Science.gov

Sample records for 30-day postoperative pause

  1. Post-operative delirium is an independent predictor of 30-day hospital readmission after spine surgery in the elderly (≥65years old): A study of 453 consecutive elderly spine surgery patients.

    PubMed

    Elsamadicy, Aladine A; Wang, Timothy Y; Back, Adam G; Lydon, Emily; Reddy, Gireesh B; Karikari, Isaac O; Gottfried, Oren N

    2017-03-02

    In the last decade, costs of U.S. healthcare expenditures have been soaring, with billions of dollars spent on hospital readmissions. Identifying causes and risk factors can reduce soaring readmission rates and help lower healthcare costs. The aim of this is to determine if post-operative delirium in the elderly is an independent risk factor for 30-day hospital readmission after spine surgery. The medical records of 453 consecutive elderly (≥65years old) patients undergoing spine surgery at Duke University Medical Center from 2008 to 2010 were reviewed. We identified 17 (3.75%) patients who experienced post-operative delirium according to DSM-V criteria. Patient demographics, comorbidities, and post-operative complication rates were collected for each patient. Elderly patients experiencing post-operative delirium had an increased length of hospital stay (10.47days vs. 5.70days, p=0.009). Complication rates were similar between the cohorts with the post-operative delirium patients having increased UTI and superficial surgical site infections. In total, 12.14% of patients were re-admitted within 30-days of discharge, with post-operative delirium patients experiencing approximately a 4-fold increase in 30-day readmission rates (Delirium: 41.18% vs. No Delirium: 11.01%, p=0.002). In a multivariate logistic regression analysis, post-operative delirium is an independent predictor of 30-day readmission after spine surgery in the elderly (p=0.03). Elderly patients experiencing post-operative delirium after spine surgery is an independent risk factor for unplanned readmission within 30-days of discharge. Preventable measures and early awareness of post-operative delirium in the elderly may help reduce readmission rates.

  2. Ares I-X 30 Day Report

    NASA Technical Reports Server (NTRS)

    Ess, Bob; Smith, Marshall

    2009-01-01

    This slide presentation represents the 30 day report on the Ares I-X test flight. Included in the review is information on the following areas: (1) Ground Systems, (2) Guidance, Navigation and Control, (3) Roll Response, (4) Vehicle Response, (5) Control System Performance, (6) Structural Damping, (7) Thrust Oscillation, (8) Stage Separation, (9) Connector Assessment, (10) USS Splashdown, (11) Data Recorder and (12) FS Hardware Assessment.

  3. Advancing Age and 30-Day Adverse Outcomes Following Non-Emergent General Surgical Operations

    PubMed Central

    Gajdos, Csaba; Kile, Deidre; Hawn, Mary T.; Finlayson, Emily; Henderson, William G.; Robinson, Thomas N.

    2014-01-01

    Background While some single center studies have demonstrated that major surgical operations are safe to perform in older adults, most multicenter database studies find advancing age to independently predict adverse postoperative outcomes. We hypothesized that thirty-day postoperative mortality, complications, failure to rescue rates and postoperative length of stay will increase with advancing age. Design Retrospective cohort study. Setting Hospitals participating in the American College of Surgeons National Surgical Quality Improvement Program (ACS-NSQIP) Participants Patients undergoing non-emergent major general surgical operations between 2005 and 2008 were studied. Measures Postoperative outcomes of interest were complications occurring within 30 days of the index operation, return to OR within 30 days, failure to rescue after a postoperative complication, post-surgical length of stay and 30 day mortality. Results A total of 165,600 patients were studied. The rates of postoperative mortality, overall morbidity, and each type of postoperative complication increased as age increased. The rates of failure to rescue after each type of postoperative complication also increased with age. Mortality rates in patients ≥80 following renal insufficiency (43.3%), stroke (36.5%), myocardial infarction (35.6%), and pulmonary complications (25-39%) were particularly high. Median postoperative length of stay increased with age following surgical site infection, UTI, pneumonia, return to OR, and overall morbidity, but not after venous thromboembolism, stroke, myocardial infarction, renal insufficiency, failure to wean from the ventilator or reintubations. Conclusion Thirty-day mortality, complications and failure to rescue rates increase with advancing age following non-emergent general surgical operations. Patients over 80 years of age have especially high mortality following renal, cardiovascular, and pulmonary complications. As patient age advances, surgeons need to be

  4. Morbidity associated with 30-day surgical site infection following nonshunt pediatric neurosurgery.

    PubMed

    Sherrod, Brandon A; Rocque, Brandon G

    2017-04-01

    OBJECTIVE Morbidity associated with surgical site infection (SSI) following nonshunt pediatric neurosurgical procedures is poorly understood. The purpose of this study was to analyze acute morbidity and mortality associated with SSI after nonshunt pediatric neurosurgery using a nationwide cohort. METHODS The authors reviewed data from the American College of Surgeons National Surgical Quality Improvement Program-Pediatric (NSQIP-P) 2012-2014 database, including all neurosurgical procedures performed on pediatric patients. Procedures were categorized by Current Procedural Terminology (CPT) codes. CSF shunts were excluded. Deep and superficial SSIs occurring within 30 days of an index procedure were identified. Deep SSIs included deep wound infections, intracranial abscesses, meningitis, osteomyelitis, and ventriculitis. The following outcomes occurring within 30 days of an index procedure were analyzed, along with postoperative time to complication development: sepsis, wound disruption, length of postoperative stay, readmission, reoperation, and death. RESULTS A total of 251 procedures associated with a 30-day SSI were identified (2.7% of 9296 procedures). Superficial SSIs were more common than deep SSIs (57.4% versus 42.6%). Deep SSIs occurred more frequently after epilepsy or intracranial tumor procedures. Superficial SSIs occurred more frequently after skin lesion, spine, Chiari decompression, craniofacial, and myelomeningocele closure procedures. The mean (± SD) postoperative length of stay for patients with any SSI was 9.6 ± 14.8 days (median 4 days). Post-SSI outcomes significantly associated with previous SSI included wound disruption (12.4%), sepsis (15.5%), readmission (36.7%), and reoperation (43.4%) (p < 0.001 for each). Post-SSI sepsis rates (6.3% vs 28.0% for superficial versus deep SSI, respectively; p < 0.001), wound disruption rates (4.9% vs 22.4%, p < 0.001), and reoperation rates (23.6% vs 70.1%, p < 0.001) were significantly greater for patients

  5. Perception of Silent Pauses in Continuous Speech.

    ERIC Educational Resources Information Center

    Duez, Danielle

    1985-01-01

    Investigates the silent pauses in continuous speech in three genres: political speeches, political interviews, and casual interviews in order to see how the semantic-syntactic information of the message, the duration of silent pauses, and the acoustic environment of these pauses interact to produce the listener's perception of pauses. (Author/SED)

  6. 78 FR 29147 - 30-Day Notice and Request for Comments

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-17

    ... SECURITY United States Secret Service 30-Day Notice and Request for Comments SUMMARY: The Department of... United States Secret Service, Department of Homeland Security, and sent via electronic mail to oira... additional information or copies of the form(s) and instructions should be directed to: United States...

  7. 78 FR 18373 - Paperwork Reduction Act; 30-Day Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-26

    ... CONTROL POLICY Paperwork Reduction Act; 30-Day Notice AGENCY: Office of National Drug Control Policy. ] The Office of National Drug Control Policy (ONDCP) proposes the collection of information concerning... of the President, Office of National Drug Control Policy, Research & Data Analysis, Washington,...

  8. 75 FR 160 - Paperwork Reduction Act; 30-Day Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-04

    ... [Federal Register Volume 75, Number 1 (Monday, January 4, 2010)] [Notices] [Page 160] [FR Doc No: E9-31132] OFFICE OF NATIONAL DRUG CONTROL POLICY Paperwork Reduction Act; 30-Day Notice AGENCY: Office of National Drug Control Policy. The Office of National Drug Control Policy (ONDCP) proposes...

  9. Worse Prognosis in Heart Failure Patients with 30-Day Readmission

    PubMed Central

    Tung, Ying-Chang; Chou, Shing-Hsien; Liu, Kuan-Liang; Hsieh, I-Chang; Wu, Lung-Sheng; Lin, Chia-Pin; Wen, Ming-Shien; Chu, Pao-Hsien

    2016-01-01

    Background Heart failure (HF) readmission results in substantial expenditure on HF management. This study aimed to evaluate the readmission rate, outcome, and predictors of HF readmission. Methods Patients with reduced left ventricular ejection fraction (LVEF < 40%) who were admitted for acute decompensation of de novo HF were enrolled to analyze readmission rate, mortality and predictors of readmission. Results A total of 433 de novo HF patients with LVEF < 40% were enrolled during the period August 2013 to December 2014. The in-hospital and 6-month mortality rates were 3.9% and 15.2%, respectively. In those patients surviving the index HF hospitalization, the 30-day and 6-month readmission rates were 10.9% and 27%, respectively. At the end of the 6-month follow-up, the readmission group had higher mortality than the non-readmission group (27.66% vs. 10.36%; p = 0.001). The survivors of the 30-day readmission had similar mortality rates at 6 months, regardless of the cause of readmission (cardiovascular vs. non-cardiovascular: 25% vs. 30.43%, p = 0.677). Among all the parameters, prescription of beta blockers independently reduced the risk of 30-day readmission (odds ratio 0.15; 95% confidence interval 0.02-0.99; p = 0.049). Conclusions Those HF patients who suffered from 30-day readmission had worse prognosis at the 6-month follow-up. Regardless of the readmission causes, the patients surviving the 30-day readmission had similar mortality rates at 6-month follow-up. These results underscored the importance of reducing readmission as a means to improve HF outcome. PMID:27899857

  10. Risk Factors and Indications for 30-Day Readmission After Primary Surgery for Epithelial Ovarian Cancer

    PubMed Central

    AlHilli, Mariam; Langstraat, Carrie; Tran, Christine; Martin, Janice; Weaver, Amy; McGree, Michaela; Mariani, Andrea; Cliby, William; Bakkum-Gamez, Jamie

    2015-01-01

    Background To identify patients at risk for postoperative morbidities, we evaluated indications and factors associated with 30-day readmission after epithelial ovarian cancer surgery. Methods Patients undergoing primary surgery for epithelial ovarian cancer between January 2, 2003, and December 29, 2008, were evaluated. Univariable and multivariable logistic regression models were fit to identify factors associated with 30-day readmission. A parsimonious multivariable model was identified using backward and stepwise variable selection. Results In total, 324 (60.2%) patients were stage III and 91 (16.9%) were stage IV. Of all 538 eligible patients, 104 (19.3%) were readmitted within 30 days. Cytoreduction to no residual disease was achieved in 300 (55.8%) patients, and 167 (31.0%) had measurable disease (≤1 cm residual disease). The most common indications for readmission were surgical site infection (SSI; 21.2%), pleural effusion/ascites management (14.4%), and thromboembolic events (12.5%). Multivariate analysis identified American Society of Anesthesiologists score of 3 or higher (odds ratio, 1.85; 95% confidence interval, 1.18–2.89; P = 0.007), ascites [1.76 (1.11–2.81); P = 0.02], and postoperative complications during initial admission [grade 3–5 vs none, 2.47 (1.19–5.16); grade 1 vs none, 2.19 (0.98–4.85); grade 2 vs none, 1.28 (0.74–2.21); P = 0.048] to be independently associated with 30-day readmission (c-index = 0.625). Chronic obstructive pulmonary disease was the sole predictor of readmission for SSI (odds ratio, 3.92; 95% confidence interval, 1.07–4.33; P = 0.04). Conclusions Clinically significant risk factors for 30-day readmission include American Society of Anesthesiologists score of 3 or higher, ascites and postoperative complications at initial admission. The SSI and pleural effusions/ascites are common indications for readmission. Systems can be developed to predict patients needing outpatient management, improve care, and reduce

  11. Discharge to a rehabilitation facility is associated with decreased 30-day readmission in elective spinal surgery.

    PubMed

    Abt, Nicholas B; McCutcheon, Brandon A; Kerezoudis, Panagiotis; Murphy, Meghan; Rinaldo, Lorenzo; Fogelson, Jeremy; Nassr, Ahmad; Currier, Bradford L; Bydon, Mohamad

    2017-02-01

    The aim of our study was to determine independent predictors of discharge disposition to rehabilitation or skilled care (SC) facilities and investigate whether discharge location is associated with unplanned readmission and/or reoperation rates. All elective spinal surgery patients in a national surgical registry were analyzed using between 2011 and 2012. Multivariable logistic regression analysis was used to assess for predictors of discharge to rehabilitation or SC facilities versus home as well as to determine whether discharge disposition was significantly associated with the 30-day unplanned readmission or reoperation. Of 34,023 elective spinal surgery patients, the distribution of discharge locations was as follows: 30,606 (90.0%) discharged home, 1674 (4.9%) discharged to rehabilitation, and 1743 (5.1%) discharged to SC. Patients discharged home were associated with the lowest complication rate relative to rehabilitation and SC facilities. Following multivariable regression analysis, there was a significant increase in the odds of discharge to rehabilitation associated with age, male gender, current smoking, ASA class three and four, history of diabetes, operative time, total hospital length of stay, preoperative neurologic morbidity and having at least one postoperative morbidity event. Moreover, there were 804 (4.06%) 30-day unplanned readmissions and 822 (2.45%) unplanned reoperations. After risk adjustment, discharge to rehabilitation was independently associated with decreased odds of 30-day unplanned readmission (OR=0.41; p=0.008) but not reoperation.

  12. Nursing Home Medical Staff Organization and 30-Day Rehospitalizations

    PubMed Central

    Lima, Julie C.; Intrator, Orna; Karuza, Jurgis; Wetle, Terrie; Mor, Vincent; Katz, Paul

    2013-01-01

    Objectives To examine the relationship between features of nursing home (NH) medical staff organization and residents’ 30-day rehospitalizations. Design Cross-sectional study combining primary data collected from a survey of medical directors, NH resident assessment data (minimum data set), Medicare claims, and the Online Survey Certification and Reporting (OSCAR) database. Setting A total of 202 freestanding US nursing homes. Participants Medicare fee-for-service beneficiaries who were hospitalized and subsequently admitted to a study nursing home. Measurements Medical staff organization dimensions derived from the survey, NH residents’ characteristics derived from minimum data set data, hospitalizations obtained from Part A Medicare claims, and NH characteristics from the OSCAR database and from www.ltcfocus.org. Study outcome defined within a 30-day window following an index hospitalization: rehospitalized, otherwise died, otherwise survived and not rehospitalized. Results Thirty-day rehospitalizations occurred for 3788 (20.3%) of the 18,680 initial hospitalizations. Death was observed for 884 (4.7%) of residents who were not rehospitalized. Adjusted by hospitalization, resident, and NH characteristics, nursing homes having a more formal appointment process for physicians were less likely to have 30-day rehospitalization (b = −0.43, SE = 0.17), whereas NHs in which a higher proportion of residents were cared for by a single physician were more likely to have rehospitalizations (b = 0.18, SE = 0.08). Conclusion This is the first study to show a direct relationship between features of NH medical staff organization and resident-level process of care. The relationship of a more strict appointment process and rehospitalizations might be a consequence of more formalized and dedicated medical practice with a sense of ownership and accountability. A higher volume of patients per physician does not appear to improve quality of care. PMID:22682694

  13. Vitamin D Status Predicts 30 Day Mortality in Hospitalised Cats

    PubMed Central

    Titmarsh, Helen; Kilpatrick, Scott; Sinclair, Jennifer; Boag, Alisdair; Bode, Elizabeth F.; Lalor, Stephanie M.; Gaylor, Donna; Berry, Jacqueline; Bommer, Nicholas X.; Gunn-Moore, Danielle; Reed, Nikki; Handel, Ian; Mellanby, Richard J.

    2015-01-01

    Vitamin D insufficiency, defined as low serum concentrations of the major circulating form of vitamin D, 25 hydroxyvitamin D (25(OH)D), has been associated with the development of numerous infectious, inflammatory, and neoplastic disorders in humans. In addition, vitamin D insufficiency has been found to be predictive of mortality for many disorders. However, interpretation of human studies is difficult since vitamin D status is influenced by many factors, including diet, season, latitude, and exposure to UV radiation. In contrast, domesticated cats do not produce vitamin D cutaneously, and most cats are fed a commercial diet containing a relatively standard amount of vitamin D. Consequently, domesticated cats are an attractive model system in which to examine the relationship between serum 25(OH)D and health outcomes. The hypothesis of this study was that vitamin D status would predict short term, all-cause mortality in domesticated cats. Serum concentrations of 25(OH)D, together with a wide range of other clinical, hematological, and biochemical parameters, were measured in 99 consecutively hospitalised cats. Cats which died within 30 days of initial assessment had significantly lower serum 25(OH)D concentrations than cats which survived. In a linear regression model including 12 clinical variables, serum 25(OH)D concentration in the lower tertile was significantly predictive of mortality. The odds ratio of mortality within 30 days was 8.27 (95% confidence interval 2.54-31.52) for cats with a serum 25(OH)D concentration in the lower tertile. In conclusion, this study demonstrates that low serum 25(OH)D concentration status is an independent predictor of short term mortality in cats. PMID:25970442

  14. Complications and 30-day Outcomes Associated With Venous Thromboembolism in the Pediatric Orthopaedic Surgical Population

    PubMed Central

    Baker, Dustin; Sherrod, Brandon; McGwin, Gerald; Ponce, Brent; Gilbert, Shawn

    2016-01-01

    Introduction The risk of morbidity associated with venous thromboembolism (VTE) after pediatric orthopaedic surgery remains unclear despite increased use of thromboprophylaxis measures. Methods The American College of Surgeons National Surgical Quality Improvement Program, Pediatric database was queried for patients undergoing an orthopaedic surgical procedure between 2012 and 2013. Upper extremity and skin/subcutaneous surgeries were excluded. Associations between VTE and procedure, demographics, comorbidities, preoperative laboratory values, and 30-day postoperative outcomes were evaluated. Results Of 14,776 cases, 15 patients (0.10%) experienced postoperative VTE. Deep vein thrombosis (DVT) occurred in 13 patients (0.09%), and pulmonary embolism developed in 2 patients (0.01%). The procedure with the highest VTE rate was surgery for infection (1.2%). Patient factors associated with the development of VTE included hyponatremia (P = 0.003), abnormal partial thromboplastin time (P = 0.046), elevated aspartate transaminase level (P = 0.004), and gastrointestinal (P = 0.011), renal (P = 0.016), and hematologic (P = 0.019) disorders. Nearly half (46.2%) of DVTs occurred postdischarge. Complications associated with VTE included prolonged hospitalization (P = <0.001), pneumonia (P = <0.001), unplanned intubation (P = 0.003), urinary tract infection (P = 0.003), and central line-associated bloodstream infection (P = <0.001). Most of the postoperative complications (66.7%) occurred before VTE diagnosis, and no patients with VTE died. Conclusion In the absence of specified risk factors, thromboprophylaxis may be unnecessary for this population. PMID:26855119

  15. Pauses and Communication Strategies in Second Language Speech.

    ERIC Educational Resources Information Center

    Cenoz, Jasone

    A study of silent and filled pauses in second language speech analyzes (1) which types of pause are produced, (2) which are the functions of non-juncture pauses, (3) whether pauses co-occur with other hesitation phenomena, and (4) whether the occurrence of pauses is associated with second language proficiency. Subjects were 15 intermediate and…

  16. On Judging Pauses in Spontaneous Speech

    ERIC Educational Resources Information Center

    Martin, James G.

    1970-01-01

    Spectrograms of spontaneous speech revealed that syllables preceding a judged-pause location were usually longer than those following, whether or not a silent interval was present. Most judged-pause locations were junctures, but syllable length governed judgments independently of juncture cues. (Author/FWB)

  17. Syllable Timing and Pausing: Evidence from Cantonese

    ERIC Educational Resources Information Center

    Perry, Conrad; Wong, Richard Kwok-Shing; Matthews, Stephen

    2009-01-01

    We examined the relationship between the acoustic duration of syllables and the silent pauses that follow them in Cantonese. The results showed that at major syntactic junctures, acoustic plus silent pause durations were quite similar for a number of different syllable types whose acoustic durations differed substantially. In addition, it appeared…

  18. Impact of Peri-Operative Acute Kidney Injury as a Severity Index for 30-day Readmission After Cardiac Surgery

    PubMed Central

    Brown, Jeremiah R.; Parikh, Chirag R.; Ross, Cathy S.; Kramer, Robert S.; Magnus, Patrick C.; Chaisson, Kristine; Boss, Richard A.; Helm, Robert E.; Horton, Susan R.; Hofmaster, Patricia; Desaulniers, Helen; Blajda, Pamela; Westbrook, Benjamin M.; Duquette, Dennis; LeBlond, Kelly; Quinn, Reed D.; Jones, Cheryl; DiScipio, Anthony W.; Malenka, David J.

    2014-01-01

    Background Of patients undergoing cardiac surgery in the United States, 15–20% are re-hospitalized within 30-days. Current models to predict readmission have not evaluated the association between severity of post-operative acute kidney injury (AKI) and 30-day readmissions. Methods We collected data from 2,209 consecutive patients who underwent either coronary artery bypass (CABG) or valve surgery at seven member hospitals of the Northern New England Cardiovascular Disease Study Group Cardiac Surgery Registry (NNE) between July 2008 and December 2010. Administrative data at each hospital was searched to identify all patients readmitted to the index hospital within 30 days of discharge. We defined AKI Stages by the AKI Network definition of 0.3 or 50% increase (Stage 1), 2-fold increase (stage 2) and a 3-fold or 0.5 increase if the baseline serum creatinine was at least 4.0 (mg/dL) or new dialysis (stage 3). We evaluate the association between stages of AKI and 30-day readmission using multivariate logistic regression. Results There were 260 patients readmitted within 30-days (12.1%). The median time to readmission was 9 (IQR 4–16) days. Patients not developing AKI following cardiac surgery had a 30-day readmission rate of 9.3% compared to patients developing AKI stage 1 (16.1%), AKI stage 2 (21.8%) and AKI stage 3 (28.6%, p <0.001). Adjusted odds ratios for AKI stage 1 (1.81; 1.35, 2.44), stage 2 (2.39; 1.38, 4.14) and stage 3 (3.47; 1.85–6.50). Models to predict readmission were significantly improved with the addition of AKI stage (c-statistic 0.65, p = 0.001) and net reclassification rate of 14.6% (95%CI: 5.05% to 24.14%, p = .003). Conclusions In addition to more traditional patient characteristics, the severity of post-operative AKI should be used when assessing a patient’s risk for readmission. PMID:24119985

  19. 9 CFR 96.12 - Uncertified casings not disinfected in 30 days; disposition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 30 days; disposition. 96.12 Section 96.12 Animals and Animal Products ANIMAL AND PLANT HEALTH... STATES § 96.12 Uncertified casings not disinfected in 30 days; disposition. Foreign animal casings... period of 30 days after arrival in the United States, subject to the ability of Division inspectors...

  20. 17 CFR 41.12 - Indexes underlying futures contracts trading for fewer than 30 days.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... contracts trading for fewer than 30 days. 41.12 Section 41.12 Commodity and Securities Exchanges COMMODITY... underlying futures contracts trading for fewer than 30 days. (a) An index on which a contract of sale for... U.S.C. 1a(25)) for the first 30 days of trading, if: (1) Such index would not have been a...

  1. 7 CFR 27.58 - Postponed classification; must be within 30 days.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Postponed classification; must be within 30 days. 27... Classification § 27.58 Postponed classification; must be within 30 days. If thereafter the classification of the cotton be desired, notice thereof shall be filed not later than the expiration of 30 days after the...

  2. 17 CFR 41.12 - Indexes underlying futures contracts trading for fewer than 30 days.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... contracts trading for fewer than 30 days. 41.12 Section 41.12 Commodity and Securities Exchanges COMMODITY... Indexes underlying futures contracts trading for fewer than 30 days. (a) An index on which a contract of... narrow-based security index under section 1a(35) of the Act (7 U.S.C. 1a(35)) for the first 30 days...

  3. 43 CFR 4.1186 - Waiver of the 30-day decision requirement.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 1 2011-10-01 2011-10-01 false Waiver of the 30-day decision requirement... Expedited Review of Section 521(a)(2) Or 521(a)(3) Orders of Cessation § 4.1186 Waiver of the 30-day decision requirement. (a) Any person qualified to receive a 30-day decision may waive that right— (1)...

  4. 7 CFR 27.58 - Postponed classification; must be within 30 days.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Postponed classification; must be within 30 days. 27... Classification § 27.58 Postponed classification; must be within 30 days. If thereafter the classification of the cotton be desired, notice thereof shall be filed not later than the expiration of 30 days after the...

  5. 43 CFR 4.1186 - Waiver of the 30-day decision requirement.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 1 2013-10-01 2013-10-01 false Waiver of the 30-day decision requirement... Expedited Review of Section 521(a)(2) Or 521(a)(3) Orders of Cessation § 4.1186 Waiver of the 30-day decision requirement. (a) Any person qualified to receive a 30-day decision may waive that right— (1)...

  6. 26 CFR 31.3406(d)-3 - Special 30-day rules for certain reportable payments.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 15 2012-04-01 2012-04-01 false Special 30-day rules for certain reportable... COLLECTION OF INCOME TAX AT SOURCE Collection of Income Tax at Source § 31.3406(d)-3 Special 30-day rules for... certification of notified payee underreporting) within 30 days after the establishment or acquisition...

  7. 43 CFR 4.1186 - Waiver of the 30-day decision requirement.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 1 2014-10-01 2014-10-01 false Waiver of the 30-day decision requirement... Expedited Review of Section 521(a)(2) Or 521(a)(3) Orders of Cessation § 4.1186 Waiver of the 30-day decision requirement. (a) Any person qualified to receive a 30-day decision may waive that right— (1)...

  8. 9 CFR 96.12 - Uncertified casings not disinfected in 30 days; disposition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 30 days; disposition. 96.12 Section 96.12 Animals and Animal Products ANIMAL AND PLANT HEALTH... STATES § 96.12 Uncertified casings not disinfected in 30 days; disposition. Foreign animal casings... period of 30 days after arrival in the United States, subject to the ability of Division inspectors...

  9. 43 CFR 4.1186 - Waiver of the 30-day decision requirement.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Waiver of the 30-day decision requirement... Expedited Review of Section 521(a)(2) Or 521(a)(3) Orders of Cessation § 4.1186 Waiver of the 30-day decision requirement. (a) Any person qualified to receive a 30-day decision may waive that right— (1)...

  10. 7 CFR 27.58 - Postponed classification; must be within 30 days.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Postponed classification; must be within 30 days. 27... Classification § 27.58 Postponed classification; must be within 30 days. If thereafter the classification of the cotton be desired, notice thereof shall be filed not later than the expiration of 30 days after the...

  11. 9 CFR 96.12 - Uncertified casings not disinfected in 30 days; disposition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 30 days; disposition. 96.12 Section 96.12 Animals and Animal Products ANIMAL AND PLANT HEALTH... STATES § 96.12 Uncertified casings not disinfected in 30 days; disposition. Foreign animal casings... period of 30 days after arrival in the United States, subject to the ability of Division inspectors...

  12. 7 CFR 27.58 - Postponed classification; must be within 30 days.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Postponed classification; must be within 30 days. 27... Classification § 27.58 Postponed classification; must be within 30 days. If thereafter the classification of the cotton be desired, notice thereof shall be filed not later than the expiration of 30 days after the...

  13. 43 CFR 4.1186 - Waiver of the 30-day decision requirement.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 1 2012-10-01 2011-10-01 true Waiver of the 30-day decision requirement... Expedited Review of Section 521(a)(2) Or 521(a)(3) Orders of Cessation § 4.1186 Waiver of the 30-day decision requirement. (a) Any person qualified to receive a 30-day decision may waive that right— (1)...

  14. 17 CFR 41.12 - Indexes underlying futures contracts trading for fewer than 30 days.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... contracts trading for fewer than 30 days. 41.12 Section 41.12 Commodity and Securities Exchanges COMMODITY... underlying futures contracts trading for fewer than 30 days. (a) An index on which a contract of sale for... U.S.C. 1a(25)) for the first 30 days of trading, if: (1) Such index would not have been a...

  15. 7 CFR 27.58 - Postponed classification; must be within 30 days.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Postponed classification; must be within 30 days. 27... Classification § 27.58 Postponed classification; must be within 30 days. If thereafter the classification of the cotton be desired, notice thereof shall be filed not later than the expiration of 30 days after the...

  16. 26 CFR 31.3406(d)-3 - Special 30-day rules for certain reportable payments.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 15 2014-04-01 2014-04-01 false Special 30-day rules for certain reportable... COLLECTION OF INCOME TAX AT SOURCE Collection of Income Tax at Source § 31.3406(d)-3 Special 30-day rules for... certification of notified payee underreporting) within 30 days after the establishment or acquisition...

  17. 9 CFR 96.12 - Uncertified casings not disinfected in 30 days; disposition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 30 days; disposition. 96.12 Section 96.12 Animals and Animal Products ANIMAL AND PLANT HEALTH... STATES § 96.12 Uncertified casings not disinfected in 30 days; disposition. Foreign animal casings... period of 30 days after arrival in the United States, subject to the ability of Division inspectors...

  18. Pause & go: from the discovery of RNA polymerase pausing to its functional implications.

    PubMed

    Mayer, Andreas; Landry, Heather M; Churchman, L Stirling

    2017-03-28

    The synthesis of nascent RNA is a discontinuous process in which phases of productive elongation by RNA polymerase are interrupted by frequent pauses. Transcriptional pausing was first observed decades ago, but was long considered to be a special feature of transcription at certain genes. This view was challenged when studies using genome-wide approaches revealed that RNA polymerase II pauses at promoter-proximal regions in large sets of genes in Drosophila and mammalian cells. High-resolution genomic methods uncovered that pausing is not restricted to promoters, but occurs globally throughout gene-body regions, implying the existence of key-rate limiting steps in nascent RNA synthesis downstream of transcription initiation. Here, we outline the experimental breakthroughs that led to the discovery of pervasive transcriptional pausing, discuss its emerging roles and regulation, and highlight the importance of pausing in human development and disease.

  19. Rheumatoid arthritis patients are not at increased risk for 30-day cardiovascular events, infections, or mortality after total joint arthroplasty

    PubMed Central

    2013-01-01

    Introduction Serious infection, cardiovascular disease, and mortality are increased in rheumatoid arthritis (RA). Whether RA affects the risk for these complications after total joint arthroplasty (TJA) is unknown, we hypothesize that it does. We compared the occurrence of 30-day postoperative complications and mortality in a large cohort of RA and osteoarthritis (OA) patients undergoing hip or knee TJA. Methods Analyses included 7-year data from the Veterans Affairs Surgical Quality Improvement Program. The 30-day complications were compared by diagnosis by using logistic regression, and long-term mortality was examined by using Cox proportional hazards regression. All analyses were adjusted for age, sex, and clustering by surgical site. Additional covariates included sociodemographics, comorbidities, health behaviors, and operative risk factors. Results The 34,524 patients (839 RA, 33,685 OA) underwent knee (65.9%) or hip TJA. Patients were 95.7% men with a mean (SD) age of 64.4 (10.7) years and had 3,764 deaths over a mean follow-up of 3.7 (2.3) years. Compared with OA patients, those with RA were significantly more likely to require a return to the operating room (odds ratio (OR), 1.45 (95% CI, 1.08 to 1.94), but had similar rates of 30-day postoperative infection, OR 1.02 (0.72 to 1.47), cardiovascular events, OR 0.69 (0.37 to 1.28), and mortality, OR 0.94 (0.38 to 2.33). RA was associated with a significantly higher long-term mortality; hazard ratio (HR), 1.22 (1.00 to 1.49). Conclusion In this study of US veterans, RA patients were not at an increased risk for short-term mortality or other major complications after TJA, although they returned to the operating room more often and had increased long-term mortality. PMID:24252350

  20. 78 FR 52005 - 30-Day Notice of Proposed Information Collection: Multifamily Project Construction Contract...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-21

    ... August 21, 2013 Part IV Department of Housing and Urban Development 30-Day Notice of Proposed Information...; ] DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Multifamily... Urban Development, 451 7th Street SW., Washington, DC 20410; email Colette Pollard at...

  1. 77 FR 48160 - Division of Cardiovascular Devices 30-Day Notices and Annual Reports; Public Workshop; Request...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-13

    ... following public workshop entitled ``Division of Cardiovascular Devices 30-Day Notices and Annual Reports... requirements applicable to premarket approval applications (PMAs), 30-day notices and annual reports... periodic (annual) report. This workshop is intended to focus on manufacturing method and procedure...

  2. 43 CFR 4.1187 - Procedure if 30-day decision requirement is not waived.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 1 2012-10-01 2011-10-01 true Procedure if 30-day decision requirement is...-day decision requirement is not waived. If the applicant does not waive the 30-day decision... a response to the application for review shall file a written response within 5 working days...

  3. 78 FR 64141 - 30-Day Notice of Proposed Information Collection: Certificate of Housing Counseling...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-25

    ... October 25, 2013 Part III Department of Housing and Urban Development 30-Day Notice of Proposed... / Notices#0;#0; ] DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Certificate of Housing Counseling: Homeownership and Certificate of Housing Counseling:...

  4. 43 CFR 4.1187 - Procedure if 30-day decision requirement is not waived.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 1 2011-10-01 2011-10-01 false Procedure if 30-day decision requirement...-day decision requirement is not waived. If the applicant does not waive the 30-day decision... a response to the application for review shall file a written response within 5 working days...

  5. 19 CFR 158.42 - Abandonment by importer within 30 days after entry.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 19 Customs Duties 2 2012-04-01 2012-04-01 false Abandonment by importer within 30 days after entry... days after entry. Allowance in duties for merchandise abandoned to the Government in accordance with... which the merchandise being abandoned appears. (b) Application within 30 days. The importer shall...

  6. 43 CFR 4.1187 - Procedure if 30-day decision requirement is not waived.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Procedure if 30-day decision requirement...-day decision requirement is not waived. If the applicant does not waive the 30-day decision... a response to the application for review shall file a written response within 5 working days...

  7. 19 CFR 158.42 - Abandonment by importer within 30 days after entry.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Abandonment by importer within 30 days after entry... days after entry. Allowance in duties for merchandise abandoned to the Government in accordance with... which the merchandise being abandoned appears. (b) Application within 30 days. The importer shall...

  8. 19 CFR 158.42 - Abandonment by importer within 30 days after entry.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 19 Customs Duties 2 2014-04-01 2014-04-01 false Abandonment by importer within 30 days after entry... days after entry. Allowance in duties for merchandise abandoned to the Government in accordance with... which the merchandise being abandoned appears. (b) Application within 30 days. The importer shall...

  9. Nonclinical Factors Associated with 30-Day Mortality after Lung Cancer Resection: An Analysis of 215,000 Patients Using the National Cancer Data Base

    PubMed Central

    Melvan, John N; Sancheti, Manu S; Gillespie, Theresa; Nickleach, Dana C; Liu, Yuan; Higgins, Kristin; Ramalingam, Suresh; Lipscomb, Joseph; Fernandez, Felix G

    2015-01-01

    Background Clinical variables associated with 30-day mortality after lung cancer surgery are well known. However, the effects of non-clinical factors, including insurance coverage, household income, education, type of treatment center, and area of residence, on short term survival are less appreciated. We studied the National Cancer Data Base (NCDB), a joint endeavor of the Commission on Cancer of the American College of Surgeons and the American Cancer Society, to identify disparities in 30-day mortality after lung cancer resection based on these non-clinical factors. Study Design We performed a retrospective cohort analysis of patients undergoing lung cancer resection from 2003-2011, using the NCDB. Data were analyzed using a multivariable logistic regression model to identify risk factors for 30-day mortality. Results 215,645 patients underwent lung cancer resection during our study period. We found that clinical variables such as age, gender, comorbidity, cancer stage, preoperative radiation, extent of resection, positive surgical margins, and tumor size were associated with 30-day mortality after resection. Non-clinical factors including living in lower income neighborhoods with a lesser proportion of high school graduates, and receiving cancer care at a non-academic medical center were also independently associated with increased 30-day postoperative mortality. Conclusions This study represents the largest analysis of 30-day mortality for lung cancer resection to date from a generalizable national cohort. Our results demonstrate that, in addition to known clinical risk factors, several non-clinical factors are associated with increased 30-day mortality after lung cancer resection. These disparities require further investigation to improve lung cancer patient outcomes. PMID:26206651

  10. 78 FR 64143 - 30-Day Notice of Proposed Information Collection: Contractor's Requisition-Project Mortgages

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-25

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Contractor's Requisition--Project..., 2013. A. Overview of Information Collection Title of Information Collection: Contractor's...

  11. 78 FR 44579 - 30-Day Notice of Proposed Information Collection: Fellowship Placement Pilot Program Evaluation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-24

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Fellowship Placement Pilot Program.... A. Overview of Information Collection Title of Information Collection: Fellowship Placement Pilot.... Description of the need for the information and proposed use: The Fellowship Placement Program places...

  12. 78 FR 64234 - 30-Day Notice of Proposed Information Collection: Environmental Review Procedures for Entities...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-28

    ... (NEPA), the regulations of the Council on Environmental Quality, related federal environmental laws... compliance with all applicable environmental laws and authorities. HUD (or the State for certain State... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Environmental Review Procedures...

  13. 78 FR 59046 - 30-Day Notice of Proposed Information Collection: Federal Labor Standards Questionnaire(s...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-25

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Federal Labor Standards..., Reports Management Officer, QDAM, Department of Housing and Urban Development, 451 7th Street...

  14. 78 FR 69103 - 30-Day Notice of Proposed Information Collection: Quality Control for Rental Assistance Subsidy...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-18

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Quality Control for Rental... Information Collection: Quality Control for Rental Assistance Subsidy Determinations. OMB Approval Number... Quality Control process involves selecting a nationally representative sample of assisted households...

  15. 78 FR 36561 - 30-Day Notice of Proposed Information Collection: The Housing Counseling Federal Advisory...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-18

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: The Housing Counseling Federal... Information Collection: The Housing Counseling Federal Advisory Committee Membership Application. OMB Approval... for the information and proposed use: The Housing Counseling Federal Advisory Committee (HCFAC)...

  16. Effect of feeding in 30-day bioaccumulation assays using Hyalella azteca in fluoranthene-dosed sediment

    SciTech Connect

    Harkey, G.A.; Landrum, P.F.

    1995-12-31

    Current protocols for conducting freshwater sediment bioaccumulation tests require that food be added to exposures. To determine effects of adding food, 30-day bioaccumulation assays were conducted with H. azteca exposed to sediment dosed with four concentrations (0.05 to 1,267 nmol/g dry weight) of fluoranthene. Accumulation was significantly greater in fed versus non-fed animals at all dose levels after 96 and 240 hours of exposure and continued to be greater after 30 days in the low dose levels. At sediment concentrations above 634 nmol/g dw, survival of unfed animals dropped to 34% after 30 days, However, after 30 days, reproduction was observed in fed animals exposed to sediment concentrations > 16 times the expected LC50 calculated for fluoranthene in sediment. These data raise questions concerning the interpretation of standard toxicity and bioaccumulation tests when food is routinely added.

  17. Avoidable 30-Day Readmissions Among Patients With Stroke and Other Cerebrovascular Disease

    PubMed Central

    Nahab, Fadi; Takesaka, Jennifer; Mailyan, Eugene; Judd, Lilith; Culler, Steven; Webb, Adam; Frankel, Michael; Choi, Dennis; Helmers, Sandra

    2012-01-01

    Background: There are limited data on factors associated with 30-day readmissions and the frequency of avoidable readmissions among patients with stroke and other cerebrovascular disease. Methods: University HealthSystem Consortium (UHC) database records were used to identify patients discharged with a diagnosis of stroke or other cerebrovascular disease at a university hospital from January 1, 2007 to December 31, 2009 and readmitted within 30 days to the index hospital. Logistic regression models were used to identify patient and clinical characteristics associated with 30-day readmission. Two neurologists performed chart reviews on readmissions to identify avoidable cases. Results: Of 2706 patients discharged during the study period, 174 patients had 178 readmissions (6.4%) within 30 days. The only factor associated with 30-day readmission was the index length of stay >10 days (vs <5 days; odds ratio [OR] 2.3, 95% CI [1.4, 3.7]). Of 174 patients readmitted within 30 days (median time to readmission 10 days), 92 (53%) were considered avoidable readmissions including 38 (41%) readmitted for elective procedures within 30 days of discharge, 27 (29%) readmitted after inadequate outpatient care coordination, 15 (16%) readmitted after incomplete initial evaluations, 8 (9%) readmitted due to delayed palliative care consultation, and 4 (4%) readmitted after being discharged with inadequate discharge instructions. Only 5% of the readmitted patients had outpatient follow-up recommended within 1 week. Conclusions: More than half of the 30-day readmissions were considered avoidable. Coordinated timing of elective procedures and earlier outpatient follow-up may prevent the majority of avoidable readmissions among patients with stroke and other cerebrovascular disease. PMID:23983857

  18. Automatic Method of Pause Measurement for Normal and Dysarthric Speech

    ERIC Educational Resources Information Center

    Rosen, Kristin; Murdoch, Bruce; Folker, Joanne; Vogel, Adam; Cahill, Louise; Delatycki, Martin; Corben, Louise

    2010-01-01

    This study proposes an automatic method for the detection of pauses and identification of pause types in conversational speech for the purpose of measuring the effects of Friedreich's Ataxia (FRDA) on speech. Speech samples of [approximately] 3 minutes were recorded from 13 speakers with FRDA and 18 healthy controls. Pauses were measured from the…

  19. Using habit reversal to decrease filled pauses in public speaking.

    PubMed

    Mancuso, Carolyn; Miltenberger, Raymond G

    2016-03-01

    This study evaluated the effectiveness of simplified habit reversal in reducing filled pauses that occur during public speaking. Filled pauses consist of "uh," "um," or "er"; clicking sounds; and misuse of the word "like." After baseline, participants received habit reversal training that consisted of awareness training and competing response training. During postintervention assessments, all 6 participants exhibited an immediate decrease in filled pauses.

  20. Predictors of 30-day mortality in patients with spontaneous primary intracerebral hemorrhage

    PubMed Central

    Safatli, Diaa A.; Günther, Albrecht; Schlattmann, Peter; Schwarz, Falko; Kalff, Rolf; Ewald, Christian

    2016-01-01

    Background: Intracerebral hemorrhage (ICH) is a life threatening entity, and an early outcome assessment is mandatory for optimizing therapeutic efforts. Methods: We retrospectively analyzed data from 342 patients with spontaneous primary ICH to evaluate possible predictors of 30-day mortality considering clinical, radiological, and therapeutical parameters. We also applied three widely accepted outcome grading scoring systems [(ICH score, FUNC score and intracerebral hemorrhage grading scale (ICH-GS)] on our population to evaluate the correlation of these scores with the 30-day mortality in our study. We also applied three widely accepted outcome grading scoring systems [(ICH score, FUNC score and intracerebral hemorrhage grading scale (ICH-GS)] on our population to evaluate the correlation of these scores with the 30-day mortality in our study. Results: From 342 patients (mean age: 67 years, mean Glasgow Coma Scale [GCS] on admission: 9, mean ICH volume: 62.19 ml, most common hematoma location: basal ganglia [43.9%]), 102 received surgical and 240 conservative treatment. The 30-day mortality was 25.15%. In a multivariate analysis, GCS (Odds ratio [OR] =0.726, 95% confidence interval [CI] =0.661–0.796, P < 0.001), bleeding volume (OR = 1.012 per ml, 95% CI = 1.007 – 1.017, P < 0.001), and infratentorial hematoma location (OR = 5.381, 95% CI = 2.166-13.356, P = 0.009) were significant predictors for the 30-day mortality. After receiver operating characteristics analysis, we defined a “high-risk group” for an unfavorable short-term outcome with GCS <11 and ICH volume >32 ml supratentorially or 21 ml infratentorially. Using Pearson correlation, we found a correlation of 0.986 between ICH score and 30-day mortality (P < 0.001), 0.853 between FUNC score and 30-day mortality (P = 0.001), and 0.924 between ICH-GS and 30-day mortality (P = 0.001). Conclusions: GCS score on admission together with the baseline volume and localization of the hemorrhage are strong

  1. Relationships between in-hospital and 30-day standardized hospital mortality: implications for profiling hospitals.

    PubMed Central

    Rosenthal, G. E.; Baker, D. W.; Norris, D. G.; Way, L. E.; Harper, D. L.; Snow, R. J.

    2000-01-01

    OBJECTIVE: To examine the relationship of in-hospital and 30-day mortality rates and the association between in-hospital mortality and hospital discharge practices. DATA SOURCES/STUDY SETTING: A secondary analysis of data for 13,834 patients with congestive heart failure who were admitted to 30 hospitals in northeast Ohio in 1992-1994. DESIGN: A retrospective cohort study was conducted. DATA COLLECTION: Demographic and clinical data were collected from patients' medical records and were used to develop multivariable models that estimated the risk of in-hospital and 30-day (post-admission) mortality. Standardized mortality ratios (SMRs) for in-hospital and 30-day mortality were determined by dividing observed death rates by predicted death rates. PRINCIPAL FINDINGS: In-hospital SMRs ranged from 0.54 to 1.42, and six hospitals were classified as statistical outliers (p <.05); 30-day SMRs ranged from 0.63 to 1.73, and seven hospitals were outliers. Although the correlation between in-hospital SMRs and 30-day SMRs was substantial (R = 0.78, p < .001), outlier status changed for seven of the 30 hospitals. Nonetheless, changes in outlier status reflected relatively small differences between in-hospital and 30-day SMRs. Rates of discharge to nursing homes or other inpatient facilities varied from 5.4 percent to 34.2 percent across hospitals. However, relationships between discharge rates to such facilities and in-hospital SMRs (R = 0.08; p = .65) and early post-discharge mortality rates (R = 0.23; p = .21) were not significant. CONCLUSIONS: SMRs based on in-hospital and 30-day mortality were relatively similar, although classification of hospitals as statistical outliers often differed. However, there was no evidence that in-hospital SMRs were biased by differences in post-discharge mortality or discharge practices. PMID:10737447

  2. Measuring hospital mortality rates: are 30-day data enough? Ischemic Heart Disease Patient Outcomes Research Team.

    PubMed Central

    Garnick, D W; DeLong, E R; Luft, H S

    1995-01-01

    OBJECTIVE. We compare 30-day and 180-day postadmission hospital mortality rates for all Medicare patients and those in three categories of cardiac care: coronary artery bypass graft surgery, acute myocardial infarction, and congestive heart failure. DATA SOURCES/COLLECTION. Health Care Financing Administration (HCFA) hospital mortality data for FY 1989. STUDY DESIGN. Using hospital level public use files of actual and predicted mortality at 30 and 180 days, we constructed residual mortality measures for each hospital. We ranked hospitals and used receiver operating characteristic (ROC) curves to compare 0-30, 31-180, and 0-180-day postadmission mortality. PRINCIPAL FINDINGS. For the admissions we studied, we found a broad range of hospital performance when we ranked hospitals using the 30-day data; some hospitals had much lower than predicted 30-day mortality rates, while others had much higher than predicted mortality rates. Data from the time period 31-180 days postadmission yield results that corroborate the 0-30 day postadmission data. Moreover, we found evidence that hospital performance on one condition is related to performance on the other conditions, but that the correlation is much weaker in the 31-180-day interval than in the 0-30-day period. Using ROC curves, we found that the 30-day data discriminated the top and bottom fifths of the 180-day data extremely well, especially for AMI outcomes. CONCLUSIONS. Using data on cumulative hospital mortality from 180 days postadmission does not yield a different perspective from using data from 30 days postadmission for the conditions we studied. PMID:7860319

  3. Hyperkalemia is Associated with Increased 30-Day Mortality in Hip Fracture Patients.

    PubMed

    Norring-Agerskov, Debbie; Madsen, Christian Medom; Abrahamsen, Bo; Riis, Troels; Pedersen, Ole B; Jørgensen, Niklas Rye; Bathum, Lise; Lauritzen, Jes Bruun; Jørgensen, Henrik L

    2017-02-17

    Abnormal plasma concentrations of potassium in the form of hyper- and hypokalemia are frequent among hospitalized patients and have been linked to poor outcomes. In this study, we examined the prevalence of hypo- and hyperkalemia in patients admitted with a fractured hip as well as the association with 30-day mortality in these patients. A total of 7293 hip fracture patients (aged 60 years or above) with admission plasma potassium measurements were included. Data on comorbidity, medication, and death was retrieved from national registries. The association between plasma potassium and mortality was examined using Cox proportional hazards models adjusted for age, sex, and comorbidities. The prevalence of hypo- and hyperkalemia on admission was 19.8% and 6.6%, respectively. The 30-day mortality rates were increased for patients with hyperkalemia (21.0%, p < 0.0001) compared to normokalemic patients (9.5%), whereas hypokalemia was not significantly associated with mortality. After adjustment for age, sex, and individual comorbidities, hyperkalemia was still associated with increased risk of death 30 days after admission (HR = 1.93 [1.55-2.40], p < 0.0001). After the same adjustments, hypokalemia remained non-associated with increased risk of 30-day mortality (HR = 1.06 [0.87-1.29], p = 0.6). Hyperkalemia, but not hypokalemia, at admission is associated with increased 30-day mortality after a hip fracture.

  4. Half of 30-Day Hospital Readmissions Among HIV-Infected Patients Are Potentially Preventable

    PubMed Central

    Kitchell, Ellen; Etherton, Sarah Shelby; Duarte, Piper; Halm, Ethan A.; Jain, Mamta K.

    2015-01-01

    Abstract Thirty-day readmission rates, a widely utilized quality metric, are high among HIV-infected individuals. However, it is unknown how many 30-day readmissions are preventable, especially in HIV patients, who have been excluded from prior potentially preventable readmission analyses. We used electronic medical records to identify all readmissions within 30 days of discharge among HIV patients hospitalized at a large urban safety net hospital in 2011. Two independent reviewers assessed whether readmissions were potentially preventable using both published criteria and detailed chart review, how readmissions might have been prevented, and the phase of care deemed suboptimal (inpatient care, discharge planning, post-discharge). Of 1137 index admissions, 213 (19%) resulted in 30-day readmissions. These admissions occurred among 930 unique HIV patients, with 130 individuals (14%) experiencing 30-day readmissions. Of these 130, about half were determined to be potentially preventable using published criteria (53%) or implicit chart review (48%). Not taking antiretroviral therapy (ART) greatly increased the odds of a preventable readmission (OR 5.9, CI:2.4–14.8). Most of the preventable causes of readmission were attributed to suboptimal care during the index hospitalization. Half of 30-day readmission in HIV patients are potentially preventable. Increased focus on early ART initiation, adherence counseling, management of chronic conditions, and appropriate timing of discharge may help reduce readmissions in this vulnerable population. PMID:26154066

  5. Sinus pause in association with Lyme carditis.

    PubMed

    Oktay, A Afsin; Dibs, Samer R; Friedman, Harvey

    2015-06-01

    Lyme disease is the most prevalent tick-borne disease in the United States. It is caused by the spirochete Borrelia burgdorferi. Cardiac involvement is seen in 4% to 10% of patients with Lyme disease. The principal manifestation of Lyme carditis is self-limited conduction system disease, with predominant involvement of the atrioventricular node. On rare occasions, Lyme carditis patients present with other conduction system disorders such as bundle branch block, intraventricular conduction delay, and supraventricular or ventricular tachycardia. We report the unusual case of a 59-year-old man who presented with new-onset symptomatic sinus pauses one month after hiking in upstate New York. To our knowledge, this is the first case report from North America that describes the relationship between symptomatic sinus pause and Lyme carditis.

  6. Sinus Pause in Association with Lyme Carditis

    PubMed Central

    Dibs, Samer R.; Friedman, Harvey

    2015-01-01

    Lyme disease is the most prevalent tick-borne disease in the United States. It is caused by the spirochete Borrelia burgdorferi. Cardiac involvement is seen in 4% to 10% of patients with Lyme disease. The principal manifestation of Lyme carditis is self-limited conduction system disease, with predominant involvement of the atrioventricular node. On rare occasions, Lyme carditis patients present with other conduction system disorders such as bundle branch block, intraventricular conduction delay, and supraventricular or ventricular tachycardia. We report the unusual case of a 59-year-old man who presented with new-onset symptomatic sinus pauses one month after hiking in upstate New York. To our knowledge, this is the first case report from North America that describes the relationship between symptomatic sinus pause and Lyme carditis. PMID:26175640

  7. Factors associated with moderate or severe left atrioventricular valve regurgitation within 30 days of repair of complete atrioventricular septal defect

    PubMed Central

    Kozak, Marcelo Felipe; Kozak, Ana Carolina Leiroz Ferreira Botelho Maisano; Marchi, Carlos Henrique De; Hassem Sobrinho Junior, Sirio; Croti, Ulisses Alexandre; Moscardini, Airton Camacho

    2015-01-01

    Introduction Left atrioventricular valve regurgitation is the most concerning residual lesion after surgical correction of atrioventricular septal defects. Objective To determine factors associated with moderate or severe left atrioventricular valve regurgitation within 30 days of surgical repair of complete atrioventricular septal defect. Methods We assessed the results of 53 consecutive patients 3 years-old and younger presenting with complete atrioventricular septal defect that were operated on at our practice between 2002 and 2010. The following variables were considered: age, weight, absence of Down syndrome, grade of preoperative atrioventricular valve regurgitation, abnormalities on the left atrioventricular valve and the use of annuloplasty. Median age was 6.7 months; median weight was 5.3 Kg; 86.8% had Down syndrome. At the time of preoperative evaluation, there were 26 cases with moderate or severe left atrioventricular valve regurgitation (49.1%). Abnormalities on the left atrioventricular valve were found in 11.3%; annuloplasty was performed in 34% of the patients. Results At the time of postoperative evaluation, there were 21 cases with moderate or severe left atrioventricular valve regurgitation (39.6%). After performing a multivariate analysis, the only significant factor associated with moderate or severe left atrioventricular valve regurgitation was the absence of Down syndrome (P=0.03). Conclusion Absence of Down syndrome was associated with moderate or severe postoperative left atrioventricular valve regurgitation after surgical repair of complete atrioventricular septal defect at our practice. PMID:26313720

  8. Characteristics of older adults rehospitalized within 7 and 30 days of discharge: implications for nursing practice.

    PubMed

    Hain, Debra J; Tappen, Ruth; Diaz, Sanya; Ouslander, Joseph G

    2012-08-01

    Rehospitalization within 30 days consumes a significant portion of health care costs; therefore, interventions aimed at reducing the risk of rehospitalization are needed. A retrospective study was conducted examining rehospitalization rates and diagnoses according to discharge location and comparing characteristics of older adults within 7 and 30 days of discharge from a community hospital. Data on rehospitalization for Medicare fee-for-service patients (75 and older) over a 12-month period were obtained from the information technology department of a not-for-profit community hospital. A total of 6,809 patients were discharged, with 12% rehospitalized within 30 days. Skilled nursing facilities had the highest rehospitalization rates (15%), followed by home with home health care (13%) and then home with self-care (8%). The highest rehospitalization rates were in areas where nursing has a strong presence, suggesting that nurses can play an important role in the development of interventions aimed at reducing rehospitalizations.

  9. Relationship between obstructive sleep apnea and 30-day mortality among patients with pulmonary embolism

    PubMed Central

    Ghiasi, Farzin; Ahmadpoor, Amin; Amra, Babak

    2015-01-01

    Background: Pulmonary embolism (PE) is the most life-threatening form of venous thrombosis which causes the majority of mortalities in this category. Obstructive sleep apnea (OSA) has been indicated as one of the risk factors for thromboembolism because of hemostatic alterations. The present study was designed to seek for the relationship between OSA and 30-day mortality of patients with PE. Materials and Methods: This prospective cohort study was conducted among 137 consecutive patients referred to hospital with symptoms of PE and preliminary stable hemodynamic. Confirmation of PE was made by multislice computed tomography pulmonary angiography and in the case of contraindication; V/Q lung scan and Doppler sonography were done. A STOP-Bang Questionnaire was used to determine patients with high- and low-risk of OSA. Patients were followed up for 1-month, and their survivals were recorded. Results: This study showed that there was no relationship between OSA and 30-day mortality (P = 0.389). Chronic kidney disease (P = 0.004), hypertension (P = 0.003), main thrombus (P = 0.004), and segmental thrombus (P = 0.022) were associated with 30-day mortality. In the logistic regression analysis, history of chronic kidney disease was diagnosed as a risk factor for 30-day mortality among the PE patients (P = 0.029, odds ratio = 4.93). Conclusion: Results of this study showed 30-day mortality was not affected by OSA directly. In fact, it was affected by complications of OSA such as hypertension and thrombus. Also, positive history of chronic kidney disease increased the risk of 30-day mortality. PMID:26622255

  10. Myelinated fibers of the mouse spinal cord after a 30-day space flight.

    PubMed

    Povysheva, T V; Rezvyakov, P N; Shaimardanova, G F; Nikolskii, E E; Islamov, R R; Chelyshev, Yu A; Grygoryev, A I

    2016-07-01

    Myelinated fibers and myelin-forming cells in the spinal cord at the L3-L5 level were studied in C57BL/6N mice that had spent 30 days in space. Signs of destruction of myelin in different areas of white matter, reduction of the thickness of myelin sheath and axon diameter, decreased number of myelin-forming cells were detected in "flight" mice. The stay of mice in space during 30 days had a negative impact on the structure of myelinated fibers and caused reduced expression of the markers myelin-forming cells. These findings can complement the pathogenetic picture of the development of hypogravity motor syndrome.

  11. 77 FR 67657 - Request for Public Comment: 30-Day Proposed Information Collection: Indian Health Service (IHS...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-13

    ... health care and preventive health services. To support the IHS mission and to provide the product/service... HUMAN SERVICES Indian Health Service Request for Public Comment: 30-Day Proposed Information Collection: Indian Health Service (IHS) Sharing What Works--Best Practice, Promising Practice, and Local...

  12. 77 FR 13128 - Agency Information Collection Request; 30-Day Public Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-05

    ...'' campaign is a national Public Service Announcement (PSA) campaign that aims to educate, engage and empower... HUMAN SERVICES Agency Information Collection Request; 30-Day Public Comment Request AGENCY: Office of... Reduction Act of 1995, the Office of the Secretary (OS), Department of Health and Human Services,...

  13. 78 FR 49280 - 30-Day Notice of Proposed Information Collection: Third-Party Documentation Facsimile Transmittal...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-13

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Third-Party Documentation Facsimile..., Department of Housing and Urban Development, 451 7th Street SW., Washington, DC 20410; email Colette...

  14. 78 FR 52008 - 30-Day Notice of Proposed Information Collection: Multifamily Housing Service Coordinator Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-21

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Multifamily Housing Service..., Department of Housing and Urban Development, 451 7th Street SW., Washington, DC 20410; email Colette...

  15. 78 FR 39002 - 30-Day Notice of Proposed Information Collection: Request for Withdrawals From Replacements...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-28

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Request for Withdrawals From..., Reports Management Officer, QDAM, Department of Housing and Urban Development, 451 7th Street...

  16. 78 FR 52009 - 30-Day Notice of Proposed Information Collection: Utility Allowance Adjustments

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-21

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Utility Allowance Adjustments AGENCY... Urban Development, 451 7th Street SW., Washington, DC 20410; email Colette Pollard at...

  17. 78 FR 39001 - 30-Day Notice of Proposed Information Collection: Uniform Physical Standards and Physical...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-28

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Uniform Physical Standards and..., Reports Management Officer, QDAM, Department of Housing and Urban Development, 451 7th Street...

  18. 78 FR 52007 - 30-Day Notice of Proposed Information Collection: Management Certification and Management Entity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-21

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Management Certification and... Management Officer, QDAM, Department of Housing and Urban Development, 451 7th Street, SW., Washington,...

  19. 78 FR 52007 - 30-Day Notice of Proposed Information Collection: Financial Statement of Corporate Applicant for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-21

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Financial Statement of Corporate..., Reports Management Officer, QDAM, Department of Housing and Urban Development, 451 7th Street,...

  20. 78 FR 52006 - 30-Day Notice of Proposed Information Collection: Final Endorsement of Credit Instrument

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-21

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Final Endorsement of Credit..., Department of Housing and Urban Development, 451 7th Street, SW., Washington, DC 20410; email Colette...

  1. 77 FR 39318 - 30-Day Notice of Proposed Information Collection: DS-5513, Supplemental Questionnaire To...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-02

    ..., Office of Project Management and Operational Support, Program Coordination (CA/PPT/PMO/PC) Form Number... information collection request to the Office of Management and Budget (OMB) for approval in accordance with... to the Office of Management and Budget (OMB) for up to 30 days from July 2, 2012. ADDRESSES:...

  2. 78 FR 36565 - 30-Day Notice of Proposed Information Collection: Standardized Form for Collecting Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-18

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Standardized Form for Collecting... Information Collection: Standardized Form for Collecting Information Regarding Race and Ethnic Data. OMB... quality, utility, and clarity of the information to be collected; and (4) Ways to minimize the burden...

  3. 77 FR 37407 - Agency Information Collection Request-30-Day Public Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-21

    ... HUMAN SERVICES Agency Information Collection Request--30-Day Public Comment Request AGENCY: Office of... Reduction Act of 1995, the Office of the Secretary (OS), Department of Health and Human Services, is.... Proposed Project: New Comprehensive Communication Campaign on Right To Non-Discrimination in Certain...

  4. Enhanced recovery of Phytophthora ramorum from soil following 30 days storage at 4C

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chlamydospores of Phytophthora ramorum produced by mixing 20 percent V8 juice broth cultures with sand and incubating over a 30 day period were used to infest field soil at densities ranging from 0.2 to 42 chlamydospores per cubic centimeter of soil. Chlamydospore recovery was determined by baiting...

  5. 77 FR 18820 - Agency Information Collection Request; 30-Day Public Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-28

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HEALTH AND HUMAN SERVICES Agency Information Collection Request; 30-Day Public Comment Request AGENCY: Office of... Reduction Act of 1995, the Office of the Secretary (OS), Department of Health and Human Services,...

  6. 78 FR 38070 - 30-Day Notice of Proposed Information Collection: Affirmative Fair Housing Marketing (AFHM) Plan

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-25

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Affirmative Fair Housing Marketing... Marketing (AFHM) Plan. OMB Approval Number: 2529-0013. Type of Request: Extension of a currently approved collection. Form Number: HUD-935.2A Affirmative Fair Housing Marketing (AFHM) Plan (Multifamily),...

  7. 78 FR 1916 - 30-Day Notice of Proposed Information Collection: Smart Traveler Enrollment Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-09

    ... From the Federal Register Online via the Government Publishing Office ] DEPARTMENT OF STATE 30-Day Notice of Proposed Information Collection: Smart Traveler Enrollment Program ACTION: Notice of request... Information Collection: Smart Traveler Enrollment Program (STEP). OMB Control Number: 1405-0152. Type...

  8. 78 FR 64142 - 30-Day Notice of Proposed Information Collection: Condominium Project Approval Document Collection

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-25

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Condominium Project Approval... submitted the proposed information collection requirement described below to the Office of Management and... Management and Budget, New Executive Office Building, Washington, DC 20503; fax: 202-395-5806. Email:...

