HRMS in electron impact mode (detection limits < 0.1 microg/l) as well as in negative chemical ionization mode (detection limit < 0.05 microg/l urine). PMID:15639450

  4. pH- and sugar-sensitive multilayer films composed of phenylboronic acid (PBA)-modified poly(allylamine hydrochloride) (PBA-PAH) and poly(vinyl alcohol) (PVA): A significant effect of PBA content on the film stability.


    Seno, Masaru; Yoshida, Kentaro; Sato, Katsuhiko; Anzai, Jun-Ichi


    Multilayer thin films composed of phenylboronic acid (PBA)-modified poly(allylamine hydrochloride) (PAH), PBA-PAH, with different PBA contents were prepared to study the effect of PBA content on the stability of the films. An alternate deposition of PBA-PAH and poly(vinyl alcohol) (PVA) on the surface of a quartz slide afforded multilayer films through forming boronate ester bonds between PBA-PAH and PVA. The 10-layered (PBA-PAH/PVA)10 films constructed using PBA-PAHs containing 16% and 26% PBA residues were stable in aqueous solutions over the range of pH4.0-10.0, whereas the multilayer films composed of PBA-PAHs with 5.9% and 8.3% PBA decomposed at pH8.0 or lower. The pH-sensitive decomposition of the films was rationalized based on the destabilization of the boronate ester bonds in neutral and acidic solutions. In addition, the (PBA-PAH/PVA)10 films decomposed in glucose and fructose solutions as a result of competitive binding of sugars to PBA-PAH in the films. The sugar response of the films depended on the PBA content in PBA-PAH. The (PBA-PAH/PVA)10 films consisting of 16% and 26% PBA-substituted PBA-PAHs are sensitive to physiological relevant level of glucose at pH7.4 while stable in glucose-free solution, suggesting a potential use of the films in constructing glucose-induced delivery systems. PMID:26952449

  5. Amino acids


    Amino acids are organic compounds that combine to form proteins . Amino acids and proteins are the building blocks of life. When proteins are digested or broken down, amino acids are left. The human body uses amino acids ...

  6. Folic Acid


    Folic acid is a B vitamin. It helps the body make healthy new cells. Everyone needs folic acid. For women who may get pregnant, it is really important. Getting enough folic acid before and during pregnancy can prevent major birth ...

  7. Folic Acid


    Folic acid is used to treat or prevent folic acid deficiency. It is a B-complex vitamin needed by ... Folic acid comes in tablets. It usually is taken once a day. Follow the directions on your prescription label ...

  8. Aspartic acid


    ... also called asparaginic acid. Aspartic acid helps every cell in the body work. It plays a role in: Hormone production and release Normal nervous system function Plant sources of aspartic acid include: Legumes such as ...

  9. Acid Rain.

    ERIC Educational Resources Information Center

    Openshaw, Peter


    Provides some background information on acid deposition. Includes a historical perspective, describes some effects of acid precipitation, and discusses acid rain in the United Kingdom. Contains several experiments that deal with the effects of acid rain on water quality and soil. (TW)

  10. Amino acids


    ... this page: // Amino acids To use the sharing features on this page, please enable JavaScript. Amino acids are organic compounds that combine to form proteins . ...

  11. Mefenamic Acid


    Mefenamic acid is used to relieve mild to moderate pain, including menstrual pain (pain that happens before or during a menstrual period). Mefenamic acid is in a class of medications called NSAIDs. ...

  12. Aminocaproic Acid


    Aminocaproic acid is used to control bleeding that occurs when blood clots are broken down too quickly. This type ... the baby is ready to be born). Aminocaproic acid is also used to control bleeding in the ...

  13. Ascorbic Acid


    Ascorbic acid is used to prevent and treat scurvy, a disease caused by a lack of vitamin C in ... Ascorbic acid comes in extended-release (long-acting) capsules and tablets, lozenges, syrup, chewable tablets, and liquid drops to ...

  14. Acid mucopolysaccharides


    ... this page: // Acid mucopolysaccharides To use the sharing features on this page, please enable JavaScript. Acid mucopolysaccharides is a test that measures the amount ...

  15. Ethacrynic Acid


    Ethacrynic acid, a 'water pill,' is used to treat swelling and fluid retention caused by various medical problems. It ... Ethacrynic acid comes as a tablet to take by mouth. It is usually taken once or twice a day ...

  16. Valproic Acid


    Valproic acid is used alone or with other medications to treat certain types of seizures. Valproic acid is also used to treat mania (episodes of ... to relieve headaches that have already begun. Valproic acid is in a class of medications called anticonvulsants. ...

  17. Fatty acids - trans fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The data supporting a negative effect of dietary trans fatty acids on cardiovascular disease risk is consistent. The primary dietary sources of trans fatty acids include partially hydrogenated fat and rudiment fat. The adverse effect of trans fatty acids on plasma lipoprotein profiles is consisten...

  18. Discovery of a new type of scaffold for the creation of novel tyrosinase inhibitors.


    Oyama, Takahiro; Takahashi, Satoshi; Yoshimori, Atsushi; Yamamoto, Tetsuya; Sato, Akira; Kamiya, Takanori; Abe, Hideaki; Abe, Takehiko; Tanuma, Sei-Ichi


    Tyrosinase is known as the key enzyme for melanin biosynthesis, which is effective in preventing skin injury by ultra violet (UV). In past decades, tyrosinase has been well studied in the field of cosmetics, medicine, agriculture and environmental sciences, and a lot of tyrosinase inhibitors have been developed for their needs. Here, we searched for new types of tyrosinase inhibitors and found phenylbenzoic acid (PBA) as a unique scaffold. Among three isomers of PBA, 3-phenylbenzoic acid (3-PBA) was revealed to be the most potent inhibitor against mushroom tyrosinase (IC50=6.97μM, monophenolase activity; IC50=36.3μM, diphenolase activity). The kinetic studies suggested that the apparent inhibition modes for the monophenolase and diphenolase activities were noncompetitive and mixed type inhibition, respectively. Analyses by in silico docking studies using the crystallographic structure of mushroom tyrosinase indicated that the carboxylic acid group of the 3-PBA could adequately bind to two cupric ions in the tyrosinase. To prove this hypothesis, we examined the effect of modification of the carboxylic acid group of the 3-PBA on its inhibitory activity. As expected, the esterification abrogated the inhibitory activity. These observations suggest that 3-PBA is a useful lead compound for the generation of novel tyrosinase inhibitors and provides a new insight into the molecular basis of tyrosinase catalytic mechanisms. PMID:27507110

  19. Acid Deposition

    EPA Science Inventory

    This indicator presents acid deposition trends in the contiguous U.S. from 1989 to 2007. Data are broken down by wet and dry deposition and deposition of nitrogen and sulfur compounds. Acid deposition is particularly damaging to lakes, streams, and forests and the plants and a...

  20. Acid rain

    SciTech Connect

    White, J.C. )


    This book presents the proceedings of the third annual conference sponsored by the Acid Rain Information Clearinghouse (ARIC). Topics covered include: Legal aspects of the source-receptor relationship: an energy perspective; Scientific uncertainty, agency inaction, and the courts; and Acid rain: the emerging legal framework.

  1. Acid rain

    SciTech Connect

    Elsworth, S.


    This book was written in a concise and readable style for the lay public. It's purpose was to make the public aware of the damage caused by acid rain and to mobilize public opinion to favor the elimination of the causes of acid rain.

  2. Acid rain

    SciTech Connect

    Sweet, W.


    Acid precipitation includes not only rain but also acidified snow, hail and frost, as well as sulfur and nitrogen dust. The principal source of acid precipitation is pollution emitted by power plants and smelters. Sulfur and nitrogen compounds contained in the emissions combine with moisture to form droplets with a high acid content - sometimes as acidic as vinegar. When sufficiently concentrated, these acids can kill fish and damage material structures. Under certain circumstances they may reduce crop and forest yields and cause or aggravate respiratory diseases in humans. During the summer, especially, pollutants tend to collect over the Great Lakes in high pressure systems. Since winds typically are westerly and rotate clockwise around high pressure systems, the pollutants gradually are dispersed throughout the eastern part of the continent.

  3. Asparagusic acid.


    Mitchell, Stephen C; Waring, Rosemary H


    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications. PMID:24099657

  4. [Gastric Acid].


    Ruíz Chávez, R


    Gastric acid, a product of parietal cells secretion, full fills multiple biological roles which are absolutely necessary to keep corporal homeostasis. The production of the acid depends upon an effector cellular process represented in the first step by histamine, acetilcholine and gastrin, first messengers of the process. These interact with specific receptors than in sequence activate second messengers -cAMP and the calcium-calmodulin system- which afterwards activate a kinase. An specific protein is then phosphorilated by this enzyme, being the crucial factor that starts the production of acid. Finally, a proton bomb, extrudes the acid towards the gastric lumen. The secretion process mentioned above, is progressive lyactivated in three steps, two of which are stimulators -cephalic and gastric phases- and the other one inhibitor or intestinal phase. These stages are started by mental and neurological phenomena -thought, sight, smell or memory-; by food, drugs or other ingested substances; and by products of digestion. Changes in regulation of acid secretion, in the structure of gastro-duodenal mucosal barrier by a wide spectrum of factors and agents including food, drugs and H. pylori, are the basis of acid-peptic disease, entity in which gastric acid plays a fundamental role. From the therapeutic point of view, so at the theoretical as at the practical levels, t is possible to interfere with the secretion of acid by neutralization of some of the steps of the effector cellular process. An adequate knowledge of the basics related to gastric acid, allows to create strategies for the clinical handling of associated pathology, specifically in relation to peptic acid disease in all of the known clinical forms. PMID:12165790

  5. Acid fog

    SciTech Connect

    Hileman, B.


    Fog in areas of southern California previously thought to be pollution-free has been shown to have a pH as low as 1.69. It has been found to be most acidic after smoggy days, suggesting that it forms on the aerosol associated with the previously exiting smog. Studies on Whiteface Mountain in the Adirondacks show that fog water is often 10 times as acidic as rainwater. As a result of their studies, California plans to spend $4 million on acid deposition research in the coming year. (JMT)

  6. Folic acid


    ... in the blood vessel to keep it open. Bipolar disorder. Taking folic acid does not appear to improve the antidepressant effects of lithium in people with bipolar disorder. However, taking folate with the medication valproate improves ...

  7. Mefenamic Acid


    ... as mefenamic acid may cause ulcers, bleeding, or holes in the stomach or intestine. These problems may ... like coffee grounds, blood in the stool, or black and tarry stools.Keep all appointments with your ...


    EPA Science Inventory

    Acid precipitation has become one of the major environmental problems of this decade. It is a challenge to scientists throughout the world. Researchers from such diverse disciplines as plant pathology, soil science, bacteriology, meteorology and engineering are investigating diff...

  9. Acid Precipitation

    ERIC Educational Resources Information Center

    Likens, Gene E.


    Discusses the fact that the acidity of rain and snow falling on parts of the U.S. and Europe has been rising. The reasons are still not entirely clear and the consequences have yet to be well evaluated. (MLH)

  10. Carnosic acid.


    Birtić, Simona; Dussort, Pierre; Pierre, François-Xavier; Bily, Antoine C; Roller, Marc


    Carnosic acid (salvin), which possesses antioxidative and antimicrobial properties, is increasingly exploited within the food, nutritional health and cosmetics industries. Since its first extraction from a Salvia species (∼70 years ago) and its identification (∼50 years ago), numerous articles and patents (∼400) have been published on specific food and medicinal applications of Rosmarinus and Salvia plant extracts abundant in carnosic acid. In contrast, relevant biochemical, physiological or molecular studies in planta have remained rare. In this overview, recent advances in understanding of carnosic acid distribution, biosynthesis, accumulation and role in planta, and its applications are summarised. We also discuss the deficiencies in our understanding of the relevant biochemical processes, and suggest the molecular targets of carnosic acid. Finally, future perspectives and studies related to its potential roles are highlighted. PMID:25639596

  11. Aminocaproic Acid


    Amicar® Oral Solution ... Aminocaproic acid comes as a tablet and a solution (liquid) to take by mouth. It is usually ... it at room temperature and away from excess heat and moisture (not in the bathroom). Throw away ...

  12. Tranexamic Acid


    ... is used to treat heavy bleeding during the menstrual cycle (monthly periods) in women. Tranexamic acid is in ... tablets for more than 5 days in a menstrual cycle or take more than 6 tablets in a ...

  13. Acidic precipitation

    SciTech Connect

    Martin, H.C.


    At the International Symposium on Acidic Precipitation, over 400 papers were presented, and nearly 200 of them are included here. They provide an overview of the present state of the art of acid rain research. The Conference focused on atmospheric science (monitoring, source-receptor relationships), aquatic effects (marine eutrophication, lake acidification, impacts on plant and fish populations), and terrestrial effects (forest decline, soil acidification, etc.).

  14. Salicylic acids

    PubMed Central

    Hayat, Shamsul; Irfan, Mohd; Wani, Arif; Nasser, Alyemeni; Ahmad, Aqil


    Salicylic acid is well known phytohormone, emerging recently as a new paradigm of an array of manifestations of growth regulators. The area unleashed yet encompassed the applied agriculture sector to find the roles to strengthen the crops against plethora of abiotic and biotic stresses. The skipped part of integrated picture, however, was the evolutionary insight of salicylic acid to either allow or discard the microbial invasion depending upon various internal factors of two interactants under the prevailing external conditions. The metabolic status that allows the host invasion either as pathogenesis or symbiosis with possible intermediary stages in close systems has been tried to underpin here. PMID:22301975

  15. Dehydrogenation of 3-phenoxybenzyl alcohol in isolated perfused rabbit skin, skin homogenate and purified dehydrogenases.


    Bast, G E; Kampffmeyer, H G


    The formation of 3-phenoxybenzoic acid from 3-phenoxybenzyl alcohol was determined in (a) rabbit ears, single-pass perfused with a protein-free buffer, pH 7.4; (b) the microsomal fraction and its supernatant from homogenized rabbit skin; and (c) purified alcohol dehydrogenase from horse liver and baker's yeast. The inhibition of product formation in (a) was about 60% by various 4-methylpyrazole concentrations, but metyrapone had no effect. Following ultracentrifugation, only the supernatant of homogenized skin showed product formation (apparent Vmay: 32 pmol/min per cm2 skin; apparent Km: 64 microM). 3-Phenoxybenzyl alcohol and ethanol dehydrogenation was similar by alcohol dehydrogenase from horse liver (apparent Km: 0.7 vs. 0.4 mM; apparent Vmax: 0.3 vs. 0.2 U/ microg protein). In baker's yeast, the apparent Km of 3-phenoxybenzoic acid formation was several times larger than that for ethanol dehydrogenation. The KI of 4-methylpyrazole for alcohol dehydrogenase from horse liver was 0.6 (3-phenoxybenzyl alcohol) vs. 0.04 microM (ethanol). The KI for ethanol in baker's yeast was 470 microM. In conclusion dehydrogenation is an important metabolic pathway in the skin for xenobiotics with an aliphatic alcohol at a side chain. PMID:9885409

  16. Folic acid


    ... disease called vitiligo, and an inherited disease called Fragile-X syndrome. It is also used for reducing harmful side ... to blood clots (ischemic stroke). Inherited disease called Fragile-X syndrome.Taking folic acid by mouth does not improve ...

  17. Acid rain

    SciTech Connect

    Not Available


    An overview is presented of acid rain and the problems it causes to the environment worldwide. The acidification of lakes and streams is having a dramatic effect on aquatic life. Aluminum, present in virtually all forest soils, leaches out readily under acid conditions and interferes with the gills of all fish, some more seriously than others. There is evidence of major damage to forests in European countries. In the US, the most severe forest damage appears to be in New England, New York's Adirondacks, and the central Appalachians. This small region is part of a larger area of the Northeast and Canada that appears to have more acid rainfall than the rest of the country. It is downwind from major coal burning states, which produce about one quarter of US SO/sub 2/ emissions and one sixth of nitrogen oxide emissions. Uncertainties exist over the causes of forest damage and more research is needed before advocating expensive programs to reduce rain acidity. The President's current budget seeks an expansion of research funds from the current $30 million per year to $120 million.

  18. Formic acid

    Integrated Risk Information System (IRIS)

    Formic acid ; CASRN 64 - 18 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effect

  19. Selenious acid

    Integrated Risk Information System (IRIS)

    Selenious acid ; CASRN 7783 - 00 - 8 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic E

  20. Benzoic acid

    Integrated Risk Information System (IRIS)

    Benzoic acid ; CASRN 65 - 85 - 0 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effec

  1. Trichloroacetic acid

    Integrated Risk Information System (IRIS)

    Trichloroacetic acid ( TCA ) ; CASRN 76 - 03 - 9 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Nonca

  2. Dichloroacetic acid

    Integrated Risk Information System (IRIS)

    Dichloroacetic acid ; CASRN 79 - 43 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogeni

  3. Acrylic acid

    Integrated Risk Information System (IRIS)

    Acrylic acid ( CASRN 79 - 10 - 7 ) Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  4. Cacodylic acid

    Integrated Risk Information System (IRIS)

    Cacodylic acid ; CASRN 75 - 60 - 5 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  5. Phosphoric acid

    Integrated Risk Information System (IRIS)

    Phosphoric acid ; CASRN 7664 - 38 - 2 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic

  6. Stearic Acid

    ERIC Educational Resources Information Center

    Young, Jay A.


    A chemical laboratory information profile (CLIP) is presented for the chemical, stearic acid. The profile lists the chemical's physical and harmful characteristics, exposure limits, and symptoms of major exposure, for the benefit of teachers and students, who use the chemical in the laboratory.

  7. Hydroxycarboxylic acids and salts


    Kiely, Donald E; Hash, Kirk R; Kramer-Presta, Kylie; Smith, Tyler N


    Compositions which inhibit corrosion and alter the physical properties of concrete (admixtures) are prepared from salt mixtures of hydroxycarboxylic acids, carboxylic acids, and nitric acid. The salt mixtures are prepared by neutralizing acid product mixtures from the oxidation of polyols using nitric acid and oxygen as the oxidizing agents. Nitric acid is removed from the hydroxycarboxylic acids by evaporation and diffusion dialysis.

  8. The central role of mosquito cytochrome P450 CYP6Zs in insecticide detoxification revealed by functional expression and structural modelling

    PubMed Central

    Chandor-Proust, Alexia; Bibby, Jaclyn; Régent-Kloeckner, Myriam; Roux, Jessica; Guittard-Crilat, Emilie; Poupardin, Rodolphe; Riaz, Muhammad Asam; Paine, Mark; Dauphin-Villemant, Chantal; Reynaud, Stéphane; David, Jean-Philippe


    The resistance of mosquitoes to chemical insecticides is threatening vector control programmes worldwide. Cytochrome P450 monooxygenases (CYPs) are known to play a major role in insecticide resistance, allowing resistant insects to metabolize insecticides at a higher rate. Among them, members of the mosquito CYP6Z subfamily, like Aedes aegypti CYP6Z8 and its Anopheles gambiae orthologue CYP6Z2, have been frequently associated with pyrethroid resistance. However, their role in the pyrethroid degradation pathway remains unclear. In the present study, we created a genetically modified yeast strain overexpressing Ae. aegypti cytochrome P450 reductase and CYP6Z8, thereby producing the first mosquito P450–CPR (NADPH-cytochrome P450-reductase) complex in a yeast recombinant system. The results of the present study show that: (i) CYP6Z8 metabolizes PBAlc (3-phenoxybenzoic alcohol) and PBAld (3-phenoxybenzaldehyde), common pyrethroid metabolites produced by carboxylesterases, producing PBA (3-phenoxybenzoic acid); (ii) CYP6Z8 transcription is induced by PBAlc, PBAld and PBA; (iii) An. gambiae CYP6Z2 metabolizes PBAlc and PBAld in the same way; (iv) PBA is the major metabolite produced in vivo and is excreted without further modification; and (v) in silico modelling of substrate–enzyme interactions supports a similar role of other mosquito CYP6Zs in pyrethroid degradation. By playing a pivotal role in the degradation of pyrethroid insecticides, mosquito CYP6Zs thus represent good targets for mosquito-resistance management strategies. PMID:23844938

  9. Methylmalonic acid blood test


    ... acid is a substance produced when proteins, called amino acids, in the body break down. The health care ... Cederbaum S, Berry GT. Inborn errors of carbohydrate, ammonia, amino acid, and organic acid metabolism. In: Gleason CA, Devaskar ...

  10. Folic acid - test


    Folic acid is a type of B vitamin. This article discusses the test to measure the amount of folic acid in the blood. ... that may interfere with test results, including folic acid supplements. Drugs that can decrease folic acid measurements ...

  11. Uric acid urine test


    The uric acid urine test measures the level of uric acid in urine. Uric acid level can also be checked using a blood ... help determine the cause of a high uric acid level in the blood. It may also be ...

  12. Methylmalonic acid blood test


    The methylmalonic acid blood test measures the amount of methylmalonic acid in the blood. ... Methylmalonic acid is a substance produced when proteins, called amino acids, in the body break down. The health care ...

  13. Folic Acid and Pregnancy


    ... 5 Things to Know About Zika & Pregnancy Folic Acid and Pregnancy KidsHealth > For Parents > Folic Acid and ... before conception and during early pregnancy . About Folic Acid Folic acid, sometimes called folate, is a B ...

  14. Understanding Acid Rain

    ERIC Educational Resources Information Center

    Damonte, Kathleen


    The term acid rain describes rain, snow, or fog that is more acidic than normal precipitation. To understand what acid rain is, it is first necessary to know what an acid is. Acids can be defined as substances that produce hydrogen ions (H+), when dissolved in water. Scientists indicate how acidic a substance is by a set of numbers called the pH…

  15. New bioactive fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many oxygenated fatty acids are bioactive compounds. Nocardia cholesterolicum and Flavobacterium DS5 convert oleic acid to 10 hydroxy stearic acid and linoleic acid to 10-hydroxy-12(Z)-octadecanoic acid. Pseudomonas aeruginosa PR3 converts oleic acid to the new compounds, 7,10-dihydroxy-8(E)-octad...

  16. New Bioactive Fatty Acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many oxygenated fatty acids are bioactive compounds. Nocardia cholesterolicum and Flavobacterium DS5 convert oleic acid to 10 hydroxy stearic acid and linoleic acid to 10-hydroxy-12(Z)-octadecanoic acid. Pseudomonas aeruginosa PR3 converts oleic acid to new compounds, 7,10-dihydroxy-8(E)-octadecen...

  17. Bioactive Fatty Acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Oxygenated fatty acids are useful as specialty chemicals, plasticizers, and biomedicals. Microbial enzymes convert fatty acids to mono-, di-, and trihydroxy fatty acid products. Among them, Bacillus megaterium ALA2 converted n-6 and n-3 PUFAs to many new oxygenated fatty acids. Linoleic acid was ...

  18. Uric acid test (image)


    Uric acid urine test is performed to check for the amount of uric acid in urine. Urine is collected over a 24 ... testing. The most common reason for measuring uric acid levels is in the diagnosis or treatment of ...

  19. Amino Acid Metabolism Disorders


    ... defects & other health conditions > Amino acid metabolism disorders Amino acid metabolism disorders E-mail to a friend Please ... baby’s newborn screening may include testing for certain amino acid metabolism disorders. These are rare health conditions that ...

  20. Plasma amino acids


    Amino acids blood test ... types of methods used to determine the individual amino acid levels in the blood. ... test is done to measure the level of amino acids in the blood. An increased level of a ...

  1. Stomach acid test


    Gastric acid secretion test ... of the cells in the stomach to release acid. The stomach contents are then removed and analyzed. ... 3.5). These numbers are converted to actual acid production in units of milliequivalents per hour in ...

  2. Azelaic Acid Topical


    Azelaic acid gel is used to clear the bumps, lesions, and swelling caused by rosacea (a skin disease that ... redness, flushing, and pimples on the face). Azelaic acid cream is used to treat acne. Azelaic acid ...

  3. Facts about Folic Acid


    ... Information For... Media Policy Makers Facts About Folic Acid Language: English Español (Spanish) Recommend on Facebook Tweet ... of the baby's brain and spine. About folic acid Folic acid is a B vitamin. Our bodies ...

  4. Acid Lipase Disease


    ... Awards Enhancing Diversity Find People About NINDS NINDS Acid Lipase Disease Information Page Synonym(s): Cholesterol Ester Storage ... Trials Related NINDS Publications and Information What is Acid Lipase Disease ? Acid lipase disease or deficiency occurs ...

  5. Folic acid - test


    ... folic acid measurements include: Alcohol Aminosalicylic acid Birth control pills Estrogens Tetracyclines Ampicillin Chloramphenicol Erythromycin Methotrexate Penicillin Aminopterin Phenobarbital Phenytoin Drugs to treat malaria

  6. Oxalic acid poisoning


    Symptoms of oxalic acid poisoning include: Abdominal pain Burns and blisters where the acid contacted the skin Collapse Convulsions Mouth pain Shock Throat pain Tremors (unintentional trembling) Vomiting

  7. Acid distribution in phosphoric acid fuel cells

    SciTech Connect

    Okae, I.; Seya, A.; Umemoto, M.


    Electrolyte acid distribution among each component of a cell is determined by capillary force when the cell is not in operation, but the distribution under the current load conditions had not been clear so far. Since the loss of electrolyte acid during operation is inevitable, it is necessary to store enough amount of acid in every cell. But it must be under the level of which the acid disturbs the diffusion of reactive gases. Accordingly to know the actual acid distribution during operation in a cell is very important. In this report, we carried out experiments to clarify the distribution using small single cells.

  8. HPLC-MS/MS Method for the Measurement of Insecticide Degradates in Baby Food

    PubMed Central


    A solid phase extraction method was developed to isolate four insecticide degradates from baby food that were measured subsequently using high-performance liquid chromatography–tandem mass spectrometry. The degradates [parent insecticide] measured were malathion dicarboxylic acid [malathion], 3,5,6-trichloro-2-pyridinol [chlorpyrifos, chlorpyrifos methyl] (TCPy), cis/trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane-1-carboxylic acid [permethrin, cypermethrin, cyfluthrin], and 3-phenoxybenzoic acid [general pyrethroid]. All degradates produced recoveries between 80 and 120% except TCPy in fruit (122% recovery), and all relative standard deviations were <16%. Use of this method demonstrated that insecticide degradates were found in baby foods frequently purchased in the United States, supporting the need for this method. These data will assist in differentiating whether biomarker levels of insecticide metabolites are the result of exposures to the toxic insecticide or its preformed degradate. PMID:24910900

  9. Acid tolerance in amphibians

    SciTech Connect

    Pierce, B.A.


    Studies of amphibian acid tolerance provide information about the potential effects of acid deposition on amphibian communities. Amphibians as a group appear to be relatively acid tolerant, with many species suffering increased mortality only below pH 4. However, amphibians exhibit much intraspecific variation in acid tolerance, and some species are sensitive to even low levels of acidity. Furthermore, nonlethal effects, including depression of growth rates and increases in developmental abnormalities, can occur at higher pH.

  10. Toxicity of adipic acid.


    Kennedy, Gerald L


    Adipic acid has very low acute toxicity in rats with an LD50 > 5000 mg/kg. Adipic acid produced mild to no skin irritation on intact guinea pig skin as a 50% concentration in propylene glycol; it was not a skin sensitizer. Adipic acid caused mild conjunctival irritation in washed rabbit eyes; in unwashed rabbit eyes, there was mild conjunctival irritation, minimal iritis, but no corneal effects. Adipic acid dust may irritate the mucous membranes of the lungs and nose. In a 2-year feeding study, rats fed adipic acid at concentrations up to 5% in the diet exhibited only weight loss. Adipic acid is not genetically active in a wide variety of assay systems. Adipic acid caused no developmental toxicity in mice, rats, rabbits, or hamsters when administered orally. Adipic acid is partially metabolized in humans; the balance is eliminated unchanged in the urine. Adipic acid is slightly to moderately toxic to fish, daphnia, and algae in acute tests. PMID:12024802

  11. Acid Thunder: Acid Rain and Ancient Mesoamerica

    ERIC Educational Resources Information Center

    Kahl, Jonathan D. W.; Berg, Craig A.


    Much of Mesoamerica's rich cultural heritage is slowly eroding because of acid rain. Just as water dissolves an Alka-Seltzer tablet, acid rain erodes the limestone surfaces of Mexican archaeological sites at a rate of about one-half millimeter per century (Bravo et al. 2003). A half-millimeter may not seem like much, but at this pace, a few…

  12. Quantity of acid in acid fog

    SciTech Connect

    Deal, W.J.


    This communication notes the actual magnitude of the acidity in acidic fog particles and suggests a possible line of inquiry into the health effects of such fog so that it can be determined whether a typical fog is detrimental or beneficial relative to dry air.

  13. [Amino acids in saliva].


    Klinger, G; Gruhn, K


    Total amino acids in saliva and free and peptide-bound amino acids from 21 saliva samples were determined. The contents of amino acids was 25 mmol/1; total nitrogen content was 78-80 mmol/1. Amino acids consist of Prolin in 25%. Some patients were examined before and after application of the depot estrogen ethinyl estradiosulfonat, which stimulates the assimilation of protein. After application, amino acids increased and the authors found a shift between the single amino acids. Estrogen medication induced an increase in proteins with the character of collagens. Clinical effects are discussed. (author's modified) PMID:6240853

  14. Hydrochloric acid poisoning


    Hydrochloric acid is a clear, poisonous liquid. It is highly corrosive, which means it immediately causes severe damage, ... discusses poisoning due to swallowing or breathing in hydrochloric acid. This article is for information only. Do NOT ...

  15. Omega-3 Fatty Acids


    Omega-3 fatty acids are used together with lifestyle changes (diet, weight-loss, exercise) to reduce the amount ... the blood in people with very high triglycerides. Omega-3 fatty acids are in a class of medications ...

  16. Omega-6 Fatty Acids


    Omega-6 fatty acids are types of fats. Some types are found in vegetable oils, including corn, evening primrose seed, safflower, and soybean oils. Other types of omega-6 fatty acids are found in black currant seed, borage seed, ...

  17. Zoledronic Acid Injection


    Zoledronic acid (Reclast) is used to prevent or treat osteoporosis (condition in which the bones become thin and weak ... of life,' end of regular menstrual periods). Zoledronic acid (Reclast) is also used to treat osteoporosis in ...

  18. Aminolevulinic Acid Topical


    Aminolevulinic acid is used in combination with photodynamic therapy (PDT; special blue light) to treat actinic keratoses (small crusty ... skin cancer) of the face or scalp. Aminolevulinic acid is in a class of medications called photosensitizing ...

  19. Acid-fast stain


    The acid-fast stain is a laboratory test that determines if a sample of tissue, blood, or other body ... dye. The slide is then washed with an acid solution and a different stain is applied. Bacteria ...

  20. Uric acid - blood


    Uric acid is a chemical created when the body breaks down substances called purines. Purines are found in some ... dried beans and peas, and beer. Most uric acid dissolves in blood and travels to the kidneys. ...

  1. Hydrochloric acid poisoning


    Hydrochloric acid is a clear, poisonous liquid. It is highly corrosive, which means it immediately causes severe damage, such ... poisoning due to swallowing or breathing in hydrochloric acid. This article is for information only. Do NOT ...

  2. Omega-6 Fatty Acids


    ... types of fats. Some types are found in vegetable oils, including corn, evening primrose seed, safflower, and soybean ... from studying specific omega-6 fatty acids or plant oils containing omega-6 fatty acids. See the separate ...