  9. 78 FR 36560 - 30-Day Notice of Proposed Information Collection: FHA Lender Approval, Annual Renewal, Periodic...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-18

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: FHA Lender Approval, Annual Renewal...: Colette Pollard, Reports Management Officer, QDAM, Department of Housing and Urban Development, 451 7th... Title of Information Collection: FHA Lender Approval, Annual Renewal, Periodic Updates and...

  10. 78 FR 40309 - 30-Day Notice of Proposed Information Collection: Application for Multifamily Project Mortgage...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-03

    ... described below to the Office of Management and Budget (OMB) for review, in accordance with the Paperwork Reduction Act. The purpose of this notice is to allow for an additional 30 days of public comment. DATES... sent to: HUD Desk Officer, Office of Management and Budget, New Executive Office Building,...

  11. 77 FR 59354 - Removal of 30-Day Residency Requirement for Per Diem Payments

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-27

    ... reasons other than hospital care, such as when a veteran travels to visit family members. This proposed... payments, stating: ``We believe that 30 days is a minimal amount of time for demonstrating that a veteran... State home within a specific period of time, or communicates that he or she will not be returning....

  12. 77 FR 59318 - Removal of 30-Day Residency Requirement for Per Diem Payments

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-27

    ... reasons other than hospital care, such as when a veteran travels to visit family members. This rule also... 30 days is a minimal amount of time for demonstrating that a veteran intends to be a resident at the... State home within a specific period of time, or communicates that he or she will not be returning....

  13. 78 FR 75366 - 30-Day Notice of Proposed Information Collection: Public Housing Energy Audits and Utility...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-11

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Public Housing Energy Audits and... Audits and Utility Allowances. OMB Approval Number: 2577-062. Type of Request: Reinstatement, with change... information and proposed use: 24 CFR 965.301, Subpart C, Energy Audit and Energy Conservation...

  14. 76 FR 59129 - Agency Information Collection Request; 30-Day Public Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-23

    ... HUMAN SERVICES Agency Information Collection Request; 30-Day Public Comment Request AGENCY: Office of... Reduction Act of 1995, the Office of the Secretary (OS), Department of Health and Human Services, is... to send comments regarding this burden estimate or any other aspect of this collection of...

  15. 26 CFR 31.3406(d)-3 - Special 30-day rules for certain reportable payments.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Special 30-day rules for certain reportable payments. 31.3406(d)-3 Section 31.3406(d)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... account. (b) Sale of an instrument for a customer by electronic transmission or by mail. The special...

  16. 78 FR 39305 - 30-Day Notice of Proposed Information Collection: OSHC Progress Report Template

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-01

    ... Doc No: 2013-15689] DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT [Docket No. FR-5683-N-54] 30-Day... Development, 451 7th Street SW., Washington, DC 20410; email Colette Pollard at Colette.Pollard@hud.gov or... proposed use: The Appropriations Act, provided a total of $100,000,000 to HUD for a Sustainable...

  17. 77 FR 32638 - Agency Information Collection Request. 30-Day Public Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-01

    ... HUMAN SERVICES Agency Information Collection Request. 30-Day Public Comment Request AGENCY: Office of... Reduction Act of 1995, the Office of the Secretary (OS), Department of Health and Human Services, is...) ways to enhance the quality, utility, and clarity of the information to be collected; and (4) the...

  18. 78 FR 52964 - 30-Day Notice of Proposed Information Collection: Section 8 Management Assessment Program (SEMAP...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-27

    ... From the Federal Register Online via the Government Publishing Office ] DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Section 8 Management Assessment..., Reports Management Officer, QDAM, Department of Housing and Urban Development, 451 7th Street...

  19. 78 FR 65695 - 30-Day Notice of Proposed Information Collection: Technical Processing Requirements for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-01

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Technical Processing Requirements..., Department of Housing and Urban Development, 451 7th Street SW., Washington, DC 20410; email Colette...

  20. 78 FR 66042 - 30-Day Notice of Proposed Information Collection: Section 3 Business Registry Pilot Program...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-04

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Section 3 Business Registry Pilot..., Reports Management Officer, QDAM, Department of Housing and Urban Development, 451 7th Street...

  1. 75 FR 50791 - 30-Day Notice of Proposed Information Collection: Recording, Reporting, and Data Collection...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-17

    ... following information collection request to the Office of Management and Budget (OMB) for approval in... Office: Bureau of Educational and Cultural Affairs, Office of Designation, ECA/EC/D. Form Number: Forms...: Submit comments to the Office of Management and Budget (OMB) for up to 30 days from August 17,...

  2. 76 FR 79683 - Agency Information Collection Request. 30-Day Public Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-22

    ... HUMAN SERVICES Agency Information Collection Request. 30-Day Public Comment Request AGENCY: Office of... Reduction Act of 1995, the Office of the Secretary (OS), Department of Health and Human Services, is... new AIDS cases. As one strategy to address this disparity, the U.S. Department of Health and...

  3. 78 FR 79474 - 30-Day Notice of Proposed Information Collection: Father's Day

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-30

    ...HUD has submitted the proposed information collection requirement described below to the Office of Management and Budget (OMB) for review, in accordance with the Paperwork Reduction Act. The purpose of this notice is to allow for an additional 30 days of public...

  4. 78 FR 79475 - 30-Day Notice of Proposed Information Collection: The Impact of Housing and Services...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-30

    ...HUD has submitted the proposed information collection requirement described below to the Office of Management and Budget (OMB) for review, in accordance with the Paperwork Reduction Act. The purpose of this notice is to allow for an additional 30 days of public...

  5. 78 FR 75365 - 30-Day Notice of Proposed Information Collection: Assessment of Native American, Alaska Native...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-11

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Assessment of Native American..., Department of Housing and Urban Development, 451 7th Street SW., Washington, DC 20410; email Colette Pollard... Number: 2528-0288. Type of Request: Revision of a currently approved collection. Form Number:...

  6. 78 FR 79703 - Submission for OMB Review; 30-Day Comment Request: Application Process for Clinical Research...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-31

    ... for OMB Review; 30-Day Comment Request: Application Process for Clinical Research Training and Medical... contact: Robert M. Lembo, MD, Deputy Director, Office of Clinical Research Training and Medical Education... Process for Clinical Research Training and Medical Education at the Clinical Center and its Impact...

  7. 76 FR 6794 - 30-Day Submission Period for Requests for ONC-Approved Accreditor (ONC-AA) Status

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-08

    ... HUMAN SERVICES 30-Day Submission Period for Requests for ONC-Approved Accreditor (ONC-AA) Status AGENCY... ONC-Approved Accreditor (ONC-AA) status. Authority: 42 U.S.C. 300jj-11. DATES: The 30-day submission... a notice in the Federal Register to announce the 30-day period during which requests for...

  8. New consensus definition for acute kidney injury accurately predicts 30-day mortality in cirrhosis with infection

    PubMed Central

    Wong, Florence; O’Leary, Jacqueline G; Reddy, K Rajender; Patton, Heather; Kamath, Patrick S; Fallon, Michael B; Garcia-Tsao, Guadalupe; Subramanian, Ram M.; Malik, Raza; Maliakkal, Benedict; Thacker, Leroy R; Bajaj, Jasmohan S

    2015-01-01

    Background & Aims A consensus conference proposed that cirrhosis-associated acute kidney injury (AKI) be defined as an increase in serum creatinine by >50% from the stable baseline value in <6 months or by ≥0.3mg/dL in <48 hrs. We prospectively evaluated the ability of these criteria to predict mortality within 30 days among hospitalized patients with cirrhosis and infection. Methods 337 patients with cirrhosis admitted with or developed an infection in hospital (56% men; 56±10 y old; model for end-stage liver disease score, 20±8) were followed. We compared data on 30-day mortality, hospital length-of-stay, and organ failure between patients with and without AKI. Results 166 (49%) developed AKI during hospitalization, based on the consensus criteria. Patients who developed AKI had higher admission Child-Pugh (11.0±2.1 vs 9.6±2.1; P<.0001), and MELD scores (23±8 vs17±7; P<.0001), and lower mean arterial pressure (81±16mmHg vs 85±15mmHg; P<.01) than those who did not. Also higher amongst patients with AKI were mortality in ≤30 days (34% vs 7%), intensive care unit transfer (46% vs 20%), ventilation requirement (27% vs 6%), and shock (31% vs 8%); AKI patients also had longer hospital stays (17.8±19.8 days vs 13.3±31.8 days) (all P<.001). 56% of AKI episodes were transient, 28% persistent, and 16% resulted in dialysis. Mortality was 80% among those without renal recovery, higher compared to partial (40%) or complete recovery (15%), or AKI-free patients (7%; P<.0001). Conclusions 30-day mortality is 10-fold higher among infected hospitalized cirrhotic patients with irreversible AKI than those without AKI. The consensus definition of AKI accurately predicts 30-day mortality, length of hospital stay, and organ failure. PMID:23999172

  9. Rotational dynamics of cargos at pauses during axonal transport

    SciTech Connect

    Gu, Yan; Sun, Wei; Wang, Gufeng; Jeftinija, Ksenija; Jeftinija, Srdija; Fang, Ning

    2012-08-28

    Direct visualization of axonal transport in live neurons is essential for our understanding of the neuronal functions and the working mechanisms of microtubule-based motor proteins. Here we use the high-speed single particle orientation and rotational tracking technique to directly visualize the rotational dynamics of cargos in both active directional transport and pausing stages of axonal transport, with a temporal resolution of 2 ms. Both long and short pauses are imaged, and the correlations between the pause duration, the rotational behaviour of the cargo at the pause, and the moving direction after the pause are established. Furthermore, the rotational dynamics leading to switching tracks are visualized in detail. These first-time observations of cargo's rotational dynamics provide new insights on how kinesin and dynein motors take the cargo through the alternating stages of active directional transport and pause.

  10. 30-Day Survival Probabilities as a Quality Indicator for Norwegian Hospitals: Data Management and Analysis

    PubMed Central

    Hassani, Sahar; Lindman, Anja Schou; Kristoffersen, Doris Tove; Tomic, Oliver; Helgeland, Jon

    2015-01-01

    Background The Norwegian Knowledge Centre for the Health Services (NOKC) reports 30-day survival as a quality indicator for Norwegian hospitals. The indicators have been published annually since 2011 on the website of the Norwegian Directorate of Health (www.helsenorge.no), as part of the Norwegian Quality Indicator System authorized by the Ministry of Health. Openness regarding calculation of quality indicators is important, as it provides the opportunity to critically review and discuss the method. The purpose of this article is to describe the data collection, data pre-processing, and data analyses, as carried out by NOKC, for the calculation of 30-day risk-adjusted survival probability as a quality indicator. Methods and Findings Three diagnosis-specific 30-day survival indicators (first time acute myocardial infarction (AMI), stroke and hip fracture) are estimated based on all-cause deaths, occurring in-hospital or out-of-hospital, within 30 days counting from the first day of hospitalization. Furthermore, a hospital-wide (i.e. overall) 30-day survival indicator is calculated. Patient administrative data from all Norwegian hospitals and information from the Norwegian Population Register are retrieved annually, and linked to datasets for previous years. The outcome (alive/death within 30 days) is attributed to every hospital by the fraction of time spent in each hospital. A logistic regression followed by a hierarchical Bayesian analysis is used for the estimation of risk-adjusted survival probabilities. A multiple testing procedure with a false discovery rate of 5% is used to identify hospitals, hospital trusts and regional health authorities with significantly higher/lower survival than the reference. In addition, estimated risk-adjusted survival probabilities are published per hospital, hospital trust and regional health authority. The variation in risk-adjusted survival probabilities across hospitals for AMI shows a decreasing trend over time: estimated

  11. Long-term effects of suppressing the preratio pause.

    PubMed

    Derenne, Adam; Richardson, Joseph V; Baron, Alan

    2006-03-01

    The preratio pause is a characteristic feature of performances under fixed-ratio schedules of reinforcement, even though the pause is not required by the schedule and it reduces the reinforcement rate. To investigate the reduction of pausing, five rats trained on fixed-ratio schedules were exposed to timeout punishment of pauses that exceeded a specified duration. After a series of 30 punishment sessions, most of the longest pauses were eliminated. For some subjects punishment was withdrawn abruptly, whereas for others a fading procedure was employed. Postpunishment observations then were continued for an additional 60 sessions. The reduced pausing was accompanied by reductions in the positive skew of the baseline distribution of pause durations, and by substantial increases in reinforcement rates. However, the results did not indicate differences as a function of the method of withdrawing the punishment contingency. Although postpunishment performances indicated some degree of recovery in the number of long pauses, performances had stabilized below prepunishment levels when the experiment ended. The results suggest the possibility that reduced pause durations can be self-maintained by the resulting increase in reinforcement rates.

  12. Work capacity during 30 days of bed rest with isotonic and isokinetic exercise training

    NASA Technical Reports Server (NTRS)

    Greenleaf, J. E.; Bernauer, E. M.; Ertl, A. C.; Trowbridge, T. S.; Wade, C. E.

    1989-01-01

    Results are presented from a study to determine whether or not short-term variable intensity isotonic and intermittent high-intensity isokinetic short-duration leg exercise is effective for the maintenance of peak O2 (VO2) uptake and muscular strength and endurance, respectively, during 30 days of -6 deg head-down bed rest deconditioning. The results show no significant changes in leg peak torque, leg mean total work, arm total peak torque, or arm mean total work for members of the isotonic, isokinetic, and controls groups. Changes are observed, however, in peak VO2 levels. The results suggest that near-peak variabile intensity, isotonic leg excercise maintains peak VO2 during 30 days of bed rest, while peak intermittent, isokinetic leg excercise protocol does not.

  13. Analysis of weekend effect on 30-day mortality among patients with acute myocardial infarction

    PubMed Central

    Noad, Rebecca; Stevenson, Michael; Herity, Niall A

    2017-01-01

    Objectives Several publications have demonstrated increased 30-day mortality in patients admitted on Saturdays or Sundays compared with weekdays. We sought to determine whether this was true for two different cohorts of patients admitted with acute myocardial infarction (MI). Methods and results Thirty-day mortality data were obtained for 3757 patients who had been admitted to the Belfast Health and Social Care Trust with acute MI between 2009 and 2015. They were subdivided into those presenting with ST elevation MI (n=2240) and non-ST elevation MI (n= 1517). We observed no excess 30-day mortality in those admitted over weekends. Conclusion Excess mortality in patients admitted at weekends is not a universal finding. This may mean that that there are patient subgroups with proportionately greater weekend hazard and points to the need for more detailed understanding of the weekend effect.

  14. A Comprehensive Analysis of the Causes and Predictors of 30-Day Mortality Following Hip Fracture Surgery

    PubMed Central

    Hossain, Fahad Siddique; Aqil, Adeel; Akinbamijo, Babawande; Mushtaq, Vhaid; Kapoor, Harish

    2017-01-01

    Background A fracture neck of femur is the leading cause of injury-related mortality in the elderly population. The 30-day mortality figure is a well utilised marker of clinical outcome following a fracture neck of femur. Current studies fail to analyse all patient demographic, biochemical and comorbid parameters associated with increased 30-day mortality. We aimed to assess medical risk factors for mortality, which are easily identifiable on admission for patients presenting with a fractured neck of femur. Methods A retrospective review of a prospectively populated database was undertaken to identify all consecutive patients with a fracture neck of femur between October 2008 and March 2011. All factors related to the patient, injury and surgery were identified. The primary outcome of interest was 30-day mortality. Univariate and subsequent multivariate analyses using a backward stepwise likelihood ratio Cox regression model were performed in order to establish all parameters that significantly increased the risk of death. Results A total of 1,356 patients were included in the study. The 30-day mortality was 8.7%. The most common causes of death included pneumonia, sepsis and acute myocardial infarction. Multiple regression analysis revealed male gender, increasing age, admission source other than the patient's own home, admission haemoglobin of less than 10 g/dL, a history of myocardial infarction, concomitant chest infection during admission, increasing Charlson comorbidity score and liver disease to be significant predictors of mortality. Conclusions This study has elucidated risk factors for mortality using clinical and biochemical information which are easily gathered at the point of hospitalization. These results allow for identification of vulnerable patients who may benefit from a prioritisation of resources. PMID:28261422

  15. Incidence, Causes and Predictors of 30-Day Readmission After Shoulder Arthroplasty

    PubMed Central

    Westermann, Robert W; Anthony, Chris A.; Duchman, Kyle R.; Pugely, Andrew J.; Gao, Yubo; Hettrich, Carolyn M.

    2016-01-01

    Background The Center for Medicare and Medicaid Service has identified several quality metrics, including unplanned readmission within 30 days of surgery, to assess and compare surgeons and hospitals. The purpose of this study was to identify the incidence, causes and risk factors for unplanned 30-day readmission after total shoulder arthroplasty. Methods We identified patients undergoing primary elective shoulder arthroplasty performed at American College of Surgeons National Surgical Quality Improvement Program (ACS NSQIP) participating hospitals in 2013. Cases were stratified by readmission status. Univariate and multivariate analyses were employed to assess patient demographics, comorbidities and operative variables predicting unplanned readmission. Results 2779 patients undergoing shoulder arthroplasty were identified, with 74 (2.66%) requiring unplanned readmissions within 30 days of surgery. The most common surgical causes for unplanned readmission were surgical site infections (18.6%), dislocations (16.3%) and venous thromboembolism (14.0%). Medical causes for readmission were responsible for 51% of unplanned readmissions. Multivariate analysis identified patient age >75 (OR 2.62, 95% CI: 1.27 - 5.41), and ASA class of 3 (OR 1.79, 95% CI: 1.01 - 3.18) or 4 (OR 3.63, 95% CI: 1.31 - 10.08) as independent risk factors for unplanned readmission. Predictive modeling estimated that patients with ASA class of 4 and age >75 are 17.4 times more likely (95% CI 1.77-171.09) to be readmitted within 30 days of shoulder arthroplasty. Conclusion Unplanned readmission after shoulder arthroplasty is infrequent and medical complications account for more than 50% of occurrences. The risk of readmission exponentially increases when age and preoperative comorbidity burden are increased. PMID:27528839

  16. Skeletal muscle adaptations following blood flow-restricted training during 30 days of muscular unloading.

    PubMed

    Cook, Summer B; Brown, Kimberly A; Deruisseau, Keith; Kanaley, Jill A; Ploutz-Snyder, Lori L

    2010-08-01

    This study evaluated the effectiveness of low-load resistance training with a blood flow restriction (LL(BFR)) to attenuate muscle loss and weakness after 30 days of unilateral lower limb suspension (ULLS). Sixteen subjects (ages 18-50 yr) underwent 30 days of ULLS. Measurements of muscle strength, cross-sectional area, and endurance on the knee extensors and plantar flexors were collected before and after ULLS. Plasma concentrations of IGF-1 and IGFBP-3 were also assessed. During ULLS, eight subjects (5 males, 3 females) participated in LL(BFR) three times per week (ULLS + Exercise) while eight subjects (4 males, 4 females) did not exercise (ULLS). The blood flow-restricted exercise consisted of dynamic knee extension at 20% of the subject's isometric maximum voluntary contraction coupled with a suprasystolic blood flow restriction. After 30 days of limb suspension, the ULLS + Exercise group experienced minimal and insignificant losses in knee extensor cross-sectional area and strength (1.2% and 2.0%, respectively; P 0.05). Muscular endurance in the knee extensors improved 31% in the ULLS + Exercise group, while it decreased 24% in the ULLS group (P = 0.01). No changes were seen in hormone concentrations throughout the study. In conclusion, LL(BFR) of the knee extensors is effective in maintaining muscle strength and size during 30 days of ULLS and results in improved knee extensor muscular endurance.

  17. The 10-30-day intraseasonal variation of the East Asian winter monsoon: The temperature mode

    NASA Astrophysics Data System (ADS)

    Yao, Suxiang; Sun, Qingfei; Huang, Qian; Chu, Peng

    2016-09-01

    East Asia is known for its monsoon characteristics, but little research has been performed on the intraseasonal time scale of the East Asian winter monsoon (EAWM). In this paper, the extended reanalysis (ERA)-Interim sub-daily data are used to study the surface air temperature intraseasonal oscillation (ISO) of the EAWM. The results show that the air temperature (2-m level) of the EAWM has a dominant period of 10-30 days. Lake Baikal and south China are the centers of the air temperature ISO. An anomalous low frequency (10-30-day filtered) anticyclone corresponds to the intraseasonal cold air. The 10-30-day filtered cold air spreads from Novaya Zemlya to Lake Baikal and even to South China. The ISO of the Arctic Oscillation (AO) index influences the temperature of the EAWM by stimulating Rossby waves in middle latitude, causing meridional circulation, and eventually leads to the temperature ISO of the EAWM. RegCM4 has good performance for the simulation of the air temperature ISO. The simulated results indicate that the plateau is responsible for the southward propagation of the intraseasonal anticyclone. The anticyclone could not reach South China when there was no plateau in western China and its upper reaches.

  18. Surgeon volume and 30 day mortality for brain tumours in England

    PubMed Central

    Williams, Matt; Treasure, Peter; Greenberg, David; Brodbelt, Andrew; Collins, Peter

    2016-01-01

    Background: There is evidence that surgeons who perform more operations have better outcomes. However, in patients with brain tumours, all of the evidence comes from the USA. Methods: We examined all English patients with an intracranial neoplasm who had an intracranial resection in 2008–2010. We included surgeons who performed at least six operations over 3 years, and at least one operation in the first and last 6 months of the period. Results: The analysis data set comprised 9194 operations, 163 consultant neurosurgeons and 30 centres. Individual surgeon volumes varied widely (7–272; median=46). 72% of operations were on the brain, and 30 day mortality was 3%. A doubling of surgeon load was associated with a 20% relative reduction in mortality. Thirty day mortality varied between centres (0·95–8·62%) but was not related to centre workload. Conclusions: Individual surgeon volumes correlated with patient 30 day mortality. Centres and surgeons in England are busier than surgeons and centres in the USA. There is no relationship between centre volume and 30 day mortality in England. Services in the UK appear to be adequately arranged at a centre level, but would benefit from further surgeon sub-specialisation. PMID:27764843

  19. Pausing Patterns: Differences between L2 Learners and Native Speakers

    ERIC Educational Resources Information Center

    Tavakoli, Parvaneh

    2011-01-01

    This paper reports on a comparative study of pauses made by L2 learners and native speakers of English while narrating picture stories. The comparison is based on the number of pauses and total amount of silence in the middle and at the end of clauses in the performance of 40 native speakers and 40 L2 learners of English. The results of the…

  20. Using Habit Reversal to Decrease Filled Pauses in Public Speaking

    ERIC Educational Resources Information Center

    Mancuso, Carolyn; Miltenberger, Raymond G.

    2016-01-01

    This study evaluated the effectiveness of simplified habit reversal in reducing filled pauses that occur during public speaking. Filled pauses consist of "uh," "um," or "er"; clicking sounds; and misuse of the word "like." After baseline, participants received habit reversal training that consisted of…

  1. Phonetic Pause Unites Phonology and Semantics against Morphology and Syntax

    ERIC Educational Resources Information Center

    Sakarna, Ahmad Khalaf; Mobaideen, Adnan

    2012-01-01

    The present study investigates the phonological effect triggered by the different types of phonetic pause used in Quran on morphology, syntax, and semantics. It argues that Quranic pause provides interesting evidence about the close relation between phonology and semantics, from one side, and semantics, morphology, and syntax, from the other…

  2. PBMA Pause and Learn Video Nuggets Transcript

    NASA Technical Reports Server (NTRS)

    Rogers, Ed

    2006-01-01

    This document is a transcript for a video about a practice practiced at Goddard Space Flight Center called Pause and Learn (PaL). The PaL process is intended to, first of all, help the team learn. So, the team that was involved in the activity, the group that actually did the work, that handled the review, or ran the tests, or developed the piece of equipment, they sit down and actually say, "What did we learn from this exercise?" The idea is to create a learning environment at various key milestones in the execution of a process, rather than wait until the end of the given process, be it a launch or a mission.

  3. 17 CFR 240.3a55-2 - Indexes underlying futures contracts trading for fewer than 30 days.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... contracts trading for fewer than 30 days. 240.3a55-2 Section 240.3a55-2 Commodity and Securities Exchanges... Indexes underlying futures contracts trading for fewer than 30 days. (a) An index on which a contract of... the Act (15 U.S.C. 78c(a)(55)) for the first 30 days of trading, if: (1) Such index would not...

  4. 17 CFR 240.3a55-2 - Indexes underlying futures contracts trading for fewer than 30 days.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... contracts trading for fewer than 30 days. 240.3a55-2 Section 240.3a55-2 Commodity and Securities Exchanges... Indexes underlying futures contracts trading for fewer than 30 days. (a) An index on which a contract of... the Act (15 U.S.C. 78c(a)(55)) for the first 30 days of trading, if: (1) Such index would not...

  5. 17 CFR 240.3a55-2 - Indexes underlying futures contracts trading for fewer than 30 days.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... contracts trading for fewer than 30 days. 240.3a55-2 Section 240.3a55-2 Commodity and Securities Exchanges... Indexes underlying futures contracts trading for fewer than 30 days. (a) An index on which a contract of... the Act (15 U.S.C. 78c(a)(55)) for the first 30 days of trading, if: (1) Such index would not...

  6. 17 CFR 240.3a55-2 - Indexes underlying futures contracts trading for fewer than 30 days.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... contracts trading for fewer than 30 days. 240.3a55-2 Section 240.3a55-2 Commodity and Securities Exchanges... Indexes underlying futures contracts trading for fewer than 30 days. (a) An index on which a contract of... the Act (15 U.S.C. 78c(a)(55)) for the first 30 days of trading, if: (1) Such index would not...

  7. 17 CFR 240.3a55-2 - Indexes underlying futures contracts trading for fewer than 30 days.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... contracts trading for fewer than 30 days. 240.3a55-2 Section 240.3a55-2 Commodity and Securities Exchanges... Indexes underlying futures contracts trading for fewer than 30 days. (a) An index on which a contract of... the Act (15 U.S.C. 78c(a)(55)) for the first 30 days of trading, if: (1) Such index would not...

  8. Rat brain pro-oxidant effects of peripherally administered 5 nm ceria 30 days after exposure.

    PubMed

    Hardas, Sarita S; Sultana, Rukhsana; Warrier, Govind; Dan, Mo; Florence, Rebecca L; Wu, Peng; Grulke, Eric A; Tseng, Michael T; Unrine, Jason M; Graham, Uschi M; Yokel, Robert A; Butterfield, D Allan

    2012-10-01

    The objective of this study was to determine the residual pro-or anti-oxidant effects in rat brain 30 days after systemic administration of a 5 nm citrate-stabilized ceria dispersion. A ∼4% aqueous ceria dispersion was iv-infused (0 or 85 mg/kg) into rats which were terminated 30 days later. Ceria concentration, localization, and chemical speciation in the brain was assessed by inductively coupled plasma mass spectrometry (ICP-MS), light and electron microscopy (EM), and electron energy loss spectroscopy (EELS), respectively. Pro- or anti-oxidant effects were evaluated by measuring levels of protein carbonyls (PC), 3-nitrotyrosine (3NT), and protein-bound-4-hydroxy-2-trans-nonenal (HNE) in the hippocampus, cortex, and cerebellum. Glutathione reductase (GR), glutathione peroxidase (GPx), superoxide dismutase (SOD), and catalase levels and activity were measured in addition to levels of inducible nitric oxide (iNOS), and heat shock protein-70 (Hsp70). The blood brain barrier (BBB) was visibly intact and no ceria was seen in the brain cells. Ceria elevated PC and Hsp70 levels in hippocampus and cerebellum, while 3NT and iNOS levels were elevated in the cortex. Whereas glutathione peroxidase and catalase activity were decreased in the hippocampus, GR levels were decreased in the cortex, and GPx and catalase levels were decreased in the cerebellum. The GSH:GSSG ratio, an index of cellular redox status, was decreased in the hippocampus and cerebellum. The results are in accordance with the observation that this nanoscale material remains in this mammal model up to 30 days after its administration and the hypothesis that it exerts pro-oxidant effects on the brain without crossing the BBB. These results have important implications on the potential use of ceria ENM as therapeutic agents.

  9. Derivation and validation of a 30-day heart failure readmission model.

    PubMed

    Fleming, Lisa M; Gavin, Michael; Piatkowski, Gail; Chang, James D; Mukamal, Kenneth J

    2014-11-01

    In 2006, there were >1 million hospital admissions for heart failure (HF), and the estimated cost to the United States in 2009 was >$37.2 billion. Better models to target aggressive therapy to patients at the highest risk for readmission are clearly needed. We studied 3,413 consecutive admissions for HF based on discharge diagnosis codes from October 2007 to August 2011 from a single academic center. We randomly generated derivation and validation sets in a 3:1 ratio. We used generalized estimating equations to develop our models, accounting for repeated hospitalizations and the Hosmer-Lemeshow test to examine model calibration. The 30-day readmission rate was 24.2% in the derivation set. Of 25 candidate variables, the best fitting model included creatinine, troponin, hematocrit, and hyponatremia at discharge; race; zip code of residence; discharge hour; and number of hospitalizations in the previous year. Insignificant variables included intravenous diuretic use on day of discharge, discharge service, diabetes, atrial fibrillation, age, and gender. The risk of 30-day readmission increased with increasing decile of predicted risk in both the validation and derivation cohorts. The area under the receiver operating characteristic curve for the model was 0.69 in the derivation set and 0.66 in the validation set. In conclusion, we derived and validated a simple model relating discharge-specific characteristics at risk of 30-day readmission. Application of this approach may facilitate targeted intervention to reduce the burden of rehospitalization in patients with HF, but our results suggest that the best readmission models may require incorporation of both clinical and local system factors for optimal prediction.

  10. Changes in size and compliance of the calf after 30 days of simulated microgravity

    NASA Technical Reports Server (NTRS)

    Convertino, Victor A.; Doerr, Donald F.; Stein, Stewart L.

    1989-01-01

    The hypothesis that reducing muscle compartment by a long-term exposure to microgravity would cause increased leg venous compliance was tested in eight men who were assessed for vascular compliance and for serial circumferences of the calf before and after 30 days of continuous 6-deg head-down bed rest. It was found that head-down bed rest caused decreases in the calculated calf volume and the calf-muscle compartment, as well as increases in calf compliance. The percent increases in calf compliance correlated significantly with decreases in calf muscle compartment.

  11. Race, Rehabilitation, and 30-Day Readmission After Elective Total Knee Arthroplasty

    PubMed Central

    Jorgenson, Erik S.; Richardson, Diane M.; Thomasson, Arwin M.; Nelson, Charles L.

    2015-01-01

    Introduction: To examine racial variations in access to postacute care (PAC) and rehabilitation (Rehab) services following elective total knee arthroplasty and whether where patients go after surgery for PAC/Rehab is associated with 30-day readmission to acute care facility. Materials and Methods: Sample consisted of 129 522 patients discharged from 169 hospitals in the State of Pennsylvania between fiscal years 2008 and 2012. We used multinomial regression models to assess the relationship between patient race and discharge destination after surgery, for patients aged 18 to 64 years and for those aged 65 and older. We used multivariable (MV) regression and propensity score (PS) approaches to examine the relationship between patient discharge destination after surgery for PAC/Rehab and 30-day readmission, controlling for key individual- and facility-level factors. Results: Lower proportions of younger patients compared to those older than 65 were discharged to inpatient rehabilitation facilities (IRFs; 5.8% vs 12.6%, respectively) and skilled nursing facilities (SNFs; 15.2% vs 32.7%, respectively) compared to home-based Rehab (self-care; 23.3% vs 14.2%, respectively). Compared to whites, African American patients had significantly higher odds of discharge to IRF (age < 65, odds ratio = 2.04; age ≥ 65, odds ratio = 1.64) and to SNF (age < 65, odds ratio = 2.86; age ≥ 65, odds ratio = 2.19) and discharge to home care in patients younger than 65 years (odds ratio = 1.31). The odds of 30-day readmission among patients discharged to an IRF (MV odds ratio = 7.76; PS odds ratio = 8.34) and SNF (MV odds ratio = 2.01; PS odds ratio = 1.83) were significantly higher in comparison to patients discharged home with self-care. Conclusion: African American patients with knee replacement are more likely to be discharged to inpatient Rehab settings following surgery. Inpatient Rehab is significantly associated with 30-day readmission to acute care facility. PMID:26623166

  12. Development and implementation of a real-time 30-day readmission predictive model.

    PubMed

    Cronin, Patrick R; Greenwald, Jeffrey L; Crevensten, Gwen C; Chueh, Henry C; Zai, Adrian H

    2014-01-01

    Hospitals are under great pressure to reduce readmissions of patients. Being able to reliably predict patients at increased risk for rehospitalization would allow for tailored interventions to be offered to them. This requires the creation of a functional predictive model specifically designed to support real-time clinical operations. A predictive model for readmissions within 30 days of discharge was developed using retrospective data from 45,924 MGH admissions between 2/1/2012 and 1/31/2013 only including factors that would be available by the day after admission. It was then validated prospectively in a real-time implementation for 3,074 MGH admissions between 10/1/2013 and 10/31/2013. The model developed retrospectively had an AUC of 0.705 with good calibration. The real-time implementation had an AUC of 0.671 although the model was overestimating readmission risk. A moderately discriminative real-time 30-day readmission predictive model can be developed and implemented in a large academic hospital.

  13. The Relationship Between Nurse Staffing and 30-Day Readmission for Adults With Heart Failure

    PubMed Central

    Giuliano, Karen K.; Danesh, Valerie; Funk, Marjorie

    2016-01-01

    OBJECTIVE The purpose of this study was to better understand the relationship between nurse staffing and 30-day excess readmission ratios for patients with heart failure in the top US adult cardiology and heart surgery hospitals. BACKGROUND Heart failure is the most common cause of hospitalization for patients older than 65 years and is the most frequent diagnosis associated with 30-day hospital readmission in the United States. METHODS A secondary data analysis was conducted using nurse staffing data from 661 cardiology and heart surgery hospitals from the 2013 US News & World Report “Best Hospitals” survey. These data were combined with excess readmission ratios from the Centers for Medicare & Medicaid Services Hospital Compare database from 2013. An independent-samples t test was used to compare staffing (low/high) and excess hospital readmissions rates. RESULTS A significant difference (P = .021) was found between the low nurse staffing group (n = 358) and the high nurse staffing group (n = 303). Hospitals with a lower nurse staffing index had a significantly higher excess readmission rate. CONCLUSION These data provide further support to the body of research showing a positive relationship between nurse staffing and positive outcomes. PMID:26579974

  14. Pausing and Backtracking in Transcription Under Dense Traffic Conditions

    NASA Astrophysics Data System (ADS)

    Klumpp, Stefan

    2011-04-01

    RNA polymerases transcribe the genetic information from DNA to RNA. They move along the DNA by stochastic single-nucleotide steps that are interrupted by pauses. Here we use a variant of driven lattice gas models or exclusion processes to study the effects of these pauses under conditions, where many RNA polymerases transcribe the same gene. We consider elemental pauses, where RNA polymerases are inactive and immobile, and backtracking pauses, during which RNA polymerases translocate backwards in a diffusive fashion. Under single-molecule conditions, backtracking can lead to complex dynamics due to a power-law distribution of the pause durations. Under conditions of dense RNA polymerase traffic, as in the highly transcribed genes coding for ribosomal RNA and transfer RNA, backtracking pauses are strongly suppressed because the trailing active RNA polymerase restricts the space available for backward translocation and ratchets the leading backtracked RNA polymerase forward. We characterize this effect quantitatively using extensive computer simulations. Furthermore, we show that such suppression of pauses may have a regulatory role and lead to highly cooperative control functions when coupled to transcription termination.

  15. 78 FR 70958 - 30-Day Notice of Proposed Information Collection: Recordkeeping for HUD's Continuum of Care Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-27

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Recordkeeping for HUD's Continuum of Care Program AGENCY: Office of the Chief Information Officer, HUD. ACTION: Notice. SUMMARY: HUD has... allow for an additional 30 days of public comment. DATES: Comments Due Date: December 27,...

  16. Early inpatient calculation of laboratory-based 30-day readmission risk scores empowers clinical risk modification during index hospitalization.

    PubMed

    Horne, Benjamin D; Budge, Deborah; Masica, Andrew L; Savitz, Lucy A; Benuzillo, José; Cantu, Gabriela; Bradshaw, Alejandra; McCubrey, Raymond O; Bair, Tami L; Roberts, Colleen A; Rasmusson, Kismet D; Alharethi, Rami; Kfoury, Abdallah G; James, Brent C; Lappé, Donald L

    2017-03-01

    Improving 30-day readmission continues to be problematic for most hospitals. This study reports the creation and validation of sex-specific inpatient (i) heart failure (HF) risk scores using electronic data from the beginning of inpatient care for effective and efficient prediction of 30-day readmission risk.

  17. Correspondence between hair cortisol concentrations and 30-day integrated daily salivary and weekly urinary cortisol measures.

    PubMed

    Short, Sarah J; Stalder, Tobias; Marceau, Kristine; Entringer, Sonja; Moog, Nora K; Shirtcliff, Elizabeth A; Wadhwa, Pathik D; Buss, Claudia

    2016-09-01

    Characterization of cortisol production, regulation and function is of considerable interest and relevance given its ubiquitous role in virtually all aspects of physiology, health and disease risk. The quantification of cortisol concentration in hair has been proposed as a promising approach for the retrospective assessment of integrated, long-term cortisol production. However, human research is still needed to directly test and validate current assumptions about which aspects of cortisol production and regulation are reflected in hair cortisol concentrations (HCC). Here, we report findings from a validation study in a sample of 17 healthy adults (mean±SD age: 34±8.6 yrs). To determine the extent to which HCC captures cumulative cortisol production, we examined the correspondence of HCC, obtained from the first 1cm scalp-near hair segment, assumed to retrospectively reflect 1-month integrated cortisol secretion, with 30-day average salivary cortisol area-under-the curve (AUC) based on 3 samples collected per day (on awakening, +30min, at bedtime) and the average of 4 weekly 24-h urinary free cortisol (UFC) assessments. To further address which aspects of cortisol production and regulation are best reflected in the HCC measure, we also examined components of the salivary measures that represent: (1) production in response to the challenge of awakening (using the cortisol awakening response [CAR]), and (2) chronobiological regulation of cortisol production (using diurnal slope). Finally, we evaluated the test-retest stability of each cortisol measure. Results indicate that HCC was most strongly associated with the prior 30-day integrated cortisol production measure (average salivary cortisol AUC) (r=0.61, p=0.01). There were no significant associations between HCC and the 30-day summary measures using CAR or diurnal slope. The relationship between 1-month integrated 24-h UFC and HCC did not reach statistical significance (r=0.30, p=0.28). Lastly, of all cortisol

  18. Etiologies, Trends, and Predictors of 30-Day Readmission in Patients With Heart Failure.

    PubMed

    Arora, Shilpkumar; Patel, Prashant; Lahewala, Sopan; Patel, Nilay; Patel, Nileshkumar J; Thakore, Kosha; Amin, Aditi; Tripathi, Byomesh; Kumar, Varun; Shah, Harshil; Shah, Mahek; Panaich, Sidakpal; Deshmukh, Abhishek; Badheka, Apurva; Gidwani, Umesh; Gopalan, Radha

    2017-03-01

    Heart failure (HF) is the most common discharge diagnosis across the United States, and these patients are particularly vulnerable to readmissions, increasing attention to potential ways to address the problem. The study cohort was derived from the Healthcare Cost and Utilization Project's National Readmission Data 2013, sponsored by the Agency for Healthcare Research and Quality. HF was identified using appropriate International Classification of Diseases, Ninth Revision, Clinical Modification codes. Readmission was defined as a subsequent hospital admission within 30 days after discharge day of index admission. Readmission causes were identified using International Classification of Diseases, Ninth Revision, codes in primary diagnosis filed. The primary outcome was 30-day readmission. Hierarchical 2-level logistic models were used to evaluate study outcomes. From a total 301,892 principal admissions (73.4% age ≥65 years and 50.6% men), 55,857 (18.5%) patients were readmitted with a total of 64,264 readmissions during the study year. Among the etiologies of readmission, cardiac causes (49.8%) were most common (HF being most common followed by coronary artery disease and arrhythmias), whereas pulmonary causes were responsible for 13.1% and renal causes for 8.9% of the readmissions. Significant predictors of increased 30-day readmission included diabetes (odds ratio, 95% confidence interval, p value: 1.06, 1.03 to 1.08, p <0.001), chronic lung disease (1.13, 1.11 to 1.16, p <0.001), renal failure/electrolyte imbalance (1.12, 1.10 to 1.15, p <0.001), discharge to facilities (1.07, 1.04 to 1.09, p <0.001), lengthier hospital stay, and transfusion during index admission. In conclusion, readmission after a hospitalization for HF is common. Although it may be necessary to readmit some patients, the striking rate of readmission demands efforts to further clarify the determinants of readmission and develop strategies in terms of quality of care and care transitions to

  19. Incidence And Risk Factors For 30-Day Readmissions After Hip Fracture Surgery

    PubMed Central

    Martin, Christopher T; Gao, Yubo; Pugely, Andrew J.

    2016-01-01

    Background Unplanned hospital readmission following orthopedic procedures results in significant expenditures for the Medicare population. In order to reduce expenditures, hospital readmission has become an important quality metric for Medicare patients. The purpose of the present study is to determine the incidence and risk factors for 30-day readmissions after hip fracture surgery. Methods Patients over the age of 18 years who underwent hip fracture surgery, including open reduction internal fixation (ORIF), intramedullary nailing, hemi-arthroplasty, or total hip arthroplasty, between the years 2012 and 2013 were identified from the American College of Surgeons National Surgical Quality improvement Program (NSQIP) database. Overall, 17,765 patients were identified. Univariate and multivariate analyses were performed in order to determine patient and surgical factors associated with 30-day readmission. Results There were 1503 patients (8.4%) readmitted within 30-days of their index procedure. Of the patients with a reason listed for readmission, 27.4% were for procedurally related reasons, including wound complications (16%), peri-prosthetic fractures (4.5%) and prosthetic dislocations (6%). 72.6% of readmissions were for medical reasons, including sepsis (7%), pneumonia (14%), urinary tract infection (6.3%), myocardial infarction (2.7%), renal failure (2.7%), and stroke (2.3%). In the subsequent multivariate analysis, pre-operative dyspnea, COPD, hypertension, disseminated cancer, a bleeding disorder, pre-operative hematocrit of <36, pre-operative creatinine of >1.2, an ASA class of 3 or 4, and the operative procedure type were each independently associated with readmissions risk (p<0.05 for each). Conclusions The overall rate of readmission following hip fracture surgery was moderate. Surgeons should consider discharge optimization in the at risk cohorts identified here, particularly patients with multiple medical comorbidities or an elevated ASA class, and

  20. Assessing Risk and Preventing 30-Day Readmissions in Decompensated Heart Failure: Opportunity to Intervene?

    PubMed

    Dunbar-Yaffe, Richard; Stitt, Audra; Lee, Joseph J; Mohamed, Shanas; Lee, Douglas S

    2015-10-01

    Heart failure (HF) patients are at high risk of hospital readmission, which contributes to substantial health care costs. There is great interest in strategies to reduce rehospitalization for HF. However, many readmissions occur within 30 days of initial hospital discharge, presenting a challenge for interventions to be instituted in a short time frame. Potential strategies to reduce readmissions for HF can be classified into three different forms. First, patients who are at high risk of readmission can be identified even before their initial index hospital discharge. Second, ambulatory remote monitoring strategies may be instituted to identify early warning signs before acute decompensation of HF occurs. Finally, strategies may be employed in the emergency department to identify low-risk patients who may not need hospital readmission. If symptoms improve with initial therapy, low-risk patients could be referred to specialized, rapid outpatient follow-up care where investigations and therapy can occur in an outpatient setting.

  1. The Gravity of LBNP Exercise: Lessons Learned from Identical Twins in Bed for 30 Days

    NASA Technical Reports Server (NTRS)

    Hargens, Alan R.; Groppo, Eli R.; Lee, Stuart M. C.; Watenpaugh, Donald; Schneider, Suzanne; O'Leary, Deborah; Smith, Scott M.; Steinbach, Gregory C.; Tanaka, Kunihiko; Kimura, Shinji; Meyer, R. Scott

    2002-01-01

    Microgravity leads to cardiovascular deconditioning in humans, which is manifested by post-flight reduction of orthostatic tolerance and upright exercise capacity. During upright posture on Earth, blood pressures are greater in the feet than at heart or head levels due to gravity's effects on columns of blood in the body. During exposure to Microgravity, all gravitational blood pressures disappear. Presently, there is no exercise hardware available for space flight to provide gravitational blood pressures to tissues of the lower body. We hypothesized that 40 minutes of supine treadmill running per day in a LBNP chamber at 1.0 to 1.2 body weight (approximately 50 - 60 mm Hg LBNP) with a 5 min resting, nonexercise LBNP exposure at 50 mm Hg after the exercise session will maintain aerobic fitness orthostatic tolerance, and selected parameters of musculoskeletal function during 30 days of bed rest (simulated microgravity). This paper is an interim report of some of our findings on 16 subjects.

  2. Development of Lightweight Material Composites to Insulate Cryogenic Tanks for 30-Day Storage in Outer Space

    NASA Technical Reports Server (NTRS)

    Krause, D. R.

    1972-01-01

    A conceptual design was developed for an MLI system which will meet the design constraints of an ILRV used for 7- to 30-day missions. The ten tasks are briefly described: (1) material survey and procurement, material property tests, and selection of composites to be considered; (2) definition of environmental parameters and tooling requirements, and thermal and structural design verification test definition; (3) definition of tanks and associated hardware to be used, and definition of MLI concepts to be considered; (4) thermal analyses, including purge, evacuation, and reentry repressurization analyses; (5) structural analyses (6) thermal degradation tests of composite and structural tests of fastener; (7) selection of MLI materials and system; (8) definition of a conceptual MLI system design; (9) evaluation of nondestructive inspection techniques and definition of procedures for repair of damaged areas; and (10) preparation of preliminary specifications.

  3. Structural and metabolic characteristics of human skeletal muscle following 30 days of simulated microgravity

    NASA Technical Reports Server (NTRS)

    Hikida, Robert S.; Gollnick, Philip D.; Dudley, Gary A.; Convertino, Victor A.; Buchanan, Paul

    1989-01-01

    The effects of simulated microgravity (30 days of continuous 6-deg headdown bedrest, BR) on the structural and metabolic characteristics of human skeletal muscle were determined. Percutaneous needle biopsy samples obtained from the vastus lateralis and soleus muscles before and after the headdown BR were analyzed for histochemical, biochemical and ultrastructual changes. It was found that headdown BR led to decreases in both fast-twitch and slow-twitch fiber areas in both muscles, and there was evidence of remodeling of the ultrastructure in both muscles. The activities of beta-hydroxyacyl-CoA dehydrogenase and citrate synthase were reduced during BR, but phosphofructokinase and lactate dehydrogenase activities did not change. The results indicate that 30-d exposure to simulated microgravity decreased the capacity for aerobic energy supply of human skeletal muscle and led to a disorganization of the contractile machinery.

  4. Continuous 30-day measurements utilizing the monkey metabolism pod. [study of weightlessness effects

    NASA Technical Reports Server (NTRS)

    Pace, N.; Kodama, A. M.; Mains, R. C.; Rahlmann, D. F.; Grunbaum, B. W.

    1977-01-01

    A fiberglass system was previously described, using which quantitative physiological measurements could be made to study the effects of weightlessness on 10 to 14 kg adult monkeys maintained in comfortable restraint under space flight conditions. Recent improvements in the system have made it possible to obtain continuous measurements of respiratory gas exchange, cardiovascular function, and mineral balance for periods of up to 30 days on pig-tailed monkeys. It has also been possible to operate two pods which share one set of instrumentation, thereby permitting simultaneous measurements to be made on two animals by commutating signal outputs from the pods. In principle, more than two pods could be operated in this fashion. The system is compatible with Spacelab design. Representative physiological data from ground tests of the system are presented.

  5. Bone metabolism and nutritional status during 30-day head-down-tilt bed rest.

    PubMed

    Morgan, Jennifer L L; Zwart, Sara R; Heer, Martina; Ploutz-Snyder, Robert; Ericson, Karen; Smith, Scott M

    2012-11-01

    Bed rest studies provide an important tool for modeling physiological changes that occur during spaceflight. Markers of bone metabolism and nutritional status were evaluated in 12 subjects (8 men, 4 women; ages 25-49 yr) who participated in a 30-day -6° head-down-tilt diet-controlled bed rest study. Blood and urine samples were collected twice before, once a week during, and twice after bed rest. Data were analyzed using a mixed-effects linear regression with a priori contrasts comparing all days to the second week of the pre-bed rest acclimation period. During bed rest, all urinary markers of bone resorption increased ~20% (P < 0.001), and serum parathyroid hormone decreased ~25% (P < 0.001). Unlike longer (>60 days) bed rest studies, neither markers of oxidative damage nor iron status indexes changed over the 30 days of bed rest. Urinary oxalate excretion decreased ~20% during bed rest (P < 0.001) and correlated inversely with urinary calcium (R = -0.18, P < 0.02). These data provide a broad overview of the biochemistry associated with short-duration bed rest studies and provide an impetus for using shorter studies to save time and costs wherever possible. For some effects related to bone biochemistry, short-duration bed rest will fulfill the scientific requirements to simulate spaceflight, but other effects (antioxidants/oxidative damage, iron status) do not manifest until subjects are in bed longer, in which case longer studies or other analogs may be needed. Regardless, maximizing research funding and opportunities will be critical to enable the next steps in space exploration.

  6. Integrated systems of stroke care and reduction in 30-day mortality

    PubMed Central

    Ganesh, Aravind; Lindsay, Patrice; Fang, Jiming; Kapral, Moira K.; Côté, Robert; Joiner, Ian; Hakim, Antoine M.

    2016-01-01

    Objective: To evaluate the association between the presence of integrated systems of stroke care and stroke case-fatality across Canada. Methods: We used the Canadian Institute of Health Information's Discharge Abstract Database to retrospectively identify a cohort of stroke/TIA patients admitted to all acute care hospitals, excluding the province of Quebec, in 11 fiscal years from 2003/2004 to 2013/2014. We used a modified Poisson regression model to compute the adjusted incidence rate ratio (aIRR) of 30-day in-hospital mortality across time for provinces with stroke systems compared to those without, controlling for age, sex, stroke type, comorbidities, and discharge year. We conducted surveys of stroke care resources in Canadian hospitals in 2009 and 2013, and compared resources in provinces with integrated systems to those without. Results: A total of 319,972 patients were hospitalized for stroke/TIA. The crude 30-day mortality rate decreased from 15.8% in 2003/2004 to 12.7% in 2012/2013 in provinces with stroke systems, while remaining 14.5% in provinces without such systems. Starting with the fiscal year 2009/2010, there was a clear reduction in relative mortality in provinces with stroke systems vs those without, sustained at aIRR of 0.85 (95% confidence interval 0.79–0.92) in the 2011/2012, 2012/2013, and 2013/2014 fiscal years. The surveys indicated that facilities in provinces with such systems were more likely to care for patients on a stroke unit, and have timely access to a stroke prevention clinic and telestroke services. Conclusion: In this retrospective study, the implementation of integrated systems of stroke care was associated with a population-wide reduction in mortality after stroke. PMID:26850979

  7. Bone metabolism and nutritional status during 30-day head-down-tilt bed rest

    PubMed Central

    Morgan, Jennifer L. L.; Zwart, Sara R.; Heer, Martina; Ploutz-Snyder, Robert; Ericson, Karen

    2012-01-01

    Bed rest studies provide an important tool for modeling physiological changes that occur during spaceflight. Markers of bone metabolism and nutritional status were evaluated in 12 subjects (8 men, 4 women; ages 25–49 yr) who participated in a 30-day −6° head-down-tilt diet-controlled bed rest study. Blood and urine samples were collected twice before, once a week during, and twice after bed rest. Data were analyzed using a mixed-effects linear regression with a priori contrasts comparing all days to the second week of the pre-bed rest acclimation period. During bed rest, all urinary markers of bone resorption increased ∼20% (P < 0.001), and serum parathyroid hormone decreased ∼25% (P < 0.001). Unlike longer (>60 days) bed rest studies, neither markers of oxidative damage nor iron status indexes changed over the 30 days of bed rest. Urinary oxalate excretion decreased ∼20% during bed rest (P < 0.001) and correlated inversely with urinary calcium (R = −0.18, P < 0.02). These data provide a broad overview of the biochemistry associated with short-duration bed rest studies and provide an impetus for using shorter studies to save time and costs wherever possible. For some effects related to bone biochemistry, short-duration bed rest will fulfill the scientific requirements to simulate spaceflight, but other effects (antioxidants/oxidative damage, iron status) do not manifest until subjects are in bed longer, in which case longer studies or other analogs may be needed. Regardless, maximizing research funding and opportunities will be critical to enable the next steps in space exploration. PMID:22995395

  8. Pause for thought: response perseveration and personality in gambling.

    PubMed

    Corr, Philip J; Thompson, Stephen J

    2014-12-01

    In a sample of normal volunteers, response perseveration (RP) on a computerised gambling task, the card perseveration task, was examined under two conditions: No pause (Standard task) and a 5-s pause (Pause task) following feedback from previous bet. Behavioural outcomes comprised number of cards played (and cash won/lost) and latency of response. Individual differences in these outcomes were conceptualised in terms of the reinforcement sensitivity theory of personality. Results showed that, on the Standard task only, sub-scales of the Carver and White (J Pers Social Psychol 67:319-333, 1994) Behavioural Approach System scale positively correlated with number of cards played and amount of money lost (indicative of impaired RP), but these associations were abolished with the imposition of a 5-s pause between feedback and the opportunity to make the next bet-this pause also had an overall main effect of improving RP and reducing losses. As related research shows that such a pause normalises the RP deficit seen in pathological gamblers, these findings hold potentially valuable implications for informing practice in the prevention and treatment of pathological gambling, and point to the role played by individual differences in approach motivation.

  9. Analysis of 30-Day Postdischarge Morbidity and Readmission after Radical Gastrectomy for Gastric Carcinoma: A Single-Center Study of 2107 Patients With Prospective Data

    PubMed Central

    Jeong, Oh; Kyu Park, Young; Ran Jung, Mi; Yeop Ryu, Seong

    2015-01-01

    Abstract PD morbidity and readmission pose a substantial clinical and economic burden to the healthcare system. Comprehensive PD complications and readmission data are essential for developing initiatives to improve patient care. No previous studies have extensively investigated PD complications after gastric cancer surgery. We investigated the incidence, types, treatment, and risk factors of 30-day postdischarge (PD) complications after gastric cancer surgery. Between 2010 and 2013, data concerning complications and readmission within 30 days of hospital discharge were prospectively collected in 2107 patients undergoing gastric cancer surgery. In total, 1642 patients (77.9%) underwent distal gastrectomy, 418 (19.8%) total gastrectomy, and 47 (2.3%) other procedures. Postoperative morbidity and mortality were 17.4% and 0.6%, respectively, with a mean 8.8-day hospital stay. Sixty-one patients (2.9%) developed 30-day PD morbidity (58 local and 3 systemic complications), accounting for 16.6% of overall morbidity; 47 (2.2%) were readmitted; and 7 (0.3%) underwent a reoperation. The mean time to PD complications was 9.5 days after index hospital discharge. The most common complication was intra-abdominal abscess (n = 14), followed by wound, ascites, and anastomosis leakage. No mortality occurred resulting from PD complications. In the univariate and multivariate analyses, underlying comorbidity (hypertension and liver cirrhosis) and obesity were independent risk factors for developing PD complications. The early PD period is a vulnerable time for surgical patients with substantial risk of complication and readmission. Tailored discharge plans along with appropriate PD patient support are essential for improving the quality of patient care. PMID:25789945

  10. 78 FR 65697 - 30-Day Notice of Proposed Information Collection: Public Housing, Contracting With Resident-Owned...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-01

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Public Housing, Contracting With...: Colette Pollard, Reports Management Officer, QDAM, Department of Housing and Urban Development, 451...

  11. 77 FR 73731 - 30-Day Notice of Proposed Information Collection: Application Under the Hague Convention on the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-11

    ... Notice is to allow 30 days for public comment. DATES: Submit comments directly to the Office of Management and Budget (OMB) up to January 10, 2013. ADDRESSES: Direct comments to the Department of...

  12. Analysis of rat testicular proteome following 30-day exposure to 900 MHz electromagnetic field radiation.

    PubMed

    Sepehrimanesh, Masood; Kazemipour, Nasrin; Saeb, Mehdi; Nazifi, Saeed

    2014-12-01

    The use of electromagnetic field (EMF) generating apparatuses such as cell phones is increasing, and has caused an interest in the investigations of its effects on human health. We analyzed proteome in preparations from the whole testis in adult male Sprague-Dawley rats that were exposed to 900 MHz EMF radiation for 1, 2, or 4 h/day for 30 consecutive days, simulating a range of possible human cell phone use. Subjects were sacrificed immediately after the end of the experiment and testes fractions were solubilized and separated via high-resolution 2D electrophoresis, and gel patterns were scanned, digitized, and processed. Thirteen proteins, which were found only in sham or in exposure groups, were identified by MALDI-TOF/TOF-MS. Among them, heat shock proteins, superoxide dismutase, peroxiredoxin-1, and other proteins related to misfolding of proteins and/or stress were identified. These results demonstrate significant effects of radio frequency modulated EMFs exposure on proteome, particularly in protein species in the rodent testis, and suggest that a 30-day exposure to EMF radiation induces nonthermal stress in testicular tissue. The functional implication of the identified proteins was discussed.

  13. [Activity of various oxidases and transaminases in the rat liver in the readaptation period after hypokinesia up to 30 days].

    PubMed

    Potapov, P P

    1990-01-01

    The activity of alpha-ketoglutarate dehydrogenase and succinic dehydrogenase in readaptation after 15-day hypokinesia was within normal limits, whereas following 30-day hypokinesia it was enhanced on days 11-15. Pyruvate dehydrogenase exhibited hyperactivity in the end of readaptation week 2 both in 15- and 30-day hypokinesia which resulted in rat liver hyperactivity of glutamate dehydrogenase and transaminases. Normal levels of the latter were recorded on readaptation day 12-19.

  14. Unplanned 30-Day Readmissions in a General Internal Medicine Hospitalist Service at a Comprehensive Cancer Center

    PubMed Central

    Manzano, Joanna-Grace M.; Gadiraju, Sahitya; Hiremath, Adarsh; Lin, Heather Yan; Farroni, Jeff; Halm, Josiah

    2015-01-01

    Purpose: Hospital readmissions are considered by the Centers for Medicare and Medicaid as a metric for quality of health care delivery. Robust data on the readmission profile of patients with cancer are currently insufficient to determine whether this measure is applicable to cancer hospitals as well. To address this knowledge gap, we estimated the unplanned readmission rate and identified factors influencing unplanned readmissions in a hospitalist service at a comprehensive cancer center. Methods: We retrospectively analyzed unplanned 30-day readmission of patients discharged from the General Internal Medicine Hospitalist Service at a comprehensive cancer center between April 1, 2012, and September 30, 2012. Multiple independent variables were studied using univariable and multivariable logistic regression models, with generalized estimating equations to identify risk factors associated with readmissions. Results: We observed a readmission rate of 22.6% in our cohort. The median time to unplanned readmission was 10 days. Unplanned readmission was more likely in patients with metastatic cancer and those with three or more comorbidities. Patients discharged to hospice were less likely to be readmitted (all P values < .01). Conclusion: We observed a high unplanned readmission rate among our population of patients with cancer. The risk factors identified appear to be related to severity of illness and open up opportunities for improving coordination with primary care physicians, oncologists, and other specialists to manage comorbidities, or perhaps transition appropriate patients to palliative care. Our findings will be instrumental for developing targeted interventions to help reduce readmissions at our hospital. Our data also provide direction for appropriate application of readmission quality measures in cancer hospitals. PMID:26152375

  15. Reinforcement magnitude and pausing on progressive-ratio schedules

    PubMed Central

    Baron, Alan; Mikorski, Jeffrey; Schlund, Michael

    1992-01-01

    Rats responded under progressive-ratio schedules for sweetened milk reinforcers; each session ended when responding ceased for 10 min. Experiment 1 varied the concentration of milk and the duration of postreinforcement timeouts. Postreinforcement pausing increased as a positively accelerated function of the size of the ratio, and the rate of increase was reduced as a function of concentration and by timeouts of 10 s or longer. Experiment 2 varied reinforcement magnitude within sessions (number of dipper operations per reinforcer) in conjunction with stimuli correlated with the upcoming magnitude. In the absence of discriminative stimuli, pausing was longer following a large reinforcer than following a small one. Pauses were reduced by a stimulus signaling a large upcoming reinforcer, particularly at the highest ratios, and the animals tended to quit responding when the past reinforcer was large and the stimulus signaled that the next one would be small. Results of both experiments revealed parallels between responding under progressive-ratio schedules and other schedules containing ratio contingencies. Relationships between pausing and magnitude suggest that ratio pausing is under the joint control of inhibitory properties of the past reinforcer and excitatory properties of stimuli correlated with the upcoming reinforcer, rather than under the exclusive control of either factor alone. PMID:16812671

  16. Detection of bursts and pauses in spike trains.

    PubMed

    Ko, D; Wilson, C J; Lobb, C J; Paladini, C A

    2012-10-15

    Midbrain dopaminergic neurons in vivo exhibit a wide range of firing patterns. They normally fire constantly at a low rate, and speed up, firing a phasic burst when reward exceeds prediction, or pause when an expected reward does not occur. Therefore, the detection of bursts and pauses from spike train data is a critical problem when studying the role of phasic dopamine (DA) in reward related learning, and other DA dependent behaviors. However, few statistical methods have been developed that can identify bursts and pauses simultaneously. We propose a new statistical method, the Robust Gaussian Surprise (RGS) method, which performs an exhaustive search of bursts and pauses in spike trains simultaneously. We found that the RGS method is adaptable to various patterns of spike trains recorded in vivo, and is not influenced by baseline firing rate, making it applicable to all in vivo spike trains where baseline firing rates vary over time. We compare the performance of the RGS method to other methods of detecting bursts, such as the Poisson Surprise (PS), Rank Surprise (RS), and Template methods. Analysis of data using the RGS method reveals potential mechanisms underlying how bursts and pauses are controlled in DA neurons.

  17. Monitoring and Modeling the Fluctuations in Apparent Groundwater Age During a 30-Day Pumping Test.

    NASA Astrophysics Data System (ADS)

    Perle, M. E.; Zhang, Y.; Fogg, G. E.

    2004-12-01

    Recent research shows that dispersion due to geologic heterogeneity can cause large (10's to 100's of yrs) variations in actual groundwater age within individual samples drawn from a well, even if well bore mixing is not significant. We hypothesize that the presence of such large ranges in groundwater age may cause the mean apparent age as estimated from environmental tracers such as CFC's, SF&_{6}, and ^{3}H-^{3}He to drift measurably during long-term, continuous pumping. This hypothesis was confirmed by 3-D numerical experiments wherein variation in groundwater ages under high-rate (\\sim0.06 m^{3}/s; 1,000 gpm) long-term pumping was modeled using backward-time random walk particle tracking techniques combined with geostatistical simulations of hydrofacies heterogeneity. Results indicate that the age distribution within a water sample and the mean apparent age implied by environmental tracers is strongly influenced by historical atmospheric concentrations of environmental tracers and subsurface heterogeneity. As a partial implementation of this same experiment in the field, an abandoned well was pumped at a low rate (\\sim0.005 m^{3}/s; 75 gpm) during 53 days. Water samples were collected from the top and bottom of a 25 foot well screen at 12 hour intervals for the first 30 days and were analyzed for CFC's, SF&6, and 3H-3He. The measured tracer ages indicate that 1) CFC-11 apparent ages increased with time within the first five days of pumping and then remained constant for the remainder of the pump test; 2) trends in CFC-12, CFC-113 and SF&_{6}$ indicate a discrepancy in apparent ages with CFC-11, 3) water reaching the top interval is younger than water reaching the bottom interval. Gas samples were collected from the unsaturated zone to investigate possible CFC contamination and tracer concentration spatial variations in the pumping well recharge zone. Potential effects of heterogeneity and local CFC contamination on the monitoring results will be discussed.

  18. Bion M1. Peculiarities of life activities of microbes in 30-day spaceflight

    NASA Astrophysics Data System (ADS)

    Viacheslav, Ilyin; Korshunov, Denis; Morozova, Julia; Voeikova, Tatiana; Tyaglov, Boris; Novikova, Liudmila; Krestyanova, Irina; Emelyanova, Lydia

    The aim of this work was to analyze the influence of space flight factors ( SFF) to microorganism strains , exposed inside unmanned spacecraft Bion M-1 during the 30- day space flight. Objectives of the work - the study of the influence of the SFF exchange chromosomal DNA in crosses microorganisms of the genus Streptomyces; the level of spontaneous phage induction of lysogenic strains fS31 from Streptomyces lividans 66 and Streptomyces coelicolor A3 ( 2 ) on the biosynthesis of the antibiotic tylosin strain of Streptomyces fradiae; survival electrogenic bacteria Shewanella oneidensis MR- 1 is used in the microbial fuel cell As a result of this work it was found that the SFF affect the exchange of chromosomal DNA by crossing strains of Streptomyces. Was detected polarity crossing , expressed in an advantageous contribution chromosome fragment of one of the parent strains in recombinant offspring. This fact may indicate a more prolonged exposure of cells in microgravity and , as a consequence, the transfer of longer fragments of chromosomal DNA This feature is the transfer of genetic material in microgravity could lead to wider dissemination and horizontal transfer of chromosomal and plasmid DNA of symbiotic microflora astronauts and other strains present in the spacecraft. It was shown no effect on the frequency of recombination PCF and the level of mutation model reversion of auxotrophic markers to prototrophy It was demonstrated that PCF increase the level of induction of cell actinophage fS31 lysogenic strain of S. lividans 66, but did not affect the level of induction of this phage cells S. coelicolor A3 ( 2). It is shown that the lower the level of synthesis PCF antibiotic aktinorodina (actinorhodin) in lysogenic strain S. coelicolor A3 ( 2). 66 Strains of S. lividans and S. coelicolor A3 ( 2 ) can be used as a biosensor for studying the effect on microorganisms PCF It is shown that the effect of the PCF reduces synthesis of tylosin and desmicosyn S. fradiae at

  19. Cotranslational response to proteotoxic stress by elongation pausing of ribosomes.

    PubMed

    Liu, Botao; Han, Yan; Qian, Shu-Bing

    2013-02-07

    Translational control permits cells to respond swiftly to a changing environment. Rapid attenuation of global protein synthesis under stress conditions has been largely ascribed to the inhibition of translation initiation. Here we report that intracellular proteotoxic stress reduces global protein synthesis by halting ribosomes on transcripts during elongation. Deep sequencing of ribosome-protected messenger RNA (mRNA) fragments reveals an early elongation pausing, roughly at the site where nascent polypeptide chains emerge from the ribosomal exit tunnel. Inhibiting endogenous chaperone molecules by a dominant-negative mutant or chemical inhibitors recapitulates the early elongation pausing, suggesting a dual role of molecular chaperones in facilitating polypeptide elongation and cotranslational folding. Our results further support the chaperone "trapping" mechanism in promoting the passage of nascent chains. Our study reveals that translating ribosomes fine tune the elongation rate by sensing the intracellular folding environment. The early elongation pausing represents a cotranslational stress response to maintain the intracellular protein homeostasis.

  20. Predictors of 30-day mortality and the risk of recurrent systemic thromboembolism in cancer patients suffering acute ischemic stroke

    PubMed Central

    Kim, Tae Jung; An, Sang Joon; Oh, Kyungmi; Mo, Heejung; Kang, Min Kyoung; Han, Moon-Ku; Demchuk, Andrew M.; Ko, Sang-Bae; Yoon, Byung-Woo

    2017-01-01

    Background Stroke in cancer patients is not rare but is a devastating event with high mortality. However, the predictors of mortality in stroke patients with cancer have not been well addressed. D-dimer could be a useful predictor because it can reflect both thromboembolic events and advanced stages of cancer. Aim In this study, we evaluate the possibility of D-dimer as a predictor of 30-day mortality in stroke patients with active cancer. Methods We included 210 ischemic stroke patients with active cancer. The 30-day mortality data were collected by reviewing medical records. We also collected follow-up D-dimer levels in 106 (50%) participants to evaluate the effects of treatment response on D-dimer levels. Results Of the 210 participants, 30-day mortality occurred in 28 (13%) patients. Higher initial NIHSS scores, D-dimer levels, and CRP levels as well as frequent cryptogenic mechanism, systemic metastasis, multiple vascular territory lesion, hemorrhagic transformation, and larger infarct volume were related to 30-day mortality. In the multivariate analysis, D-dimer [adjusted OR (aOR) = 2.19; 95% CI, 1.46–3.28, P < 0.001] predicted 30-day mortality after adjusting for confounders. The initial NIHSS score (aOR = 1.07; 95% CI, 1.00–1.14, P = 0.043) and hemorrhagic transformation (aOR = 3.02; 95% CI, 1.10–8.29, P = 0.032) were also significant independent of D-dimer levels. In the analysis of D-dimer changes after treatment, the mortality group showed no significant decrease in D-dimer levels, despite treatment, while the survivor group showed the opposite response. Conclusions D-dimer levels may predict 30-day mortality in acute ischemic stroke patients with active cancer. PMID:28282388

  1. Impact of Inpatient Versus Outpatient Total Joint Arthroplasty on 30-Day Hospital Readmission Rates and Unplanned Episodes of Care.

    PubMed

    Springer, Bryan D; Odum, Susan M; Vegari, David N; Mokris, Jeffrey G; Beaver, Walter B

    2017-01-01

    This article describes a study comparing 30-day readmission rates between patients undergoing outpatient versus inpatient total hip (THA) and knee (TKA) arthroplasty. A retrospective review of 137 patients undergoing outpatient total joint arthroplasty (TJA) and 106 patients undergoing inpatient (minimum 2-day hospital stay) TJA was conducted. Unplanned hospital readmissions and unplanned episodes of care were recorded. All patients completed a telephone survey. Seven inpatients and 16 outpatients required hospital readmission or an unplanned episode of care following hospital discharge. Readmission rates were higher for TKA than THA. The authors found no statistical differences in 30-day readmission or unplanned care episodes.

  2. Hypotension During Hospitalization for Acute Heart Failure Is Independently Associated With 30-Day Mortality: Findings from ASCEND-HF

    PubMed Central

    Patel, Priyesh A.; Heizer, Gretchen; O’Connor, Christopher M.; Schulte, Phillip J.; Dickstein, Kenneth; Ezekowitz, Justin A.; Armstrong, Paul W.; Hasselblad, Vic; Mills, Roger M.; McMurray, John J.; Starling, Randall C.; Wilson Tang, W. H.; Califf, Robert M.; Hernandez, Adrian F.

    2015-01-01

    Background Outcomes associated with episodes of hypotension while hospitalized are not well understood. Methods and Results Using data from ASCEND-HF, we assessed factors associated with inhospital hypotension and subsequent 30-day outcomes. Patients were classified as having symptomatic or asymptomatic hypotension. Multivariable logistic regression was used to determine factors associated with in-hospital hypotension, and Cox proportional hazards models were used to assess the association between hypotension and 30-day outcomes. We also tested for treatment interaction with nesiritide on 30-day outcomes and the association between inhospital hypotension and renal function at hospital discharge. Overall, 1555/7141 (21.8%) patients had an episode of hypotension, of which 73.1% were asymptomatic and 26.9% were symptomatic. Factors strongly associated with in-hospital hypotension included randomization to nesiritide (odds ratio [OR] 1.98, 95% confidence interval [CI] 1.76–2.23; p<0.001), chronic metolazone therapy (OR 1.74, 95% CI 1.17–2.60; p<0.001), and baseline orthopnea (OR 1.31, 95% CI 1.13–1.52; p=0.001) or S3 gallop (OR 1.21, 95% CI 1.06–1.40; p=0.006). In-hospital hypotension was associated with increased hazards of 30-day mortality (hazard ratio [HR] 2.03, 95% CI 1.57–2.61; p<0.001), 30-day heart failure (HF) hospitalization or mortality (HR 1.58, 95% CI 1.34–1.86; p<0.001), and 30-day all-cause hospitalization or mortality (HR 1.40, 95% CI 1.22–1.61; p<0.001). Nesiritide had no interaction on the relationship between hypotension and 30-day outcomes (interaction p=0.874 for death, p=0.908 for death/HF hospitalization, p=0.238 death/all-cause hospitalization). Conclusions Hypotension while hospitalized for acute decompensated HF is an independent risk factor for adverse 30-day outcomes, and its occurrence highlights the need for modified treatment strategies. Clinical Trial Registration URL: http://www.clinicaltrials.gov. Unique identifier: NCT

  3. [Postoperative hypothyroidism].

    PubMed

    Olifirova, O S; Trynov, N N

    2015-01-01

    There is a number of factors such as the thyroidectomy and limiting subtotal thyroid resection against the background of euthyroidism and initial hypothyroidism (in any extent of operation) which leads to the prediction of early postoperative hypothyroidism origin during 10 days of the postoperative peri- od. The early postoperative hypothyroidism is accompanied by activation processes of lipid peroxide oxidation and at the same time by reduction of antioxidant protection.

  4. Code-Switching and Pausing: An Interdisciplinary Study

    ERIC Educational Resources Information Center

    Gardner-Chloros, Penelope; McEntee-Atalianis, Lisa; Paraskeva, Marilena

    2013-01-01

    This study considers code-switching (CS) and pausing in two sociolinguistically distinct groups in London and Cyprus, bilingual in Greek-Cypriot Dialect (GCD) and English. The characteristics of their speech are examined both in monolingual and bilingual modes (Grosjean, 2001). It was hypothesised that in London Greek-Cypriots, where CS is a…

  5. The Effects of the Pause Procedure on Classroom Engagement

    ERIC Educational Resources Information Center

    Korvick, Lynn Marie

    2010-01-01

    Scope and Method of Study: The purpose of this study was to examine an instructional strategy intended to enhance engagement in the college classroom. The effects of the pause procedure on classroom engagement and cognitive load were studied. The relationships between levels of classroom engagement and near-term learning outcomes, as well as…

  6. Recurrent sinus pauses: an atypical presentation of temporal lobe epilepsy.

    PubMed

    Amor, Martin Miguel; Eltawansy, Sherif Ali; Osofsky, Jeffrey; Holland, Neil

    2014-01-01

    Autonomic dysfunction related to seizures may give rise to a broad spectrum of cardiovascular abnormalities. Among these, ictal bradycardia and conduction delays may be encountered. Failure to recognize these abnormalities may contribute to sudden, unexplained death in epilepsy patients. We report a case of a Haitian female with temporal lobe epilepsy associated with recurrent sinus pauses.

  7. Pause, Prompt, and Praise: The Need for More Research.

    ERIC Educational Resources Information Center

    Goyen, Judith D.; McClelland, David J.

    1994-01-01

    Finds that the effectiveness of the "Pause, Prompt, and Praise" procedure varied according to the method of analysis used: subjective interpretation of gain scores indicated that the procedure was the most effective treatment for both tutees and tutors; the ANOVA indicated that the tutoring experience was effective; whereas the more rigorous…

  8. Transient pauses of the bacterial flagellar motor at low load

    NASA Astrophysics Data System (ADS)

    Nord, A. L.; Pedaci, F.; Berry, R. M.

    2016-11-01

    The bacterial flagellar motor (BFM) is the molecular machine responsible for the swimming and chemotaxis of many species of motile bacteria. The BFM is bidirectional, and changes in the rotation direction of the motor are essential for chemotaxis. It has previously been observed that many species of bacteria also demonstrate brief pauses in rotation, though the underlying cause of such events remains poorly understood. We examine the rotation of Escherichia coli under low mechanical load with high spatial and temporal resolution. We observe and characterize transient pauses in rotation in a strain which lacks a functional chemosensory network, showing that such events are a phenomenon separate from a change in rotational direction. Rotating at low load, the BFM of E. coli exhibits about 10 pauses s-1, lasting on average 5 ms, during which time the rotor diffuses with net forwards rotation. Replacing the wild type stators with Na+ chimera stators has no substantial effect on the pausing. We discuss possible causes of such events, which are likely a product of a transient change in either the stator complex or the rotor.

  9. Superfund reform: US Environmental Protection Agency`s 30-day study and its implication for the US Department of Energy

    SciTech Connect

    Siegel, M.R.; Friedman, J.R.; Neff, R.W.

    1993-03-01

    As part of an ongoing effort to reform and restructure the US Environmental Protection Agency`s (EPAS) Superfund program, the EPA Administrator on October 21, 1991, announced several key programmatic reforms. These reforms are a result of the Superfund 30-Day Task Force Report (30-Day Study, EPA 1991a), an effort carried out by EPAs office of Solid Waste and Emergency Response (OSWER). The EPA OSWER oversees environmental cleanup activities under a number of statutory authorities, including the Comprehensive Environmental response, Compensation, and Liability Act (CERCLA, also known as Superfund). CERCLA and its implementing regulation, the National Contingency Plan (NCP), establish a regulatory framework to govern the cleanup of existing, and often abandoned, hazardous waste sites. The purposes of this report are to (1) review the background and recommendations of EPNs 30-Day Study, (2) identify and discuss the initiatives from the 30-Day Study that may impact DOE`s environmental restoration mission, (3) report on EPAs progress in implementing the selected priority initiatives, and (4) describe potentially related DOE activities.

  10. 31 CFR 538.506 - 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-November 4, 1997 trade contracts involving Sudan. 538.506 Section 538.506 Money and Finance: Treasury....506 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan. (a) Pre... of Sudanese origin or owned or controlled by the Government of Sudan, importations under the...

  11. 31 CFR 538.506 - 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-November 4, 1997 trade contracts involving Sudan. 538.506 Section 538.506 Money and Finance: Treasury....506 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan. (a) Pre... of Sudanese origin or owned or controlled by the Government of Sudan, importations under the...

  12. 31 CFR 538.506 - 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...-November 4, 1997 trade contracts involving Sudan. 538.506 Section 538.506 Money and Finance: Treasury....506 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan. (a) Pre... of Sudanese origin or owned or controlled by the Government of Sudan, importations under the...

  13. 31 CFR 538.506 - 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-November 4, 1997 trade contracts involving Sudan. 538.506 Section 538.506 Money and Finance: Treasury....506 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan. (a) Pre... of Sudanese origin or owned or controlled by the Government of Sudan, importations under the...

  14. 31 CFR 538.506 - 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...-November 4, 1997 trade contracts involving Sudan. 538.506 Section 538.506 Money and Finance: Treasury....506 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan. (a) Pre... of Sudanese origin or owned or controlled by the Government of Sudan, importations under the...

  15. 31 CFR 560.515 - 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...-May 7, 1995 trade contracts involving Iran. 560.515 Section 560.515 Money and Finance: Treasury....515 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran. (a) All... involving Iran (a pre-existing trade contract), including the exportation of goods, services...

  16. 31 CFR 560.515 - 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...-May 7, 1995 trade contracts involving Iran. 560.515 Section 560.515 Money and Finance: Treasury....515 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran. (a) All... involving Iran (a pre-existing trade contract), including the exportation of goods, services...

  17. 31 CFR 560.515 - 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-May 7, 1995 trade contracts involving Iran. 560.515 Section 560.515 Money and Finance: Treasury....515 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran. (a) All... involving Iran (a pre-existing trade contract), including the exportation of goods, services...

  18. Predicting 30-Day Readmissions: Performance of the LACE Index Compared with a Regression Model among General Medicine Patients in Singapore

    PubMed Central

    Low, Lian Leng; Lee, Kheng Hock; Hock Ong, Marcus Eng; Wang, Sijia; Tan, Shu Yun; Thumboo, Julian; Liu, Nan

    2015-01-01

    The LACE index (length of stay, acuity of admission, Charlson comorbidity index, CCI, and number of emergency department visits in preceding 6 months) derived in Canada is simple and may have clinical utility in Singapore to predict readmission risk. We compared the performance of the LACE index with a derived model in identifying 30-day readmissions from a population of general medicine patients in Singapore. Additional variables include patient demographics, comorbidities, clinical and laboratory variables during the index admission, and prior healthcare utilization in the preceding year. 5,862 patients were analysed and 572 patients (9.8%) were readmitted in the 30 days following discharge. Age, CCI, count of surgical procedures during index admission, white cell count, serum albumin, and number of emergency department visits in previous 6 months were significantly associated with 30-day readmission risk. The final logistic regression model had fair discriminative ability c-statistic of 0.650 while the LACE index achieved c-statistic of 0.628 in predicting 30-day readmissions. Our derived model has the advantage of being available early in the admission to identify patients at high risk of readmission for interventions. Additional factors predicting readmission risk and machine learning techniques should be considered to improve model performance. PMID:26682212

  19. 76 FR 17734 - 30-Day Notice of Proposed Information Collection: Form DS-1998E, Foreign Service Officer Test...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-30

    .... Originating Office: Human Resources, HR/REE/BEX. Form Number: DS-1998E. Respondents: Registrants for the... information collection request to the Office of Management and Budget (OMB) for ] approval in accordance with... Office of Management and Budget (OMB) for up to 30 days from March 30, 2011. ADDRESSES: Direct...

  20. 78 FR 31999 - 30-Day Notice of Proposed Information Collection: Young Turkey/Young America Evaluation (YTYA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-28

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF STATE 30-Day Notice of Proposed Information Collection: Young Turkey/ Young America Evaluation (YTYA) Survey ACTION... Collection: Young Turkey/Young America Evaluation (YTYA) Survey. OMB Control Number: None. Type of...

  1. 78 FR 36562 - 30-Day Notice of Proposed Information Collection: Application and Re-certification Packages for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-18

    ...HUD has submitted the proposed information collection requirement described below to the Office of Management and Budget (OMB) for review, in accordance with the Paperwork Reduction Act. The purpose of this notice is to allow for an additional 30 days of public...

  2. 78 FR 66040 - 30-Day Notice of Proposed Information Collection: HUD-Owned Real Estate-Sales Contract and Addendums

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-04

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: HUD-Owned Real Estate--Sales... collection entitled HUD-Owned Real Estate-Sales Contract and Addendums (2502-0306). HUD will republish...

  3. 77 FR 62518 - Submission for OMB Review; Comment Request (30-Day FRN); Prostate, Lung, Colorectal and Ovarian...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-15

    ... their full effect if received within 30 days of the date of this publication. Proposed Collection... ovarian cancer can reduce mortality from these cancers which currently cause an estimated 255,700 deaths... term effects of the screening on cancer incidence and mortality for the four targeted cancers....

  4. 78 FR 59047 - 30-Day Notice of Proposed Information Collection: Semi-Annual Labor Standards Enforcement Report...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-25

    ... Title of Information Collection: Semi-annual Labor Standards Enforcement Report--Local Contracting... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Semi-Annual Labor Standards Enforcement Report--Local Contracting Agencies (HUD Programs) AGENCY: Office of the Chief Information...

  5. 76 FR 58074 - 30-Day Notice of Proposed Information Collection: DS-7001 and DS-7005, DOS-Sponsored Academic...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-19

    ... information collection request to the Office of Management and Budget (OMB) for approval in accordance with... Collection. Originating Office: Bureau of Educational and Cultural Affairs, ECA/A/E/EUR. Form Number: DS-7001... to the Office of Management and Budget (OMB) for up to 30 days from September 19, 2011....

  6. 77 FR 47690 - 30-Day Notice of Proposed Information Collection: Civilian Response Corps Database In-Processing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-09

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF STATE 30-Day Notice of Proposed Information Collection: Civilian Response Corps Database In-Processing Electronic Form... Database In-Processing Electronic Form. OMB Control Number: 1405-0168. Type of Request: Extension of...

  7. 75 FR 32961 - 30-Day Federal Register Notice of Intention To Request Clearance of Collection of Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-10

    ... collection Office of Management and Budget (OMB) Control 1024-0231. The OMB has up to 60 days to approve or... consideration, OMB should receive public comments within 30 days of the date on which this notice is published... were received on this notice. DATES: Public comments on the proposed Information Collection...

  8. 78 FR 15799 - 30-Day Notice of Proposed Information Collection: Statement Regarding a Lost or Stolen U.S...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-12

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF STATE 30-Day Notice of Proposed Information Collection: Statement Regarding a Lost or Stolen U.S. Passport Book and/or... INFORMATION: Title of Information Collection: Statement Regarding a Lost or Stolen U.S. Passport Book...

  9. 78 FR 64145 - 30-Day Notice of Proposed Information Collection: Housing Finance Agency Risk-Sharing Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-25

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Housing Finance Agency Risk-Sharing..., 2013. A. Overview of Information Collection Title of Information Collection: Housing Finance Agency... Secretary to implement risk sharing with State and local housing finance agencies (HFAs). Under this...

  10. 78 FR 65696 - 30-Day Notice of Proposed Information Collection: Housing Finance Agency Risk-Sharing Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-01

    ... URBAN DEVELOPMENT 30-Day Notice of Proposed Information Collection: Housing Finance Agency Risk-Sharing... Collection Title of Information Collection: Housing Finance Agency Risk- Sharing Program. OMB Approval Number... with State and local housing finance agencies (HFAs). Under this program, HUD provides full...

  11. 78 FR 35040 - Submission for OMB Review; 30-day Comment Request; Web-Based Media Literacy Parent Training for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-11

    ... HUMAN SERVICES National Institutes of Health Submission for OMB Review; 30-day Comment Request; Web-Based Media Literacy Parent Training for Substance Use Prevention in Rural Locations SUMMARY: Under the... Branch, Division of Epidemiology, Services, and Prevention Research, NIDA, NIH, 6001 Executive...

  12. Relationship between Early Physician Follow-Up and 30-Day Readmission after Acute Myocardial Infarction and Heart Failure

    PubMed Central

    Tung, Yu-Chi; Chang, Guann-Ming; Chang, Hsien-Yen

    2017-01-01

    Background Thirty-day readmission rates after acute myocardial infarction (AMI) and heart failure are important patient outcome metrics. Early post-discharge physician follow-up has been promoted as a method of reducing 30-day readmission rates. However, the relationships between early post-discharge follow-up and 30-day readmission for AMI and heart failure are inconclusive. We used nationwide population-based data to examine associations between 7-day physician follow-up and 30-day readmission, and further associations of 7-day same physician (during the index hospitalization and at follow-up) and cardiologist follow-up with 30-day readmission for non-ST-segment-elevation myocardial infarction (NSTEMI) or heart failure. Methods We analyzed all patients 18 years or older with NSTEMI and heart failure and discharged from hospitals in 2010 in Taiwan through Taiwan’s National Health Insurance Research Database. Cox proportional hazard models with robust sandwich variance estimates and propensity score weighting were performed after adjustment for patient and hospital characteristics to test associations between 7-day physician follow-up and 30-day readmission. Results The study population for NSTEMI and heart failure included 5,008 and 13,577 patients, respectively. Early physician follow-up was associated with a lower hazard ratio of readmission compared with no early physician follow-up for patients with NSTEMI (hazard ratio [HR], 0.47; 95% confidence interval [CI], 0.39–0.57), and for patients with heart failure (HR, 0.54; 95% CI, 0.48–0.60). Same physician follow-up was associated with a reduced hazard ratio of readmission compared with different physician follow-up for patients with NSTEMI (HR, 0.56; 95% CI, 0.48–0.65), and for patients with heart failure (HR, 0.69; 95% CI, 0.62–0.76). Conclusions For each condition, patients who have an outpatient visit with a physician within 7 days of discharge have a lower risk of 30-day readmission. Moreover

  13. Sex Differences in the Rate, Timing and Principal Diagnoses of 30-Day Readmissions in Younger Patients with Acute Myocardial Infarction

    PubMed Central

    Dreyer, Rachel P.; Ranasinghe, Isuru; Wang, Yongfei; Dharmarajan, Kumar; Murugiah, Karthik; Nuti, Sudhakar V.; Hsieh, Angela F.; Spertus, John A.; Krumholz, Harlan M.

    2016-01-01

    Background Young women (<65 years) experience a 2–3-fold greater mortality risk than younger men after acute myocardial infarction (AMI). However, it is unknown whether they are at higher risk for 30-day readmission, and if this association varies by age. We examined sex differences in the rate, timing and principal diagnoses of 30-day readmissions, including the independent effect of sex following adjustment for confounders. Methods and Results We included patients aged 18–64 years with a principal diagnosis of AMI. Data was utilized from the Healthcare Cost and Utilization Project-State Inpatient Database for California (07–09). Readmission diagnoses were categorized using an aggregated version of the Centers for Medicare and Medicaid Services’ Condition Categories, and readmission timing was determined from the day after discharge. Of 42,518 younger patients with AMI (26.4% female), 4,775 (11.2%) had at least one readmission. The 30-day all-cause readmission rate was higher for women (15.5% vs. 9.7%, P<0.0001). For both sexes, readmission risk was highest on days 2–4 after discharge and declined thereafter, and women were more likely to present with non-cardiac diagnoses (44.4% vs. 40.6%, P=0.01). Female sex was associated with a higher rate of 30-day readmission, which persisted after adjustment (HR=1.22, 95% CI 1.15, 1.30). There was no significant interaction between age and sex on readmission. Conclusions Compared with men, younger women have a higher risk for readmission, even after adjustment for confounders. The timing of 30-day readmission was similar in women and men, and both sexes were susceptible to a wide range of causes for readmission. PMID:26085455

  14. Preadmission use of SSRIs alone or in combination with NSAIDs and 30-day mortality after peptic ulcer bleeding.

    PubMed

    Gasse, Christiane; Christensen, Steffen; Riis, Anders; Mortensen, Preben B; Adamsen, Sven; Thomsen, Reimar W

    2009-01-01

    OBJECTIVE. Use of selective serotonin reuptake inhibitors (SSRIs) increases the risk of upper gastrointestinal bleeding and this risk is amplified by concomitant use of non-steroidal anti-inflammatory drugs (NSAIDs). The aim of the study was to examine the impact of SSRI use alone or in combination with NSAIDs on 30-day mortality after peptic ulcer bleeding (PUB). MATERIAL AND METHODS. A population-based cohort study of patients with a first hospitalization with PUB in three Danish counties was carried out between 1991 and 2005 using medical databases. We calculated 30-day mortality rate ratios (MRRs) associated with the use of SSRIs, alone or in combination with NSAIDs, adjusted for important covariates. RESULTS. Of 7415 patients admitted with PUB, 5.9% used SSRIs only, and 3.8% used SSRIs in combination with NSAIDs, with a 30-day mortality of 11.8% and 11.3%, respectively. Compared with patients who used neither SSRIs nor NSAIDs, the adjusted 30-day MRR was 1.02 (95% CI: 0.76-1.36) for current users of SSRIs and 0.89 (0.62-1.28) for the combined use of SSRIs with NSAIDs. There was a 2.11-fold (95% CI 1.35-3.30) increased risk of death associated with SSRI use starting within 60 days of admission; for those younger than 80 years, the adjusted MRR was 1.54 (0.72-3.29), and 2.57 (1.47-4.49) for those older than 80 years. CONCLUSIONS. Use of SSRIs, alone or in combination with NSAIDs, was not associated with increased 30-day mortality following PUB. However, increased mortality was found in patients who started SSRI therapy, particularly among those older than 80 years. We can only speculate on whether this finding is due to pharmacological action or confounding factors.

  15. 30 Days Wild: Development and Evaluation of a Large-Scale Nature Engagement Campaign to Improve Well-Being.

    PubMed

    Richardson, Miles; Cormack, Adam; McRobert, Lucy; Underhill, Ralph

    2016-01-01

    There is a need to increase people's engagement with and connection to nature, both for human well-being and the conservation of nature itself. In order to suggest ways for people to engage with nature and create a wider social context to normalise nature engagement, The Wildlife Trusts developed a mass engagement campaign, 30 Days Wild. The campaign asked people to engage with nature every day for a month. 12,400 people signed up for 30 Days Wild via an online sign-up with an estimated 18,500 taking part overall, resulting in an estimated 300,000 engagements with nature by participants. Samples of those taking part were found to have sustained increases in happiness, health, connection to nature and pro-nature behaviours. With the improvement in health being predicted by the improvement in happiness, this relationship was mediated by the change in connection to nature.

  16. African Easterly Waves in 30-day High-Resolution Global Simulations: A Case Study During the 2006 NAMMA Period

    NASA Technical Reports Server (NTRS)

    Shen, Bo-Wen; Tao, Wei-Kuo; Wu, Man-Li C.

    2010-01-01

    In this study, extended -range (30 -day) high-resolution simulations with the NASA global mesoscale model are conducted to simulate the initiation and propagation of six consecutive African easterly waves (AEWs) from late August to September 2006 and their association with hurricane formation. It is shown that the statistical characteristics of individual AEWs are realistically simulated with larger errors in the 5th and 6th AEWs. Remarkable simulations of a mean African easterly jet (AEJ) are also obtained. Nine additional 30 -day experiments suggest that although land surface processes might contribute to the predictability of the AEJ and AEWs, the initiation and detailed evolution of AEWs still depend on the accurate representation of dynamic and land surface initial conditions and their time -varying nonlinear interactions. Of interest is the potential to extend the lead time for predicting hurricane formation (e.g., a lead time of up to 22 days) as the 4th AEW is realistically simulated.

  17. No evidence for race and socioeconomic status as independent predictors of 30-day readmission rates following orthopedic surgery.

    PubMed

    Hunter, Tracey; Yoon, Richard S; Hutzler, Lorraine; Band, Philip; Liublinksa, Victoria; Slover, James; Bosco, Joseph A

    2015-01-01

    The Centers for Medicare & Medicaid Services considers readmissions within 30 days of discharge to be a quality indicator. Hospitals' and eventually physicians' readmission rates will be used to determine payment for services. It is imperative that health care providers understand which patients are at risk for readmission so that they can apply the appropriate preventive interventions. The research team analyzed all orthopedic admissions and readmissions at their institution from September 2008 to April 2011 in this study. Preparing for the next stage in health care reform, identifying any preoperative factors that may place certain patients into a "high-risk" category for readmission following an orthopedic procedure is of paramount importance. This data analysis of more than 13 000 patients noted that race-based and income-based risk factors did not translate into significant risk factors or predictors of 30-day readmission following orthopedic admission.

  18. 30 Days Wild: Development and Evaluation of a Large-Scale Nature Engagement Campaign to Improve Well-Being

    PubMed Central

    Richardson, Miles; Cormack, Adam; McRobert, Lucy; Underhill, Ralph

    2016-01-01

    There is a need to increase people’s engagement with and connection to nature, both for human well-being and the conservation of nature itself. In order to suggest ways for people to engage with nature and create a wider social context to normalise nature engagement, The Wildlife Trusts developed a mass engagement campaign, 30 Days Wild. The campaign asked people to engage with nature every day for a month. 12,400 people signed up for 30 Days Wild via an online sign-up with an estimated 18,500 taking part overall, resulting in an estimated 300,000 engagements with nature by participants. Samples of those taking part were found to have sustained increases in happiness, health, connection to nature and pro-nature behaviours. With the improvement in health being predicted by the improvement in happiness, this relationship was mediated by the change in connection to nature. PMID:26890891

  19. Predicting 30-Day Readmissions in an Asian Population: Building a Predictive Model by Incorporating Markers of Hospitalization Severity

    PubMed Central

    Low, Lian Leng; Liu, Nan; Wang, Sijia; Thumboo, Julian; Ong, Marcus Eng Hock; Lee, Kheng Hock

    2016-01-01

    Background To reduce readmissions, it may be cost-effective to consider risk stratification, with targeting intervention programs to patients at high risk of readmissions. In this study, we aimed to derive and validate a prediction model including several novel markers of hospitalization severity, and compare the model with the LACE index (Length of stay, Acuity of admission, Charlson comorbidity index, Emergency department visits in past 6 months), an established risk stratification tool. Method This was a retrospective cohort study of all patients ≥ 21 years of age, who were admitted to a tertiary hospital in Singapore from January 1, 2013 through May 31, 2015. Data were extracted from the hospital’s electronic health records. The outcome was defined as unplanned readmissions within 30 days of discharge from the index hospitalization. Candidate predictive variables were broadly grouped into five categories: Patient demographics, social determinants of health, past healthcare utilization, medical comorbidities, and markers of hospitalization severity. Multivariable logistic regression was used to predict the outcome, and receiver operating characteristic analysis was performed to compare our model with the LACE index. Results 74,102 cases were enrolled for analysis. Of these, 11,492 patient cases (15.5%) were readmitted within 30 days of discharge. A total of fifteen predictive variables were strongly associated with the risk of 30-day readmissions, including number of emergency department visits in the past 6 months, Charlson Comorbidity Index, markers of hospitalization severity such as ‘requiring inpatient dialysis during index admission, and ‘treatment with intravenous furosemide 40 milligrams or more’ during index admission. Our predictive model outperformed the LACE index by achieving larger area under the curve values: 0.78 (95% confidence interval [CI]: 0.77–0.79) versus 0.70 (95% CI: 0.69–0.71). Conclusion Several factors are important for

  20. International Validity of the “HOSPITAL” Score to Predict 30-day Potentially Avoidable Readmissions in Medical Patients

    PubMed Central

    Donzé, Jacques D.; Williams, Mark V.; Robinson, Edmondo J.; Zimlichman, Eyal; Aujesky, Drahomir; Vasilevskis, Eduard E.; Kripalani, Sunil; Metlay, Joshua P.; Wallington, Tamara; Fletcher, Grant S.; Auerbach, Andrew D.; Schnipper, Jeffrey L.

    2016-01-01

    IMPORTANCE Identification of patients at high risk of potentially avoidable readmission allows hospitals to efficiently direct additional care transitions services to the patients most likely to benefit. OBJECTIVE To externally validate the “HOSPITAL” score in an international multicenter study to assess its generalizability. DESIGN International multicenter retrospective cohort study. SETTING 9 large hospitals across 4 different countries. PARTICIPANTS All adult patients consecutively discharged alive from a medical department between January and December, 2011 (117,065 participants). Patients transferred to another acute care facility were excluded. EXPOSURES The “HOSPITAL” score includes the following predictors at discharge: Hemoglobin, discharge from an Oncology service, Sodium level, Procedure during the index admission, Index Type of admission (urgent), number of Admissions during the last 12 months, and Length of stay. MAIN OUTCOMES AND MEASURES 30-day potentially avoidable readmission to the index hospital using the SQLape algorithm. RESULTS Of all medical discharges, 14.5% (n=16,992) were followed by a 30-day readmission, and 9.7% (n=11,307) were followed by a 30-day potentially avoidable readmission. The discriminatory power of the “HOSPITAL” score to predict potentially avoidable readmission was good with a C-statistic of 0.72 (95% CI 0.72-0.72). As in the derivation study, patients were classified into 3 risk categories: low (62%), intermediate (24%), and high risk (14%). The estimated proportions of potentially avoidable readmission for each risk category matched the observed proportion, resulting in an excellent calibration (Pearson goodness of fit test P=0.89). CONCLUSIONS AND RELEVANCE The “HOSPITAL” score identified patients at high risk of 30-day potentially avoidable readmission with moderately high discrimination and excellent calibration when applied to a large international multicenter cohort of medical patients. This score

  1. Prolonging the postcomplex spike pause speeds eyeblink conditioning.

    PubMed

    Maiz, Jaione; Karakossian, Movses H; Pakaprot, Narawut; Robleto, Karla; Thompson, Richard F; Otis, Thomas S

    2012-10-09

    Climbing fiber input to the cerebellum is believed to serve as a teaching signal during associative, cerebellum-dependent forms of motor learning. However, it is not understood how this neural pathway coordinates changes in cerebellar circuitry during learning. Here, we use pharmacological manipulations to prolong the postcomplex spike pause, a component of the climbing fiber signal in Purkinje neurons, and show that these manipulations enhance the rate of learning in classical eyelid conditioning. Our findings elucidate an unappreciated aspect of the climbing fiber teaching signal, and are consistent with a model in which convergent postcomplex spike pauses drive learning-related plasticity in the deep cerebellar nucleus. They also suggest a physiological mechanism that could modulate motor learning rates.

  2. Backtracking dynamics of RNA polymerase: pausing and error correction

    NASA Astrophysics Data System (ADS)

    Sahoo, Mamata; Klumpp, Stefan

    2013-09-01

    Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

  3. Definition of transcriptional pause elements in fission yeast.

    PubMed

    Aranda, A; Proudfoot, N J

    1999-02-01

    Downstream elements (DSEs) with transcriptional pausing activity play an important role in transcription termination of RNA polymerase II. We have defined two such DSEs in Schizosaccharomyces pombe, one for the ura4 gene and a new one in the 3'-end region of the nmt2 gene. Although these DSEs do not have sequence homology, both are orientation specific and are composed of multiple and redundant sequence elements that work together to achieve full pausing activity. Previous studies on the nmt1 and nmt2 genes revealed that transcription extends several kilobases past the genes' poly(A) sites. We show that the insertion of either DSE immediately downstream of the nmt1 poly(A) site induces more immediate termination. nmt2 termination efficiency can be increased by moving the DSE closer to the poly(A) site. These results suggest that DSEs may be a common feature in yeast genes.

  4. Outpatient Follow-Up versus 30-day Readmission among General and Vascular Surgery Patients: A Case for Redesigning Transitional Care

    PubMed Central

    Saunders, Richard Scott; Fernandes-Taylor, Sara; Rathouz, Paul J.; Saha, Sandeep; Wiseman, Jason T.; Havlena, Jeffrey; Matsumura, Jon; Kent, K. Craig

    2014-01-01

    Background The association between early outpatient follow-up and 30-day readmission has not been evaluated in any surgical population. Our study characterizes the relationship between outpatient follow-up and early readmissions among surgical patients. Methods We queried the medical record at a large, tertiary care institution (July 2008-December 2012) to determine rates of 30-day outpatient follow-up and readmission for general or vascular surgical procedures. Results The majority of discharges for general (84% of 7552) and vascular (75% of 2362) surgery had a follow-up visit before readmission or within 30 days of discharge. General surgery patients who were not readmitted had high rates of follow-up (88%) and received follow-up at approximately 2-weeks post-discharge (median time 11 days after discharge). In contrast, readmitted general surgery patients received first follow-up at one week (a median time of 8 days); 49% had follow-up. Vascular surgery patients showed a similar trend. Over half of patients readmitted after follow-up were readmitted within 24 hours of their most recent outpatient visit. Conclusions Current routine follow-up does not occur early enough to detect adverse events and prevent readmission. Early outpatient care may prevent readmission in some patients, but often serves as a conduit for readmission among patients already experiencing complications. PMID:25239351

  5. A positioned +1 nucleosome enhances promoter-proximal pausing.

    PubMed

    Jimeno-González, Silvia; Ceballos-Chávez, María; Reyes, José C

    2015-03-31

    Chromatin distribution is not uniform along the human genome. In most genes there is a promoter-associated nucleosome free region (NFR) followed by an array of nucleosomes towards the gene body in which the first (+1) nucleosome is strongly positioned. The function of this characteristic chromatin distribution in transcription is not fully understood. Here we show in vivo that the +1 nucleosome plays a role in modulating RNA polymerase II (RNAPII) promoter-proximal pausing. When a +1 nucleosome is strongly positioned, elongating RNAPII has a tendency to stall at the promoter-proximal region, recruits more negative elongation factor (NELF) and produces less mRNA. The nucleosome-induced pause favors pre-mRNA quality control by promoting the addition of the cap to the nascent RNA. Moreover, the uncapped RNAs produced in the absence of a positioned nucleosome are degraded by the 5'-3' exonuclease XRN2. Interestingly, reducing the levels of the chromatin remodeler ISWI factor SNF2H decreases +1 nucleosome positioning and increases RNAPII pause release. This work demonstrates a function for +1 nucleosome in regulation of transcription elongation, pre-mRNA processing and gene expression.

  6. Run-and-pause dynamics of cytoskeletal motor proteins

    PubMed Central

    Hafner, Anne E.; Santen, Ludger; Rieger, Heiko; Shaebani, M. Reza

    2016-01-01

    Cytoskeletal motor proteins are involved in major intracellular transport processes which are vital for maintaining appropriate cellular function. When attached to cytoskeletal filaments, the motor exhibits distinct states of motility: active motion along the filaments, and pause phase in which it remains stationary for a finite time interval. The transition probabilities between motion and pause phases are asymmetric in general, and considerably affected by changes in environmental conditions which influences the efficiency of cargo delivery to specific targets. By considering the motion of individual non-interacting molecular motors on a single filament as well as a dynamic filamentous network, we present an analytical model for the dynamics of self-propelled particles which undergo frequent pause phases. The interplay between motor processivity, structural properties of filamentous network, and transition probabilities between the two states of motility drastically changes the dynamics: multiple transitions between different types of anomalous diffusive dynamics occur and the crossover time to the asymptotic diffusive or ballistic motion varies by several orders of magnitude. We map out the phase diagrams in the space of transition probabilities, and address the role of initial conditions of motion on the resulting dynamics. PMID:27849013

  7. Run-and-pause dynamics of cytoskeletal motor proteins

    NASA Astrophysics Data System (ADS)

    Hafner, Anne E.; Santen, Ludger; Rieger, Heiko; Shaebani, M. Reza

    2016-11-01

    Cytoskeletal motor proteins are involved in major intracellular transport processes which are vital for maintaining appropriate cellular function. When attached to cytoskeletal filaments, the motor exhibits distinct states of motility: active motion along the filaments, and pause phase in which it remains stationary for a finite time interval. The transition probabilities between motion and pause phases are asymmetric in general, and considerably affected by changes in environmental conditions which influences the efficiency of cargo delivery to specific targets. By considering the motion of individual non-interacting molecular motors on a single filament as well as a dynamic filamentous network, we present an analytical model for the dynamics of self-propelled particles which undergo frequent pause phases. The interplay between motor processivity, structural properties of filamentous network, and transition probabilities between the two states of motility drastically changes the dynamics: multiple transitions between different types of anomalous diffusive dynamics occur and the crossover time to the asymptotic diffusive or ballistic motion varies by several orders of magnitude. We map out the phase diagrams in the space of transition probabilities, and address the role of initial conditions of motion on the resulting dynamics.

  8. A positioned +1 nucleosome enhances promoter-proximal pausing

    PubMed Central

    Jimeno-González, Silvia; Ceballos-Chávez, María; Reyes, José C.

    2015-01-01

    Chromatin distribution is not uniform along the human genome. In most genes there is a promoter-associated nucleosome free region (NFR) followed by an array of nucleosomes towards the gene body in which the first (+1) nucleosome is strongly positioned. The function of this characteristic chromatin distribution in transcription is not fully understood. Here we show in vivo that the +1 nucleosome plays a role in modulating RNA polymerase II (RNAPII) promoter-proximal pausing. When a +1 nucleosome is strongly positioned, elongating RNAPII has a tendency to stall at the promoter-proximal region, recruits more negative elongation factor (NELF) and produces less mRNA. The nucleosome-induced pause favors pre-mRNA quality control by promoting the addition of the cap to the nascent RNA. Moreover, the uncapped RNAs produced in the absence of a positioned nucleosome are degraded by the 5′-3′ exonuclease XRN2. Interestingly, reducing the levels of the chromatin remodeler ISWI factor SNF2H decreases +1 nucleosome positioning and increases RNAPII pause release. This work demonstrates a function for +1 nucleosome in regulation of transcription elongation, pre-mRNA processing and gene expression. PMID:25735750

  9. Widespread regulation of translation by elongation pausing in heat shock.

    PubMed

    Shalgi, Reut; Hurt, Jessica A; Krykbaeva, Irina; Taipale, Mikko; Lindquist, Susan; Burge, Christopher B

    2013-02-07

    Global repression of protein synthesis is a hallmark of the cellular stress response and has been attributed primarily to inhibition of translation initiation, although this mechanism may not always explain the full extent of repression. Here, using ribosome footprinting, we show that 2 hr of severe heat stress triggers global pausing of translation elongation at around codon 65 on most mRNAs in both mouse and human cells. The genome-wide nature of the phenomenon, its location, and features of protein N termini suggested the involvement of ribosome-associated chaperones. After severe heat shock, Hsp70's interactions with the translational machinery were markedly altered and its association with ribosomes was reduced. Pretreatment with mild heat stress or overexpression of Hsp70 protected cells from heat shock-induced elongation pausing, while inhibition of Hsp70 activity triggered elongation pausing without heat stress. Our findings suggest that regulation of translation elongation in general, and by chaperones in particular, represents a major component of cellular stress responses.

  10. Factors associated with 30-day mortality in elderly inpatients with community acquired pneumonia during 2 influenza seasons.

    PubMed

    Torner, Núria; Izquierdo, Conchita; Soldevila, Núria; Toledo, Diana; Chamorro, Judith; Espejo, Elena; Fernández-Sierra, Amelia; Domínguez, Angela

    2017-02-01

    Community-acquired pneumonia (CAP) refers to pneumonia unrelated to hospitals or extended-care facilities. The aim of this study was to determine factors associated with 30-day mortality in patients with CAP aged ≥ 65 y admitted to 20 hospitals in 7 Spanish regions during the 2013-14 and 2014-15 influenza seasons. Logistic regression was used to identify factors associated with 30-day mortality. The adjusted model included variables selected by backward elimination with a cut off of < 0.02. A total of 1928 CAP cases were recorded; 60.7% were male, 46.67% were aged 75-84 years, and 30-day mortality was 7.6% (n = 146). Pneumococcal vaccination had a significant protective effect (OR 0.68, 95% CI, 0.48-0.96; p = 0.03) and influenza vaccination in any 3 preceding seasons slight protective effect against CAP (OR 0.72, 95% CI, 0.51-1.02;p = 0.06). Factors significantly associated with 30-day mortality were having a degree of dependence (aOR 3.67, 95% CI, 2.34-5.75; p < 0,001); age ≥ 85 y (OR 3.01, 95% CI, 1.71-5.30; p < 0.001), liver impairment (aOR 2.41, 95% CI, 1.10-5.31; p = 0.03); solid organ neoplasm (aOR 2.24, 95% CI, 1.46-3.45; p < 0.001), impaired cognitive function (aOR 1.93, 95% CI, 1.22-3.05; p = 0.005), and ICU admittance (aOR2.56, 95% CI, 1.27-5.16; p = 0.009); length of stay (aOR 1.56, 95% CI, 1.02 - 2.40; p = 0.04) and cardio-respiratory resuscitation (aOR 7.75, 95% CI, 1.20 - 49.98; p = 0.03). No association was observed for other comorbidities such as chronic pulmonary obstructive disease (COPD) or heart conditions in the adjusted model. Offering both pneumococcal and influenza vaccination to the elderly may improve 30-day mortality in patients with CAP.

  11. Emergency department evaluation and 30-day readmission after craniotomy for primary brain tumor resection in New York State.

    PubMed

    Missios, Symeon; Bekelis, Kimon

    2017-01-06

    OBJECTIVE Fragmentation of care has been recognized as a major contributor to 30-day readmissions after surgical procedures. The authors investigated the association of evaluation in the hospital where the original procedure was performed with the rate of 30-day readmissions for patients presenting to the emergency department (ED) after craniotomy for primary brain tumor resection. METHODS A cohort study was conducted, involving patients who were evaluated in the ED within 30 days after discharge following a craniotomy for primary brain tumor resection between 2009 and 2013, and who were registered in the Statewide Planning and Research Cooperative System (SPARCS) database of New York State. A propensity score-adjusted model was used to control for confounding, whereas a mixed-effects model accounted for clustering at the hospital level. RESULTS Of the 610 patients presenting to the ED, 422 (69.2%) were evaluated in a hospital different from the one where the original procedure was performed (28.9% were readmitted), and 188 (30.8%) were evaluated at the original hospital (20.3% were readmitted). In a multivariable analysis, the authors demonstrated that being evaluated in the ED of the original hospital was associated with a decreased rate of 30-day readmission (OR 0.64, 95% CI 0.41-0.98). Similar associations were found in a mixed-effects logistic regression model (OR 0.63, 95% CI 0.40-0.96) and a propensity score-adjusted model (OR 0.64, 95% CI 0.41-0.98). This corresponds to one less readmission per 12 patients evaluated in the hospital where the original procedure was performed. CONCLUSIONS Using a comprehensive all-payer cohort of patients in New York State who were evaluated in the ED after craniotomy for primary brain tumor resection, the authors identified an association of assessment in the hospital where the original procedure was performed with a lower rate of 30-day readmissions. This underscores the potential importance of continuity of care in

  12. Relationship between platelet count and 30-day clinical outcomes after percutaneous coronary interventions. Pooled analysis of four ISAR trials.

    PubMed

    Iijima, Raisuke; Ndrepepa, Gjin; Mehilli, Julinda; Bruskina, Olga; Schulz, Stefanie; Schömig, Albert; Kastrati, Adnan

    2007-10-01

    Platelets play an important role in the development of major adverse cardiac events (MACE) following percutaneous coronary intervention (PCI). The impact of platelet count on the outcome of patients undergoing PCI after pre-treatment with clopidogrel is unknown. The study included 5,256 patients enrolled in four randomized trials - ISAR-REACT, ISAR-SMART2, ISAR-SWEET, and ISAR-REACT2 - which assessed the value of abciximab in patients with coronary artery disease (CAD) undergoing PCI after pre-treatment with 600 mg of clopidogrel. Platelet count was measured at baseline before PCI. Primary endpoint was the 30-day incidence of MACE, secondary endpoint was mortality. The tertiles of platelet counts were: lower tertile (<198 x 10(9)/L; n = 1,726), middle tertile (198-244 x 10(9)/L; n = 1,750) and upper tertile (>244 x 10(9)/L; n = 1,780). The 30-day incidence of MACE was 6.7% (n = 116) among patients of the lower tertile, 6.3% (n = 111) among patients of the middle tertile, and 7.0% (n = 124) among patients of the upper tertile (P = 0.76). The 30-day mortality was 1.2% (n = 22) among patients of the upper tertile, 0.5% (n = 9) among patients of middle tertile and 0.6% (n = 11) among patients of the lower tertile (P = 0.04). Q-wave myocardial infarction occurred in 1.3% of patients (n = 23) in the upper tertile, 0.7% of patients (n = 13) in the middle tertile and 0.5% of patients (n = 8) in the lower tertile (P = 0.02). Platelet count was an independent correlate of 30-day mortality (hazard ratio 2.69, 95% confidence interval 1.08-6.67; P = 0.033 for the third vs. the first tertile). In conclusion, in patients with CAD undergoing PCI after pre-treatment with 600 mg clopidogrel, baseline platelet count predicts 30-day mortality.

  13. Cerebellar Nuclear Neurons Use Time and Rate Coding to Transmit Purkinje Neuron Pauses.

    PubMed

    Sudhakar, Shyam Kumar; Torben-Nielsen, Benjamin; De Schutter, Erik

    2015-12-01

    Neurons of the cerebellar nuclei convey the final output of the cerebellum to their targets in various parts of the brain. Within the cerebellum their direct upstream connections originate from inhibitory Purkinje neurons. Purkinje neurons have a complex firing pattern of regular spikes interrupted by intermittent pauses of variable length. How can the cerebellar nucleus process this complex input pattern? In this modeling study, we investigate different forms of Purkinje neuron simple spike pause synchrony and its influence on candidate coding strategies in the cerebellar nuclei. That is, we investigate how different alignments of synchronous pauses in synthetic Purkinje neuron spike trains affect either time-locking or rate-changes in the downstream nuclei. We find that Purkinje neuron synchrony is mainly represented by changes in the firing rate of cerebellar nuclei neurons. Pause beginning synchronization produced a unique effect on nuclei neuron firing, while the effect of pause ending and pause overlapping synchronization could not be distinguished from each other. Pause beginning synchronization produced better time-locking of nuclear neurons for short length pauses. We also characterize the effect of pause length and spike jitter on the nuclear neuron firing. Additionally, we find that the rate of rebound responses in nuclear neurons after a synchronous pause is controlled by the firing rate of Purkinje neurons preceding it.

  14. What 50 Years of Research Tell Us About Pausing Under Ratio Schedules of Reinforcement

    PubMed Central

    Schlinger, Henry D; Derenne, Adam; Baron, Alan

    2008-01-01

    Textbooks in learning and behavior commonly describe performance on fixed-ratio schedules as “break and run,” indicating that after reinforcement subjects typically pause and then respond quickly to the next reinforcement. Performance on variable-ratio schedules, on the other hand, is described as steady and fast, with few long pauses. Beginning with Ferster and Skinner's magnum opus, Schedules of Reinforcement (1957), the literature on pausing under ratio schedules has identified the influences on pausing of numerous important variables, in particular ratio size and reinforcement magnitude. As a result, some previously held assumptions have been called into question. For example, research has shown that the length of the pause is controlled not only by the preceding ratio, as Ferster and Skinner and others had assumed (and as implied by the phrase postreinforcement pause), but by the upcoming ratio as well. Similarly, despite the commonly held belief that ratio pausing is unique to the fixed-ratio schedule, there is evidence that pausing also occurs under variable-ratio schedules. If such widely held beliefs are incorrect, then what about other assumptions? This article selectively examines the literature on pausing under ratio schedules over the past 50 years and concludes that although there may indeed be some common patterns, there are also inconsistencies that await future resolution. Several accounts of pausing under ratio schedules are discussed along with the implications of the literature for human performances, most notably the behaviors termed procrastination. PMID:22478501

  15. Effects of leg strength and bicycle ergometry exercise on cardiovascular deconditioning after 30-day head-down bed rest

    NASA Astrophysics Data System (ADS)

    Wu, Bin; Liu, Yusheng; Sun, Hongyi; Zhao, Dongming; Wang, Yue; Wu, Ping; Ni, Chengzhi

    2010-10-01

    The purpose of this study is to determine if the intermittent leg muscular strength exercise and bicycle ergometry exercise could attenuate cardiovascular deconditioning induced by prolonged -6° head-down bed rest (HDBR). Fifteen male subjects were randomly allocated into group A ( n=5, 30 days HDBR without exercise), group B ( n=5, 30 days HDBR with leg muscular strength exercise) and group C ( n=5, 30 days HDBR with bicycle ergometry exercise). The orthostatic tolerance (OT) was determined by +75°/20 min head-up tilt (HUT) test and the submaximal exercise capacity was determined by bicycle ergometry before and after HDBR. The results were as follows: (1) Compared with that before HDBR, OT time decreased dramatically by 57.6% ( p<0.001) after HDBR in group A, while it decreased by 36.4% ( p=0.084) in group B and by 34.7% ( p=0.062) in group C. (2) Compared with that before HDBR, the submaximal exercise time decreased significantly by 17.7% ( p<0.05) and 21.1% ( p<0.05) in groups A and B, respectively, after HDBR. However, it had no change (+1.3%, p>0.77) in group C. (3) compared with that before HDBR, the changes of heart rate (HR) and blood pressure were slightly improved in group B and C, while deteriorated in group A during orthostatic test and exercise test after HDBR. The results indicate that leg muscular strength exercise and bicycle ergometry exercise could partially attenuate the cardiovascular deconditioning induced by 30 d HDBR, and the latter exercise training could fully provide the protection for the loss of exercise capacity.

  16. Hospital Nursing and 30-Day Readmissions among Medicare Patients with Heart Failure, Acute Myocardial Infarction, and Pneumonia

    PubMed Central

    McHugh, Matthew D.; Ma, Chenjuan

    2013-01-01

    Background Provisions of the Affordable Care Act that increase hospitals’ financial accountability for preventable readmissions have heightened interest in identifying system-level interventions to reduce readmissions. Objectives To determine the relationship between hospital nursing; i.e. nurse work environment, nurse staffing levels, and nurse education, and 30-day readmissions among Medicare patients with heart failure, acute myocardial infarction, and pneumonia. Method and Design Analysis of linked data from California, New Jersey, and Pennsylvania that included information on the organization of hospital nursing (i.e., work environment, patient-to-nurse ratios, and proportion of nurses holding a BSN degree) from a survey of nurses, as well as patient discharge data, and American Hospital Association Annual Survey data. Robust logistic regression was used to estimate the relationship between nursing factors and 30-day readmission. Results Nearly one-quarter of heart failure index admissions (23.3% [n=39,954]); 19.1% (n=12,131) of myocardial infarction admissions; and 17.8% (n=25,169) of pneumonia admissions were readmitted within 30-days. Each additional patient per nurse in the average nurse’s workload was associated with a 7% higher odds of readmission for heart failure (OR=1.07, [1.05–1.09]), 6% for pneumonia patients (OR=1.06, [1.03–1.09]), and 9% for myocardial infarction patients (OR=1.09, [1.05–1.13]). Care in a hospital with a good versus poor work environment was associated with odds of readmission that were 7% lower for heart failure (OR = 0.93, [0.89–0.97]); 6% lower for myocardial infarction (OR = 0.94, [0.88–0.98]); and 10% lower for pneumonia (OR = 0.90, [0.85–0.96]) patients. Conclusions Improving nurses’ work environments and staffing may be effective interventions for preventing readmissions. PMID:23151591

  17. Effects of Cardiopulmonary Support With a Novel Pediatric Pump-Lung in a 30-Day Ovine Animal Model.

    PubMed

    Liu, Yang; Sanchez, Pablo G; Wei, Xufeng; Watkins, Amelia C; Niu, Shuqiong; Wu, Zhongjun J; Griffith, Bartley P

    2015-12-01

    The scarcity of donor organs has led to the development of devices that provide optimal long-term respiratory or cardiopulmonary support to bridge recipients as they wait for lung and/or heart transplantation. This study was designed to evaluate the 30-day in vivo performance of the newly developed pediatric pump-lung (PediPL) for cardiopulmonary support using a juvenile sheep model. The PediPL device was placed surgically between the right atrium and descending aorta in eight sheep (25.4-31.2 kg) and evaluated for 30 days. Anticoagulation was maintained with continuous heparin infusion (activated clotting time 150-200 s). The flow rate was measured continually, and gas transfer was measured daily. Plasma free hemoglobin, platelet activation, hematologic data, and blood biochemistry were assessed twice a week. Sheep were euthanized after 30 days. The explanted devices were examined for gross thrombosis. Six sheep survived for 30-32 days. During the study, the oxygen transfer rate of the devices was 54.9 ± 13.2 mL/min at a mean flow rate of 1.14 ± 0.46 L/min with blood oxygen saturation of 95.4% ± 1.7%. Plasma free hemoglobin was 8.2 ± 3.7 mg/dL. Platelet activation was 5.35 ± 2.65%. The animals had normal organ chemistries except for surgery-related transient alterations in kidney and liver function. Although we found some scattered thrombi on the membrane surfaces of some explanted devices during the necropsy, the device function and performance did not degrade. The PediPL device was capable of providing cardiopulmonary support with long-term reliability and good biocompatibility over the 30-day duration and offers the potential option for bridging pediatric patients with end-stage heart or lung disease to heart and/or lung transplantation.

  18. A space maintainability experiment aboard the Ben Franklin submersible during the 30-day Gulf Stream drift mission.

    NASA Technical Reports Server (NTRS)

    Kappler, J. R.; May, C. B.

    1972-01-01

    In the summer of 1969, a deep submersible drifted for 30 days below the surface of the Gulf Stream, while operated by a six man crew. The main purpose of the mission was oceanographic research. The crew's activities and completely self-contained environment resembled those of a space station such as Skylab. Because of these similarities aspects of onboard vehicle maintenance during the actual conduct of a scientific mission were investigated. The maintainability study was accomplished in six distinct phases. Two useful plots of manpower distribution were developed. A maintenance action summary is presented in a table.

  19. Long-acting bronchodilators with or without inhaled corticosteroids and 30-day readmission in patients hospitalized for COPD

    PubMed Central

    Bishwakarma, Raju; Zhang, Wei; Kuo, Yong-Fang; Sharma, Gulshan

    2017-01-01

    Background The ability of a long-acting muscarinic antagonist (LAMA) and long-acting beta 2 agonists (LABAs; long-acting bronchodilators, LABDs) with or without inhaled corticosteroids (ICSs) to reduce early readmission in hospitalized patients with COPD is unknown. Methods We studied a 5% sample of Medicare beneficiaries enrolled in Medicare parts A, B and D and hospitalized for COPD in 2011. We examined prescriptions filled for LABDs with or without ICSs (LABDs±ICSs) within 90 days prior to and 30 days after hospitalization. Primary outcome was the 30-day readmission rate between “users” and “nonusers” of LABDs±ICSs. Propensity score matching and sensitivity analysis were performed by limiting analysis to patients hospitalized for acute exacerbation of COPD (AECOPD). Among 6,066 patients hospitalized for COPD, 3,747 (61.8%) used LABDs±ICSs during the specified period. The “user” and “nonuser” groups had similar rates of all-cause emergency room (ER) visits and readmissions within 30 days of discharge date (22.4% vs 20.7%, P-value 0.11; 18.0% vs 17.8%, P-value 0.85, respectively). However, the “users” had higher rates of COPD-related ER visits (5.3% vs 3.4%, P-value 0.0006), higher adjusted odds ratio (aOR) 1.47 (95% CI, 1.11–1.93) and readmission (7.8% vs 5.0%, P-value <0.0001 and aOR 1.48 [95% CI, 1.18–1.86]) than “nonusers”. After propensity score matching, the aOR of COPD-related ER visits was 1.45 (95% CI, 1.07–1.96) and that of readmission was 1.34 (95% CI, 1.04–1.73). The results were similar when restricted to patients hospitalized for AECOPD. Conclusion Use of LABDs±ICSs did not reduce 30-day readmissions in patients hospitalized for COPD. PMID:28203071

  20. Pharmacokinetic and Genomic Effects of Arsenite in Drinking Water on Mouse Lung in a 30-Day Exposure.

    PubMed

    Chilakapati, Jaya; Wallace, Kathleen; Hernandez-Zavala, Araceli; Moore, Tanya; Ren, Hongzu; Kitchin, Kirk T

    2015-01-01

    The 2 objectives of this subchronic study were to determine the arsenite drinking water exposure dependent increases in female C3H mouse liver and lung tissue arsenicals and to characterize the dose response (to 0, 0.05, 0.25, 1, 10, and 85 ppm arsenite in drinking water for 30 days and a purified AIN-93M diet) for genomic mouse lung expression patterns. Mouse lungs were analyzed for inorganic arsenic, monomethylated, and dimethylated arsenicals by hydride generation atomic absorption spectroscopy. The total lung mean arsenical levels were 1.4, 22.5, 30.1, 50.9, 105.3, and 316.4 ng/g lung tissue after 0, 0.05, 0.25, 1, 10, and 85 ppm, respectively. At 85 ppm, the total mean lung arsenical levels increased 14-fold and 131-fold when compared to either the lowest noncontrol dose (0.05 ppm) or the control dose, respectively. We found that arsenic exposure elicited minimal numbers of differentially expressed genes (DEGs; 77, 38, 90, 87, and 87 DEGs) after 0.05, 0.25, 1, 10, and 85 ppm, respectively, which were associated with cardiovascular disease, development, differentiation, apoptosis, proliferation, and stress response. After 30 days of arsenite exposure, this study showed monotonic increases in mouse lung arsenical (total arsenic and dimethylarsinic acid) concentrations but no clear dose-related increases in DEG numbers.