  3. Uric Acid Test


    ... limited. Home Visit Global Sites Search Help? Uric Acid Share this page: Was this page helpful? Also known as: Serum Urate; UA Formal name: Uric Acid Related tests: Synovial Fluid Analysis , Kidney Stone Analysis , ...

  4. Acid-fast stain


    ... this page: // Acid-fast stain To use the sharing features on this page, please enable JavaScript. The acid-fast stain is a laboratory test that determines ...

  5. Aminocaproic Acid Injection


    Aminocaproic acid injection is used to control bleeding that occurs when blood clots are broken down too quickly. This ... the baby is ready to be born). Aminocaproic acid injection is also used to control bleeding in ...

  6. Deoxycholic Acid Injection


    Deoxycholic acid injection is used to improve the appearance and profile of moderate to severe submental fat ('double chin'; fatty tissue located under the chin). Deoxycholic acid injection is in a class of medications called ...

  7. Methylmalonic Acid Test


    ... limited. Home Visit Global Sites Search Help? Methylmalonic Acid Share this page: Was this page helpful? Also known as: MMA Formal name: Methylmalonic Acid Related tests: Vitamin B12 and Folate , Homocysteine , Intrinsic ...

  8. Fatty acid analogs


    Elmaleh, David R.; Livni, Eli


    In one aspect, a radioactively labeled analog of a fatty acid which is capable of being taken up by mammalian tissue and which exhibits an in vivo beta-oxidation rate below that with a corresponding radioactively labeled fatty acid.

  9. Boric acid poisoning


    ... boric acid poisoning usually occurs when someone swallows powdered roach-killing products that contain the chemical. Chronic ... vein (IV) Medicines to treat symptoms Note: Activated charcoal does not effectively treat (absorb) boric acid. For ...

  10. Lactic acid test


    ... this page: // Lactic acid test To use the sharing features on this page, please enable JavaScript. Lactic acid is mainly produced in muscle cells and red ...



    Haworth, W.N.; Stacey, M.


    A method is given for the production of improved yields of trifluoroacetic acid. The compound is prepared by oxidizing m-aminobenzotrifluoride with an alkali metal or alkaline earth metal permanganate at a temperature in the range of 80 deg C to 100 deg C while dissolved ln a mixture of water with glacial acetic acid and/or trifluoroacetic acid. Preferably a mixture of water and trifluoroacetic acid ls used as the solvent.

  12. Plant fatty acid hydroxylases


    Somerville, Chris; Broun, Pierre; van de Loo, Frank


    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

  13. Quantity of acid in acid fog

    SciTech Connect

    Deal, W.J.


    The chemical composition of fog particles has become of considerable interest, because of both the possibility of interpreting atmospheric- chemistry processes in fog particles in terms of the principles of aqueous chemistry and the potential health effects of species present in fog particles. The acidity of fog particles has received wide attention. This communication noted the actual magnitude of the excess acidity in acidic fog particles and suggested a possible line of inquiry into the health effects of such fog so that it can be determined whether a typical fog is detrimental or beneficial relative to dry air. (DP)

  14. The Acid Rain Reader.

    ERIC Educational Resources Information Center

    Stubbs, Harriett S.; And Others

    A topic which is often not sufficiently dealt with in elementary school textbooks is acid rain. This student text is designed to supplement classroom materials on the topic. Discussed are: (1) "Rain"; (2) "Water Cycle"; (3) "Fossil Fuels"; (4) "Air Pollution"; (5) "Superstacks"; (6) "Acid/Neutral/Bases"; (7) "pH Scale"; (8) "Acid Rain"; (9)…

  15. What Is Acid Rain?

    ERIC Educational Resources Information Center

    Likens, Gene E.


    Acid rain is the collective term for any type of acidified precipitation: rain, snow, sleet, and hail, as well as the presence of acidifying gases, particles, cloud water, and fog in the atmosphere. The increased acidity, primarily from sulfuric and nitric acids, is generated as a by-product of the combustion of fossil fuels such as coal and oil.…

  16. Acid Rain Study Guide.

    ERIC Educational Resources Information Center

    Hunger, Carolyn; And Others

    Acid rain is a complex, worldwide environmental problem. This study guide is intended to aid teachers of grades 4-12 to help their students understand what acid rain is, why it is a problem, and what possible solutions exist. The document contains specific sections on: (1) the various terms used in conjunction with acid rain (such as acid…

  17. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.


    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  18. Cleavage of nucleic acids


    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor L.; Brow, Mary Ann D.; Dahlberg, James E.


    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  19. Amino acid analysis

    NASA Technical Reports Server (NTRS)

    Winitz, M.; Graff, J. (Inventor)


    The process and apparatus for qualitative and quantitative analysis of the amino acid content of a biological sample are presented. The sample is deposited on a cation exchange resin and then is washed with suitable solvents. The amino acids and various cations and organic material with a basic function remain on the resin. The resin is eluted with an acid eluant, and the eluate containing the amino acids is transferred to a reaction vessel where the eluant is removed. Final analysis of the purified acylated amino acid esters is accomplished by gas-liquid chromatographic techniques.

  20. Editorial: Acid precipitation

    SciTech Connect


    This editorial focuses on acid rain and the history of public and governmental response to acid rain. Comments on a book by Gwineth Howell `Acid Rain and Acid Waters` are included. The editor feels that Howells has provide a service to the environmental scientific community, with a textbook useful to a range of people, as well as a call for decision makers to learn from the acid rain issue and use it as a model for more sweeping global environmental issues. A balance is needed among several parameters such as level of evidence, probability that the evidence will lead to a specific direction and the cost to the global community. 1 tab.

  1. Cleavage of nucleic acids

    SciTech Connect

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow; Mary Ann D.; Dahlberg, James E.


    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  2. Cleavage of nucleic acids


    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.


    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  3. Nucleic acid detection assays


    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James E.


    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  4. Nucleic acid detection compositions


    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James L.


    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  5. Acidic Ionic Liquids.


    Amarasekara, Ananda S


    Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition. PMID:27175515

  6. Nucleic acid detection kits


    Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann; Kwiatkowski, Robert W.; Vavra, Stephanie H.


    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.

  7. Demospongic Acids Revisited

    PubMed Central

    Kornprobst, Jean-Michel; Barnathan, Gilles


    The well-known fatty acids with a Δ5,9 unsaturation system were designated for a long period as demospongic acids, taking into account that they originally occurred in marine Demospongia sponges. However, such acids have also been observed in various marine sources with a large range of chain-lengths (C16–C32) and from some terrestrial plants with short acyl chains (C18–C19). Finally, the Δ5,9 fatty acids appear to be a particular type of non-methylene-interrupted fatty acids (NMA FAs). This article reviews the occurrence of these particular fatty acids in marine and terrestrial organisms and shows the biosynthetic connections between Δ5,9 fatty acids and other NMI FAs. PMID:21116406

  8. Process for the preparation of lactic acid and glyceric acid


    Jackson, James E [Haslett, MI; Miller, Dennis J [Okemos, MI; Marincean, Simona [Dewitt, MI


    Hexose and pentose monosaccharides are degraded to lactic acid and glyceric acid in an aqueous solution in the presence of an excess of a strongly anionic exchange resin, such as AMBERLITE IRN78 and AMBERLITE IRA400. The glyceric acid and lactic acid can be separated from the aqueous solution. Lactic acid and glyceric acid are staple articles of commerce.

  9. Microorganisms for producing organic acids

    SciTech Connect

    Pfleger, Brian Frederick; Begemann, Matthew Brett


    Organic acid-producing microorganisms and methods of using same. The organic acid-producing microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid, acrylic acid, propionic acid, lactic acid, and others. Further modifications to the microorganisms increase production of such organic acids as 3-hydroxypropionic acid, lactate, and others. Methods of producing such organic acids as 3-hydroxypropionic acid, lactate, and others with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers are also provided.

  10. Acid-Base Homeostasis

    PubMed Central

    Nakhoul, Nazih; Hering-Smith, Kathleen S.


    Acid-base homeostasis and pH regulation are critical for both normal physiology and cell metabolism and function. The importance of this regulation is evidenced by a variety of physiologic derangements that occur when plasma pH is either high or low. The kidneys have the predominant role in regulating the systemic bicarbonate concentration and hence, the metabolic component of acid-base balance. This function of the kidneys has two components: reabsorption of virtually all of the filtered HCO3− and production of new bicarbonate to replace that consumed by normal or pathologic acids. This production or generation of new HCO3− is done by net acid excretion. Under normal conditions, approximately one-third to one-half of net acid excretion by the kidneys is in the form of titratable acid. The other one-half to two-thirds is the excretion of ammonium. The capacity to excrete ammonium under conditions of acid loads is quantitatively much greater than the capacity to increase titratable acid. Multiple, often redundant pathways and processes exist to regulate these renal functions. Derangements in acid-base homeostasis, however, are common in clinical medicine and can often be related to the systems involved in acid-base transport in the kidneys. PMID:26597304

  11. Citric Acid Alternative to Nitric Acid Passivation

    NASA Technical Reports Server (NTRS)

    Lewis, Pattie L. (Compiler)


    The Ground Systems Development and Operations GSDO) Program at NASA John F. Kennedy Space Center (KSC) has the primary objective of modernizing and transforming the launch and range complex at KSC to benefit current and future NASA programs along with other emerging users. Described as the launch support and infrastructure modernization program in the NASA Authorization Act of 2010, the GSDO Program will develop and implement shared infrastructure and process improvements to provide more flexible, affordable, and responsive capabilities to a multi-user community. In support of the GSDO Program, the purpose of this project is to demonstratevalidate citric acid as a passivation agent for stainless steel. Successful completion of this project will result in citric acid being qualified for use as an environmentally preferable alternative to nitric acid for passivation of stainless steel alloys in NASA and DoD applications.

  12. USGS Tracks Acid Rain

    USGS Publications Warehouse

    Gordon, John D.; Nilles, Mark A.; Schroder, LeRoy J.


    The U.S. Geological Survey (USGS) has been actively studying acid rain for the past 15 years. When scientists learned that acid rain could harm fish, fear of damage to our natural environment from acid rain concerned the American public. Research by USGS scientists and other groups began to show that the processes resulting in acid rain are very complex. Scientists were puzzled by the fact that in some cases it was difficult to demonstrate that the pollution from automobiles and factories was causing streams or lakes to become more acidic. Further experiments showed how the natural ability of many soils to neutralize acids would reduce the effects of acid rain in some locations--at least as long as the neutralizing ability lasted (Young, 1991). The USGS has played a key role in establishing and maintaining the only nationwide network of acid rain monitoring stations. This program is called the National Atmospheric Deposition Program/National Trends Network (NADP/NTN). Each week, at approximately 220 NADP/NTN sites across the country, rain and snow samples are collected for analysis. NADP/NTN site in Montana. The USGS supports about 72 of these sites. The information gained from monitoring the chemistry of our nation's rain and snow is important for testing the results of pollution control laws on acid rain.

  13. Recovery of organic acids


    Verser, Dan W.; Eggeman, Timothy J.


    A method is disclosed for the recovery of an organic acid from a dilute salt solution in which the cation of the salt forms an insoluble carbonate salt. A tertiary amine and CO.sub.2 are introduced to the solution to form the insoluble carbonate salt and a complex between the acid and an amine. A water immiscible solvent, such as an alcohol, is added to extract the acid/amine complex from the dilute salt solution to a reaction phase. The reaction phase is continuously dried and a product between the acid and the solvent, such as an ester, is formed.

  14. Recovery of organic acids

    SciTech Connect

    Verser, Dan W.; Eggeman, Timothy J.


    A method is disclosed for the recovery of an organic acid from a dilute salt solution in which the cation of the salt forms an insoluble carbonate salt. A tertiary amine and CO.sub.2 are introduced to the solution to form the insoluble carbonate salt and a complex between the acid and an amine. A water immiscible solvent, such as an alcohol, is added to extract the acid/amine complex from the dilute salt solution to a reaction phase. The reaction phase is continuously dried and a product between the acid and the solvent, such as an ester, is formed.


    EPA Science Inventory

    This paper describes a two-dimensional mixed-layer method for separating citric acid cycle intermediates, lactic acid and the amino acid taurine. The method cleanly separates all citric acid cycle intermediates tested, excepting citric acid and isocitric acid. The solvents are in...

  16. Toxicology of Perfluoroalkyl acids

    EPA Science Inventory

    The Perfluoroalkyl acids(PFAAs) area a family of organic chemicals consisting of a perflurinated carbon backbone (4-12in length) and a acidic functional moiety (Carboxylate or sulfonate). These compounds have excellent surface-tension reducing properties and have numerous industr...

  17. Toxicology of Perfluoroalkyl Acids*

    EPA Science Inventory

    The perfluoroalkyl acids (PFAAs) are a family of organic chemicals consisting of a perfluorinated carbon backbone (4-12 in length) and an acidic functional moiety (carboxylate or sulfonate). These compounds are chemically stable, have excellent surface-tension reducing properties...

  18. Lead-acid cell

    SciTech Connect

    Hradcovsky, R.J.; Kozak, O.R.


    A lead-acid storage battery is described that has a lead negative electrode, a lead dioxide positive electrode and a sulfuric acid electrolyte having an organic catalyst dissolved therein which prevents dissolution of the electrodes into lead sulfate whereby in the course of discharge, the lead dioxide is reduced to lead oxide and the lead is oxidized.

  19. Proteins and Amino Acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteins are the most abundant substances in living organisms and cells. All proteins are constructed from the same twenty amino acids that are linked together by covalent bonds. Shorter chains of two or more amino acids can be linked by covalent bonds to form polypeptides. There are twenty amino...


    EPA Science Inventory

    Recent reviews of available data indicate that precipitation in a large region of North America is highly acidic when its pH is compared with the expected pH value of 5.65 for pure rain water in equilibrium with CO2. A growing body of evidence suggests that acid rain is responsib...

  1. Bile acid transporters

    PubMed Central

    Dawson, Paul A.; Lan, Tian; Rao, Anuradha


    In liver and intestine, transporters play a critical role in maintaining the enterohepatic circulation and bile acid homeostasis. Over the past two decades, there has been significant progress toward identifying the individual membrane transporters and unraveling their complex regulation. In the liver, bile acids are efficiently transported across the sinusoidal membrane by the Na+ taurocholate cotransporting polypeptide with assistance by members of the organic anion transporting polypeptide family. The bile acids are then secreted in an ATP-dependent fashion across the canalicular membrane by the bile salt export pump. Following their movement with bile into the lumen of the small intestine, bile acids are almost quantitatively reclaimed in the ileum by the apical sodium-dependent bile acid transporter. The bile acids are shuttled across the enterocyte to the basolateral membrane and effluxed into the portal circulation by the recently indentified heteromeric organic solute transporter, OSTα-OSTβ. In addition to the hepatocyte and enterocyte, subgroups of these bile acid transporters are expressed by the biliary, renal, and colonic epithelium where they contribute to maintaining bile acid homeostasis and play important cytoprotective roles. This article will review our current understanding of the physiological role and regulation of these important carriers. PMID:19498215

  2. Fats and fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The absolute fat requirement of the human species is the amount of essential fatty acids needed to maintain optimal fatty acid composition of all tissues and normal eicosanoid synthesis. At most, this requirement is no more than about 5% of an adequate energy intake. However, fat accounts for appro...

  3. Analysis of Organic Acids.

    ERIC Educational Resources Information Center

    Griswold, John R.; Rauner, Richard A.


    Presented are the procedures and a discussion of the results for an experiment in which students select unknown carboxylic acids, determine their melting points, and investigate their solubility behavior in water and ethanol. A table of selected carboxylic acids is included. (CW)


    EPA Science Inventory

    Ambient monitoring of acid aerosol in four U.S. cities and in a rural region of southern Ontario clearly show distinct periods of strong acidity. easurements made in Kingston, TN, and Stuebenville, OH, resulted in 24-hr H+ ion concentrations exceeding 100 nmole/m3 more than 10 ti...

  5. Mutant fatty acid desaturase


    Shanklin, John; Cahoon, Edgar B.


    The present invention relates to a method for producing mutants of a fatty acid desaturase having a substantially increased activity towards fatty acid substrates with chains containing fewer than 18 carbons relative to an unmutagenized precursor desaturase having an 18 carbon atom chain length substrate specificity. The method involves inducing one or more mutations in the nucleic acid sequence encoding the precursor desaturase, transforming the mutated sequence into an unsaturated fatty acid auxotroph cell such as MH13 E. coli, culturing the cells in the absence of supplemental unsaturated fatty acids, thereby selecting for recipient cells which have received and which express a mutant fatty acid desaturase with an elevated specificity for fatty acid substrates having chain lengths of less than 18 carbon atoms. A variety of mutants having 16 or fewer carbon atom chain length substrate specificities are produced by this method. Mutant desaturases produced by this method can be introduced via expression vectors into prokaryotic and eukaryotic cells and can also be used in the production of transgenic plants which may be used to produce specific fatty acid products.

  6. Omega-3 Fatty Acids


    Omega-3 fatty acids are used together with lifestyle changes (diet, weight-loss, exercise) to reduce the amount of triglycerides (a fat-like ... people with very high triglycerides. Omega-3 fatty acids are in a class of medications called antilipemic ...

  7. Salicylic Acid Topical


    Propa pH® Peel-Off Acne Mask ... pimples and skin blemishes in people who have acne. Topical salicylic acid is also used to treat ... medications called keratolytic agents. Topical salicylic acid treats acne by reducing swelling and redness and unplugging blocked ...

  8. Amino Acid Crossword Puzzle

    ERIC Educational Resources Information Center

    Sims, Paul A.


    Learning the 20 standard amino acids is an essential component of an introductory course in biochemistry. Later in the course, the students study metabolism and learn about various catabolic and anabolic pathways involving amino acids. Learning new material or concepts often is easier if one can connect the new material to what one already knows;…

  9. Trans Fatty Acids

    NASA Astrophysics Data System (ADS)

    Doyle, Ellin


    Fats and their various fatty acid components seem to be a perennial concern of nutritionists and persons concerned with healthful diets. Advice on the consumption of saturated, polyunsaturated, monounsaturated, and total fat bombards us from magazines and newspapers. One of the newer players in this field is the group of trans fatty acids found predominantly in partially hydrogenated fats such as margarines and cooking fats. The controversy concerning dietary trans fatty acids was recently addressed in an American Heart Association (AHA) science advisory (1) and in a position paper from the American Society of Clinical Nutrition/American Institute of Nutrition (ASCN/AIN) (2). Both reports emphasize that the best preventive strategy for reducing risk for cardiovascular disease and some types of cancer is a reduction in total and saturated fats in the diet, but a reduction in the intake of trans fatty acids was also recommended. Although the actual health effects of trans fatty acids remain uncertain, experimental evidence indicates that consumption of trans fatty acids adversely affects serum lipid levels. Since elevated levels of serum cholesterol and triacylglycerols are associated with increased risk of cardiovascular disease, it follows that intake of trans fatty acids should be minimized.

  10. Sulfuric Acid on Europa

    NASA Technical Reports Server (NTRS)


    Frozen sulfuric acid on Jupiter's moon Europa is depicted in this image produced from data gathered by NASA's Galileo spacecraft. The brightest areas, where the yellow is most intense, represent regions of high frozen sulfuric acid concentration. Sulfuric acid is found in battery acid and in Earth's acid rain.

    This image is based on data gathered by Galileo's near infrared mapping spectrometer.

    Europa's leading hemisphere is toward the bottom right, and there are enhanced concentrations of sulfuric acid in the trailing side of Europa (the upper left side of the image). This is the face of Europa that is struck by sulfur ions coming from Jupiter's innermost moon, Io. The long, narrow features that crisscross Europa also show sulfuric acid that may be from sulfurous material extruded in cracks.

    Galileo, launched in 1989, has been orbiting Jupiter and its moons since December 1995. JPL manages the Galileo mission for NASA's Office of Space Science, Washington DC. JPL is a division of the California Institute of Technology, Pasadena, CA.

  11. Strongly Acidic Auxin Indole-3-Methanesulfonic Acid

    PubMed Central

    Cohen, Jerry D.; Baldi, Bruce G.; Bialek, Krystyna


    A radiochemical synthesis is described for [14C]indole-3-methanesulfonic acid (IMS), a strongly acidic auxin analog. Techniques were developed for fractionation and purification of IMS using normal and reverse phase chromatography. In addition, the utility of both Fourier transform infrared spectrometry and fast atom bombardment mass spectrometry for analysis of IMS has been demonstrated. IMS was shown to be an active auxin, stimulating soybean hypocotyl elongation, bean first internode curvature, and ethylene production. IMS uptake by thin sections of soybean hypocotyl was essentially independent of solution pH and, when applied at a 100 micromolar concentration, IMS exhibited a basipetal polarity in its transport in both corn coleoptile and soybean hypocotyl sections. [14C]IMS should, therefore, be a useful compound to study fundamental processes related to the movement of auxins in plant tissues and organelles. PMID:16664007

  12. Understanding acid rain

    SciTech Connect

    Budiansky, S.


    The complexities of the phenomenon of acid rain are described. Many factors, including meteorology, geology, chemistry, and biology, all play parts. Varying weather, varying soils, the presence of other pollutants and species differences all act to blur the connections between industrial emissions, acid rain, and environmental damage. Some experts believe that the greatest pH shock to lakes occurs during snow melt and runoff in the spring; others believe that much of the plant damage ascribed to acid rain is actually due to the effects of ozone. Much work needs to be done in the area of sampling. Historical data are lacking and sampling methods are not sufficiently accurate. (JMT)


    EPA Science Inventory

    This Environmental Security Technology Certification Program (ESTCP) project demonstrated the Waste Acid Detoxification and Reclamation (WADR) systems ability to recover waste electropolish acid solutions generated during the manufacturing of gun-tubes, and reuse the clean acid. ...

  14. Disorders of Amino Acid Metabolism


    ... Aspiration Syndrome Additional Content Medical News Disorders of Amino Acid Metabolism By Lee M. Sanders, MD, MPH NOTE: ... Metabolic Disorders Disorders of Carbohydrate Metabolism Disorders of Amino Acid Metabolism Disorders of Lipid Metabolism Amino acids are ...

  15. Acid soldering flux poisoning


    The harmful substances in soldering fluxes are called hydrocarbons. They include: Ammonium chloride Rosin Hydrochloric acid Zinc ... Lee DC. Hydrocarbons. In: Marx JA, Hockberger RS, Walls RM, et ... Rosen's Emergency Medicine: Concepts and Clinical Practice . 8th ...

  16. Aminolevulinic Acid Topical


    ... in combination with photodynamic therapy (PDT; special blue light) to treat actinic keratoses (small crusty or scaly ... photosensitizing agents. When aminolevulinic acid is activated by light, it damages the cells of actinic keratosis lesions.

  17. Difficult Decisions: Acid Rain.

    ERIC Educational Resources Information Center

    Miller, John A.; Slesnick, Irwin L.


    Discusses some of the contributing factors and chemical reactions involved in the production of acid rain, its effects, and political issues pertaining to who should pay for the clean up. Supplies questions for consideration and discussion. (RT)

  18. Uric acid - urine


    ... to filter fluids and waste normally (chronic glomerulonephritis ) Lead poisoning Long-term (chronic) alcohol use Risks There are ... Elsevier Saunders; 2011:chap 28. Read More Gout Lead poisoning Liver disease Polycythemia vera Uric acid - blood Update ...

  19. Amoxicillin and Clavulanic Acid


    ... is used to treat certain infections caused by bacteria, including infections of the ears, lungs, sinus, skin, ... antibiotics. It works by stopping the growth of bacteria. Clavulanic acid is in a class of medications ...

  20. Hydrofluoric acid poisoning


    Chemical Emergencies: Case Definition: Hydrofluoric Acid . Centers for Disease Control and Prevention, U.S. Dept of Health and Human Services; 2005. Goldfrank LR, ed. Goldfrank's Toxicologic Emergencies . 8th ed. New ...

  1. Lead/acid batteries

    NASA Astrophysics Data System (ADS)

    Bullock, Kathryn R.

    Lead/acid batteries are produced in sizes from less than 1 to 3000 Ah for a wide variety of portable, industrial and automotive applications. Designs include Planté, Fauré or pasted, and tubular electrodes. In addition to the traditional designs which are flooded with sulfuric acid, newer 'valve-regulated" designs have the acid immolibized in a silica gel or absorbed in a porous glass separator. Development is ongoing worldwide to increase the specific power, energy and deep discharge cycle life of this commercially successful system to meet the needs of new applications such as electric vehicles, load leveling, and solar energy storage. The operating principles, current status, technical challenges and commercial impact of the lead/acid battery are reviewed.

  2. Citric acid urine test


    ... used to diagnose renal tubular acidosis and evaluate kidney stone disease. ... tubular acidosis and a tendency to form calcium kidney stones. The following may decrease urine citric acid levels: ...

  3. Pantothenic acid and biotin


    ... JavaScript. Pantothenic acid and biotin are types of B vitamins. They are water-soluble, which means that the ... found in foods that are good sources of B vitamins, including the following: Animal proteins Avocado Broccoli, kale, ...

  4. (Acid rain workshop)

    SciTech Connect

    Turner, R.S.


    The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

  5. Stomach acid test


    Gastric acid secretion test ... The test is done after you have not eaten for a while so fluid is all that remains in ... injected into your body. This is done to test the ability of the cells in the stomach ...

  6. Deoxycholic Acid Injection


    ... severe submental fat ('double chin'; fatty tissue located under the chin). Deoxycholic acid injection is in a ... as a liquid to be injected subcutaneously (just under the skin) by a doctor. Your doctor will ...

  7. Amino Acids and Chirality

    NASA Technical Reports Server (NTRS)

    Cook, Jamie E.


    Amino acids are among the most heavily studied organic compound class in carbonaceous chondrites. The abundance, distributions, enantiomeric compositions, and stable isotopic ratios of amino acids have been determined in carbonaceous chondrites fi'om a range of classes and petrographic types, with interesting correlations observed between these properties and the class and typc of the chondritcs. In particular, isomeric distributions appear to correlate with parent bodies (chondrite class). In addition, certain chiral amino acids are found in enantiomeric excess in some chondrites. The delivery of these enantiomeric excesses to the early Earth may have contributed to the origin of the homochirality that is central to life on Earth today. This talk will explore the amino acids in carbonaceous chondritcs and their relevance to the origin of life.

  8. Valproic Acid and Pregnancy


    ... in the treatment of epilepsy, and to treat bipolar disorder and migraines. I have been taking valproic acid ... that women with seizure disorders and women with bipolar disorder might have menstrual problems and difficulty getting pregnant. ...

  9. Amino Acid Metabolism Disorders


    Metabolism is the process your body uses to make energy from the food you eat. Food is ... One group of these disorders is amino acid metabolism disorders. They include phenylketonuria (PKU) and maple syrup ...

  10. Uric acid - blood


    ... High levels of uric acid can sometimes cause gout or kidney disease. You may have this test ... Alcoholism Chemotherapy-related side effects Diabetes Excessive exercise Gout Hypoparathyroidism Lead poisoning Leukemia Medullary cystic kidney disease ...

  11. Citric acid urine test


    ... The test is used to diagnose renal tubular acidosis and evaluate kidney stone disease. Normal Results The ... level of citric acid may mean renal tubular acidosis and a tendency to form calcium kidney stones. ...

  12. Folic Acid Quiz


    ... more easily than natural food folate. Close × Answer: D CORRECT: Folic acid reduces the risk for spina ... g., orange juice and green vegetables). Close × Answer: D CORRECT: Spina bifida and anencephaly are neural tube ...

  13. Folic acid in diet


    ... green leafy vegetables Dried beans and peas (legumes) Citrus fruits and juices Fortified means that vitamins have ... A.D.A.M. Editorial team. Related MedlinePlus Health Topics Folic Acid Browse the Encyclopedia A.D. ...

  14. Amoxicillin and Clavulanic Acid


    ... Amoxicillin is in a class of medications called penicillin-like antibiotics. It works by stopping the growth ... allergic to amoxicillin (Amoxil, Trimox, Wymox), clavulanic acid, penicillin, cephalosporins, or any other medications.tell your doctor ...

  15. Boric Acid Poisoning

    PubMed Central

    Wong, L. C.; Heimbach, M. D.; Truscott, D. R.; Duncan, B. D.


    Boric acid poisoning in 11 infants, occurring in the newborn nursery as a result of the accidental and inadvertent use of 2.5% boric acid in the preparation of the formulae, is reported. Five of the infants died. All except two exhibited the classical symptomatology of acute boric acid poisoning, namely, diarrhea, vomiting, erythema, exfoliation, desquamation of the skin, and marked central nervous system irritation. Early manifestations of poisoning were nonspecific, and one patient died before skin manifestations were noted. Peritoneal dialysis, instituted in nine cases, was found to be the most effective method of treatment. It is recommended that boric acid, which is of doubtful therapeutic value, should be completely removed from hospitals, dispensaries and pharmacopoeias. ImagesFig. 1Fig. 2 PMID:14166459

  16. Polymers for acid thickening

    SciTech Connect

    Dixon, K.W.


    Acids, thickened with branched emulsion or suspension polymers of diallyldimethylammonium chloride are useful as oil well drilling and fracturing fluids for stimulating well production and in other applications, such as thickeners for cosmetics, paints, adhesives, textiles and printing inks.

  17. Acid-base chemistry

    SciTech Connect

    Hand, C.W.; Blewit, H.L.


    The book is not a research compendium and there are no references to the literature. It is a teaching text covering the entire range of undergraduate subject matter dealing with acid-base chemistry (some of it remotely) as taught in inorganic, analytical, and organic chemistry courses. The excellent chapters VII through IX deal in detail with the quantitative aspects of aqueous acid-base equilibria (salt hydrolysis and buffer, titrations, polyprotic and amphoteric substances).

  18. Utilization of acid tars

    SciTech Connect

    Frolov, A.F.; Denisova, T.L.; Aminov, A.N.


    Freshly produced acid tar (FPAT), obtained as refinery waste in treating petroleum oils with sulfuric acid and oleum, contains 80% or more sulfuric acid. Of such tars, pond acid tars, which contain up to 80% neutral petroleum products and sulfonated resins, are more stable, and have found applications in the production of binders for paving materials. In this article the authors are presenting results obtained in a study of the composition and reactivity of FPAT and its stability in storage in blends with asphalts obtained in deasphalting operations, and the possibility of using the FPAT in road construction has been examined. In this work, wastes were used which were obtained in treating the oils T-750, KhF-12, I-8A, and MS-14. Data on the change in group chemical composition of FPAT are shown, and the acidity, viscosity, needle penetration, and softening point of acid tars obtained from different grades of oils are plotted as functions of the storage time. It is also shown that the fresh and hardened FPATs differ in their solubilities in various solvents.

  19. Mammalian Fatty Acid Elongases

    PubMed Central

    Jump, Donald B.


    Summary Very long chain fatty acids confer functional diversity on cells by variations in their chain length and degree of unsaturation. Microsomal fatty acid elongation represents the major pathway for determining the chain length of saturated, monounsaturated, and polyunsaturated fatty acids in cellular lipids. The overall reaction for fatty acid elongation involves four enzymes and utilizes malonyl CoA, NADPH, and fatty acyl CoA as substrates. While the fundamental pathway and its requirements have been known for many years, recent advances have revealed a family of enzymes involved in the first step of the reaction, i.e., the condensation reaction. Seven fatty acid elongase subtypes (Elovl #1–7) have been identified in the mouse, rat, and human genomes. These enzymes determine the rate of overall fatty acid elongation. Moreover, these enzymes also display differential substrate specificity, tissue distribution, and regulation, making them important regulators of cellular lipid composition as well as specific cellular functions. Herein, methods are described to measure elongase activity, analyze elongation products, and alter cellular elongase expression. PMID:19763486

  20. Neutron Nucleic Acid Crystallography.


    Chatake, Toshiyuki


    The hydration shells surrounding nucleic acids and hydrogen-bonding networks involving water molecules and nucleic acids are essential interactions for the structural stability and function of nucleic acids. Water molecules in the hydration shells influence various conformations of DNA and RNA by specific hydrogen-bonding networks, which often contribute to the chemical reactivity and molecular recognition of nucleic acids. However, X-ray crystallography could not provide a complete description of structural information with respect to hydrogen bonds. Indeed, X-ray crystallography is a powerful tool for determining the locations of water molecules, i.e., the location of the oxygen atom of H2O; however, it is very difficult to determine the orientation of the water molecules, i.e., the orientation of the two hydrogen atoms of H2O, because X-ray scattering from the hydrogen atom is very small.Neutron crystallography is a specialized tool for determining the positions of hydrogen atoms. Neutrons are not diffracted by electrons, but are diffracted by atomic nuclei; accordingly, neutron scattering lengths of hydrogen and its isotopes are comparable to those of non-hydrogen atoms. Therefore, neutron crystallography can determine both of the locations and orientations of water molecules. This chapter describes the current status of neutron nucleic acid crystallographic research as well as the basic principles of neutron diffraction experiments performed on nucleic acid crystals: materials, crystallization, diffraction experiments, and structure determination. PMID:26227050

  1. Autophagy on acid.


    Wojtkowiak, Jonathan W; Gillies, Robert J


    The microenvironment of solid tumors tends to be more acidic (6.5-7.0) than surrounding normal (7.2-7.4) tissue. Chaotic vasculature, oxygen limitation and major metabolic changes all contribute to the acidic microenvironment. We have previously proposed that low extracellular pH (pHe) plays a critical role in the development and progression of solid tumors. While extracellular acidosis is toxic to most normal cells, cancer cells can adapt and survive under this harsh condition. In this study, we focused on identifying survival strategies employed by cancer cells when challenged with an acidic pHe (6.6-6.7) either acutely or for many generations. While acutely acidic cells did not grow, those acclimated over many generations grew at the same rate as control cells. We observed that these cells induce autophagy in response to acidosis both acutely and chronically, and that this adaptation appears to be necessary for survival. Inhibition of autophagy in low pH cultured cells results in cell death. Histological analysis of tumor xenografts reveals a strong correlation of LC3 protein expression in regions projected to be acidic. Furthermore, in vivo buffering experiments using sodium bicarbonate, previously shown to raise extracellular tumor pH, decreases LC3 protein expression in tumor xenografts. These data imply that autophagy can be induced by extracellular acidosis and appears to be chronically employed as a survival adaptation to acidic microenvironments. PMID:22874557

  2. Method for isolating nucleic acids


    Hurt, Jr., Richard Ashley; Elias, Dwayne A.


    The current disclosure provides methods and kits for isolating nucleic acid from an environmental sample. The current methods and compositions further provide methods for isolating nucleic acids by reducing adsorption of nucleic acids by charged ions and particles within an environmental sample. The methods of the current disclosure provide methods for isolating nucleic acids by releasing adsorbed nucleic acids from charged particles during the nucleic acid isolation process. The current disclosure facilitates the isolation of nucleic acids of sufficient quality and quantity to enable one of ordinary skill in the art to utilize or analyze the isolated nucleic acids for a wide variety of applications including, sequencing or species population analysis.

  3. Acidification and Acid Rain

    NASA Astrophysics Data System (ADS)

    Norton, S. A.; Veselã½, J.


    Air pollution by acids has been known as a problem for centuries (Ducros, 1845; Smith, 1872; Camuffo, 1992; Brimblecombe, 1992). Only in the mid-1900s did it become clear that it was a problem for more than just industrially developed areas, and that precipitation quality can affect aquatic resources ( Gorham, 1955). The last three decades of the twentieth century saw tremendous progress in the documentation of the chemistry of the atmosphere, precipitation, and the systems impacted by acid atmospheric deposition. Chronic acidification of ecosystems results in chemical changes to soil and to surface waters and groundwater as a result of reduction of base cation supply or an increase in acid (H+) supply, or both. The most fundamental changes during chronic acidification are an increase in exchangeable H+ or Al3+ (aluminum) in soils, an increase in H+ activity (˜concentration) in water in contact with soil, and a decrease in alkalinity in waters draining watersheds. Water draining from the soil is acidified and has a lower pH (=-log [H+]). As systems acidify, their biotic community changes.Acidic surface waters occur in many parts of the world as a consequence of natural processes and also due to atmospheric deposition of strong acid (e.g., Canada, Jeffries et al. (1986); the United Kingdom, Evans and Monteith (2001); Sweden, Swedish Environmental Protection Board (1986); Finland, Forsius et al. (1990); Norway, Henriksen et al. (1988a); and the United States (USA), Brakke et al. (1988)). Concern over acidification in the temperate regions of the northern hemisphere has been driven by the potential for accelerating natural acidification by pollution of the atmosphere with acidic or acidifying compounds. Atmospheric pollution ( Figure 1) has resulted in an increased flux of acid to and through ecosystems. Depending on the ability of an ecosystem to neutralize the increased flux of acidity, acidification may increase only imperceptibly or be accelerated at a rate that

  4. Discovery of essential fatty acids

    PubMed Central

    Spector, Arthur A.; Kim, Hee-Yong


    Dietary fat was recognized as a good source of energy and fat-soluble vitamins by the first part of the 20th century, but fatty acids were not considered to be essential nutrients because they could be synthesized from dietary carbohydrate. This well-established view was challenged in 1929 by George and Mildred Burr who reported that dietary fatty acid was required to prevent a deficiency disease that occurred in rats fed a fat-free diet. They concluded that fatty acids were essential nutrients and showed that linoleic acid prevented the disease and is an essential fatty acid. The Burrs surmised that other unsaturated fatty acids were essential and subsequently demonstrated that linolenic acid, the omega-3 fatty acid analog of linoleic acid, is also an essential fatty acid. The discovery of essential fatty acids was a paradigm-changing finding, and it is now considered to be one of the landmark discoveries in lipid research. PMID:25339684

  5. Acid Rain, pH & Acidity: A Common Misinterpretation.

    ERIC Educational Resources Information Center

    Clark, David B.; Thompson, Ronald E.


    Illustrates the basis for misleading statements about the relationship between pH and acid content in acid rain. Explains why pH cannot be used as a measure of acidity for rain or any other solution. Suggests that teachers present acidity and pH as two separate and distinct concepts. (RT)

  6. Nitric acid-formic acid compatibility in DWPF

    SciTech Connect

    Eibling, R.E.


    The addition of the Nitric Acid Flowsheet to the DWPF feed preparation process introduces nitric acid into a vessel which will subsequently receive a formic acid solution. The combination of these two acids suggests that a denitration reaction might occur. This memorandum reviews the conditions under which a denitration reaction is possible and compares these conditions to DWPF operating conditions.

  7. Amino-acid contamination of aqueous hydrochloric acid.

    NASA Technical Reports Server (NTRS)

    Wolman, Y.; Miller, S. L.


    Considerable amino-acid contamination in commercially available analytical grade hydrochloric acid (37% HCl) was found. One bottle contained 8,300 nmol of amino-acids per liter. A bottle from another supplier contained 6,700 nmol per liter. The contaminants were mostly protein amino-acids and several unknowns. Data on the volatility of the amino-acids during HCl distillation were also obtained.

  8. Optical high acidity sensor


    Jorgensen, B.S.; Nekimken, H.L.; Carey, W.P.; O`Rourke, P.E.


    An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber. 10 figs.

  9. Domoic Acid Epileptic Disease

    PubMed Central

    Ramsdell, John S.; Gulland, Frances M.


    Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. We discuss causative mechanisms and neural underpinnings of disease maturation revealed by the rat model to present the concept for olfactory origin of an epileptic disease; triggered in dendodendritic synapases of the olfactory bulb and maturing in the olfactory cortex. We conclude with updated information on populations at risk, medical diagnosis, treatment, and prognosis. PMID:24663110

  10. Domoic acid epileptic disease.


    Ramsdell, John S; Gulland, Frances M


    Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. We discuss causative mechanisms and neural underpinnings of disease maturation revealed by the rat model to present the concept for olfactory origin of an epileptic disease; triggered in dendodendritic synapases of the olfactory bulb and maturing in the olfactory cortex. We conclude with updated information on populations at risk, medical diagnosis, treatment, and prognosis. PMID:24663110

  11. Optical high acidity sensor


    Jorgensen, Betty S.; Nekimken, Howard L.; Carey, W. Patrick; O'Rourke, Patrick E.


    An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and, a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber.

  12. A Demonstration of Acid Rain

    ERIC Educational Resources Information Center

    Fong, Man Wai


    A demonstration showing acid rain formation is described. Oxides of sulfur and nitrogen that result from the burning of fossil fuels are the major pollutants of acid rain. In this demonstration, SO[subscript 2] gas is produced by the burning of matches. An acid-base indicator will show that the dissolved gas turns an aqueous solution acidic.

  13. Oleanolic acid ethanol monosolvate

    PubMed Central

    Froelich, Anna; Gzella, Andrzej K.


    Crystals of the title compound (systematic name: 3β-hy­droxy­olean-12-en-28-oic acid ethanol monosolvate), C30H48O3·C2H5OH, were obtained from unsuccessful co-crystallization trials. The asymmetric unit contains two symmetry-independent oleanolic acid mol­ecules, as well as two ethanol solvent mol­ecules. Inter­molecular O—H⋯O hydrogen bonds stabilize the crystal packing. In the oleanolic acid mol­ecules, ring C has a slightly distorted envelope conformation, while rings A, B, D and E adopt chair conformations and rings D and E are cis-fused. Both independent ethanol mol­ecules are orientationally disordered [occupancy ratios of 0.742 (8):0.258 (8) and 0.632 (12):0.368 (12). PMID:21588987

  14. Amino acid analysis.


    Crabb, J W; West, K A; Dodson, W S; Hulmes, J D


    Amino acid analysis (AAA) is one of the best methods to quantify peptides and proteins. Two general approaches to quantitative AAA exist, namely, classical postcolumn derivatization following ion-exchange chromatography and precolumn derivatization followed by reversed-phase HPLC (RP-HPLC). Excellent instrumentation and several specific methodologies are available for both approaches, and both have advantages and disadvantages. This unit focuses on picomole-level AAA of peptides and proteins using the most popular precolumn-derivatization method, namely, phenylthiocarbamyl amino acid analysis (PTC-AAA). It is directed primarily toward those interested in establishing the technology with a modest budget. PTC derivatization and analysis conditions are described, and support and alternate protocols describe additional techniques necessary or useful for most any AAA method--e.g., sample preparation, hydrolysis, instrument calibration, data interpretation, and analysis of difficult or unusual residues such as cysteine, tryptophan, phosphoamino acids, and hydroxyproline. PMID:18429107

  15. Acid rain: Controllable?

    NASA Astrophysics Data System (ADS)

    Machta, Lester

    Acid rain is one of a growing number of environmental issues in which impacts are far removed from the source o f the irritants. Those who suffer may differ in geographical area from those who benefit from the activity which releases pollution to the atmosphere. Like the issue concerning the depletion of ozone by manufactured chemicals, the acid rain issue further emphasizes the need for continuing atmospheric chemistry research, a science whose history dates back but a few decades. Examination of the acid rain issue also calls for intimate collaboration of atmospheric scientists with ecologists, biologists, and other scientists, who must advise the geophysicists regarding what chemicals in the environment produce damage, their mode of entry into an ecosystem, and the need to understand acute or chronic impacts.

  16. Acid rain in Asia

    NASA Astrophysics Data System (ADS)

    Bhatti, Neeloo; Streets, David G.; Foell, Wesley K.


    Acid rain has been an issue of great concern in North America and Europe during the past several decades. However, due to the passage of a number of recent regulations, most notably the Clean Air Act in the United States in 1990, there is an emerging perception that the problem in these Western nations is nearing solution. The situation in the developing world, particularly in Asia, is much bleaker. Given the policies of many Asian nations to achieve levels of development comparable with the industrialized world—which necessitate a significant expansion of energy consumption (most derived from indigenous coal reserves)—the potential for the formation of, and damage from, acid deposition in these developing countries is very high. This article delineates and assesses the emissions patterns, meteorology, physical geology, and biological and cultural resources present in various Asian nations. Based on this analysis and the risk factors to acidification, it is concluded that a number of areas in Asia are currently vulnerable to acid rain. These regions include Japan, North and South Korea, southern China, and the mountainous portions of Southeast Asia and southwestern India. Furthermore, with accelerated development (and its attendant increase in energy use and production of emissions of acid deposition precursors) in many nations of Asia, it is likely that other regions will also be affected by acidification in the near future. Based on the results of this overview, it is clear that acid deposition has significant potential to impact the Asian region. However, empirical evidence is urgently needed to confirm this and to provide early warning of increases in the magnitude and spread of acid deposition and its effects throughout this part of the world.



    Boller, E.R.; Eubank, L.D.


    An improved process is described for the treatment of metallic uranium surfaces preparatory to being given hot dip coatings. The process consists in first pickling the uraniunn surInce with aqueous 50% to 70% nitric acid, at 60 to 70 deg C, for about 5 minutes, rinsing the acid solution from the uranium article, promptly drying and then passing it through a molten alkali-metal halide flux consisting of 42% LiCl, 53% KCla and 5% NaCl into a molten metal bath consisting of 85 parts by weight of zinc and 15 parts by weight of aluminum

  18. [Nicotinic acid and nicotinamide].


    Kobayashi, M; Shimizu, S


    Nicotinic acid and nicotinamide are called niacin. They are the antipellagra vitamin essential to many animals for growth and health. In human being, niacin is believed necessary together with other vitamins for the prevention and cure of pellagra. Niacin is widely distributed in nature; appreciable amounts are found in liver, fish, yeast and cereal grains. Nicotinamide is a precursor of the coenzyme NAD and NADP. Some of the most understood metabolic processes that involve niacin are glycolysis, fatty acid synthesis and respiration. Niacin is also related to the following diseases: Hartnup disease; blue diaper syndrome; tryptophanuria; hydroxykynureninuria; xanthurenic aciduria; Huntington's disease. PMID:10540864

  19. Fatty Acids of Thiobacillus thiooxidans

    PubMed Central

    Levin, Richard A.


    Fatty acid spectra were made on Thiobacillus thiooxidans cultures both in the presence and absence of organic compounds. Small additions of glucose or acetate had no significant effect either on growth or fatty acid content. The addition of biotin had no stimulatory effect but did result in slight quantitative changes in the fatty acid spectrum. The predominant fatty acid was a C19 cyclopropane acid. PMID:4945206

  20. The Acid-Base Titration of a Very Weak Acid: Boric Acid

    ERIC Educational Resources Information Center

    Celeste, M.; Azevedo, C.; Cavaleiro, Ana M. V.


    A laboratory experiment based on the titration of boric acid with strong base in the presence of d-mannitol is described. Boric acid is a very weak acid and direct titration with NaOH is not possible. An auxiliary reagent that contributes to the release of protons in a known stoichiometry facilitates the acid-base titration. Students obtain the…

  1. Comparison of Buffer Effect of Different Acids During Sandstone Acidizing

    NASA Astrophysics Data System (ADS)

    Umer Shafiq, Mian; Khaled Ben Mahmud, Hisham; Hamid, Mohamed Ali


    The most important concern of sandstone matrix acidizing is to increase the formation permeability by removing the silica particles. To accomplish this, the mud acid (HF: HCl) has been utilized successfully for many years to stimulate the sandstone formations, but still it has many complexities. This paper presents the results of laboratory investigations of different acid combinations (HF: HCl, HF: H3PO4 and HF: HCOOH). Hydrofluoric acid and fluoboric acid are used to dissolve clays and feldspar. Phosphoric and formic acids are added as a buffer to maintain the pH of the solution; also it allows the maximum penetration of acid into the core sample. Different tests have been performed on the core samples before and after the acidizing to do the comparative study on the buffer effect of these acids. The analysis consists of permeability, porosity, color change and pH value tests. There is more increase in permeability and porosity while less change in pH when phosphoric and formic acids were used compared to mud acid. From these results it has been found that the buffer effect of phosphoric acid and formic acid is better than hydrochloric acid.

  2. Alkyl phosphonic acids and sulfonic acids in the Murchison meteorite

    NASA Technical Reports Server (NTRS)

    Cooper, George W.; Onwo, Wilfred M.; Cronin, John R.


    Homologous series of alkyl phosphonic acids and alkyl sulfonic acids, along with inorganic orthophosphate and sulfate, are identified in water extracts of the Murchison meteorite after conversion to their t-butyl dimethylsilyl derivatives. The methyl, ethyl, propyl, and butyl compounds are observed in both series. Five of the eight possible alkyl phosphonic acids and seven of the eight possible alkyl sulfonic acids through C4 are identified. Abundances decrease with increasing carbon number as observed of other homologous series indigenous to Murchison. Concentrations range downward from approximately 380 nmol/gram in the alkyl sulfonic acid series, and from 9 nmol/gram in the alkyl phosphonic acid series.

  3. Docosahexaenoic acid and lactation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Docosahexaenoic acid (DHA) is an important component of membrane phospholipids in the retina, and brain, and accumulates rapidly in these tissues during early infancy. DHA is present in human milk, but the amount varies considerably and is largely dependent on maternal diet. This article reviews dat...


    EPA Science Inventory

    This report documents the discussion and results of the U.S. EPA Acid Aerosol Measurement Workshop, conducted February 1-3, 1989, in Research Triangle Park, North Carolina. t was held in response to recommendations by the Clean Air Scientific Advisory Committee (CASAC) regarding ...

  5. Acid Rain Classroom Projects.

    ERIC Educational Resources Information Center

    Demchik, Michael J.


    Describes a curriculum plan in which students learn about acid rain through instructional media, research and class presentations, lab activities, simulations, design, and design implementation. Describes the simulation activity in detail and includes materials, procedures, instructions, examples, results, and discussion sections. (SAH)

  6. Acid rain bibliography

    SciTech Connect

    Sayers, C.S.


    This bibliography identifies 900 citations on various aspects of Acid Rain, covering published bibliographies, books, reports, conference and symposium proceedings, audio visual materials, pamphlets and newsletters. It includes five sections: citations index (complete record of author, title, source, order number); KWIC index; title index; author index; and source index. 900 references.

  7. The Acid Rain Debate.

    ERIC Educational Resources Information Center

    Oates-Bockenstedt, Catherine


    Details an activity designed to motivate students by incorporating science-related issues into a classroom debate. Includes "The Acid Rain Bill" and "Position Guides" for student roles as committee members, consumers, governors, industry owners, tourism professionals, senators, and debate directors. (DKM)

  8. The Acid Rain Debate.

    ERIC Educational Resources Information Center

    Bybee, Rodger; And Others


    Describes an activity which provides opportunities for role-playing as industrialists, ecologists, and government officials. The activity involves forming an international commission on acid rain, taking testimony, and, based on the testimony, making recommendations to governments on specific ways to solve the problem. Includes suggestions for…

  9. The Acid Rain Game.

    ERIC Educational Resources Information Center

    Rakow, Steven J.; Glenn, Allen


    Provides rationale for and description of an acid rain game (designed for two players), a problem-solving model for elementary students. Although complete instructions are provided, including a copy of the game board, the game is also available for Apple II microcomputers. Information for the computer program is available from the author.…

  10. Acid Rain Investigations.

    ERIC Educational Resources Information Center

    Hugo, John C.


    Presents an activity in which students investigate the formation of solid ammonium chloride aerosol particles to help students better understand the concept of acid rain. Provides activity objectives, procedures, sample data, clean-up instructions, and questions and answers to help interpret the data. (MDH)

  11. Brain amino acid sensing.


    Tsurugizawa, T; Uneyama, H; Torii, K


    The 20 different amino acids, in blood as well as in the brain, are strictly maintained at the same levels throughout the day, regardless of food intake. Gastric vagal afferents only respond to free glutamate and sugars, providing recognition of food intake and initiating digestion. Metabolic control of amino acid homeostasis and diet-induced thermogenesis is triggered by this glutamate signalling in the stomach through the gut-brain axis. Rats chronically fed high-sugar and high-fat diets do not develop obesity when a 1% (w/v) monosodium glutamate (MSG) solution is available in a choice paradigm. Deficiency of the essential amino acid lysine (Lys) induced a plasticity in rats in response to Lys. This result shows how the body is able to identify deficient nutrients to maintain homeostasis. This plastic effect is induced by activin A activity in the brain, particularly in certain neurons in the lateral hypothalamic area (LHA) which is the centre for amino acid homeostasis and appetite. These neurons respond to glutamate signalling in the oral cavity by which umami taste is perceived. They play a quantitative role in regulating ingestion of deficient nutrients, thereby leading to a healthier life. After recovery from malnutrition, rats prefer MSG solutions, which serve as biomarkers for protein nutrition. PMID:25200295

  12. Targeting tumor acidity

    NASA Astrophysics Data System (ADS)

    Reshetnyak, Yana K.; Engelman, Donald M.; Andreev, Oleg A.


    One of the main features of solid tumors is extracellular acidity, which correlates with tumor aggressiveness and metastatic potential. We introduced novel approach in targeting of acidic tumors, and translocation of cell-impermeable cargo molecules across cellular membrane. Our approach is based on main principle of insertion and folding of a polypeptide in lipid bilayer of membrane. We have identified family of pH Low Insertion Peptides (pHLIPs), which are capable spontaneous insertion and folding in membrane at mild acidic conditions. The affinity of peptides of pHLIP family to membrane at low pH is several times higher than at neutral pH. The process of peptides folding occurs within milliseconds. The energy released in a result of folding (about 2 kcal/mol) could be used to move polar cargo across a membrane, which is a novel concept in drug delivery. pHLIP peptides could be considered as a pH-sensitive single peptide molecular transporters and conjugated with imaging probes for fluorescence, MR, PET and SPECT imaging, they represent a novel in vivo marker of acidity. The work is supported by NIH grants CA133890 and GM073857 to OAA, DME, YRK.

  13. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei


    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  14. Plant fatty acid hydroxylase


    Somerville, Chris; van de Loo, Frank


    The present invention relates to the identification of nucleic acid sequences and constructs, and methods related thereto, and the use of these sequences and constructs to produce genetically modified plants for the purpose of altering the composition of plant oils, waxes and related compounds.

  15. Spermatotoxicity of dichloroacetic acid

    EPA Science Inventory

    The testicular toxicity of dichloroacetic acid (DCA), a disinfection byproduct of drinking water, was evaluated in adult male rats given both single and multiple (up to 14 d) oral doses. Delayed spermiation and altered resorption of residual bodies were observed in rats given sin...

  16. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert


    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  17. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters


    Moens, Luc


    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  18. Photostabilization of ascorbic acid with citric acid, tartaric acid and boric acid in cream formulations.


    Ahmad, I; Ali Sheraz, M; Ahmed, S; Shad, Z; Vaid, F H M


    This study involves the evaluation of the effect of certain stabilizers, that is, citric acid (CT), tartaric acid (TA) and boric acid (BA) on the degradation of ascorbic acid (AH(2) ) in oil-in-water cream formulations exposed to the UV light and stored in the dark. The apparent first-order rate constants (0.34-0.95 × 10(-3) min(-1) in light, 0.38-1.24 × 10(-2) day(-1) in dark) for the degradation reactions in the presence of the stabilizers have been determined. These rate constants have been used to derive the second-order rate constants (0.26-1.45 × 10(-2) M(-1) min(-1) in light, 3.75-8.50 × 10(-3) M(-1) day(-1) in dark) for the interaction of AH(2) and the individual stabilizers. These stabilizers are effective in causing the inhibition of the rate of degradation of AH(2) both in the light and in the dark. The inhibitory effect of the stabilizers is in the order of CT > TA > BA. The rate of degradation of AH(2) in the presence of these stabilizers in the light is about 120 times higher than that in the dark. This could be explained on the basis of the deactivation of AH(2) -excited triplet state by CT and TA and by the inhibition of AH(2) degradation through complex formation with BA. AH(2) leads to the formation of dehydroascorbic acid (A) by chemical and photooxidation in cream formulations. PMID:22296174

  19. Fatty acid-producing hosts

    SciTech Connect

    Pfleger, Brian F; Lennen, Rebecca M


    Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at C. Methods of producing a fatty acid product comprising culturing such hosts at C. are also described.

  20. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].


    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua


    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  1. Circulating folic acid in plasma: relation to folic acid fortification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The implementation of folic acid fortification in the United States has resulted in unprecedented amounts of this synthetic form of folate in the American diet. Folic acid in circulation may be a useful measure of physiologic exposure to synthetic folic acid, and there is a potential for elevated co...

  2. College Chemistry Students' Mental Models of Acids and Acid Strength

    ERIC Educational Resources Information Center

    McClary, LaKeisha; Talanquer, Vicente


    The central goal of this study was to characterize the mental models of acids and acid strength expressed by advanced college chemistry students when engaged in prediction, explanation, and justification tasks that asked them to rank chemical compounds based on their relative acid strength. For that purpose we completed a qualitative research…

  3. NAPAP (National Acid Precipitation Assessment Program) results on acid rain

    SciTech Connect

    Not Available


    The National Acid Precipitation Assessment Program (NAPAP) was mandated by Congress in 1980 to study the effects of acid rain. The results of 10 years of research on the effect of acid deposition and ozone on forests, particularly high elevation spruce and fir, southern pines, eastern hardwoods and western conifers, will be published this year.

  4. Acid Earth--The Global Threat of Acid Pollution.

    ERIC Educational Resources Information Center

    McCormick, John

    Acid pollution is a major international problem, but the debate it has elicited has often clouded the distinction between myth and facts. This publication attempts to concerning the acid pollution situation. This publication attempts to identify available facts. It is the first global review of the problem of acid pollution and the first to…

  5. Industrial ecotoxicology "acid rain".


    Astolfi, E; Gotelli, C; Higa, J


    The acid rain phenomenon was studied in the province of Cordoba, Argentina. This study, based on a previously outlined framework, determined the anthropogenic origin of the low pH due to the presence of industrial hydrochloric acid wastage. This industrial ecotoxicological phenomenon seriously affected the forest wealth, causing a great defoliation of trees and shrubs, with a lower effect on crops. A survey on its effects on human beings has not been carried out, but considering the corrosion caused to different metals and its denouncing biocide effect on plants and animals, we should expect to find some kind of harm to the health of the workers involved or others engaged in farming, and even to those who are far away from the polluting agent. PMID:3758667

  6. [Progress in glucaric acid].


    Qiu, Yuying; Fang, Fang; Du, Guocheng; Chen, Jian


    Glucaric acid (GA) is derived from glucose and commonly used in chemical industry. It is also considered as one of the "Top value-added chemicals from biomass" as carbohydrate monomers to produce various synthetic polymers and bioenergy. The demand for GA in food manufacture is increasing. GA has also attracted public attentions due to its therapeutic uses such as regulating hormones, increasing the immune function and reducing the risks of cancers. Currently GA is produced by chemical oxidation. Research on production of GA via microbial synthesis is still at preliminary stage. We reviewed the advances of glucaric acid applications, preparation and quantification methods. The prospects on production of GA by microbial fermentation were also discussed. PMID:26380405

  7. Acid hydrolysis of cellulose

    SciTech Connect

    Salazar, H.


    One of the alternatives to increase world production of etha nol is by the hydrolysis of cellulose content of agricultural residues. Studies have been made on the types of hydrolysis: enzimatic and acid. Data obtained from the sulphuric acid hydrolysis of cellulose showed that this process proceed in two steps, with a yield of approximately 95% glucose. Because of increases in cost of alternatives resources, the high demand of the product and the more economic production of ethanol from cellulose materials, it is certain that this technology will be implemented in the future. At the same time further studies on the disposal and reuse of the by-products of this production must be undertaken.

  8. Eucomic acid methanol monosolvate

    PubMed Central

    Li, Guo-Qiang; Li, Yao-Lan; Wang, Guo-Cai; Liang, Zhi-Hong; Jiang, Ren-Wang


    In the crystal structure of the title compound [systematic name: 2-hy­droxy-2-(4-hy­droxy­benz­yl)butane­dioic acid methanol monosolvate], C11H12O6·CH3OH, the dihedral angles between the planes of the carboxyl groups and the benzene ring are 51.23 (9) and 87.97 (9)°. Inter­molecular O—H⋯O hydrogen-bonding inter­actions involving the hy­droxy and carb­oxy­lic acid groups and the methanol solvent mol­ecule give a three-dimensional structure. PMID:22091200

  9. (Radioiodinated free fatty acids)

    SciTech Connect

    Knapp, Jr., F. F.


    The traveler participated in the Second International Workshop on Radioiodinated Free Fatty Acids in Amsterdam, The Netherlands where he presented an invited paper describing the pioneering work at the Oak Ridge National Laboratory (ORNL) involving the design, development and testing of new radioiodinated methyl-branched fatty acids for evaluation of heart disease. He also chaired a technical session on the testing of new agents in various in vitro and in vivo systems. He also visited the Institute for Clinical and Experimental Nuclear Medicine in Bonn, West Germany, to review, discuss, plan and coordinate collaborative investigations with that institution. In addition, he visited the Cyclotron Research Center in Liege, Belgium, to discuss continuing collaborative studies with the Osmium-191/Iridium-191m radionuclide generator system, and to complete manuscripts and plan future studies.

  10. Tunnelling in carbonic acid.


    Wagner, J Philipp; Reisenauer, Hans Peter; Hirvonen, Viivi; Wu, Chia-Hua; Tyberg, Joseph L; Allen, Wesley D; Schreiner, Peter R


    The cis,trans-conformer of carbonic acid (H2CO3), generated by near-infrared radiation, undergoes an unreported quantum mechanical tunnelling rotamerization with half-lives in cryogenic matrices of 4-20 h, depending on temperature and host material. First-principles quantum chemistry at high levels of theory gives a tunnelling half-life of about 1 h, quite near those measured for the fastest rotamerizations. PMID:27248671

  11. Optimize acid gas removal

    SciTech Connect

    Nicholas, D.M.; Wilkins, J.T.


    Innovative design of physical solvent plants for acid gas removal can materially reduce both installation and operating costs. A review of the design considerations for one physical solvent process (Selexol) points to numerous arrangements for potential improvement. These are evaluated for a specific case in four combinations that identify an optimum for the case in question but, more importantly, illustrate the mechanism for use for such optimization elsewhere.