  1. Kansas City Cardiomyopathy Questionnaire Utility in Prediction of 30-Day Readmission Rate in Patients with Chronic Heart Failure

    PubMed Central

    Gui, Junhong; Zhu, Xiang; Malhotra, Divyanshu; Li, Shenjing; Virkram, Fnu; Chada, Aditya; Jiang, Haibing

    2016-01-01

    Background. Heart failure (HF) is one of the most common diagnoses associated with hospital readmission. We designed this prospective study to evaluate whether Kansas City Cardiomyopathy Questionnaire (KCCQ) score is associated with 30-day readmission in patients hospitalized with decompensated HF. Methods and Results. We enrolled 240 patients who met the study criteria. Forty-eight (20%) patients were readmitted for decompensated HF within thirty days of hospital discharge, and 192 (80%) patients were not readmitted. Compared to readmitted patients, nonreadmitted patients had a higher average KCCQ score (40.8 versus 32.6, P = 0.019) before discharge. Multivariate analyses showed that a high KCCQ score was associated with low HF readmission rate (adjusted OR = 0.566, P = 0.022). The c-statistic for the base model (age + gender) was 0.617. The combination of home medication and lab tests on the base model resulted in an integrated discrimination improvement (IDI) increase of 3.9%. On that basis, the KCQQ further increased IDI of 2.7%. Conclusions. The KCCQ score determined before hospital discharge was significantly associated with 30-day readmission rate in patients with HF, which may provide a clinically useful measure and could significantly improve readmission prediction reliability when combined with other clinical components. PMID:27872790

  2. Psychometric Properties of 7- and 30-Day Versions of the PROMIS Emotional Distress Item Banks in an Australian Adult Sample.

    PubMed

    Batterham, Philip J; Sunderland, Matthew; Carragher, Natacha; Calear, Alison L

    2017-01-01

    This study aimed to examine the psychometric properties of the PROMIS depression, anxiety, and anger item banks in a large Australian population-based sample. The study tested for unidimensionality; evaluated invariance across age, gender, and education; assessed local independence; and tested item bank scores as an indicator for clinical criteria. In addition, equivalence of the 7-day time frame against an alternative 30-day time frame was assessed. A sample of 3,175 Australian adults were recruited into the study through online advertising. All three item banks showed strong evidence of unidimensionality and parsimony, with no items showing local dependence. All items were invariant across age, gender, and education. The item banks were accurate in detecting clinical criteria for major depressive disorder, generalized anxiety disorder, and panic disorder, although legacy measures designed for this purpose sometimes performed marginally better. Responses to the 30-day time frame were highly consistent with the original 7-day time frame. The study provided support for the validity of the PROMIS emotional distress item banks as measures of depression, anxiety, and anger in the Australian population, supporting the generalizability of the measures. The time frame chosen for assessing mental health outcomes using these item banks should be based on pragmatic considerations.

  3. Readmission for Acute Exacerbation within 30 Days of Discharge Is Associated with a Subsequent Progressive Increase in Mortality Risk in COPD Patients: A Long-Term Observational Study

    PubMed Central

    Guerrero, Mónica; Crisafulli, Ernesto; Liapikou, Adamantia; Huerta, Arturo; Gabarrús, Albert; Chetta, Alfredo; Soler, Nestor; Torres, Antoni

    2016-01-01

    Background and Objective Twenty per cent of chronic obstructive pulmonary disease (COPD) patients are readmitted for acute exacerbation (AECOPD) within 30 days of discharge. The prognostic significance of early readmission is not fully understood. The objective of our study was to estimate the mortality risk associated with readmission for acute exacerbation within 30 days of discharge in COPD patients. Methods The cohort (n = 378) was divided into patients readmitted (n = 68) and not readmitted (n = 310) within 30 days of discharge. Clinical, laboratory, microbiological, and severity data were evaluated at admission and during hospital stay, and mortality data were recorded at four time points during follow-up: 30 days, 6 months, 1 year and 3 years. Results Patients readmitted within 30 days had poorer lung function, worse dyspnea perception and higher clinical severity. Two or more prior AECOPD (HR, 2.47; 95% CI, 1.51–4.05) was the only variable independently associated with 30-day readmission. The mortality risk during the follow-up period showed a progressive increase in patients readmitted within 30 days in comparison to patients not readmitted; moreover, 30-day readmission was an independent risk factor for mortality at 1 year (HR, 2.48; 95% CI, 1.10–5.59). In patients readmitted within 30 days, the estimated absolute increase in the mortality risk was 4% at 30 days (number needed to harm NNH, 25), 17% at 6-months (NNH, 6), 19% at 1-year (NNH, 6) and 24% at 3 years (NNH, 5). Conclusion In conclusion a readmission for AECOPD within 30 days is associated with a progressive increased long-term risk of death. PMID:26943928

  4. Kinetic modeling of molecular motors: pause model and parameter determination from single-molecule experiments

    NASA Astrophysics Data System (ADS)

    Morin, José A.; Ibarra, Borja; Cao, Francisco J.

    2016-05-01

    Single-molecule manipulation experiments of molecular motors provide essential information about the rate and conformational changes of the steps of the reaction located along the manipulation coordinate. This information is not always sufficient to define a particular kinetic cycle. Recent single-molecule experiments with optical tweezers showed that the DNA unwinding activity of a Phi29 DNA polymerase mutant presents a complex pause behavior, which includes short and long pauses. Here we show that different kinetic models, considering different connections between the active and the pause states, can explain the experimental pause behavior. Both the two independent pause model and the two connected pause model are able to describe the pause behavior of a mutated Phi29 DNA polymerase observed in an optical tweezers single-molecule experiment. For the two independent pause model all parameters are fixed by the observed data, while for the more general two connected pause model there is a range of values of the parameters compatible with the observed data (which can be expressed in terms of two of the rates and their force dependencies). This general model includes models with indirect entry and exit to the long-pause state, and also models with cycling in both directions. Additionally, assuming that detailed balance is verified, which forbids cycling, this reduces the ranges of the values of the parameters (which can then be expressed in terms of one rate and its force dependency). The resulting model interpolates between the independent pause model and the indirect entry and exit to the long-pause state model

  5. Postoperative astigmatism.

    PubMed

    Swinger, C A

    1987-01-01

    With the numerous significant advances in surgical methodology--e.g., microinstrumentation, the operating microscope, the surgical keratometer, and intraocular lenses--that have been developed over the past two decades, both surgeons and patients have become increasingly aware of the final optic result of any surgical intervention. This is especially so since the development of refractive surgery, where good uncorrected vision is frequently the final arbiter of success. We have progressed to the stage where the optic manipulation of the cornea, whether intentional or otherwise, can be understood in terms of a number of variables. These include the preparation and closure of the surgical wound, the choice of suture material, and both intraoperative and postoperative manipulations. Where these have failed and postoperative astigmatism still occurs, a number of surgical procedures are available to reduce the astigmatic error to an acceptable level.

  6. Pauses During Autobiographical Discourse Reflect Episodic Memory Processes in Early Alzheimer's Disease.

    PubMed

    Pistono, Aurélie; Jucla, Mélanie; Barbeau, Emmanuel J; Saint-Aubert, Laure; Lemesle, Béatrice; Calvet, Benjamin; Köpke, Barbara; Puel, Michèle; Pariente, Jérémie

    2016-01-01

    There is a large body of research on discourse production in Alzheimer's disease (AD). Some studies have focused on pause production, revealing that patients make extensive use of pauses during speech. This has been attributed to lexical retrieval difficulties, but pausing may also reflect other forms of cognitive impairment as it increases with cognitive load. The aim of the present study was to analyze autobiographical discourse impairment in AD from a broad perspective, looking at pausing behavior (frequency, duration, and location). Our first objective was to characterize discourse changes in mild cognitive impairment (MCI) due to AD. Our second objective was to determine the cognitive and neuroanatomical correlates of these changes. Fifteen patients with MCI due to AD and 15 matched cognitively normal controls underwent an ecological episodic memory task, a full neuropsychological assessment, and a 3D T1-weighted MRI scans. Autobiographical discourse collected from the ecological episodic memory task was recorded, transcribed, and analyzed, focusing on pausing. Intergroup comparisons showed that although patients did not produce more pauses than controls overall, they did make more between-utterance pauses. The number of these specific pauses was positively correlated with patients' episodic memory performance. Furthermore, neuroimaging analysis showed that, in the patient group, their use was negatively correlated with frontopolar area (BA 10) grey matter density. This region may therefore play an important role in the planning of autobiographical discourse production. These findings demonstrate that pauses in early AD may reflect a compensatory mechanism for improving mental time travel and memory retrieval.

  7. Promoter-proximal pausing of RNA polymerase II: emerging roles in metazoans

    PubMed Central

    Adelman, Karen; Lis, John T.

    2013-01-01

    Recent years have witnessed a sea change in our understanding of transcription regulation: whereas traditional models focused solely on the events that brought RNA polymerase II (Pol II) to a gene promoter to initiate RNA synthesis, emerging evidence points to the pausing of Pol II during early elongation as a widespread regulatory mechanism in higher eukaryotes. Current data indicate that pausing is particularly enriched at genes in signal-responsive pathways. Here the evidence for pausing of Pol II from recent high-throughput studies will be discussed, as well as the potential interconnected functions of promoter-proximally paused Pol II. PMID:22986266

  8. [Effect of 30-day space flight and subsequent readaptation on the signaling processes in m. longissimus dorsi of mice].

    PubMed

    Mirzoev, T M; Vil'chinskaia, N A; Lomonosova, Iu N; Nemirovskaia, T L; Shenkman, B S

    2014-01-01

    Some steps of anabolic and catabolic signaling pathways were investigated in postural/tonic m. longissimus dorsi of mice following the 30-day orbital flight of biosatellite "Bion-M1" and 8-day recovery. Western blotting was used for determining insulin receptor substrate 1 (IRS-1) and AMR-activated protein kinase (AMPK) involved in reciprocal regulation of anabolic and catabolic pathways, as well as E3-ligase MURF-1, and elongation factor eEF2. Functioning of the IGF-1-dependent IRS-1 signaling pathway was activated in the recovery period only. Though the content of ubiquitinligase MURF-1 showed an increase after flight, on completion of the recovery period it did not exceed the pre-flight level unambiguously.

  9. Hip Fractures: What Information Does the Evidence Show That Patients and Families Need to Decrease 30-Day Readmission?

    PubMed

    Gardner, Kristin OʼMara

    2015-01-01

    The current bundled payment reimbursement from the Centers for Medicare & Medicaid Services will not cover the additional cost of hospital readmission for the same diagnosis, and patients with hip fractures have one of the highest cost-saving opportunities when compared with other admission reasons. Common reasons for readmission to the hospital after hip fracture include pneumonia, dehydration, and mobility issues. The learning modalities including visual, aural, read/write, and kinesthetic were used to make recommendations on how the education can be incorporated into the instruction of patients with hip fractures and their families. These learning techniques can be used to develop education to decrease possibility of 30-day readmission after hip fracture. Nurses must focus their education to meet the needs of each individual patient, adapting to different types of adult learners to increase the health literacy of patients with hip fractures and their families.

  10. Adding Laboratory Data to Hospital Claims Data to Improve Risk Adjustment of Inpatient/30-Day Postdischarge Outcomes.

    PubMed

    Pine, Michael; Fry, Donald E; Hannan, Edward L; Naessens, James M; Whitman, Kay; Reband, Agnes; Qian, Feng; Schindler, Joseph; Sonneborn, Mark; Roland, Jaclyn; Hyde, Linda; Dennison, Barbara A

    Numerical laboratory data at admission have been proposed for enhancement of inpatient predictive modeling from administrative claims. In this study, predictive models for inpatient/30-day postdischarge mortality and for risk-adjusted prolonged length of stay, as a surrogate for severe inpatient complications of care, were designed with administrative data only and with administrative data plus numerical laboratory variables. A comparison of resulting inpatient models for acute myocardial infarction, congestive heart failure, coronary artery bypass grafting, and percutaneous cardiac interventions demonstrated improved discrimination and calibration with administrative data plus laboratory values compared to administrative data only for both mortality and prolonged length of stay. Improved goodness of fit was most apparent in acute myocardial infarction and percutaneous cardiac intervention. The emergence of electronic medical records should make the addition of laboratory variables to administrative data an efficient and practical method to clinically enhance predictive modeling of inpatient outcomes of care.

  11. Effect of a 30-day isolation stress on calcium, phosphorus and other excretory products in an unrestrained chimpanzee.

    NASA Technical Reports Server (NTRS)

    Sabbot, I. M.; Mcnew, J. J.; Hoshizaki, T.; Sedgwick, C. J.; Adey, W. R.

    1972-01-01

    An unrestrained chimpanzee was studied in an isolation chamber and in his home cage environment. The study consisted of 49 urine collection days (14 days pre-, 5 days post- and 30 days of isolation), and then of 10 days in the home cage. Dietary intake, urine and fecal data were obtained. The effect of isolation on various excretory parameters was studied. Urine samples were analyzed for volume, osmolarity, creatinine, creatine, urea-N, 17-hydroxy corticosteroids, VMA, calcium and inorganic phosphorus. One way analyses of variance performed on the urinary excretion parameters showed all except creatinine excretion to vary significantly during periods of the study. The changes observed in calcium and phosphorus were highly significant. The data suggests that the calcium to phosphorus excretion ratio might serve as a physiological stress indicator of Selye's adaptation syndrome (period of resistance).

  12. Community Level Association between Home Health and Nursing Home Performance on Quality and Hospital 30-day Readmissions for Medicare Patients.

    PubMed

    Wang, Yun; Pandolfi, Michelle M; Fine, Jonathan; Metersky, Mark L; Wang, Changqin; Ho, Shih-Yieh; Galusha, Deron; Nuti, Sudhakar V; Murugiah, Karthik; Spenard, Ann; Elwell, Timothy; Krumholz, Harlan M

    2016-11-01

    We evaluated whether community-level home health agencies and nursing home performance is associated with community-level hospital 30-day all-cause risk-standardized readmission rates for Medicare patients used data from the Centers for Medicare & Medicaid Service from 2010 to 2012. Our final sample included 2,855 communities that covered 4,140 hospitals with 6,751,713 patients, 13,060 nursing homes with 1,250,648 residents, and 7,613 home health agencies providing services to 35,660 zipcodes. Based on a mixed effect model, we found that increasing nursing home performance by one star for all of its 4 measures and home health performance by 10 points for all of its 6 measures is associated with decreases of 0.25% (95% CI 0.17-0.34) and 0.60% (95% CI 0.33-0.83), respectively, in community-level risk-standardized readmission rates.

  13. Classifying emergency 30-day readmissions in England using routine hospital data 2004–2010: what is the scope for reduction?

    PubMed Central

    Blunt, Ian; Bardsley, Martin; Grove, Amy; Clarke, Aileen

    2015-01-01

    Background Many health systems across the globe have introduced arrangements to deny payment for patients readmitted to hospital as an emergency. The purpose of this study was to develop an exploratory categorisation based on likely causes of readmission, and then to assess the prevalence of these different types. Methods Retrospective analysis of 82 million routinely collected National Health Service hospital records in England (2004–2010) was undertaken using anonymised linkage of records at person-level. Numbers of 30-day readmissions were calculated. Exploratory categorisation of readmissions was applied using simple rules relating to International Classification of Diseases (ICD) diagnostic codes for both admission and readmission. Results There were 5 804 472 emergency 30-day readmissions over a 6-year period, equivalent to 7.0% of hospital discharges. Readmissions were grouped into hierarchically exclusive categories: potentially preventable readmission (1 739 519 (30.0% of readmissions)); anticipated but unpredictable readmission (patients with chronic disease or likely to need long-term care; 1 141 987 (19.7%)); preference-related readmission (53 718 (0.9%)); artefact of data collection (16 062 (0.3%)); readmission as a result of accident, coincidence or related to a different body system (1 101 818 (19.0%)); broadly related readmission (readmission related to the same body system (1 751 368 (30.2%)). Conclusions In this exploratory categorisation, a large minority of emergency readmissions (eg, those that are potentially preventable or due to data artefacts) fell into groups potentially amenable to immediate reduction. For other categories, a hospital's ability to reduce emergency readmission is less clear. Reduction strategies and payment incentives must be carefully tailored to achieve stated aims. PMID:24668396

  14. Anabolic and Catabolic Signaling Pathways in mouse Longissimus Dorsi after 30-day BION-M1 Spaceflight and Subsequent Recovery

    NASA Astrophysics Data System (ADS)

    Mirzoev, Timur; Blottner, Dieter; Shenkman, Boris; Lomonosova, Yulia; Vilchinskaya, Natalia; Nemirovskaya, Tatiana; Salanova, Michele

    The aim of the study was to analyze some of the key markers regulating anabolic and catabolic processes in mouse m. longissimus dorsi, an important back muscle system for trunk stabilization, following 30-day spaceflight and 8-day recovery period. C57/black mice were divided into 3 groups: 1) Vivarium Control (n=7), 2) Flight (n=5), 3) Recovery (n=5). The experiment was carried out in accordance with the rules of biomedical ethics certified by the Russian Academy of Sciences Committee on Bioethics. Using Western-blotting analysis we determined the content of IRS-1, p-AMPK, MURF-1 and eEF2 in m. longissimus dorsi. The content of IRS-1 in mice m. longissimus dorsi after the 30-day flight did not differ from the control group, however, in the Recovery group IRS-1 level was 80% higher (p<0.05) as compared to Control. Phospho-AMPK content remained unchanged. In the Recovery group there was an increase of eEF2 by 75% compared to the Control (p<0.05). After spaceflight MuRF-1 content was increased more than 2 times compared to the control animals. Thus, our findings showed that the work of the IRS-1 - dependent signaling pathway is only active in the recovery period. The content of the ubiquitin-ligase MURF-1 that takes parts in degrading myosin heavy chain was increased after the spaceflight, however, after 8-day recovery period MURF-1 level did not exceed the control indicating normalization of protein degradation in m. longissimus dorsi. The work was supported by the program of basic research of RAS and Federal Space Program of Russia for the period of 2006-2015.

  15. Progress in Written Language Bursts, Pauses, Transcription, and Written Composition across Schooling

    ERIC Educational Resources Information Center

    Alves, Rui A.; Limpo, Teresa

    2015-01-01

    Research on adult writers has shown that writing proceeds through bursts of transcription activity interspersed by long pauses. Yet few studies have examined how these writing behaviors unfold during early and middle childhood. This study traces the progress of bursts, pauses, transcription, and written composition in Portuguese students from…

  16. Pauses in Elementary School Children's Verbatim and Gist Free Recall of a Story

    ERIC Educational Resources Information Center

    Schonpflug, Ute

    2008-01-01

    The aim of the research was to explore the function of pauses in children's oral verbatim and gist-based free recall, assuming that pauses indicate cognitive processing. The main question guiding this research was whether verbatim and gist recall constituted two different ways of cognitive processing associated with different time patterns of…

  17. Reducing Vocalized Pauses in Public Speaking Situations Using the VP Card

    ERIC Educational Resources Information Center

    Ramos Salazar, Leslie

    2014-01-01

    This article describes a speaking problem very common in today's world--"vocalized pauses" (VP). Vocalized pauses are defined as utterances such as "uh," "like," and "um" that occur between words in oral sentences. This practice of everyday speech can affect how a speaker's intentions are…

  18. Short Pauses in Thalamic Deep Brain Stimulation Promote Tremor and Neuronal Bursting

    PubMed Central

    Swan, Brandon D.; Brocker, David T.; Hilliard, Justin D.; Tatter, Stephen B.; Gross, Robert E.; Turner, Dennis A.; Grill, Warren M.

    2015-01-01

    Objective We conducted intraoperative measurements of tremor during DBS containing short pauses (≤50 ms) to determine if there is a minimum pause duration that preserves tremor suppression. Methods Nine subjects with ET and thalamic DBS participated during IPG replacement surgery. Patterns of DBS included regular 130 Hz stimulation interrupted by 0, 15, 25 or 50 ms pauses. The same patterns were applied to a model of the thalamic network to quantify effects of pauses on activity of model neurons. Results All patterns of DBS decreased tremor relative to ‘off’. Patterns with pauses generated less tremor reduction than regular high frequency DBS. The model revealed that rhythmic burst-driver inputs to thalamus were masked during DBS, but pauses in stimulation allowed propagation of bursting activity. The mean firing rate of bursting-type model neurons as well as the firing pattern entropy of model neurons were both strongly correlated with tremor power across stimulation conditions. Conclusion The temporal pattern of stimulation influences the efficacy of thalamic DBS. Pauses in stimulation resulted in decreased tremor suppression indicating that masking of pathological bursting is a mechanism of thalamic DBS for tremor. Significance Pauses in stimulation decreased the efficacy of open-loop DBS for suppression of tremor. PMID:26330131

  19. An Experimental Investigation of the Function of Filled Pauses in Speech

    ERIC Educational Resources Information Center

    Lallgee, Mansur G.; Cook, Mark

    1969-01-01

    Examines the relationship of filled pauses (e.g. er, ah, um) to the speaker's desire to continue speaking when engaged in a dialogue. The data suggest that filled pauses increase as a result of this desire only during monologues. Table and bibliography. (RW)

  20. What 50 Years of Research Tell Us about Pausing under Ratio Schedules of Reinforcement

    ERIC Educational Resources Information Center

    Schlinger, H. D.; Derenne, A.; Baron, A.

    2008-01-01

    Textbooks in learning and behavior commonly describe performance on fixed-ratio schedules as "break and run," indicating that after reinforcement subjects typically pause and then respond quickly to the next reinforcement. Performance on variable-ratio schedules, on the other hand, is described as steady and fast, with few long pauses. Beginning…

  1. Extensive polymerase pausing during Drosophila axis patterning enables high-level and pliable transcription

    PubMed Central

    Saunders, Abbie; Core, Leighton J.; Sutcliffe, Catherine; Lis, John T.; Ashe, Hilary L.

    2013-01-01

    Cascades of zygotic gene expression pattern the anterior–posterior (AP) and dorsal–ventral (DV) axes of the early Drosophila embryo. Here, we used the global run-on sequencing assay (GRO-seq) to map the genome-wide RNA polymerase distribution during early Drosophila embryogenesis, thus providing insights into how genes are regulated. We identify widespread promoter-proximal pausing yet show that the presence of paused polymerase does not necessarily equate to direct regulation through pause release to productive elongation. Our data reveal that a subset of early Zelda-activated genes is regulated at the level of polymerase recruitment, whereas other Zelda target and axis patterning genes are predominantly regulated through pause release. In contrast to other signaling pathways, we found that bone morphogenetic protein (BMP) target genes are collectively more highly paused than BMP pathway components and show that BMP target gene expression requires the pause-inducing negative elongation factor (NELF) complex. Our data also suggest that polymerase pausing allows plasticity in gene activation throughout embryogenesis, as transiently repressed and transcriptionally silenced genes maintain and lose promoter polymerases, respectively. Finally, we provide evidence that the major effect of pausing is on the levels, rather than timing, of transcription. These data are discussed in terms of the efficiency of transcriptional activation required across cell populations during developmental time constraints. PMID:23699410

  2. Effect of 30-day orbital flight BION M1 on excretion of expired endogenous CO in mice

    NASA Astrophysics Data System (ADS)

    Shulagin, Yury; Tatarkin, Sergey; Dyachenko, Alexander

    It is known that increased destruction of hem structures is accompanied by increase of the endogenous carbon monoxide excretion rate with respiration (VCO). Changes VCO preceded the observed changes in the blood composition [D’yachenko A. et al., 2010]. Changes in blood composition, i.e. rise of red blood cells content and reduction of reticulocytes content was detected after a 12-day orbital flight (OF) in mice C57BL/6 [Gridley D.et al., 2003]. The purpose of this study was to investigate the effect of 30-day OF on excretion of endogenous CO. The method and apparatus for simultaneous measurement of VCO, and O2 and CO2 exchange were developed. The research consisted of three parts: 1). Measurement of VCO in five C57BL/6 mice after 30-day OF on the Russian satellite BION M1. 2). Measurement of VCO in six C57BL/6 mice after 30-day ground-based experiment (GBE) with simulated flight telemetry environment of BION M1. 3). Measurement of VCO in seven C57BL/6 mice in vivarium The results: Mice weight after OF was 24.3+-3.3 (mean +-SD) with minimal weight 18.1 g, and maximal weight 29.9 g. Vivarium mice weight was 27.0+-1.8 g. KGE mice weight was 25.0+-1.3 g. Mice age in all three groups was the same. We measured and estimated VCO and total CO excretion (MCO) for two gas mixtures ventilated mouse camera: atmospheric CO-contained air and then CO-free air(30 min). The results showed that the average MCO allocated GBE and vivarium mice did not significantly differ. Average MCO in mice after OF was significantly higher then in vivarium group (T=-2,74; p=0.02). MCO after GBE was between the vivarium and OF groups. MCO in OF and KGE groups did not differ ( T=-1,93; p=0,085). Blood tests in mice after OF was not carried out, because the recovery after the OF was studied in this group. The largest excretion of CO was observed in a mouse N39 after the OF. The weight of this mouse was only 18.1 g, i.e. much less than mean weight. Increase of VCO in food-restricted animal is known

  3. 30-Day Mortality and Late Survival with Reinterventions and Readmissions after Open and Endovascular Aortic Aneurysm Repair in Medicare Beneficiaries

    PubMed Central

    Giles, Kristina A; Landon, Bruce E; Cotterill, Philip; O'Malley, A. James; Pomposelli, Frank B; Schermerhorn, Marc L

    2010-01-01

    Objectives Late survival is similar after EVAR and open AAA repair despite a perioperative benefit with EVAR. AAA-related reinterventions are more common after EVAR while laparotomy related reinterventions are more common after open repair. The impact of reinterventions on survival, however, is unknown. We therefore evaluate the rate of reinterventions and readmission after initial AAA repair along with 30-day mortality and the effect upon long term survival. Methods We identified AAA and laparotomy-related reinterventions for propensity score matched cohorts of Medicare beneficiaries (n=45,652) undergoing EVAR and open repair from 2001-2004. Follow-up was up to 6 years. Hospitalizations for ruptured AAA without repair and for bowel obstruction or ventral hernia without abdominal surgery were also recorded. Event rates were calculated per year and are also presented through 6 years of follow-up as events per 100 person years. Thirty day mortality was calculated for each reintervention or readmission. Results Through 6 years, overall reinterventions or readmissions were similar between repair methods but slightly more common after EVAR (7.6 vs. 7.0 per 100 person years, RR 1.1, P < .001). Overall 30 day mortality with any reintervention or readmission was 9.1%. EVAR patients had more ruptures (0.50 vs. 0.09, RR 5.7, P < .001) with a mortality of 28%, but these were uncommon. EVAR patients also had more AAA-related reinterventions through 6 years (3.7 vs. 0.9, RR 4.0, P < .001) (mortality 5.6%), the majority of which were minor endovascular reinterventions (2.4 vs. 0.2, RR 11.4, P < .001) with a 30 day mortality of 3.0%. However, minor open (0.8 vs. 0.5, RR 1.4, P < .001) (mortality 6.9%) and major reinterventions (0.4 vs. 0.2, RR 2.4, P < .001) (mortality 12.1%) were also more common after EVAR than open repair. Conversely, EVAR patients had fewer laparotomy related reinterventions than open patients (1.4 vs. 3.0, RR 0.5, P < .001) (mortality 8.1%) and readmissions

  4. Contextual Interaction Design: The Case of Pause Buddy

    NASA Astrophysics Data System (ADS)

    Keyson, David V.; Doff-Ottens, Hannah J.

    This paper describes a range of design techniques which have been elaborated upon by Industrial Designers to create novel interactive products in which context and social interaction play a central role in the user experience. The techniques described here can be broadly grouped under Context Mapping and Research through Design. The methods are presented as part of a design process, from "fuzzy front end" to a working field prototype. To illustrate how the methods can be applied, the design of a prototype product that was developed to reduce office stress by stimulating short breaks and social interaction pauses is described. The results of a field study are reported following by a reflection on the value of applied design methods.

  5. Utility of models to predict 28-day or 30-day unplanned hospital readmissions: an updated systematic review

    PubMed Central

    Zhou, Huaqiong; Della, Phillip R; Roberts, Pamela; Goh, Louise; Dhaliwal, Satvinder S

    2016-01-01

    Objective To update previous systematic review of predictive models for 28-day or 30-day unplanned hospital readmissions. Design Systematic review. Setting/data source CINAHL, Embase, MEDLINE from 2011 to 2015. Participants All studies of 28-day and 30-day readmission predictive model. Outcome measures Characteristics of the included studies, performance of the identified predictive models and key predictive variables included in the models. Results Of 7310 records, a total of 60 studies with 73 unique predictive models met the inclusion criteria. The utilisation outcome of the models included all-cause readmissions, cardiovascular disease including pneumonia, medical conditions, surgical conditions and mental health condition-related readmissions. Overall, a wide-range C-statistic was reported in 56/60 studies (0.21–0.88). 11 of 13 predictive models for medical condition-related readmissions were found to have consistent moderate discrimination ability (C-statistic ≥0.7). Only two models were designed for the potentially preventable/avoidable readmissions and had C-statistic >0.8. The variables ‘comorbidities’, ‘length of stay’ and ‘previous admissions’ were frequently cited across 73 models. The variables ‘laboratory tests’ and ‘medication’ had more weight in the models for cardiovascular disease and medical condition-related readmissions. Conclusions The predictive models which focused on general medical condition-related unplanned hospital readmissions reported moderate discriminative ability. Two models for potentially preventable/avoidable readmissions showed high discriminative ability. This updated systematic review, however, found inconsistent performance across the included unique 73 risk predictive models. It is critical to define clearly the utilisation outcomes and the type of accessible data source before the selection of the predictive model. Rigorous validation of the predictive models with moderate-to-high discriminative

  6. Immunohistochemical study of motoneurons in lumbar spinal cord of c57black/6 mice after 30-days space flight

    NASA Astrophysics Data System (ADS)

    Tyapkina, Oksana; Islamov, Rustem; Nurullin, Leniz; Petrov, Konstantin.; Rezvyakov, Pavel; Nikolsky, Evgeny

    To investigate mechanisms of hypogravity motor syndrome development the immunoexpression of heat shock proteins (Hsp27 and Hsp70), proteins of synaptic transmission (Synaptophysin and PSD95) and neuroprotective proteins (VEGF and Flt-1) in motoneurons of lumbar spinal cord in c57black/6 control mice (n=2) and after 30-days space flight (n=2) was studied. For a quantitative assessment of target proteins level in motoneurons frozen cross sections of lumbar spinal cord were underwent to immunohistochemical staining. Primary antibodies against VEGF, Flt-1, Hsp27 and Hsp70 (SantaCruz Biotechnology, inc. USA), against Synaptophysin and PSD95 (Abcam plc, UK) were visualized by streptavidin-biotin method. Images of spinal cords were received using OlympusBX51WI microscope with AxioCamMRm camera (CarlZeiss, Germany) and the AxioVisionRel. 4.6.3 software (CarlZeiss, Germany). The digitized data were analyzed using ImageJ 1.43 software (NIH, the USA). Quantitively, protein level in motoneurons was estimated by the density of immunoprecipitation. Results of research have not revealed any reliable changes in the immunnoexpression of vascular endothelial growth factor (VEGF) and its Flt-1 receptor in motoneurons of lumbar spinal cord in control and in mice after 30-day space flight. Studying of heat shock proteins, such as Hsp27 and Hsp70, revealed the decrease in level of these proteins immunoexpression in motoneurons of mice from flight group by 15% and 10%, respectively. Some decrease in level of immunnoexpression of presynaptic membrane proteins (synaptophysin, by 21%) and proteins of postsynaptic area (PSD95, by 55%) was observed after space flight. The data obtained testify to possible changes in a functional state (synaptic activity and stress resistance) of motoneurons of lumbar spinal cord in mice after space flight. Thus, we obtained new data on involvement of motoneurons innervating skeletal muscles in development of hypogravity motor syndrome. Research was supported

  7. Control of transcriptional pausing by biased thermal fluctuations on repetitive genomic sequences

    PubMed Central

    Imashimizu, Masahiko; Afek, Ariel; Takahashi, Hiroki; Lubkowska, Lucyna; Lukatsky, David B.

    2016-01-01

    In the process of transcription elongation, RNA polymerase (RNAP) pauses at highly nonrandom positions across genomic DNA, broadly regulating transcription; however, molecular mechanisms responsible for the recognition of such pausing positions remain poorly understood. Here, using a combination of statistical mechanical modeling and high-throughput sequencing and biochemical data, we evaluate the effect of thermal fluctuations on the regulation of RNAP pausing. We demonstrate that diffusive backtracking of RNAP, which is biased by repetitive DNA sequence elements, causes transcriptional pausing. This effect stems from the increased microscopic heterogeneity of an elongation complex, and thus is entropy-dominated. This report shows a linkage between repetitive sequence elements encoded in the genome and regulation of RNAP pausing driven by thermal fluctuations. PMID:27830653

  8. Transcriptional pausing at the translation start site operates as a critical checkpoint for riboswitch regulation

    PubMed Central

    Chauvier, Adrien; Picard-Jean, Frédéric; Berger-Dancause, Jean-Christophe; Bastet, Laurène; Naghdi, Mohammad Reza; Dubé, Audrey; Turcotte, Pierre; Perreault, Jonathan; Lafontaine, Daniel A.

    2017-01-01

    On the basis of nascent transcript sequencing, it has been postulated but never demonstrated that transcriptional pausing at translation start sites is important for gene regulation. Here we show that the Escherichia coli thiamin pyrophosphate (TPP) thiC riboswitch contains a regulatory pause site in the translation initiation region that acts as a checkpoint for thiC expression. By biochemically probing nascent transcription complexes halted at defined positions, we find a narrow transcriptional window for metabolite binding, in which the downstream boundary is delimited by the checkpoint. We show that transcription complexes at the regulatory pause site favour the formation of a riboswitch intramolecular lock that strongly prevents TPP binding. In contrast, cotranscriptional metabolite binding increases RNA polymerase pausing and induces Rho-dependent transcription termination at the checkpoint. Early transcriptional pausing may provide a general mechanism, whereby transient transcriptional windows directly coordinate the sensing of environmental cues and bacterial mRNA regulation. PMID:28071751

  9. An examination of writing pauses in the handwriting of children with developmental coordination disorder.

    PubMed

    Prunty, Mellissa M; Barnett, Anna L; Wilmut, Kate; Plumb, Mandy S

    2014-11-01

    Difficulties with handwriting are reported as one of the main reasons for the referral of children with Developmental Coordination Disorder (DCD) to healthcare professionals. In a recent study we found that children with DCD produced less text than their typically developing (TD) peers and paused for 60% of a free-writing task. However, little is known about the nature of the pausing; whether they are long pauses possibly due to higher level processes of text generation or fatigue, or shorter pauses related to the movements between letters. This gap in the knowledge-base creates barriers to understanding the handwriting difficulties in children with DCD. The aim of this study was to characterise the pauses observed in the handwriting of English children with and without DCD. Twenty-eight 8-14 year-old children with a diagnosis of DCD participated in the study, with 28 TD age and gender matched controls. Participants completed the 10 min free-writing task from the Detailed Assessment of Speed of Handwriting (DASH) on a digitising writing tablet. The total overall percentage of pausing during the task was categorised into four pause time-frames, each derived from the literature on writing (250 ms to 2 s; 2-4 s; 4-10 s and >10 s). In addition, the location of the pauses was coded (within word/between word) to examine where the breakdown in the writing process occurred. The results indicated that the main group difference was driven by more pauses above 10 s in the DCD group. In addition, the DCD group paused more within words compared to TD peers, indicating a lack of automaticity in their handwriting. These findings may support the provision of additional time for children with DCD in written examinations. More importantly, they emphasise the need for intervention in children with DCD to promote the acquisition of efficient handwriting skill.

  10. Effects of 30 day simulated microgravity and recovery on fluid homeostasis and renal function in the rat

    NASA Technical Reports Server (NTRS)

    Tucker, Bryan J.; Mendonca, Margarida M.

    1995-01-01

    Transition from a normal gravitational environment to that of microgravity eventually results in decreased plasma and blood volumes, increasing with duration of exposure to microgravity. This loss of vascular fluid is presumably due to negative fluid and electrolyte balance and most likely contributes to the orthostatic intolerance associated with the return to gravity. The decrease in plasma volume is presumed to be a reflection of a concurrent decrease in extracellular fluid volume with maintenance of normal plasma-interstitial fluid balance. In addition, the specific alterations in renal function contributing to these changes in fluid and electrolyte homeostasis are potentially responding to neuro-humoral signals that are not consistent with systemic fluid volume status. We have previously demonstrated an early increase in both glomerular filtration rate and extracellular fluid volume and that this decreases towards control values by 7 days of simulated microgravity. However, longer duration studies relating these changes to plasma volume alterations and the response to return to orthostasis have not been fully addressed. Male Wistar rats were chronically cannulated, submitted to 30 days heat-down tilt (HDT) and followed for 7 days after return to orthostasis from HDT. Measurements of renal function and extracellular and blood volumes were performed in the awake rat.

  11. Increased in vivo glucose utilization in 30-day-old obese Zucker rat: Role of white adipose tissue

    SciTech Connect

    Krief, S.; Bazin, R.; Dupuy, F.; Lavau, M. )

    1988-03-01

    In vivo whole-body glucose utilization and uptake in multiple individual tissues were investigated in conscious 30-day-old Zucker rats, which when obese are hyperphagic, hyperinsulinemic, and normoglycemic. Whole-body glucose metabolism (assessed by (3-{sup 3}H)glucose) was 40% higher in obese (fa/fa) than in lean (Fa/fa) rats, suggesting that obese rats were quite responsive to their hyperinsulinemia. In obese compared with lean rats, tissue glucose uptake was increased by 15, 12, and 6 times in dorsal, inguinal, perigonadal white depots, respectively; multiplied by 2.5 in brown adipose tissue; increased by 50% in skin from inguinal region but not in that from cranial, thoracic, or dorsal area; and increased twofold in diaphragm but similar in heart in proximal intestine, and in total muscular mass of limbs. The data establish that in young obese rats the hypertrophied white adipose tissue was a major glucose-utilizing tissue whose capacity for glucose disposal compared with that of half the muscular mass. Adipose tissue could therefore play an important role in the homeostasis of glucose in obese rats in the face of their increased carbohydrate intake.

  12. Human performance profiles for planetary analog extra-vehicular activities: 120 day and 30 day analog missions

    NASA Astrophysics Data System (ADS)

    Swarmer, Tiffany M.

    Understanding performance factors for future planetary missions is critical for ensuring safe and successful planetary extra-vehicular activities (EVAs). The goal of this study was to gain operational knowledge of analog EVAs and develop biometric profiles for specific EVA types. Data was collected for a 120 and 30 day analog planetary exploration simulation focusing on EVA type, pre and post EVA conditions, and performance ratings. From this five main types of EVAs were performed: maintenance, science, survey/exploratory, public relations, and emergency. Each EVA type has unique characteristics and performance ratings showing specific factors in chronological components, environmental conditions, and EVA systems that have an impact on performance. Pre and post biometrics were collected to heart rate, blood pressure, and SpO2. Additional data about issues and specific EVA difficulties provide some EVA trends illustrating how tasks and suit comfort can negatively affect performance ratings. Performance decreases were noted for 1st quarter and 3rd quarter EVAs, survey/exploratory type EVAs, and EVAs requiring increased fine and gross motor function. Stress during the simulation is typically higher before the EVA and decreases once the crew has returned to the habitat. Stress also decreases as the simulation nears the end with the 3rd and 4th quarters showing a decrease in stress levels. Operational components and studies have numerous variable and components that effect overall performance, by increasing the knowledge available we may be able to better prepare future crews for the extreme environments and exploration of another planet.

  13. The migraine generator revisited: continuous scanning of the migraine cycle over 30 days and three spontaneous attacks.

    PubMed

    Schulte, Laura H; May, Arne

    2016-07-01

    Functional imaging using positron emission tomography and later functional magnetic resonance imaging revealed a particular brainstem area that is believed to be specifically activated in migraine during, but not outside of the attack, and consequently has been coined the 'migraine generator'. However, the pathophysiological concept behind this term is not undisputed and typical migraine premonitory symptoms such as fatigue and yawning, but also a typical association of attacks to circadian and menstrual cycles, all make the hypothalamus a possible regulating region of migraine attacks. Neuroimaging studies investigating native human migraine attacks however are scarce and for methodological but also clinical reasons there are currently no studies investigating the last 24 h before headache onset. Here we report a migraine patient who had magnetic resonance imaging every day for 30 days, always in the morning, to cover, using functional imaging, a whole month and three complete, untreated migraine attacks. We found that hypothalamic activity as a response to trigeminal nociceptive stimulation is altered during the 24 h prior to pain onset, i.e. increases towards the next migraine attack. More importantly, the hypothalamus shows altered functional coupling with the spinal trigeminal nuclei and the region of the migraine generator, i.e. the dorsal rostral pons during the preictal day and the pain phase of native human migraine attacks. These data suggest that although the brainstem is highly linked to the migraine biology, the real driver of attacks might be the functional changes in hypothalamo-brainstem connectivity.

  14. The History of Research on the Filled Pause as Evidence of "The Written Language Bias in Linguistics" (Linell, 1982)

    ERIC Educational Resources Information Center

    O'Connell, Daniel C.; Kowal, Sabine

    2004-01-01

    Erard's (2004) publication in the "New York Times" of a journalistic history of the filled pause serves as the occasion for this critical review of the past half-century of research on the filled pause. Historically, the various phonetic realizations or instantiations of the filled pause have been presented with an odd recurrent admixture of the…

  15. Gene Expression Profiling in Slow-Type Calf Soleus Muscle of 30 Days Space-Flown Mice.

    PubMed

    Gambara, Guido; Salanova, Michele; Ciciliot, Stefano; Furlan, Sandra; Gutsmann, Martina; Schiffl, Gudrun; Ungethuem, Ute; Volpe, Pompeo; Gunga, Hanns-Christian; Blottner, Dieter

    2017-01-01

    Microgravity exposure as well as chronic disuse are two main causes of skeletal muscle atrophy in animals and humans. The antigravity calf soleus is a reference postural muscle to investigate the mechanism of disuse-induced maladaptation and plasticity of human and rodent (rats or mice) skeletal musculature. Here, we report microgravity-induced global gene expression changes in space-flown mouse skeletal muscle and the identification of yet unknown disuse susceptible transcripts found in soleus (a mainly slow phenotype) but not in extensor digitorum longus (a mainly fast phenotype dorsiflexor as functional counterpart to soleus). Adult C57Bl/N6 male mice (n = 5) flew aboard a biosatellite for 30 days on orbit (BION-M1 mission, 2013), a sex and age-matched cohort were housed in standard vivarium cages (n = 5), or in a replicate flight habitat as ground control (n = 5). Next to disuse atrophy signs (reduced size and myofiber phenotype I to II type shift) as much as 680 differentially expressed genes were found in the space-flown soleus, and only 72 in extensor digitorum longus (only 24 genes in common) compared to ground controls. Altered expression of gene transcripts matched key biological processes (contractile machinery, calcium homeostasis, muscle development, cell metabolism, inflammatory and oxidative stress response). Some transcripts (Fzd9, Casq2, Kcnma1, Ppara, Myf6) were further validated by quantitative real-time PCR (qRT-PCR). Besides previous reports on other leg muscle types we put forth for the first time a complete set of microgravity susceptible gene transcripts in soleus of mice as promising new biomarkers or targets for optimization of physical countermeasures and rehabilitation protocols to overcome disuse atrophy conditions in different clinical settings, rehabilitation and spaceflight.

  16. Gene Expression Profiling in Slow-Type Calf Soleus Muscle of 30 Days Space-Flown Mice

    PubMed Central

    Gambara, Guido; Salanova, Michele; Ciciliot, Stefano; Furlan, Sandra; Gutsmann, Martina; Schiffl, Gudrun; Ungethuem, Ute; Volpe, Pompeo; Gunga, Hanns-Christian; Blottner, Dieter

    2017-01-01

    Microgravity exposure as well as chronic disuse are two main causes of skeletal muscle atrophy in animals and humans. The antigravity calf soleus is a reference postural muscle to investigate the mechanism of disuse-induced maladaptation and plasticity of human and rodent (rats or mice) skeletal musculature. Here, we report microgravity-induced global gene expression changes in space-flown mouse skeletal muscle and the identification of yet unknown disuse susceptible transcripts found in soleus (a mainly slow phenotype) but not in extensor digitorum longus (a mainly fast phenotype dorsiflexor as functional counterpart to soleus). Adult C57Bl/N6 male mice (n = 5) flew aboard a biosatellite for 30 days on orbit (BION-M1 mission, 2013), a sex and age-matched cohort were housed in standard vivarium cages (n = 5), or in a replicate flight habitat as ground control (n = 5). Next to disuse atrophy signs (reduced size and myofiber phenotype I to II type shift) as much as 680 differentially expressed genes were found in the space-flown soleus, and only 72 in extensor digitorum longus (only 24 genes in common) compared to ground controls. Altered expression of gene transcripts matched key biological processes (contractile machinery, calcium homeostasis, muscle development, cell metabolism, inflammatory and oxidative stress response). Some transcripts (Fzd9, Casq2, Kcnma1, Ppara, Myf6) were further validated by quantitative real-time PCR (qRT-PCR). Besides previous reports on other leg muscle types we put forth for the first time a complete set of microgravity susceptible gene transcripts in soleus of mice as promising new biomarkers or targets for optimization of physical countermeasures and rehabilitation protocols to overcome disuse atrophy conditions in different clinical settings, rehabilitation and spaceflight. PMID:28076365

  17. A contemporary risk model for predicting 30-day mortality following percutaneous coronary intervention in England and Wales

    PubMed Central

    McAllister, Katherine S.L.; Ludman, Peter F.; Hulme, William; de Belder, Mark A.; Stables, Rodney; Chowdhary, Saqib; Mamas, Mamas A.; Sperrin, Matthew; Buchan, Iain E.

    2016-01-01

    Background The current risk model for percutaneous coronary intervention (PCI) in the UK is based on outcomes of patients treated in a different era of interventional cardiology. This study aimed to create a new model, based on a contemporary cohort of PCI treated patients, which would: predict 30 day mortality; provide good discrimination; and be well calibrated across a broad risk-spectrum. Methods and results The model was derived from a training dataset of 336,433 PCI cases carried out between 2007 and 2011 in England and Wales, with 30 day mortality provided by record linkage. Candidate variables were selected on the basis of clinical consensus and data quality. Procedures in 2012 were used to perform temporal validation of the model. The strongest predictors of 30-day mortality were: cardiogenic shock; dialysis; and the indication for PCI and the degree of urgency with which it was performed. The model had an area under the receiver operator characteristic curve of 0.85 on the training data and 0.86 on validation. Calibration plots indicated a good model fit on development which was maintained on validation. Conclusion We have created a contemporary model for PCI that encompasses a range of clinical risk, from stable elective PCI to emergency primary PCI and cardiogenic shock. The model is easy to apply and based on data reported in national registries. It has a high degree of discrimination and is well calibrated across the risk spectrum. The examination of key outcomes in PCI audit can be improved with this risk-adjusted model. PMID:26942330

  18. The statistical extended-range (10-30-day) forecast of summer rainfall anomalies over the entire China

    NASA Astrophysics Data System (ADS)

    Zhu, Zhiwei; Li, Tim

    2017-01-01

    The extended-range (10-30-day) rainfall forecast over the entire China was carried out using spatial-temporal projection models (STPMs). Using a rotated empirical orthogonal function analysis of intraseasonal (10-80-day) rainfall anomalies, China is divided into ten sub-regions. Different predictability sources were selected for each of the ten regions. The forecast skills are ranked for each region. Based on temporal correlation coefficient (TCC) and Gerrity skill score, useful skills are found for most parts of China at a 20-25-day lead. The southern China and the mid-lower reaches of Yangtze River Valley show the highest predictive skills, whereas southwestern China and Huang-Huai region have the lowest predictive skills. By combining forecast results from ten regional STPMs, the TCC distribution of 8-year (2003-2010) independent forecast for the entire China is investigated. The combined forecast results from ten STPMs show significantly higher skills than the forecast with just one single STPM for the entire China. Independent forecast examples of summer rainfall anomalies around the period of Beijing Olympic Games in 2008 and Shanghai World Expo in 2010 are presented. The result shows that the current model is able to reproduce the gross pattern of the summer intraseasonal rainfall over China at a 20-day lead. The present study provides, for the first time, a guide on the statistical extended-range forecast of summer rainfall anomalies for the entire China. It is anticipated that the ideas and methods proposed here will facilitate the extended-range forecast in China.

  19. Integrated in vivo and in vitro nascent chain profiling reveals widespread translational pausing

    PubMed Central

    Chadani, Yuhei; Niwa, Tatsuya; Chiba, Shinobu; Taguchi, Hideki; Ito, Koreaki

    2016-01-01

    Although the importance of the nonuniform progression of elongation in translation is well recognized, there have been few attempts to explore this process by directly profiling nascent polypeptides, the relevant intermediates of translation. Such approaches will be essential to complement other approaches, including ribosome profiling, which is extremely powerful but indirect with respect to the actual translation processes. Here, we use the nascent polypeptide's chemical trait of having a covalently attached tRNA moiety to detect translation intermediates. In a case study, Escherichia coli SecA was shown to undergo nascent polypeptide-dependent translational pauses. We then carried out integrated in vivo and in vitro nascent chain profiling (iNP) to characterize 1,038 proteome members of E. coli that were encoded by the first quarter of the chromosome with respect to their propensities to accumulate polypeptidyl–tRNA intermediates. A majority of them indeed undergo single or multiple pauses, some occurring only in vitro, some occurring only in vivo, and some occurring both in vivo and in vitro. Thus, translational pausing can be intrinsically robust, subject to in vivo alleviation, or require in vivo reinforcement. Cytosolic and membrane proteins tend to experience different classes of pauses; membrane proteins often pause multiple times in vivo. We also note that the solubility of cytosolic proteins correlates with certain categories of pausing. Translational pausing is widespread and diverse in nature. PMID:26831095

  20. Postoperative hyperkalemia.

    PubMed

    Ayach, Taha; Nappo, Robert W; Paugh-Miller, Jennifer L; Ross, Edward A

    2015-03-01

    Hyperkalemia occurs frequently in hospitalized patients and is of particular concern for those who have undergone surgery, with postoperative care provided by clinicians of many disciplines. This review describes the normal physiology and how multiple perioperative factors can disrupt potassium homeostasis and lead to severe elevations in plasma potassium concentration. The pathophysiologic basis of diverse causes of hyperkalemia was used to broadly classify etiologies into those with altered potassium distribution (e.g. increased potassium release from cells or other transcellular shifts), reduced urinary excretion (e.g. reduced sodium delivery, volume depletion, and hypoaldosteronism), or an exogenous potassium load (e.g. blood transfusions). Surgical conditions of particular concern involve: rhabdomyolysis from malpositioning, trauma or medications; bariatric surgery; vascular procedures with tissue ischemia; acidosis; hypovolemia; and volume or blood product resuscitation. Certain acute conditions and chronic co-morbidities present particular risk. These include chronic kidney disease, diabetes mellitus, many outpatient preoperative medications (e.g. beta blockers, salt substitutes), and inpatient agents (e.g. succinylcholine, hyperosmolar volume expanders). Clinicians need to be aware of these pathophysiologic mechanisms for developing perioperative hyperkalemia as many of the risks can be minimized or avoided.

  1. Pauses During Autobiographical Discourse Reflect Episodic Memory Processes in Early Alzheimer’s Disease

    PubMed Central

    Pistono, Aurélie; Jucla, Mélanie; Barbeau, Emmanuel J.; Saint-Aubert, Laure; Lemesle, Béatrice; Calvet, Benjamin; Köpke, Barbara; Puel, Michèle; Pariente, Jérémie

    2015-01-01

    There is a large body of research on discourse production in Alzheimer’s disease (AD). Some studies have focused on pause production, revealing that patients make extensive use of pauses during speech. This has been attributed to lexical retrieval difficulties, but pausing may also reflect other forms of cognitive impairment as it increases with cognitive load. The aim of the present study was to analyze autobiographical discourse impairment in AD from a broad perspective, looking at pausing behavior (frequency, duration, and location). Our first objective was to characterize discourse changes in mild cognitive impairment (MCI) due to AD. Our second objective was to determine the cognitive and neuroanatomical correlates of these changes. Fifteen patients with MCI due to AD and 15 matched cognitively normal controls underwent an ecological episodic memory task, a full neuropsychological assessment, and a 3D T1-weighted MRI scans. Autobiographical discourse collected from the ecological episodic memory task was recorded, transcribed, and analyzed, focusing on pausing. Intergroup comparisons showed that although patients did not produce more pauses than controls overall, they did make more between-utterance pauses. The number of these specific pauses was positively correlated with patients’ episodic memory performance. Furthermore, neuroimaging analysis showed that, in the patient group, their use was negatively correlated with frontopolar area (BA 10) grey matter density. This region may therefore play an important role in the planning of autobiographical discourse production. These findings demonstrate that pauses in early AD may reflect a compensatory mechanism for improving mental time travel and memory retrieval. PMID:26757034

  2. Sequence-specific thermodynamic properties of nucleic acids influence both transcriptional pausing and backtracking in yeast

    PubMed Central

    2017-01-01

    RNA Polymerase II pauses and backtracks during transcription, with many consequences for gene expression and cellular physiology. Here, we show that the energy required to melt double-stranded nucleic acids in the transcription bubble predicts pausing in Saccharomyces cerevisiae far more accurately than nucleosome roadblocks do. In addition, the same energy difference also determines when the RNA polymerase backtracks instead of continuing to move forward. This data-driven model corroborates—in a genome wide and quantitative manner—previous evidence that sequence-dependent thermodynamic features of nucleic acids influence both transcriptional pausing and backtracking. PMID:28301878

  3. Preoperative anemia increases postoperative morbidity in elective cranial neurosurgery

    PubMed Central

    Bydon, Mohamad; Abt, Nicholas B.; Macki, Mohamed; Brem, Henry; Huang, Judy; Bydon, Ali; Tamargo, Rafael J.

    2014-01-01

    Background: Preoperative anemia may affect postoperative mortality and morbidity following elective cranial operations. Methods: The American College of Surgeons National Surgical Quality Improvement Program (NSQIP) database was used to identify elective cranial neurosurgical cases (2006-2012). Morbidity was defined as wound infection, systemic infection, cardiac, respiratory, renal, neurologic, and thromboembolic events, and unplanned returns to the operating room. For 30-day postoperative mortality and morbidity, adjusted odds ratios (ORs) were estimated with multivariable logistic regression. Results: Of 8015 patients who underwent elective cranial neurosurgery, 1710 patients (21.4%) were anemic. Anemic patients had an increased 30-day mortality of 4.1% versus 1.3% in non-anemic patients (P < 0.001) and an increased 30-day morbidity rate of 25.9% versus 14.14% in non-anemic patients (P < 0.001). The 30-day morbidity rates for all patients undergoing cranial procedures were stratified by diagnosis: 26.5% aneurysm, 24.7% sellar tumor, 19.7% extra-axial tumor, 14.8% intra-axial tumor, 14.4% arteriovenous malformation, and 5.6% pain. Following multivariable regression, the 30-day mortality in anemic patients was threefold higher than in non-anemic patients (4.1% vs 1.3%; OR = 2.77; 95% CI: 1.65-4.66). The odds of postoperative morbidity in anemic patients were significantly higher than in non-anemic patients (OR = 1.29; 95% CI: 1.03-1.61). There was a significant difference in postoperative morbidity event odds with a hematocrit level above (OR = 1.07; 95% CI: 0.78-1.48) and below (OR = 2.30; 95% CI: 1.55-3.42) 33% [hemoglobin (Hgb) 11 g/dl]. Conclusions: Preoperative anemia in elective cranial neurosurgery was independently associated with an increased risk of 30-day postoperative mortality and morbidity when compared to non-anemic patients. A hematocrit level below 33% (Hgb 11 g/dl) was associated with a significant increase in postoperative morbidity. PMID

  4. Redundancy of the genetic code enables translational pausing

    PubMed Central

    D'Onofrio, David J.; Abel, David L.

    2014-01-01

    The codon redundancy (“degeneracy”) found in protein-coding regions of mRNA also prescribes Translational Pausing (TP). When coupled with the appropriate interpreters, multiple meanings and functions are programmed into the same sequence of configurable switch-settings. This additional layer of Ontological Prescriptive Information (PIo) purposely slows or speeds up the translation-decoding process within the ribosome. Variable translation rates help prescribe functional folding of the nascent protein. Redundancy of the codon to amino acid mapping, therefore, is anything but superfluous or degenerate. Redundancy programming allows for simultaneous dual prescriptions of TP and amino acid assignments without cross-talk. This allows both functions to be coincident and realizable. We will demonstrate that the TP schema is a bona fide rule-based code, conforming to logical code-like properties. Second, we will demonstrate that this TP code is programmed into the supposedly degenerate redundancy of the codon table. We will show that algorithmic processes play a dominant role in the realization of this multi-dimensional code. PMID:24904640

  5. PAUSED Encodes the Arabidopsis Exportin-t Ortholog1

    PubMed Central

    Hunter, Christine A.; Aukerman, Milo J.; Sun, Hui; Fokina, Maria; Poethig, R. Scott

    2003-01-01

    Los1p/exportin-t (XPOT) mediates the nuclear export of tRNAs in yeast and mammals. The requirements for this transport pathway are unclear, however, because los1 mutations do not affect yeast growth, and the phenotype of XPOT mutations in mammals is unknown. Here, we show that PAUSED (PSD) is the Arabidopsis ortholog of LOS1/XPOT and is capable of rescuing the tRNA export defect of los1 in Brewer's yeast (Saccharomyces cerevisiae), suggesting that its function has been conserved. Putative null alleles of PSD disrupt the initiation of the shoot apical meristem and delay leaf initiation after germination, the emergence of the radicle and lateral roots, and the transition to flowering. Plants doubly mutant for psd and hasty, the Arabidopsis ortholog of exportin 5, are viable but have a more severe phenotype than either single mutant. These results suggest that PSD plays a role in tRNA export in Arabidopsis, but that at least one—and perhaps several—additional tRNA export pathways also exist. The PSD transcript is broadly expressed during development and is alternatively spliced in the 3′-untranslated region. No temporal or spatial difference in the abundance of different splice forms was observed. We propose that the mutant phenotype of psd reflects defects in developmental events and cell/tissue types that require elevated levels of protein synthesis and are therefore acutely sensitive to a reduction in tRNA export. PMID:12913168

  6. PAUSED encodes the Arabidopsis exportin-t ortholog.

    PubMed

    Hunter, Christine A; Aukerman, Milo J; Sun, Hui; Fokina, Maria; Poethig, R Scott

    2003-08-01

    Los1p/exportin-t (XPOT) mediates the nuclear export of tRNAs in yeast and mammals. The requirements for this transport pathway are unclear, however, because los1 mutations do not affect yeast growth, and the phenotype of XPOT mutations in mammals is unknown. Here, we show that PAUSED (PSD) is the Arabidopsis ortholog of LOS1/XPOT and is capable of rescuing the tRNA export defect of los1 in Brewer's yeast (Saccharomyces cerevisiae), suggesting that its function has been conserved. Putative null alleles of PSD disrupt the initiation of the shoot apical meristem and delay leaf initiation after germination, the emergence of the radicle and lateral roots, and the transition to flowering. Plants doubly mutant for psd and hasty, the Arabidopsis ortholog of exportin 5, are viable but have a more severe phenotype than either single mutant. These results suggest that PSD plays a role in tRNA export in Arabidopsis, but that at least one-and perhaps several-additional tRNA export pathways also exist. The PSD transcript is broadly expressed during development and is alternatively spliced in the 3'-untranslated region. No temporal or spatial difference in the abundance of different splice forms was observed. We propose that the mutant phenotype of psd reflects defects in developmental events and cell/tissue types that require elevated levels of protein synthesis and are therefore acutely sensitive to a reduction in tRNA export.

  7. High Precision Analysis of Translational Pausing by Ribosome Profiling in Bacteria Lacking EFP

    PubMed Central

    Woolstenhulme, Christopher J.; Guydosh, Nicholas R.; Green, Rachel; Buskirk, Allen R.

    2015-01-01

    Summary Ribosome profiling is a powerful method for globally assessing the activity of ribosomes in a cell. Despite its application in many organisms, ribosome profiling studies in bacteria have struggled to obtain the resolution necessary to precisely define translational pauses. Here we report improvements that yield much higher resolution in E. coli profiling data, enabling us to more accurately assess ribosome pausing and refine earlier studies of the impact of polyproline motifs on elongation. We comprehensively characterize pausing at proline-rich motifs in the absence of elongation factor EFP. We find that only a small fraction of genes with strong pausing motifs have reduced ribosome density downstream and identify features that explain this phenomenon. These features allow us to predict which proteins likely have reduced output in the efp knockout strain. PMID:25843707

  8. Preratio pausing: effects of an alternative reinforcer on fixed- and variable-ratio responding.

    PubMed Central

    Derenne, Adam; Baron, Alan

    2002-01-01

    Seven rats responding under fixed-ratio or variable-ratio schedules of food reinforcement had continuous access to a drinking tube inserted into the operant chamber. Under different conditions they could drink either tap water or one of two saccharin solutions. In a baseline condition, the drinking bottle was empty. Preratio pausing was observed with both schedules, more so with the fixed-ratio than the variable-ratio schedule, and increasing the concentration of the saccharin solution increased the duration of pausing. Comparisons with baseline performances revealed that the additional pausing was largely, but not entirely, spent drinking. The results support the view that pausing under ratio schedules is a consequence of competition between the scheduled reinforcer and alternative reinforcers that also are available within the experimental environment. PMID:12083680

  9. Astronaut Daniel W. Bursch, mission specialist, pauses during a photography session on the aft

    NASA Technical Reports Server (NTRS)

    1996-01-01

    STS-77 ESC VIEW --- Astronaut Daniel W. Bursch, mission specialist, pauses during a photography session on the aft flight deck of the Space Shuttle Endeavour. The scene was recorded with an Electronic Still Camera (ESC).