  12. Studies on terreic acid.


    Yamamoto, H; Moriyama, K; Jinnouchi, H; Yagishita, K


    It was found that Aspergillus sp. No. Y-8980 which was isolated from a soil sample collected at Yoron Island in Kagoshima Prefecture belonged to Aspergillus terreus group by morphological observation. The active substance produced by the strain was obtained with a high yield in sucrose-yeast extract medium and extracted by chloroform, ethyl acetate and n-butanol at pH 2.4 approximately 2.6 from the culture broth. The substance was crystallized from chloroform and ethyl acetate after charcoal treatment of the crude crystal. From various physico-chemical properties, it was found that the substance was identical to terreic acid. Terreic acid showed MICs of 25 approximately 100 mcg/ml, 12.5 mcg/ml and 50 mcg/ml against Gram-positive and Gram-negative bacteria, Xanthomonas oryzae and Xanthomonas citri, respectively, but it did not control Pseudomonas, fungi and yeast. The LD50 was 75 mg/kg i.p. and i.v. in mice. With regards to the anti-tumor effect, the morphological degeneration on HeLa cells (human carcinoma cells) was observed in the concentrations of more than 6.25 mcg/ml of terreic acid. An increase of body weight of mice caused by Ehrlich ascites carcinoma cells was not definitely observed by the daily administration of 150 mcg of terreic acid per mouse for 8 consecutive days. Above showed the enough survival effect in dd mice implanted with Ehrlich ascites carcinoma cells, and the effect also was demonstrated by anatomies of mice. PMID:7190624

  13. Perfluorooctanoic acid and environmental risks

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is a member of the perfluoroalkyl acids (PFAA) family of chemicals, which consist of a carbon backbone typically four to fourteen carbons in length and a charged functional moiety.

  14. Folic Acid Questions and Answers


    ... swallow large pills. How can I take a vitamin with folic acid? A : These days, multivitamins with folic acid come in chewable chocolate or fruit flavors, liquids, and large oval or smaller round ...

  15. Pantothenic acid (Vitamin B5)


    Pantothenic acid is a vitamin, also known as vitamin B5. It is widely found in both plants and animals ... Vitamin B5 is commercially available as D-pantothenic acid, as well as dexpanthenol and calcium pantothenate, which ...

  16. Bile acid sequestrants for cholesterol


    Bile acid sequestrants are medicines that help lower your LDL (bad) cholesterol . Too much cholesterol in your blood can ... block them. These medicines work by blocking bile acid in your stomach from being absorbed in your ...

  17. Omega-3 fatty acids (image)


    Omega-3 fatty acids are a form of polyunsaturated fat that the body derives from food. Omega-3s (and omega-6s) are known as essential fatty acids (EFAs) because they are important for good health. ...

  18. Pantothenic acid (Vitamin B5)


    ... D-pantothenic acid, as well as dexpanthenol and calcium pantothenate, which are chemicals made in the lab from ... Early research suggests that pantothenic acid (given as calcium pantothenate) does not reduce symptoms of osteoarthritis. Recovery after ...

  19. Amino acid imbalance in cystinuria

    PubMed Central

    Asatoor, A. M.; Freedman, P. S.; Gabriel, J. R. T.; Milne, M. D.; Prosser, D. I.; Roberts, J. T.; Willoughby, C. P.


    After oral ingestion of a free amino acid mixture by three cystinuric patients, plasma increments of lysine and arginine were lower and those of many other amino acids were significantly higher than those found in control subjects. Similar results were obtained in control subjects after amino acid imbalance had been artificially induced by the omission of cystine, lysine, and arginine from the amino acid mixture. Especially high increments of alanine and proline provided the best evidence of amino acid imbalance caused by a temporary lysine and, to a lesser extent, arginine and cystine deficit. No such amino acid imbalance was found to occur in the cystinuric patients after ingestion of whole protein, indicating that absorption of oligopeptides produced by protein digestion provided a balanced physiological serum amino acid increment. This is considered to explain the lack of any unequivocal nutritional deficit in cystinuric patients despite poor absorption of the essential free amino acid, lysine. PMID:4411931

  20. Immunomodulatory spherical nucleic acids

    PubMed Central

    Radovic-Moreno, Aleksandar F.; Chernyak, Natalia; Mader, Christopher C.; Nallagatla, Subbarao; Kang, Richard S.; Hao, Liangliang; Walker, David A.; Halo, Tiffany L.; Merkel, Timothy J.; Rische, Clayton H.; Anantatmula, Sagar; Burkhart, Merideth; Mirkin, Chad A.; Gryaznov, Sergei M.


    Immunomodulatory nucleic acids have extraordinary promise for treating disease, yet clinical progress has been limited by a lack of tools to safely increase activity in patients. Immunomodulatory nucleic acids act by agonizing or antagonizing endosomal toll-like receptors (TLR3, TLR7/8, and TLR9), proteins involved in innate immune signaling. Immunomodulatory spherical nucleic acids (SNAs) that stimulate (immunostimulatory, IS-SNA) or regulate (immunoregulatory, IR-SNA) immunity by engaging TLRs have been designed, synthesized, and characterized. Compared with free oligonucleotides, IS-SNAs exhibit up to 80-fold increases in potency, 700-fold higher antibody titers, 400-fold higher cellular responses to a model antigen, and improved treatment of mice with lymphomas. IR-SNAs exhibit up to eightfold increases in potency and 30% greater reduction in fibrosis score in mice with nonalcoholic steatohepatitis (NASH). Given the clinical potential of SNAs due to their potency, defined chemical nature, and good tolerability, SNAs are attractive new modalities for developing immunotherapies. PMID:25775582

  1. Cannabinoid acids analysis.


    Lercker, G; Bocci, F; Frega, N; Bortolomeazzi, R


    The cannabinoid pattern of vegetable preparations from Cannabis sativa (hashish, marijuana) allows to recognize the phenotype of the plants, to be used as drug or for fiber. Cannabinoid determination by analytical point of view has represented some problems caused by the complex composition of the hexane extract. Capillary gas chromatography of the hexane extracts of vegetable samples, shows the presence of rather polar constituents that eluted, with noticeable interactions, only on polar phase. The compounds can be methylated by diazomethane and silanized (TMS) by silylating reagents. The methyl and methyl-TMS derivatives are analyzed by high resolution gas chromatography (HRGC) and by gas chromatography-mass spectrometry (GC-MS). The identification of the compounds shows their nature of cannabinoid acids, which the main by quantitative point of view results the cannabidiolic acid (CBDA). It is known that the cannabinoid acids are thermally unstable and are transformed in the corresponding cannabinoids by decarboxilation. This is of interest in forensic analysis with the aim to establish the total amount of THC in the Cannabis preparations, as the active component. PMID:1503600

  2. Acid rain: Reign of controversy

    SciTech Connect

    Kahan, A.M.


    Acid Rain is a primer on the science and politics of acid rain. Several introductory chapters describe in simple terms the relevant principles of water chemistry, soil chemistry, and plant physiology and discuss the demonstrated or postulated effects of acid rain on fresh waters and forests as well as on statuary and other exposed objects. There follow discussions on the economic and social implications of acid rain (for example, possible health effects) and on the sources, transport, and distribution of air pollutants.

  3. Carboxylic acid sorption regeneration process


    King, C. Judson; Poole, Loree J.


    Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine.

  4. Carboxylic acid sorption regeneration process


    King, C.J.; Poole, L.J.


    Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine. 10 figs.

  5. An Umbrella for Acid Rain.

    ERIC Educational Resources Information Center

    Randal, Judith


    The Environmental Protection Agency has awarded several grants to study effects of and possible solutions to the problem of "acid rain"; pollution from atmospheric nitric and sulfuric acids. The research program is administered through North Carolina State University at Raleigh and will focus on biological effects of acid rain. (JMF)


    PubMed Central

    Kobayashi, Yasuo; Arima, Kei


    Kobayashi, Yasuo (University of Tokyo, Tokyo, Japan) and Kei Arima. Bacterial oxidation of dipicolinic acid. II. Identification of α-ketoglutaric acid and 3-hydroxydipicolinic acid and some properties of cell-free extracts. J. Bacteriol. 84:765–771. 1962—When a dipicolinic acid (DPA)-decomposing bacterium, Achromobacter strain 1–2, was incubated at 30 C with shaking in a DPA solution containing 10−3m arsenite, a keto acid was accumulated. The 2,4-dinitrophenylhydrazone of this acid was synthesized and identified as α-ketoglutaric acid by paper chromatography, visible absorption spectrum, infrared analysis, elemental analysis, and mixed melting point. During this incubation, oxalic acid equivalent to the consumed dipicolinic acid was produced. A fluorescent material was also isolated from culture fluid and identified as 3-hydroxydipicolinic acid by paper chromatography and the ultraviolet absorption spectrum. Further, cell-free extracts were prepared by sonic oscillation. Ferrous ion and a reduced di- or triphosphopyridine nucleotide-generating system were proven to be required for enzymic oxidation of DPA. And 3-hydroxydipicolinic acid was also oxidized by this preparation. From the results obtained, a possible metabolic pathway of dipicolinic acid was proposed. PMID:14033954

  7. Pantothenic acid biosynthesis in zymomonas

    SciTech Connect

    Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.


    Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

  8. Scientists Puzzle Over Acid Rain

    ERIC Educational Resources Information Center

    Chemical and Engineering News, 1975


    Reports on a growing concern over increased acidity in atmospheric percipitation. Explores possible causes of the increased acidity, identifies chemical components of precipitation in various parts of the world, and presents environmental changes that might be attributed to the acidity. (GS)

  9. Serum Uric Acid in Smokers

    PubMed Central

    Hanna, Bassam E.; Hamed, Jamal M.; Touhala, Luma M.


    Objectives To demonstrate the possible effect of smoking on serum uric acid. Methods Subjects enrolled in study were divided into two groups; nonsmokers and smokers, each with 60 male volunteers of the same social class and dietary habit without history of alcohol consumption, diabetes mellitus, hyperuricemia and gout, renal, joint, lung or heart diseases. Fasting blood and random urine samples were obtained from both groups for measurement of uric acid and creatinine. Calculation of both urine uric acid/urine creatinine ratio and fraction excretion of uric acid were done. The results were statistically evaluated by standard statistical methods. Results No significant differences in the age, serum creatinine, spot urine uric acid/urine creatinine ratio and fraction excretion of uric acid between the two groups, serum uric acid was significantly lower in smokers. In smokers there was significant negative correlation of smoking status (average number of cigarette smoked/day, duration of smoking and cumulative amount of smoking) with serum uric acid. Conclusion After exclusion of other factors affecting uric acid level, the significant low serum uric acid level in smokers was attributed to reduce endogenous production as a result of chronic exposure to cigarette smoke that is a significant source of oxidative stress. As this reduction is proportionate with smoking status and predisposes to cardiovascular disease, it is, therefore, recommended for smokers to stop or reduce smoking and introduce serum uric acid estimation as routine test since its cheap and simple to reflect their antioxidant level. Keywords Smokers; Uric acid; CVD. PMID:22334840

  10. Experimental study of the hydrothermal reactivity of organic acids and acid anions: II. Acetic acid, acetate, and valeric acid

    NASA Astrophysics Data System (ADS)

    McCollom, Thomas M.; Seewald, Jeffrey S.


    Organic acids and acid anions occur in substantial concentrations in many aqueous geologic fluids and are thought to take part in a variety of geochemical processes ranging from the transport of metals in ore-forming fluids to the formation of natural gas to serving as a metabolic energy source for microbes in subsurface habitats. The widespread occurrence of organic acids and their potential role in diverse geologic processes has led to numerous experimental studies of their thermal stability, yet there remain substantial gaps in our knowledge of the factors that control the rates and reaction pathways for the decomposition of these compounds under geologic conditions. In order to address some of these uncertainties, a series of laboratory experiments were conducted to examine the behavior of organic acids and acid anions under hydrothermal conditions in the presence of minerals. Reported here are results of experiments where aqueous solutions of acetic acid, sodium acetate, or valeric acid ( n-pentanoic acid) were heated at 325°C, 350 bars in the presence of the mineral assemblages hematite + magnetite + pyrite, pyrite + pyrrhotite + magnetite, and hematite + magnetite. The results indicate that aqueous acetic acid and acetate decompose by a combination of two reaction pathways: decarboxylation and oxidation. Both reactions are promoted by minerals, with hematite catalyzing the oxidation reaction while magnetite catalyzes decarboxylation. The oxidation reaction is much faster, so that oxidation dominates the decomposition of acetic acid and acetate when hematite is present. In contrast to previous reports that acetate decomposed more slowly than acetic acid, we found that acetate decomposed at slightly faster rates than the acid in the presence of minerals. Although longer-chain monocarboxylic acids are generally thought to decompose by decarboxylation, valeric acid appeared to decompose primarily by "deformylation" to 1-butene plus formic acid. Subsequent

  11. Role of acid diffusion in matrix acidizing of carbonates

    SciTech Connect

    Hoefner, M.L.; Fogler, H.S.; Stenius, P.; Sjoblom, J.


    To increase the efficiency of matrix treatments in carbonates, a new type of retarded acid-in-oil microemulsion system has ben developed. The microemulsion is of low viscosity but can exhibit acid diffusion rates two orders of magnitude lower than aqueous HCl. Decreased acid diffusion delays spending and allows live acid to penetrate the rock matrix more uniformly and to greater distances. Coreflood results show that the microemulsion can stimulate cores in fewer PV's and under conditions of low injection rates where aqueous HCl fails completely. The microemulsion could also conceivably increase acid penetration along any natural fractures and fissures that may be present, thus increasing acidizing efficiency in this type of treatment. The relationship between the acid diffusion rate and the ability of the fluid to matrix-stimulate limestone is investigated.

  12. Composition for nucleic acid sequencing


    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu


    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  13. Evolution of rosmarinic acid biosynthesis.


    Petersen, Maike; Abdullah, Yana; Benner, Johannes; Eberle, David; Gehlen, Katja; Hücherig, Stephanie; Janiak, Verena; Kim, Kyung Hee; Sander, Marion; Weitzel, Corinna; Wolters, Stefan


    Rosmarinic acid and chlorogenic acid are caffeic acid esters widely found in the plant kingdom and presumably accumulated as defense compounds. In a survey, more than 240 plant species have been screened for the presence of rosmarinic and chlorogenic acids. Several rosmarinic acid-containing species have been detected. The rosmarinic acid accumulation in species of the Marantaceae has not been known before. Rosmarinic acid is found in hornworts, in the fern family Blechnaceae and in species of several orders of mono- and dicotyledonous angiosperms. The biosyntheses of caffeoylshikimate, chlorogenic acid and rosmarinic acid use 4-coumaroyl-CoA from the general phenylpropanoid pathway as hydroxycinnamoyl donor. The hydroxycinnamoyl acceptor substrate comes from the shikimate pathway: shikimic acid, quinic acid and hydroxyphenyllactic acid derived from l-tyrosine. Similar steps are involved in the biosyntheses of rosmarinic, chlorogenic and caffeoylshikimic acids: the transfer of the 4-coumaroyl moiety to an acceptor molecule by a hydroxycinnamoyltransferase from the BAHD acyltransferase family and the meta-hydroxylation of the 4-coumaroyl moiety in the ester by a cytochrome P450 monooxygenase from the CYP98A family. The hydroxycinnamoyltransferases as well as the meta-hydroxylases show high sequence similarities and thus seem to be closely related. The hydroxycinnamoyltransferase and CYP98A14 from Coleus blumei (Lamiaceae) are nevertheless specific for substrates involved in RA biosynthesis showing an evolutionary diversification in phenolic ester metabolism. Our current view is that only a few enzymes had to be "invented" for rosmarinic acid biosynthesis probably on the basis of genes needed for the formation of chlorogenic and caffeoylshikimic acid while further biosynthetic steps might have been recruited from phenylpropanoid metabolism, tocopherol/plastoquinone biosynthesis and photorespiration. PMID:19560175

  14. The politics of acid rain

    SciTech Connect

    Wilcher, M.E. )


    This work examines and compares the acid rain policies through the different political systems of Canada, Great Britain and the United States. Because the flow of acid rain can transcend national boundaries, acid rain has become a crucial international problem. According to the author, because of differences in governmental institutions and structure, the extent of governmental intervention in the industrial economy, the degree of reliance on coal for power generation, and the extent of acid rain damage, national responses to the acid rain problem have varied.

  15. Invasive cleavage of nucleic acids


    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.


    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  16. Invasive cleavage of nucleic acids


    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.


    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  17. Tested Demonstrations: Color Oscillations in the Formic Acid-Nitric Acid-Sulfuric Acid System.

    ERIC Educational Resources Information Center

    Raw, C. J. G.; And Others


    Presented are procedures for demonstrating the production of color oscillations when nitric acid is added to a formic acid/concentrated sulfuric acid mixture. Because of safety considerations, "Super-8" home movie of the color changes was found to be satisfactory for demonstration purposes. (JN)

  18. Amino acids in Arctic aerosols

    NASA Astrophysics Data System (ADS)

    Scalabrin, E.; Zangrando, R.; Barbaro, E.; Kehrwald, N. M.; Gabrieli, J.; Barbante, C.; Gambaro, A.


    Amino acids are significant components of atmospheric aerosols, affecting organic nitrogen input to marine ecosystems, atmospheric radiation balance, and the global water cycle. The wide range of amino acid reactivities suggest that amino acids may serve as markers of atmospheric transport and deposition of particles. Despite this potential, few measurements have been conducted in remote areas to assess amino acid concentrations and potential sources. Polar regions offer a unique opportunity to investigate atmospheric processes and to conduct source apportionment studies of such compounds. In order to better understand the importance of amino acid compounds in the global atmosphere, we determined free amino acids (FAAs) in seventeen size-segregated aerosol samples collected in a polar station in the Svalbard Islands from 19 April until 14 September 2010. We used an HPLC coupled with a tandem mass spectrometer (ESI-MS/MS) to analyze 20 amino acids and quantify compounds at fmol m-3 levels. Mean total FAA concentration was 1070 fmol m-3 where serine and glycine were the most abundant compounds in almost all samples and accounted for 45-60% of the total amino acid relative abundance. The other eighteen compounds had average concentrations between 0.3 and 98 fmol m-3. The higher amino acid concentrations were present in the ultrafine aerosol fraction (< 0.49 μm) and accounted for the majority of the total amino acid content. Local marine sources dominate the boreal summer amino acid concentrations, with the exception of the regional input from Icelandic volcanic emissions.

  19. Amino acids in Arctic aerosols

    NASA Astrophysics Data System (ADS)

    Scalabrin, E.; Zangrando, R.; Barbaro, E.; Kehrwald, N. M.; Gabrieli, J.; Barbante, C.; Gambaro, A.


    Amino acids are significant components of atmospheric aerosols, affecting organic nitrogen input to marine ecosystems, atmospheric radiation balance, and the global water cycle. The wide range of amino acid reactivities suggest that amino acids may serve as markers of atmospheric transport and deposition of particles. Despite this potential, few measurements have been conducted in remote areas to assess amino acid concentrations and potential sources. Polar regions offer a unique opportunity to investigate atmospheric processes and to conduct source apportionment studies of such compounds. In order to better understand the importance of amino acid compounds in the global atmosphere, we determined free amino acids (FAAs) in seventeen size-segregated aerosol samples collected in a polar station in the Svalbard Islands from 19 April until 14 September 2010. We used an HPLC coupled with a tandem mass spectrometer (ESI-MS/MS) to analyze 20 amino acids to quantify compounds at fmol m-3 levels. Mean total FAA concentration was 1070 fmol m-3 where serine and glycine were the most abundant compounds in almost all samples and accounted for 45-60% of the total amino acid relative abundance. The other eighteen compounds had average concentrations between 0.3 and 98 fmol m-3. The higher amino acid concentrations were present in the ultrafine aerosol fraction (<0.49 μm) and accounted for the majority of the total amino acid content. Local marine sources dominate the boreal summer amino acid concentrations, with the exception of the regional input from Icelandic volcanics.

  20. Twinning of dodecanedicarboxylic acid

    NASA Technical Reports Server (NTRS)

    Sen, R.; Wilcox, W. R.


    Twinning of 1,10-dodecanedicarboxyl acid (DDA) was observed in 0.1 mm thick films with a polarizing microscope. Twins originated from polycrystalline regions which tended to nucleate on twin faces, and terminated by intersection gone another. Twinning increased dramatically with addition of organic compounds with a similar molecular size and shape. Increasing the freezing rate, increasing the temperature gradient, and addition of silica particles increased twinning. It is proposed that twins nucleate with polycrystals and sometimes anneal out before they become observable. The impurities may enhance twinning either by lowering the twin energy or by adsorbing on growing faces.

  1. Synthesis of amino acids


    Davis, J.W. Jr.


    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  2. Controlling acid rain

    SciTech Connect

    Cannon, J.S.


    This book examines recent transfer of electric power among 48 states and present evidence of significant transfers of electric power from so-called ''perpetrator'' to ''victim'' states. The book compares the efforts of several midwestern and northeastern states during the 1970's to control the sulfur dioxide (SO/sub 2/) emissions causing acid rain. The report includes utility and government data on electricity production and sales, on purchase of out-of-state electricity, and on coal use and sulfur dioxide emissions, state by state, for 48 states.

  3. Cryoprotection from lipoteichoic acid

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth


    Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as the high salt concentration of brine veins and adhesion to particulates or ice crystal defects. We have discovered an endogenous cryoprotectant in the cell wall of bacteria, lipoteichoic acid biopolymers. Adding 1% LTA to bacteria cultures immediately prior to freezing provides 50% survival rate, similar to the results obtained with 1% glycerol. In the absence of an additive, bacterial survival is negligible as measured with the resazurin cell viability assay. The mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. Our observations suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.

  4. Nucleic acid detection methods


    Smith, C.L.; Yaar, R.; Szafranski, P.; Cantor, C.R.


    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3{prime}-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated. 18 figs.

  5. Nucleic Acid Detection Methods


    Smith, Cassandra L.; Yaar, Ron; Szafranski, Przemyslaw; Cantor, Charles R.


    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3'-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated.

  6. Ribonucleic acid purification.


    Martins, R; Queiroz, J A; Sousa, F


    Research on RNA has led to many important biological discoveries and improvement of therapeutic technologies. From basic to applied research, many procedures employ pure and intact RNA molecules; however their isolation and purification are critical steps because of the easy degradability of RNA, which can impair chemical stability and biological functionality. The current techniques to isolate and purify RNA molecules still have several limitations and the requirement for new methods able to improve RNA quality to meet regulatory demands is growing. In fact, as basic research improves the understanding of biological roles of RNAs, the biopharmaceutical industry starts to focus on them as a biotherapeutic tools. Chromatographic bioseparation is a high selective unit operation and is the major option in the purification of biological compounds, requiring high purity degree. In addition, its application in biopharmaceutical manufacturing is well established. This paper discusses the importance and the progress of RNA isolation and purification, considering RNA applicability both in research and clinical fields. In particular and in view of the high specificity, affinity chromatography has been recently applied to RNA purification processes. Accordingly, recent chromatographic investigations based on biorecognition phenomena occurring between RNA and amino acids are focused. Histidine and arginine have been used as amino acid ligands, and their ability to isolate different RNA species demonstrated a multipurpose applicability in molecular biology analysis and RNA therapeutics preparation, highlighting the potential contribution of these methods to overcome the challenges of RNA purification. PMID:24951289

  7. Growth of nitric acid hydrates on thin sulfuric acid films

    NASA Technical Reports Server (NTRS)

    Iraci, Laura T.; Middlebrook, Ann M.; Wilson, Margaret A.; Tolbert, Margaret A.


    Type I polar stratospheric clouds (PSCs) are thought to nucleate and grow on stratospheric sulfate aerosols (SSAs). To model this system, thin sulfuric acid films were exposed to water and nitric acid vapors (1-3 x 10(exp -4) Torr H2O and 1-2.5 x 10(exp -6) Torr HNO3) and subjected to cooling and heating cycles. Fourier Transform Infrared (FTIR) spectroscopy was used to probe the phase of the sulfuric acid and to identify the HNO3/H2O films that condensed. Nitric acid trihydrate (NAT) was observed to grow on crystalline sulfuric acid tetrahydrate (SAT) films. NAT also condensed in/on supercooled H2SO4 films without causing crystallization of the sulfuric acid. This growth is consistent with NAT nucleation from ternary solutions as the first step in PSC formation.

  8. Growth of nitric acid hydrates on thin sulfuric acid films

    NASA Astrophysics Data System (ADS)

    Iraci, Laura T.; Middlebrook, Ann M.; Wilson, Margaret A.; Tolbert, Margaret A.


    Type I polar stratospheric clouds (PSCs) are thought to nucleate and grow on stratospheric sulfate aerosols (SSAs). To model this system, thin sulfuric acid films were exposed to water and nitric acid vapors (1 - 3 × 10-4 Torr H2O and 1 - 2.5 × 10-6 Torr HNO3) and subjected to cooling and heating cycles. FTIR spectroscopy was used to probe the phase of the sulfuric acid and to identify the HNO3/H2O films that condensed. Nitric acid trihydrate (NAT) was observed to grow on crystalline sulfuric acid tetrahydrate (SAT) films. NAT also condensed in/on supercooled H2SO4 films without causing crystallization of the sulfuric acid. This growth is consistent with NAT nucleation from ternary solutions as the first step in PSC formation.

  9. Interaction of silicic acid with sulfurous acid scale inhibitor

    SciTech Connect

    Gallup, D.L.


    The solubility of amorphous silica and the inhibition of silica polymerization in the presence of sulfurous acid and sulfite salts has been investigated to 260{degrees}C. Investigations of inhibition of silica scaling from geothermal brines by sulfurous acid have produced unusual results. Bisulfite/sulfite increases amorphous silica solubility by {open_quotes}salting in{close_quotes} effects resulting from apparent complexation. Silica-sulfite complexes are postulated to form via hydrogen bonding, and appear to be much stronger than silica-sulfate complexes. Treatment of brines with sulfurous acid inhibits silica scaling by (1) retarding the kinetics of silicic acid polymerization, and (2) forming soluble sulfito-silicate complexes. Sulfurous acid offers several advantages over sulfuric acid in controlling scale deposition-reduced corrosion potential, reduced by-product scale formation potential, oxygen scavenging and inhibition of certain metal silicate scales.

  10. Determination of benzoic acid, chlorobenzoic acids and chlorendic acid in water

    SciTech Connect

    Dietz, E.A.; Cortellucci, N.J.; Singley, K.F. )


    To characterize and conduct treatment studies of a landfill leachate an analysis procedure was required to determine concentrations of benzoic acid, the three isomers of chlorobenzoic acid and chlorendic acid. The title compounds were isolated from acidified (pH 1) water by extraction with methyl t-butyl ether. Analytes were concentrated by back-extracting the ether with 0.1 N sodium hydroxide which was separated and acidified. This solution was analyzed by C[sub 18] reversed-phase HPLC with water/acetonitrile/acetic acid eluent and UV detection at 222 nm. The method has detection limits of 200 [mu]g/L for chlorendic acid and 100 [mu]g/L for benzoic acid and each isomer of chlorobenzoic acid. Validation studies with water which was fortified with the analytes at concentrations ranging from one to ten times detection limits resulted in average recoveries of >95%.

  11. Acid rain: Rhetoric and reality

    SciTech Connect

    Park, C.C.


    Acid rain is now one of the most serious environmental problems in developed countries. Emissions and fallout were previously extremely localized, but since the introduction of tall stacks policies in both Britain and the US - pardoxically to disperse particulate pollutants and hence reduce local damage - emissions are now lifted into the upper air currents and carried long distances downwind. The acid rain debate now embraces many western countries - including Canada, the US, England, Scotland, Wales, Sweden, Norway, Denmark, West Germany, the Netherlands, Austria, Switzerland - and a growing number of eastern countries - including the Soviet Union, Poland, East Germany, and Czechoslovakia. The problem of acid rain arises, strictly speaking, not so much from the rainfall itself as from its effects on the environment. Runoff affects surface water and groundwater, as well as soils and vegetation. Consequently changes in rainfall acidity can trigger off a range of impacts on the chemistry and ecology of lakes and rivers, soil chemistry and processes, the health and productivity of plants, and building materials, and metallic structures. The most suitable solutions to the problems of acid rain require prevention rather than cure, and there is broad agreement in both the political scientific communities on the need to reduce emissions of sulfur and nitrogen oxides to the atmosphere. Book divisions discuss: the problem of acid rain, the science of acid rain, the technology of acid rain, and the politics of acid rain, in an effort to evaluate this growing global problem of acid rain.

  12. Increased formation of ursodeoxycholic acid in patients treated with chenodeoxycholic acid.

    PubMed Central

    Salen, G; Tint, G S; Eliav, B; Deering, N; Mosbach, E H


    The formation of ursodeoxycholic acid, the 7 beta-hydroxy epimer of chenodeoxycholic acid, was investigated in three subjects with cerebrotendinous xanthomatosis and in four subjects with gallstones. Total biliary bile acid composition was analyzed by gas-liquid chromatography before and after 4 months of treatment with 0.75 g/day of chenodeoxycholic acid. Individual bile acids were identified by mass spectrometry. Before treatment, bile from cerebrotendinous xanthomatosis (CTX) subjects contained cholic acid, 85%; chenodeoxycholic acid, 7%; deoxycholic acid, 3%; allocholic acid, 3%; and unidentified steroids, 2%; while bile from gallstone subjects contained cholic acid, 45%; chenodeoxycholic acid, 43%; deoxycholic acid, 11%, and lithocholic acid, 1%. In all subjects, 4 months of chenodeoxycholic acid therapy increased the proportion of this bile acid to approximately 80% and decreased cholic acid to 3% of the total biliary bile acids, the remaining 17% of bile acids were identified as ursodeoxycholic acid. After the intravenous injection of [3H]chenodeoxycholic acid, the specific activity of biliary ursodeoxycholic acid exceeded the specific activity of chenodeoxycholic acid, and the resulting specific activity decay curves suggested precursor-product relationships. When [3H]7-ketolithocholic acid was administrated to another patient treated with chenodeoxycholic acid, radioactivity was detected in both the ursodeoxycholic acid and chenodeoxycholic acid fractions. These results indicate that substantial amounts of ursodeoxycholic acid are formed in patients treated with chenodeoxycholic acid. The ursodeoxycholic acid was synthesized from chenodeoxycholic acid presumably via 7-ketolithocholic acid. Images PMID:11344576

  13. Interactions of amino acids, carboxylic acids, and mineral acids with different quinoline derivatives

    NASA Astrophysics Data System (ADS)

    Kalita, Dipjyoti; Deka, Himangshu; Samanta, Shyam Sundar; Guchait, Subrata; Baruah, Jubaraj B.


    A series of quinoline containing receptors having amide and ester bonds are synthesized and characterised. The relative binding abilities of these receptors with various amino acids, carboxylic acids and mineral acids are determined by monitoring the changes in fluorescence intensity. Among the receptors bis(2-(quinolin-8-yloxy)ethyl) isophthalate shows fluorescence enhancement on addition of amino acids whereas the other receptors shows fluorescence quenching on addition of amino acids. The receptor N-(quinolin-8-yl)-2-(quinolin-8-yloxy) propanamide has higher binding affinity for amino acids. However, the receptor N-(quinolin-8-yl)-2-(quinolin-8-yloxy)acetamide having similar structure do not bind to amino acids. This is attributed to the concave structure of the former which is favoured due to the presence of methyl substituent. The receptor bis(2-(quinolin-8-yloxy)ethyl) isophthalate do not bind to hydroxy carboxylic acids, but is a good receptor for dicarboxylic acids. The crystal structure of bromide and perchlorate salts of receptor 2-bromo-N-(quinolin-8-yl)-propanamide are determined. In both the cases the amide groups are not in the plane of quinoline ring. The structure of N-(quinolin-8-yl)-2-(quinolin-8-yloxy)acetamide, N-(2-methoxyphenethyl)-2-(quinolin-8-yloxy)acetamide and their salts with maleic acid as well as fumaric acid are determined. It is observed that the solid state structures are governed by the double bond geometry of these two acid. Maleic acid forms salt in both the cases, whereas fumaric acid forms either salt or co-crystals.

  14. Acidity of Strong Acids in Water and Dimethyl Sulfoxide.


    Trummal, Aleksander; Lipping, Lauri; Kaljurand, Ivari; Koppel, Ilmar A; Leito, Ivo


    Careful analysis and comparison of the available acidity data of HCl, HBr, HI, HClO4, and CF3SO3H in water, dimethyl sulfoxide (DMSO), and gas-phase has been carried out. The data include experimental and computational pKa and gas-phase acidity data from the literature, as well as high-level computations using different approaches (including the W1 theory) carried out in this work. As a result of the analysis, for every acid in every medium, a recommended acidity value is presented. In some cases, the currently accepted pKa values were revised by more than 10 orders of magnitude. PMID:27115918

  15. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2014 CFR


    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by rail... 49 Transportation 2 2014-10-01 2014-10-01 false Nitric acid. 173.158 Section...

  16. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2011 CFR


    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by rail... 49 Transportation 2 2011-10-01 2011-10-01 false Nitric acid. 173.158 Section...

  17. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2010 CFR


    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by rail... 49 Transportation 2 2010-10-01 2010-10-01 false Nitric acid. 173.158 Section...

  18. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2013 CFR


    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by rail... 49 Transportation 2 2013-10-01 2013-10-01 false Nitric acid. 173.158 Section...

  19. Shaping up nucleic acid computation

    PubMed Central

    Chen, Xi


    Summary of recent advances (abstract) Nucleic acid-based nanotechnology has always been perceived as novel, but has begun to move from theoretical demonstrations to practical applications. In particular, the large address spaces available to nucleic acids can be exploited to encode algorithms and/or act as circuits, and thereby process molecular information. In this review we revisit several milestones in the field of nucleic acid-based computation, but also highlight how the prospects for nucleic acid computation go beyond just a large address space. Functional nucleic acid elements (aptamers, ribozymes, and deoxyribozymes) can serve as inputs and outputs to the environment, and can act as logical elements. Into the future, the chemical dynamics of nucleic acids may prove as useful as hybridization for computation. PMID:20538451

  20. Clinical use of acid steatocrit.


    Van den Neucker, A; Pestel, N; Tran, T M; Forget, P P; Veeze, H J; Bouquet, J; Sinaasappel, M


    Malabsorption of fat is an important gastrointestinal cause of malnutrition and growth retardation in childhood. The gold standard for the evaluation of fat malabsorption is the faecal fat balance method. The acid steatocrit method has recently been introduced as a simple method to evaluate faecal fat. The present study was aimed at evaluating the acid steatocrit in clinical practice. Faecal fat excretion and acid steatocrit results were determined in 42 children, half with and half without fat malabsorption. Acid steatocrit results correlated significantly with both faecal fat excretion (p < 0.01) and faecal fat concentration (p < 0.001). Sensitivity and specificity of the acid steatocrit for the diagnosis of malabsorption were 90% and 100%, respectively. We consider the acid steatocrit method useful for the screening and monitoring of patients with steatorrhoea. PMID:9183483

  1. Acid rain degradation of nylon

    SciTech Connect

    Kyllo, K.E.


    Acid rain, precipitation with a pH less than 5.6, is known to damage lakes, vegetation and buildings. Degradation of outdoor textiles by acid rain is strongly suspected but not well documented. This study reports the effects of sunlight, aqueous acid, heat and humidity (acid rain conditions) on spun delustered nylon 6,6 fabric. Untreated nylon and nylon treated with sulfuric acid of pH 2.0, 3.0, and 4.4 were exposed to light in an Atlas Xenon-arc fadeometer at 63/sup 0/C and 65% R.H. for up to 640 AATCC Fading Units. The untreated and acid treated nylon fabrics were also exposed to similar temperature and humidity condition without light. Nylon degradation was determined by changes in breaking strength, elongation, molecular weight, color, amino end group concentration (NH/sub 2/) and /sup 13/C NMR spectra. Physical damage was assessed using SEM.

  2. A Simpler Nucleic Acid

    NASA Technical Reports Server (NTRS)

    Orgel, Leslie


    It has been supposed that for a nucleic acid analog to pair with RNA it must, like RNA, have a backbone with at least a sixatom repeat; a shorter backbone presumably would not stretch far enough to bind RNA properly. The Eschenmoser group has shown, however, that this first impression is incorrect.As they report in their new paper, Eschenmoser and co-workers ( I ) have now synthesized a substantial number of these polymers, which are called (L)-a-threofuranosyl oligonucleotides or TNAs. They are composed of bases linked to a threose sugar-phosphate backbone, with phosphodiester bonds connecting the nucleotides. The investigators discovered that pairs of complementary TNAs do indeed form stable Watson-Crick double helices and, perhaps more importantly, that TNAs form stable double helices with complementary RNAs and DNAs.

  3. Ghrelin and gastric acid secretion

    PubMed Central

    Yakabi, Koji; Kawashima, Junichi; Kato, Shingo


    Ghrelin, a novel growth hormone-releasing peptide, was originally isolated from rat and human stomach. Ghrelin has been known to increase the secretion of growth hormone (GH), food intake, and body weight gain when administered peripherally or centrally. Ghrelin is also known to stimulate the gastric motility and the secretion of gastric acid. In the previous studies, the action of ghrelin on acid secretion was shown to be as strong as that of histamine and gastrin in in-vivo experiment. In the studies, the mechanism for the action of ghrelin was also investigated. It was shown that vagotomy completely inhibited the action of ghrelin on the secretion of gastric acid suggesting that vagal nerve is involved in the mechanism for the action of ghrelin on acid secretion. As famotidine did not inhibit ghrelin-induced acid secretion in the study by Masuda et al, they concluded that histamine was not involved in the action of ghrelin on acid secretion. However, we have shown that famotidine completely inhibited ghrelin-induced acid secretion and histidine decarboxylase (HDC) mRNA was increased in gastric mucosa by ghrelin injection which is inhibited by vagotomy Our results indicate that histamine is involved in the action of ghrelin on acid secretion. Furthermore synergistic action of gastrin and ghrelin on gastric acid secretion was shown. Although gastrin has important roles in postprandial secretion of gastric acid, ghrelin may be related to acid secretion during fasting period or at night. However, further studies are needed to elucidate the physiological role of ghrelin in acid secretion. PMID:19009648

  4. Organic Acids by Ion Chromatography

    NASA Astrophysics Data System (ADS)

    Rich, William E.; Johnson, Edward; Lois, Louis; Stafford, Brian E.; Kabra, Pokar M.; Marton, Laurence J.

    The presence of increased levels of various organic acids in physiological fluids such as serum, plasma, and urine has been correlated with a variety of diseases (1). Although some are rare, others such as lactic acidosis and hyperoxaluria are more widespread (2, 3). The estimation of organic acids in biological fluids has long been an analytical problem owing to the nature of the samples and the hydrophilic behavior of the various acids.

  5. All-trans retinoic acid regulates hepatic bile acid homeostasis

    PubMed Central

    Yang, Fan; He, Yuqi; Liu, Hui-Xin; Tsuei, Jessica; Jiang, Xiaoyue; Yang, Li; Wang, Zheng-Tao; Wan, Yu-Jui Yvonne


    Retinoic acid (RA) and bile acids share common roles in regulating lipid homeostasis and insulin sensitivity. In addition, the receptor for RA (retinoid x receptor) is a permissive partner of the receptor for bile acids, farnesoid x receptor (FXR/NR1H4). Thus, RA can activate the FXR-mediated pathway as well. The current study was designed to understand the effect of all-trans RA on bile acid homeostasis. Mice were fed an all-trans RA-supplemented diet and the expression of 46 genes that participate in regulating bile acid homeostasis was studied. The data showed that all-trans RA has a profound effect in regulating genes involved in synthesis and transport of bile acids. All-trans RA treatment reduced the gene expression levels of Cyp7a1, Cyp8b1, and Akr1d1, which are involved in bile acid synthesis. All-trans RA also decreased the hepatic mRNA levels of Lrh-1 (Nr5a2) and Hnf4α (Nr2a1), which positively regulate the gene expression of Cyp7a1 and Cyp8b1. Moreover, all-trans RA induced the gene expression levels of negative regulators of bile acid synthesis including hepatic Fgfr4, Fxr, and Shp (Nr0b2) as well as ileal Fgf15. All-trans RA also decreased the expression of Abcb11 and Slc51b, which have a role in bile acid transport. Consistently, all-trans RA reduced hepatic bile acid levels and the ratio of CA/CDCA, as demonstrated by liquid chromatography-mass spectrometry. The data suggest that all-trans RA-induced SHP may contribute to the inhibition of CYP7A1 and CYP8B1, which in turn reduces bile acid synthesis and affects lipid absorption in the gastrointestinal tract. PMID:25175738

  6. Preparation and characterization Al3+-bentonite Turen Malang for esterification fatty acid (palmitic acid, oleic acid and linoleic acid)

    NASA Astrophysics Data System (ADS)

    Abdulloh, Abdulloh; Aminah, Nanik Siti; Triyono, Mudasir, Trisunaryanti, Wega


    Catalyst preparation and characterization of Al3+-bentonite for esterification of palmitic acid, oleic acid and linoleic acid has been done. Al3+-bentonite catalyst was prepared from natural bentonite of Turen Malang through cation exchange reaction using AlCl3 solution. The catalysts obtained were characterized by XRD, XRF, pyridine-FTIR and surface area analyser using the BET method. Catalyst activity test of Al3+-bentonite for esterification reaction was done at 65°C using molar ratio of metanol-fatty acid of 30:1 and 0.25 g of Al3+-bentonite catalyst for the period of ½, 1, 2, 3, 4 and 5 hours. Based on the characterization results, the Al3+-bentonite Turen Malang catalyst has a d-spacing of 15.63 Ǻ, acid sites of Brönsted and Lewis respectively of 230.79 µmol/g and 99.39 µmol/g, surface area of 507.3 m2/g and the average of radius pore of 20.09 Å. GC-MS analysis results of the oil phase after esterification reaction showed the formation of biodiesel (FAME: Fatty acid methyl ester), namely methyl palmitate, methyl oleate and methyl linoleate. The number of conversions resulted in esterification reaction using Al3+-bentonite Turen Malang catalyst was 74.61%, 37.75%, and 20, 93% for the esterification of palmitic acid, oleic acid and linoleic acid respectively.

  7. Acidity of frozen electrolyte solutions.


    Robinson, Carmen; Boxe, C S; Guzman, M I; Colussi, A J; Hoffmann, M R


    Ice is selectively intolerant to impurities. A preponderance of implanted anions or cations generates electrical imbalances in ice grown from electrolyte solutions. Since the excess charges are ultimately neutralized via interfacial (H(+)/HO(-)) transport, the acidity of the unfrozen portion can change significantly and permanently. This insufficiently recognized phenomenon should critically affect rates and equilibria in frozen media. Here we report the effective (19)F NMR chemical shift of 3-fluorobenzoic acid as in situ probe of the acidity of extensively frozen electrolyte solutions. The sign and magnitude of the acidity changes associated with freezing are largely determined by specific ion combinations, but depend also on solute concentration and/or the extent of supercooling. NaCl solutions become more basic, those of (NH(4))(2)SO(4) or Na(2)SO(4) become more acidic, while solutions of the 2-(N-morpholino)ethanesulfonic acid zwitterion barely change their acidity upon freezing. We discuss how acidity scales based on solid-state NMR measurements could be used to assess the degree of ionization of weak acids and bases in frozen media. PMID:16610849

  8. Acidic gas capture by diamines


    Rochelle, Gary; Hilliard, Marcus


    Compositions and methods related to the removal of acidic gas. In particular, the present disclosure relates to a composition and method for the removal of acidic gas from a gas mixture using a solvent comprising a diamine (e.g., piperazine) and carbon dioxide. One example of a method may involve a method for removing acidic gas comprising contacting a gas mixture having an acidic gas with a solvent, wherein the solvent comprises piperazine in an amount of from about 4 to about 20 moles/kg of water, and carbon dioxide in an amount of from about 0.3 to about 0.9 moles per mole of piperazine.

  9. MedlinePlus: Folic Acid


    ... and Tests Homocysteine Test (American Association for Clinical Chemistry) Vitamin B12 and Folate Test (American Association for Clinical Chemistry) Related Issues Folic Acid Supplements: Can They Slow ...

  10. Bacterial Decarboxylation of o-Phthalic Acids

    PubMed Central

    Taylor, Barrie F.; Ribbons, Douglas W.


    The decarboxylation of phthalic acids was studied with Bacillus sp. strain FO, a marine mixed culture ON-7, and Pseudomonas testosteroni. The mixed culture ON-7, when grown anaerobically on phthalate but incubated aerobically with chloramphenicol, quantitatively converted phthalic acid to benzoic acid. Substituted phthalic acids were also decarboxylated: 4,5-dihydroxyphthalic acid to protocatechuic acid; 4-hydroxyphthalic and 4-chlorophthalic acids to 3-hydroxybenzoic and 3-chlorobenzoic acids, respectively; and 3-fluorophthalic acid to 2-and 3-fluorobenzoic acids. Bacillus sp. strain FO gave similar results except that 4,5-dihydroxyphthalic acid was not metabolized, and both 3- and 4-hydroxybenzoic acids were produced from 4-hydroxyphthalic acid. P. testosteroni decarboxylated 4-hydroxyphthalate (to 3-hydroxybenzoate) and 4,5-dihydroxyphthalate but not phthalic acid and halogenated phthalates. Thus, P. testosteroni and the mixed culture ON-7 possessed 4,5-dihydroxyphthalic acid decarboxylase, previously described in P. testosteroni, that metabolized 4,5-dihydroxyphthalic acid and specifically decarboxylated 4-hydroxyphthalic acid to 3-hydroxybenzoic acid. The mixed culture ON-7 and Bacillus sp. strain FO also possessed a novel decarboxylase that metabolized phthalic acid and halogenated phthalates, but not 4,5-dihydroxyphthalate, and randomly decarboxylated 4-hydroxyphthalic acid. The decarboxylation of phthalic acid is suggested to involve an initial reduction to 1,2-dihydrophthalic acid followed by oxidative decarboxylation to benzoic acid. PMID:16346440

  11. Fatty acid-amino acid conjugates diversification in Lepidopteran caterpillars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fatty acid amino acid conjugates (FACs) have been found in Noctuid as well as Sphingid caterpillar oral secretions and especially volicitin [N-(17-hydroxylinolenoyl)-L-Glutamine] and its biochemical precursor, N-linolenoyl-L-glutamine, are known elicitors of induced volatile emissions in corn plants...

  12. Fatty Acid Desaturases, Polyunsaturated Fatty Acid Regulation, and Biotechnological Advances.


    Lee, Je Min; Lee, Hyungjae; Kang, SeokBeom; Park, Woo Jung


    Polyunsaturated fatty acids (PUFAs) are considered to be critical nutrients to regulate human health and development, and numerous fatty acid desaturases play key roles in synthesizing PUFAs. Given the lack of delta-12 and -15 desaturases and the low levels of conversion to PUFAs, humans must consume some omega-3 and omega-6 fatty acids in their diet. Many studies on fatty acid desaturases as well as PUFAs have shown that fatty acid desaturase genes are closely related to different human physiological conditions. Since the first front-end desaturases from cyanobacteria were cloned, numerous desaturase genes have been identified and animals and plants have been genetically engineered to produce PUFAs such as eicosapentaenoic acid and docosahexaenoic acid. Recently, a biotechnological approach has been used to develop clinical treatments for human physiological conditions, including cancers and neurogenetic disorders. Thus, understanding the functions and regulation of PUFAs associated with human health and development by using biotechnology may facilitate the engineering of more advanced PUFA production and provide new insights into the complexity of fatty acid metabolism. PMID:26742061

  13. Fatty Acid Desaturases, Polyunsaturated Fatty Acid Regulation, and Biotechnological Advances

    PubMed Central

    Lee, Je Min; Lee, Hyungjae; Kang, SeokBeom; Park, Woo Jung


    Polyunsaturated fatty acids (PUFAs) are considered to be critical nutrients to regulate human health and development, and numerous fatty acid desaturases play key roles in synthesizing PUFAs. Given the lack of delta-12 and -15 desaturases and the low levels of conversion to PUFAs, humans must consume some omega-3 and omega-6 fatty acids in their diet. Many studies on fatty acid desaturases as well as PUFAs have shown that fatty acid desaturase genes are closely related to different human physiological conditions. Since the first front-end desaturases from cyanobacteria were cloned, numerous desaturase genes have been identified and animals and plants have been genetically engineered to produce PUFAs such as eicosapentaenoic acid and docosahexaenoic acid. Recently, a biotechnological approach has been used to develop clinical treatments for human physiological conditions, including cancers and neurogenetic disorders. Thus, understanding the functions and regulation of PUFAs associated with human health and development by using biotechnology may facilitate the engineering of more advanced PUFA production and provide new insights into the complexity of fatty acid metabolism. PMID:26742061

  14. A comparison of chromic acid and sulfuric acid anodizing

    NASA Technical Reports Server (NTRS)

    Danford, M. D.


    Because of federal and state mandates restricting the use of hexavalent chromium, it was deemed worthwhile to compare the corrosion protection afforded 2219-T87 aluminum alloy by both Type I chromic acid and Type II sulfuric acid anodizing per MIL-A-8625. Corrosion measurements were made on large, flat 2219-T87 aluminum alloy sheet material with an area of 1 cm(exp 2) exposed to a corrosive medium of 3.5-percent sodium chloride at pH 5.5. Both ac electrochemical impedance spectroscopy and the dc polarization resistance techniques were employed. The results clearly indicate that the corrosion protection obtained by Type II sulfuric acid anodizing is superior, and no problems should result by substituting Type II sulfuric acid anodizing for Type I chromic acid anodizing.

  15. Effect of propionic acid on fatty acid oxidation and ureagenesis.


    Glasgow, A M; Chase, H P


    Propionic acid significantly inhibited 14CO2 production from [1-14C] palmitate at a concentration of 10 muM in control fibroblasts and 100 muM in methylmalonic fibroblasts. This inhibition was similar to that produced by 4-pentenoic acid. Methylmalonic acid also inhibited 14CO2 production from [1-14C] palmitate, but only at a concentration of 1 mM in control cells and 5 mM in methylmalonic cells. Propionic acid (5 mM) also inhibited ureagenesis in rat liver slices when ammonia was the substrate but not with aspartate and citrulline as substrates. Propionic acid had no direct effect on either carbamyl phosphate synthetase or ornithine transcarbamylase. These findings may explain the fatty degeneration of the liver and the hyperammonemia in propionic and methylmalonic acidemia. PMID:934734

  16. Microbial desulfonation of substituted naphthalenesulfonic acids and benzenesulfonic acids.

    PubMed Central

    Zürrer, D; Cook, A M; Leisinger, T


    Sulfur-limited batch enrichment cultures containing one of nine multisubstituted naphthalenesulfonates and an inoculum from sewage yielded several taxa of bacteria which could quantitatively utilize 19 sulfonated aromatic compounds as the sole sulfur source for growth. Growth yields were about 4 kg of protein per mol of sulfur. Specific degradation rates were about 4 to 14 mu kat/kg of protein. A Pseudomonas sp., an Arthrobacter sp., and an unidentified bacterium were examined. Each desulfonated at least 16 aromatic compounds, none of which served as a carbon source. Pseudomonas sp. strain S-313 converted 1-naphthalenesulfonic acid, 2-naphthalenesulfonic acid, 5-amino-1-naphthalenesulfonic acid, benzenesulfonic acid, and 3-aminobenzenesulfonic acid to 1-naphthol, 2-naphthol, 5-amino-1-naphthol, phenol, and 3-aminophenol, respectively. Experiments with 18O2 showed that the hydroxyl group was derived from molecular oxygen. PMID:3662502

  17. Carbonic Acid Retreatment of Biomass

    SciTech Connect

    Baylor university


    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. (1) Solidify the theoretical understanding of the binary CO{sub 2}/H{sub 2}O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. (2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. (3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. (4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. (5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for

  18. Carbonic Acid Pretreatment of Biomass

    SciTech Connect

    G. Peter van Walsum; Kemantha Jayawardhana; Damon Yourchisin; Robert McWilliams; Vanessa Castleberry


    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. 1) Solidify the theoretical understanding of the binary CO2/H2O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. 2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. 3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. 4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. 5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for the use of carbonic

  19. Anacardic Acid, Salicylic Acid, and Oleic Acid Differentially Alter Cellular Bioenergetic Function in Breast Cancer Cells.


    Radde, Brandie N; Alizadeh-Rad, Negin; Price, Stephanie M; Schultz, David J; Klinge, Carolyn M


    Anacardic acid is a dietary and medicinal phytochemical that inhibits breast cancer cell proliferation and uncouples oxidative phosphorylation (OXPHOS) in isolated rat liver mitochondria. Since mitochondrial-targeted anticancer therapy (mitocans) may be useful in breast cancer, we examined the effect of anacardic acid on cellular bioenergetics and OXPHOS pathway proteins in breast cancer cells modeling progression to endocrine-independence: MCF-7 estrogen receptor α (ERα)+ endocrine-sensitive; LCC9 and LY2 ERα+, endocrine-resistant, and MDA-MB-231 triple negative breast cancer (TNBC) cells. At concentrations similar to cell proliferation IC50 s, anacardic acid reduced ATP-linked oxygen consumption rate (OCR), mitochondrial reserve capacity, and coupling efficiency while increasing proton leak, reflecting mitochondrial toxicity which was greater in MCF-7 compared to endocrine-resistant and TNBC cells. These results suggest tolerance in endocrine-resistant and TNBC cells to mitochondrial stress induced by anacardic acid. Since anacardic acid is an alkylated 2-hydroxybenzoic acid, the effects of salicylic acid (SA, 2-hydroxybenzoic acid moiety) and oleic acid (OA, monounsaturated alkyl moiety) were tested. SA inhibited whereas OA stimulated cell viability. In contrast to stimulation of basal OCR by anacardic acid (uncoupling effect), neither SA nor OA altered basal OCR- except OA inhibited basal and ATP-linked OCR, and increased ECAR, in MDA-MB-231 cells. Changes in OXPHOS proteins correlated with changes in OCR. Overall, neither the 2-hydroxybenzoic acid moiety nor the monounsaturated alky moiety of anacardic acid is solely responsible for the observed mitochondria-targeted anticancer activity in breast cancer cells and hence both moieties are required in the same molecule for the observed effects. J. Cell. Biochem. 117: 2521-2532, 2016. © 2016 Wiley Periodicals, Inc. PMID:26990649

  20. Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

    PubMed Central

    Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo


    A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

  1. Acid rain: effects on fish and wildlife

    SciTech Connect

    Mayer, K.S.; Multer, E.P.; Schreiber, R.K.


    The following questions concerning acid rain are discussed: what is acid rain; what causes acid rain; where do sulfur and nitrogen oxides originate; what areas in the U.S. are susceptible to acid rain; are there early warning signals of acidification to aquatic resources; how does acid rain affect fishery resources; does acid rain affect wildlife; and how can effects of acid rain be reduced.

  2. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  3. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...


    EPA Science Inventory

    Acidic precipitation can be characterized as wet or frozen atmospheric deposition with a hydrogen ion concentration greater than 2.5 microequivalents liter-1. Acidic precipitation is perceived as a significant air pollution problem derived chiefly from combustion of fossil fuels,...


    EPA Science Inventory

    This chapter discusses the major chemical processes by which acidic deposition interacts with soils. he focus is on forest soils, as the effects of acidic deposition on soils used for production of food and fiber are generally small compared to effects of agricultural practices s...

  6. Acid Rain: The Scientific Challenge.

    ERIC Educational Resources Information Center

    Godfrey, Paul J.


    Documents the workings and findings of the Massachusetts Acid Rain Monitoring Project, which has pooled the volunteer efforts of more than 1,000 amateur and professional scientists since 1983. Reports on the origins of air pollution, the prediction of acid rain, and its effects on both water life and land resources. (JJK)

  7. Acid Rain: An Educational Opportunity?

    ERIC Educational Resources Information Center

    Marion, James I.


    Deals with how educators can handle the subject of acid rain; illustrates suggestions with experiences of grade nine students visiting Frost Valley Environmental Education Center (Oliverea, New York) to learn scientific concepts through observation of outdoor phenomena, including a stream; and discusses acid rain, pH levels, and pollution control…

  8. Acid Rain: What's the Forecast?

    ERIC Educational Resources Information Center

    Bybee, Rodger


    Discusses various types of acid rain, considered to be a century-old problem. Topics include: wet and dry deposition, effects on a variety of environments, ecosystems subject to detrimental effects, and possible solutions to the problem. A list of recommended resources on acid rain is provided. (BC)

  9. Acid rain & electric utilities II

    SciTech Connect


    This document presents reports which were presented at the Acid Rain and Electric Utilities Conference. Topics include environmental issues and electric utilities; acid rain program overview; global climate change and carbon dioxide; emissions data management; compliance; emissions control; allowance and trading; nitrogen oxides; and assessment. Individual reports have been processed separately for the United States Department of Energy databases.

  10. Acid Precipitation: Causes and Consequences.

    ERIC Educational Resources Information Center

    Babich, Harvey; And Others


    This article is the first of three articles in a series on the acid rain problem in recent years. Discussed are the causes of acid precipitation and its consequences for the abiotic and biotic components of the terrestrial and aquatic ecosystems, and for man-made materials. (Author/SA)


    Technology Transfer Automated Retrieval System (TEKTRAN)

    The role of trans acids in human health and nutrition is highly controversial and a search of the Internet reveals the interest in the subject. Trans acids are perceived as "killer fats" at one end of the spectrum to having no adverse effects at the other. In addition, saturated fats are perceived...

  12. Acid precipitation in historical perspective

    SciTech Connect

    Cowling, E.B.


    The history of acid precipitation is traced from the first awareness of the problem in the mid-17th century to the present. An outline of the National Acid Precipitation Assessment program is also given, and the author makes recommendations for future research. (JMT)


    EPA Science Inventory

    In 1981, simulated H2SO4 acid rain was applied to alfalfa and tall fescue and a 2:1 ratio of H2SO4:HNO3 acid rain was applied to alfalfa, tall fescue, barley, wheat, potato, tomato, radish, and corn crops growing in the open field at Corvallis, Oregon. Careful attention was given...

  14. Acid rain: a background report

    SciTech Connect

    Glustrom, L.; Stolzenberg, J.


    This Staff Brief was prepared for the Wisconsin Legislative Council's Special Committee on Acid Rain to provide an introduction to the issue of acid rain. It is divided into four parts. Part I provides an overview on the controversies surrounding the measurement, formation and effects of acid rain. As described in Part I, the term acid rain is used to describe the deposition of acidic components through both wet deposition (e.g., rain or snow) and dry deposition (e.g., direct contact between atmospheric constituents and the land, water or vegetation of the earth). Part II presents background information on state agency activities relating to acid rain in Wisconsin, describes what is known about the occurrence of, susceptibility to and effects of acid rain in Wisconsin, and provides information related to man-made sources of sulfur and nitrogen oxides in Wisconsin. Part III describes major policies and regulations relating to acid rain which have been or are being developed jointly by the United States and Canadian governments, by the United States government and by the State of Wisconsin. Part IV briefly discusses possible areas for Committee action.

  15. Getting Back to Basics (& Acidics)

    ERIC Educational Resources Information Center

    Rhodes, Sam


    This article describes a few novel acid-base experiments intended to introduce students to the basic concepts of acid-base chemistry and provide practical examples that apply directly to the study of biology and the human body. Important concepts such as the reaction between carbon dioxide and water, buffers and protein denaturation, are covered.…


    EPA Science Inventory

    The location, topography and other characteristics of the high-elevation forests of eastern North America cause them to be receptors of high levels of acid deposition and airborn trace metals. No other major forested areas in the U.S. are subjected to such intensely acid cloud mo...

  17. Acid Tests and Basic Fun.

    ERIC Educational Resources Information Center

    McBride, John W.


    Explores acids and bases using different indicators, such as turmeric, purple grape juice, and lichens. Because some of these indicators are not as sensitive as cabbage juice or litmus paper, determining to which acids and bases each indicator is sensitive presents an enjoyable, problem-solving challenge for students. Presents directions for…

  18. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.


    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  19. Lead-acid battery

    SciTech Connect

    Rowlette, J.J.


    A light weight lead-acid battery is disclosed having a positive terminal and a negative terminal and including one or more cells or grid stacks having a plurality of vertically stacked conductive monoplates with positive active material and negative active material deposited on alternating plates in the cell or grid stack. Electrolyte layers positioned between each monoplate are included to provide a battery cell having four sides which is capable of being electrically charged and discharged. Two vertical positive bus bars are provided on opposite sides of the battery cell for connecting the monoplates with positive active material together in parallel current conducting relation. In addition, two negative bus bars on opposite sides of the battery cell each being adjacent the positive bus bars are provided for connecting the monoplates with negative active material together in parallel current conducting relation. The positive and negative bus bars not only provide a low resistance method for connecting the plurality of conductive monoplates of their respective battery terminals but also provides support and structural strength to the battery cell structure. In addition, horizontal orientation of monoplates is provided in a vertical stacking arrangement to reduce electrolyte stratification and short circuiting due to flaking of positive and negative active materials from the monoplates.

  20. Lead-acid battery

    NASA Technical Reports Server (NTRS)

    Rowlette, John J. (Inventor)


    A light weight lead-acid battery (30) having a positive terminal (36) and a negative terminal (34) and including one or more cells or grid stacks having a plurality of vertically stacked conductive monoplates (10, 20) with positive active material and negative active material deposited on alternating plates in the cell or grid stack. Electrolyte layers (26, 28) positioned between each monoplate are included to provide a battery cell having four sides which is capable of being electrically charged and discharged. Two vertical positive bus bars (42, 43) are provided on opposite sides of the battery cell for connecting the monoplates (10) with positive active material together in parallel current conducting relation. In addition, two negative bus bars (38, 39) on opposite sides of the battery cell each being adjacent the positive bus bars are provided for connecting the monoplates (20) with negative active material together in parallel current conducting relation. The positive (42, 43) and negative (38, 39) bus bars not only provide a low resistance method for connecting the plurality of conductive monoplates of their respective battery terminals (36, 34) but also provides support and structural strength to the battery cell structure. In addition, horizontal orientation of monoplates (10, 20) is provided in a vertical stacking arrangement to reduce electrolyte stratification and short circuiting due to flaking of positive and negative active materials from the monoplates.

  1. Atmospheric dust and acid rain

    SciTech Connect

    Hedin, L.O.; Likens, G.E.


    Why is acid rain still an environmental problem in Europe and North America despite antipollution reforms? The answer really is blowing in the wind: atmospheric dust. These airborne particles can help neutralize the acids falling on forests, but dust levels are unusually low these days. In the air dust particles can neutralize acid rain. What can we do about acid rain and atmospheric dust? Suggestions range from the improbable to the feasible. One reasonable suggestion is to reduce emissions of acidic pollutants to levels that can be buffered by natural quantities of basic compounds in the atmosphere; such a goal would mean continued reductions in sulfur dioxide and nitrogen oxides, perhaps even greater than those prescribed in the 1990 Amendments to the Clean Air Act in the U.S. 5 figs.