  10. Changes in electric organ discharge after pausing the electromotor system of Gymnotus carapo.

    PubMed

    Schuster, S

    2000-05-01

    During their entire lives, weakly electric fish produce an uninterrupted train of discharges to electrolocate objects and to communicate. In an attempt to learn about activity-dependent processes that might be involved in this ability, the continuous train of discharges of intact Gymnotus carapo was experimentally interrupted to investigate how this pausing affects post-pause electric organ discharges. In particular, an analysis was conducted of how the amplitude and relative timing of the three major deflections of the complex discharge change over the course of the first 1000 post-pause discharges. The dependence of these variables on the duration of the preceding pause and on water temperature is analysed. In addition, pause-induced small reverberations at the end of the discharge are described. Common to all amplitude changes is a fast initial decrease in amplitude with a slow recovery phase; amplitude changes scale with the duration of the preceding pause and are independent of the interdischarge interval. The absence of changes in the postsynaptic-potential-derived first phase of the discharge together with changes in the amplitude ratio of the third and fourth deflections suggest that the amplitude changes are mainly due to pause-induced changes in the inner resistance of the electric organ. A model is formulated that approximates the pattern of amplitude changes. The post-pause changes described here may provide a new way to test current models of complex discharge generation in Gymnotus carapo and illustrate the speed at which changes of an electric organ discharge can take place.

  11. Development, Validation and Deployment of a Real Time 30 Day Hospital Readmission Risk Assessment Tool in the Maine Healthcare Information Exchange

    PubMed Central

    Hao, Shiying; Wang, Yue; Jin, Bo; Shin, Andrew Young; Zhu, Chunqing; Huang, Min; Zheng, Le; Luo, Jin; Hu, Zhongkai; Fu, Changlin; Dai, Dorothy; Wang, Yicheng; Culver, Devore S.; Alfreds, Shaun T.; Rogow, Todd; Stearns, Frank; Sylvester, Karl G.; Widen, Eric; Ling, Xuefeng B.

    2015-01-01

    Objectives Identifying patients at risk of a 30-day readmission can help providers design interventions, and provide targeted care to improve clinical effectiveness. This study developed a risk model to predict a 30-day inpatient hospital readmission for patients in Maine, across all payers, all diseases and all demographic groups. Methods Our objective was to develop a model to determine the risk for inpatient hospital readmission within 30 days post discharge. All patients within the Maine Health Information Exchange (HIE) system were included. The model was retrospectively developed on inpatient encounters between January 1, 2012 to December 31, 2012 from 24 randomly chosen hospitals, and then prospectively validated on inpatient encounters from January 1, 2013 to December 31, 2013 using all HIE patients. Results A risk assessment tool partitioned the entire HIE population into subgroups that corresponded to probability of hospital readmission as determined by a corresponding positive predictive value (PPV). An overall model c-statistic of 0.72 was achieved. The total 30-day readmission rates in low (score of 0–30), intermediate (score of 30–70) and high (score of 70–100) risk groupings were 8.67%, 24.10% and 74.10%, respectively. A time to event analysis revealed the higher risk groups readmitted to a hospital earlier than the lower risk groups. Six high-risk patient subgroup patterns were revealed through unsupervised clustering. Our model was successfully integrated into the statewide HIE to identify patient readmission risk upon admission and daily during hospitalization or for 30 days subsequently, providing daily risk score updates. Conclusions The risk model was validated as an effective tool for predicting 30-day readmissions for patients across all payer, disease and demographic groups within the Maine HIE. Exposing the key clinical, demographic and utilization profiles driving each patient’s risk of readmission score may be useful to providers

  12. Extent of Surgery Does Not Influence 30-Day Mortality in Surgery for Metastatic Bone Disease: An Observational Study of a Historical Cohort.

    PubMed

    Sørensen, Michala Skovlund; Hindsø, Klaus; Hovgaard, Thea Bechmann; Petersen, Michael Mørk

    2016-04-01

    Estimating patient survival has hitherto been the main focus when treating metastatic bone disease (MBD) in the appendicular skeleton. This has been done in an attempt to allocate the patient to a surgical procedure that outlives them. No questions have been addressed as to whether the extent of the surgery and thus the surgical trauma reduces survival in this patient group. We wanted to evaluate if perioperative parameters such as blood loss, extent of bone resection, and duration of surgery were risk factors for 30-day mortality in patients having surgery due to MBD in the appendicular skeleton. We retrospectively identified 270 consecutive patients who underwent joint replacement surgery or intercalary spacing for skeletal metastases in the appendicular skeleton from January 1, 2003 to December 31, 2013. We collected intraoperative (duration of surgery, extent of bone resection, and blood loss), demographic (age, gender, American Society of Anesthesiologist score [ASA score], and Karnofsky score), and disease-specific (primary cancer) variables. An association with 30-day mortality was addressed using univariate and multivariable analyses and calculation of odds ratio (OR). All patients were included in the analysis. ASA score 3 + 4 (OR 4.16 [95% confidence interval, CI, 1.80-10.85], P = 0.002) and Karnofsky performance status below 70 (OR 7.34 [95% CI 3.16-19.20], P < 0.001) were associated with increased 30-day mortality in univariate analysis. This did not change in multivariable analysis. No parameters describing the extent of the surgical trauma were found to be associated with 30-day mortality. The 30-day mortality in patients undergoing surgery for MBD is highly dependent on the general health status of the patients as measured by the ASA score and the Karnofsky performance status. The extent of surgery, measured as duration of surgery, blood loss, and degree of bone resection were not associated with 30-day mortality.

  13. Radiologic Findings and Patient Factors Associated with 30-Day Mortality after Surgical Evacuation of Subdural Hematoma in Patients Less Than 65 Years Old

    PubMed Central

    Han, Myung-Hoon; Ryu, Je Il; Kim, Choong Hyun; Kim, Jae Min; Cheong, Jin Hwan; Yi, Hyeong-Joong

    2017-01-01

    Objective The purpose of this study is to evaluate the associations between 30-day mortality and various radiological and clinical factors in patients with traumatic acute subdural hematoma (SDH). During the 11-year study period, young patients who underwent surgery for SDH were followed for 30 days. Patients who died due to other medical comorbidities or other organ problems were not included in the study population. Methods From January 1, 2004 to December 31, 2014, 318 consecutive surgically-treated traumatic acute SDH patients were registered for the study. The Kaplan–Meier method was used to analyze 30-day survival rates. We also estimated the hazard ratios of various variables in order to identify the independent predictors of 30-day mortality. Results We observed a negative correlation between 30-day mortality and Glasgow coma scale score (per 1-point score increase) (hazard ratio [HR], 0.60; 95% confidence interval [CI], 0.52–0.70; p<0.001). In addition, use of antithrombotics (HR, 2.34; 95% CI, 1.27–4.33; p=0.008), history of diabetes mellitus (HR, 2.28; 95% CI, 1.20–4.32; p=0.015), and accompanying traumatic subarachnoid hemorrhage (hazard ratio, 2.13; 95% CI, 1.27–3.58; p=0.005) were positively associated with 30-day mortality. Conclusion We found significant associations between short-term mortality after surgery for traumatic acute SDH and lower Glasgow Coma Scale scores, use of antithrombotics, history of diabetes mellitus, and accompanying traumatic subarachnoid hemorrhage at admission. We expect these findings to be helpful for selecting patients for surgical treatment of traumatic acute SDH, and for making accurate prognoses. PMID:28264246

  14. Differential Purkinje cell simple spike activity and pausing behavior related to cerebellar modules

    PubMed Central

    Zhou, Haibo; Voges, Kai; Lin, Zhanmin; Ju, Chiheng

    2015-01-01

    The massive computational capacity of the cerebellar cortex is conveyed by Purkinje cells onto cerebellar and vestibular nuclei neurons through their GABAergic, inhibitory output. This implies that pauses in Purkinje cell simple spike activity are potentially instrumental in cerebellar information processing, but their occurrence and extent are still heavily debated. The cerebellar cortex, although often treated as such, is not homogeneous. Cerebellar modules with distinct anatomical connectivity and gene expression have been described, and Purkinje cells in these modules also differ in firing rate of simple and complex spikes. In this study we systematically correlate, in awake mice, the pausing in simple spike activity of Purkinje cells recorded throughout the entire cerebellum, with their location in terms of lobule, transverse zone, and zebrin-identified cerebellar module. A subset of Purkinje cells displayed long (>500-ms) pauses, but we found that their occurrence correlated with tissue damage and lower temperature. In contrast to long pauses, short pauses (<500 ms) and the shape of the interspike interval (ISI) distributions can differ between Purkinje cells of different lobules and cerebellar modules. In fact, the ISI distributions can differ both between and within populations of Purkinje cells with the same zebrin identity, and these differences are at least in part caused by differential synaptic inputs. Our results suggest that long pauses are rare but that there are differences related to shorter intersimple spike intervals between and within specific subsets of Purkinje cells, indicating a potential further segregation in the activity of cerebellar Purkinje cells. PMID:25717166

  15. Activity-dependent plasticity of spike pauses in cerebellar Purkinje cells

    PubMed Central

    Grasselli, Giorgio; He, Qionger; Wan, Vivian; Adelman, John P.; Ohtsuki, Gen; Hansel, Christian

    2016-01-01

    Summary Plasticity of intrinsic excitability has been described in several types of neurons, but the significance of non-synaptic mechanisms in brain plasticity and learning remains elusive. Cerebellar Purkinje cells are inhibitory neurons that spontaneously fire action potentials at high frequencies and regulate activity in their target cells in the cerebellar nuclei by generating a characteristic spike burst–pause sequence upon synaptic activation. Using patch-clamp recordings from mouse Purkinje cells, we find that depolarization-triggered intrinsic plasticity enhances spike firing and shortens the duration of spike pauses. Pause plasticity is absent from mice lacking SK2-type potassium channels (SK2−/− mice) and in occlusion experiments using the SK channel blocker apamin, while apamin wash-in mimics pause reduction. Our findings demonstrate that spike pauses can be regulated through an activity-dependent, exclusively non-synaptic, SK2 channel-dependent mechanism and suggest that pause plasticity—by altering the Purkinje cell output—may be crucial to cerebellar information storage and learning. PMID:26972012

  16. 75 FR 77901 - 30-Day Notice of Opportunity for Public Comment on U.S. Nominations to the World Heritage List...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-14

    ... National Park Service 30-Day Notice of Opportunity for Public Comment on U.S. Nominations to the World Heritage List and Potential Additions to the U.S. World Heritage Tentative List AGENCY: National Park... to comment on the next potential U.S. nominations from the U.S. World Heritage Tentative List to...

  17. The association of culling and death rate within 30 days after calving with productivity or reproductive performance in dairy herds in Fukuoka, Southern Japan

    PubMed Central

    GOTO, Akira; NAKADA, Ken; KATAMOTO, Hiromu

    2015-01-01

    The incidence of peripartum disorders in dairy herds negatively influences productivity and reproductive performance. Concrete data from local areas are helpful for explaining the importance of peripartum management to dairy farmers. This study was conducted to clarify the association of culling and death rate within 30 days after calving with productivity or reproductive performance in 179 dairy herds in Fukuoka, Southern Japan. A database was compiled from the records of the Livestock Improvement Association of Japan, the Dairy Cooperative Association and the Federation of Agricultural Mutual Relief Association. In this study, we created a comprehensive database of dairy farm production data for epidemiological analysis and used a general linear mixed model to analyze the association of culling and death rate within 30 days after calving with milk production or reproductive performance. The database can be used to describe, analyze and predict the risk of production. A cross-sectional analysis with contrasts was applied to investigate the association of cows served by AI/all cows, pregnant cows/cows served by AI, days open, milk yield and somatic cell counts with culling and death rate within 30 days after calving. The days open value significantly increased with increasing rate of culling and death within 30 days after calving (P for trend <0.001). No significant differences were found for the other comparisons. Our data suggest that proper feeding and management in the dry period may lead to improved postpartum reproductive performance in this dairy cow cohort. PMID:26666177

  18. 75 FR 55625 - 30-Day Notice of Proposed Information Collection: Form DS-1622, DS-1843, DS-1622P, and DS-1843P...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-13

    .... SUMMARY: The Department of State is seeking Office of Management and Budget (OMB) approval for the... Management and Budget (OMB) for up to 30 days from August 30, 2010. ADDRESSES: You may submit comments by any... maintain the health and fitness of the individual and family members within the Department of State...

  19. The 30-day prognosis of chronic-disease patients after contact with the out-of-hours service in primary healthcare

    PubMed Central

    Carlsen, Anders Helles; Moth, Grete; Christensen, Morten Bondo; Vestergaard, Mogens; Olesen, Frede; Vedsted, Peter

    2014-01-01

    Abstract Objective. Little is known about the prognosis of patients with chronic disease who contact the out-of-hours (OOH) service in primary care. The characteristics of contacts with the Danish out-of-hours service and daytime general practice, hospitalization, and death were studied during a 30-day follow-up period in patients with chronic heart diseases. Design. Cohort study. Setting and subjects. The study was based on data from 11 897 adults aged 18 + years from a Danish survey of OOH contacts, including information on consultation type. Reason for encounter (RFE) was categorized by OOH GPs at triage as either “exacerbation” or “new health problem”. Registry data were used to identify eligible patients, and the cohort was followed for 30 days after OOH contact through nationwide registries on healthcare use and mortality. Main outcome measures. The 30-day prognosis of chronic-disease patients after OOH contact. Results. Included patients with chronic disease had a higher risk of new OOH contact, daytime GP contact, and hospitalization than other patients during the 30-day follow-up period. OOH use was particularly high among patients with severe mental illness. A strong association was seen between chronic disease and risk of dying during follow-up. Conclusion. Patients with chronic disease used both daytime general practice and the out-of-hours service more often than others during the 30-day follow-up period; they were more often hospitalized and had higher risk of dying. The findings call for a proactive approach to future preventive day care and closer follow-up of this group, especially patients with psychiatric disease. PMID:25471829

  20. The AFFORD Clinical Decision Aid To Identify Emergency Department Patients With Atrial Fibrillation At Low Risk For 30-Day Adverse Events

    PubMed Central

    Barrett, Tyler W.; Storrow, Alan B.; Jenkins, Cathy A.; Abraham, Robert L.; Liu, Dandan; Miller, Karen F.; Moser, Kelly M.; Russ, Stephan; Roden, Dan M.; Harrell, Frank E.; Darbar, Dawood

    2015-01-01

    There is wide variation in the management of emergency department (ED) patients with atrial fibrillation (AF). We aimed to derive and internally validate the first prospective, ED-based clinical decision aid to identify patients with AF at low risk for 30-day adverse events. We performed a prospective cohort study at a university-affiliated, tertiary-care, ED. Patients were enrolled from June 9, 2010 to February 28, 2013 and followed for 30 days. We enrolled a convenience sample of ED patients presenting with symptomatic AF. Candidate predictors were based on ED data available in the first two hours. The decision aid was derived using model approximation (preconditioning) followed by strong bootstrap internal validation. We utilized an ordinal outcome hierarchy defined as the incidence of the most severe adverse event within 30 days of the ED evaluation. Of 497 patients enrolled, stroke and AF-related death occurred in 13 (3%) and 4 (<1%) patients, respectively. The decision aid included the following: age, triage vitals (systolic blood pressure, temperature, respiratory rate, oxygen saturation, supplemental oxygen requirement); medical history (heart failure, home sotalol use, prior percutaneous coronary intervention, electrical cardioversion, cardiac ablation, frequency of AF symptoms); ED data (2 hour heart rate, chest radiograph results, hemoglobin, creatinine, and brain natriuretic peptide). The decision aid’s c-statistic in predicting any 30-day adverse event was 0.7 (95% CI, 0.65, 0.76). In conclusion, among ED patients with AF, AFFORD provides the first evidence based decision aid for identifying patients who are at low risk for 30-day adverse events and candidates for safe discharge. PMID:25633190

  1. Tropical 40-50- and 25-30-day oscillations appearing in realistic and idealized GFDL climate models and the ECMWF dataset

    SciTech Connect

    Hayashi, Y.; Golder, D.G. )

    1993-02-01

    To clarify differences between the tropical 40-50- and 25-30-day oscillations and to evaluate simulations and various theories, space-time spectrum and filter analyses were performed on a nine-year dataset taken from the nine-level R30 spectral general circulation model and the nine-year (1979-1987) ECMWF four-dimensional analysis dataset. The 40-level SKYHI model was analyzed to examine the effect of increased vertical resolution, while an ocean-surface perpetual January R30 model was analyzed to examine the effects of the absence of geographical and seasonal variations. The R30 model results indicate that the relative amplitude of the wavenumber-one component of the 40-50- and 25-30-day oscillations varies greatly from year to year. The SKYHI model indicates that 25-30-day oscillations still appear too strong, although this model reveals a longer vertical wavelength, a higher penetration of the 25-30-day amplitude above the level of convective heating, and a slightly greater height of the convective-heating amplitude, which cannot be detected in the R30 model. The ocean-surface perpetual January R30 model indicates that not only the 25-30-day mode but also the 40-50-day mode can be simulated in the absence of geographical and seasonal modulations, while the wave-CISK and evaporation-wind feedback theories cannot explain the 40-50-day mode. Both R30 models indicate that daily precipitation is usuallys associated with upward motion. A comparison between the two R30 models suggests that the sea surface temperature geographically modules the intrinsically eastward-moving wavenumber-one precipitation oscillations, resulting in their major Pacific and minor Atlantic local amplitudes. This causes planetary-scale eastward-moving zonal-velocity oscillations and standing geopotential oscillations. 121 refs., 26 figs.

  2. Using Scaling for accurate stochastic macroweather forecasts (including the "pause")

    NASA Astrophysics Data System (ADS)

    Lovejoy, Shaun; del Rio Amador, Lenin

    2015-04-01

    At scales corresponding to the lifetimes of structures of planetary extent (about 5 - 10 days), atmospheric processes undergo a drastic "dimensional transition" from high frequency weather to lower frequency macroweather processes. While conventional GCM's generally well reproduce both the transition and the corresponding (scaling) statistics, due to their sensitive dependence on initial conditions, the role of the weather scale processes is to provide random perturbations to the macroweather processes. The main problem with GCM's is thus that their long term (control run, unforced) statistics converge to the GCM climate and this is somewhat different from the real climate. This is the motivation for using a stochastic model and exploiting the empirical scaling properties and past data to make a stochastic model. It turns out that macroweather intermittency is typically low (the multifractal corrections are small) so that they can be approximated by fractional Gaussian Noise (fGN) processes whose memory can be enormous. For example for annual forecasts, and using the observed global temperature exponent, even 50 years of global temperature data would only allow us to exploit 90% of the available memory (for ocean regions, the figure increases to 600 years). The only complication is that anthropogenic effects dominate the global statistics at time scales beyond about 20 years. However, these are easy to remove using the CO2 forcing as a linear surrogate for all the anthropogenic effects. Using this theoretical framework, we show how to make accurate stochastic macroweather forecasts. We illustrate this on monthly and annual scale series of global and northern hemisphere surface temperatures (including nearly perfect hindcasts of the "pause" in the warming since 1998). We obtain forecast skill nearly as high as the theoretical (scaling) predictability limits allow. These scaling hindcasts - using a single effective climate sensitivity and single scaling exponent are

  3. Preoperative anemia and postoperative outcomes after hepatectomy

    PubMed Central

    Tohme, Samer; Varley, Patrick R.; Landsittel, Douglas P.; Chidi, Alexis P.; Tsung, Allan

    2015-01-01

    Background Preoperative anaemia is associated with adverse outcomes after surgery but outcomes after liver surgery specifically are not well established. We aimed to analyze the incidence of and effects of preoperative anemia on morbidity and mortality in patients undergoing liver resection. Methods All elective hepatectomies performed for the period 2005–2012 recorded in the American College of Surgeons' National Surgical Quality Improvement Program (ACS-NSQIP) database were evaluated. We obtained anonymized data for 30-day mortality and major morbidity (one or more major complication), demographics, and preoperative and perioperative risk factors. We used multivariable logistic regression models to assess the adjusted effect of anemia, which was defined as (hematocrit <39% in men, <36% in women), on postoperative outcomes. Results We obtained data for 12,987 patients, of whom 4260 (32.8%) had preoperative anemia. Patients with preoperative anemia experienced higher postoperative major morbidity and mortality rates compared to those without anemia. After adjustment for predefined variables, preoperative anemia was an independent risk factor for postoperative major morbidity (adjusted OR 1.21, 1.09–1.33). After adjustment, there was no significant difference in postoperative mortality for patients with or without preoperative anemia (adjusted OR 0.88, 0.66–1.16). Conclusion Preoperative anemia is independently associated with an increased risk of major morbidity in patients undergoing hepatectomy. Therefore, it is crucial to readdress preoperative blood management in anemic patients prior to hepatectomy. PMID:27017165

  4. Kinesin-4 KIF21B is a potent microtubule pausing factor

    PubMed Central

    van Riel, Wilhelmina E; Rai, Ankit; Bianchi, Sarah; Katrukha, Eugene A; Liu, Qingyang; Heck, Albert JR; Hoogenraad, Casper C; Steinmetz, Michel O; Kapitein, Lukas C; Akhmanova, Anna

    2017-01-01

    Microtubules are dynamic polymers that in cells can grow, shrink or pause, but the factors that promote pausing are poorly understood. Here, we show that the mammalian kinesin-4 KIF21B is a processive motor that can accumulate at microtubule plus ends and induce pausing. A few KIF21B molecules are sufficient to induce strong growth inhibition of a microtubule plus end in vitro. This property depends on non-motor microtubule-binding domains located in the stalk region and the C-terminal WD40 domain. The WD40-containing KIF21B tail displays preference for a GTP-type over a GDP-type microtubule lattice and contributes to the interaction of KIF21B with microtubule plus ends. KIF21B also contains a motor-inhibiting domain that does not fully block the interaction of the protein with microtubules, but rather enhances its pause-inducing activity by preventing KIF21B detachment from microtubule tips. Thus, KIF21B combines microtubule-binding and regulatory activities that together constitute an autonomous microtubule pausing factor. DOI: http://dx.doi.org/10.7554/eLife.24746.001 PMID:28290984

  5. Low serum albumin and total lymphocyte count as predictors of 30 day hospital readmission in patients 65 years of age or older.

    PubMed

    Robinson, Robert

    2015-01-01

    Introduction. Hospital readmission within 30 days of discharge is a target for health care cost savings through the medicare Value Based Purchasing initiative. Because of this focus, hospitals and health systems are investing considerable resources into the identification of patients at risk of hospital readmission and designing interventions to reduce the rate of hospital readmission. Malnutrition is a known risk factor for hospital readmission. Materials and Methods. All medical patients 65 years of age or older discharged from Memorial Medical Center from January 1, 2012 to March 31, 2012 who had a determination of serum albumin level and total lymphocyte count on hospital admission were studied retrospectively. Admission serum albumin levels and total lymphocyte counts were used to classify the nutritional status of all patients in the study. Patients with a serum albumin less than 3.5 grams/dL and/or a TLC less than 1,500 cells per mm3 were classified as having protein energy malnutrition. The primary outcome investigated in this study was hospital readmission for any reason within 30 days of discharge. Results. The study population included 1,683 hospital discharges with an average age of 79 years. The majority of the patients were female (55.9%) and had a DRG weight of 1.22 (0.68). 219 patients (13%) were readmitted within 30 days of hospital discharge. Protein energy malnutrition was common in this population. Low albumin was found in 973 (58%) patients and a low TLC was found in 1,152 (68%) patients. Low albumin and low TLC was found in 709 (42%) of patients. Kaplan-Meier analysis shows any laboratory evidence of PEM is a significant (p < 0.001) predictor of hospital readmission. Low serum albumin (p < 0.001) and TLC (p = 0.018) show similar trends. Cox proportional-hazards regression analysis showed low serum albumin (Hazard Ratio 3.27, 95% CI [2.30-4.63]) and higher DRG weight (Hazard Ratio 1.19, 95% CI [1.03-1.38]) to be significant independent

  6. Low serum albumin and total lymphocyte count as predictors of 30 day hospital readmission in patients 65 years of age or older

    PubMed Central

    2015-01-01

    Introduction. Hospital readmission within 30 days of discharge is a target for health care cost savings through the medicare Value Based Purchasing initiative. Because of this focus, hospitals and health systems are investing considerable resources into the identification of patients at risk of hospital readmission and designing interventions to reduce the rate of hospital readmission. Malnutrition is a known risk factor for hospital readmission. Materials and Methods. All medical patients 65 years of age or older discharged from Memorial Medical Center from January 1, 2012 to March 31, 2012 who had a determination of serum albumin level and total lymphocyte count on hospital admission were studied retrospectively. Admission serum albumin levels and total lymphocyte counts were used to classify the nutritional status of all patients in the study. Patients with a serum albumin less than 3.5 grams/dL and/or a TLC less than 1,500 cells per mm3 were classified as having protein energy malnutrition. The primary outcome investigated in this study was hospital readmission for any reason within 30 days of discharge. Results. The study population included 1,683 hospital discharges with an average age of 79 years. The majority of the patients were female (55.9%) and had a DRG weight of 1.22 (0.68). 219 patients (13%) were readmitted within 30 days of hospital discharge. Protein energy malnutrition was common in this population. Low albumin was found in 973 (58%) patients and a low TLC was found in 1,152 (68%) patients. Low albumin and low TLC was found in 709 (42%) of patients. Kaplan–Meier analysis shows any laboratory evidence of PEM is a significant (p < 0.001) predictor of hospital readmission. Low serum albumin (p < 0.001) and TLC (p = 0.018) show similar trends. Cox proportional-hazards regression analysis showed low serum albumin (Hazard Ratio 3.27, 95% CI [2.30–4.63]) and higher DRG weight (Hazard Ratio 1.19, 95% CI [1.03–1.38]) to be significant independent

  7. The history of research on the filled pause as evidence of the written language bias in linguistics (Linell, 1982).

    PubMed

    O'Connell, Daniel C; Kowal, Sabine

    2004-11-01

    Erard's (2004) publication in the New York Times of a journalistic history of the filled pause serves as the occasion for this critical review of the past half-century of research on the filled pause. Historically, the various phonetic realizations or instantiations of the filled pause have been presented with an odd recurrent admixture of the interjection ah. In addition, the filled pause has been consistently associated with both hesitation and disfluency. The present authors hold that such a mandatory association of the filled pause with disfluency is the product of The written language bias in linguistics [Linell, 1982] and disregards much cogent evidence to the contrary. The implicit prescriptivism of well formedness--a demand derived from literacy--must be rejected; literate well formedness is not a necessary or even typical property of spontaneous spoken discourse; its structures and functions--including those of the filled pause--are very different from those of written language The recent work of Clark and Fox Tree (2002) holds promise for moving the status of the filled pause not only toward that of a conventional word, but also toward its status as an interjection. This latter development is also being fostered by lexicographers. Nonetheless, in view of ongoing research regarding the disparate privileges of occurrence and functions of filled pauses in comparison with interjections, the present authors are reluctant to categorize the filled pause as an interjection.

  8. An investigation of quality improvement initiatives in decreasing the rate of avoidable 30-day, skilled nursing facility-to-hospital readmissions: a systematic review

    PubMed Central

    Mileski, Michael; Topinka, Joseph Baar; Lee, Kimberly; Brooks, Matthew; McNeil, Christopher; Jackson, Jenna

    2017-01-01

    Objectives The main objective was to investigate the applicability and effectiveness of quality improvement initiatives in decreasing the rate of avoidable 30-day, skilled nursing facility (SNF)-to-hospital readmissions. Problem The rate of rehospitalizations from SNF within 30 days of original discharge has increased within the last decade. Setting The research team participants conducted a literature review via Cumulative Index of Nursing and Allied Health Literature and PubMed to collect data about quality improvement implemented in SNFs. Results The most common facilitator was the incorporation of specialized staff. The most cited barriers were quality improvement tracking and implementation. Conclusion These strategy examples can be useful to acute care hospitals attempting to lower bounce back from subacute care providers and long-term care facilities seeking quality improvement initiatives to reduce hospital readmissions. PMID:28182162

  9. Influence of second- and third-degree heart block on 30-day outcome following acute myocardial infarction in the drug-eluting stent era.

    PubMed

    Kim, Hack-Lyoung; Kim, Sang-Hyun; Seo, Jae-Bin; Chung, Woo-Young; Zo, Joo-Hee; Kim, Myung-A; Park, Kyung-Woo; Koo, Bon-Kwon; Kim, Hyo-Soo; Chae, In-Ho; Choi, Dong-Ju; Cho, Myeong-Chan; Kim, Young-Jo; Kim, Ju Han; Ahn, Youngkeun; Jeong, Myung Ho

    2014-12-01

    This study was conducted to investigate the prognostic value of heart block among patients with acute myocardial infarction (AMI) treated with drug-eluting stents. A total of 13,862 patients with AMI, registered in the nation-wide AMI database from January 2005 to June 2013, were analyzed. Second- (Mobitz type I or II) and third-degree atrioventricular block were considered as heart block in this study. Thirty-day major adverse cardiac events (MACE) including all causes of death, recurrent myocardial infarction, and revascularization were evaluated. Percutaneous coronary intervention with implantation of drug-eluting stent was performed in 89.8% of the patients. Heart block occurred in 378 patients (2.7%). Thirty-day MACE occurred in 1,144 patients (8.2%). Patients with heart block showed worse clinical parameters at initial admission, and the presence of heart block was associated with 30-day MACE in univariate analyses. However, the prognostic impact of heart block was not significant after adjustment of potential confounders (p = 0.489). Among patients with heart block, patients with a culprit in the left anterior descending (LAD) coronary artery had worse clinical outcomes than those of patients with a culprit in the left circumflex or right coronary artery. LAD culprit was a significant risk factor for 30-day MACE even after controlling for confounders (odds ratio 5.28, 95% confidence interval 1.22 to 22.81, p = 0.026). In conclusion, despite differences in clinical parameters at the initial admission, heart block was not an independent risk factor for 30-day MACE in adjusted analyses. However, a LAD culprit was an independent risk factor for 30-day MACE among patients with heart block.

  10. Predictors of early dyspnoea relief in acute heart failure and the association with 30-day outcomes: findings from ASCEND-HF

    PubMed Central

    Mentz, Robert J.; Hernandez, Adrian F.; Stebbins, Amanda; Ezekowitz, Justin A.; Felker, G. Michael; Heizer, Gretchen M.; Atar, Dan; Teerlink, John R.; Califf, Robert M.; Massie, Barry M.; Hasselblad, Vic; Starling, Randall C.; O'Connor, Christopher M.; Ponikowski, Piotr

    2013-01-01

    Aims To examine the characteristics associated with early dyspnoea relief during acute heart failure (HF) hospitalization, and its association with 30-day outcomes. Methods and results ASCEND-HF was a randomized trial of nesiritide vs. placebo in 7141 patients hospitalized with acute HF in which dyspnoea relief at 6 h was measured on a 7-point Likert scale. Patients were classified as having early dyspnoea relief if they experienced moderate or marked dyspnoea improvement at 6 h. We analysed the clinical characteristics, geographical variation, and outcomes (mortality, mortality/HF hospitalization, and mortality/hospitalization at 30 days) associated with early dyspnoea relief. Early dyspnoea relief occurred in 2984 patients (43%). In multivariable analyses, predictors of dyspnoea relief included older age and oedema on chest radiograph; higher systolic blood pressure, respiratory rate, and natriuretic peptide level; and lower serum blood urea nitrogen (BUN), sodium, and haemoglobin (model mean C index = 0.590). Dyspnoea relief varied markedly across countries, with patients enrolled from Central Europe having the lowest risk-adjusted likelihood of improvement. Early dyspnoea relief was associated with lower risk-adjusted 30-day mortality/HF hospitalization [hazard ratio (HR) 0.81; 95% confidence interval (CI) 0.68–0.96] and mortality/hospitalization (HR 0.85; 95% CI 0.74–0.99), but similar mortality. Conclusion Clinical characteristics such as respiratory rate, pulmonary oedema, renal function, and natriuretic peptide levels are associated with early dyspnoea relief, and moderate or marked improvement in dyspnoea was associated with a lower risk for 30-day outcomes. PMID:23159547

  11. In vitro study of 24-hour and 30-day shear bond strengths of three resin-glass ionomer cements used to bond orthodontic brackets.

    PubMed

    Lippitz, S J; Staley, R N; Jakobsen, J R

    1998-06-01

    Interest in using composite resin-glass ionomer hybrid cements as orthodontic bracket adhesives has grown because of their potential for fluoride release. The purpose of this pilot study was to compare shear bond strengths of three resin-glass ionomer cements (Advance, Fuji Duet, Fuji Ortho LC) used as bracket adhesives with a composite resin 24 hours and 30 days after bonding. The amount of adhesive remaining on the debonded enamel surface was scored for each adhesive. Mesh-backed stainless-steel brackets were bonded to 100 extracted human premolars, which were stored in artificial saliva at 37 degrees C until being tested to failure in a testing machine. The hybrid cements, with one exception, had bond strengths similar to those of the composite resin at 24 hours and 30 days. Fuji Ortho LC had significantly lower bond strengths (ANOVA p < or = 0.05) than the other adhesives at 24 hours and 30 days when it was bonded to unetched, water-moistened enamel. Adhesive-remnant scores were similar for all cements, except for cement Fuji Ortho LC when it was bonded to unetched enamel. The resin-glass ionomer cements we tested appear to have bond strengths suitable for routine use as orthodontic bracket-bonding adhesives.

  12. The age estimation of blood stains up to 30 days old using visible wavelength hyperspectral image analysis and linear discriminant analysis.

    PubMed

    Li, Bo; Beveridge, Peter; O'Hare, William T; Islam, Meez

    2013-09-01

    A novel application of visible wavelength hyperspectral image analysis has been applied to determine the age of blood stains up to 30 days old. Reflectance spectra from selected locations within the hyperspectral image, obtained from a portable instrument, were subjected to spectral pre-processing. This was followed by the application of a linear discriminant classification model, making estimations possible with an average error of ±0.27days for the first 7 days and an overall average error of ±1.17days up to 30 days. This is also the first reported study of the determination of the age of fresh blood stains (less than one day old) with an error of ±0.09h. The studies have been made under controlled conditions and represent, at this stage, proof of concept results but also are the most accurate age estimation results for measurements between 0 and 30 days reported to date. The results are consistent with well-established kinetic processes suggesting that the pre-processing stages described are revealing spectroscopic changes which are reliably following the time dependent oxidation of HbO2. The potential for parameterisation of environmental factors to make the method generally applicable at crime scenes is discussed, along with the developments required to further improve classification and to make the instrument genuinely portable.

  13. The HOSPITAL score and LACE index as predictors of 30 day readmission in a retrospective study at a university-affiliated community hospital

    PubMed Central

    Hudali, Tamer

    2017-01-01

    Introduction Hospital readmissions are common, expensive, and a key target of the Medicare Value Based Purchasing (VBP) program. Validated risk assessment tools such as the HOSPITAL score and LACE index have been developed to identify patients at high risk of hospital readmission so they can be targeted for interventions aimed at reducing the rate of readmission. This study aims to evaluate the utility of HOSPITAL score and LACE index for predicting hospital readmission within 30 days in a moderate-sized university affiliated hospital in the midwestern United States. Materials and Methods All adult medical patients who underwent one or more ICD-10 defined procedures discharged from the SIU-SOM Hospitalist service from Memorial Medical Center (MMC) from October 15, 2015 to March 16, 2016, were studied retrospectively to determine if the HOSPITAL score and LACE index were a significant predictors of hospital readmission within 30 days. Results During the study period, 463 discharges were recorded for the hospitalist service. The analysis includes data for the 432 discharges. Patients who died during the hospital stay, were transferred to another hospital, or left against medical advice were excluded. Of these patients, 35 (8%) were readmitted to the same hospital within 30 days. A receiver operating characteristic evaluation of the HOSPITAL score for this patient population shows a C statistic of 0.75 (95% CI [0.67–0.83]), indicating good discrimination for hospital readmission. The Brier score for the HOSPITAL score in this setting was 0.069, indicating good overall performance. The Hosmer–Lemeshow goodness of fit test shows a χ2 value of 3.71 with a p value of 0.59. A receiver operating characteristic evaluation of the LACE index for this patient population shows a C statistic of 0.58 (95% CI [0.48–0.68]), indicating poor discrimination for hospital readmission. The Brier score for the LACE index in this setting was 0.082, indicating good overall performance

  14. [Causal analysis and management strategies of 30-day unplanned revision surgery following single-stage posterior vertebral column resection for severe spinal deformity].

    PubMed

    Tao, Y P; Wu, J G; Ma, H S; Shao, S L; Zhang, L L; Gao, B; Li, H X

    2017-03-01

    Objective: To investigate the causes of 30-day unplanned revision surgery following one-stage posterior vertebral column resection (PVCR) for severe spinal deformity and the methods of prevention and management. Methods: A total of 112 severe deformity patients underwent one-stage PVCR for surgical treatment in the 306(th) Hospital of People's Liberation Army from May 2010 to December 2015 were retrospectively reviewed. Six patients required reoperation within 30 days after PVCR, including 2 males and 4 females with average age of 21 years (ranging from 12 to 38 years). Four cases were congenital kyphoscoliosis, 1 was post-laminectomy kyphoscoliosis and 1 was post-tuberculous angular kyphosis. Three cases associated with preoperative neurologic deficit (Frankel C in 1 patient and D in 2 patients). The causes, management and outcomes of unplanned revision surgery within 30 days after PVCR were recorded. Results: The total incidence of unplanned revision surgery within 30 days following PVCR was 5.4% (6/112). There was 1 case due to cerebrospinal fluid leak, 5 cases with varying degrees of new neurologic deficits, the causes were as followed: dural buckling in 1 case, residual bone compression in 1 case, epidural hematoma compression in 2 cases, spinal subdural hematoma in 1 case. All the 6 cases underwent surgical exploration again, including further dural repair, decompression and hematoma clearance. After unplanned reoperation, 6 cases recovered completely. The average follow-up time after surgery was 30.8 months (ranging from 10 to 60 months). The major curve at coronal plane was improved from preoperative 87.7° to 34.2°, with a mean correction of 61.0% at final follow-up; the sagittal kyphosis curve was improved from preoperative 119.5° to 45.5°, with a mean correction of 61.9% at final follow-up. Two patients' neurological status improved from Frankel D to Frankel E, one patient's neurological status improved from Frankel C to Frankel E. Conclusions: One

  15. An Investigation of the Effects of Different Types of Activities during Pauses in a Segmented Instructional Animation

    ERIC Educational Resources Information Center

    Cheon, Jongpil; Chung, Sungwon; Crooks, Steven M.; Song, Jaeki; Kim, Jeakyeong

    2014-01-01

    Since the complex and transient information in instructional animations requires more cognitive resources, the segmenting principle has been proposed to reduce cognitive overload by providing smaller chunks with pauses between segments. This study examined the effects of different types of activities during pauses in a segmented animation. Four…

  16. Extended Pausing by Humans on Multiple Fixed-Ratio Schedules with Varied Reinforcer Magnitude and Response Requirements

    ERIC Educational Resources Information Center

    Williams, Dean C.; Saunders, Kathryn J.; Perone, Michael

    2011-01-01

    We conducted three experiments to reproduce and extend Perone and Courtney's (1992) study of pausing at the beginning of fixed-ratio schedules. In a multiple schedule with unequal amounts of food across two components, they found that pigeons paused longest in the component associated with the smaller amount of food (the lean component), but only…

  17. RNA polymerase II pauses at the 5 prime end of the transcriptionally induced Drosophila hsp70 gene

    SciTech Connect

    O'Brien, T.; Lis, J.T. )

    1991-10-01

    An RNA polymerase II molecule is associated with the 5{prime} end of the Drosophila melanogaster hsp70 gene under non-heat shock conditions. This polymerase is engaged in transcription but has paused, or arrested, after synthesizing about 25 nucleotides. Resumption of elongation by this paused polymerase appears to be the rate-limiting step in hsp70 transcription in uninduced cells. Here the authors report results of nuclear run-on assays that measure the distribution of elongating and paused RNA polymerase molecules on the hsp70 gene in induced cells. Pausing of polymerase was detected at the 5{prime} end of hsp70 was transcribed approximately five times during the 25-min heat shock that they used. Therefore, once the hsp70 gene is induced to an intermediate level, initiation of transcription by RNA polymerase II remains more rapid than the resumption of elongation by a paused polymerase molecule.

  18. Comparison of Pausing Behavior in Children Who Stutter and Children Who Have Asperger Syndrome

    ERIC Educational Resources Information Center

    Beltrame, Jessica Monique; Viera, Renata Alves Torello; Tamanaha, Ana Carina; Arcuri, Claudia Fassin; Osborn, Ellen; Perissinoto, Jacy; Schiefer, Ana Maria

    2011-01-01

    Purpose: The objective of this research was to compare the number and types of grammatical and non-grammatical silent pauses presented by stutterers and subjects with Asperger syndrome in their narratives. Method: Ten children who stutter and four participants with Asperger syndrome (mean ages of both groups 10 years) were assessed at the Speech…

  19. Pause Time Patterns in Writing Narrative and Expository Texts by Children and Adults

    ERIC Educational Resources Information Center

    van Hell, Janet G.; Verhoeven, Ludo; van Beijsterveldt, Liesbeth M.

    2008-01-01

    How do beginning and skilled writers compose a text in the course of time? To gain insight into the temporal aspects of planning and translating activities during writing, this article examined writing in real time and analyzed pause time patterns in writing in relation to linguistic characteristics of the written product. Fourth-grade children…

  20. The Incidence of Filled Pauses in Relation to Part of Speech

    ERIC Educational Resources Information Center

    Cook, Mark

    1971-01-01

    Examines the occurrence of filled pauses (FP) in the spontaneous speech of 11 speakers, finding that FP's occur (1) less often than expected before nouns, verbs, and adverbs, (2) more often than expected before pronouns, and (3) about as often as expected before adjectives. Tables and references. (VJ)

  1. Transcriptional interference by RNA polymerase pausing and dislodgement of transcription factors.

    PubMed

    Palmer, Adam C; Egan, J Barry; Shearwin, Keith E

    2011-01-01

    Transcriptional interference is the in cis suppression of one transcriptional process by another. Mathematical modeling shows that promoter occlusion by elongating RNA polymerases cannot produce strong interference. Interference may instead be generated by (1) dislodgement of slow-to-assemble pre-initiation complexes and transcription factors and (2) prolonged occlusion by paused RNA polymerases.

  2. Cues-Pause-Point Language Training: Teaching Echolalics Functional Use of Their Verbal Labeling Repertoires.

    ERIC Educational Resources Information Center

    McMorrow, Martin J.; And Others

    1987-01-01

    A cues-pause-point procedure was used to train two severely retarded females to remain quiet before, during, and briefly after the presentation of questions and then to verbalize on the basis of environmental cues whose labels represented the correct responses. Echolalia was rapidly replaced by correct responding on the trained stimuli. (Author/JW)

  3. Explaining the Segmentation Effect in Learning from Animations: The Role of Pausing and Temporal Cueing

    ERIC Educational Resources Information Center

    Spanjers, Ingrid A. E.; van Gog, Tamara; Wouters, Pieter; van Merrienboer, Jeroen J. G.

    2012-01-01

    Segmentation of animations, that is presenting them in pieces rather than as a continuous stream of information, has been shown to have a beneficial effect on cognitive load and learning for novices. Two different explanations of this segmentation effect have been proposed. Firstly, pauses are usually inserted between the segments, which may give…

  4. The mitochondrial transcription termination factor mTERF modulates replication pausing in human mitochondrial DNA

    PubMed Central

    Hyvärinen, Anne K.; Pohjoismäki, Jaakko L. O.; Reyes, Aurelio; Wanrooij, Sjoerd; Yasukawa, Takehiro; Karhunen, Pekka J.; Spelbrink, Johannes N.; Holt, Ian J.; Jacobs, Howard T.

    2007-01-01

    The mammalian mitochondrial transcription termination factor mTERF binds with high affinity to a site within the tRNALeu(UUR) gene and regulates the amount of read through transcription from the ribosomal DNA into the remaining genes of the major coding strand of mitochondrial DNA (mtDNA). Electrophoretic mobility shift assays (EMSA) and SELEX, using mitochondrial protein extracts from cells induced to overexpress mTERF, revealed novel, weaker mTERF-binding sites, clustered in several regions of mtDNA, notably in the major non-coding region (NCR). Such binding in vivo was supported by mtDNA immunoprecipitation. Two-dimensional neutral agarose gel electrophoresis (2DNAGE) and 5′ end mapping by ligation-mediated PCR (LM-PCR) identified the region of the canonical mTERF-binding site as a replication pause site. The strength of pausing was modulated by the expression level of mTERF. mTERF overexpression also affected replication pausing in other regions of the genome in which mTERF binding was found. These results indicate a role for TERF in mtDNA replication, in addition to its role in transcription. We suggest that mTERF could provide a system for coordinating the passage of replication and transcription complexes, analogous with replication pause-region binding proteins in other systems, whose main role is to safeguard the integrity of the genome whilst facilitating its efficient expression. PMID:17884915

  5. In the Pause and Listening to the Little People: A Folk Healer's Journey

    ERIC Educational Resources Information Center

    Robbins, Rockey; Hong, Ji; Jennings, Aaron M.

    2012-01-01

    This article employs a qualitative case study approach to describe the views and perspectives of a folk healer (White Bear) regarding spiritual healing. White Bear argues for a mobile, in-the-moment form of diagnosis and a "pause," in which the mind ceases to tyrannize and the healer is no longer absorbed in his or her emotions. He contends that a…

  6. Academic Writers On-Line: Investigating Pausing in the Production of Text.

    ERIC Educational Resources Information Center

    Miller, Kristyan Spelman

    2000-01-01

    Describes an approach to the study of writing processes based on the analysis of temporal aspects of the writing event. The approach involves recording the keystroke presses made during production of a text using a word processor, and analyzing such features as pausing, fluency, and revision activity. (Author/VWL)

  7. Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells.

    PubMed

    Min, Irene M; Waterfall, Joshua J; Core, Leighton J; Munroe, Robert J; Schimenti, John; Lis, John T

    2011-04-01

    Transitions between pluripotent stem cells and differentiated cells are executed by key transcription regulators. Comparative measurements of RNA polymerase distribution over the genome's primary transcription units in different cell states can identify the genes and steps in the transcription cycle that are regulated during such transitions. To identify the complete transcriptional profiles of RNA polymerases with high sensitivity and resolution, as well as the critical regulated steps upon which regulatory factors act, we used genome-wide nuclear run-on (GRO-seq) to map the density and orientation of transcriptionally engaged RNA polymerases in mouse embryonic stem cells (ESCs) and mouse embryonic fibroblasts (MEFs). In both cell types, progression of a promoter-proximal, paused RNA polymerase II (Pol II) into productive elongation is a rate-limiting step in transcription of ∼40% of mRNA-encoding genes. Importantly, quantitative comparisons between cell types reveal that transcription is controlled frequently at paused Pol II's entry into elongation. Furthermore, "bivalent" ESC genes (exhibiting both active and repressive histone modifications) bound by Polycomb group complexes PRC1 (Polycomb-repressive complex 1) and PRC2 show dramatically reduced levels of paused Pol II at promoters relative to an average gene. In contrast, bivalent promoters bound by only PRC2 allow Pol II pausing, but it is confined to extremely 5' proximal regions. Altogether, these findings identify rate-limiting targets for transcription regulation during cell differentiation.

  8. Impact of Typical Aging and Parkinson's Disease on the Relationship among Breath Pausing, Syntax, and Punctuation

    ERIC Educational Resources Information Center

    Huber, Jessica E.; Darling, Meghan; Francis, Elaine J.; Zhang, Dabao

    2012-01-01

    Purpose: The present study examines the impact of typical aging and Parkinson's disease (PD) on the relationship among breath pausing, syntax, and punctuation. Method: Thirty young adults, 25 typically aging older adults, and 15 individuals with PD participated. Fifteen participants were age- and sex-matched to the individuals with PD.…

  9. An Exploratory Study of Pauses in Computer-Assisted EFL Writing

    ERIC Educational Resources Information Center

    Xu, Cuiqin; Ding, Yanren

    2014-01-01

    The advance of computer input log and screen-recording programs over the last two decades has greatly facilitated research into the writing process in real time. Using Inputlog 4.0 and Camtasia 6.0 to record the writing process of 24 Chinese EFL writers in an argumentative task, this study explored L2 writers' pausing patterns in computer-assisted…

  10. 78 FR 67140 - Office of Environmental Information; Pause the Development of the Draft Quality Standard for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-08

    ... comments for the Draft Quality Standard for Environmental Data Collection, Production, and Use by Non-EPA... draft Quality Standards for Data Collection, Production and Use. This decision was made after careful... AGENCY Office of Environmental Information; Pause the Development of the Draft Quality Standard...

  11. Neural correlates of prosodic boundary perception in German preschoolers: If pause is present, pitch can go.

    PubMed

    Männel, Claudia; Friederici, Angela D

    2016-02-01

    Children׳s perception of prosodic phrasing provides a head start into the discovery of speech structure. Based on the close prosody-syntax correspondence, children can infer the underlying syntactic structure from the acoustic modulations of prosodic boundaries, typically consisting of co-occurring pitch changes, preboundary lengthening, and pausing. Previous electrophysiological studies revealed that listeners are to some degree flexible in the detection of major prosodic boundaries that are not marked with all three of the suprasegmental cues. Adults and 6-year-olds still showed the brain response for prosodic boundary perception, the Closure Positive Shift (CPS), when pauses marking boundaries were deleted. In contrast, younger children at 3 years did not show this ability yet, but required pausing to complement the other boundary cues. Following the hypothesis that German weights duration cues more heavily than pitch cues, we here examined 3-year-olds׳ brain responses to prosodic phrasing, testing the role of boundary-related pitch changes. Results revealed that children at this age even showed the CPS in response to pitch-neutralized boundaries with only pausing and preboundary lengthening being present. These results indicate differential roles of acoustic cues in boundary perception, with a preferential reliance on duration cues over pitch changes in 3-year-olds. This preference likely results from the characteristics of the German intonation system and furthers the discussion of cross-linguistic differences in the weighting of prosodic boundary cues.

  12. Pause and Utterance Duration in Child-Directed Speech in Relation to Child Vocabulary Size

    ERIC Educational Resources Information Center

    Marklund, Ulrika; Marklund, Ellen; Lacerda, Francisco; Schwarz, Iris-Corinna

    2015-01-01

    This study compares parental pause and utterance duration in conversations with Swedish speaking children at age 1;6 who have either a large, typical, or small expressive vocabulary, as measured by the Swedish version of the McArthur-Bates CDI. The adjustments that parents do when they speak to children are similar across all three vocabulary…

  13. What Makes Speech Sound Fluent? The Contributions of Pauses, Speed and Repairs

    ERIC Educational Resources Information Center

    Bosker, Hans Rutger; Pinget, Anne-France; Quene, Hugo; Sanders, Ted; de Jong, Nivja H.

    2013-01-01

    The oral fluency level of an L2 speaker is often used as a measure in assessing language proficiency. The present study reports on four experiments investigating the contributions of three fluency aspects (pauses, speed and repairs) to perceived fluency. In Experiment 1 untrained raters evaluated the oral fluency of L2 Dutch speakers. Using…

  14. Computer work duration and its dependence on the used pause definition.

    PubMed

    Richter, Janneke M; Slijper, Harm P; Over, Eelco A B; Frens, Maarten A

    2008-11-01

    Several ergonomic studies have estimated computer work duration using registration software. In these studies, an arbitrary pause definition (Pd; the minimal time between two computer events to constitute a pause) is chosen and the resulting duration of computer work is estimated. In order to uncover the relationship between the used pause definition and the computer work duration (PWT), we used registration software to record usage patterns of 571 computer users across almost 60,000 working days. For a large range of Pds (1-120 s), we found a shallow, log-linear relationship between PWT and Pds. For keyboard and mouse use, a second-order function fitted the data best. We found that these relationships were dependent on the amount of computer work and subject characteristics. Comparison of exposure duration from studies using different pause definitions should take this into account, since it could lead to misclassification. Software manufacturers and ergonomists assessing computer work duration could use the found relationships for software design and study comparison.

  15. Predictors of 30-Day Mortality and 90-Day Functional Recovery after Primary Intracerebral Hemorrhage : Hospital Based Multivariate Analysis in 585 Patients

    PubMed Central

    2009-01-01

    Objective The purpose of this study was to identify independent predictors of mortality and functional recovery in patients with primary intracerebral hemorrhage (PICH) and to improve functional outcome in these patients. Methods Data were collected retrospectively on 585 patients with supratentorial PICH admitted to the Stroke Unit at our hospital between 1st January 2004 and the 31st July 2008. Using multivariate logistic regression analysis, the associations between all selected variables and 30-day mortality and 90-day functional recoveries after PICH was evaluated. Results Ninety-day functional recovery was achieved in 29.1% of the 585 patients and 30-day mortality in 15.9%. Age (OR=7.384, p=0.000), limb weakness (OR=6.927, p=0.000), and hematoma volume (OR=5.293, p=0.000) were found to be powerful predictors of 90-day functional recovery. Furthermore, initial consciousness (OR=3.013, p=0.014) hematoma location (lobar, OR=2.653, p=0.003), ventricular extension of blood (OR=2.077, p=0.013), leukocytosis (OR=2.048, p=0.008), alcohol intake (drinker, OR=1.927, p=0.023), and increased serum aminotransferase (OR=1.892, p=0.035) were found to be independent predictors of 90-day functional recovery after PICH. On the other hand, a pupillary abnormality (OR=4.532, p=0.000) and initial unconsciousness (OR=3.362, p=0.000) were found to be independent predictors of 30-day mortality after PICH. Conclusion The predictors of mortality and functional recovery after PICH identified during this analysis may assist during clinical decision-making, when advising patients or family members about the prognosis of PICH and when planning intervention trials. PMID:19609417

  16. Length of stay, wait time to surgery and 30-day mortality for patients with hip fractures after the opening of a dedicated orthopedic weekend trauma room

    PubMed Central

    Taylor, Michel; Hopman, Wilma; Yach, Jeff

    2016-01-01

    Background In September 2011, Kingston General Hospital (KGH) opened a dedicated orthopedic weekend trauma room. Previously, 1 weekend operating room (OR) was used by all surgical services. We assessed the impact this dedicated weekend trauma room had on hospital length of stay (LOS), time to surgery and 30-day mortality for patients with hip fractures. Methods Patients admitted between Oct. 1, 2009, and Sept. 30, 2012, were identified through our trauma registry, representing the 2 years before and 1 year after the opening of the orthopedic weekend trauma room. We documented type of fracture, mode of fixation, age, sex, American Society of Anesthesiologists (ASA) score, time to OR, LOS, discharge disposition and 30-day mortality. We excluded patients with multiple fractures, open fractures and those requiring trauma team activation. Results Our study included 609 patients (405 pre- and 204 post–trauma room opening). Mean LOS decreased from 11.6 to 9.4 days (p = 0.005) and there was a decreasing trend in mean time to OR from 31.5 to 28.5 hours (p = 0.16). There was no difference in 30-day mortality (p = 0.24). The LOS decreased by an average of 2 days following opening of the weekend trauma room (p = 0.031) and by an average of 2.2 additional days if the patient was admitted on the weekend versus during the week (p = 0.024). Conclusion The weekend trauma OR at KGH significantly decreased the LOS and appears to have decreased wait times to surgery. Further analysis is needed to assess the cost-effectiveness of the current strategy, the long-term outcome of this patient population and the impact the additional orthopedic weekend trauma room has had on other surgical services (i.e., general surgery) and their patients. PMID:27668332

  17. Effectiveness of using thyrocalcitonin for the prevention of a calcium metabolic disorder in the mineralized tissues of rabbits with 30 days hypokinesia

    NASA Technical Reports Server (NTRS)

    Volozhin, A. I.; Shashkov, V. S.; Dmitriyev, B. S.; Yegorov, B. B.; Lobachik, V. I.; Brishin, A. I.

    1980-01-01

    A 30 day hypokinesia in rabbits led to a considerable lag in weight gain for the skeletal bones, reduction in Ca45 uptake, and an increase in isotope resorption rate in the rapidly metabolized fraction of extremity bones. On the other hand, Ca45 content in the teeth and maxillae increased, which may be explained by redistribution of isotope among the various mineralized tissues. Injection of thyrocalcitonin (50 IU/day) produced a distinct normalizing effect on Ca45 uptake and resorption in the mineralized tissues of rabbits kept hypokinetic.

  18. Life sciences payload definition and integration study. Volume 4: Appendix, costs, and data management requirements of the dedicated 30-day laboratory. [carry-on laboratory for Spacelab

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The results of the updated 30-day life sciences dedicated laboratory scheduling and costing activities are documented, and the 'low cost' methodology used to establish individual equipment item costs is explained in terms of its allowances for equipment that is commerical off-the-shelf, modified commercial, and laboratory prototype; a method which significantly lowers program costs. The costs generated include estimates for non-recurring development, recurring production, and recurring operations costs. A cost for a biomedical emphasis laboratory and a Delta cost to provide a bioscience and technology laboratory were also generated. All cost reported are commensurate with the design and schedule definitions available.

  19. Execution and pauses in writing narratives: processing time, cognitive effort and typing skill.

    PubMed

    Alves, Rui Alexandre; Castro, São Luís; Olive, Thierry

    2008-12-01

    At the behavioural level, the activity of a writer can be described as periods of typing separated by pauses. Although some studies have been concerned with the functions of pauses, few have investigated motor execution periods. Precise estimates of the distribution of writing processes, and their cognitive demands, across periods of typing and pauses are lacking. Furthermore, it is uncertain how typing skill affects these aspects of writing. We addressed these issues, selecting writers of low and high typing skill who performed dictation and composition tasks. The occurrences of writing processes were assessed through directed verbalization, and their cognitive demands were measured through interference in reaction times (IRT). Before writing a narrative, 34 undergraduates learned to categorize examples of introspective thoughts as different types of activities related to writing (planning, translating, or revising). Then, while writing, they responded to random auditory probes, and reported their ongoing activity according to the learned categories. Convergent with previous findings, translating was most often reported, and revising and planning had fewer occurrences. Translating was mostly activated during motor execution, whereas revising and planning were mainly activated during pauses. However, none of the writing processes can be characterized as being typical of pauses, since translating was activated to a similar extent as the other two processes. Regarding cognitive demands, revising is likely to be the most demanding process in narrative writing. Typing skill had an impact on IRTs of motor execution. The demands of execution were greater in the low than in the high typing skill group, but these greater demands did not affect the strategy of writing processes activation. Nevertheless, low typing skill had a detrimental impact on text quality.

  20. Shockwave lithotripsy with renoprotective pause is associated with renovascular vasoconstriction in humans.

    PubMed

    Bailey, Michael; Lee, Franklin; Hsi, Ryan; Paun, Marla; Dunmire, Barbrina; Liu, Ziyue; Sorensen, Mathew; Harper, Jonathan

    2014-09-03

    Animal studies have shown that shock wave lithotripsy (SWL) delivered with an initial course of low-energy shocks followed by a pause reduces renal injury. The pause correlates with increased arterial resistive index (RI) during SWL as measured by ultrasound. This suggests that renal vasoconstriction is associated with protecting the kidney from injury. This study explored whether a similar increase in RI is observed in humans. Patients were prospectively recruited from two hospitals. All received an initial dose of 250 lowest energy shocks followed by a two-minute pause. Shock power was then ramped up at the discretion of the physician; shock rate was maintained at 1 Hz. Spectral Doppler velocity measurements were taken from an interlobar artery at baseline after induction, during the pause at 250 shocks, after 750 shocks, after 1500 shocks, and at the end of the procedure. RI was calculated from the peak systolic and end diastolic velocities and a linear mixed-effects model was used to compare RIs. The statistical model accounted for age, gender, laterality, and body mass index (BMI). Measurements were taken from 15 patients. Average RI ± standard deviation pretreatment, after 250 shocks, after 750 shocks, after 1500 shocks, and post treatment was 0.68 ± 0.06, 0.71 ± 0.07, 0.73 ± 0.06, 0.75 ± 0.07 and 0.75 ± 0.06, respectively. RI was found to be significantly higher after 250 shocks compared to pretreatment (p = 0.04). RI did not correlate with age, gender, BMI, or treatment side. This is suggestive that allowing a pause for renal vascular vasoconstriction to develop may be beneficial, and can be monitored for during SWL, providing real-time feedback as to when the kidney is protected.

  1. Shockwave lithotripsy with renoprotective pause is associated with renovascular vasoconstriction in humans

    PubMed Central

    Bailey, Michael; Lee, Franklin; Hsi, Ryan; Paun, Marla; Dunmire, Barbrina; Liu, Ziyue; Sorensen, Mathew; Harper, Jonathan

    2015-01-01

    Animal studies have shown that shock wave lithotripsy (SWL) delivered with an initial course of low-energy shocks followed by a pause reduces renal injury. The pause correlates with increased arterial resistive index (RI) during SWL as measured by ultrasound. This suggests that renal vasoconstriction is associated with protecting the kidney from injury. This study explored whether a similar increase in RI is observed in humans. Patients were prospectively recruited from two hospitals. All received an initial dose of 250 lowest energy shocks followed by a two-minute pause. Shock power was then ramped up at the discretion of the physician; shock rate was maintained at 1 Hz. Spectral Doppler velocity measurements were taken from an interlobar artery at baseline after induction, during the pause at 250 shocks, after 750 shocks, after 1500 shocks, and at the end of the procedure. RI was calculated from the peak systolic and end diastolic velocities and a linear mixed-effects model was used to compare RIs. The statistical model accounted for age, gender, laterality, and body mass index (BMI). Measurements were taken from 15 patients. Average RI ± standard deviation pretreatment, after 250 shocks, after 750 shocks, after 1500 shocks, and post treatment was 0.68 ± 0.06, 0.71 ± 0.07, 0.73 ± 0.06, 0.75 ± 0.07 and 0.75 ± 0.06, respectively. RI was found to be significantly higher after 250 shocks compared to pretreatment (p = 0.04). RI did not correlate with age, gender, BMI, or treatment side. This is suggestive that allowing a pause for renal vascular vasoconstriction to develop may be beneficial, and can be monitored for during SWL, providing real-time feedback as to when the kidney is protected. PMID:26203348

  2. Profiling Speech and Pausing in Amyotrophic Lateral Sclerosis (ALS) and Frontotemporal Dementia (FTD)

    PubMed Central

    Yunusova, Yana; Graham, Naida L.; Shellikeri, Sanjana; Phuong, Kent; Kulkarni, Madhura; Rochon, Elizabeth; Tang-Wai, David F.; Chow, Tiffany W.; Black, Sandra E.; Zinman, Lorne H.; Green, Jordan R.