  2. Microfluidics in amino acid analysis.


    Pumera, Martin


    Microfluidic devices have been widely used to derivatize, separate, and detect amino acids employing many different strategies. Virtually zero-dead volume interconnections and fast mass transfer in small volume microchannels enable dramatic increases in on-chip derivatization reaction speed, while only minute amounts of sample and reagent are needed. Due to short channel path, fast subsecond separations can be carried out. With sophisticated miniaturized detectors, the whole analytical process can be integrated on one platform. This article reviews developments of lab-on-chip technology in amino acid analysis, it shows important design features such as sample preconcentration, precolumn and postcolumn amino acid derivatization, and unlabeled and labeled amino acid detection with focus on advanced designs. The review also describes important biomedical and space exploration applications of amino acid analysis on microfluidic devices. PMID:17542043

  3. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.


    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  4. Fumaric acid production by fermentation

    PubMed Central

    Roa Engel, Carol A.; Zijlmans, Tiemen W.; van Gulik, Walter M.; van der Wielen, Luuk A. M.


    The potential of fumaric acid as a raw material in the polymer industry and the increment of cost of petroleum-based fumaric acid raises interest in fermentation processes for production of this compound from renewable resources. Although the chemical process yields 112% w/w fumaric acid from maleic anhydride and the fermentation process yields only 85% w/w from glucose, the latter raw material is three times cheaper. Besides, the fermentation fixes CO2. Production of fumaric acid by Rhizopus species and the involved metabolic pathways are reviewed. Submerged fermentation systems coupled with product recovery techniques seem to have achieved economically attractive yields and productivities. Future prospects for improvement of fumaric acid production include metabolic engineering approaches to achieve low pH fermentations. PMID:18214471

  5. Sialic acids and autoimmune disease.


    Mahajan, Vinay S; Pillai, Shiv


    An important underlying mechanism that contributes to autoimmunity is the loss of inhibitory signaling in the immune system. Sialic acid-recognizing Ig superfamily lectins or Siglecs are a family of cell surface proteins largely expressed in hematopoietic cells. The majority of Siglecs are inhibitory receptors expressed in immune cells that bind to sialic acid-containing ligands and recruit SH2-domain-containing tyrosine phosphatases to their cytoplasmic tails. They deliver inhibitory signals that can contribute to the constraining of immune cells, and thus protect the host from autoimmunity. The inhibitory functions of CD22/Siglec-2 and Siglec-G and their contributions to tolerance and autoimmunity, primarily in the B lymphocyte context, are considered in some detail in this review. The relevance to autoimmunity and unregulated inflammation of modified sialic acids, enzymes that modify sialic acid, and other sialic acid-binding proteins are also reviewed. PMID:26683151

  6. Nucleic acid based molecular devices.


    Krishnan, Yamuna; Simmel, Friedrich C


    In biology, nucleic acids are carriers of molecular information: DNA's base sequence stores and imparts genetic instructions, while RNA's sequence plays the role of a messenger and a regulator of gene expression. As biopolymers, nucleic acids also have exciting physicochemical properties, which can be rationally influenced by the base sequence in myriad ways. Consequently, in recent years nucleic acids have also become important building blocks for bottom-up nanotechnology: as molecules for the self-assembly of molecular nanostructures and also as a material for building machinelike nanodevices. In this Review we will cover the most important developments in this growing field of nucleic acid nanodevices. We also provide an overview of the biochemical and biophysical background of this field and the major "historical" influences that shaped its development. Particular emphasis is laid on DNA molecular motors, molecular robotics, molecular information processing, and applications of nucleic acid nanodevices in biology. PMID:21432950

  7. Molten fatty acid based microemulsions.


    Noirjean, Cecile; Testard, Fabienne; Dejugnat, Christophe; Jestin, Jacques; Carriere, David


    We show that ternary mixtures of water (polar phase), myristic acid (MA, apolar phase) and cetyltrimethylammonium bromide (CTAB, cationic surfactant) studied above the melting point of myristic acid allow the preparation of microemulsions without adding a salt or a co-surfactant. The combination of SANS, SAXS/WAXS, DSC, and phase diagram determination allows a complete characterization of the structures and interactions between components in the molten fatty acid based microemulsions. For the different structures characterized (microemulsion, lamellar or hexagonal phases), a similar thermal behaviour is observed for all ternary MA/CTAB/water monophasic samples and for binary MA/CTAB mixtures without water: crystalline myristic acid melts at 52 °C, and a thermal transition at 70 °C is assigned to the breaking of hydrogen bounds inside the mixed myristic acid/CTAB complex (being the surfactant film in the ternary system). Water determines the film curvature, hence the structures observed at high temperature, but does not influence the thermal behaviour of the ternary system. Myristic acid is partitioned in two "species" that behave independently: pure myristic acid and myristic acid associated with CTAB to form an equimolar complex that plays the role of the surfactant film. We therefore show that myristic acid plays the role of a solvent (oil) and a co-surfactant allowing the fine tuning of the structure of oil and water mixtures. This solvosurfactant behaviour of long chain fatty acid opens the way for new formulations with a complex structure without the addition of any extra compound. PMID:27241163

  8. Acid soil and acid rain, 2nd edition

    SciTech Connect

    Kennedy, I.R.


    This book examines the basic chemical processes involved in acidification in order to better assess their long-term effects on the status of soils, the health of plants and other living species that depend on them. It also discusses acidity, pH and protons their significance in bioenergetics and the consequent role of autotrophic organisms in acidifying ecosystems. This edition incorporates and integrates recent findings that render more explanations of the causes of the environmental impacts of acidity, especially in forests and lakes. Also explores current research into acid rain and soil in order to devise appropriate measures for their amelioration.

  9. Functional nucleic acid probes and uses thereof


    Nilsen-Hamilton, Marit


    The present invention provides functional nucleic acid probes, and methods of using functional nucleic acid probes, for binding a target to carry out a desired function. The probes have at least one functional nucleic acid, at least one regulating nucleic acid, and at least one attenuator. The functional nucleic acid is maintained in an inactive state by the attenuator and activated by the regulating nucleic acid only in the presence of a regulating nucleic acid target. In its activated state the functional nucleic acid can bind to its target to carry out a desired function, such as generating a signal, cleaving a nucleic acid, or catalyzing a reaction.

  10. Polyglycolic acid induced inflammation

    PubMed Central

    Ceonzo, Kathleen; Gaynor, Anne; Shaffer, Lisa; Kojima, Koji; Vacanti, Charles A.; Stahl, Gregory L.


    Tissue and organ replacement have quickly outpaced available supply. Tissue bioengineering holds the promise for additional tissue availability. Various scaffolds are currently used, whereas polyglycolic acid (PGA), which is currently used in absorbable sutures and orthopedic pins, provides an excellent support for tissue development. Unfortunately, PGA can induce a local inflammatory response following implantation, so we investigated the molecular mechanism of inflammation in vitro and in vivo. Degraded PGA induced an acute peritonitis, characterized by neutrophil (PMN) infiltration following intraperitoneal injection in mice. Similar observations were observed using the metabolite of PGA, glycolide. Dissolved PGA or glycolide, but not native PGA, activated the classical complement pathway in human sera, as determined by classical complement pathway hemolytic assays, C3a and C5a production, C3 and immunoglobulin deposition. To investigate whether these in vitro observations translated to in vivo findings, we used genetically engineered mice. Intraperitoneal administration of glycolide or dissolved PGA in mice deficient in C1q, factor D, C1q and factor D or C2 and factor B demonstrated significantly reduced PMN infiltration compared to congenic controls (WT). Mice deficient in C6 also demonstrated acute peritonitis. However, treatment of WT or C6 deficient mice with a monoclonal antibody against C5 prevented the inflammatory response. These data suggest that the hydrolysis of PGA to glycolide activates the classical complement pathway. Further, complement is amplified via the alternative pathway and inflammation is induced by C5a generation. Inhibition of C5a may provide a potential therapeutic approach to limit the inflammation associated with PGA derived materials following implantation. PMID:16548688

  11. 21 CFR 189.155 - Monochloroacetic acid.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Monochloroacetic acid. 189.155 Section 189.155... Human Food § 189.155 Monochloroacetic acid. (a) Monochloroacetic acid is the chemical chloroacetic acid... in alcoholic and nonalcoholic beverages. Monochloroacetic acid is permitted in food package...

  12. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  13. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and....1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid occurs naturally are...

  14. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  15. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  16. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  17. Cycloadditions for Studying Nucleic Acids.


    Kath-Schorr, Stephanie


    Cycloaddition reactions for site-specific or global modification of nucleic acids have enabled the preparation of a plethora of previously inaccessible DNA and RNA constructs for structural and functional studies on naturally occurring nucleic acids, the assembly of nucleic acid nanostructures, therapeutic applications, and recently, the development of novel aptamers. In this chapter, recent progress in nucleic acid functionalization via a range of different cycloaddition (click) chemistries is presented. At first, cycloaddition/click chemistries already used for modifying nucleic acids are summarized, ranging from the well-established copper(I)-catalyzed alkyne-azide cycloaddition reaction to copper free methods, such as the strain-promoted azide-alkyne cycloaddition, tetrazole-based photoclick chemistry and the inverse electron demand Diels-Alder cycloaddition reaction between strained alkenes and tetrazine derivatives. The subsequent sections contain selected applications of nucleic acid functionalization via click chemistry; in particular, site-specific enzymatic labeling in vitro, either via DNA and RNA recognizing enzymes or by introducing unnatural base pairs modified for click reactions. Further sections report recent progress in metabolic labeling and fluorescent detection of DNA and RNA synthesis in vivo, click nucleic acid ligation, click chemistry in nanostructure assembly and click-SELEX as a novel method for the selection of aptamers. PMID:27572987

  18. Phytic acid in green leaves.


    Hadi Alkarawi, H; Zotz, G


    Phytic acid or phytate, the free-acid form of myo-inositolhexakiphosphate, is abundant in many seeds and fruits, where it represents the major storage form of phosphorus. Although also known from other plant tissues, available reports on the occurrence of phytic acid, e.g. in leaves, have never been compiled, nor have they been critically reviewed. We found 45 published studies with information on phytic acid content in leaves. Phytic acid was almost always detected when studies specifically tried to detect it, and accounted for up to 98% of total P. However, we argue that such extreme values, which rival findings from storage organs, are dubious and probably result from measurement errors. Excluding these high values from further quantitative analysis, foliar phytic acid-P averaged 2.3 mg·g(-1) , and represented, on average, 7.6% of total P. Remarkably, the ratio of phytic acid-P to total P did not increase with total P, we even detected a negative correlation of the two variables within one species, Manihot esculenta. This enigmatic finding warrants further attention. PMID:24341824

  19. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail


    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  20. Terahertz spectrum of gallic acid

    NASA Astrophysics Data System (ADS)

    Wu, Meng; Zhao, Guozhong; Wang, Haiyan; Liang, Chengshen


    Gallic acid is natural polyphenol compound found in many green plants. More and more experiments have demonstrated that the gallic acid has comprehensive applications. In the field of medicine, the gallic acid plays an important role in antianaphylaxis, antineoplastic, antimycotic, anti-inflammatory, antivirotic, antiasthmatic and inhibiting the degradation of insulin. It also has a lot of applications in chemical industry, food industry and light industry. So it is important to study the terahertz time-domain spectroscopy of gallic acid. Terahertz time-domain spectroscopy (THz-TDS) is a new coherent spectral technology based on the femtosecond laser. In this work, the spectral characteristics of gallic acid in the range of 0.4 THz to 2.6 THz have been measured by THz-TDS. We obtained its absorption and refraction spectra at room temperature. The vibration absorption spectrum of the single molecule between 0.4 THz and 2.6 THz is simulated based on the Density Functional Theory (DFT). It is found that the gallic acid has the spectral response to THz wave in this frequency range. The results show the abnormal dispersion at 1.51 THz and 2.05 THz. These results can be used in the qualitative analysis of gallic acid and the medicine and food inspection.

  1. Pyroligneous acid-the smoky acidic liquid from plant biomass.


    Mathew, Sindhu; Zakaria, Zainul Akmar


    Pyroligneous acid (PA) is a complex highly oxygenated aqueous liquid fraction obtained by the condensation of pyrolysis vapors, which result from the thermochemical breakdown or pyrolysis of plant biomass components such as cellulose, hemicellulose, and lignin. PA produced by the slow pyrolysis of plant biomass is a yellowish brown or dark brown liquid with acidic pH and usually comprises a complex mixture of guaiacols, catechols, syringols, phenols, vanillins, furans, pyrans, carboxaldehydes, hydroxyketones, sugars, alkyl aryl ethers, nitrogenated derivatives, alcohols, acetic acid, and other carboxylic acids. The phenolic components, namely guaiacol, alkyl guaiacols, syringol, and alkyl syringols, contribute to the smoky odor of PA. PA finds application in diverse areas, as antioxidant, antimicrobial, antiinflammatory, plant growth stimulator, coagulant for natural rubber, and termiticidal and pesticidal agent; is a source for valuable chemicals; and imparts a smoky flavor for food. PMID:25467926

  2. Drilling fluids containing amps, acrylic acid, itaconic acid polymer

    SciTech Connect

    Bardoliwalla, D.F.


    This patent describes an aqueous drilling fluid having present in an amount sufficient to reduce fluid loss of the drilling fluid, at least one polymer of (1) from about 5% to about 50% by weight of 2-acrylamido-2-methylpropane sulfonic acid and (2) from about 95% to about 50% by weight of a second component, there being from 100% to about 80% by weight of acrylic acid and from 0% by weight to about 20% by weight of itaconic acid in the second component. The polymer has a weight average molecular weight of between about 50,000 to about 1,000,000 being in its free acid or partially or completely neutralized form and being at least water dispersible. A method is described of drilling a well into a subterranean formation in which an aqueous drilling fluid is circulated into the well. The step of circulating the drilling fluid contains in an amount sufficient to reduce fluid loss of the drilling fluid, at least one polymer of (1) from about 5% to about 50% by weight of 2-acrylamido-2-methylpropane sulfonic acid and (2) from about 95% to about 50% by weight of a second component. There is from 100% to about 80% by weight of acrylic acid and from 0% by weight to about 20% by weight of itaconic acid in the second component. The polymer has weight average molecular weight of between about 50,000 to about 1,000,000 in its free acid or partially or completely neutralized form and is at least water dispersible.



    Haworth, W.N.; Stacey, M.


    A process is described for the preparation of trifluoroacetic acid. Acetone vapor diluted wlth nitrogen and fluorine also diluted with nltrogen are fed separately at a temperature of about 210 deg C into a reaction vessel containing a catalyst mass selected from-the group consisting of silver and gold. The temperature in the reaction vessel is maintained in the range of 200 deg to 250 deg C. The reaction product, trifluoroacetyl fluoride, is absorbed in aqueous alkali solution. Trifluoroacetic acid is recovered from the solution by acidification wlth an acid such as sulfuric followed by steam distillation.

  4. Chemiluminescent measurement of atmospheric acid

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.; Kok, G. L.


    The design and construction of a gas phase acid sensitive analyzer are reported. These studies showed that the chemical system was a practical analytical method. A complete instrument was developed and prepared for field testing. A Titan 3-C rocket was scheduled for launching on February 11, 1974. Through preparations made by NASA Langley the instrument was set up to monitor the acid concentration in the rocket exhaust. Due to adverse wind conditions no acid was detected. This entire trip is described in detail.



    Khan, Abida Kalsoom; Rashid, Rehana; Fatima, Nighat; Mahmood, Sadaf; Mir, Sadullah; Khan, Sara; Jabeen, Nyla; Murtaza, Ghulam


    Protocatechuic acid (3,4-dihydroxybenzoic acid, PCA) is a simple phenolic acid. It is found in a large variety of edible plants and possesses various pharmacological activities. This article aims to review the modern trends in phytochemical isolation and extraction of PCA from plants and other natural resources. Moreover, this article also encompasses pharmacological and biological activities of PCA. It is well known to have anti-inflammatory, antioxidant, anti-hyperglycemia, antibacterial, anticancer, anti-ageing, anti-athro- genic, anti-tumoral, anti-asthma, antiulcer, antispasmodic and neurological properties. PMID:26647619

  6. Can crops tolerate acid rain

    SciTech Connect

    Kaplan, J.K.


    This brief article describes work by scientists at the ARS Air Quality-Plant Growth and Development Laboratory in Raleigh, North Carolina, that indicates little damage to crops as a result of acid rain. In studies with simulated acid rain and 216 exposed varieties of 18 crops, there were no significant injuries nor was there reduced growth in most species. Results of chronic and acute exposures were correlated in sensitive tomato and soybean plants and in tolerant winter wheat and lettuce plants. These results suggest that 1-hour exposures could be used in the future to screen varieties for sensitivity to acid rain.

  7. Amino Acids from a Comet

    NASA Technical Reports Server (NTRS)

    Cook, Jamie Elisla


    NASA's Stardust spacecraft returned samples from comet 81P/Wild 2 to Earth in January 2006. Examinations of the organic compounds in cometary samples can reveal information about the prebiotic organic inventory present on the early Earth and within the early Solar System, which may have contributed to the origin of life. Preliminary studies of Stardust material revealed the presence of a suite of organic compounds including several amines and amino acids, but the origin of these compounds (cometary- vs. terrestrial contamination) could not be identified. We have recently measured the carbon isotopic ratios of these amino acids to determine their origin, leading to the first detection of a coetary amino acid.

  8. Be an acid rain detective

    SciTech Connect

    Atwill, L.


    Acid rain is discussed in a question and answer format. The article is aimed at educating sport fishermen on the subject, and also to encourage them to write their congressmen, senators, and the President about the acid rain problem. The article also announces the availability of an acid rain test kit available through the magazine, ''Sports Afield.'' The kit consists of pH-test paper that turns different shades of pink and blue according to the pH of the water tested. The color of the test paper is then compared to a color chart furnished in the kit and an approximate pH can be determined.

  9. Abscission: Role of Abscisic Acid

    PubMed Central

    Cracker, L. E.; Abeles, F. B.


    The effect of abscisic acid on cotton (Gossypium hirsutum L. cv. Acala 4-42) and bean (Phaseolus vulgaris L. cv. Red Kidney) explants was 2-fold. It increased ethylene production from the explants, which was found to account for some of its ability to accelerate abscission. Absci is acid also increased the activity of cellulase. Increased synthesis of cellulase was not du to an increase in aging of the explants but rather was an effect of abscisic acid on the processes that lead to cellulase synthesis or activity. PMID:16657181

  10. Treatment of Amino Acid Metabolism Disorders


    ... Treatment of amino acid metabolism disorders Treatment of amino acid metabolism disorders E-mail to a friend Please ... this page It's been added to your dashboard . Amino acid metabolism disorders are rare health conditions that affect ...

  11. Genetics Home Reference: sialic acid storage disease


    ... Home Health Conditions sialic acid storage disease sialic acid storage disease Enable Javascript to view the expand/ ... Download PDF Open All Close All Description Sialic acid storage disease is an inherited disorder that primarily ...

  12. Treatment of Fatty Acid Oxidation Disorders


    ... of fatty acid oxidation disorders Treatment of fatty acid oxidation disorders E-mail to a friend Please ... page It's been added to your dashboard . Fatty acid oxidation disorders are rare health conditions that affect ...

  13. Molar extinction coefficients of some fatty acids

    NASA Astrophysics Data System (ADS)

    Sandhu, G. K.; Singh, Kulwant; Lark, B. S.; Gerward, L.


    The attenuation of gamma rays in some fatty acids, viz. formic acid (CH 2O 2), acetic acid (C 2H 4O 2), propionic acid (C 3H 6O 2), butyric acid (C 4H 8O 2), n-hexanoic acid (C 6H 12O 2), n-caprylic acid (C 8H 16O 2), lauric acid (C 12H 24O 2), myristic acid (C 14H 28O 2), palmitic acid (C 16H 32O 2), oleic acid (C 18H 34O 2) and stearic acid (C 18H 36O 2), has been measured at the photon energies 81, 356, 511, 662, 1173 and 1332 keV. Experimental values for the molar extinction coefficient, the effective atomic number and the electron density have been derived and compared with theoretical calculations. There is good agreement between experiment and theory.

  14. Phosphonic acid based exchange resins


    Horwitz, E. Philip; Alexandratos, Spiro D.; Gatrone, Ralph C.; Chiarizia, Ronato


    An ion exchange resin for extracting metal ions from a liquid waste stream. An ion exchange resin is prepared by copolymerizing a vinylidene diphosphonic acid with styrene, acrylonitrile and divinylbenzene.

  15. Microbial production of lactic acid.


    Eiteman, Mark A; Ramalingam, Subramanian


    Lactic acid is an important commodity chemical having a wide range of applications. Microbial production effectively competes with chemical synthesis methods because biochemical synthesis permits the generation of either one of the two enantiomers with high optical purity at high yield and titer, a result which is particularly beneficial for the production of poly(lactic acid) polymers having specific properties. The commercial viability of microbial lactic acid production relies on utilization of inexpensive carbon substrates derived from agricultural or waste resources. Therefore, optimal lactic acid formation requires an understanding and engineering of both the competing pathways involved in carbohydrate metabolism, as well as pathways leading to potential by-products which both affect product yield. Recent research leverages those biochemical pathways, while researchers also continue to seek strains with improved tolerance and ability to perform under desirable industrial conditions, for example, of pH and temperature. PMID:25604523

  16. Low acid producing solid propellants

    NASA Technical Reports Server (NTRS)

    Bennett, Robert R.


    The potential environmental effects of the exhaust products of conventional rocket propellants have been assessed by various groups. Areas of concern have included stratospheric ozone, acid rain, toxicity, air quality and global warming. Some of the studies which have been performed on this subject have concluded that while the impacts of rocket use are extremely small, there are propellant development options which have the potential to reduce those impacts even further. This paper discusses the various solid propellant options which have been proposed as being more environmentally benign than current systems by reducing HCI emissions. These options include acid neutralized, acid scavenged, and nonchlorine propellants. An assessment of the acid reducing potential and the viability of each of these options is made, based on current information. Such an assessment is needed in order to judge whether the potential improvements justify the expenditures of developing the new propellant systems.

  17. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.


    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  18. Bile acid sequestrants for cholesterol


    ... ency/patientinstructions/000787.htm Bile acid sequestrants for cholesterol To use the sharing features on this page, ... are medicines that help lower your LDL (bad) cholesterol . Too much cholesterol in your blood can stick ...

  19. Biopreservation by lactic acid bacteria.


    Stiles, M E


    Biopreservation refers to extended storage life and enhanced safety of foods using the natural microflora and (or) their antibacterial products. Lactic acid bacteria have a major potential for use in biopreservation because they are safe to consume and during storage they naturally dominate the microflora of many foods. In milk, brined vegetables, many cereal products and meats with added carbohydrate, the growth of lactic acid bacteria produces a new food product. In raw meats and fish that are chill stored under vacuum or in an environment with elevated carbon dioxide concentration, the lactic acid bacteria become the dominant population and preserve the meat with a "hidden' fermentation. The same applies to processed meats provided that the lactic acid bacteria survive the heat treatment or they are inoculated onto the product after heat treatment. This paper reviews the current status and potential for controlled biopreservation of foods. PMID:8879414

  20. Antibiofilm Properties of Acetic Acid

    PubMed Central

    Bjarnsholt, Thomas; Alhede, Morten; Jensen, Peter Østrup; Nielsen, Anne K.; Johansen, Helle Krogh; Homøe, Preben; Høiby, Niels; Givskov, Michael; Kirketerp-Møller, Klaus


    Bacterial biofilms are known to be extremely tolerant toward antibiotics and other antimicrobial agents. These biofilms cause the persistence of chronic infections. Since antibiotics rarely resolve these infections, the only effective treatment of chronic infections is surgical removal of the infected implant, tissue, or organ and thereby the biofilm. Acetic acid is known for its antimicrobial effect on bacteria in general, but has never been thoroughly tested for its efficacy against bacterial biofilms. In this article, we describe complete eradication of both Gram-positive and Gram-negative biofilms using acetic acid both as a liquid and as a dry salt. In addition, we present our clinical experience of acetic acid treatment of chronic wounds. In conclusion, we here present the first comprehensive in vitro and in vivo testing of acetic acid against bacterial biofilms. PMID:26155378

  1. Biotechnological production of citric acid

    PubMed Central

    Max, Belén; Salgado, José Manuel; Rodríguez, Noelia; Cortés, Sandra; Converti, Attilio; Domínguez, José Manuel


    This work provides a review about the biotechnological production of citric acid starting from the physicochemical properties and industrial applications, mainly in the food and pharmaceutical sectors. Several factors affecting citric acid fermentation are discussed, including carbon source, nitrogen and phosphate limitations, pH of culture medium, aeration, trace elements and morphology of the fungus. Special attention is paid to the fundamentals of biochemistry and accumulation of citric acid. Technologies employed at industrial scale such as surface or submerged cultures, mainly employing Aspergillus niger, and processes carried out with Yarrowia lipolytica, as well as the technology for recovering the product are also described. Finally, this review summarizes the use of orange peels and other by-products as feedstocks for the bioproduction of citric acid. PMID:24031566

  2. Simulated acid rain on crops

    SciTech Connect

    Plocher, M.D.; Perrigan, S.C.; Hevel, R.J.; Cooper, R.M.; Moss, D.N.


    In 1981, simulated H/sub 2/SO/sub 4/ acid rain was applied to alfalfa and tall fescue and a 2:1 ratio of H/sub 2/SO/sub 4/:HNO/sub 3/ acid rain was applied to alfalfa, tall fescue, barley, wheat, potato, tomato, radish, and corn crops growing in the open field at Corvallis, Oregon. Careful attention was given to effects of the acid rain on the appearance of the foliage, and the effects on yield were measured. Because the effect of pH 4.0 rain on corn yield was the only significant effect noted in the 1981 studies, in 1982, more-extensive studies of the effect of simulated H/sub 2/SO/sub 4//HNO/sub 3/ rain on corn were conducted. No significant effects of acid rain were found on foliage appearance, or on yield of grain or stover in the 1982 studies.

  3. [Treatment of hydrofluoric acid burns].


    Thiele, B; Winter, U J; Mahrle, G; Steigleder, G K


    A chemical-plant worker sustained hydrofluoric acid burns during cleaning procedures. Intra-arterial perfusion and intralesional injections of calcium gluconate solution prevented progression of the burns into deeper tissue layers. PMID:3943470

  4. Making cents of acid recovery

    SciTech Connect

    Ondrey, G.; Shanley, A.


    Acid recovery may be expensive, but rising transportation and landfill costs may soon make it the only alternative. Traditionally, acids used in processes from titanium dioxide production to gasoline alkylation and metal pickling were neutralized and discharged into waterways or injected into deep wells. Today, however, discharge permits are being phased out in many countries, and deep well injection is coming under closer scrutiny. An even cheaper option was selling spent acid to fertilizer producers, who used it to dissolve phosphate ores. Health concerns, a depressed fertilizer market and tightening disposal regulations for gypsum byproduct have dried up this option. The paper discusses the processes and costs involved in spent acid regeneration, gypsum-free gas treatments, and problems with explosive contaminants.


    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) is conducting an intensive characterization and human exposure monitoring program of acid species and related air pollutants in an urban environment. he EPA's Atmospheric Research and Exposure Assessment Laboratory (AREAL) in coopera...

  6. Phosphonic acid based exchange resins


    Horwitz, E.P.; Alexandratos, S.D.; Gatrone, R.C.; Chiarizia, R.


    An ion exchange resin is described for extracting metal ions from a liquid waste stream. An ion exchange resin is prepared by copolymerizing a vinylidene diphosphonic acid with styrene, acrylonitrile and divinylbenzene. 10 figs.

  7. Glucaric acids from Leonurus japonicus.


    Jiang, Jianshuang; Li, Yixiu; Feng, Ziming; Yang, Yanan; Zhang, Peicheng


    Three new glucaric acids, namely 2-feruloyl-4-syringoyl or 5-feruloyl-3-syringoyl glucaric acid (1), 2-syringoyl-4-feruloyl or 5-syringoyl-3-feruloyl glucaric acid (2), and 3-feruloyl-4-syringoyl or 4-feruloyl-3-syringoyl glucaric acid (3), were isolated from Leonurus japonicus Houtt. Their structures were elucidated by detailed spectroscopic means including UV, IR, HR-ESI-MS, 1D and 2D NMR data spectra. The bioactive assays of compounds 1-3 against hepatoprotection activity were determined. The result suggested that compound 2 exhibited a moderate hepatoprotection activity and the cell survival rate was 74% (10(-5)mol/L), using bicyclol (survival rate: 66%, 10(-5)mol/L) as a positive control. Furthermore, compounds 1-3 were evaluated cytotoxic activities in vitro using HCT-8, Bel-7402, BGC-823, A-549, and A2780 model and the results exhibited no obvious cytotoxicity activity. PMID:26526024

  8. Acid diffusion through polymer films

    NASA Astrophysics Data System (ADS)

    Zhang, P. Linda; Eckert, Andrew R.; Willson, C. Grant; Webber, Stephen E.; Byers, Jeffrey D.


    In order to perform 0.2 micrometer processes, one needs to study the diffusion of photoacid generators within the photoresist system, since diffusion during post exposure bake time has an influence on the critical dimension (CD). We have developed a new method to study the diffusion of photoacid generators within a polymer film. This new method is based on monitoring the change of the fluorescence intensity of a pH- sensitive fluorescent dye caused by the reaction with photoacid. A simplified version of this experiment has been conducted by introducing acid vapor to quench the fluorescence intensity of this pH sensor. A thin polymer film is spin cast onto the sensor to create a barrier to the acid diffusion process. During the acid diffusion process, the fluorescence intensity of this pH sensor is measured in situ, using excitation and emission wavelengths at 466 nm and 516 nm, respectively. Fluoresceinamine, the pH sensitive fluorescent dye, is covalently bonded onto the treated quartz substrate to form a single dye layer. Poly(hydroxystyrene) (Mn equals 13k, Tg equals 180 degrees Celsius) in PGMEA (5% - 18% by weight) is spin cast onto this quartz substrate to form films with varying thickness. The soft bake time is 60 seconds at 90 degrees Celsius and a typical film has a thickness of 1.4 micrometers. Trifluoroacetic acid is introduced into a small chamber while the fluorescence from this quartz window is observed. Our study focuses on finding the diffusion constant of the vaporized acid (trifluoroacetic acid) in the poly(hydroxystyrene) polymer film. By applying the Fick's second law, (It - Io)/(I(infinity ) - Io) equals erfc [L/(Dt)1/2] is obtained. The change of fluorescence intensity with respect to the diffusion time is monitored. The above equation is used for the data analysis, where L represents the film thickness and t represents the average time for the acid to diffuse through the film. The diffusion constant is calculated to be at the order of 10

  9. Nucleic acid arrays and methods of synthesis


    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles


    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  10. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  11. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and....1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid oxidation of cyclohexanol...

  12. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  13. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  14. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  15. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  16. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  17. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and....1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It is commercially prepared...

  18. 40 CFR 721.10512 - Fatty acid maleic acid amides (generic).

    Code of Federal Regulations, 2014 CFR


    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Fatty acid maleic acid amides (generic... Specific Chemical Substances § 721.10512 Fatty acid maleic acid amides (generic). (a) Chemical substance... fatty acid maleic acid amides (PMNs P-07-563 and P-07-564) are subject to reporting under this...

  19. 40 CFR 721.10512 - Fatty acid maleic acid amides (generic).

    Code of Federal Regulations, 2013 CFR


    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Fatty acid maleic acid amides (generic... Specific Chemical Substances § 721.10512 Fatty acid maleic acid amides (generic). (a) Chemical substance... fatty acid maleic acid amides (PMNs P-07-563 and P-07-564) are subject to reporting under this...

  20. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  1. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  2. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  3. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  4. Aqueous Photochemistry of Glyoxylic Acid.


    Eugene, Alexis J; Xia, Sha-Sha; Guzman, Marcelo I


    Aerosols affect climate change, the energy balance of the atmosphere, and public health due to their variable chemical composition, size, and shape. While the formation of secondary organic aerosols (SOA) from gas phase precursors is relatively well understood, studying aqueous chemical reactions contributing to the total SOA budget is the current focus of major attention. Field measurements have revealed that mono-, di-, and oxo-carboxylic acids are abundant species present in SOA and atmospheric waters. This work explores the fate of one of these 2-oxocarboxylic acids, glyoxylic acid, which can photogenerate reactive species under solar irradiation. Additionally, the dark thermal aging of photoproducts is studied by UV-visible and fluorescence spectroscopies to reveal that the optical properties are altered by the glyoxal produced. The optical properties display periodicity in the time domain of the UV-visible spectrum of chromophores with absorption enhancement (thermochromism) or loss (photobleaching) during nighttime and daytime cycles, respectively. During irradiation, excited state glyoxylic acid can undergo α-cleavage or participate in hydrogen abstractions. The use of (13)C nuclear magnetic resonance spectroscopy (NMR) analysis shows that glyoxal is an important intermediate produced during direct photolysis. Glyoxal quickly reaches a quasi-steady state as confirmed by UHPLC-MS analysis of its corresponding (E) and (Z) 2,4-dinitrophenylhydrazones. The homolytic cleavage of glyoxylic acid is proposed as a fundamental step for the production of glyoxal. Both carbon oxides, CO2(g) and CO(g) evolving to the gas-phase, are quantified by FTIR spectroscopy. Finally, formic acid, oxalic acid, and tartaric acid photoproducts are identified by ion chromatography (IC) with conductivity and electrospray (ESI) mass spectrometry (MS) detection and (1)H NMR spectroscopy. A reaction mechanism is proposed based on all experimental observations. PMID:27192089

  5. Chemical composition of acid fog

    SciTech Connect

    Waldman, J.M.; Munger, J.W.; Jacob, D.J.; Flagan, R.C.; Morgan, J.J.; Hoffmann, M.R.


    Fog water collected at three sites in Los Angeles and Bakersfield, California, was found to have higher acidity and higher concentrations of sulfate, nitrate, and ammonium than previously observed in atmospheric water droplets. The pH of the fog water was in the range of 2.2 to 4.0. the dominant processes controlling the fog water chemistry appear to be the condensation and evaporation of water vapor on preexisting aerosol and the scavenging of gas-phase nitric acid.

  6. Bile acids as metabolic regulators

    PubMed Central

    Li, Tiangang; Chiang, John Y. L.


    Summary Small molecule ligands that target to TGR5 and FXR have shown promise in treating various metabolic and inflammation-related human diseases. New insights into the mechanisms underlying the bariatric surgery and bile acid sequestrant treatment suggest that targeting the enterohepatic circulation to modulate gut-liver bile acid signaling, incretin production and microbiota represents a new strategy to treat obesity and type-2 diabetes. PMID:25584736

  7. Acidic extracellular microenvironment and cancer

    PubMed Central


    Acidic extracellular pH is a major feature of tumor tissue, extracellular acidification being primarily considered to be due to lactate secretion from anaerobic glycolysis. Clinicopathological evidence shows that transporters and pumps contribute to H+ secretion, such as the Na+/H+ exchanger, the H+-lactate co-transporter, monocarboxylate transporters, and the proton pump (H+-ATPase); these may also be associated with tumor metastasis. An acidic extracellular pH not only activates secreted lysosomal enzymes that have an optimal pH in the acidic range, but induces the expression of certain genes of pro-metastatic factors through an intracellular signaling cascade that is different from hypoxia. In addition to lactate, CO2 from the pentose phosphate pathway is an alternative source of acidity, showing that hypoxia and extracellular acidity are, while being independent from each other, deeply associated with the cellular microenvironment. In this article, the importance of an acidic extracellular pH as a microenvironmental factor participating in tumor progression is reviewed. PMID:24004445

  8. Photodissociation dynamics of hydroxybenzoic acids

    SciTech Connect

    Yang Yilin; Dyakov, Yuri; Lee, Y. T.; Ni, Chi-Kung; Sun Yilun; Hu Weiping


    Aromatic amino acids have large UV absorption cross-sections and low fluorescence quantum yields. Ultrafast internal conversion, which transforms electronic excitation energy to vibrational energy, was assumed to account for the photostability of amino acids. Recent theoretical and experimental investigations suggested that low fluorescence quantum yields of phenol (chromophore of tyrosine) are due to the dissociation from a repulsive excited state. Radicals generated from dissociation may undergo undesired reactions. It contradicts the observed photostability of amino acids. In this work, we explored the photodissociation dynamics of the tyrosine chromophores, 2-, 3- and 4-hydroxybenzoic acid in a molecular beam at 193 nm using multimass ion imaging techniques. We demonstrated that dissociation from the excited state is effectively quenched for the conformers of hydroxybenzoic acids with intramolecular hydrogen bonding. Ab initio calculations show that the excited state and the ground state potential energy surfaces change significantly for the conformers with intramolecular hydrogen bonding. It shows the importance of intramolecular hydrogen bond in the excited state dynamics and provides an alternative molecular mechanism for the photostability of aromatic amino acids upon irradiation of ultraviolet photons.

  9. Evaluation of ascorbic acid in protecting labile folic acid derivatives.

    PubMed Central

    Wilson, S D; Horne, D W


    The use of ascorbic acid as a reducing agent to protect labile, reduced derivatives of folic acid has been evaluated by high-performance liquid chromatographic separations and Lactobacillus casei microbiological assay of eluate fractions. Upon heating for 10 min at 100 degrees C, solutions of tetrahydropteroylglutamic acid (H4PteGlu) in 2% sodium ascorbate gave rise to 5,10-methylene-H4PteGlu and 5-methyl-H4PteGlu. H2PteGlu acid gave rise to 5-methyl-H4PteGlu and PteGlu. 10-Formyl-H4PteGlu gave rise to 5-formyl-H4PteGlu and 10-formyl-PteGlu. 5-Formyl-H4-PteGlu gave rise to a small amount of 10-formyl-PteGlu. 5-Methyl-H4PteGlu and PteGlu appeared stable to these conditions. These interconversions were not seen when solutions of these folate derivatives were kept at 0 degrees C in 1% ascorbate. These observations indicate that elevated temperatures are necessary for the interconversions of folates in ascorbate solutions. Assays of ascorbic acid solutions indicated the presence of formaldehyde (approximately equal to 6 mM). This was confirmed by the identification of 3,5-diacetyl-1,4-dihydrolutidine by UV, visible, and fluorescence spectroscopy and by thin-layer chromatography of chloroform extracts of the reaction mixture of ascorbic acid solutions, acetylacetone, and ammonium acetate. These results indicate that solutions of sodium ascorbate used at elevated temperatures are not suitable for extracting tissue for the subsequent assay of the individual folic acid derivatives. PMID:6415653

  10. Gas-Phase Acidities of Phosphorylated Amino Acids.


    Stover, Michele L; Plummer, Chelsea E; Miller, Sean R; Cassady, Carolyn J; Dixon, David A


    Gas-phase acidities and heats of formation have been predicted at the G3(MP2)/SCRF-COSMO level of theory for 10 phosphorylated amino acids and their corresponding amides, including phospho-serine (pSer), -threonine (pThr), and -tyrosine (pTyr), providing the first reliable set of these values. The gas-phase acidities (GAs) of the three named phosphorylated amino acids and their amides have been determined using proton transfer reactions in a Fourier transform ion cyclotron mass spectrometer. Excellent agreement was found between the experimental and predicted GAs. The phosphate group is the deprotonation site for pSer and pThr and deprotonation from the carboxylic acid generated the lowest energy anion for pTyr. The infrared spectra were calculated for six low energy anions of pSer, pThr, and pTyr. For deprotonated pSer and pThr, good agreement is found between the experimental IRMPD spectra and the calculated spectra for our lowest energy anion structure. For pTyr, the IR spectra for a higher energy phosphate deprotonated structure is in good agreement with experiment. Additional experiments tested electrospray ionization (ESI) conditions for pTyr and determined that variations in solvent, temperature, and voltage can result in a different experimental GA value, indicating that ESI conditions affect the conformation of the pTyr anion. PMID:26492552

  11. Recovery of uranium from acid media by macroporous bifunctional phosphinic acid resin

    SciTech Connect

    Sabharwal, K.N.; Srinivasan, T.G.; Rao, P.R.V.; Nandy, K.K.


    The extraction of uranium from various acid media such as nitric acid, sulphuric acid, hydrochloric acid, phosphoric acid and perchloric acid by a macroporous bifunctional phosphinic acid resin (MPBPA) has been studied. The distribution coefficients for the extraction of uranium by the MPBPA resin are compared with the corresponding values reported in literature for the conventional sulphonic acid resin. The results clearly indicate the suitability of the MPBPA resin to recover uranium from different types of acid solutions of widely ranging acidities. 17 refs., 6 figs., 5 tabs.

  12. Extractive fermentation of acetic acid

    SciTech Connect

    Busche, R.M.


    In this technoeconomic evaluation of the manufacture of acetic acid by fermentation, the use of the bacterium: Acetobacter suboxydans from the old vinegar process was compared with expected performance of the newer Clostridium thermoaceticum bacterium. Both systems were projected to operate as immobilized cells in a continuous, fluidized bed bioreactor, using solvent extraction to recover the product. Acetobacter metabolizes ethanol aerobically to produce acid at 100 g/L in a low pH medium. This ensures that the product is in the form of a concentrated extractable free acid, rather than as an unextractable salt. Unfortunately, yields from glucose by way of the ethanol fermentation are poor, but near the biological limits of the organisms involved. Conversely, C. thermoaceticum is a thermophilic anaerobe that operates at high fermentation rates on glucose at neutral pH to produce acetate salts directly in substantially quantitative yields. However, it is severely inhibited by product, which restricts concentration to a dilute 20 g/L. An improved Acetobacter system operating with recycled cells at 50 g/L appears capable of producing acid at $0.38/lb, as compared with a $0.29/lb price for synthetic acid. However, this system has only a limited margin for process improvement. The present Clostridium system cannot compete, since the required selling price would be $0.42/lb. However, if the organism could be adapted to tolerate higher product concentrations at acid pH, selling price could be reduced to $0.22/lb, or about 80% of the price of synthetic acid.

  13. Anaerobic biotransformation of organoarsenical pesticides monomethylarsonic acid and dimethylarsinic acid

    USGS Publications Warehouse

    Sierra-Alvarez, R.; Yenal, U.; Feld, J.A.; Kopplin, M.; Gandolfi, A.J.; Garbarino, J.R.


    Monomethylarsonic acid (MMAV) and dimethylarsinic acid (DMAV) are extensively utilized as pesticides, introducing large quantities of arsenic into the environment. Once released into the environment, these organoarsenicals are subject to microbial reactions. Aerobic biodegradation of MMAV and DMAV has been evaluated, but little is known about their fate in anaerobic environments. The objective of this study was to evaluate the biotransformation of MMAV and DMAV in anaerobic sludge. Biologically mediated conversion occurred under methanogenic or sulfate-reducing conditions but not in the presence of nitrate. Monomethylarsonous acid (MMAIII) was consistently observed as an important metabolite of MMAV degradation, and it was recovered in molar yields ranging from 5 to 47%. The main biotransformation product identified from DMAV metabolism was MMAV, which was recovered in molar yields ranging from 8 to 65%. The metabolites indicate that reduction and demethylation are important steps in the anaerobic bioconversion of MMAV and DMAV, respectively. ?? 2006 American Chemical Society.

  14. Bound sup 14 C residues in stored wheat treated with ( sup 14 C)deltamethrin and their bioavailability in rats

    SciTech Connect

    Khan, S.U.; Kacew, S. ); Akhtar, M.H. )


    Wheat grains treated with radiolabeled deltamethrin ((S)-{alpha}-cyano-3-phenoxybenzyl (1R,3R)-cis-3-(2,2-dibromovinyl)-2,2-dimethylcyclopropanecarboxylate) and stored in the laboratory for 168 days formed bound (nonextractable) {sup 14}C residues. The amount of bound {sup 14}C residues formed was about 11% of the total {sup 14}C in stored grain. Br{sub 2}CA (3-(2,2-dibromovinyl)-2,2-dimethylcyclopropanecarboxylic acid) and 3-PBacid (3-phenoxybenzoic acid) were present in the form of bound {sup 14}C residues in addition to some radiolabeled product of unknown composition. The stored wheat containing bound {sup 14}C was fed to rats. The {sup 14}C residues were excreted in urine and feces in nearly equal proportion. The {sup 14}C residues identified in urine were Br{sub 2}CA, 3-PBacid, and conjugated compounds of 4{prime}-OH-3-PBacid (3-(4-hydroxyphenoxy)benzoic acid). Most of the {sup 14}C residues excreted in feces were extractable with methanol. Trace amounts of {sup 14}C residues were also present in lungs, kidney, and liver. The results suggest that bound residues in stored wheat treated with deltamethrin when fed to rats are highly bioavailable.

  15. Arterial Blood Carbonic Acid Inversely Determines Lactic and Organic Acids

    PubMed Central

    Aiken, Christopher Geoffrey Alexander


    Objective: To establish that arterial blood carbonic acid varies inversely with lactic acid in accordance with bicarbonate exchanging for lactate across cell membranes through the anion exchange mechanism to maintain the Gibbs-Donnan equilibrium. Study Design: Over 5 years, lactate was measured on all blood gases taken from neonatal admissions, as well as organic acid whenever electrolytes were required. Results: Arterial blood gases from 63 infants given high calcium TPN were analyzed. Twenty two needed continuous positive airways pressure (CPAP) only and 31 intermittent positive pressure ventilation (IPPV) and surfactant followed by CPAP to treat respiratory distress syndrome in 51 and meconium aspiration syndrome in 2. All survived and were free of infection. Excluded gases were those with high and falling lactate soon after delivery representing perinatal asphyxia, and those on dexamethasone. Strong inverse relations between carbonic and lactic acids were found at all gestational ages and, independent of glomerular filtration, between carbonic and organic acids. Lactate (mmol/L) = 62.53 X PCO2 -0.96(mmHg) r2 0.315, n 1232, p <0.001. Sixty divided by PCO2 is a convenient measure of physiological lactate at any given PCO2. In the first week, 9.13 ± 2.57% of arterial gases from infants on IPPV had lactates above 120/PCO2, significantly more than 4.74 ± 2.73% on CPAP (p<0.05) and 2.47 ± 2.39% on no support. Conclusion: Changes in arterial blood carbonic acid cause immediate inverse changes in lactic acid, because their anions interchange across cell membranes according to the Gibbs –Donnan equilibrium. Increasing PCO2 from 40 to 120 mmHg decreased lactate from 1.5 mmol/L to 0.5 mmol/L, so that the sum of carbonic and lactic acids increased from 2.72 mmol/L to only 4.17 mmol/L. This helps explain the neuroprotective effect of hypercapnoea and highlights the importance of avoiding any degree of hypocapnoea in infants on IPPV. PMID:24392387

  16. Gallic Acid, Ellagic Acid and Pyrogallol Reaction with Metallic Iron

    NASA Astrophysics Data System (ADS)

    Jaén, J. A.; González, L.; Vargas, A.; Olave, G.


    The reaction between gallic acid, ellagic acid and pyrogallol with metallic iron was studied using infrared and Mössbauer spectroscopy. Most hydrolysable tannins with interesting anticorrosive or inhibition properties are structurally related to these compounds, thus they may be used as models for the study of hydrolysable tannins and related polyphenols. The interaction was followed up to 3 months. Results indicated two different behaviors. At polyphenol concentrations higher than 1% iron converts to sparingly soluble and amorphous ferric (and ferrous) polyphenolate complexes. At lower concentrations (0.1%), the hydrolysis reactions are dominant, resulting in the formation of oxyhydroxides, which can be further reduced to compounds like magnetite by the polyphenols.

  17. Gibberellic acid stimulates acid invertase secretion in pea ovary protoplasts.


    Estruch, J J; Beltrán, J P


    Protoplasts purified from mesocarp of nonpollinated pea (Pisum sativum L.) ovaries released acid invertase to the incubation medium. The association of the acid invertase with microsomal fractions, and the sensitivity to energy-metabolism inhibitors and to tunicamycin, indicated the secretory nature of the release process. In the presence of GA3 (10 microM), the protoplasts increased their invertase secretion at about 60 min, this effect being counteracted by tunicamycin but not by cycloheximide. Subcellular fractionation of GA3-treated protoplasts showed that higher invertase secretion was the result of a promotion of invertase transfer from endoplasmic reticulum (ER) to Golgi apparatus. PMID:2001743

  18. Structural features of lignohumic acids

    NASA Astrophysics Data System (ADS)

    Novák, František; Šestauberová, Martina; Hrabal, Richard


    The composition and structure of humic acids isolated from lignohumate, which is produced by hydrolytic-oxidative conversion of technical lignosulfonates, were characterized by chemical and spectral methods (UV/VIS, FTIR, and 13C NMR spectroscopy). As comparative samples, humic acids (HA) were isolated also from lignite and organic horizon of mountain spruce forest soil. When compared with other HA studied, the lignohumate humic acids (LHHA) contained relatively few carboxyl groups, whose role is partly fulfilled by sulfonic acid groups. Distinctive 13C NMR signal of methoxyl group carbons, typical for lignin and related humic substances, was found at the shift of 55.9 ppm. Other alkoxy carbons were present in limited quantity, like the aliphatic carbons. Due to the low content of these carbon types, the LHHA has high aromaticity of 60.6%. Comparison with the natural HA has shown that lignohumate obtained by thermal processing of technical lignosulfonate can be regarded as an industrially produced analog of natural humic substances. Based on the chemical and spectral data evaluation, structural features of lignohumate humic acids were clarified and their hypothetical chemical structure proposed, which described typical "average" properties of the isolated fraction.

  19. Isothermal Amplification of Nucleic Acids.


    Zhao, Yongxi; Chen, Feng; Li, Qian; Wang, Lihua; Fan, Chunhai


    Isothermal amplification of nucleic acids is a simple process that rapidly and efficiently accumulates nucleic acid sequences at constant temperature. Since the early 1990s, various isothermal amplification techniques have been developed as alternatives to polymerase chain reaction (PCR). These isothermal amplification methods have been used for biosensing targets such as DNA, RNA, cells, proteins, small molecules, and ions. The applications of these techniques for in situ or intracellular bioimaging and sequencing have been amply demonstrated. Amplicons produced by isothermal amplification methods have also been utilized to construct versatile nucleic acid nanomaterials for promising applications in biomedicine, bioimaging, and biosensing. The integration of isothermal amplification into microsystems or portable devices improves nucleic acid-based on-site assays and confers high sensitivity. Single-cell and single-molecule analyses have also been implemented based on integrated microfluidic systems. In this review, we provide a comprehensive overview of the isothermal amplification of nucleic acids encompassing work published in the past two decades. First, different isothermal amplification techniques are classified into three types based on reaction kinetics. Then, we summarize the applications of isothermal amplification in bioanalysis, diagnostics, nanotechnology, materials science, and device integration. Finally, several challenges and perspectives in the field are discussed. PMID:26551336

  20. Polyunsaturated Fatty Acids in Children

    PubMed Central


    Polyunsaturated fatty acids (PUFAs) are the major components of brain and retina, and are the essential fatty acids with important physiologically active functions. Thus, PUFAs should be provided to children, and are very important in the brain growth and development for fetuses, newborn infants, and children. Omega-3 fatty acids decrease coronary artery disease and improve blood flow. PUFAs have been known to have anti-inflammatory action and improved the chronic inflammation such as auto-immune diseases or degenerative neurologic diseases. PUFAs are used for metabolic syndrome related with obesity or diabetes. However, there are several considerations related with intake of PUFAs. Obsession with the intake of unsaturated fatty acids could bring about the shortage of essential fatty acids that are crucial for our body, weaken the immune system, and increase the risk of heart disease, arrhythmia, and stroke. In this review, we discuss types, physiologic mechanism of action of PUFAs, intake of PUFAs for children, recommended intake of PUFAs, and considerations for the intake of PUFAs. PMID:24224148

  1. Scientist, researchers, and acid rain

    SciTech Connect

    Alm, L.R. )


    The role of the hidden participants in agenda-setting for environmental issues is discussed. These personnel involve academics, researchers, career bureaucrats, congressional staffers, consultants, and administration appointees below the top level. Scientists have been publicly involved in the acid rain issue from the beginning, using the media to dramatize the possible catastrophic consequences of acid rain. Presently, the scientific community is not in consensus about the solutions to the problem. Since the initial enactment of the National Acid Precipitation Act in 1980, not a single acid rain law has been passed, although many bills have been proposed. Spokesman for the coal and utility industries and Reagan administration personnel have used the scientific disagreements to delay abatement actions and refute claims that acid rain is a severe problem. Another result of the confusion is a distrust and even disdain for academic work. One possible solution to the stalemate is an accurate form for resolving scientific disputes that have a strong political component and that the forum should have a mechanism for converging on accurate science. 19 refs.

  2. Bile acid transformations by Alcaligenes recti.


    Mazumder, I; Mahato, S B


    Metabolism of cholic acid, chenodeoxycholic acid, ursodeoxycholic acid, and deoxycholic acid by the grown cells of the bacterium Alcaligenes recti suspended in water was studied. Each isolated metabolite was characterized by the application of various spectroscopic methods. Cholic acid, chenodeoxycholic acid, ursodeoxycholic acid, and deoxycholic acid yielded methylated derivatives 3 alpha-methoxy-7 alpha, 12 alpha-dihydroxy-5 beta-cholanoic acid, 3 alpha-methoxy-7 alpha-hydroxy-5 beta-cholanoic acid, 3 alpha-methoxy-7 beta-hydroxy-5 beta-cholanoic acid, and 3 alpha-methoxy-12 alpha-hydroxy-5 beta-cholanoic acid, respectively. In addition, cholic acid furnished 7 alpha, 12 alpha-dihydroxy-3-oxochol-4-en-24-oic acid; chenodeoxycholic acid gave 7 alpha-hydroxy-3-oxo-5 beta-cholanoic acid and 7 alpha-hydroxy-3-oxochol-4-en-24-oic acid while ursodeoxycholic acid yielded 7 beta-hydroxy-3-oxochol-4-en-24-oic acid and 3-oxochola-4,6-dien-24-oic acid. The formation of various metabolites showed that two competitive enzymic reactions, i.e., selective methylation of the 3 alpha-hydroxy group and dehydrogenation in the A/B rings, were operative. The methylation process was found to be enzymic involving an S-adenosyl-L-methionine (AdoMet)-dependent methyl transferase, and this reaction appeared to be inhibitory to the process of degradation of the ring system. In the other reaction sequence, degradation of the ring system was initiated by dehydrogenation of the 3 alpha-hydroxy group. A 7 beta-dehydratase activity producing the delta 6 double bond was also noticeable in the metabolism of ursodeoxycholic acid. PMID:8484188

  3. How does Listeria monocytogenes combat acid conditions?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Listeria monocytogenes, a major foodborne pathogen, possesses a number of mechanisms which enable it to combat the challenges posed by acidic environments such as acidic foods and the acidity in the gastrointestinal tract. These mechanisms include the acid tolerance response, a two-component regula...

  4. 21 CFR 582.5013 - Ascorbic acid.

    Code of Federal Regulations, 2013 CFR


    ... 1 § 582.5013 Ascorbic acid. (a) Product. Ascorbic acid. 1 Amino acids listed in this subpart may be... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Ascorbic acid. 582.5013 Section 582.5013 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL...

  5. 21 CFR 582.5013 - Ascorbic acid.

    Code of Federal Regulations, 2011 CFR


    ... 1 § 582.5013 Ascorbic acid. (a) Product. Ascorbic acid. 1 Amino acids listed in this subpart may be... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Ascorbic acid. 582.5013 Section 582.5013 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL...

  6. 21 CFR 582.5013 - Ascorbic acid.

    Code of Federal Regulations, 2014 CFR


    ... 1 § 582.5013 Ascorbic acid. (a) Product. Ascorbic acid. 1 Amino acids listed in this subpart may be... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Ascorbic acid. 582.5013 Section 582.5013 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL...

  7. 21 CFR 582.5013 - Ascorbic acid.

    Code of Federal Regulations, 2012 CFR


    ... 1 § 582.5013 Ascorbic acid. (a) Product. Ascorbic acid. 1 Amino acids listed in this subpart may be... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Ascorbic acid. 582.5013 Section 582.5013 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL...

  8. Sulfuric Acid in the Venus Clouds

    NASA Technical Reports Server (NTRS)

    Sill, G. T.


    The visible and ultraviolet transmission features of a thin layer of elemental bromine and hydrobromic acid dissolved in sulfuric acid somewhat resemble the Venus spectrum, up to 14 microns. The chemical process postulated for forming sulfuric acid involves the oxidation of sulfur and its compounds to sulfuric acid through the agency of elemental bromine, produced by the photolytic decomposition of hydrogen bromide.

  9. 27 CFR 24.318 - Acid record.

    Code of Federal Regulations, 2013 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Acid record. 24.318... OF THE TREASURY ALCOHOL WINE Records and Reports § 24.318 Acid record. A proprietor who adds acid to... use, the kind and quantity of acid used, the kinds and volume of juice or wine in which used,...

  10. 21 CFR 189.155 - Monochloroacetic acid.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Monochloroacetic acid. 189.155 Section 189.155 Food... Prohibited From Direct Addition or Use as Human Food § 189.155 Monochloroacetic acid. (a) Monochloroacetic acid is the chemical chloroacetic acid, C2H3C1O2. It is a synthetic chemical not found in...

  11. 27 CFR 24.318 - Acid record.

    Code of Federal Regulations, 2011 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Acid record. 24.318... OF THE TREASURY LIQUORS WINE Records and Reports § 24.318 Acid record. A proprietor who adds acid to... use, the kind and quantity of acid used, the kinds and volume of juice or wine in which used,...

  12. 21 CFR 573.480 - Formic acid.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Formic acid. 573.480 Section 573.480 Food and... Listing § 573.480 Formic acid. The food additive, formic acid, may be safely used in accordance with the...) The top foot of silage stored should not contain formic acid and (2) Silage should not be fed...

  13. 27 CFR 24.318 - Acid record.

    Code of Federal Regulations, 2010 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Acid record. 24.318... OF THE TREASURY LIQUORS WINE Records and Reports § 24.318 Acid record. A proprietor who adds acid to... use, the kind and quantity of acid used, the kinds and volume of juice or wine in which used,...

  14. 27 CFR 24.318 - Acid record.

    Code of Federal Regulations, 2012 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Acid record. 24.318... OF THE TREASURY LIQUORS WINE Records and Reports § 24.318 Acid record. A proprietor who adds acid to... use, the kind and quantity of acid used, the kinds and volume of juice or wine in which used,...

  15. 21 CFR 184.1005 - Acetic acid.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Acetic acid. 184.1005 Section 184.1005 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DIRECT FOOD....1005 Acetic acid. (a) Acetic acid (C2H4O2, CAS Reg. No. 64-19-7) is known as ethanoic acid. It...

  16. 27 CFR 24.318 - Acid record.

    Code of Federal Regulations, 2014 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Acid record. 24.318... OF THE TREASURY ALCOHOL WINE Records and Reports § 24.318 Acid record. A proprietor who adds acid to... use, the kind and quantity of acid used, the kinds and volume of juice or wine in which used,...

  17. 21 CFR 172.130 - Dehydroacetic acid.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Dehydroacetic acid. 172.130 Section 172.130 Food... Food Preservatives § 172.130 Dehydroacetic acid. The food additive dehydroacetic acid and/or its sodium... meets the following specifications: Dehydroacetic acid: Melting point, 109 °C-111 °C; assay, minimum...

  18. 21 CFR 189.155 - Monochloroacetic acid.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Monochloroacetic acid. 189.155 Section 189.155... Prohibited From Direct Addition or Use as Human Food § 189.155 Monochloroacetic acid. (a) Monochloroacetic acid is the chemical chloroacetic acid, C2H3C1O2. It is a synthetic chemical not found in...

  19. 21 CFR 573.480 - Formic acid.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Formic acid. 573.480 Section 573.480 Food and... Listing § 573.480 Formic acid. The food additive, formic acid, may be safely used in accordance with the...) The top foot of silage stored should not contain formic acid and (2) Silage should not be fed...

  20. 21 CFR 189.155 - Monochloroacetic acid.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Monochloroacetic acid. 189.155 Section 189.155... Prohibited From Direct Addition or Use as Human Food § 189.155 Monochloroacetic acid. (a) Monochloroacetic acid is the chemical chloroacetic acid, C2H3C1O2. It is a synthetic chemical not found in...

  1. 21 CFR 172.130 - Dehydroacetic acid.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Dehydroacetic acid. 172.130 Section 172.130 Food... Food Preservatives § 172.130 Dehydroacetic acid. The food additive dehydroacetic acid and/or its sodium... meets the following specifications: Dehydroacetic acid: Melting point, 109 °C-111 °C; assay, minimum...

  2. 21 CFR 189.155 - Monochloroacetic acid.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Monochloroacetic acid. 189.155 Section 189.155... Prohibited From Direct Addition or Use as Human Food § 189.155 Monochloroacetic acid. (a) Monochloroacetic acid is the chemical chloroacetic acid, C2H3C1O2. It is a synthetic chemical not found in...

  3. 21 CFR 172.130 - Dehydroacetic acid.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Dehydroacetic acid. 172.130 Section 172.130 Food... Dehydroacetic acid. The food additive dehydroacetic acid and/or its sodium salt may be safely used in accordance...: Dehydroacetic acid: Melting point, 109 °C-111 °C; assay, minimum 98 percent (dry basis). Sodium salt...

  4. 21 CFR 172.130 - Dehydroacetic acid.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Dehydroacetic acid. 172.130 Section 172.130 Food... Food Preservatives § 172.130 Dehydroacetic acid. The food additive dehydroacetic acid and/or its sodium... meets the following specifications: Dehydroacetic acid: Melting point, 109 °C-111 °C; assay, minimum...

  5. 21 CFR 573.210 - Benzoic acid.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Benzoic acid. 573.210 Section 573.210 Food and... Listing § 573.210 Benzoic acid. The food additive, benzoic acid, may be safely used in the manufacture of... acid (CAS 65-85-0) by weight with the sum of 2-methylbiphenyl, 3-methylbiphenyl,...

  6. 21 CFR 172.130 - Dehydroacetic acid.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dehydroacetic acid. 172.130 Section 172.130 Food... Food Preservatives § 172.130 Dehydroacetic acid. The food additive dehydroacetic acid and/or its sodium... meets the following specifications: Dehydroacetic acid: Melting point, 109 °C-111 °C; assay, minimum...