    2016-01-01

    Objective This study examines reading aloud in patients with amyotrophic lateral sclerosis (ALS) and those with frontotemporal dementia (FTD) in order to determine whether differences in patterns of speaking and pausing exist between patients with primary motor vs. primary cognitive-linguistic deficits, and in contrast to healthy controls. Design 136 participants were included in the study: 33 controls, 85 patients with ALS, and 18 patients with either the behavioural variant of FTD (FTD-BV) or progressive nonfluent aphasia (FTD-PNFA). Participants with ALS were further divided into 4 non-overlapping subgroups—mild, respiratory, bulbar (with oral-motor deficit) and bulbar-respiratory—based on the presence and severity of motor bulbar or respiratory signs. All participants read a passage aloud. Custom-made software was used to perform speech and pause analyses, and this provided measures of speaking and articulatory rates, duration of speech, and number and duration of pauses. These measures were statistically compared in different subgroups of patients. Results The results revealed clear differences between patient groups and healthy controls on the passage reading task. A speech-based motor function measure (i.e., articulatory rate) was able to distinguish patients with bulbar ALS or FTD-PNFA from those with respiratory ALS or FTD-BV. Distinguishing the disordered groups proved challenging based on the pausing measures. Conclusions and Relevance This study demonstrated the use of speech measures in the identification of those with an oral-motor deficit, and showed the usefulness of performing a relatively simple reading test to assess speech versus pause behaviors across the ALS—FTD disease continuum. The findings also suggest that motor speech assessment should be performed as part of the diagnostic workup for patients with FTD. PMID:26789001

  3. [The participation of opioids in the antinociceptive effect induced by the stimulation of hypothalamic "pleasure zones" in 20- to 30-day-old rabbits].

    PubMed

    Butkevich, I P; Kassil', V G

    1995-01-01

    The involvement of opioid peptides in the mediation of inhibitory influences of the positive reinforcement system ("reward areas") on the evoked potential (EPs) recorded in the thalamic parafascicular complex (CM-Pf) in response to the nociceptive electrodermal stimulation of the hind paw in 20-30 day rabbits has been studied. Electrical stimulation of "reward areas" identified in the preliminary behavioural experiments inhibited the EPs. The systemic injection of naloxone potentiated the antinociceptive effect of "reward areas" stimulation in 75% of cases under the incomplete inhibition of EPs (the decrease of EPs amplitude) but decreased its inhibitory effect in 87% of cases under the complete inhibition of EPs. Naloxone did not change the inhibitory effect of "reward areas" stimulation suggesting to the relationship of analgesic "reward areas" function with nonopioid mechanisms too. On the basis of the comparison of the present data and the ones obtained before it can be inferred that opioid mechanism in realization of antinociceptive influence of "reward areas" stimulation on EPs in CM-Pf is more important for 20-30 day rabbits compared with 41-60 day ones. The correlation of the phenomenon under investigation with the formation of neurotransmitter systems has been discussed.

  4. External Validation of a Case-Mix Adjustment Model for the Standardized Reporting of 30-Day Stroke Mortality Rates in China

    PubMed Central

    Yu, Ping; Pan, Yuesong; Wang, Yongjun; Wang, Xianwei; Liu, Liping; Ji, Ruijun; Meng, Xia; Jing, Jing; Tong, Xu; Guo, Li; Wang, Yilong

    2016-01-01

    Background and Purpose A case-mix adjustment model has been developed and externally validated, demonstrating promise. However, the model has not been thoroughly tested among populations in China. In our study, we evaluated the performance of the model in Chinese patients with acute stroke. Methods The case-mix adjustment model A includes items on age, presence of atrial fibrillation on admission, National Institutes of Health Stroke Severity Scale (NIHSS) score on admission, and stroke type. Model B is similar to Model A but includes only the consciousness component of the NIHSS score. Both model A and B were evaluated to predict 30-day mortality rates in 13,948 patients with acute stroke from the China National Stroke Registry. The discrimination of the models was quantified by c-statistic. Calibration was assessed using Pearson’s correlation coefficient. Results The c-statistic of model A in our external validation cohort was 0.80 (95% confidence interval, 0.79–0.82), and the c-statistic of model B was 0.82 (95% confidence interval, 0.81–0.84). Excellent calibration was reported in the two models with Pearson’s correlation coefficient (0.892 for model A, p<0.001; 0.927 for model B, p = 0.008). Conclusions The case-mix adjustment model could be used to effectively predict 30-day mortality rates in Chinese patients with acute stroke. PMID:27846282

  5. The effect of pause time upon the communicative interactions of young people who use augmentative and alternative communication.

    PubMed

    Mathis, Hilary; Sutherland, Dean; McAuliffe, Megan

    2011-10-01

    This study investigated the effect of variation in partner-initiated pause time on the expressive communication of young people who use Augmentative and Alternative Communication (AAC). Eight participants aged 8;11-20;08 years (mean 16;02 years) participated in the study. Three pause time conditions (2, 10, and 45 seconds) were trialled during a scripted shared storybook reading task. A total of 27 turn opportunities were provided for participants during the task. Participant interactions were analysed for the percentage of responses made to a turn opportunity, mean length of utterance in words (MLU), percentage of assertive conversational acts made, and the modes of communication used. Findings indicated that participants were more likely to respond to a turn opportunity when their communication partner provided a longer pause time. Additionally, a longer pause time resulted in longer MLUs. Participants did not use more assertive conversational acts and continued to use a variety of communication modes when provided with a longer pause time. Results indicate that increasing pause time is an effective strategy to support the development of expressive communication for young people who use AAC. This suggests the need for professionals providing AAC services to encourage communication partners to provide extended pauses during interactions.

  6. Development of key-pecking, pause, and ambulation during extended exposure to a fixed-interval schedule of reinforcement.

    PubMed

    Berry, Meredith S; Kangas, Brian D; Branch, Marc N

    2012-05-01

    Six pigeons key-pecked under a fixed-interval (FI) 3-min schedule of food presentation. Each pigeon was studied for 200 daily sessions with 15 intervals per session (3,000 total food presentations). Analyses included the examination of latency to first peck (pause), mean rate of key pecking, and ambulation. Characterizations of stable performance were assessed across measures of behavior and evaluated using commonly employed stability criteria. Stability of response rate and pause was identified better by assessments that evaluated variability and trend, rather than just variability. Between-subject differences in rate of acquisition and terminal values of steady-state performance of pause were observed, and stable pause durations took longer to develop than did stable key-pecking rates. Relative variability in response rate and pause duration decreased as the means increased. A temporally organized pattern of key-pecking (the so-called FI scallop) developed within 50 sessions of exposure to the schedule. Overall ambulation decreased during the early sessions of exposure and further analyses showed greater rates of ambulation during the pause than after it for 4 of the 6 pigeons. Performance under the FI 3-min schedule developed relatively slowly, and key-pecking, pause, and ambulation developed at different rates.

  7. [Postoperative pain in craniotomy].

    PubMed

    Peón, Andréa Ungaro; Diccini, Solange

    2005-01-01

    In the postoperative period, 47% to 75% of the patients report some degree of pain. This study aimed to evaluate pain in the pre and postoperative period of patients submitted to craniotomy. This prospective research was carried out at the neurosurgery unit of a large Brazilian hospital. For a quantitative evaluation of pain, the verbal numeric 0-10 rating scale was used. Forty patients with a mean age of 36 years were evaluated. In the preoperative period, 34 (85%) patients indicated headache as the main cause of pain. In the postoperative period, 37 (93%) patients complained of pain while three (7%) reported absence of pain. Pain peaks were observed on the 2nd postoperative day, when 12 (32%) of the patients reported severe pain and 10 (27%) moderate pain. Absence of severe pain occurred after the 8th postoperative day. It was concluded that protocols of analgesia in craniotomy are needed, such as training nurses to better evaluate and handle pain.

  8. Characteristics and preliminary observations of the influence of electromyostimulation on the size and function of human skeletal muscle during 30 days of simulated microgravity

    NASA Technical Reports Server (NTRS)

    Duvoisin, Marc R.; Convertino, Victor A.; Buchanan, Paul; Gollnick, Philip A.; Dudley, Gary A.

    1989-01-01

    The effect of transcutaneous electromyostimulation (EMS) on the development of atrophy and the loss of strength in lower limb musculature in humans exposed to microgravity was determined in three subjects who received EMS twice daily in a 3-d on/1-d off cycle on their dominant leg during 30 days of bedrest. The output waveform from the stimulator was sequenced to the knee extensors, knee flexors, ankle extensors, and ankle flexors, and caused three isometric contractions of each muscle group per minute. It was found that, in the dominant leg, EMS acted to attenuate the changes caused by bedrest, such as reductions in the leg volume, muscle compartment size, cross-sectional area of slow- and fast-twitch fibers, strength, and aerobic enzyme activities, and an increase in leg compliance.

  9. Results of 30-day petroleum Co-Fire test at the Houston Lighting & Power W.A. Parish Station. Final report

    SciTech Connect

    Jones, A.F.; Booth, R.C.; Machtemes, A.P.

    1995-10-01

    As more heavy crude oil is refined, petroleum coke may become cheaper and more available. A 30-day test co-firing of petroleum coke with Western coal was performed on Unit 8 of Houston Lighting & Power`s W.A. Parish Station to address several concerns about the effects of co-firing coke. The test program studied fuel handling and consistency issues, coal mill performance, furnace operation, emissions, baghouse operation, and flue gas desulfurization (FGD) system performance. Results indicated that petroleum coke can be co-fired with Western coal without any significant problems. The limiting factor on how much coke can be in the bend is the ability of the FGD system to meet emission limits for SO{sub 2}.

  10. Myeloid Precursors in the Bone Marrow of Mice after a 30-Day Space Mission on a Bion-M1 Biosatellite.

    PubMed

    Sotnezova, E V; Markina, E A; Andreeva, E R; Buravkova, L B

    2017-02-01

    The content of myeloid stem CFU in bone marrow karyocytes from the tibial bone of C57Bl/6 mice was evaluated after a 30-day Bion-M1 pace flight/ground control experiment and subsequent 7-day recovery period. After the space flight, we observed a significant decrease in the number of erythroid progenitors in the bone marrow, including common myeloid precursor - granulocyte, erythrocyte, monocyte/macrophage, megakaryocyte CFU. After 7-day readaptation, CFU level in flight animals did not recover completely. In the ground control, the count of erythroid burst-forming units was higher than in vivarium animals. Comparison of the changes observed in fight and ground experiments demonstrated effects associated space flight factors and manifesting in suppression of the bone marrow erythropoiesis.

  11. Pause and utterance duration in child-directed speech in relation to child vocabulary size.

    PubMed

    Marklund, Ulrika; Marklund, Ellen; Lacerda, Francisco; Schwarz, Iris-Corinna

    2015-09-01

    This study compares parental pause and utterance duration in conversations with Swedish speaking children at age 1;6 who have either a large, typical, or small expressive vocabulary, as measured by the Swedish version of the McArthur-Bates CDI. The adjustments that parents do when they speak to children are similar across all three vocabulary groups; they use longer utterances than when speaking to adults, and respond faster to children than they do to other adults. However, overall pause duration varies with the vocabulary size of the children, and as a result durational aspects of the language environment to which the children are exposed differ between groups. Parents of children in the large vocabulary size group respond faster to child utterances than do parents of children in the typical vocabulary size group, who in turn respond faster to child utterances than do parents of children in the small vocabulary size group.

  12. Influence of Pause Duration and Nod Response Timing in Dialogue between Human and Communication Robot

    NASA Astrophysics Data System (ADS)

    Takasugi, Shoji; Yoshida, Shohei; Okitsu, Kengo; Yokoyama, Masanori; Yamamoto, Tomohito; Miyake, Yoshihiro

    The purpose of this study is to clarify the influence from timing of utterance and body motion in dialogue between human and robot. We controlled pause duration and nod response timing in robot-side, and analyzed impression of communication in human-side by using Scheffe's Paired Comparison method. The results revealed that the impression of communication significantly modified by changing the pause duration and nod response timing. And, timing pattern of the impression altered diversely in elderly people than in younger, indicating that elderly generation uses various timing control mechanisms. From these results, it was suggested that timing control and impression of communication are mutually influenced, and this mechanism is thought to be useful to realize human-robot communication system for elderly generation.

  13. Immunotoxicological Evaluation of Corn Genetically Modified with Bacillus thuringiensis Cry1Ah Gene by a 30-Day Feeding Study in BALB/c Mice

    PubMed Central

    Song, Yan; Liang, Chunlai; Wang, Wei; Fang, Jin; Sun, Nana; Jia, Xudong; Li, Ning

    2014-01-01

    This study was to investigate the immunotoxicological potential of corn genetically modified (GM) with Bacillus thuringiensis (Bt) Cry1Ah gene in BALB/c mice. Female BALB/c mice were randomly assigned to one of the four groups: the negative control group, the parental corn group, the GM corn group and the positive control group with 10 mice per group. Mice in the GM corn group and the parental corn group were fed with diets containing 70% corresponding corn for 30 days. Mice in the negative control group and the positive control group were fed with AIN93G diet, administered with saline or 200 mg/kg of cyclophosphamide (CY) via intraperitoneal injection 24 h before the termination of the study, respectively. At the end of the study, the immunotoxicological effects of the GM corn were evaluated through immunopathology parameters including body and organ weights, hematology and clinical chemistry parameters, histological examination, peripheral blood lymphocytes phenotype; humoral immunity including antibody plaque-forming cell, serum immunoglobulin, cytokine and half hemolysis value; cellular immunity such as mitogen-induced splenocyte proliferation, cytotoxic T-lymphocyte reaction, delayed-type hypersensitivity reaction; non-specific immunity including phagocytic activities of phagocytes, natural killer cell activity. A single dose of cyclophosphamide (200 mg/kg bw) was found to have significant adverse effects on immunopathology, cellular immunity, and humoral immunity in mice. The corn genetically modified with Bt Cry1Ah gene is considered consistent with the parental corn in terms of immunopathology, humoral immunity, cellular immunity and non-specific immunity. No adverse immunotoxicological effects of GM corn with Bt Cry1Ah gene were found when feeding mice for 30 days. PMID:24520311

  14. Immunotoxicological evaluation of corn genetically modified with Bacillus thuringiensis Cry1Ah gene by a 30-day feeding study in BALB/c mice.

    PubMed

    Song, Yan; Liang, Chunlai; Wang, Wei; Fang, Jin; Sun, Nana; Jia, Xudong; Li, Ning

    2014-01-01

    This study was to investigate the immunotoxicological potential of corn genetically modified (GM) with Bacillus thuringiensis (Bt) Cry1Ah gene in BALB/c mice. Female BALB/c mice were randomly assigned to one of the four groups: the negative control group, the parental corn group, the GM corn group and the positive control group with 10 mice per group. Mice in the GM corn group and the parental corn group were fed with diets containing 70% corresponding corn for 30 days. Mice in the negative control group and the positive control group were fed with AIN93G diet, administered with saline or 200 mg/kg of cyclophosphamide (CY) via intraperitoneal injection 24 h before the termination of the study, respectively. At the end of the study, the immunotoxicological effects of the GM corn were evaluated through immunopathology parameters including body and organ weights, hematology and clinical chemistry parameters, histological examination, peripheral blood lymphocytes phenotype; humoral immunity including antibody plaque-forming cell, serum immunoglobulin, cytokine and half hemolysis value; cellular immunity such as mitogen-induced splenocyte proliferation, cytotoxic T-lymphocyte reaction, delayed-type hypersensitivity reaction; non-specific immunity including phagocytic activities of phagocytes, natural killer cell activity. A single dose of cyclophosphamide (200 mg/kg bw) was found to have significant adverse effects on immunopathology, cellular immunity, and humoral immunity in mice. The corn genetically modified with Bt Cry1Ah gene is considered consistent with the parental corn in terms of immunopathology, humoral immunity, cellular immunity and non-specific immunity. No adverse immunotoxicological effects of GM corn with Bt Cry1Ah gene were found when feeding mice for 30 days.

  15. Exposure to microgravity for 30 days onboard Bion M1 caused muscle atrophy and decreased regeneration in the mouse femoral Quadriceps

    NASA Astrophysics Data System (ADS)

    Grigoryan, Eleonora; Radugina, Elena A.; Almeida, Eduardo; Blaber, Elizabeth; Poplinskaya, Valentina; Markitantova, Yulia

    Mechanical unloading of muscle during spaceflight in microgravity is known to cause muscular atrophy, changes in muscle fiber type composition, gene expression, and reductions in regenerative muscle growth. Although limited data exists for long-term effects of microgravity in human muscle, these processes have mostly been studied in rodents for short periods of time, up to two weeks of spaceflight. Here we report on how 30-day, long-term, mechanical unloading in microgravity affects mouse muscle of the femoral Quadriceps group. To conduct these studies we used muscle tissue from 6 mice from the NASA Biospecimen Sharing Program conducted in collaboration with the Institute for Biomedical Problems of the Russian Academy of Sciences, during the Russian Bion M1 biosatellite mission in 2013. Muscle morphology observed in histological sections shows signs of extensive atrophy and regenerative hypoplasia. Specifically, we observed a two-fold decrease in the number of myonuclei and low density of myofibrils, their separation and fragmentation. Despite obvious atrophy, muscle regeneration nevertheless appears to have continued after 30 days in microgravity as evidenced by thin and short newly formed muscle fibers. Many of them however showed evidence of apoptosis and degradation of synthesized fibrils, suggesting long-term unloading in microgravity affects late stages of myofiber differentiation. Ground asynchronous and vivarium control animals showed normal, well-developed tissue structure with sufficient blood and nerve supply and evidence of regenerative formation of new muscle fibers free of apoptotic nuclei. Myofiber nuclei stress responses in spaceflight animals was detected by positive nuclear immunolocalization of c-jun and c-myc proteins. Regenerative activity of satellite cells in muscle was localized with pax-7, MyoD and MCad immunostaining, and did not appear altered in microgravity. In summary, long-term spaceflight in microgravity causes significant atrophy

  16. Snoring and breathing pauses during sleep: telephone interview survey of a United Kingdom population sample.

    PubMed Central

    Ohayon, M. M.; Guilleminault, C.; Priest, R. G.; Caulet, M.

    1997-01-01

    OBJECTIVES: To determine the prevalence of snoring, breathing pauses during sleep, and obstructive sleep apnoea syndrome and determine the relation between these events and sociodemographic variables, other health problems, driving accidents, and consumption of healthcare resources. DESIGN: Telephone interview survey directed by a previously validated computerised system (Sleep-Eval). SETTING: United Kingdom. SUBJECTS: 2894 women and 2078 men aged 15-100 years who formed a representative sample of the non-institutionalised population. MAIN OUTCOME MEASURES: Interview responses. RESULTS: Forty per cent of the population reported snoring regularly and 3.8% reported breathing pauses during sleep. Regular snoring was significantly associated with male sex, age 25 or more, obesity, daytime sleepiness or naps, night time awakenings, consuming large amounts of caffeine, and smoking. Breathing pauses during sleep were significantly associated with obstructive airways or thyroid disease, male sex, age 35-44 years, consumption of anxiety reducing drugs, complaints of non-restorative sleep, and consultation with a doctor in the past year. The two breathing symptoms were also significantly associated with drowsiness while driving. Based on minimal criteria of the International classification of Sleep Disorders (1990), 1.9% of the sample had obstructive sleep apnoea syndrome. In the 35-64 year age group 1.5% of women (95% confidence interval 0.8% to 2.2%) and 3.5% of men (2.4% to 4.6%) had obstructive sleep apnoea syndrome. CONCLUSIONS: Disordered breathing during sleep is widely underdiagnosed in the United Kingdom. The condition is linked to increased use of medical resources and a greater risk of daytime sleepiness, which augments the risk of accidents. Doctors should ask patients and bed partners regularly about snoring and breathing pauses during sleep. PMID:9093095

  17. Understanding postoperative fatigue.

    PubMed

    Rose, E A; King, T C

    1978-07-01

    Performance characteristics of the central nervous, cardiovascular, respiratory and muscular systems in man postoperatively have received little investigative attention, despite the well known syndrome of postoperative fatigue. The impairmen in perception and psychomotor skills that has been shown to result from caloric restriction, bedrest, sedation and sleep deprivation suggests that a similar deficit may occur after surgical procedures. After a simple elective surgical procedure, maximal oxygen uptake decreases and the adaptability of heart rate to submaximal workloads is impaired. Similar deleterious effects on cardiorespiratory performance have been documented with starvation and bedrest; an understanding of cardiorespiratory performance postoperatively awaits further investigation. Maximal muscular force of contraction is also impaired by caloric restriction and bedrest, suggesting that similar effects may be seen in the postoperative state, although this has not been studied. A better understanding of the syndrome of postoperative fatigue could be achieved by a descriptive analysis of physiologic performance postoperatively. Such descriptive data could form the basis for objective evaluation of therapeutic measures intended to improve performance, such as nutritional supplementation and pharmacologic intervention. The observation that exercise with the patient in the supine position may decrease the impairment in maximal aerobic power otherwise expected in immobilized patients suggests that controlled exercise therapy may be of value in reducing physiologic impairment postoperatively.

  18. The Solsticial Pause on Mars. Part 1; A Planetary Wave Reanalysis

    NASA Technical Reports Server (NTRS)

    Lewis, Stephen R.; Mulholland, David P.; Read, Peter L.; Montabone, Luca; Wilson, R. John; Smith, Michael D.

    2015-01-01

    Large-scale planetary waves are diagnosed from an analysis of profiles retrieved from the Thermal Emission Spectrometer aboard the Mars Global Surveyor spacecraft during its scientific mapping phase. The analysis is conducted by assimilating thermal profiles and total dust opacity retrievals into a Mars global circulation model. Transient waves are largest throughout the northern hemisphere autumn, winter and spring period and almost absent during the summer. The southern hemisphere exhibits generally weaker transient wave behavior. A striking feature of the low-altitude transient waves in the analysis is that they show a broad subsidiary minimum in amplitude centred on the winter solstice, a period when the thermal contrast between the summer hemisphere and the winter pole is strongest and baroclinic wave activity might be expected to be strong. This behavior, here called the 'solsticial pause,' is present in every year of the analysis. This strong pause is under-represented in many independent model experiments, which tend to produce relatively uniform baroclinic wave activity throughout the winter. This paper documents and diagnoses the transient wave solsticial pause found in the analysis; a companion paper investigates the origin of the phenomenon in a series of model experiments.

  19. Starvation induces FoxO-dependent mitotic-to-endocycle switch pausing during Drosophila oogenesis.

    PubMed

    Jouandin, Patrick; Ghiglione, Christian; Noselli, Stéphane

    2014-08-01

    When exposed to nutrient challenge, organisms have to adapt their physiology in order to balance reproduction with adult fitness. In mammals, ovarian follicles enter a massive growth phase during which they become highly dependent on gonadotrophic factors and nutrients. Somatic tissues play a crucial role in integrating these signals, controlling ovarian follicle atresia and eventually leading to the selection of a single follicle for ovulation. We used Drosophila follicles as a model to study the effect of starvation on follicle maturation. Upon starvation, Drosophila vitellogenic follicles adopt an 'atresia-like' behavior, in which some slow down their development whereas others enter degeneration. The mitotic-to-endocycle (M/E) transition is a critical step during Drosophila oogenesis, allowing the entry of egg chambers into vitellogenesis. Here, we describe a specific and transient phase during M/E switching that is paused upon starvation. The Insulin pathway induces the pausing of the M/E switch, blocking the entry of egg chambers into vitellogenesis. Pausing of the M/E switch involves a previously unknown crosstalk between FoxO, Cut and Notch that ensures full reversion of the process and rapid resumption of oogenesis upon refeeding. Our work reveals a novel genetic mechanism controlling the extent of the M/E switch upon starvation, thus integrating metabolic cues with development, growth and reproduction.

  20. [Chronic postoperative pain].

    PubMed

    Cachemaille, Matthieu; Blanc, Catherine

    2016-06-22

    Chronic postoperative pain remains a frequent pathology whose global impact approximates 20 and 30% and accounts for 20% of the consultations in a pain center. Risk factors consider firstly each patient's feature and comorbidity and also different surgical procedures with their technical approach. Neuropathic pain compared to nociceptive pain is a great component in the postoperative period and needs to be recognized by specific tests (DN4). Pain prevention involves risk factors' detection, appropriate anesthetic support and effective postoperative pain management. Treatment is based on the type of pain and includes a multimodal analgesia with interventional pain therapy.

  1. [Characteristics of postoperative peritonitis].

    PubMed

    Lock, J F; Eckmann, C; Germer, C-T

    2016-01-01

    Postoperative peritonitis is still a life-threatening complication after abdominal surgery and approximately 10,000 patients annually develop postoperative peritonitis in Germany. Early recognition and diagnosis before the onset of sepsis has remained a clinical challenge as no single specific screening test is available. The aim of therapy is a rapid and effective control of the source of infection and antimicrobial therapy. After diagnosis of diffuse postoperative peritonitis surgical revision is usually inevitable after intestinal interventions. Peritonitis after liver, biliary or pancreatic surgery is managed as a rule by means of differentiated therapy approaches depending on the severity.

  2. Postoperative permanent pressure alopecia.

    PubMed

    Chang, Zi Yun; Ngian, Jan; Chong, Claudia; Chong, Chin Ted; Liew, Qui Yin

    2016-04-01

    A 49-year-old Chinese female underwent elective laparoscopic assisted Whipple's surgery lasting 12 h. This was complicated by postoperative pressure alopecia at the occipital area of the scalp. Pressure-induced hair loss after general anaesthesia is uncommon and typically temporary, but may be disconcerting to the patient. We report this case of postoperative permanent pressure alopecia due to its rarity in the anaesthesia/local literature, and review the risk factors for its development.

  3. Effect of Hospital Use of Oral Nutritional Supplementation on Length of Stay, Hospital Cost, and 30-Day Readmissions Among Medicare Patients With COPD

    PubMed Central

    Snider, Julia Thornton; Linthicum, Mark T.; Hegazi, Refaat A.; Partridge, Jamie S.; LaVallee, Chris; Lakdawalla, Darius N.; Wischmeyer, Paul E.

    2015-01-01

    BACKGROUND: COPD is a leading cause of death and disability in the United States. Patients with COPD are at a high risk of nutritional deficiency, which is associated with declines in respiratory function, lean body mass and strength, and immune function. Although oral nutritional supplementation (ONS) has been associated with improvements in some of these domains, the impact of hospital ONS on readmission risk, length of stay (LOS), and cost among hospitalized patients is unknown. METHODS: Using the Premier Research Database, we first identified Medicare patients aged ≥ 65 years hospitalized with a primary diagnosis of COPD. We then identified hospitalizations in which ONS was provided, and used propensity-score matching to compare LOS, hospitalization cost, and 30-day readmission rates in a one-to-one matched sample of ONS and non-ONS hospitalizations. To further address selection bias among patients prescribed ONS, we also used instrumental variables analysis to study the association of ONS with study outcomes. Model covariates included patient and provider characteristics and a time trend. RESULTS: Out of 10,322 ONS hospitalizations and 368,097 non-ONS hospitalizations, a one-to-one matched sample was created (N = 14,326). In unadjusted comparisons in the matched sample, ONS use was associated with longer LOS (8.7 days vs 6.9 days, P < .0001), higher hospitalization cost ($14,223 vs $9,340, P < .0001), and lower readmission rates (24.8% vs 26.6%, P = .0116). However, in instrumental variables analysis, ONS use was associated with a 1.9-day (21.5%) decrease in LOS, from 8.8 to 6.9 days (P < .01); a hospitalization cost reduction of $1,570 (12.5%), from $12,523 to $10,953 (P < .01); and a 13.1% decrease in probability of 30-day readmission, from 0.34 to 0.29 (P < .01). CONCLUSIONS: ONS may be associated with reduced LOS, hospitalization cost, and readmission risk in hospitalized Medicare patients with COPD. PMID:25357165

  4. Music benefits on postoperative distress and pain in pediatric day care surgery.

    PubMed

    Calcaterra, Valeria; Ostuni, Selene; Bonomelli, Irene; Mencherini, Simonetta; Brunero, Marco; Zambaiti, Elisa; Mannarino, Savina; Larizza, Daniela; Albertini, Riccardo; Tinelli, Carmine; Pelizzo, Gloria

    2014-08-12

    Postoperative effect of music listening has not been established in pediatric age. Response on postoperative distress and pain in pediatric day care surgery has been evaluated. Forty-two children were enrolled. Patients were randomly assigned to the music-group (music intervention during awakening period) or the non-music group (standard postoperative care). Slow and fast classical music and pauses were recorded and played via ambient speakers. Heart rate, blood pressure, oxygen saturation, glucose and cortisol levels, faces pain scale and Face, Legs, Activity, Cry, Consolability (FLACC) Pain Scale were considered as indicators of response to stress and pain experience. Music during awakening induced lower increase of systolic and diastolic blood pressure levels. The non-music group showed progressive increasing values of glycemia; in music-group the curve of glycemia presented a plateau pattern (P<0.001). Positive impact on reactions to pain was noted using the FLACC scale. Music improves cardiovascular parameters, stress-induced hyperglycemia. Amelioration on pain perception is more evident in older children. Positive effects seems to be achieved by the alternation of fast, slow rhythms and pauses even in pediatric age.

  5. Analyses of promoter-proximal pausing by RNA polymerase II on the hsp70 heat shock gene promoter in a Drosophila nuclear extract.

    PubMed Central

    Li, B; Weber, J A; Chen, Y; Greenleaf, A L; Gilmour, D S

    1996-01-01

    Analyses of Drosophila cells have revealed that RNA polymerase II is paused in a region 20 to 40 nucleotides downstream from the transcription start site of the hsp70 heat shock gene when the gene is not transcriptionally active. We have developed a cell-free system that reconstitutes this promoter-proximal pausing. The paused polymerase has been detected by monitoring the hyperreactivity of thymines in the transcription bubble toward potassium permanganate. The pattern of permanganate reactivity for the hsp70 promoter in the reconstituted system matches the pattern found on the promoter after it has been introduced back into files by P-element-mediated transposition. Matching patterns of permanganate reactivity are also observed for a non-heat shock promoter, the histone H3 promoter. Further analysis of the hsp70 promoter in the reconstituted system reveals that pausing does not depend on sequence-specific interactions located immediately downstream from the pause site. Sequences upstream from the TATA box influence the recruitment of polymerase rather than the efficiency of pausing. Kinetic analysis indicates that the polymerase rapidly enters the paused state and remains stably in this state for at least 25 min. Further analysis shows that the paused polymerase will initially resume elongation when Sarkosyl is added but loses this capacity within minutes of pausing. Using an alpha-amanitin-resistant polymerase, we provide evidence that promoter-proximal pausing does not require the carboxy-terminal domain of the polymerase. PMID:8816456

  6. [Desmin content and transversal stiffness of the left ventricle mouse cardiomyocytes and skeletal muscle fibers after a 30-day space flight on board "BION-M1" biosatellite].

    PubMed

    Ogneva, I V; Maximova, M V; Larina, I M

    2014-01-01

    The aim of this study was to determine the transversal stiffness of the cortical cytoskeleton and the cytoskeletal protein desmin content in the left ventricle cardiomyocytes, fibers of the mouse soleus and tibialis anterior muscle after a 30-day space flight on board the "BION-M1" biosatellite (Russia, 2013). The dissection was made after 13-16.5 h after landing. The transversal stiffness was measured in relaxed and calcium activated state by, atomic force microscopy. The desmin content was estimated by western blotting, and the expression level of desmin-coding gene was detected using real-time PCR. The results indicate that, the transversal stiffness of the left ventricle cardiomyocytes and fibers of the soleus muscle in relaxed and activated states did not differ from the control. The transversal stiffness of the tibialis muscle fibers in relaxed and activated state was increased in the mice group after space flight. At the same time, in all types of studied tissues the desmin content and the expression level of desmin-coding gene did not differ from the control level.

  7. Isoform composition and gene expression of thick and thin filament proteins in striated muscles of mice after 30-day space flight.

    PubMed

    Ulanova, Anna; Gritsyna, Yulia; Vikhlyantsev, Ivan; Salmov, Nikolay; Bobylev, Alexander; Abdusalamova, Zarema; Rogachevsky, Vadim; Shenkman, Boris; Podlubnaya, Zoya

    2015-01-01

    Changes in isoform composition, gene expression of titin and nebulin, and isoform composition of myosin heavy chains as well as changes in titin phosphorylation level in skeletal (m. gastrocnemius, m. tibialis anterior, and m. psoas) and cardiac muscles of mice were studied after a 30-day-long space flight onboard the Russian spacecraft "BION-M" number 1. A muscle fibre-type shift from slow-to-fast and a decrease in the content of titin and nebulin in the skeletal muscles of animals from "Flight" group was found. Using Pro-Q Diamond staining, an ~3-fold increase in the phosphorylation level of titin in m. gastrocnemius of mice from the "Flight" group was detected. The content of titin and its phosphorylation level in the cardiac muscle of mice from "Flight" and "Control" groups did not differ; nevertheless an increase (2.2 times) in titin gene expression in the myocardium of flight animals was found. The observed changes are discussed in the context of their role in the contractile activity of striated muscles of mice under conditions of weightlessness.

  8. The 2013 German-Russian BION-M1 Joint Flight Project: Skeletal Muscle and Neuromuscular Changes in Mice Housed for 30 Days in a Biosatellite on Orbit

    NASA Astrophysics Data System (ADS)

    Blottner, Dieter; Shenkman, Boris; Salanova, Michele

    Exposure to microgravity results in various structural, biochemical and molecular changes of the skeletal neuromuscular system. The BION Joint Flight Proposal between the Charité Berlin Center of Space Medicine (www.zwmb.de) in Berlin, and the Institute of Biomedical Problem (IMBP) in Moscow, provided an exciting opportunity for a more detailed analysis of neuromuscular changes in mice (C57/bl6) exposed to real microgravity housed for 30 days in a BION M1 biosatellite on orbit. The mice from the BION flight group (n=5) were compared to three different on-ground control groups (Flight control, BION-ground and Vivarium, each n=5 mice). We started to analyse various skeletal muscles from the hind limbs or trunk. Apart from routine structural and biochemical analysis (fiber size and type distribution, slow/fastMyHC) we test the hypothesis for the presence of a microgravity-induced sarcolemma-cytosolic protein shift of nitric oxide synthase (NOS) and partial loss in neuromuscular synapse scaffold protein (Homer) immunoexpression known to be prone to disuse in mice or humans (hind limb unloading, bed rest) as previously shown (Sandonà D et al., PLoS One, 2012, Salanova M et al., FASEB J, 2011). National Sponsors: Federal Ministry of Economics and Technology (BMWi) via the German AeroSpace Board, DLR e.V., Bonn-Oberkassel, Germany (#50WB1121); Contract RAS-IMBP/Charité Berlin # Bion-M1/2013

  9. Isoform Composition and Gene Expression of Thick and Thin Filament Proteins in Striated Muscles of Mice after 30-Day Space Flight

    PubMed Central

    Ulanova, Anna; Gritsyna, Yulia; Vikhlyantsev, Ivan; Salmov, Nikolay; Bobylev, Alexander; Abdusalamova, Zarema; Rogachevsky, Vadim; Shenkman, Boris; Podlubnaya, Zoya

    2015-01-01

    Changes in isoform composition, gene expression of titin and nebulin, and isoform composition of myosin heavy chains as well as changes in titin phosphorylation level in skeletal (m. gastrocnemius, m. tibialis anterior, and m. psoas) and cardiac muscles of mice were studied after a 30-day-long space flight onboard the Russian spacecraft “BION-M” number 1. A muscle fibre-type shift from slow-to-fast and a decrease in the content of titin and nebulin in the skeletal muscles of animals from “Flight” group was found. Using Pro-Q Diamond staining, an ~3-fold increase in the phosphorylation level of titin in m. gastrocnemius of mice from the “Flight” group was detected. The content of titin and its phosphorylation level in the cardiac muscle of mice from “Flight” and “Control” groups did not differ; nevertheless an increase (2.2 times) in titin gene expression in the myocardium of flight animals was found. The observed changes are discussed in the context of their role in the contractile activity of striated muscles of mice under conditions of weightlessness. PMID:25664316

  10. Nutritional Status and Physical and Mental Performance of Special Operations Soldiers Consuming the Ration, Lightweight, or the Meal, Ready-to-Eat Military Field Ration during a 30-Day Field Training Exercise

    DTIC Science & Technology

    1987-03-23

    reverse if necessary and identify by block number) A 2000 kcal lightweight ration (RLW-30) was tested as the sole source of food for 30 continuous days...after the 30-day FTX. Food and water intakes were recorded daily and nutritional and hydration status were evaluated. Medical examinations were...sole source of food for 30 days, can be expected to cause some uncomfortable physical symptoms and a small to moderate decrement in physical

  11. External validation of the Revised Cardiac Risk Index and update of its renal variable to predict 30-day risk of major cardiac complications after non-cardiac surgery: rationale and plan for analyses of the VISION study

    PubMed Central

    Walsh, Michael; Devereaux, P J; MacNeil, S Danielle; Lam, Ngan N; Hildebrand, Ainslie M; Acedillo, Rey R; Mrkobrada, Marko; Chow, Clara K; Lee, Vincent W; Thabane, Lehana; Garg, Amit X

    2017-01-01

    Introduction The Revised Cardiac Risk Index (RCRI) is a popular classification system to estimate patients' risk of postoperative cardiac complications based on preoperative risk factors. Renal impairment, defined as serum creatinine >2.0 mg/dL (177 µmol/L), is a component of the RCRI. The estimated glomerular filtration rate has become accepted as a more accurate indicator of renal function. We will externally validate the RCRI in a modern cohort of patients undergoing non-cardiac surgery and update its renal component. Methods and analysis The Vascular Events in Non-cardiac Surgery Patients Cohort Evaluation (VISION) study is an international prospective cohort study. In this prespecified secondary analysis of VISION, we will test the risk estimation performance of the RCRI in ∼34 000 participants who underwent elective non-cardiac surgery between 2007 and 2013 from 29 hospitals in 15 countries. Using data from the first 20 000 eligible participants (the derivation set), we will derive an optimal threshold for dichotomising preoperative renal function quantified using the Chronic Kidney Disease Epidemiology Collaboration (CKD-Epi) glomerular filtration rate estimating equation in a manner that preserves the original structure of the RCRI. We will also develop a continuous risk estimating equation integrating age and CKD-Epi with existing RCRI risk factors. In the remaining (approximately) 14 000 participants, we will compare the risk estimation for cardiac complications of the original RCRI to this modified version. Cardiac complications will include 30-day non-fatal myocardial infarction, non-fatal cardiac arrest and death due to cardiac causes. We have examined an early sample to estimate the number of events and the distribution of predictors and missing data, but have not seen the validation data at the time of writing. Ethics and dissemination The research ethics board at each site approved the VISION protocol prior to recruitment. We will

  12. Efficient stripping of photoresist on metallized wafers by a pause flow of supercritical fluid.

    PubMed

    Chao, Mu-Rong; Chen, Jian-Lian

    2009-09-30

    Utilization of supercritical fluids (SCFs) is studied here on the premises of a saving of hazardous organic solvents and of the specification for stripping the photoresist (PR) on metallization layers, which is one of the integrated circuit processing modules. By using factorial experimental designs with five factors and four level ranges, this research focuses on determining an optimized recipe with high stripping efficiency and to determine the stripping mechanism. In the case of PR on an aluminum layer, the initial use of the pulse flow mode could increase the extraction ratio remarkably when compared to the conventional continuous flow mode. Based on the limitation of a total volume of 30 mL purging SCF-CO(2) for economical considerations, the optimum conditions can be summarized as follows: 120 degrees C, oven temperature; 350 atm, CO(2) pressure; 0.2 mL of ethylacetate spiking to SCF-CO(2); 2.0 min, static equilibrium time; and five cycles of dynamic flow pausing. A recovery of 94.6% (n=3, RSD=6.5%) was obtained, while the diffusion of stripped PR from substrate matrix prevailed over the dissolution of binding PR into the SCF medium. In the case of copper, the optimum parameters in a pause flow mode were 140 degrees C, oven temperature; 500 atm, CO(2) pressure; 0.75 mL, ethylacetate spiking volume; 5.0 min, static time; and six cycles of flow pausing. These extreme parameters still did not produce an SCF environment suitable for diffusion or dissolution mass transfer, and thus a recovery of 76.2% (n=3, RSD=7.5%) was only obtained. Removing PR coated on a Cu layer was harder than that on an Al layer.

  13. Transcriptional regulation: effects of promoter proximal pausing on speed, synchrony and reliability.

    PubMed

    Boettiger, Alistair N; Ralph, Peter L; Evans, Steven N

    2011-05-01

    Recent whole genome polymerase binding assays in the Drosophila embryo have shown that a substantial proportion of uninduced genes have pre-assembled RNA polymerase-II transcription initiation complex (PIC) bound to their promoters. These constitute a subset of promoter proximally paused genes for which mRNA elongation instead of promoter access is regulated. This difference can be described as a rearrangement of the regulatory topology to control the downstream transcriptional process of elongation rather than the upstream transcriptional initiation event. It has been shown experimentally that genes with the former mode of regulation tend to induce faster and more synchronously, and that promoter-proximal pausing is observed mainly in metazoans, in accord with a posited impact on synchrony. However, it has not been shown whether or not it is the change in the regulated step per se that is causal. We investigate this question by proposing and analyzing a continuous-time Markov chain model of PIC assembly regulated at one of two steps: initial polymerase association with DNA, or release from a paused, transcribing state. Our analysis demonstrates that, over a wide range of physical parameters, increased speed and synchrony are functional consequences of elongation control. Further, we make new predictions about the effect of elongation regulation on the consistent control of total transcript number between cells. We also identify which elements in the transcription induction pathway are most sensitive to molecular noise and thus possibly the most evolutionarily constrained. Our methods produce symbolic expressions for quantities of interest with reasonable computational effort and they can be used to explore the interplay between interaction topology and molecular noise in a broader class of biochemical networks. We provide general-purpose code implementing these methods.

  14. A Job Pause Service under LAM/MPI+BLCR for Transparent Fault Tolerance

    SciTech Connect

    Wang, Chao; Mueller, Frank; Engelmann, Christian; Scott, Steven L

    2007-01-01

    Checkpoint/restart (C/R) has become a requirement for long-running jobs in large-scale clusters due to a meantime- to-failure (MTTF) in the order of hours. After a failure, C/R mechanisms generally require a complete restart of an MPI job from the last checkpoint. A complete restart, however, is unnecessary since all but one node are typically still alive. Furthermore, a restart may result in lengthy job requeuing even though the original job had not exceeded its time quantum. In this paper, we overcome these shortcomings. Instead of job restart, we have developed a transparent mechanism for job pause within LAM/MPI+BLCR. This mechanism allows live nodes to remain active and roll back to the last checkpoint while failed nodes are dynamically replaced by spares before resuming from the last checkpoint. Our methodology includes LAM/MPI enhancements in support of scalable group communicationwith fluctuating number of nodes, reuse of network connections, transparent coordinated checkpoint scheduling and a BLCR enhancement for job pause. Experiments in a cluster with the NAS Parallel Benchmark suite show that our overhead for job pause is comparable to that of a complete job restart. A minimal overhead of 5.6% is only incurred in case migration takes place while the regular checkpoint overhead remains unchanged. Yet, our approach alleviates the need to reboot the LAM run-time environment, which accounts for considerable overhead resulting in net savings of our scheme in the experiments. Our solution further provides full transparency and automation with the additional benefit of reusing existing resources. Executing continues after failures within the scheduled job, i.e., the application staging overhead is not incurred again in contrast to a restart. Our scheme offers additional potential for savings through incremental checkpointing and proactive diskless live migration, which we are currently working on.

  15. Transcriptional pausing and stalling causes multiple clustered mutations by human activation-induced deaminase

    PubMed Central

    Canugovi, Chandrika; Samaranayake, Mala; Bhagwat, Ashok S.

    2009-01-01

    Transcription of the rearranged immunoglobulin gene and expression of the enzyme activation-induced deaminase (AID) are essential for somatic hypermutations of this gene during antibody maturation. While AID acts as a single-strand DNA-cytosine deaminase creating U · G mispairs that lead to mutations, the role played by transcription in this process is less clear. We have used in vitro transcription of the kan gene by the T7 RNA polymerase (RNAP) in the presence of AID and a genetic reversion assay for kanamycin-resistance to investigate the causes of multiple clustered mutations (MCMs) during somatic hypermutations. We find that, depending on transcription conditions, AID can cause single-base substitutions or MCMs. When wild-type RNAP is used for transcription at physiologically relevant concentrations of ribonucleoside triphosphates (NTPs), few MCMs are found. In contrast, slowing the rate of elongation by reducing the NTP concentration or using a mutant RNAP increases several-fold the percent of revertants containing MCMs. Arresting the elongation complexes by a quick removal of NTPs leads to formation of RNA-DNA hybrids (R-loops). Treatment of these structures with AID results in a high percentage of KanR revertants with MCMs. Furthermore, selecting for transcription elongation complexes stalled near the codon that suffers mutations during acquisition of kanamycin-resistance results in an overwhelming majority of revertants with MCMs. These results show that if RNAP II pauses or stalls during transcription of immunoglobulin gene, AID is likely to promote MCMs. As changes in physiological conditions such as occurrence of certain DNA primary or secondary structures or DNA adducts are known to cause transcriptional pausing and stalling in mammalian cells, this process may cause MCMs during somatic hypermutation.—Canugovi, C., Samaranayake, M., Bhagwat, A. S. Transcriptional pausing and stalling causes multiple clustered mutations by human activation

  16. Kinetic order-disorder transitions in a pause-and-go swarming model with memory.

    PubMed

    Rimer, Oren; Ariel, Gil

    2017-02-09

    A two dimensional model of self-propelled particles combining both a pause-and-go movement pattern and memory is studied in simulations. It is shown, that in contrast to previously studied agent based models in two-dimensions, order and disorder are metastable states that can co-exist at some parameter range. In particular, this implies that the formation and decay of global order in swarms may be kinetic rather than a phase transition. Our results explain metastability recently observed in swarming locust and fish.

  17. Influence of secondary structure on recovery from pauses during early stages of RNA transcription.

    PubMed

    Klopper, A V; Bois, J S; Grill, S W

    2010-03-01

    The initial stages of transcription by RNA polymerase are frequently marked by pausing and stalling events. These events have been linked to an inactive backtracked state in which the polymerase diffuses along the template DNA. We investigate theoretically the influence of RNA secondary structure in confining this diffusion. The effective confinement length peaks at transcript lengths commensurate with early stalling. This finite-size effect accounts for slow progress at the beginning of transcription, which we illustrate via stochastic hopping models for backtracking polymerases.

  18. Influence of secondary structure on recovery from pauses during early stages of RNA transcription

    NASA Astrophysics Data System (ADS)

    Klopper, A. V.; Bois, J. S.; Grill, S. W.

    2010-03-01

    The initial stages of transcription by RNA polymerase are frequently marked by pausing and stalling events. These events have been linked to an inactive backtracked state in which the polymerase diffuses along the template DNA. We investigate theoretically the influence of RNA secondary structure in confining this diffusion. The effective confinement length peaks at transcript lengths commensurate with early stalling. This finite-size effect accounts for slow progress at the beginning of transcription, which we illustrate via stochastic hopping models for backtracking polymerases.

  19. Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

    PubMed Central

    Brennan, V E; Bobek, L A; Bruenn, J A

    1981-01-01

    ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH. Images PMID:7031603

  20. Uptake of a Consumer-Focused mHealth Application for the Assessment and Prevention of Heart Disease: The <30 Days Study

    PubMed Central

    Morita, Plinio P; Picton, Peter; Seto, Emily; Zbib, Ahmad; Cafazzo, Joseph A

    2016-01-01

    Background Lifestyle behavior modification can reduce the risk of cardiovascular disease, one of the leading causes of death worldwide, by up to 80%. We hypothesized that a dynamic risk assessment and behavior change tool delivered as a mobile app, hosted by a reputable nonprofit organization, would promote uptake among community members. We also predicted that the uptake would be influenced by incentives offered for downloading the mobile app. Objective The primary objective of our study was to evaluate the engagement levels of participants using the novel risk management app. The secondary aim was to assess the effect of incentives on the overall uptake and usage behaviors. Methods We publicly launched the app through the iTunes App Store and collected usage data over 5 months. Aggregate information included population-level data on download rates, use, risk factors, and user demographics. We used descriptive statistics to identify usage patterns, t tests, and analysis of variance to compare group means. Correlation and regression analyses determined the relationship between usage and demographic variables. Results We captured detailed mobile usage data from 69,952 users over a 5-month period, of whom 23,727 (33.92%) were registered during a 1-month AIR MILES promotion. Of those who completed the risk assessment, 73.92% (42,380/57,330) were female, and 59.38% (34,042/57,330) were <30 years old. While the older demographic had significantly lower uptake than the younger demographic, with only 8.97% of users aged ≥51 years old downloading the app, the older demographic completed more challenges than their younger counterparts (F 8, 52,422 = 55.10, P<.001). In terms of engagement levels, 84.94% (44,537/52,431) of users completed 1–14 challenges over a 30-day period, and 10.03% (5,259/52,431) of users completed >22 challenges. On average, users in the incentives group completed slightly more challenges during the first 30 days of the intervention (mean 7.9, SD 0

  1. Early processing variations in selective attention to the color and direction of moving stimuli during 30 days head-down bed rest

    NASA Astrophysics Data System (ADS)

    Wang, Lin-Jie; He, Si-Yang; Niu, Dong-Bin; Guo, Jian-Ping; Xu, Yun-Long; Wang, De-Sheng; Cao, Yi; Zhao, Qi; Tan, Cheng; Li, Zhi-Li; Tang, Guo-Hua; Li, Yin-Hui; Bai, Yan-Qiang

    2013-11-01

    Dynamic variations in early selective attention to the color and direction of moving stimuli were explored during a 30 days period of head-down bed rest. Event-related potentials (ERPs) were recorded at F5, F6, P5, P6 scalp locations in seven male subjects who attended to pairs of bicolored light emitting diodes that flashed sequentially to produce a perception of movement. Subjects were required to attend selectively to a critical feature of the moving target, e.g., color or direction. The tasks included: a no response task, a color selective response task, a moving direction selective response task, and a combined color-direction selective response task. Subjects were asked to perform these four tasks on: the 3rd day before bed rest; the 3rd, 15th and 30th day during the bed rest; and the 5th day after bed rest. Subjects responded quickly to the color than moving direction and combined color-direction response. And they had a longer reaction time during bed rest on the 15th and 30th day during bed rest after a relatively quicker response on the 3rd day. Using brain event-related potentials technique, we found that in the color selective response task, the mean amplitudes of P1 and N1 for target ERPs decreased in the 3rd day during bed rest and 5th day after bed rest in comparison with pre-bed rest, 15th day and 30th day during bed rest. In the combined color-direction selective response task, the P1 latencies for target ERPs on the 3rd and 30th day during bed rest were longer than on the 15th day during bed rest. As 3rd day during bed rest was in the acute adaptation period and 30th day during bed rest was in the relatively adaptation stage of head-down bed rest, the results help to clarify the effects of bed rest on different task loads and patterns of attention. It was suggested that subjects expended more time to give correct decision in the head-down tilt bed rest state. A difficulty in the recruitment of brain resources was found in feature selection task

  2. Structure of cortical cytoskeleton in fibers of mouse muscle cells after being exposed to a 30-day space flight on board the BION-M1 biosatellite.

    PubMed

    Ogneva, I V; Maximova, M V; Larina, I M

    2014-05-15

    The aim of the work was to analyze changes in the organization of the cortical cytoskeleton in fibers of the mouse soleus muscle, tibialis anterior muscle and left ventricular cardiomyocytes after completion of a 30-day space flight on board the BION-M1 biosatellite (Russia, 2013). The transversal stiffness of the cortical cytoskeleton of the cardiomyocytes and fibers of the skeletal muscles did not differ significantly within the study groups compared with the vivarium control group. The content of beta- and gamma-actin in the membranous fraction of proteins in the left ventricular cardiomyocytes did not differ significantly within all study groups and correlated with the transversal stiffness. A similar situation was revealed in fibers of the soleus muscle and tibialis anterior muscle. At the same time, the content of beta-actin in the cytoplasmic fraction of proteins was found to be decreased in all types of studied tissues compared with the control levels in the postflight group, with lowered beta-actin gene expression rates in the postflight group. After completion of the space flight, the content of alpha-actinin-4 was found to be reduced in the membranous fraction of proteins from the mouse cardiomyocytes, while its content in the cytoplasmic fraction of proteins did not change significantly. Furthermore, gene expression rates of this protein were decreased at the time of dissection (it was started after 13 h after landing). At the same time, the content of alpha-actinin-1 decreased in the membranous fraction and increased in the cytoplasmic fraction of proteins from the soleus muscle fibers.

  3. The Risk of Acute Kidney Injury and Its Impact on 30-Day and Long-Term Mortality after Transcatheter Aortic Valve Implantation

    PubMed Central

    Gebauer, Katrin; Diller, Gerhard-Paul; Kaleschke, Gerrit; Kerckhoff, Gregor; Malyar, Nasser; Meyborg, Matthias; Reinecke, Holger; Baumgartner, Helmut

    2012-01-01

    Background. Transcatheter aortic valve implantation (TAVI) is widely used in high risk patients (pts) with aortic stenosis. Underlying chronic kidney disease implicates a high risk of postprocedural acute kidney injury (AKI). We analyzed its occurrence, impact on hospital stay, and mortality. Methods. 150 consecutive pts underwent TAVI in our institution (mean age 81 ± 7 years; logistic EuroSCORE 24 ± 15%). AKI definition was a creatinine rise of 26.5 μmol/L or more within 48 hours postprocedural. Ten patients on chronic hemodialysis were excluded. Results. AKI occurred in 28 pts (20%). Baseline creatinine was higher in AKI pts (126.4 ± 59.2 μmol/L versus 108.7 ± 45.1 μmol/L, P = 0.09). Contrast media use was distributed evenly. Both, 30-day mortality (29% versus 7%, P < 0.0001) and long-term mortality (43% versus 18%, P < 0.0001) were higher; hospital stay was longer in AKI pts (20 ± 12 versus 15 ± 10 days, P = 0.03). Predicted renal failure calculated STS Score was similar (8.0 ± 5.0% [AKI] versus 7.1 ± 4.0% [non-AKI], P = 0.32) and estimated lower renal failure rates than observed. Conclusion. AKI remains a frequent complication with increased mortality in TAVI pts. Careful identification of risk factors and development of more suitable risk scores are essential. PMID:23365748

  4. Coat and claws as new matrices for noninvasive long-term cortisol assessment in dogs from birth up to 30 days of age.

    PubMed

    Veronesi, M C; Comin, A; Meloni, T; Faustini, M; Rota, A; Prandi, A

    2015-09-15

    The last stage of fetal development and the neonatal period represent the most critical phases for the mammals' offspring. In the dog, the knowledge about the final intrauterine fetal development and biology, as well as about the neonatal physiology, remains scarce. Hormonal changes occurring in the last intrauterine fetal phase and during the early neonatal age are still not completely clear, probably because of the invasiveness related to the collection of the more common biological matrix, represented by circulating blood. Toward term of pregnancy, during parturition, and after birth, the hypothalamic-pituitary-adrenal axis is a key system regulating several physiological processes, and its activity was previously investigated by blood analysis, considered an invasive procedure providing a single-point measurement. In respect to animal welfare, and for a more correct long-term retrospective investigation, noninvasive hormonal studies were performed firstly on the hair of humans and coat of animals and, more recently, in the nails of human beings. This study was aimed to assess cortisol (COR) in coat and claws of newborn puppies and to evaluate the possible influence of the newborn gender, breed body size, and age on coat and claws COR concentrations. The results obtained from 165 newborn puppies evidenced that coat and claws COR levels were highly correlated each other (P < 0.0001), although the COR accumulation in the two matrices was different in relation to the class of age. Moreover, the puppies age influenced both coat and claws COR concentrations (P < 0.05), with premature puppies showing higher values when compared to term born-dead puppies or puppies dead between 1 and 30 days of age. The present study reported that COR is quantifiable in coat and claws of newborn dogs. Moreover, both matrices appear as useful tools for new, noninvasive, long-term perinatal and neonatal researches also in canine species.

  5. Editorial Commentary: Big Data Suggest That Because of a Significant Increased Risk of Postoperative Infection, Steroid Injection Is Not Recommended After Ankle Arthroscopy.

    PubMed

    Brand, Jefferson C

    2016-02-01

    A recent study addressing infection rate after intra-articular steroid injection during ankle arthroscopy gives pause to this practice, with an odds ratio of 2.2 in the entire population that was injected with a steroid simultaneously with ankle arthroscopy compared with patients who did not receive an ankle injection. Big data, used in the study upon which the Editor comments here, suggest that because of a significant increased risk of postoperative infection, steroid injection is not recommended after ankle arthroscopy.

  6. Postoperative intravenous morphine titration.

    PubMed

    Aubrun, F; Mazoit, J-X; Riou, B

    2012-02-01

    Relief of acute pain during the immediate postoperative period is an important task for anaesthetists. Morphine is widely used to control moderate-to-severe postoperative pain and the use of small i.v. boluses of morphine in the post-anaesthesia care unit allows a rapid titration of the dose needed for adequate pain relief. The essential principle of a titration regimen must be to adapt the morphine dose to the pain level. Although morphine would not appear to be the most appropriate choice for achieving rapid pain relief, this is the sole opioid assessed in many studies of immediate postoperative pain management using titration. More than 90% of the patients have pain relief using a protocol of morphine titration and the mean dose required to obtain pain relief is 12 (7) mg, after a median of four boluses. Sedation is frequent during i.v. morphine titration and should be considered as a morphine-related adverse event and not evidence of pain relief. The incidence of ventilatory depression is very low when the criteria to limit the dose of i.v. morphine are enforced. Morphine titration can be used with caution in elderly patients, in children, or in obese patients. In practice, i.v. morphine titration allows the physician to meet the needs of individual patients rapidly and limits the risk of overdose making this method the first step in postoperative pain management.

  7. Recent pause in the growth rate of atmospheric CO2 due to enhanced terrestrial carbon uptake

    PubMed Central

    Keenan, Trevor F; Prentice, I. Colin; Canadell, Josep G; Williams, Christopher A; Wang, Han; Raupach, Michael; Collatz, G. James

    2016-01-01

    Terrestrial ecosystems play a significant role in the global carbon cycle and offset a large fraction of anthropogenic CO2 emissions. The terrestrial carbon sink is increasing, yet the mechanisms responsible for its enhancement, and implications for the growth rate of atmospheric CO2, remain unclear. Here using global carbon budget estimates, ground, atmospheric and satellite observations, and multiple global vegetation models, we report a recent pause in the growth rate of atmospheric CO2, and a decline in the fraction of anthropogenic emissions that remain in the atmosphere, despite increasing anthropogenic emissions. We attribute the observed decline to increases in the terrestrial sink during the past decade, associated with the effects of rising atmospheric CO2 on vegetation and the slowdown in the rate of warming on global respiration. The pause in the atmospheric CO2 growth rate provides further evidence of the roles of CO2 fertilization and warming-induced respiration, and highlights the need to protect both existing carbon stocks and regions, where the sink is growing rapidly. PMID:27824333

  8. Recent pause in the growth rate of atmospheric CO2 due to enhanced terrestrial carbon uptake.

    PubMed

    Keenan, Trevor F; Prentice, I Colin; Canadell, Josep G; Williams, Christopher A; Wang, Han; Raupach, Michael; Collatz, G James

    2016-11-08

    Terrestrial ecosystems play a significant role in the global carbon cycle and offset a large fraction of anthropogenic CO2 emissions. The terrestrial carbon sink is increasing, yet the mechanisms responsible for its enhancement, and implications for the growth rate of atmospheric CO2, remain unclear. Here using global carbon budget estimates, ground, atmospheric and satellite observations, and multiple global vegetation models, we report a recent pause in the growth rate of atmospheric CO2, and a decline in the fraction of anthropogenic emissions that remain in the atmosphere, despite increasing anthropogenic emissions. We attribute the observed decline to increases in the terrestrial sink during the past decade, associated with the effects of rising atmospheric CO2 on vegetation and the slowdown in the rate of warming on global respiration. The pause in the atmospheric CO2 growth rate provides further evidence of the roles of CO2 fertilization and warming-induced respiration, and highlights the need to protect both existing carbon stocks and regions, where the sink is growing rapidly.

  9. A Pause-then-Cancel model of stopping: evidence from basal ganglia neurophysiology.

    PubMed

    Schmidt, Robert; Berke, Joshua D

    2017-04-19

    Many studies have implicated the basal ganglia in the suppression of action impulses ('stopping'). Here, we discuss recent neurophysiological evidence that distinct hypothesized processes involved in action preparation and cancellation can be mapped onto distinct basal ganglia cell types and pathways. We examine how movement-related activity in the striatum is related to a 'Go' process and how going may be modulated by brief epochs of beta oscillations. We then describe how, rather than a unitary 'Stop' process, there appear to be separate, complementary 'Pause' and 'Cancel' mechanisms. We discuss the implications of these stopping subprocesses for the interpretation of the stop-signal reaction time-in particular, some activity that seems too slow to causally contribute to stopping when assuming a single Stop processes may actually be fast enough under a Pause-then-Cancel model. Finally, we suggest that combining complementary neural mechanisms that emphasize speed or accuracy respectively may serve more generally to optimize speed-accuracy trade-offs.This article is part of the themed issue 'Movement suppression: brain mechanisms for stopping and stillness'.

  10. Coordination of RNA Polymerase II Pausing and 3′ End Processing Factor Recruitment with Alternative Polyadenylation

    PubMed Central

    Fusby, Becky; Kim, Soojin; Erickson, Benjamin; Kim, Hyunmin; Peterson, Martha L.

    2015-01-01

    Most mammalian genes produce transcripts whose 3′ ends are processed at multiple alternative positions by cleavage/polyadenylation (CPA). Poly(A) site cleavage frequently occurs cotranscriptionally and is facilitated by CPA factor binding to the RNA polymerase II (Pol II) C-terminal domain (CTD) phosphorylated on Ser2 residues of its heptad repeats (YS2PTSPS). The function of cotranscriptional events in the selection of alternative poly(A) sites is poorly understood. We investigated Pol II pausing, CTD Ser2 phosphorylation, and processing factor CstF recruitment at wild-type and mutant IgM transgenes that use alternative poly(A) sites to produce mRNAs encoding the secreted and membrane-bound forms of the immunoglobulin (Ig) heavy chain. The results show that the sites of Pol II pausing and processing factor recruitment change depending on which poly(A) site is utilized. In contrast, the extent of Pol II CTD Ser2 phosphorylation does not closely correlate with poly(A) site selection. We conclude that changes in properties of the transcription elongation complex closely correlate with utilization of different poly(A) sites, suggesting that cotranscriptional events may influence the decision between alternative modes of pre-mRNA 3′ end processing. PMID:26527620

  11. Recent pause in the growth rate of atmospheric CO2 due to enhanced terrestrial carbon uptake

    NASA Astrophysics Data System (ADS)

    Keenan, Trevor F.; Prentice, I. Colin; Canadell, Josep G.; Williams, Christopher A.; Wang, Han; Raupach, Michael; Collatz, G. James

    2016-11-01

    Terrestrial ecosystems play a significant role in the global carbon cycle and offset a large fraction of anthropogenic CO2 emissions. The terrestrial carbon sink is increasing, yet the mechanisms responsible for its enhancement, and implications for the growth rate of atmospheric CO2, remain unclear. Here using global carbon budget estimates, ground, atmospheric and satellite observations, and multiple global vegetation models, we report a recent pause in the growth rate of atmospheric CO2, and a decline in the fraction of anthropogenic emissions that remain in the atmosphere, despite increasing anthropogenic emissions. We attribute the observed decline to increases in the terrestrial sink during the past decade, associated with the effects of rising atmospheric CO2 on vegetation and the slowdown in the rate of warming on global respiration. The pause in the atmospheric CO2 growth rate provides further evidence of the roles of CO2 fertilization and warming-induced respiration, and highlights the need to protect both existing carbon stocks and regions, where the sink is growing rapidly.

  12. Postoperative incentive spirometry use.

    PubMed

    Hassanzadeh, Hamid; Jain, Amit; Tan, Eric W; Stein, Benjamin E; Van Hoy, Megan L; Stewart, Nadine N; Lemma, Mesfin A

    2012-06-01

    The authors hypothesized that the use of incentive spirometry by orthopedic patients is less than the recommended level and is affected by patient-related factors and type of surgery. To determine its postoperative use, the authors prospectively surveyed all patients in their institution's general orthopedic ward who had undergone elective spine surgery or total knee or hip arthroplasty during a consecutive 3-month period in 2010, excluding patients with postoperative delirium or requiring a monitored bed. All 182 patients (74 men, 108 women; average age, 64.5 years; range, 32-88 years; spine group, n=55; arthroplasty group, n=127), per protocol, received preoperative spirometry education by a licensed respiratory therapist (recommended use, 10 times hourly) and reinforcement education by nurses. Patients were asked twice daily (morning and evening) regarding their spirometry use during the previous 1-hour period by a registered nurse on postoperative days 1 through 3. All data were collected by the same 2 nurses using the same standardized questionnaire. Spirometry use was correlated with surgery type, postoperative day/time, and patient's age and sex. Student's t test, Spearman test, and one-way analysis of variance were used to compare differences (P<.05). Spirometry use averaged 4.1 times per hour (range, 0-10 times). No statistical correlations were found between spirometry use and age. Sex did not influence spirometry use. The arthroplasty group reported significantly higher use than did the spine group: 4.3 and 3.5 times per hour, respectively. Mean use increased significantly between postoperative days 1, 2, and 3.

  13. Characteristics and Preliminary Observations of the Influence of Electromyostimulation on the Size and Function of Human Skeletal Muscle During 30 Days of Simulated Microgravity

    NASA Technical Reports Server (NTRS)

    Duvoisin, Marc R.; Convertino, Victor A; Buchanan, Paul; Gollinick, Philip D.; Dudley, Gary A.

    1989-01-01

    During 30 days (d) of bedrest, the practicality of using Elec- troMyoStimulation (EMS) as a deterrent to atrophy and strength loss of lower limb musculature was examined. An EMS system was developed that provided variable but quantifiable levels of EMS, and measured torque. The dominant log of three male subjects was stimulated twice daily in a 3-d on/1-d off cycle during bedrest. The non-dominant leg of each subject acted as a control. A stimulator, using a 0.3 ms monophasic 60 Hz pulse waveform, activated muscle tissue for 4 s. The output waveform from the stimulator was sequenced to the Knee Extensors (KE), Knee Flex- ors (KF), Ankle Extensors (AE), and Ankle Flexors (AF), and caused three isometric contractions of each muscle group per minute. Subject tolerance determined EMS Intensity. Each muscle group received four 5-min bouts of EMS each session with a 10 -min rest between bouts. EMS and torque levels for each muscle action were recorded directly an a computer. Overall average EMS Intensity was 197, 197, 195, and 188 mA for the KE, KF, AF, and AE, respectively. Overall average torque development for these muscle groups was 70, 16, 12, and 27 Nm, respectively. EMS intensity doubled during the study, and average torque increased 2.5 times. Average maximum torque throughout a session reached 54% of maximal voluntary for the KE and 29% for the KF. Reductions in leg volume, muscle compartment size, cross-sectional area of slow and fast-twitch fibers, strength, and aerobic enzyme activities, and increased log compliance were attenuated in the legs which received EMS during bedrest. These results indicate that similar EMS levels induce different torques among different muscle groups and that repeated exposure to EMS increases tolerance and torque development. Longer orien- tation periods, therefore, may enhance its effectiveness. Our preliminary data suggest that the efficacy of EMS as an effective countermeasure for muscle atrophy and strength loss during long

  14. Mechanical properties of non-sarcomeric cytoskeleton of mice cardiomyocytes and skeletal muscle fibers after 30-day spaceflight biosatellite BION-M1

    NASA Astrophysics Data System (ADS)

    Ogneva, Irina; Maximova, Maria; Larina, Irina

    The aim of this study was to determine transversal stiffness of the cortical cytoskeleton and cytoskeletal protein desmin content of the left ventricle cardiomyocytes, soleus and tibialis anterior muscle fibers of the mice after 30-days space flight biosatellite «BION-M1» (Russia, 2013). The dissection was made after 13-16.5 hours after landing. Transversal stiffness was measured in relaxed and calcium activated state by atomic force microscope. Desmin content was estimated by using western-blot, expression level of the gene, coding desmin, - by real time PCR. The transversal stiffness of the cortical cytoskeleton of the cardiomyocytes and fibers of the skeletal muscles (as measured using the atomic force microscopy) did not differ significantly within the study groups in comparison to the vivarium control group, except for its slight increase in tibialis anterior fibers muscle in the post-flight group of animals. The content of beta- and gamma-actin in the membranous fraction of proteins in the left ventricular cardiomyocytes (as detected using the western blot technique) did not differ significantly within all study groups and correlated with the transversal stiffness. Similar situation was revealed in fibers of the soleus muscle and tibialis anterior muscle, as well as correlation with the transversal stiffness of their cortical cytoskeleton was noted. At the same time, the content of beta-actin in the cytoplasmic fraction of proteins was found to be decreased in all types of studied tissues in comparison to the control levels in the post-flight group, as well as lowered beta-actin gene expression rates in the post-flight group of animals (as detected using the RT-PCR technique). After completion of the space flight, content of alpha-actinin-4 was found to be reduced in the membranous fraction of proteins of mouse cardiomyocytes, while its content in the cytoplasmic fraction of proteins did not change significantly. Furthermore, gene expression rates of this

  15. Risk factors for postoperative complications in total thyroidectomy

    PubMed Central

    Caulley, Lisa; Johnson-Obaseki, Stephanie; Luo, Lindy; Javidnia, Hedyeh

    2017-01-01

    Abstract Thyroid cancer incidence is increasing, and with it, an increase in total thyroidectomy. There are limited studies comparing outcomes in total thyroidectomy performed in the inpatient versus outpatient setting. The objective of this study was to perform a comparative analysis of risk factors and outcomes of postoperative morbidity and mortality in total thyroidectomy performed as an inpatient versus outpatient surgery. Retrospective cohort study of data from the 2005 to 2014 multi-institutional, risk-adjusted American College of Surgeons National Surgical Quality Improvement Program (ACS-NSQIP) database. A multivariate regression model with corresponding odds ratios and 95% confidence intervals was used to determine 30-day morbidity and mortality after total thyroidectomies, and also risk factors of postoperative outcomes. From 2005 to 2014, 40,025 total thyroidectomies were performed (48.5% inpatient, 51.5% outpatient). The 30-day complication rate for all total thyroidectomies was 7.74%. Multivariate logistic regression analysis was performed to control for potential confounding variables. Preoperative factors that affected complications rates for inpatient thyroidectomies included: age ≥70, non-Caucasian race, dependent functional status, history of congestive heart failure, smoking history, bleeding disorder, wound infection, and preoperative sepsis (P < 0.05). In addition, preoperative factors affecting complications in thyroidectomy performed as an outpatient surgery included malignant thyroid pathology (P  0.05). We identified a subset of preoperative conditions that affect risk of complications after total thyroidectomy. Recommendations for patient selection for outpatient total thyroidectomies should be modified to account for pre-existing conditions that increase the risk of postoperative morbidity. PMID:28151852

  16. Keratophakia--postoperative astigmatism.

    PubMed

    Swinger, C A; Troutman, R C; Forman, J S

    1987-01-01

    Forty-nine cases of primary keratophakia and 13 cases of secondary keratophakia were analyzed for postoperative astigmatism. For primary cases, the surgically induced astigmatism was 1.55 D, whereas for secondary cases it was 0.19 D (insignificant). There was a tendency for both procedures to induce against-the-rule astigmatism, and both procedures were found capable of producing irregular astigmatism.

  17. Intraoperative transfusion of packed red blood cells in microvascular free tissue transfer patients: assessment of 30-day morbidity using the NSQIP dataset.

    PubMed

    Kim, Bobby D; Ver Halen, Jon P; Mlodinow, Alexei S; Kim, John Y S

    2014-02-01

    Although often a life-saving therapeutic maneuver, there is minimal data available that details the effects of intraoperative packed red blood cell transfusion (IOT) after microvascular free tissue transfer. The National Surgical Quality Improvement Program database was queried to identify all patients who underwent microvascular free tissue transfer between 2006 and 2010. Multivariate logistic regression models were used to determine the association between intraoperative transfusion and outcomes. Upon bivariate and multivariate analyses, IOT was significantly associated with higher rates of overall complications (odds ratio [OR], 2.02; 95% confidence interval [CI], 1.12-3.63), medical complications (OR, 3.35; 95% CI, 1.75-6.42), postoperative transfusion (OR, 6.02; 95% CI, 2.02-17.97), and reoperation (OR, 2.24; 95% CI, 1.24-4.04). IOT was not associated with either surgical complications or free flap loss. IOT significantly increases risk for adverse overall and medical complications. However, IOT was not associated with surgical complications or free flap loss. Transfusion practices in the operating room should be reevaluated to improve overall outcomes.

  18. mRNA-programmed translation pauses in the targeting of E. coli membrane proteins.

    PubMed

    Fluman, Nir; Navon, Sivan; Bibi, Eitan; Pilpel, Yitzhak

    2014-08-18

    In all living organisms, ribosomes translating membrane proteins are targeted to membrane translocons early in translation, by the ubiquitous signal recognition particle (SRP) system. In eukaryotes, the SRP Alu domain arrests translation elongation of membrane proteins until targeting is complete. Curiously, however, the Alu domain is lacking in most eubacteria. In this study, by analyzing genome-wide data on translation rates, we identified a potential compensatory mechanism in E. coli that serves to slow down the translation during membrane protein targeting. The underlying mechanism is likely programmed into the coding sequence, where Shine-Dalgarno-like elements trigger elongation pauses at strategic positions during the early stages of translation. We provide experimental evidence that slow translation during targeting and improves membrane protein production fidelity, as it correlates with better folding of overexpressed membrane proteins. Thus, slow elongation is important for membrane protein targeting in E. coli, which utilizes mechanisms different from the eukaryotic one to control the translation speed.

  19. Syntactic Complexity and L2 Academic Immersion Effects on Readers' Recall and Pausing Strategies for English and Spanish Texts

    ERIC Educational Resources Information Center

    Lazarte, Alejandro A.; Barry, Sue

    2008-01-01

    In Experiment 1, monolingual native Spanish speakers (NSSs) had better kernel recall and longer end-of-clause (EOC) pauses than native English speakers (NESs) when reading texts that varied in syntactic complexity as a function of the number of nonessential clauses added to the kernel text. NSS familiarity with embedded clauses in Spanish seem to…

  20. Interventions for Echolalic Behaviour for Children with Autism: A Review of Verbal Prompts and the Cues Pause Point Procedure.

    ERIC Educational Resources Information Center

    Kavon, Nicole M.; McLaughlin, T. F.

    1995-01-01

    This paper examines behavior interventions for echolalic behavior in children with autism, including verbal prompting (focusing on the echolalic behavior itself) and the cues-pause-point procedure (which employs the child's prerequisite skills to teach correct verbal responses). A review of the literature indicated that both techniques were…

  1. The Pause Model: A Qualitative Method of Self-Directed Continuing Education for Professionals with Social Practices.

    ERIC Educational Resources Information Center

    Liebowitz, Steven E.

    This paper introduces the Pause Model, an innovative means of integrating self-directed learning and continuing professional education. Since the method was developed for professionals such as counselors, educators, and managers who practice in social settings, the paper begins with an explanation of a few of the unique attributes of professional…

  2. Syntactic and Lexical Context of Pauses and Hesitations in the Discourse of Alzheimer Patients and Healthy Elderly Subjects

    ERIC Educational Resources Information Center

    Gayraud, Frederique; Lee, Hye-Ran; Barkat-Defradas, Melissa

    2011-01-01

    Psycholinguistic studies dealing with Alzheimer's disease (AD) commonly consider verbal aspects of language. In this article, we investigated both verbal and non-verbal aspects of speech production in AD. We used pauses and hesitations as markers of planning difficulties and hypothesized that AD patients show different patterns in the process of…

  3. Development of Key-Pecking, Pause, and Ambulation during Extended Exposure to a Fixed-Interval Schedule of Reinforcement

    ERIC Educational Resources Information Center

    Berry, Meredith S.; Kangas, Brian D.; Branch, Marc N.

    2012-01-01

    Six pigeons key-pecked under a fixed-interval (FI) 3-min schedule of food presentation. Each pigeon was studied for 200 daily sessions with 15 intervals per session (3,000 total food presentations). Analyses included the examination of latency to first peck (pause), mean rate of key pecking, and ambulation. Characterizations of stable performance…

  4. Predictors of Postoperative Complications After Trimodality Therapy for Esophageal Cancer

    SciTech Connect

    Wang, Jingya; Wei, Caimiao; Tucker, Susan L.; Myles, Bevan; Palmer, Matthew; Hofstetter, Wayne L.; Swisher, Stephen G.; Ajani, Jaffer A.; Cox, James D.; Komaki, Ritsuko; Liao, Zhongxing; Lin, Steven H.

    2013-08-01

    Purpose: While trimodality therapy for esophageal cancer has improved patient outcomes, surgical complication rates remain high. The goal of this study was to identify modifiable factors associated with postoperative complications after neoadjuvant chemoradiation. Methods and Materials: From 1998 to 2011, 444 patients were treated at our institution with surgical resection after chemoradiation. Postoperative (pulmonary, gastrointestinal [GI], cardiac, wound healing) complications were recorded up to 30 days postoperatively. Kruskal-Wallis tests and χ{sup 2} or Fisher exact tests were used to assess associations between continuous and categorical variables. Multivariate logistic regression tested the association between perioperative complications and patient or treatment factors that were significant on univariate analysis. Results: The most frequent postoperative complications after trimodality therapy were pulmonary (25%) and GI (23%). Lung capacity and the type of radiation modality used were independent predictors of pulmonary and GI complications. After adjusting for confounding factors, pulmonary and GI complications were increased in patients treated with 3-dimensional conformal radiation therapy (3D-CRT) versus intensity modulated radiation therapy (IMRT; odds ratio [OR], 2.018; 95% confidence interval [CI], 1.104-3.688; OR, 1.704; 95% CI, 1.03-2.82, respectively) and for patients treated with 3D-CRT versus proton beam therapy (PBT; OR, 3.154; 95% CI, 1.365-7.289; OR, 1.55; 95% CI, 0.78-3.08, respectively). Mean lung radiation dose (MLD) was strongly associated with pulmonary complications, and the differences in toxicities seen for the radiation modalities could be fully accounted for by the MLD delivered by each of the modalities. Conclusions: The radiation modality used can be a strong mitigating factor of postoperative complications after neoadjuvant chemoradiation.

  5. Postoperative conversion disorder.

    PubMed

    Afolabi, Kola; Ali, Sameer; Gahtan, Vivian; Gorji, Reza; Li, Fenghua; Nussmeier, Nancy A

    2016-05-01

    Conversion disorder is a psychiatric disorder in which psychological stress causes neurologic deficits. A 28-year-old female surgical patient had uneventful general anesthesia and emergence but developed conversion disorder 1 hour postoperatively. She reported difficulty speaking, right-hand numbness and weakness, and right-leg paralysis. Neurologic examination and imaging revealed no neuronal damage, herniation, hemorrhage, or stroke. The patient mentioned failing examinations the day before surgery and discontinuing her prescribed antidepressant medication, leading us to diagnose conversion disorder, with eventual confirmation by neuroimaging and follow-up examinations.

  6. Postoperative fluid management

    PubMed Central

    Kayilioglu, Selami Ilgaz; Dinc, Tolga; Sozen, Isa; Bostanoglu, Akin; Cete, Mukerrem; Coskun, Faruk

    2015-01-01

    Postoperative care units are run by an anesthesiologist or a surgeon, or a team formed of both. Management of postoperative fluid therapy should be done considering both patients’ status and intraoperative events. Types of the fluids, amount of the fluid given and timing of the administration are the main topics that determine the fluid management strategy. The main goal of fluid resuscitation is to provide adequate tissue perfusion without harming the patient. The endothelial glycocalyx dysfunction and fluid shift to extracellular compartment should be considered wisely. Fluid management must be done based on patient’s body fluid status. Patients who are responsive to fluids can benefit from fluid resuscitation, whereas patients who are not fluid responsive are more likely to suffer complications of over-hydration. Therefore, common use of central venous pressure measurement, which is proved to be inefficient to predict fluid responsiveness, should be avoided. Goal directed strategy is the most rational approach to assess the patient and maintain optimum fluid balance. However, accessible and applicable monitoring tools for determining patient’s actual fluid need should be further studied and universalized. The debate around colloids and crystalloids should also be considered with goal directed therapies. Advantages and disadvantages of each solution must be evaluated with the patient’s specific condition. PMID:26261771

  7. [Effect of practical use of preoperative immunonutrition with impact on prevention of postoperative pneumonia after esophagectomy].

    PubMed

    Kano, Masayuki; Nabeya, Yoshihiro; Akutsu, Yasunori; Shuto, Kiyohiko; Uesato, Masaya; Miyazawa, Yukimasa; Matsubara, Hisahiro

    2009-11-01

    To clarify the clinical benefits of administering immune-enhancing diet, Impact,we examined retrospectively the effect of preoperative immunonutrition with Impact on prevention of postoperative pneumonia after esophagectomy. In 47 patients without preoperative radiotherapy, no patient who preoperatively administered Impact>or=2,250 mL failed to develop pneumonia. The patients whose postoperative hospital stay was more than 30 days were administered Impactpostoperative pneumonia and a long hospital stay after surgery.

  8. EARLY POSTOPERATIVE COMPLICATIONS IN ROUX-EN-Y GASTRIC BYPASS

    PubMed Central

    STOLL, Aluisio; ROSIN, Leandro; DIAS, Mariana Fernandes; MARQUIOTTI, Bruna; GUGELMIN, Giovana; STOLL, Gabriela Fanezzi

    2016-01-01

    ABSTRACT Background: Roux-en-Y gastric bypass is one of the most common bariatric surgery and leads to considerable weight loss in the first months. Aim: To quantify the main early postoperative complications in patients submitted to the gastric bypass. Method: Observational retrospective cohort. Data of 1051 patients with class II obesity associated with comorbidities or class III obesity submitted to the gastric bypass with 30 days of follow-up starting from the date of the surgery. Results: The age average was 36 years with a predominance of females (81.1%). The mean preoperative body mass index was 43 kg/m². The major complication was fistula (2.3%), followed by intestinal obstruction (0.5%) and pulmonary embolism (0.5%). Death occurred in 0.6% of the cases. Conclusion: In the period of 30 days after surgery the overall complication rate was 3.8%; reoperation was necessary in 2.6% and death occurred in 0.6%. Fistula was the main complication and the leading cause of hospitalization in intensive care unit, reoperation and death. PMID:27683781

  9. Factors associated with postoperative complications and 1-year mortality after surgery for colorectal cancer in octogenarians and nonagenarians

    PubMed Central

    Kim, Young Wan; Kim, Ik Yong

    2016-01-01

    Purpose To identify the factors affecting 30-day postoperative complications and 1-year mortality after surgery for colorectal cancer in octogenarians and nonagenarians. Methods Between 2005 and 2014, a total of 204 consecutive patients aged ≥80 years who underwent major colorectal surgery were included. Results One hundred patients were male (49%) and 52 patients had American Society of Anesthesiologists (ASA) score ≥3 (25%). Combined surgery was performed in 32 patients (16%). Postoperative complications within 30 days after surgery occurred in 54 patients (26%) and 30-day mortality occurred in five patients (2%). Independent risk factors affecting 30-day postoperative complications were older age (≥90 years, hazard ratio [HR] with 95% confidence interval [CI] =4.95 [1.69−14.47], P=0.004), an ASA score ≥3 (HR with 95% CI =4.19 [1.8−9.74], P=0.001), performance of combined surgery (HR with 95% CI =3.1 [1.13−8.46], P=0.028), lower hemoglobin level (<10 g/dL, HR with 95% CI =7.56 [3.07−18.63], P<0.001), and lower albumin level (<3.4 g/dL, HR with 95% CI =3.72 [1.43−9.69], P=0.007). An ASA score ≥3 (HR with 95% CI =2.72 [1.15−6.46], P=0.023), tumor-node-metastasis (TNM) stage IV (HR with 95% CI =3.47 [1.44−8.39], P=0.006), and occurrence of postoperative complications (HR with 95% CI =4.42 [1.39−14.09], P=0.012) were significant prognostic factors for 1-year mortality. Conclusion Patient-related factors (older age, higher ASA score, presence of anemia, and lower serum albumin) and procedure-related factors (performance of combined surgical procedure) increased postoperative complications. Avoidance of 30-day postoperative complications may decrease 1-year mortality. PMID:27279741

  10. [Postoperative analgesia and dexamethasone].

    PubMed

    Miralles, F S; Cárceles, M D; Micol, J A; Hernández, J; del Pino, A

    1989-01-01

    A randomized, double-blind, prospective study was carried out in 100 patients who had undergone some type of surgical treatment in order to evaluate the degree of pain and relief of pain, the degree of achieved analgesia according to the opinion of the observer and consumption of analgesic agents. The evaluation was carried out on seven occasions during the first 12 hours of the postoperative period. Patients received dexamethasone (4 mg before or after the operation or 8 mg after the operation), 6-methylprednisolone (16 mg at the end of the operation) or nothing (control group). Regardless of type, dose or timing of administration of the drugs, all patients receiving corticosteroids presented less pain, more relief of pain (expressed by themselves or in opinion of the observer) and needed lower doses of analgesics during the studied time.

  11. Imaging of postoperative shoulder instability.

    PubMed

    De Filippo, M; Pesce, A; Barile, A; Borgia, D; Zappia, M; Romano, A; Pogliacomi, F; Verdano, M; Pellegrini, A; Johnson, K

    2017-03-01

    Postoperative imaging in shoulder instability is still a challenge for radiologists due to various postsurgical anatomical findings that could be considered pathologic in treated shoulder. For this reason is very important a deep knowledge about surgical procedures, anatomical changes after surgery and the appropriate diagnostic imaging modalities to work up the symptomatic postoperative shoulder. Postoperative imaging options include use conventional radiography, magnetic resonance imaging (MRI), MRI arthrography, computed tomography (CT) and CT arthrography. The purpose of our review is to explain the different surgical procedures and to describe postoperative changes detected with radiological imaging.

  12. TRICARE: changes included in the National Defense Authorization Act for Fiscal Year 2010; enhancement of transitional dental care for members of the Reserve Component on active duty for more than 30 days in support of a contingency operation. Final rule.

    PubMed

    2011-12-28

    The Department is publishing this final rule to implement section 703 of the National Defense Authorization Act for Fiscal Year 2010 (NDAA for FY10). Specifically, that legislation amends the transitional health care dental benefits for Reserve Component members on active duty for more than 30 days in support of a contingency operation. The legislation entitles these Reserve Component members to dental care in the same manner as a member of the uniformed services on active duty for more than 30 days, thus providing care to the Reserve member in both military dental treatment facilities and authorized private sector dental care. This final rule does not eliminate any medical or dental care that is currently covered as transitional health care for the member.

  13. Relationship between attack and pause in world taekwondo championship contests: effects of gender and weight category

    PubMed Central

    Santos, Victor Gustavo Ferreira; de Oliveira Pires, Flavio; Bertuzzi, Romulo; Frachini, Emerson; da Silva-Cavalcante, Marcos David; Peduti Dal Molin Kiss, Maria Augusta; Lima-Silva, Adriano Eduardo

    2014-01-01

    Summary Background: the aim of this study was to compare between weight and gender categories the attack and pause times during the 2007 Taekwondo World Championship. Methods: a total of 88 rounds (47 male and 41 female contests) were analyzed. Results: there was no difference in attack/balancing times ratio between genders (0.13 ± 0.06 vs 0.13 ± 0.06, P > 0.05). The attack number was significantly higher in round 3 than in round 1 for all categories and genders. The balancing time was lower during the round 3 than round 1 for low-weight male and high-weight female categories. The delta of change from round 1 to 3 (round 3 - round 1) for attack time and attack/balancing times ratio were lower in male than female. Conclusions: female seems to intensify more the combat in the last round than male, and this seems be related to the weight division. PMID:25332922

  14. Control of VEGF-A transcriptional programs by pausing and genomic compartmentalization

    PubMed Central

    Kaikkonen, Minna U.; Niskanen, Henri; Romanoski, Casey E.; Kansanen, Emilia; Kivelä, Annukka M.; Laitalainen, Jarkko; Heinz, Sven; Benner, Christopher; Glass, Christopher K.; Ylä-Herttuala, Seppo

    2014-01-01

    Vascular endothelial growth factor A (VEGF-A) is a master regulator of angiogenesis, vascular development and function. In this study we investigated the transcriptional regulation of VEGF-A-responsive genes in primary human aortic endothelial cells (HAECs) and human umbilical vein endothelial cells (HUVECs) using genome-wide global run-on sequencing (GRO-Seq). We demonstrate that half of VEGF-A-regulated gene promoters are characterized by a transcriptionally competent paused RNA polymerase II (Pol II). We show that transition into productive elongation is a major mechanism of gene activation of virtually all VEGF-regulated genes, whereas only ∼40% of the genes are induced at the level of initiation. In addition, we report a comprehensive chromatin interaction map generated in HUVECs using tethered conformation capture (TCC) and characterize chromatin interactions in relation to transcriptional activity. We demonstrate that sites of active transcription are more likely to engage in chromatin looping and cell type-specific transcriptional activity reflects the boundaries of chromatin interactions. Furthermore, we identify large chromatin compartments with a tendency to be coordinately transcribed upon VEGF-A stimulation. We provide evidence that these compartments are enriched for clusters of regulatory regions such as super-enhancers and for disease-associated single nucleotide polymorphisms (SNPs). Collectively, these findings provide new insights into mechanisms behind VEGF-A-regulated transcriptional programs in endothelial cells. PMID:25352550

  15. Filled pause refinement based on the pronunciation probability for lecture speech.

    PubMed

    Long, Yan-Hua; Ye, Hong

    2015-01-01

    Nowadays, although automatic speech recognition has become quite proficient in recognizing or transcribing well-prepared fluent speech, the transcription of speech that contains many disfluencies remains problematic, such as spontaneous conversational and lecture speech. Filled pauses (FPs) are the most frequently occurring disfluencies in this type of speech. Most recent studies have shown that FPs are widely believed to increase the error rates for state-of-the-art speech transcription, primarily because most FPs are not well annotated or provided in training data transcriptions and because of the similarities in acoustic characteristics between FPs and some common non-content words. To enhance the speech transcription system, we propose a new automatic refinement approach to detect FPs in British English lecture speech transcription. This approach combines the pronunciation probabilities for each word in the dictionary and acoustic language model scores for FP refinement through a modified speech recognition forced-alignment framework. We evaluate the proposed approach on the Reith Lectures speech transcription task, in which only imperfect training transcriptions are available. Successful results are achieved for both the development and evaluation datasets. Acoustic models trained on different styles of speech genres have been investigated with respect to FP refinement. To further validate the effectiveness of the proposed approach, speech transcription performance has also been examined using systems built on training data transcriptions with and without FP refinement.

  16. STS-91 Mission Specialist Chang-Diaz pauses at the pad following TCDT activities

    NASA Technical Reports Server (NTRS)

    1998-01-01

    STS-91 Mission Specialist Franklin Chang-Diaz, Ph.D., pauses on the 217-foot level of Launch Complex 39A after the completion of Terminal Countdown Demonstration Test (TCDT) activities. Behind him, the Space Shuttle Discovery is being prepared for flight. The TCDT is held at KSC prior to each Space Shuttle flight to provide crews with an opportunity to participate in simulated countdown activities. STS-91 is scheduled to be launched on June 2 with a launch window opening around 6:10 p.m. EDT. The mission will feature the ninth Shuttle docking with the Russian Space Station Mir, the first Mir docking for Discovery, the conclusion of Phase I of the joint U.S.-Russian International Space Station Program, and the first flight of the new Space Shuttle super lightweight external tank. The STS-91 flight crew also includes Commander Charles Precourt; Pilot Dominic Gorie; and Mission Specialists Wendy B. Lawrence; Janet Kavandi, Ph.D.; and Valery Ryumin, with the Russian Space Agency. Andrew Thomas, Ph.D., will be returning to Earth with the crew after living more than four months aboard Mir.

  17. Higher frequency of intron loss from the promoter proximally paused genes of Drosophila melanogaster.

    PubMed

    Jiang, Li; Li, Xue-Nan; Niu, Deng-Ke

    2014-01-01

    Although intron losses have been widely reported, it is not clear whether they are neutral and therefore random or driven by positive selection. Intron transcription and splicing are time-consuming and can delay the expression of its host gene. For genes that must be activated quickly to respond to physiological or stress signals, intron delay may be deleterious. Promoter proximally paused (PPP) genes are a group of rapidly expressed genes. To respond quickly to activation signals, they generally initiate transcription competently but stall after synthesizing a short RNA. In this study, performed in Drosophila melanogaster, the PPP genes were found to have a significantly higher rate of intron loss than control genes. However, further analysis did not find more significant shrinkage of intron size in PPP genes. Referring to previous studies on the rates of transcription and splicing and to the time saved by deletion of the introns from mouse gene Hes7, it is here suggested that transcription delay is comparable to splicing delay only when the intron is 28.5 kb or larger, which is greater in size than 95% of vertebrate introns, 99.5% of Drosophila introns, and all the annotated introns of Saccharomyces cerevisiae and Arabidopsis thaliana. Delays in intron splicing are probably a selective force, promoting intron loss from quickly expressed genes. In other genes, it may have been an exaptation during the emergency of developmental clocks.

  18. Variation between Hospitals with Regard to Diagnostic Practice, Coding Accuracy, and Case-Mix. A Retrospective Validation Study of Administrative Data versus Medical Records for Estimating 30-Day Mortality after Hip Fracture

    PubMed Central

    Kristoffersen, Doris Tove; Skyrud, Katrine Damgaard; Lindman, Anja Schou

    2016-01-01

    Background The purpose of this study was to assess the validity of patient administrative data (PAS) for calculating 30-day mortality after hip fracture as a quality indicator, by a retrospective study of medical records. Methods We used PAS data from all Norwegian hospitals (2005–2009), merged with vital status from the National Registry, to calculate 30-day case-mix adjusted mortality for each hospital (n = 51). We used stratified sampling to establish a representative sample of both hospitals and cases. The hospitals were stratified according to high, low and medium mortality of which 4, 3, and 5 hospitals were sampled, respectively. Within hospitals, cases were sampled stratified according to year of admission, age, length of stay, and vital 30-day status (alive/dead). The final study sample included 1043 cases from 11 hospitals. Clinical information was abstracted from the medical records. Diagnostic and clinical information from the medical records and PAS were used to define definite and probable hip fracture. We used logistic regression analysis in order to estimate systematic between-hospital variation in unmeasured confounding. Finally, to study the consequences of unmeasured confounding for identifying mortality outlier hospitals, a sensitivity analysis was performed. Results The estimated overall positive predictive value was 95.9% for definite and 99.7% for definite or probable hip fracture, with no statistically significant differences between hospitals. The standard deviation of the additional, systematic hospital bias in mortality estimates was 0.044 on the logistic scale. The effect of unmeasured confounding on outlier detection was small to moderate, noticeable only for large hospital volumes. Conclusions This study showed that PAS data are adequate for identifying cases of hip fracture, and the effect of unmeasured case mix variation was small. In conclusion, PAS data are adequate for calculating 30-day mortality after hip-fracture as a quality

  19. Distribution and biomarkers of Carbon-14 labeled fullerene C60 ([14C(U)]C60) in female rats and mice for up to 30 days after intravenous exposure

    PubMed Central

    Sumner, Susan C. J.; Snyder, Rodney W.; Wingard, Christopher; Mortensen, Ninell P.; Holland, Nathan A.; Shannahan, Jonathan H.; Dhungana, Suraj; Pathmasiri, Wimal; Han, Li; Lewin, Anita H.; Fennell, Timothy R.

    2016-01-01

    A comprehensive distribution study was conducted in female rats and mice exposed to a suspension of uniformly carbon-14 labeled C60 ([14C(U)]C60). Rodents were administered [14C(U)]C60 (~0.9 mg /kg body weight) or 5% PVP-saline vehicle alone via a single tail vein injection. Tissues were collected at 1 hour, 1, 7, 14 and 30 days after administration. A separate group of rodents received 5 daily injections of suspensions of either [14C(U)]C60 or vehicle with tissue collection 14 days post exposure. Radioactivity was detected in over 20 tissues at all time period. The highest concentration of radioactivity in rodents at each time point was in liver, lungs and spleen. Elimination of [14C(U)]C60 was <2% in urine and feces at any 24 hour time points. [14C(U)]C60 and [14C(U)]C60-retinol were detected in liver of rats and together accounted for ~99% and ~56% of the total recovered at 1 and 30 days post exposure, respectively. The blood radioactivity at 1 hour after [14C(U)]C60 exposure was four-fold higher in rats than in mice; blood radioactivity was still in circulation at 30 days post [14C(U)]C60 exposure in both species (<1%). Levels of oxidative stress markers increased by 5 days after exposure and remained elevated, while levels of inflammation markers initially increased and then returned to control values. The level of cardiovascular marker vWF, increased in rats, but remained at control levels in mice. This study demonstrates that [14C(U)]C60 is retained in female rodents with little elimination by 30 days after i.v. exposure, and leads to systemic oxidative stress. PMID:25727383

  20. Distribution and biomarkers of carbon-14-labeled fullerene C60 ([(14) C(U)]C60 ) in female rats and mice for up to 30 days after intravenous exposure.

    PubMed

    Sumner, Susan C J; Snyder, Rodney W; Wingard, Christopher; Mortensen, Ninell P; Holland, Nathan A; Shannahan, Jonathan H; Dhungana, Suraj; Pathmasiri, Wimal; Han, Li; Lewin, Anita H; Fennell, Timothy R

    2015-12-01

    A comprehensive distribution study was conducted in female rats and mice exposed to a suspension of uniformly carbon-14-labeled C60 ([(14) C(U)]C60 ). Rodents were administered [(14) C(U)]C60 (~0.9 mg kg(-1) body weight) or 5% polyvinylpyrrolidone-saline vehicle alone via a single tail vein injection. Tissues were collected at 1 h and 1, 7, 14 and 30 days after administration. A separate group of rodents received five daily injections of suspensions of either [(14) C(U)]C60 or vehicle with tissue collection 14 days post exposure. Radioactivity was detected in over 20 tissues at all time points. The highest concentration of radioactivity in rodents at each time point was in liver, lungs and spleen. Elimination of [(14) C(U)]C60 was < 2% in urine and feces at any 24 h time points. [(14) C(U)]C60 and [(14) C(U)]C60 -retinol were detected in liver of rats and together accounted for ~99% and ~56% of the total recovered at 1 and 30 days postexposure, respectively. The blood radioactivity at 1 h after [(14) C(U)]C60 exposure was fourfold higher in rats than in mice; blood radioactivity was still in circulation at 30 days post [(14) C(U)]C60 exposure in both species (<1%). Levels of oxidative stress markers increased by 5 days after exposure and remained elevated, while levels of inflammation markers initially increased and then returned to control values. The level of cardiovascular marker von Willebrand factor, increased in rats, but remained at control levels in mice. This study demonstrates that [(14) C(U)]C60 is retained in female rodents with little elimination by 30 days after i.v. exposure, and leads to systemic oxidative stress.

  1. Pausing and activating thread state upon pin assertion by external logic monitoring polling loop exit time condition

    DOEpatents

    Chen, Dong; Giampapa, Mark; Heidelberger, Philip; Ohmacht, Martin; Satterfield, David L; Steinmacher-Burow, Burkhard; Sugavanam, Krishnan

    2013-05-21

    A system and method for enhancing performance of a computer which includes a computer system including a data storage device. The computer system includes a program stored in the data storage device and steps of the program are executed by a processer. The processor processes instructions from the program. A wait state in the processor waits for receiving specified data. A thread in the processor has a pause state wherein the processor waits for specified data. A pin in the processor initiates a return to an active state from the pause state for the thread. A logic circuit is external to the processor, and the logic circuit is configured to detect a specified condition. The pin initiates a return to the active state of the thread when the specified condition is detected using the logic circuit.

  2. Guanosine tetraphosphate as a global regulator of bacterial RNA synthesis: a model involving RNA polymerase pausing and queuing.

    PubMed

    Bremer, H; Ehrenberg, M

    1995-05-17

    A recently reported comparison of stable RNA (rRNA, tRNA) and mRNA synthesis rates in ppGpp-synthesizing and ppGpp-deficient (delta relA delta spoT) bacteria has suggested that ppGpp inhibits transcription initiation from stable RNA promoters, as well as synthesis of (bulk) mRNA. Inhibition of stable RNA synthesis occurs mainly during slow growth of bacteria when cytoplasmic levels of ppGpp are high. In contrast, inhibition of mRNA occurs mainly during fast growth when ppGpp levels are low, and it is associated with a partial inactivation of RNA polymerase. To explain these observations it has been proposed that ppGpp causes transcriptional pausing and queuing during the synthesis of mRNA. Polymerase queuing requires high rates of transcription initiation in addition to polymerase pausing, and therefore high concentrations of free RNA polymerase. These conditions are found in fast growing bacteria. Furthermore, the RNA polymerase queues lead to a promoter blocking when RNA polymerase molecules stack up from the pause site back to the (mRNA) promoter. This occurs most frequently at pause sites close to the promoter. Blocking of mRNA promoters diverts RNA polymerase to stable RNA promoters. In this manner ppGpp could indirectly stimulate synthesis of stable RNA at high growth rates. In the present work a mathematical analysis, based on the theory of queuing, is presented and applied to the global control of transcription in bacteria. This model predicts the in vivo distribution of RNA polymerase over stable RNA and mRNA genes for both ppGpp-synthesizing and ppGpp-deficient bacteria in response to different environmental conditions. It also shows how small changes in basal ppGpp concentrations can produce large changes in the rate of stable RNA synthesis.

  3. Essential Roles of the Smc5/6 Complex in Replication through Natural Pausing Sites and Endogenous DNA Damage Tolerance

    PubMed Central

    Menolfi, Demis; Delamarre, Axel; Lengronne, Armelle; Pasero, Philippe; Branzei, Dana

    2015-01-01

    Summary The essential functions of the conserved Smc5/6 complex remain elusive. To uncover its roles in genome maintenance, we established Saccharomyces cerevisiae cell-cycle-regulated alleles that enable restriction of Smc5/6 components to S or G2/M. Unexpectedly, the essential functions of Smc5/6 segregated fully and selectively to G2/M. Genetic screens that became possible with generated alleles identified processes that crucially rely on Smc5/6 specifically in G2/M: metabolism of DNA recombination structures triggered by endogenous replication stress, and replication through natural pausing sites located in late-replicating regions. In the first process, Smc5/6 modulates remodeling of recombination intermediates, cooperating with dissolution activities. In the second, Smc5/6 prevents chromosome fragility and toxic recombination instigated by prolonged pausing and the fork protection complex, Tof1-Csm3. Our results thus dissect Smc5/6 essential roles and reveal that combined defects in DNA damage tolerance and pausing site-replication cause recombination-mediated DNA lesions, which we propose to drive developmental and cancer-prone disorders. PMID:26698660

  4. Myosin Va Increases the Efficiency of Neurofilament Transport by Decreasing the Duration of Long-Term Pauses

    PubMed Central

    Alami, Nael H.; Jung, Peter; Brown, Anthony

    2009-01-01

    We investigated the axonal transport of neurofilaments in cultured neurons from two different strains of dilute lethal mice, which lack myosin Va. To analyze the motile behavior, we tracked the movement of green fluorescent protein (GFP)-tagged neurofilaments through naturally occurring gaps in the axonal neurofilament array of cultured superior cervical ganglion neurons from DLS/LeJ dilute lethal mice. Compared with wild-type controls, we observed no statistically significant difference in velocity or frequency of movement. To analyze the pausing behavior, we used a fluorescence photoactivation pulse– escape technique to measure the rate of departure of PAGFP (photoactivatable GFP)-tagged neurofilaments from photoactivated axonal segments in cultured dorsal root ganglion neurons from DLS/LeJ and dl20J dilute lethal mice. Compared with wild-type controls, we observed a 48% increase in the mean time for neurofilaments to depart the activated regions in neurons from DLS/LeJ mice ( p<0.001) and a 169% increase in neurons from dl20J mice ( p<0.0001). These data indicate that neurofilaments pause for more prolonged periods in the absence of myosin Va. We hypothesize that myosin Va is a short-range motor for neurofilaments and that it can function to enhance the efficiency of neurofilament transport in axons by delivering neurofilaments to their microtubule tracks, thereby reducing the duration of prolonged off-track pauses. PMID:19458233

  5. Genome-wide dynamics of Pol II elongation and its interplay with promoter proximal pausing, chromatin, and exons

    PubMed Central

    Jonkers, Iris; Kwak, Hojoong; Lis, John T

    2014-01-01

    Production of mRNA depends critically on the rate of RNA polymerase II (Pol II) elongation. To dissect Pol II dynamics in mouse ES cells, we inhibited Pol II transcription at either initiation or promoter-proximal pause escape with Triptolide or Flavopiridol, and tracked Pol II kinetically using GRO-seq. Both inhibitors block transcription of more than 95% of genes, showing that pause escape, like initiation, is a ubiquitous and crucial step within the transcription cycle. Moreover, paused Pol II is relatively stable, as evidenced from half-life measurements at ∼3200 genes. Finally, tracking the progression of Pol II after drug treatment establishes Pol II elongation rates at over 1000 genes. Notably, Pol II accelerates dramatically while transcribing through genes, but slows at exons. Furthermore, intergenic variance in elongation rates is substantial, and is influenced by a positive effect of H3K79me2 and negative effects of exon density and CG content within genes. DOI: http://dx.doi.org/10.7554/eLife.02407.001 PMID:24843027

  6. Post-sigh Breathing Behavior and Spontaneous Pauses in the C57BL/6J (B6) Mouse

    PubMed Central

    Yamauchi, Motoo; Hasan, Ocak; Dostal, Jesse; Jacono, Frank J.; Loparo, Kenneth A.; Strohl, Kingman P.

    2008-01-01

    The purpose was to examine sighs and spontaneous pauses in regard to the stability of resting breathing in the B6 strain, compared to the A/J strain. A 5-HT1A receptor agonist (buspirone) and a chromosomal substitution strain (B6a1) were used to further alter breathing patterning. Ten-minute recordings of room air breathing were collected from unanaesthetized B6, A/J, and B6a1 mice. Despite no differences between strains in the magnitude and incidence of sighs, post-sigh apneas, the variation for duration of expiration (Te) after sighs, and the number of spontaneous pauses were greater in the B6, while Shannon Entropy (nonlinear metrics) for Te after sighs was lower in B6, compared to the other strains. Buspirone and chromosomal substitution eliminated post-sigh apneas and decreased spontaneous pauses. A greater irregularity and the lower complexity of post-sigh breathing in B6 are reversed by elements on A/J Chromosome 1 and by increased 5-HT1A serotonergic tone. PMID:18565803

  7. Impact of Typical Aging and Parkinson’s Disease on the Relationship Among Breath Pausing, Syntax, and Punctuation

    PubMed Central

    Huber, Jessica E.; Darling, Meghan; Francis, Elaine J.; Zhang, Dabao

    2013-01-01

    Purpose The present study examines the impact of typical aging and Parkinson’s disease (PD) on the relationship among breath pausing, syntax, and punctuation. Methods Thirty young adults, 25 typically aging older adults, and 15 individuals with PD participated. Fifteen participants were age- and sex-matched to the individuals with PD. Participants read a passage aloud two times. Utterance length, location of breath pauses relative to punctuation and syntax, and number of disfluencies and mazes were measured. Results Older adults produced shorter utterances, a smaller percentage of breaths at major boundaries, and a greater percentage of breaths at minor boundaries than young adults, but there was no significant difference between older adults and individuals with PD on these measures. Individuals with PD took a greater percentage of breaths at locations unrelated to a syntactic boundary than control participants. Individuals with PD produced more mazes than control participants. Breaths were significantly correlated with punctuation for all groups. Conclusions Changes in breath pausing patterns in older adults are likely due to changes in respiratory physiology. However, in individuals with PD, such changes appear to result from a combination of changes to respiratory physiology and cognition. PMID:22846880

  8. Postoperative complications of spine surgery.

    PubMed

    Swann, Matthew C; Hoes, Kathryn S; Aoun, Salah G; McDonagh, David L

    2016-03-01

    A variety of surgical approaches are available for the treatment of spine diseases. Complications can arise intraoperatively, in the immediate postoperative period, or in a delayed fashion. These complications may lead to severe or even permanent morbidity if left unrecognized and untreated [1-4]. Here we review a range of complications in the early postoperative period from more benign complications such as postoperative nausea and vomiting (PONV) to more feared complications leading to permanent loss of neurological function or death [5]. Perioperative pain management is covered in a separate review (Chapter 8).

  9. [Management of postoperative pancreatic fistula].

    PubMed

    Hackert, T; Büchler, M W

    2015-06-01

    The occurrence of a postoperative pancreatic fistula is one of the most important complications following pancreatic resections. The frequency of this complication varies between 3 % after pancreatic head resection and up to 35 % following distal pancreatectomy. In 2005, the international definition of postoperative pancreatic fistula was standardized according to the approach of the International Study Group of Pancreatic Surgery (ISGPS) including an A-C grading system of the severity. Consequently, results from different studies have become comparable and the historically reported fistula rates can be evaluated more critically. The present review summarises the currently available data on incidence, risk factors, fistula-associated complications and management of postoperative pancreatic fistula.

  10. Imaging of the Postoperative Orbit.

    PubMed

    Learned, Kim O; Nasseri, Farbod; Mohan, Suyash

    2015-08-01

    Imaging evaluation of the postoperative orbit remains challenging even for the expert neuroradiologist. This article provides a simplified framework for understanding the complex postoperative appearances of the orbit, in an attempt to enhance the diagnostic accuracy of postoperative computed tomography and MR imaging of the orbit. Readers are familiarized with the normal appearances of common eye procedures and orbit reconstructions to help avoid interpretative pitfalls. Also reviewed are imaging features of common surgical complications, and evaluation of residual/recurrent neoplasm in the setting of oncologic imaging surveillance.

  11. [Postoperative imaging of the shoulder].

    PubMed

    Wörtler, K; Rummeny, E J

    2004-06-01

    Correct interpretation of imaging findings in the postoperative shoulder is impaired by surgical distortion of normal anatomy and possible artifacts. Advanced postoperative imaging of the shoulder in addition to the selection of the best suited modality necessitates familiarity with the surgical procedure that has been performed and its consecutive morphological changes. This article reviews the most common arthroscopic and open techniques used for treatment of shoulder instability, lesions of the superior labral-bicipital complex, primary impingement, and rotator cuff tears, their typical postoperative imaging findings, as well as the diagnostic performance of cross sectional imaging techniques in the detection of recurrent lesions and complications.

  12. TbRGG2 facilitates kinetoplastid RNA editing initiation and progression past intrinsic pause sites.

    PubMed

    Ammerman, Michelle L; Presnyak, Vladimir; Fisk, John C; Foda, Bardees M; Read, Laurie K

    2010-11-01

    TbRGG2 is an essential kinetoplastid RNA editing accessory factor that acts specifically on pan-edited RNAs. To understand the mechanism of TbRGG2 action, we undertook an in-depth analysis of edited RNA populations in TbRGG2 knockdown cells and an in vitro examination of the biochemical activities of the protein. We demonstrate that TbRGG2 down-regulation more severely impacts editing at the 5' ends of pan-edited RNAs than at their 3' ends. The initiation of editing is reduced to some extent in TbRGG2 knockdown cells. In addition, TbRGG2 plays a post-initiation role as editing becomes stalled in TbRGG2-depleted cells, resulting in an overall decrease in the 3' to 5' progression of editing. Detailed analyses of edited RNAs from wild-type and TbRGG2-depleted cells reveal that TbRGG2 facilitates progression of editing past intrinsic pause sites that often correspond to the 3' ends of cognate guide RNAs (gRNAs). In addition, noncanonically edited junction regions are either absent or significantly shortened in TbRGG2-depleted cells, consistent with impaired gRNA transitions. Sequence analysis further suggests that TbRGG2 facilitates complete utilization of certain gRNAs. In vitro RNA annealing and in vivo RNA unwinding assays demonstrate that TbRGG2 can modulate RNA-RNA interactions. Collectively, these data are consistent with a model in which TbRGG2 facilitates initiation and 3' to 5' progression of editing through its ability to affect gRNA utilization, both during the transition between specific gRNAs and during usage of certain gRNAs.

  13. TbRGG2 facilitates kinetoplastid RNA editing initiation and progression past intrinsic pause sites

    PubMed Central

    Ammerman, Michelle L.; Presnyak, Vladimir; Fisk, John C.; Foda, Bardees M.; Read, Laurie K.

    2010-01-01

    TbRGG2 is an essential kinetoplastid RNA editing accessory factor that acts specifically on pan-edited RNAs. To understand the mechanism of TbRGG2 action, we undertook an in-depth analysis of edited RNA populations in TbRGG2 knockdown cells and an in vitro examination of the biochemical activities of the protein. We demonstrate that TbRGG2 down-regulation more severely impacts editing at the 5′ ends of pan-edited RNAs than at their 3′ ends. The initiation of editing is reduced to some extent in TbRGG2 knockdown cells. In addition, TbRGG2 plays a post-initiation role as editing becomes stalled in TbRGG2-depleted cells, resulting in an overall decrease in the 3′ to 5′ progression of editing. Detailed analyses of edited RNAs from wild-type and TbRGG2-depleted cells reveal that TbRGG2 facilitates progression of editing past intrinsic pause sites that often correspond to the 3′ ends of cognate guide RNAs (gRNAs). In addition, noncanonically edited junction regions are either absent or significantly shortened in TbRGG2-depleted cells, consistent with impaired gRNA transitions. Sequence analysis further suggests that TbRGG2 facilitates complete utilization of certain gRNAs. In vitro RNA annealing and in vivo RNA unwinding assays demonstrate that TbRGG2 can modulate RNA–RNA interactions. Collectively, these data are consistent with a model in which TbRGG2 facilitates initiation and 3′ to 5′ progression of editing through its ability to affect gRNA utilization, both during the transition between specific gRNAs and during usage of certain gRNAs. PMID:20855539

  14. Convergent Validity of Three Methods for Measuring Postoperative Complications

    PubMed Central

    Fritz, Bradley A.; Escallier, Krisztina E.; Abdallah, Arbi Ben; Oberhaus, Jordan; Becker, Jennifer; Geczi, Kristin; McKinnon, Sherry; Helsten, Dan L.; Sharma, Anshuman; Wildes, Troy S.; Avidan, Michael S.

    2016-01-01

    Background Anesthesiologists need tools to accurately track postoperative outcomes. The accuracy of patient report in identifying a wide variety of postoperative complications after diverse surgical procedures has not previously been investigated. Methods In this cohort study, 1,578 adult surgical patients completed a survey at least 30 days after their procedure asking if they had experienced any of 18 complications while in the hospital after surgery. Patient responses were compared to the results of an automated electronic chart review and (for a random subset of 750 patients) to a manual chart review. Results from automated chart review were also compared to those from manual chart review. Forty-two randomly selected patients were contacted by telephone to explore reasons for discrepancies between patient report and manual chart review. Results Comparisons between patient report, automated chart review, and manual chart review demonstrated poor-to-moderate positive agreement (range, 0 to 58%) and excellent negative agreement (range, 82 to 100%). Discordance between patient report and manual chart review was frequently explicable by patients reporting events that happened outside the time period of interest. Conclusions Patient report can provide information about subjective experiences or events that happen after hospital discharge, but often yields different results from chart review for specific in-hospital complications. Effective in-hospital communication with patients and thoughtful survey design may increase the quality of patient-reported complication data. PMID:27028469

  15. Reduction of postoperative adhesion development.

    PubMed

    Diamond, Michael P

    2016-10-01

    Despite use of meticulous surgical techniques, and regardless of surgical access via laparotomy or laparoscopy, postoperative adhesions develop in the vast majority of women undergoing abdominopelvic surgery. Such adhesions represent not only adhesion reformation at sites of adhesiolysis, but also de novo adhesion formation at sites of surgical procedures. Application of antiadhesion adjuvants compliment the benefits of meticulous surgical techniques, providing an opportunity to further reduce postoperative adhesion development. Improved understanding of the pathophysiology of adhesion development and distinguishing variations in the molecular biologic mechanisms from adhesion-free peritoneal repair represent future opportunities to improve the reduction of postoperative adhesions. Optimization of the reduction of postoperative adhesions will likely require identification of unique, personalized approaches in each individual, representing interindividual variation in peritoneal repair processes.

  16. Shuttle flight experiment 30-day summary report

    NASA Technical Reports Server (NTRS)

    1985-01-01

    A total of 12 AFT training sessions were administered to SL 3 Payload Specialists over a 7 month period. Nine of these sessions were 2 hours in duration and three were 3 hours in duration. A total of three rotating chair tests were conducted in this time frame with four subjects. The performance of these crewmen across tests is shown. Test 1, a baseline motion sickness test, was conducted approximately 10 months prior to the mission, before any AFT was administered. Test 2 was administered after 2 hours of AFT, test 3 after 4 hours and test 4 after 6 hours (total) of training in symptom control. Improvement in performance is reflected by a subject's ability to tolerate a greater number of rotations across tests. Additional training for crewman was not possible within the constraints of the mission. Results of the mission indicate that, as predicted preflight, subject #32 was relatively symptom free inflight while subject #33 was not. Other preflight and postflight tests and analyses are reported.

  17. Stair-Climbing Test Predicts Postoperative Cardiopulmonary Complications and Hospital Stay in Patients with Non-Small Cell Lung Cancer

    PubMed Central

    Dong, Jingsi; Mao, Yousheng; Li, Jiagen; He, Jie

    2017-01-01

    Background There is currently no reliable method to predict major postoperative cardiopulmonary complications for patients with non-small cell lung cancer (NSCLC). In this study, we hypothesized that exercise oxygen desaturation (EOD) and heart rate change results in a stair-climbing test (SCT) would predict postoperative cardiopulmonary complications for patients with NSCLC. Material/Methods We examined 171 patients (41 females and 130 males) with NSCLC by preoperative SCT from January 2010 to July 2015. Among them, 27 underwent wedge resection, 122 underwent lobectomy, and 22 underwent pneumonectomy. The correlation between postoperative cardiopulmonary complications and parameters of SCT and pulmonary function test (PFT) parameters were analyzed retrospectively. Results The overall 30-day postoperative morbidity of the patients was 46/171 (26.9%), with death occurring in 3/171(1.8%). The age, FEV1%, MVV, height of climbing, EOD, and heart rate change were found to be significantly different between the group with postoperative cardiopulmonary complications and those without. Binary logistic regression analysis showed that EOD and heart rate change were independently correlated with postoperative cardiopulmonary complications. In addition, a model predicting the probability of postoperative cardiopulmonary complication based on logistic regression for multivariable analysis was used to confirm our findings. Conclusions A symptom-limited SCT with oxygen saturation monitoring is a safe, simple, and low-cost method to evaluate cardiopulmonary function preoperatively. PMID:28336909

  18. Stair-Climbing Test Predicts Postoperative Cardiopulmonary Complications and Hospital Stay in Patients with Non-Small Cell Lung Cancer.

    PubMed

    Dong, Jingsi; Mao, Yousheng; Li, Jiagen; He, Jie

    2017-03-24

    BACKGROUND There is currently no reliable method to predict major postoperative cardiopulmonary complications for patients with non-small cell lung cancer (NSCLC). In this study, we hypothesized that exercise oxygen desaturation (EOD) and heart rate change results in a stair-climbing test (SCT) would predict postoperative cardiopulmonary complications for patients with NSCLC. MATERIAL AND METHODS We examined 171 patients (41 females and 130 males) with NSCLC by preoperative SCT from January 2010 to July 2015. Among them, 27 underwent wedge resection, 122 underwent lobectomy, and 22 underwent pneumonectomy. The correlation between postoperative cardiopulmonary complications and parameters of SCT and pulmonary function test (PFT) parameters were analyzed retrospectively. RESULTS The overall 30-day postoperative morbidity of the patients was 46/171 (26.9%), with death occurring in 3/171(1.8%). The age, FEV1%, MVV, height of climbing, EOD, and heart rate change were found to be significantly different between the group with postoperative cardiopulmonary complications and those without. Binary logistic regression analysis showed that EOD and heart rate change were independently correlated with postoperative cardiopulmonary complications. In addition, a model predicting the probability of postoperative cardiopulmonary complication based on logistic regression for multivariable analysis was used to confirm our findings. CONCLUSIONS A symptom-limited SCT with oxygen saturation monitoring is a safe, simple, and low-cost method to evaluate cardiopulmonary function preoperatively.

  19. Obstructive Sleep Apnea Screening and Postoperative Mortality in a Large Surgical Cohort

    PubMed Central

    Willingham, Mark D.; Abdallah, Arbi Ben; Helsten, Daniel L.; Bedair, Bahaa A.; Thomas, James; Duntley, Stephen; Avidan, Michael S.

    2015-01-01

    Objective A recent investigation at Barnes-Jewish Hospital located in St. Louis, Missouri, found that an estimated 22% of adults presenting for inpatient surgery screened as high risk for obstructive sleep apnea (OSA). Surgical patients with OSA have multiple comorbidities and are at increased risk for perioperative complications. Our objective was to determine whether a prior diagnosis of OSA, or a positive screen for OSA is associated with increased risk for 30 days and one year mortality. Methods B-J APNEAS (Barnes-Jewish Apnea Prevalence in Every Admission Study) was a prospective cohort study. Unselected adult surgical patients at Barnes Jewish Hospital were prospectively enrolled between February 2006 and April 2010. All patients completed preoperative OSA screening and those who were at risk for OSA according to a combination of the Berlin and Flemons screening tools received targeted postoperative interventions. STOP and STOP-BANG scores were also obtained. Results Overall, the sample included 14,962 patients, of whom 1,939 (12.9%) reported a history of OSA. All four screening tools identified a high prevalence of undiagnosed patients at risk for OSA (9.5% to 41.6%), but agreement among screens was not strong with Kappa ranging from 0.225 to 0.611. There was no significant difference in 30 day postoperative mortality between patients with possible OSA (based on their history or on a positive OSA screen with any of the four instruments) and the rest of the surgical population. Significant differences in one-year mortality were noted between the low and high-risk groups as identified by the Flemons’ (4.96% versus 6.91%; p <0.0001), STOP (5.28% versus 7.57%; p <0.0001) and STOP-BANG (4.13% versus 7.45%; p <0.0001) screens. After adjusting for risk factors, none of the OSA screening tools independently predicted mortality rate up to one year postoperatively. Conclusion Neither a prior diagnosis of OSA, or a positive screen for OSA risk was associated with

  20. 90-day postoperative mortality is a legitimate measure of hepatopancreatobiliary surgical quality

    PubMed Central

    Mise, Yoshihiro; Vauthey, Jean-Nicolas; Zimmitti, Giuseppe; Parker, Nathan H.; Conrad, Claudius; Aloia, Thomas A.; Lee, Jeffery E.; Fleming, Jason B.; Katz, Matthew H. G.

    2015-01-01

    Objective To investigate the legitimacy of 90-day mortality as a measure of hepatopancreatobiliary quality. Summary Background Data The 90-day mortality rate has been increasingly but not universally reported after hepatopancreatobiliary surgery. The legitimacy of this definition as a measure of surgical quality has not been evaluated. Methods We retrospectively reviewed the causes of all deaths that occurred within 365 postoperative days in patients undergoing hepatectomy (n = 2811) and/or pancreatectomy (n = 1092) from January 1997 through December 2012. The rates of surgery-related, disease-related, and overall mortality within 30 days, within 30 days or during the index hospitalization, within 90 days, and within 180 days following surgery were calculated. Results Seventy-nine (3%) surgery-related deaths and 92 (3%) disease-related deaths occurred within 365 days after hepatectomy. Twenty (2%) surgery-related deaths and 112 (10%) disease-related deaths occurred within 365 days after pancreatectomy. The overall mortality rates at 99 day and 118 days optimally reflected surgery-related mortality following hepatobiliary and pancreatic operations, respectively. The 90-day overall mortality rate was a less sensitive but equivalently specific measure of surgery-related death. Conclusions and Relevance The 99-day and 118-day definitions of postoperative mortality optimally reflected surgery-related mortality following hepatobiliary and pancreatic operations, respectively. However, among commonly reported metrics, the 90-day overall mortality rate represents a legitimate measure of surgical quality. PMID:25590497

  1. EFFECTS OF A SIGNALED DELAY TO REINFORCEMENT IN THE PREVIOUS AND UPCOMING RATIOS ON BETWEEN-RATIO PAUSING IN FIXED-RATIO SCHEDULES

    PubMed Central

    Harris, Aimee; Foster, T. Mary; Levine, Joshua; Temple, William

    2012-01-01

    Domestic hens responded under multiple fixed-ratio fixed-ratio schedules with equal fixed ratios. One component provided immediate reinforcement and the other provided reinforcement after a delay, signaled by the offset of the key light. The components were presented quasirandomly so that all four possible transitions occurred in each session. The delay was varied over 0, 4, 8, 16, and 32 s with fixed-ratio 5 schedules, and over 0, 8 and 32 s with fixed-ratio 1, 15 and 40 schedules. Main effects of fixed-ratio value and delay duration were detected on between-ratio pauses. Pauses were longer when the multiple-schedule stimulus correlated with a delayed-reinforcer component was presented, with the longest pauses occurring at the transition from a component with an immediate reinforcer to one with a delayed reinforcer. Pause durations were shortest during immediate components. Overall, both the presence or absence of a delay in the upcoming component, and the presence or absence of a delay in the preceding component affected pause length, but the upcoming delay had the larger effect. Thus changes in delay had similar effects to past reports of the effects of changes in response force, response requirement, and reinforcer magnitude in multiple fixed-ratio fixed-ratio schedules. PMID:23144507

  2. Post-operative urinary retention.

    PubMed

    Steggall, Martin; Treacy, Colm; Jones, Mark

    Urinary retention is a common complication of surgery and anaesthesia. The risk of post-operative urinary retention is increased following certain surgical procedures and anaesthetic modalities, and with patients' advancing age. Patients at increased risk of post-operative urinary retention should be identified before surgery or the condition should be identified and treated in a timely manner following surgery. If conservative measures do not help the patient to pass urine, the bladder will need to be drained using either an intermittent catheter or an indwelling urethral catheter, which can result in catheter-associated urinary tract infections. This article provides an overview of normal bladder function, risk factors for developing post-operative urinary retention, and treatment options. Guidance drawn from the literature aims to assist nurses in identifying at-risk patients and inform patient care.