  7. Synthesis of new polysialic acid derivatives.


    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke


    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  8. Nonprotein Amino Acids in the Murchison Meteorite

    PubMed Central

    Kvenvolden, Keith A.; Lawless, James G.; Ponnamperuma, Cyril


    Twelve nonprotein amino acids appear to be present in the Murchison meteorite. The identity of eight of them has been conclusively established as N-methylglycine, β-alanine, 2-methylalanine, α-amino-n-butyric acid, β-amino-n-butyric acid, γ-amino-n-butyric acid, isovaline, and pipecolic acid. Tentative evidence is presented for the presence of N-methylalanine, N-ethylglycine, β-aminoisobutyric acid, and norvaline. These amino acids appear to be extraterrestrial in origin and may provide new evidence for the hypothesis of chemical evolution. PMID:16591908

  9. Fusidic acid betamethasone lipid cream.


    Girolomoni, G; Mattina, R; Manfredini, S; Vertuani, S; Fabrizi, G


    Bacterial infections of the skin and soft tissues are frequent disorders. They can be primitive infections (e.g. impetigo, folliculitis) or secondary infections complicating other diseases, particularly atopic dermatitis. The most common aetiologic agent is Staphylococcus aureus. Topical antibiotic therapy may be sufficient in many instances to control these infections. Fusidic acid is an antibiotic used topically on the skin which is very active against S. aureus, including methicillin-resistant strains, and other Gram-positive bacteria. Resistance rates to fusidic acid are stably low. A fusidic acid and betamethasone formulation in a lipid-enriched cream (lipid cream) has been recently developed in order to provide effective antibacterial and anti-inflammatory activities in conjunction with a powerful emollient and moisturising effect. This preparation may be especially useful in patients with atopic-infected eczema. PMID:27121235

  10. [Circulating nucleic acids and infertility].


    Scalici, E; Mullet, T; Ferrières Hoa, A; Gala, A; Loup, V; Anahory, T; Belloc, S; Hamamah, S


    Circulating nucleic acids (cell-free DNA and microRNAs) have for particularity to be easily detectable in the biological fluids of the body. Therefore, they constitute biomarkers of interest in female and male infertility care. Indeed, in female, they can be used to detect ovarian reserve disorders (polycystic ovary syndrome and low functional ovarian reserve) as well as to assess follicular microenvironment quality. Moreover, in men, their expression levels can vary in case of spermatogenesis abnormalities. Finally, circulating nucleic acids have also the ability to predict successfully the quality of in vitro embryo development. Their multiple contributions during assisted reproductive technology (ART) make of them biomarkers of interest, for the development of new diagnostic and/or prognostic tests, applied to our specialty. Circulating nucleic acids would so offer the possibility of personalized medical care for infertile couples in ART. PMID:26298813

  11. Blood uric acid in executives

    PubMed Central

    Phoon, W. H.; Pincherle, G.


    Phoon, W. H., and Pincherle, G. (1972).Brit. J. industr. Med.,29, 334-337. Blood uric acid in executives. The mean blood uric acid in over 7000 male executives was found to be 5·96 mg/100 ml (standard deviation 1·12). This was significantly higher than the mean level (4·64 mg/100 ml) in 778 females from the same social background. The women showed a rise in mean level with age which was not found in the men. In the men, significant correlations were found with haemoglobin level, cholesterol level, electrocardiographic findings, relative weight, and stated alcohol consumption. These results and the importance of blood uric acid determinations in a screening programme are discussed. PMID:5044606

  12. (International conference on acidic deposition)

    SciTech Connect

    McLaughlin, S.B. Jr.


    The traveler took the opportunity to participate in a mini-sabbatical at the Institute of Terrestrial Ecology (ITE) in Edinburgh, Scotland, as a part of planned travel to Glasgow, Scotland, to attend the International Conference on Acidic Precipitation. The purpose of the sabbatical was to provide quality time for study and interchange of ideas with scientists at ITE working on physiological effects of acidic deposition and to allocate significant time for writing and synthesizing of results of physiological studies from the National Forest Response Program's Spruce/Fir Research Cooperative. The study focused on the very significant cytological and physiological effects of calcium deficiency in trees, a response that appears to be amplified in spruce by acidic deposition.

  13. Hydroxamic acids in asymmetric synthesis.


    Li, Zhi; Yamamoto, Hisashi


    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  14. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi


    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  15. Enrichment of decanoic acid in cuphea fatty acids via distillation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The introduction of a new crop often requires the development of new products and purification techniques of either the oil or fatty acids. Most new crops enter the cosmetic market first due to their high rates of returns. However, the cosmetic market often demands high purity and colorless materi...

  16. Acid Sulfate Alteration on Mars

    NASA Technical Reports Server (NTRS)

    Ming, D. W.; Morris, R. V.


    A variety of mineralogical and geochemical indicators for aqueous alteration on Mars have been identified by a combination of surface and orbital robotic missions, telescopic observations, characterization of Martian meteorites, and laboratory and terrestrial analog studies. Acid sulfate alteration has been identified at all three landing sites visited by NASA rover missions (Spirit, Opportunity, and Curiosity). Spirit landed in Gusev crater in 2004 and discovered Fe-sulfates and materials that have been extensively leached by acid sulfate solutions. Opportunity landing on the plains of Meridiani Planum also in 2004 where the rover encountered large abundances of jarosite and hematite in sedimentary rocks. Curiosity landed in Gale crater in 2012 and has characterized fluvial, deltaic, and lacustrine sediments. Jarosite and hematite were discovered in some of the lacustrine sediments. The high elemental abundance of sulfur in surface materials is obvious evidence that sulfate has played a major role in aqueous processes at all landing sites on Mars. The sulfate-rich outcrop at Meridiani Planum has an SO3 content of up to 25 wt.%. The interiors of rocks and outcrops on the Columbia Hills within Gusev crater have up to 8 wt.% SO3. Soils at both sites generally have between 5 to 14 wt.% SO3, and several soils in Gusev crater contain around 30 wt.% SO3. After normalization of major element compositions to a SO3-free basis, the bulk compositions of these materials are basaltic, with a few exceptions in Gusev crater and in lacustrine mudstones in Gale crater. These observations suggest that materials encountered by the rovers were derived from basaltic precursors by acid sulfate alteration under nearly isochemical conditions (i.e., minimal leaching). There are several cases, however, where acid sulfate alteration minerals (jarosite and hematite) formed in open hydrologic systems, e.g., in Gale crater lacustrine mudstones. Several hypotheses have been suggested for the

  17. Rigid separator lead acid batteries

    SciTech Connect

    Cannone, A.G.; Salkind, A.J.; Stempin, J.L.; Wexell, D.R.


    Lead acid cells assembled with extruded separators displayed relatively uniform capacity and voltage parameters through 100{sup +} cycles of charge/discharge. This contrasts to failure of control cells with glass mat separators after 60 cycles. The mullite/alumina separators with 50, 60, and 70% porosity separators appear suitable for both flooded and sealed lead acid cell applications. The advantages of the rigid ceramic separators over fiber mat materials are in the uniformity of capacity and voltage, the ease of cell assembly, and the probability that firm stacking pressure on the active material will yield greater cycle life, especially at elevated temperatures.

  18. Bipolar lead acid battery development

    NASA Technical Reports Server (NTRS)

    Eskra, Michael; Vidas, Robin; Miles, Ronald; Halpert, Gerald; Attia, Alan; Perrone, David


    A modular bipolar battery configuration is under development at Johnson Control, Inc. (JCI) and the Jet Propulsion Laboratory (JPL). The battery design, incorporating proven lead acid electrochemistry, yields a rechargeable, high-power source that is light weight and compact. This configuration offers advantages in power capability, weight, and volume over conventional monopolar batteries and other battery chemistries. The lead acid bipolar battery operates in a sealed, maintenance-free mode allowing for maximum application flexibility. It is ideal for high-voltage and high-power applications.

  19. High speed nucleic acid sequencing


    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu


    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

  20. Bipolar lead acid battery development

    NASA Astrophysics Data System (ADS)

    Eskra, Michael; Vidas, Robin; Miles, Ronald; Halpert, Gerald; Attia, Alan; Perrone, David

    A modular bipolar battery configuration is under development at Johnson Control, Inc. (JCI) and the Jet Propulsion Laboratory (JPL). The battery design, incorporating proven lead acid electrochemistry, yields a rechargeable, high-power source that is light weight and compact. This configuration offers advantages in power capability, weight, and volume over conventional monopolar batteries and other battery chemistries. The lead acid bipolar battery operates in a sealed, maintenance-free mode allowing for maximum application flexibility. It is ideal for high-voltage and high-power applications.

  1. Nucleic acids and molecular biology

    SciTech Connect

    Eckstein, F.; Lilley, D.M.J.


    Molecular biology has always been a discipline of rapid development. Despite this the authors are presently experiencing a period of unprecedented proliferation of information in nucleic acid studies and molecular biology. These areas are intimately interwoven, so that each influences the other to their mutual benefit. The rapid growth in information leads to ever-increasing specialization. The authors present the series Nucleic Acids and Molecular Biology. It comprises focused review articles by active researchers who report on the newest developments in their areas of particular interest.

  2. Acid rain and electricity conservation

    SciTech Connect

    Geller, H.; Miller, E.; Ledbetter, M.; Miller, P.


    Conservation directly lowers the emissions of SO/sub 2/ and other pollutants by reducing the amount of coal and other fuels that must be burned to meet electricity demand. This book is the first report to provide an integrated analysis of electricity supply, acid raid abatement, and conservation opportunities. The authors use a utility simulation model to examine SO/sub 2/ emissions, electric rates, and overall costs to consumers for different load growth and emissions control scenarios. The study also suggests how acid rain legislation can be designed to encourage electricity conservation.

  3. Gelled acidic well treating composition and process

    SciTech Connect

    Swanson, B.L.


    Gelled acidic compositions suitable for either matrix-acidizing or fracture-acidizing of subterranean formations comprising water , a water-dispersible polymer selected from cellulose ethers and polymers of acrylamides, an acid, an aldehyde, and a phenolic compound capable of causing gelation of an aqueous dispersion of the polymer, acid, aldehyde, and phenolic compound are provided. In another embodiment, guar gum, polyvinylpyrrolidone and biopolysaccharides can also be used as the polymeric component in said compositions.

  4. Identifying a base in a nucleic acid


    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua


    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  5. 21 CFR 186.1316 - Formic acid.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Formic acid. 186.1316 Section 186.1316 Food and... Substances Affirmed as GRAS § 186.1316 Formic acid. (a) Formic acid (CH2O2, CAS Reg. No. 64-18-6) is also referred to as methanoic acid or hydrogen carboxylic acid. It occurs naturally in some insects and...

  6. 21 CFR 186.1316 - Formic acid.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Formic acid. 186.1316 Section 186.1316 Food and....1316 Formic acid. (a) Formic acid (CH2O2, CAS Reg. No. 64-18-6) is also referred to as methanoic acid or hydrogen carboxylic acid. It occurs naturally in some insects and is contained in the free...

  7. 21 CFR 184.1069 - Malic acid.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Malic acid. 184.1069 Section 184.1069 Food and....1069 Malic acid. (a) Malic acid (C4H6O5, CAS Reg. No. of L-form 97-67-6, CAS Reg. No. of DL-form 617-48-1) is the common name for 1-hydroxy-1, 2-ethanedicarboxylic acid. L (+) malic acid, referred to as...

  8. 21 CFR 186.1316 - Formic acid.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Formic acid. 186.1316 Section 186.1316 Food and... Substances Affirmed as GRAS § 186.1316 Formic acid. (a) Formic acid (CH2O2, CAS Reg. No. 64-18-6) is also referred to as methanoic acid or hydrogen carboxylic acid. It occurs naturally in some insects and...

  9. 21 CFR 186.1316 - Formic acid.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Formic acid. 186.1316 Section 186.1316 Food and... Substances Affirmed as GRAS § 186.1316 Formic acid. (a) Formic acid (CH2O2, CAS Reg. No. 64-18-6) is also referred to as methanoic acid or hydrogen carboxylic acid. It occurs naturally in some insects and...

  10. 21 CFR 186.1316 - Formic acid.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Formic acid. 186.1316 Section 186.1316 Food and... Substances Affirmed as GRAS § 186.1316 Formic acid. (a) Formic acid (CH2O2, CAS Reg. No. 64-18-6) is also referred to as methanoic acid or hydrogen carboxylic acid. It occurs naturally in some insects and...

  11. Acid-functionalized polyolefin materials and their use in acid-promoted chemical reactions


    Oyola, Yatsandra; Tian, Chengcheng; Bauer, John Christopher; Dai, Sheng


    An acid-functionalized polyolefin material that can be used as an acid catalyst in a wide range of acid-promoted chemical reactions, wherein the acid-functionalized polyolefin material includes a polyolefin backbone on which acid groups are appended. Also described is a method for the preparation of the acid catalyst in which a precursor polyolefin is subjected to ionizing radiation (e.g., electron beam irradiation) of sufficient power and the irradiated precursor polyolefin reacted with at least one vinyl monomer having an acid group thereon. Further described is a method for conducting an acid-promoted chemical reaction, wherein an acid-reactive organic precursor is contacted in liquid form with a solid heterogeneous acid catalyst comprising a polyolefin backbone of at least 1 micron in one dimension and having carboxylic acid groups and either sulfonic acid or phosphoric acid groups appended thereto.

  12. Amino Acid Analyses of Acid Hydrolysates in Desert Varnish

    NASA Technical Reports Server (NTRS)

    Perry, Randall S.; Staley, James T.; Dworkin, Jason P.; Engel, Mike


    There has long been a debate as to whether rock varnish deposits are microbially mediated or are deposited by inorganic processes. Varnished rocks are found throughout the world primarily in arid and semi-arid regions. The varnish coats are typically up to 200 microns thick and are composed of clays and alternating layers enriched in manganese and iron oxides. The individual layers range in thickness from 1 micron to greater than 10 microns and may continue laterally for more than a 100 microns. Overlapping botryoidal structures are visible in thin section and scanning electron micrographs. The coatings also include small amounts of organic mater and detrital grains. Amino-acid hydrolysates offer a means of assessing the organic composition of rock varnish collected from the Sonoran Desert, near Phoenix, AZ. Chromatographic analyses of hydrolysates from powdered samples of rock varnish suggest that the interior of rock varnish is relatively enriched in amino acids and specifically in d-alanine and glutamic acid. Peptidoglycan (murein) is the main structural component of gram-positive bacterial cell walls. The d-enantiomer of alanine and glutamic acid are specific to peptidoglycan and are consequently an indicator for the presence of bacteria. D-alanine is also found in teichoic acid which is only found in gram-positive bacteria. Several researchers have cultured bacteria from the surface of rock varnish and most have been gram-positive, suggesting that gram-positive bacteria are intimately associated with varnish coatings and may play a role in the formation of varnish coatings.

  13. Citric Acid Passivation of Stainless Steel

    NASA Technical Reports Server (NTRS)

    Yasensky, David; Reali, John; Larson, Chris; Carl, Chad


    Passivation is a process for cleaning and providing corrosion protection for stainless steel. Currently, on Kennedy Space Center (KSC), only parts passivated with nitric acid are acceptable for use. KSC disposes of approximately 125gal of concentrated nitric acid per year, and receives many parts from vendors who must also dispose of used nitric acid. Unfortunately, nitric acid presents health and environmental hazards. As a result, several recent industry studies have examined citric acid as an alternative. Implementing a citric acid-based passivation procedure would improve the health and environmental safety aspects of passivation process. However although there is a lack of published studies that conclusively prove citric acid is a technically sound passivation agent. In 2007, NASA's KSC Materials Advisory Working Group requested the evaluation of citric acid in place of nitric acid for passivation of parts at KSC. United Space Alliance Materials & Processes engineers have developed a three-phase test plan to evaluate citric acid as an alternative to nitric acid on three stainless steels commonly used at KSC: UNS S30400, S41000, and S17400. Phases 1 and 2 will produce an optimized citric acid treatment based on results from atmospheric exposure at NASA's Beach Corrosion Facility. Phase 3 will compare the optimized solution(s) with nitric acid treatments. If the results indicate that citric acid passivates as well or better than nitric acid, NASA intends to approve this method for parts used at the Kennedy Space Center.

  14. [Alpha-linolenic acid and cardiovascular diseases].


    Ristić-Medić, Danijela; Ristić, Gordana; Tepsić, Vesna


    IMPORTANCE AND METABOLISM OF ALPHA-LINOLENIC ACID: Alpha-linolenic acid is an essential fatty acid which cannot be produced in the body and must be taken by food. Both in animals and humans, alpha-linolenic acid is desaturated and elongated into eicosapentaenoic and docosahexaenoic acid. It is also incorporated into plasma and tissue lipids and its conversion is affected by levels of linoleic acid. POTENTIAL ROLE IN PATHOGENESIS OF CARDIOVASCULAR DISEASES: Diet enriched in n-3 fatty acids, especially alpha-linolenic acid, reduces the incidence of cardiac death. Studies have shown that alpha linolenic acid prevents ventricular fibrillation which is the main cause of cardiac death. Studies in rats suggest that alpha-linolenic acid may be more effective in preventing ventricular fibrillations than eicosapentaenoic and docosahexaenoic acid. Furthermore, alpha-linolenic acid is the main fatty acid decreasing platalet aggregation which is an important step in thrombosis i.e. non-fatal myocardial infarction and stroke. DIETARY SOURCES AND NUTRITION RECOMMENDATIONS: Dietary sources include flaxseed and flaxseed oil, canola oil, soybean and soybean oil, pumpkin seed and pumpkin oil, walnuts and walnut oil. Strong evidence supports beneficial effects of alpha-linolenic acid and its dietary sources should be incorporated into balanced diet for prevention of cardiovascular diseases. The recommended daily intake is 2 g with a ratio of 5/1 for linoleic/alpha-linolenic acid. PMID:15510909

  15. Acid Rain: What It Is -- How You Can Help!

    ERIC Educational Resources Information Center

    National Wildlife Federation, Washington, DC.

    This publication discusses the nature and consequences of acid precipitation (commonly called acid rain). Topic areas include: (1) the chemical nature of acid rain; (2) sources of acid rain; (3) geographic areas where acid rain is a problem; (4) effects of acid rain on lakes; (5) effect of acid rain on vegetation; (6) possible effects of acid rain…

  16. Acid deposition in Maryland: Implications of the results of the National Acid Precipitation Assessment Program

    SciTech Connect

    DeMuro, J.; Bowmann, M.; Ross, J.; Blundell, C.; Price, R.


    Acid deposition, commonly referred to as 'acid rain,' is a major global environmental concern. Acid deposition has reportedly resulted in damage to aquatic, terrestrial, and physical resources and has potentially adverse effects on human health. A component of the Maryland acid deposition program is the preparation of an annual report that summarizes yearly activities and costs of ongoing acid deposition research and monitoring programs.

  17. 5-Caffeoylquinic acid and caffeic acid orally administered suppresses P-selectin expression on mouse platelets

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Caffeic acid and 5-caffeoylquinic acid are a naturally occurring phenolic acid and its ester found in human diets. In this paper, potential effects of caffeic acid and 5-caffeoylquinic acid found in coffee and other plant sources on platelet activation were studied via investigating P-selectin expre...

  18. Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants


    Ohlrogge, J.B.; Cahoon, E.B.; Shanklin, J.; Somerville, C.R.


    The present invention relates to a process for producing lipids containing the fatty acid, petroselinic acid, in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a {omega}12 desaturase from another species which does normally accumulate petroselinic acid. 19 figs.

  19. 40 CFR 721.2086 - Coco acid triamine condensate, polycarboxylic acid salts.

    Code of Federal Regulations, 2010 CFR


    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Coco acid triamine condensate... Specific Chemical Substances § 721.2086 Coco acid triamine condensate, polycarboxylic acid salts. (a... coco acid triamine condensate, poly-car-box-ylic acid salts. (PMN P-92-446) is subject to...

  20. 40 CFR 721.2086 - Coco acid triamine condensate, polycarboxylic acid salts.

    Code of Federal Regulations, 2011 CFR


    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Coco acid triamine condensate... Specific Chemical Substances § 721.2086 Coco acid triamine condensate, polycarboxylic acid salts. (a... coco acid triamine condensate, poly-car-box-ylic acid salts. (PMN P-92-446) is subject to...

  1. 21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Fumaric acid and salts of fumaric acid. 172.350... HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.350 Fumaric acid and salts of fumaric acid. Fumaric acid and its calcium, ferrous, magnesium, potassium, and sodium salts may be safely...

  2. 46 CFR 151.50-77 - Fluorosilicic acid (30% or less) (hydrofluorosilicic acid).

    Code of Federal Regulations, 2011 CFR


    ... 46 Shipping 5 2011-10-01 2011-10-01 false Fluorosilicic acid (30% or less) (hydrofluorosilicic acid). 151.50-77 Section 151.50-77 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... § 151.50-77 Fluorosilicic acid (30% or less) (hydrofluorosilicic acid). (a) Hydrofluorosilicic acid...

  3. 21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Fumaric acid and salts of fumaric acid. 172.350... HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.350 Fumaric acid and salts of fumaric acid. Fumaric acid and its calcium, ferrous, magnesium, potassium, and sodium salts may be safely...

  4. 46 CFR 151.50-77 - Fluorosilicic acid (30% or less) (hydrofluorosilicic acid).

    Code of Federal Regulations, 2014 CFR


    ... 46 Shipping 5 2014-10-01 2014-10-01 false Fluorosilicic acid (30% or less) (hydrofluorosilicic acid). 151.50-77 Section 151.50-77 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... § 151.50-77 Fluorosilicic acid (30% or less) (hydrofluorosilicic acid). (a) Hydrofluorosilicic acid...

  5. 46 CFR 151.50-77 - Fluorosilicic acid (30% or less) (hydrofluorosilicic acid).

    Code of Federal Regulations, 2012 CFR


    ... 46 Shipping 5 2012-10-01 2012-10-01 false Fluorosilicic acid (30% or less) (hydrofluorosilicic acid). 151.50-77 Section 151.50-77 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... § 151.50-77 Fluorosilicic acid (30% or less) (hydrofluorosilicic acid). (a) Hydrofluorosilicic acid...

  6. 21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Fumaric acid and salts of fumaric acid. 172.350... HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.350 Fumaric acid and salts of fumaric acid. Fumaric acid and its calcium, ferrous, magnesium, potassium, and sodium salts may be safely...

  7. Erythrocyte stearidonic acid and other n-3 fatty acids and CHD in the Physicians’ Health Study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Intake of marine-based n-3 fatty acids (EPA, docosapentaenoic acid and DHA) is recommended to prevent CHD. Stearidonic acid (SDA), a plant-based n-3 fatty acid, is a precursor of EPA and may be more readily converted to EPA than a-linolenic acid (ALA). While transgenic soyabeans might supply SDA at ...

  8. Structure of aldobiouronic acid and glucuronic acid from Agathis australis degraded gum polysaccharide.


    Singh, R B


    Agathis australis gum on acid hydrolysis with sulphuric acid yielded L-arabinose and D-galactose in 1:4 molar ratio with traces of L-fucose. The components of aldobiouronic acid and glucuronic acid were obtained by graded hydrolysis of degraded gum polysaccharide. The derivatives of aldobiouronic acid was obtained as methyl ester methyl glycoside. PMID:17915743

  9. Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants


    Ohlrogge, John B.; Cahoon, Edgar B.; Shanklin, John; Somerville, Christopher R.


    The present invention relates to a process for producing lipids containing the fatty acid petroselinic acid in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a .omega.12 desaturase from another species which does normally accumulate petroselinic acid.

  10. Method of increasing conversion of a fatty acid to its corresponding dicarboxylic acid


    Craft, David L.; Wilson, C. Ron; Eirich, Dudley; Zhang, Yeyan


    A nucleic acid sequence including a CYP promoter operably linked to nucleic acid encoding a heterologous protein is provided to increase transcription of the nucleic acid. Expression vectors and host cells containing the nucleic acid sequence are also provided. The methods and compositions described herein are especially useful in the production of polycarboxylic acids by yeast cells.

  11. Fatty acid profile of Albizia lebbeck and Albizia saman seed oils: Presence of coronaric acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this work, the fatty acid profiles of the seed oils of Albizia lebbeck and Albizia saman (Samanea saman) are reported. The oils were analyzed by GC, GC-MS, and NMR. The most prominent fatty acid in both oils is linoleic acid (30-40%), followed by palmitic acid and oleic acid for A. lebbeck and ol...

  12. Acid evaporation property in chemically amplified resists

    NASA Astrophysics Data System (ADS)

    Hashimoto, Shuichi; Itani, Toshiro; Yoshino, Hiroshi; Yamana, Mitsuharu; Samoto, Norihiko; Kasama, Kunihiko


    The lithographic performance of a chemically amplified resist system very much depends on the photo-generated acid structure. In a previous paper, we reported the molecular structure dependence of two typical photo-generated acids (aromatic sulfonic acid and alkyl sulfonic acid) from the viewpoints of lithographic performance and acid characteristics such as acid generation efficiency, acid diffusion behavior and acid evaporation property. In this paper, we evaluate the effect of the remaining solvent in a resist film on the acid evaporation property. Four types of two-component chemically amplified positive KrF resists were prepared consisting of tert-butoxycarbonyl (t-BOC) protected polyhydroxystyrene and sulfonic acid derivative photo-acid generator (PAG). Here, a different combination of two types of PAGs [2,4-dimethylbenzenesulfonic acid (aromatic sulfonic acid) derivative PAG and cyclohexanesulfonic acid (alkyl sulfonic acid) derivative PAG] and two types of solvents (propylene glycol monomethyl ether acetate; PGMEA and ethyl lactate; EL) were evaluated. The aromatic sulfonic acid was able to evaporate easily during post exposure bake (PEB) treatment, but the alkyl sulfonic acid was not. The higher evaporation property of aromatic sulfonic acid might be due to the higher vapor pressure and the longer acid diffusion length. Furthermore, the amount of aromatic sulfonic acid in the PGMEA resist was reduced by more than that in the EL resist. The amount of acid loss also became smaller at a higher prebake temperature. The concentration of the remaining solvent in the resist film decreased with the increasing prebake temperature. We think that the acid evaporation property was affected by the remaining solvent in the resist, film; the large amount of remaining solvent promoted the acid diffusion and eventually accelerated the acid evaporation from the resist film surface in the PGMEA resist. In summary, the acid evaporation property depends on both the acid

  13. Process for forming sulfuric acid


    Lu, Wen-Tong P.


    An improved electrode is disclosed for the anode in a sulfur cycle hydrogen generation process where sulfur dioxie is oxidized to form sulfuric acid at the anode. The active compound in the electrode is palladium, palladium oxide, an alloy of palladium, or a mixture thereof. The active compound may be deposited on a porous, stable, conductive substrate.

  14. Getting folic acid nutrition right

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The two articles in this issue of the journal provide some definitive answers to questions relating to folic acid exposure and folate nutritional status of the US population in the post-fortification era, and, by implication, pose other questions. Most convincingly, these reports, which are based la...

  15. Dietary fatty acids and minerals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Accumulating evidence in animals and humans shows that dietary fatty acids influence the absorption and utilization of certain mineral elements. Fat intake exceeding 10% of energy intake reduces calcium uptake and use by the body, and this effect is more pronounced with saturated compared to unsatu...


    EPA Science Inventory

    Trichloroacetic acid (TCA)is a by-product of the chlorine disinfection of water containing natural organic material. It is detectable finished drinking water at levels comparable to the trihalomethanes (30-60). TCA is also formed in vivo after ingestion of hypochlorite and has be...

  17. An assessment of acid fog

    SciTech Connect

    Lipfert, F.W.


    Airborne particles have long been associated with adverse effects on public health, begin with the notorious air pollution disasters of several decades ago. Although H{sub 2}SO{sub 4} was identified early on as a potential causal factors during these episodes (in part because of concern for potential health effects of particle acidity per se has intensified only recently. Most of the recent aerometric research in the US on acid fog has focused on the ability of clouds and fog to deliver acidity to vegetation and ecosystems. Strong acids are characterized chemically by their pH or H{sup +} concentration. For fog, concentrations are referred to the droplet liquid content; for other (i.e., ``clear air``) aerosols, to the volume of air sampled. A useful measure of the relationship between aerosol and fog is obtained by comparing their mass concentrations on the basis of the same volume of air, by multiplying fogwater concentrations by liquid water content (LWC). This paper reviews fog measurement capability, physical properties and chemistry, and presents a simple urban airshed model which is used to simulate the evolution of fog and aerosol concentrations under urban stagnation conditions.

  18. Hyaluronic acid and tendon lesions

    PubMed Central

    Kaux, Jean-François; Samson, Antoine; Crielaard, Jean-Michel


    Summary Introduction recently, the viscoelastic properties of hyaluronic acid (HA) on liquid connective tissue have been proposed for the treatment of tendinopathies. Some fundamental studies show encouraging results on hyaluronic acid’s ability to promote tendon gliding and reduce adhesion as well as to improve tendon architectural organisation. Some observations also support its use in a clinical setting to improve pain and function. This literature review analyses studies relating to the use of hyaluronic acid in the treatment of tendinopathies. Methods this review was constructed using the Medline database via Pubmed, Scopus and Google Scholar. The key words hyaluronic acid, tendon and tendinopathy were used for the research. Results in total, 28 articles (in English and French) on the application of hyaluronic acid to tendons were selected for their relevance and scientific quality, including 13 for the in vitro part, 7 for the in vivo animal part and 8 for the human section. Conclusions preclinical studies demonstrate encouraging results: HA permits tendon gliding, reduces adhesions, creates better tendon architectural organisation and limits inflammation. These laboratory observations appear to be supported by limited but encouraging short-term clinical results on pain and function. However, controlled randomised studies are still needed. PMID:26958533

  19. Toxicological Characterization of Phthalic Acid

    PubMed Central

    Bang, Du Yeon; Lee, In Kyung


    There has been growing concern about the toxicity of phthalate esters. Phthalate esters are being used widely for the production of perfume, nail varnish, hairsprays and other personal/cosmetic uses. Recently, exposure to phthalates has been assessed by analyzing urine for their metabolites. The parent phthalate is rapidly metabolized to its monoester (the active metabolite) and also glucuronidated, then excreted. The objective of this study is to evaluate the toxicity of phthalic acid (PA), which is the final common metabolic form of phthalic acid esters (PAEs). The individual PA isomers are extensively employed in the synthesis of synthetic agents, for example isophthalic acid (IPA), and terephthalic acid (TPA), which have very broad applications in the preparation of phthalate ester plasticizers and components of polyester fiber, film and fabricated items. There is a broad potential for exposure by industrial workers during the manufacturing process and by the general public (via vehicle exhausts, consumer products, etc). This review suggests that PA shows in vitro and in vivo toxicity (mutagenicity, developmental toxicity, reproductive toxicity, etc.). In addition, PA seems to be a useful biomarker for multiple exposure to PAEs in humans. PMID:24278572

  20. Deoxyribonucleic acid in Nitrobacter carboxysomes.

    PubMed Central

    Westphal, K; Bock, E; Cannon, G; Shively, J M


    Carboxysomes were isolated from Nitrobacter winogradskyi and Nitrobacter agilis. The icosahedral particles contained double-stranded deoxyribonucleic acid (DNA). In the presence of ethidium bromide and cesium chloride, the particle-bound DNA had a buoyant density of rho 25 = 1.701 g/cm3. Electron microscopy revealed the DNA to be a 14-micron circular molecule. Images PMID:227833