  3. Predictive value of NT-proBNP for 30-day mortality in patients with non-ST-elevation acute coronary syndromes: a comparison with the GRACE and TIMI risk scores

    PubMed Central

    Schellings, Dirk AAM; Adiyaman, Ahmet; Dambrink, Jan-Henk E; Gosselink, AT Marcel; Kedhi, Elvin; Roolvink, Vincent; Ottervanger, Jan Paul; van’t Hof, Arnoud WJ

    2016-01-01

    Background The biomarker N-terminal pro-brain natriuretic peptide (NT-proBNP) predicts outcome in patients with non-ST-elevation acute coronary syndromes (NSTE-ACS). Whether NT-proBNP has incremental prognostic value beyond established risk strategies is still questionable. Purpose To evaluate the predictive value of NT-proBNP for 30-day mortality over and beyond the Global Registry of Acute Coronary Events (GRACE) and Thrombolysis In Myocardial Infarction (TIMI) risk scores in patients with NSTE-ACS. Methods Patients included in our ACS registry were candidates. NT-proBNP levels on admission were measured and the GRACE and TIMI risk scores were assessed. We compared the predictive value of NT-proBNP to both risk scores and evaluated whether NT-proBNP improves prognostication by using receiver operator curves and measures of discrimination improvement. Results A total of 1324 patients were included and 50 patients died during follow-up. On logistic regression analysis NT-proBNP and the GRACE risk score (but not the TIMI risk score) both independently predicted mortality at 30 days. The predictive value of NT-proBNP did not differ significantly compared to the GRACE risk score (area under the curve [AUC]) 0.85 vs 0.87 p=0.67) but was considerably higher in comparison to the TIMI risk score (AUC 0.60 p<0.001). Adjustment of the GRACE risk score by adding NT-proBNP did not improve prognostication: AUC 0.86 (p=0.57), integrated discrimination improvement 0.04 (p=0.003), net reclassification improvement 0.12 (p=0.21). Conclusion In patients with NSTE-ACS, NT-proBNP and the GRACE risk score (but not the TIMI risk score) both have good and comparable predictive value for 30-day mortality. However, incremental prognostic value of NT-proBNP beyond the GRACE risk score could not be demonstrated. PMID:27920547

  4. Mutational Pressure in Zika Virus: Local ADAR-Editing Areas Associated with Pauses in Translation and Replication

    PubMed Central

    Khrustalev, Vladislav V.; Khrustaleva, Tatyana A.; Sharma, Nitin; Giri, Rajanish

    2017-01-01

    Zika virus (ZIKV) spread led to the recent medical health emergency of international concern. Understanding the variations in virus system is of utmost need. Using available complete sequences of ZIKV we estimated directions of mutational pressure along the length of consensus sequences of three lineages of the virus. Results showed that guanine usage is growing in ZIKV RNA plus strand due to adenine to guanine transitions, while adenine usage is growing due to cytosine to adenine transversions. Especially high levels of guanine have been found in two-fold degenerated sites of certain areas of RNA plus strand with high amount of secondary structure. The usage of cytosine in two-fold degenerated sites shows direct dependence on the amount of secondary structure in 52% (consensus sequence of East African ZIKV lineage)—32% (consensus sequence of epidemic strains) of the length of RNA minus strand. These facts are the evidences of ADAR-editing of both strands of ZIKV genome during pauses in replication. RNA plus strand can also be edited by ADAR during pauses in translation caused by the appearance of groups of rare codons. According to our results, RNA minus strand of epidemic ZIKV strain has lower number of points in which polymerase can be stalled (allowing ADAR-editing) compared to other strains. The data on preferable directions of mutational pressure in epidemic ZIKV strain is useful for future vaccine development and understanding the evolution of new strains. PMID:28275585

  5. Mutational Pressure in Zika Virus: Local ADAR-Editing Areas Associated with Pauses in Translation and Replication.

    PubMed

    Khrustalev, Vladislav V; Khrustaleva, Tatyana A; Sharma, Nitin; Giri, Rajanish

    2017-01-01

    Zika virus (ZIKV) spread led to the recent medical health emergency of international concern. Understanding the variations in virus system is of utmost need. Using available complete sequences of ZIKV we estimated directions of mutational pressure along the length of consensus sequences of three lineages of the virus. Results showed that guanine usage is growing in ZIKV RNA plus strand due to adenine to guanine transitions, while adenine usage is growing due to cytosine to adenine transversions. Especially high levels of guanine have been found in two-fold degenerated sites of certain areas of RNA plus strand with high amount of secondary structure. The usage of cytosine in two-fold degenerated sites shows direct dependence on the amount of secondary structure in 52% (consensus sequence of East African ZIKV lineage)-32% (consensus sequence of epidemic strains) of the length of RNA minus strand. These facts are the evidences of ADAR-editing of both strands of ZIKV genome during pauses in replication. RNA plus strand can also be edited by ADAR during pauses in translation caused by the appearance of groups of rare codons. According to our results, RNA minus strand of epidemic ZIKV strain has lower number of points in which polymerase can be stalled (allowing ADAR-editing) compared to other strains. The data on preferable directions of mutational pressure in epidemic ZIKV strain is useful for future vaccine development and understanding the evolution of new strains.

  6. Effect of Growth Pause on Indium Gallium Phosphorus/gallium Arsenic Heterointerfaces during Gas-Source Molecular Beam Epitaxy

    NASA Astrophysics Data System (ADS)

    Lee, Hyong Yong

    Molecular beam epitaxial (MBE) growth of InGaP/GaAs quantum-well structures requires switching of the arsenic and phosphorus beams at each heterointerface. Using in -situ reflection high energy electron diffraction, double crystal X-ray (DCXR) diffraction, and transmission electron microscopy, the effects of a growth pause on the interfacial structure and composition of lattice-matched InGaP/GaAs multiple quantum well structures were studied. For the purpose of this study growth pause at each interface was divided into two time periods: the interval (denoted by t_1) after stopping growth by closing the group-III shutters but before switching the group-V beams, and the interval (t_2) after switching the group-V beams but before recommencing growth. The effect of the As_2 beam on the GaAs growth front and the P_2 beam on the InGaP growth front was first studied. An atomically smooth GaAs surface was obtained with about 30 sec of pause in an As_2 beam. With the experimental methods used, the InGaP growth front did not show any major structural changes with increasing growth pause time. The GaAs-to-InGaP interface is found to be composed of one to two monolayers of GaAs_ {y}P_{1-y} (0 < y < 0.05) and the InGaP-to-GaAs interface is composed of one to two monolayers of In_{.5}Ga_ {.5}As_{y}P _{1-y} (0 < y < 0.05). This requires an exchange of As and P in the uppermost group-V atoms. The effect of an As_2 beam on the InGaP surface and an P_2 beam on the GaAs surface was next studied. For t _2 < 20 sec, atomically flat heterointerfaces were obtained and both the GaAs-to-InGaP and the InGaP -to-GaAs interfaces were found to be composed of group-V exchange strained layers. For t_2 >=q 60 sec a wavy interface was obtained. The irregularities of the interface may be the result of the As and P exchange mechanism. The experimental results show that a combination of an As_2 beam on the InGaP surface and a P_2 beam on the GaAs surface lasting 2 min produces rougher growth fronts

  7. Detection of Respiratory Viruses in Nasopharyngeal Swab and Adenoid Tissue from Children Submitted to Adenoidectomy: Pre- and Postoperative Analysis

    PubMed Central

    Biill Primo, Osvaldo Vinícius; Lourenço, Edmir Américo; Passos, Saulo Duarte

    2014-01-01

    Introduction The presence of respiratory viruses in lymphoid tissues of the nasopharynx and oropharynx and its impact on recurrent infections and hypertrophy of these tissues are not yet fully understood. Objective To identify and determine the prevalence of major respiratory viruses in nasopharyngeal secretions and adenoid tissue pre- and postoperatively of children undergoing adenoidectomy. Methods A prospective observational study was conducted in 36 patients under 12 years of age with upper airway lymphoid hypertrophy who were undergoing adenoidectomy, in which various respiratory viruses were investigated using real-time polymerase chain reaction in adenoid tissue and nasopharyngeal secretions collected preoperatively and 30 days postoperatively. Results At least 1 viral agent was isolated in any of the samples collected in 58.3% of children and 25.9% of total samples. Respiratory viruses were identified in 33.8% of preoperative nasopharyngeal specimens and in 19.8% of postoperative secretion. Of the 21 patients with positive results for any respiratory virus, 6 (28.6%) had more than 1 virus. Considering all 36 respiratory viruses found, the main agent isolated was rhinovirus (27.8%), followed by bocavirus (22.2%). Conclusion The virus found more frequently in all samples was rhinovirus. After removal of adenoid tissue, there was a decrease in the prevalence of the virus contained in nasopharyngeal secretion 30 days after surgery. PMID:25992082

  8. Incidence, Predictors, and Impact of Postoperative Atrial Fibrillation after Coronary Artery Bypass Grafting in Military Veterans

    PubMed Central

    Cornwell, Lorraine D.; Bakshi, Ankur; Rachlin, Eric; Preventza, Ourania; Rosengart, Todd K.; Coselli, Joseph S.; LeMaire, Scott A.; Petersen, Nancy J.; Pattakos, Greg; Bakaeen, Faisal G.

    2016-01-01

    Little is known about the frequency and clinical implications of postoperative atrial fibrillation in military veterans who undergo coronary artery bypass grafting (CABG). We examined long-term survival data, clinical outcomes, and associated risk factors in this population. We retrospectively reviewed baseline, intraoperative, and postoperative data from 1,248 consecutive patients with similar baseline risk profiles who underwent primary isolated CABG at a Veterans Affairs hospital from October 2006 through March 2013. Multivariable logistic regression identified predictors of postoperative atrial fibrillation. Kaplan-Meier analysis was used to evaluate long-term survival (the primary outcome measure), morbidity, and length of hospital stay. Postoperative atrial fibrillation occurred in 215 patients (17.2%). Independent predictors of this sequela were age ≥65 years (odds ratios [95% confidence intervals], 1.7 [1.3–2.4] for patients of age 65–75 yr and 2.6 [1.4–4.8] for patients >75 yr) and body mass index ≥30 kg/m2 (2.0 [1.2–3.2]). Length of stay was longer for patients with postoperative atrial fibrillation than for those without (12.7 ± 6.6 vs 10.3 ± 8.9 d; P ≤0.0001), and the respective 30-day mortality rate was higher (1.9% vs 0.4%; P=0.014). Seven-year survival rates did not differ significantly. Older and obese patients are particularly at risk of postoperative atrial fibrillation after CABG. Patients who develop the sequela have longer hospital stays than, but similar long-term survival rates to, patients who do not. PMID:27777519

  9. Central Venous Pressure After Coronary Artery Bypass Surgery: Does it Predict Postoperative Mortality or Renal Failure?

    PubMed Central

    Williams, Judson B.; Peterson, Eric D.; Wojdyla, Daniel; Ferguson, T. Bruce; Smith, Peter K.; Milano, Carmelo A.; Lopes, Renato D.

    2015-01-01

    Background While hemodynamic monitoring is often performed following coronary artery bypass grafting (CABG), the relationship between postoperative central venous pressure (CVP) measurement and clinical outcomes is unknown. Methods Detailed clinical data were analyzed from 2,390 randomly selected patients undergoing high risk CABG or CABG/valve at 55 hospitals participating in the Society of Thoracic Surgeons' National Cardiac Surgery Database from 2004 to 2005. Eligible patients underwent elective/urgent isolated CABG with an ejection fraction < 40%, or elective/urgent CABG at age ≥65 years with diabetes or a glomerular filtration rate 60 mL/min per 1.73 m2. Correlation between post-operative CVP and in-hospital / 30-day mortality and renal failure was assessed as a continuous variable, both unadjusted and after adjusting for important clinical factors using logistic regression modeling. Results Mean age was 72 years, 54% of patients had diabetes mellitus, 49% were urgent procedures, and mean cardiopulmonary bypass time was 105 minutes. Patients’ CVP 6 hours post-operation was strongly associated with in-hospital and 30 day mortality: odds ratio (OR) 1.5 (95% confidence interval [CI] 1.23, 1.87) for every 5 mmHg increase in CVP, p<0.0001. This association remained significant after risk-adjustment for cardiac index: adjusted OR 1.44 (95% CI 1.10, 1.89), p<0.01. A model adjusting for cardiac index also revealed increased incidence of mortality or renal failure: adjusted OR 1.5 (95% CI 1.28, 1.86) for every 5 mmHg increase in CVP, p<0.0001. Conclusion Patients’ central venous pressure at 6 hours following CABG surgery was highly predictive of operative mortality or renal failure, independent of cardiac index and other important clinical variables. Future studies will need to assess whether post-operative CVP can be used to guide intervention and improve outcomes. PMID:25035048

  10. Who pressed the pause button on global warming: is the answer in the past?

    NASA Astrophysics Data System (ADS)

    Tan, Ming

    2014-05-01

    Although there is coverage bias in the HadCRUT4 temperature series (Cotan and Way, 2013) or in other global surface temperature sequences, IPCC-AR5 still claimed that "much interest has focused on the period since 1998 and an apparent flattening ('hiatus') in trends". According to statistical principle, in fact, this flattening trend is unlikely to be changed by adding the missing 16% area-weighed regional data. In addition, if the "warming hiatus" could not be attributed to the solar output, volcanic eruptions and the green house gases when comparing them to the rhythm of the temperature, then the question arise: who pressed the pause button on global warming? However, it would be a golden opportunity to further understand the ocean as a fundamental role in controlling climate change. The current hypothesis attributed this "hiatus" to a La Niña-like decadal cooling occurring in the central and eastern equatorial Pacific (Kosaka and Die, 2013). Here we separate the global surface temperature into land surface air temperature (LSAT, adopt from HadCRUT4) and sea surface temperatures (SSTs, adopt from different original data). Obviously, the decadal cooling of the central and eastern equatorial Pacific occurred in 1987, a decade earlier than the beginning of the LSAT flattening (1998), whereas the SSTs of the west Pacific warm pool (WPWP), the Indian Ocean (IO, 20S-20N, 40-110E) and the North Atlantic (NA, here its variation is represented by the Atlantic multi-decadal oscillation or hereafter referred to as AMO) are exactly in phase with the LSAT. The combined data (SSTs, arithmetic mean) of the three ocean areas has the highest correlation with the LSAT (0.91), but the correlation coefficient is reduced (0.54) if adding the decadal variation in the central and eastern equatorial Pacific (here it is represented by the Pacific decadal oscillation or hereafter referred to as PDO). Therefore, the tree ocean areas (WPWP, IO and NA) could be regarded as the key ocean

  11. Postoperative singultus: an osteopathic approach.

    PubMed

    Petree, Kristie; Bruner, Jonathan

    2015-03-01

    Singultus, or hiccups, is a common medical condition. Despite exponential leaps in medicine, the pathophysiologic cause remains poorly defined. Persistent singultus has been associated with conditions such as pulmonary embolism and myocardial infarction. Singultus is also a well-known postoperative complication. The criterion standard of care for patients with singultus involves ruling out lethal pathologic causes, attempting physical stimulation with Valsava maneuvers or drinking water, and, if no relief has been achieved, administering drugs to ease the symptoms. The authors report a case of a man whose postoperative singultus was successfully managed with osteopathic manipulative treatment. This approach addresses many of the possible underlying neuromechanical causes of the aberrant reflex with minimal potential for adverse effects. Physicians should consider osteopathic manipulative treatment in the care of patients with singultus.

  12. Postoperative pain assessment after septorhinoplasty.

    PubMed

    Wittekindt, D; Wittekindt, C; Schneider, G; Meissner, W; Guntinas-Lichius, O

    2012-06-01

    Postoperative pain after septorhinoplasty and its optimal management has not been described in detail. Fifty-two adult septorhinoplasty patients were included in a prospective cohort single center study. Patients' and surgical characteristics were evaluated. Outcome and process parameters were analyzed using the questionnaires of the German-wide project Quality Improvement in Postoperative Pain Management (QUIPS) on the first postoperative day. Pain during the first operative day after septorhinoplasty was moderate. Pain management predominately consisted of remifentanil intraoperatively, metamizole in the recovery room, in combination with piritramide in one-third of the patients, and metamizole on ward. Patients younger than 31 years were less satisfied with pain management (P = 0.018). Open rhinoplasty was associated with less satisfaction with pain management (P = 0.007). Use of rib grafts led to more mobility, breathing, sleeping and mood disturbances (P = 0.003, 0.047; 0.047; 0.022, respectively). Preoperative pain counseling was followed by higher satisfaction, less breathing and mood disturbances after surgery (P = 0.021; 0.004; 0.046, respectively). Opioids in the recovery room in addition to non-opioids and treatment with non-opioids on ward led to less maximal pain (P = 0.027 and 0.040, respectively). We conclude that QUIPS is an easy tool to evaluate the quality of postoperative pain management following rhinoplasty. Preoperative pain counseling, specific care for patients with rib grafts, consequent use of opioids in the recovery room in addition to non-opioids, and use of non-opioids on ward seem to be effective to improve pain management after septorhinoplasty.

  13. Replication termination at eukaryotic chromosomes is mediated by Top2 and occurs at genomic loci containing pausing elements.

    PubMed

    Fachinetti, Daniele; Bermejo, Rodrigo; Cocito, Andrea; Minardi, Simone; Katou, Yuki; Kanoh, Yutaka; Shirahige, Katsuhiko; Azvolinsky, Anna; Zakian, Virginia A; Foiani, Marco

    2010-08-27

    Chromosome replication initiates at multiple replicons and terminates when forks converge. In E. coli, the Tus-TER complex mediates polar fork converging at the terminator region, and aberrant termination events challenge chromosome integrity and segregation. Since in eukaryotes, termination is less characterized, we used budding yeast to identify the factors assisting fork fusion at replicating chromosomes. Using genomic and mechanistic studies, we have identified and characterized 71 chromosomal termination regions (TERs). TERs contain fork pausing elements that influence fork progression and merging. The Rrm3 DNA helicase assists fork progression across TERs, counteracting the accumulation of X-shaped structures. The Top2 DNA topoisomerase associates at TERs in S phase, and G2/M facilitates fork fusion and prevents DNA breaks and genome rearrangements at TERs. We propose that in eukaryotes, replication fork barriers, Rrm3, and Top2 coordinate replication fork progression and fusion at TERs, thus counteracting abnormal genomic transitions.

  14. Postoperative (pressure) alopecia following sacrocolpopexy.

    PubMed

    Bagaria, Madhu; Luck, Ali Maria

    2015-06-01

    Postoperative alopecia is a rare occurrence seen after a variety of surgical procedures performed under general anesthesia. The speculated cause is pressure-induced ischemia due to prolonged head immobilization. This case describes a patient who developed this complication after undergoing sacrocolpopexy. A 57-year-old postmenopausal Caucasian female was consented to undergo a robotic-assisted sacrocolpopexy, perineoplasty, and midurethral sling with possible conversion to an open procedure. The indication was symptomatic proximal and distal rectocele with foreshortened vagina. It was converted to laparotomy due to difficult presacral dissection. Her total operative time was 540 with 240 min in the Trendelenburg position. No intraoperative hypotension or excessive blood loss was noted. She started complaining of scalp pain in the postoperative recovery area. She developed soreness, crusting, and later alopecia in the same area. It was noted at her 3-week office visit. Referral was made for dermatology and anesthesiology evaluation. There was spontaneous full recovery by the 5th month. Postoperative alopecia is a rare condition mimicking alopecia areata but it is preceded by inciting events. There is some evidence to suggest that it is a preventable condition by frequent head repositioning during surgery. This case report is intended to increase the surgeon's awareness about this rare complication as its occurrence can be distressing for the patient.

  15. The Impact of Promoting Transcription on Early Text Production: Effects on Bursts and Pauses, Levels of Written Language, and Writing Performance

    ERIC Educational Resources Information Center

    Alves, Rui A.; Limpo, Teresa; Fidalgo, Raquel; Carvalhais, Lénia; Pereira, Luísa Álvares; Castro, São Luís

    2016-01-01

    Writing development seems heavily dependent upon the automatization of transcription. This study aimed to further investigate the link between transcription and writing by examining the effects of promoting handwriting and spelling skills on a comprehensive set of writing measures (viz., bursts and pauses, levels of written language, and writing…

  16. Postreinforcement Pause Duration Varies within a Session and with a Variable Response Requirement but Not as a Function of Prior Revolutions

    ERIC Educational Resources Information Center

    Belke, Terry W.

    2011-01-01

    The current study examined the variables that influence postreinforcement pause (PRP) duration in rats when wheel running serves as the reinforcing consequence. The relationship between revolutions and PRP duration when revolutions were manipulated within a session and the effect of changing the response requirement from fixed to variable on PRP…

  17. A Comparison between the Occurrence of Pauses, Repetitions and Recasts under Conditions of Face-to-Face and Computer-Mediated Communication: A Preliminary Study

    ERIC Educational Resources Information Center

    Cabaroglu, Nese; Basaran, Suleyman; Roberts, Jon

    2010-01-01

    This study compares pauses, repetitions and recasts in matched task interactions under face-to-face and computer-mediated conditions. Six first-year English undergraduates at a Turkish University took part in Skype-based voice chat with a native speaker and face-to-face with their instructor. Preliminary quantitative analysis of transcripts showed…

  18. Comparative evaluation of honey, chlorhexidine gluconate (0.2%) and combination of xylitol and chlorhexidine mouthwash (0.2%) on the clinical level of dental plaque: A 30 days randomized control trial

    PubMed Central

    Jain, Ankita; Bhaskar, Dara John; Gupta, Devanand; Agali, Chandan; Gupta, Vipul; Gupta, Rajendra Kumar; Yadav, Priyanka; Lavate, Akash B.; Chaturvedi, Mudita

    2015-01-01

    Aim: To compare the effect of honey, chlorhexidine mouthwash and combination of xylitol chewing gum and chlorhexidine mouthwash on the dental plaque level. Materials and Methods: Ninety healthy dental students, both male and female, aged between 21 to 25 years participated in the study. The subjects were randomly divided into three groups, i.e. the honey group, the chlorhexidine gluconate mouthwash group and the combination of xylitol chewing gum and chlorhexidine (CHX) mouthwash group. The data was collected at the baseline, 15th day and 30th day; the plaque was disclosed using disclosing solution and their scores were recorded at six sites per tooth using the Quigley and Hein plaque index modified by Turesky-Gilmore-Glickman. Statistical analysis was carried out later to compare the effect of all the three groups. P ≤ 0.05 was considered as statistically significant. Results: Our result showed that all the three groups were effective in reducing the plaque but post-hoc LSD (Least Significant Difference) showed that honey group and chlorhexidine + xylitol group were more effective than chlorhexidine group alone. The results demonstrated a significant reduction of plaque indices in honey group and chlorhexidine + xylitol group over a period of 15 and 30 days as compared to chlorhexidine. PMID:25657903

  19. Radiological contribution to the diagnosis of early postoperative complications after lung resection for primary tumor: a revisional study

    PubMed Central

    Priola, Adriano Massimiliano; Priola, Sandro Massimo; Boccuzzi, Francesco; Dervishi, Najada; Lisi, Elena; Veltri, Andrea; Ardissone, Francesco

    2016-01-01

    In the post-operative course of the interventions of lung resection for primary tumor, complications of different nature and severity can arise, recognizing different pathogenetic mechanisms and differing according to the type of resection performed and to the time elapsed after surgery. The low diagnostic accuracy of chest radiography requires a thorough knowledge of the radiologist about all radiographic findings, both normal and pathological, which can be found in the immediate post-operative period (within 30 days after surgery). This article aims to describe the incidence, the clinical features and the radiological aspects of immediate complications following pulmonary resections, with specific reference to those in which the diagnostic imaging provides a fundamental contribution. PMID:27621893

  20. Association between day of the week of elective surgery and postoperative mortality

    PubMed Central

    Dubois, Luc; Vogt, Kelly; Vinden, Chris; Winick-Ng, Jennifer; McClure, J. Andrew; Roshanov, Pavel S.; Bell, Chaim M.; Garg, Amit X.

    2017-01-01

    BACKGROUND: In prior studies, higher mortality was observed among patients who had elective surgery on a Friday rather than earlier in the week. We investigated whether mortality after elective surgery was associated with day of the week of surgery in a Canadian population and whether the association was influenced by surgeon experience and volume. METHODS: We conducted a population-based retrospective cohort study in the province of Ontario, Canada. We included adults who underwent 1 of 12 elective daytime surgical procedures from Apr. 1, 2002, to Dec. 31, 2012. The primary outcome was 30-day mortality. We used generalized estimating equations to compare outcomes for surgeries performed on different days of the week, adjusting for patient and surgeon factors. RESULTS: A total of 402 899 procedures performed by 1691 surgeons met our inclusion criteria. The median length of hospital stay was 6 (interquartile range 5–8) days. Surgeon experience varied significantly by day of week (p < 0.001), with surgeons operating on Fridays having the least experience. Nearly all of the patients who had their procedure on a Friday had postoperative care on the weekend, as compared with 49.1% of those whose surgery was on a Monday (p < 0.001). We found no difference in the 30-day mortality between procedures performed on Fridays and those performed on Mondays (adjusted odds ratio 1.08, 95% confidence interval 0.97–1.21). INTERPRETATION: Although surgeon experience differed across days of the week, the risk of 30-day mortality after elective surgery was similar regardless of which day of the week the procedure took place. PMID:27754897

  1. [Postoperative radiotherapy of prostate cancer].

    PubMed

    Guérif, S; Latorzeff, I; Lagrange, J-L; Hennequin, C; Supiot, S; Garcia, A; François, P; Soulié, M; Richaud, P; Salomon, L

    2014-10-01

    Between 10 and 40% of patients who have undergone a radical prostatectomy may have a biologic recurrence. Local or distant failure represents the possible patterns of relapse. Patients at high-risk for local relapse have extraprostatic disease, positive surgical margins or seminal vesicles infiltration or high Gleason score at pathology. Three phase-III randomized clinical trials have shown that, for these patients, adjuvant irradiation reduces the risk of tumoral progression without higher toxicity. Salvage radiotherapy for late relapse allows a disease control in 60-70% of the cases. Several research in order to improve the therapeutic ratio of the radiotherapy after prostatectomy are evaluate in the French Groupe d'Étude des Tumeurs Urogénitales (Gétug) and of the French association of urology (Afu). The Gétug-Afu 17 trial will provide answers to the question of the optimal moment for postoperative radiotherapy for pT3-4 R1 pN0 Nx patients, with the objective of comparing an immediate treatment to a differed early treatment initiated at biological recurrence. The Gétug-Afu 22 questions the place of a short hormonetherapy combined with image-guided, intensity-modulated radiotherapy (IMRT) in adjuvant situation for a detectable prostate specific antigen (PSA). The implementation of a multicenter quality control within the Gétug-Afu in order to harmonize a modern postoperative radiotherapy will allow the development of a dose escalation IMRT after surgery.

  2. The association of subclinical hypocalcemia, negative energy balance and disease with bodyweight change during the first 30 days post-partum in dairy cows milked with automatic milking systems.

    PubMed

    Caixeta, L S; Ospina, P A; Capel, M B; Nydam, D V

    2015-05-01

    In a prospective cohort study, the daily bodyweight (BW) and milk production of 92 cows were recorded using automatic milking systems. The objectives were to characterize calcium serum concentration variability on days 1-3 post-partum and to evaluate the association between subclinical hypocalcemia (SHPC) and change in BW over the first 30 days in milk (DIM) in Holstein dairy cows, while controlling for concurrent disease and negative energy balance (NEB). SHPC was defined as total serum calcium concentration between 6 and 8 mg/dL, NEB was defined as non-esterified fatty acids (NEFA) > 0.7 mEq/L or β-hydroxybutyrate (BHB) ≥ 1.2 mmol/L. The peak incidence of SHPC was at 1 DIM for all groups (11%, 42% and 60% for parities 1, 2, and ≥3, respectively). All parity groups lost weight (21, 33, and 34 kg) during the first 30 DIM. Parity 1 animals with disease compared with those without disease lost the most weight (2.6 kg/day BW loss vs. <1.9 kg/day, respectively). Normocalcemic parity 2 animals with either NEB or disease lost the most weight (>5 kg/day) compared with those in the SHPC group (≤4.5 kg/day). In parity ≥ 3 animals, SHPC was an important factor for BW loss; SHPC animals lost the most weight (>3.7 kg/day) vs. normocalcemic cows (≤3.3 kg/day) regardless of NEB or disease status. Even though all animals lost weight during early lactation the effect of disease, NEB, and SHPC on BW loss was different in each parity group.

  3. The 2013 German-Russian Bion-M1 Joint Flight Project: Altered cAMP/PKA Signaling Pathway in Skeletal Muscle during Exposure to Real Microgravity in Mice Housed for 30 Days in a Biosatellite on Orbit

    NASA Astrophysics Data System (ADS)

    Salanova, Michele; Blottner, Dieter; Shenkman, Boris S.; Lomonosova, Yulia

    Exposure to real microgravity (muG) results in an impaired skeletal muscle structure and function. We here hypothesized that the cAMP/PKA cell signaling pathway, which triggers a multitude of intracellular effects in response to a variety of extracellular stimuli and which further promote muscle growth, play an important role during Spaceflight- induced disuse atrophy. Particularly, we hypothesized that different effectors of the cAMP-PKA signaling machinery, which are highly compartmentalized into subcellular functional microdomains in order to guarantee signal specificity, are altered after long term exposure to real µG. Taking advantage of the Bion-M1 Spaceflight program which provided us an excellent opportunity to explore mice skeletal muscle exposed for 30 days to real µG, by investigating at the cAMP-dependent protein kinase A (PKA) subcellular localization we compared muscle soleus (SOL) and extensor digitorum longus (EDL) of C57/black mice of a Bion-flight (n=5) group with a Bion-ground control (n=5) group and a ground control (n=5) group which was housed in a standard cage considered as vivarium control. Preliminary results of our experiments showed that different cAMP-PKA micro pools were normally detectable using high-resolution images of immunofluorescence experiments in different subcellular compartments of both SOL and EDL of Bion-ground and ground control groups which were not any longer detectable in Bion-flight group. In summary, our data indicate that an efficient organization in microdomains of the cAMP/PKA pathway may exist in skeletal muscle on ground and that such compartmentalization may be altered in response to prolonged exposure to real muG. National Sponsors: Federal Ministry of Economics and Technology (BMWi) via the German AeroSpace Board, DLR e.V., Bonn-Oberkassel, Germany (#50WB1121 to DB); Contract RAS-IMPB/Charité Berlin # Bion-M1/2013

  4. Patient- and lesion-tailored algorithm of endovascular treatment for arterial occlusive disease of extracranial arteries supplying the brain: safety of the treatment at 30-day follow-up

    PubMed Central

    Simka, Marian; Brzegowy, Paweł; Janas, Piotr; Kazibudzki, Marek; Pieniążek, Piotr; Ochała, Andrzej; Popiela, Tadeusz; Mrowiecki, Tomasz

    2017-01-01

    Introduction Although surgical endarterectomy remains the treatment of choice for carotid artery stenosis, stenting plays an important role as an alternative treatment modality, especially in high-risk patients. The actual safety profile associated with stenting procedures is probably better than that reported by randomized controlled trials. Aim To assess the safety of stent implantations in extracranial arteries supplying the brain, and also to identify risk factors associated with this procedure. Material and methods This was a post hoc analysis, with 30-day follow-up. We analyzed the results of treatment of 372 patients who underwent 408 procedures, 197 such procedures in asymptomatic, and 211 in symptomatic individuals. Stenting procedures were performed using a technique and armamentarium which were tailored to the type and anatomy of lesions. Results There were 6 (1.5%) strokes, including 2 (0.5%) major strokes, 1 ipsi- and 1 contralateral, and 4 (1.0%) minor strokes. In asymptomatic patients there was 1 (0.3%) minor stroke. Transient ischemic attacks occurred in 5 (1.2%) patients. There were 2 (0.5%) non-STEMI myocardial infarctions and 2 (0.5%) non-stroke related fatalities. Risk factors of these adverse events were diabetes mellitus, lesions localized in a tortuous segment of the artery, embolic material in the filter and bilateral stenoses of carotid arteries. Additional risk factors in asymptomatic patients were renal impairment and advanced coronary artery disease; and in symptomatic patients, grade 3 arterial hypertension, dislipidemia, cigarette smoking and lesions requiring predilatation. Conclusions Stenting procedures of extracranial arteries supplying the brain, which are tailored to the type and anatomy of lesions, seem to be relatively safe. PMID:28344618

  5. Fish Oil and Post-Operative Atrial Fibrillation – Results of the Omega-3 Fatty Acids for Prevention of Post-Operative Atrial Fibrillation (OPERA) Trial

    PubMed Central

    Mozaffarian, Dariush; Marchioli, Roberto; Macchia, Alejandro; Silletta, Maria G.; Ferrazzi, Paolo; Gardner, Timothy J.; Latini, Roberto; Libby, Peter; Lombardi, Federico; O’Gara, Patrick T.; Page, Richard L.; Tavazzi, Luigi; Tognoni, Gianni

    2013-01-01

    Context Post-operative atrial fibrillation/flutter (AF) is one of the most common complications of cardiac surgery and significantly increases morbidity and healthcare utilization. A few small trials have evaluated whether long-chain n-3-polyunsaturated fatty acids (PUFA) reduce post-op AF, with mixed results. Objective To determine whether peri-operative n-3-PUFA supplementation reduces post-op AF. Design Randomized, double-blind, placebo-controlled, multinational, clinical trial. Patients A total of 1,516 patients scheduled for cardiac surgery across 28 centers in the US, Italy, and Argentina, enrolled between Aug 2010 and Jun 2012. Inclusion criteria were broad; the main exclusions were regular use of fish oil or absence of sinus rhythm at enrollment. Forty-eight percent of screened patients and 94% of eligible patients were enrolled. Intervention Patients were randomized to receive fish oil (1 g capsules containing ≥840 mg n-3-PUFA as ethyl esters) or placebo, with pre-operative loading of 10g over 3-5 days (or 8g over 2 days) followed post-operatively by 2g/d until hospital discharge or post-op day10, whichever first. Main Outcome Measures The primary endpoint was occurrence of post-op AF >30 sec. We also evaluated post-op AF lasting >1hr, resulting in symptoms, or treated with cardioversion; other secondary post-op AF endpoints; other tachyarrhythmias; hospital utilization; and major adverse cardiovascular events, 30-day mortality, bleeding, and other adverse events. All endpoints and analyses plans were prespecified. Results At enrollment, mean±SD age was 64±13 years, 72.2% were male, and 51.8% had planned valvular surgery. The primary endpoint occurred in 233 (30.7%) and 227 (30.0%) patients assigned to placebo and n-3-PUFA, respectively (OR=0.96, 95%CI=0.77-1.20; P=0.74). None of the secondary endpoints were significantly different, including post-op AF that was sustained, symptomatic, or treated (n=231 [30.5%] vs. n=224 [29.6%], P=0.70) or number of

  6. Computed tomography of the postoperative lumbar spine

    SciTech Connect

    Teplick, J.G.; Haskin, M.E.

    1983-11-01

    In the postoperative patient ordinary radiographs of the spine generally add very little information, revealing the usual postoperative bone changes and often postoperative narrowing of the intervertebral space. Myelography may sometimes be informative, showing evidence of focal arachnoiditis or a focal defect at the surgical site. However, the latter finding is difficult to interpret. As experience with high-resolution CT scanning of the lumbar spine has been increasing, it is becoming apparent that this noninvasive and easily performed study can give considerably more information about the postoperative spine than any of the other current imaging methods. About 750 patients with previous lumbar laminectomies had CT scanning within a 28 month period.

  7. [AGGLUTINATION OF MESOPHYLL PLASTIDS AND OBLITERATION OF PHLOEM SIEVE TUBES ARE THE TOTAL RESULT OF SEASONAL PAUSES IN PHOTOSYNTHATE EXPORT].

    PubMed

    Gamalei, Yu V

    2015-01-01

    Chloroplast agglutination and sieve tube obliteration are related to the different plant tissues: the agglutination--to the leaf mesophyll, and the obliteration--to the axis phloem. Being equally produced by photosynthate export dynamics, both phenomena are synchronous and can be used for diagnostics of seasonal flashes and pauses of photosynthetic activity with equal success. The nature of the mobility of chloroplast and their shuttle displacements from the nuclear envelope to the cell periphery connected with export dynamics have been established. It is assumed that nuclear envelope is the base structure of the endoplasmic reticulum (ER) inside which the chloroplasts are localized. Activation of photosynthesis and sugar accumulation inside the ER induces its expansion followed by centrifugal diffusion of chloroplasts. Come back effect--ER collapse, its return to the source--can be induced by the blockade of photosynthesis. Centripetal collapse is accompanied by plastid concentration around the nuclear envelope. Displacements of ER and the chloroplasts dislocating inside it are reversible. It depends on seasonal fluctuations of photosynthesis and export intensities. Changes in the volume of sieve tubes, which are due to the same reason, are irreversible. Each seasonal wave of photosynthesis and sugar export forms new series of sieve tubes, replacing obliterated ones.

  8. Replication fork progression is paused in two large chromosomal zones flanking the DNA replication origin in Escherichia coli.

    PubMed

    Akiyama, Masahiro Tatsumi; Oshima, Taku; Chumsakul, Onuma; Ishikawa, Shu; Maki, Hisaji

    2016-08-01

    Although the speed of nascent DNA synthesis at individual replication forks is relatively uniform in bacterial cells, the dynamics of replication fork progression on the chromosome are hampered by a variety of natural impediments. Genome replication dynamics can be directly measured from an exponentially growing cell population by sequencing newly synthesized DNA strands that were specifically pulse-labeled with the thymidine analogue 5-bromo-2'-deoxyuridine (BrdU). However, a short pulse labeling with BrdU is impracticable for bacteria because of poor incorporation of BrdU into the cells, and thus, the genomewide dynamics of bacterial DNA replication remain undetermined. Using a new thymidine-requiring Escherichia coli strain, eCOMB, and high-throughput sequencing, we succeeded in determining the genomewide replication profile in bacterial cells. We also found that fork progression is paused in two ~200-kb chromosomal zones that flank the replication origin in the growing cells. This origin-proximal obstruction to fork progression was overcome by an increased thymidine concentration in the culture medium and enhanced by inhibition of transcription. These indicate that DNA replication near the origin is sensitive to the impediments to fork progression, namely a scarcity of the DNA precursor deoxythymidine triphosphate and probable conflicts between replication and transcription machineries.

  9. Forecasting Flooding in the Brahmaputra and Ganges Delta of Bangladesh on Short (1-10 days), Medium (20-30 days) and Seasonal Time Scales (1-6 months)

    NASA Astrophysics Data System (ADS)

    Webster, P. J.; Hoyos, C. D.; Hopson, T. M.; Chang, H.; Jian, J.

    2007-12-01

    Following the devastating flood years of 1998 during which 60% of Bangladesh was under water for a period of 3 months, the Climate Forecast Applications in Bangladesh (CFAB) project was formed with funding by USAID and NSF which eventually resulted in a joint project with the European Centre for Medium Range Weather Forecasting (ECMWF), the Asian Disaster Preparedness Centre (ADPC) and the Bangladesh Flood Forecasting and Warning Centre. The project was organized and developed through the Georgia Institute of Technology. The aim of CFAB was to develop innovative methods of extending the warning of flooding in Bangladesh noting that there was a unique problem: India provided no upstream discharge data to Bangladesh so that before CFAB the maximum lead time of a forecast was that given by measuring river discharge at the India-Bangladesh border: no lead-time at the border and 2 days in the southern parts of the country. Given that the Brahmaputra and Ganges catchment areas had to be regarded as essentially unguaged, it was clear that innovative techniques had to be developed. On of the basic criterion was that the system should provide probabilistic forecasts in order for the Bangladeshis to assess risk. A three-tier system was developed to allow strategic and tactical decisions to be made for agricultural purposes and disaster mitigation: seasonal (1-6 months: strategic), medium range (20-30 days: strategic/tactical) and short range (1-10 days: tactical). The system that has been developed brings together for the first time operational meteorological forecasts (ensemble forecasts from ECMWF), with satellite and discharge data and a suite of hydrological models. In addition, with ADPC and FFWC we have developed an in-country forecast dispersion system that allows a rapid dissemination. The system has proven to be rather successful, especially in the short range. The flooding events of 2004 were forecast with all forecasting tiers at the respective lead time. In

  10. dDsk2 regulates H2Bub1 and RNA polymerase II pausing at dHP1c complex target genes.

    PubMed

    Kessler, Roman; Tisserand, Johan; Font-Burgada, Joan; Reina, Oscar; Coch, Laura; Attolini, Camille Stephan-Otto; Garcia-Bassets, Ivan; Azorín, Fernando

    2015-04-28

    dDsk2 is a conserved extraproteasomal ubiquitin receptor that targets ubiquitylated proteins for degradation. Here we report that dDsk2 plays a nonproteolytic function in transcription regulation. dDsk2 interacts with the dHP1c complex, localizes at promoters of developmental genes and is required for transcription. Through the ubiquitin-binding domain, dDsk2 interacts with H2Bub1, a modification that occurs at dHP1c complex-binding sites. H2Bub1 is not required for binding of the complex; however, dDsk2 depletion strongly reduces H2Bub1. Co-depletion of the H2Bub1 deubiquitylase dUbp8/Nonstop suppresses this reduction and rescues expression of target genes. RNA polymerase II is strongly paused at promoters of dHP1c complex target genes and dDsk2 depletion disrupts pausing. Altogether, these results suggest that dDsk2 prevents dUbp8/Nonstop-dependent H2Bub1 deubiquitylation at promoters of dHP1c complex target genes and regulates RNA polymerase II pausing. These results expand the catalogue of nonproteolytic functions of ubiquitin receptors to the epigenetic regulation of chromatin modifications.

  11. Principles of postoperative anterior cruciate ligament rehabilitation

    PubMed Central

    Saka, Tolga

    2014-01-01

    It is known that anterior cruciate ligament (ACL) reconstruction needs to be combined with detailed postoperative rehabilitation in order for patients to return to their pre-injury activity levels, and that the rehabilitation process is as important as the reconstruction surgery. Literature studies focus on how early in the postoperative ACL rehabilitation period rehabilitation modalities can be initiated. Despite the sheer number of studies on this topic, postoperative ACL rehabilitation protocols have not been standardized yet. Could common, “ossified” knowledge or modalities really prove themselves in the literature? Could questions such as “is postoperative brace use really necessary?”, “what are the benefits of early restoration of the range of motion (ROM)?”, “to what extent is neuromuscular electrical stimulation (NMES) effective in the protection from muscular atrophy?”, “how early can proprioception training and open chain exercises begin?”, “should strengthening training start in the immediate postoperative period?” be answered for sure? My aim is to review postoperative brace use, early ROM restoration, NMES, proprioception, open/closed chain exercises and early strengthening, which are common modalities in the very comprehensive theme of postoperative ACL rehabilitation, on the basis of several studies (Level of Evidence 1 and 2) and to present the commonly accepted ways they are presently used. Moreover, I have presented the objectives of postoperative ACL rehabilitation in tables and recent miscellaneous studies in the last chapter of the paper. PMID:25232521

  12. Epidural Analgesia in the Postoperative Period

    DTIC Science & Technology

    2001-10-01

    violations. VI ABSTRACT Postoperative pain is an unwanted side effect of surgery, and is associated with many postoperative complications...This descriptive study was conducted to determine which surgical patients experienced the most analgesia with the fewest side effects when...epidural medication, side effects , incidence of breakthrough pain, and treatments were recorded and cross-tabulated. The following surgical categories

  13. Postoperative surgical complications of lymphadenohysterocolpectomy

    PubMed Central

    Marin, F; Pleşca, M; Bordea, CI; Voinea, SC; Burlănescu, I; Ichim, E; Jianu, CG; Nicolăescu, RR; Teodosie, MP; Maher, K; Blidaru, A

    2014-01-01

    Rationale The current standard surgical treatment for the cervix and uterine cancer is the radical hysterectomy (lymphadenohysterocolpectomy). This has the risk of intraoperative accidents and postoperative associated morbidity. Objective The purpose of this article is the evaluation and quantification of the associated complications in comparison to the postoperative morbidity which resulted after different types of radical hysterectomy. Methods and results Patients were divided according to the type of surgery performed as follows: for cervical cancer – group A- 37 classic radical hysterectomies Class III Piver - Rutledge -Smith ( PRS ), group B -208 modified radical hysterectomies Class II PRS and for uterine cancer- group C -79 extended hysterectomies with pelvic lymphadenectomy from which 17 patients with paraaortic lymphnode biopsy . All patients performed preoperative radiotherapy and 88 of them associated radiosensitization. Discussion Early complications were intra-abdominal bleeding ( 2.7% Class III PRS vs 0.48% Class II PRS), supra-aponeurotic hematoma ( 5.4% III vs 2.4% II) , dynamic ileus (2.7% III vs 0.96% II) and uro - genital fistulas (5.4% III vs 0.96% II).The late complications were the bladder dysfunction (21.6% III vs 16.35% II) , lower limb lymphedema (13.5% III vs 11.5% II), urethral strictures (10.8% III vs 4.8% II) , incisional hernias ( 8.1% III vs 7.2% II), persistent pelvic pain (18.91% III vs 7.7% II), bowel obstruction (5.4% III vs 1.4% II) and deterioration of sexual function (83.3% III vs 53.8% II). PRS class II radical hysterectomy is associated with fewer complications than PRS class III radical hysterectomy , except for the complications of lymphadenectomy . A new method that might reduce these complications is a selective lymphadenectomy represented by sentinel node biopsy . In conclusion PRS class II radical hysterectomy associated with neoadjuvant radiotherapy is a therapeutic option for the incipient stages of cervical cancer

  14. Preoperative Sleep Disruption and Postoperative Delirium

    PubMed Central

    Leung, Jacqueline M.; Sands, Laura P.; Newman, Stacey; Meckler, Gabriela; Xie, Yimeng; Gay, Caryl; Lee, Kathryn

    2015-01-01

    Study Objectives: To describe preoperative and postoperative sleep disruption and its relationship to postoperative delirium. Design: Prospective cohort study with 6 time points (3 nights pre-hospitalization and 3 nights post-surgery). Setting: University medical center. Patients: The sample consisted of 50 English-speaking patients ≥ 40 years of age scheduled for major non-cardiac surgery, with an anticipated hospital stay ≥ 3 days. Interventions: None. Measurements and results: Sleep was measured before and after surgery for a total of 6 days using a wrist actigraph to quantify movement in a continuous fashion. Postoperative delirium was measured by a structured interview using the Confusion Assessment Method. Sleep variables for patients with (n = 7) and without (n = 43) postoperative delirium were compared using the unpaired Student t-tests or χ2 tests. Repeated measures analysis of variance for the 6 days was used to examine within-subject changes over time and between group differences. The mean age of the patients was 66 ± 11 years (range 43–91 years), and it was not associated with sleep variables or postoperative delirium. The incidence of postoperative delirium observed during any of the 3 postoperative days was 14%. For the 7 patients who subsequently developed postoperative delirium, wake after sleep onset (WASO) as a percentage of total sleep time was significantly higher (44% ± 22%) during the night before surgery compared to the patients who did not subsequently developed delirium (21% ± 20%, p = 0.012). This sleep disruption continued postoperatively, and to a greater extent, for the first 2 nights after surgery. Patients with WASO < 10% did not experience postoperative delirium. Self-reported sleep disturbance did not differ between patients with vs. without postoperative delirium. Conclusions: In this pilot study of adults over 40 years of age, sleep disruption was more severe before surgery in the patients who experienced postoperative

  15. Recovery from post-operative anaemia.

    PubMed

    Wallis, J P; Wells, A W; Whitehead, S; Brewster, N

    2005-10-01

    Acceptance of lower transfusion thresholds and shorter post-operative stays results in patients leaving hospital after surgery with lower haemoglobin (Hb) than previously. We undertook a prospective observational study to assess the haematological response to post-operative anaemia and to determine the utility of quality of life (QoL) measures in assessing the impact of anaemia on such patients. Thirty patients undergoing unilateral hip arthroplasty had blood samples taken and QoL questionnaires administered pre-operatively and at 7, 28 and 56 days post-operatively. Increased erythropoiesis was evident at day 7 post-operatively. Approximately two-thirds of the post-operative Hb deficit was corrected by day 28. There was evidence of functional iron deficiency in more than one-quarter of patients at day 56. QoL scores used did not show any relationship with Hb in the post-operative period. Red cell 2,3-diphosphoglycerate (2,3DPG) levels increased in proportion to the degree of post-operative anaemia. We concluded that substantial recovery of Hb occurs between day 7 and day 28 post-operatively. Complete recovery of Hb may be delayed beyond day 56 due to development of iron deficiency. Patients are at significant risk of developing post-operative iron deficiency depending on operative blood loss and pre-operative iron stores. Increased red cell 2,3DPG may offset the effect of anaemia on oxygen delivery. We found no evidence that anaemia produces a measurable effect on chosen QoL scores in the post-operative period.

  16. Using a Mobile App for Monitoring Post-Operative Quality of Recovery of Patients at Home: A Feasibility Study

    PubMed Central

    Sharpe, Sarah; Murnaghan, M Lucas; Theodoropoulos, John; Metcalfe, Kelly A

    2015-01-01

    Background Mobile apps are being viewed as a new solution for post-operative monitoring of surgical patients. Mobile phone monitoring of patients in the post-operative period can allow expedited discharge and may allow early detection of complications. Objective The objective of the current study was to assess the feasibility of using a mobile app for the monitoring of post-operative quality of recovery at home following surgery in an ambulatory setting. Methods We enrolled 65 consecutive patients (n=33, breast reconstruction surgery; n=32, orthopedic surgery) and asked them to use a mobile phone daily to complete a validated quality of recovery scale (QoR-9) and take photographs of the surgical site for the first 30 days post-op. Surgeons were asked to review patient-entered data on each patient in their roster daily. A semistructured questionnaire was administered to patients and surgeons to assess satisfaction and feasibility of the mobile device. Results All 65 patients completed the study. The mean number of logins was 23.9 (range 7-30) for the breast patients and 19.3 (range 5-30) for the orthopedic patients. The mean number of logins was higher in the first 14 days compared to the 15-30 days post-op for both breast patients (13.4 vs 10.5; P<.001) and for the orthopedic patients (13.4 vs 6.0; P<.001). The mean score for overall satisfaction with using the mobile device was 3.9 for breast patients and 3.7 for orthopedic patients (scored from 1 (poor) to 4 (excellent)). Surgeons reported on the easy-to-navigate design, the portability to monitor patients outside of hospital, and the ability of the technology to improve time efficiency. Conclusions The use of mobile apps for monitoring the quality of recovery in post-operative patients at home was feasible and acceptable to patients and surgeons in the current study. Future large scale studies in varying patient populations are required. PMID:25679749

  17. Postoperative radicular neuroma. Case report.

    PubMed

    Erman, T; Tuna, M; Göçer, A I; Idan, F; Akgül, E; Zorludemir, S

    2001-11-15

    Lumbar discectomy is the most common surgical procedure performed in neurosurgery clinics. Such a large number of procedures underscore not only the prevalence of conditions such as intervertebral disc herniation, but also the strong belief of surgeons that the operation does provide benefits to patients suffering from sciatica. In spite of this belief, sciatic pain may continue after the surgery. The recurrence of sciatic and/or back pain after primary discectomy is called the "failed back surgery syndrome." The rate of the complications involved in standard lumbar discectomy ranges from 5.4 to 14%. One of the complications of the lumbar disc surgery is nerve root injury. The complication rate of this injury ranges from 0.7 to 2.2%. Postoperative radicular neuroma must be considered in differential diagnosis for the patient who has failed back surgery syndrome. In this study the authors evaluate a patient who had undergone surgery for lumbar disc herniation and suffered intractable pain. A traumatic radicular neuroma is demonstrated and the pertinent literature is presented.

  18. Hypothermic anesthesia attenuates postoperative proteolysis.

    PubMed Central

    Johnson, D J; Brooks, D C; Pressler, V M; Hulton, N R; Colpoys, M F; Smith, R J; Wilmore, D W

    1986-01-01

    The catabolic response that commonly occurs after major operation is characterized by net skeletal muscle proteolysis and accelerated nitrogen excretion. This response was absent in patients undergoing cardiac surgical procedures associated with the combination of cardiopulmonary bypass, narcotic anesthesia, neuromuscular blockade, and hypothermia. Forearm nitrogen release was 422 +/- 492 nmol/100 ml X min on the first postoperative day, approximately 25% of preoperative values (1677 +/- 411, p less than 0.05). Nitrogen excretion and the degree of negative nitrogen balance were comparable to levels observed in nonstressed, fasting subjects. The potential role of hypothermia, high-dose fentanyl anesthesia, and neuromuscular blockade in modifying the catabolic response to laparotomy and retroperitoneal dissection was further evaluated in animal studies. Six hours after operation, amino acid nitrogen release from the hindquarter was 84% less than control values (p less than 0.05). Nitrogen excretion and urea production were also reduced compared to normothermic controls. It is concluded that the combination of hypothermia, narcotic anesthesia, and neuromuscular blockade attenuates the catabolic response to injury and thus may be useful in the care of critically ill surgical patients. PMID:3767477

  19. Management of postoperative spinal infections

    PubMed Central

    Hegde, Vishal; Meredith, Dennis S; Kepler, Christopher K; Huang, Russel C

    2012-01-01

    Postoperative surgical site infection (SSI) is a common complication after posterior lumbar spine surgery. This review details an approach to the prevention, diagnosis and treatment of SSIs. Factors contributing to the development of a SSI can be split into three categories: (1) microbiological factors; (2) factors related to the patient and their spinal pathology; and (3) factors relating to the surgical procedure. SSI is most commonly caused by Staphylococcus aureus. The virulence of the organism causing the SSI can affect its presentation. SSI can be prevented by careful adherence to aseptic technique, prophylactic antibiotics, avoiding myonecrosis by frequently releasing retractors and preoperatively optimizing modifiable patient factors. Increasing pain is commonly the only symptom of a SSI and can lead to a delay in diagnosis. C-reactive protein and magnetic resonance imaging can help establish the diagnosis. Treatment requires acquiring intra-operative cultures to guide future antibiotic therapy and surgical debridement of all necrotic tissue. A SSI can usually be adequately treated without removing spinal instrumentation. A multidisciplinary approach to SSIs is important. It is useful to involve an infectious disease specialist and use minimum serial bactericidal titers to enhance the effectiveness of antibiotic therapy. A plastic surgeon should also be involved in those cases of severe infection that require repeat debridement and delayed closure. PMID:23330073

  20. TOLERANCE TO COCAINE’S EFFECTS FOLLOWING CHRONIC ADMINISTRATION OF A DOSE WITHOUT DETECTED EFFECTS ON RESPONSE RATE OR PAUSE

    PubMed Central

    Minervini, Vanessa; Branch, Marc N.

    2014-01-01

    To observe tolerance to drug effects on operant behavior, the dose that researchers have often selected for chronic administration is one that disrupts, but does not abolish, responding. Some evidence suggests that tolerance may develop after chronic administration of relatively smaller doses. The purpose of the present experiment was to assess systematically effects of chronic administration of a dose without detected effect on responding. Specifically, response rates and postreinforcement pauses of five pigeons key pecking under a three-component multiple fixed-ratio schedule of food reinforcement were observed under chronic cocaine administration. We evaluated the effects of a range of doses (1.0 mg/kg to 17.0 mg/kg) during acute administration. The largest dose that failed to alter responding acutely then was administered chronically (1.0 mg/kg for one pigeon, 3.0 mg/kg for three pigeons, and 5.6 mg/kg for one pigeon). After 30 consecutive sessions of chronic administration, smaller and larger doses occasionally were substituted for the chronic dose. Pigeons then received presession saline administration for 30 consecutive sessions, and the postchronic effects of the series of doses on responding were determined. All subjects developed tolerance to doses of cocaine that initially had caused large decreases in rate, with the magnitude of the effects varying across components of the multiple schedule and subjects. Specifically, tolerance generally was greatest in the components with smaller ratios. Following postchronic saline administration, tolerance was usually diminished. Overall, the results demonstrate that under these conditions, repeated experience with disruptive effects of cocaine on food-maintained responding is not a necessary factor in the development of tolerance. PMID:24019029

  1. Deep brain stimulation: postoperative issues.

    PubMed

    Deuschl, Günther; Herzog, Jan; Kleiner-Fisman, Galit; Kubu, Cynthia; Lozano, Andres M; Lyons, Kelly E; Rodriguez-Oroz, Maria C; Tamma, Filippo; Tröster, Alexander I; Vitek, Jerrold L; Volkmann, Jens; Voon, Valerie

    2006-06-01

    Numerous factors need to be taken into account when managing a patient with Parkinson's disease (PD) after deep brain stimulation (DBS). Questions such as when to begin programming, how to conduct a programming screen, how to assess the effects of programming, and how to titrate stimulation and medication for each of the targeted sites need to be addressed. Follow-up care should be determined, including patient adjustments of stimulation, timing of follow-up visits and telephone contact with the patient, and stimulation and medication conditions during the follow-up assessments. A management plan for problems that can arise after DBS such as weight gain, dyskinesia, axial symptoms, speech dysfunction, muscle contractions, paresthesia, eyelid, ocular and visual disturbances, and behavioral and cognitive problems should be developed. Long-term complications such as infection or erosion, loss of effect, intermittent stimulation, tolerance, and pain or discomfort can develop and need to be managed. Other factors that need consideration are social and job-related factors, development of dementia, general medical issues, and lifestyle changes. This report from the Consensus on Deep Brain Stimulation for Parkinson's Disease, a project commissioned by the Congress of Neurological Surgeons and the Movement Disorder Society, outlines answers to a series of questions developed to address all aspects of DBS postoperative management and decision-making with a systematic overview of the literature (until mid-2004) and by the expert opinion of the authors. The report has been endorsed by the Scientific Issues Committee of the Movement Disorder Society and the American Society of Stereotactic and Functional Neurosurgery.

  2. [Postoperative complications in plastic surgery].

    PubMed

    Vogt, P M

    2009-09-01

    aspects of postoperative complication management in plastic surgery.

  3. A Pregnant Pause?

    ERIC Educational Resources Information Center

    Zirkel, Perry A.

    2001-01-01

    In a case involving a swim-team student's mandatory pregnancy test and a varsity coach's mishandling of confidentiality, the Third Circuit Court of Appeals awarded the coach qualified immunity, while rejecting the student's Fourth and First Amendment claims. Discretion and legal counsel would have helped. (MLH)

  4. Postoperative Delirium in the Geriatric Patient

    PubMed Central

    Schenning, Katie J.; Deiner, Stacie G.

    2015-01-01

    SYNOPSIS Postoperative delirium, a common complication in older surgical patients, is independently associated with increased morbidity and mortality. Patients over the age of 65 years receive greater than 1/3 of the over 40 million anesthetics delivered yearly in the United States. This number is expected to increase with the aging of the population. Thus, it is increasingly important that perioperative clinicians who care for geriatric patients have an understanding of the complex syndrome of postoperative delirium. PMID:26315635

  5. Epidural Analgesia in the Postoperative Period

    DTIC Science & Technology

    2001-10-01

    an unwanted side effect of surgery, and is associated with many postoperative complications. This descriptive study was conducted to determine which...surgical patients experienced the most analgesia with the fewest side effects when receiving epidural analgesia in the postoperative period. A...hospital. A description of the patients age, gender, type of surgery, type of epidural medication, side effects , incidence of breakthrough pain, and

  6. [Caloric substrates in postoperative parenteral nutrition].

    PubMed

    De Salvo, L; Romairone, E; Ansaldo, G L; Mattioli, G

    1991-05-31

    The paper describes the carbohydrate, lipidic and nitrogen metabolism of the postoperative period which is subdivided into an early and a late phase. Since the metabolism of caloric substrates in the early postoperative period is a stress metabolism with glucose intolerance and wide protein catabolism, the authors emphasise that an insufficient caloric intake is worse than the fasting state and suggest that alternative caloric sources, such as branched chain amino acids, fatty acids and, even, ketonic bodies, should be used.

  7. L1/Laminin modulation of growth cone response to EphB triggers growth pauses and regulates the microtubule destabilizing protein SCG10.

    PubMed

    Suh, Leejee H; Oster, Stephen F; Soehrman, Sophia S; Grenningloh, Gabriele; Sretavan, David W

    2004-02-25

    During development, EphB proteins serve as axon guidance molecules for retinal ganglion cell axon pathfinding toward the optic nerve head and in midbrain targets. To better understand the mechanisms by which EphB proteins influence retinal growth cone behavior, we investigated how axon responses to EphB were modulated by laminin and L1, two guidance molecules that retinal axons encounter during in vivo pathfinding. Unlike EphB stimulation in the presence of laminin, which triggers typical growth cone collapse, growth cones co-stimulated by L1 did not respond to EphB. Moreover, EphB exposure in the presence of both laminin and L1 resulted in a novel growth cone inhibition manifested as a pause in axon elongation with maintenance of normal growth cone morphology and filopodial activity. Pauses were not associated with loss of growth cone actin but were accompanied by a redistribution of the microtubule cytoskeleton with increased numbers of microtubules extending into filopodia and to the peripheral edge of the growth cone. This phenomenon was accompanied by reduced levels of the growth cone microtubule destabilizing protein SCG10. Antibody blockade of SCG10 function in growth cones resulted in both changes in microtubule distribution and pause responses mirroring those elicited by EphB in the presence of laminin and L1. These results demonstrate that retinal growth cone responsiveness to EphB is regulated by co-impinging signals from other axon guidance molecules. Furthermore, the results are consistent with EphB-mediated axon guidance mechanisms that involve the SCG10-mediated regulation of the growth cone microtubule cytoskeleton.

  8. P-TEFb, the Super Elongation Complex and Mediator Regulate a Subset of Non-paused Genes during Early Drosophila Embryo Development

    PubMed Central

    Dahlberg, Olle; Shilkova, Olga; Tang, Min; Holmqvist, Per-Henrik; Mannervik, Mattias

    2015-01-01

    Positive Transcription Elongation Factor b (P-TEFb) is a kinase consisting of Cdk9 and Cyclin T that releases RNA Polymerase II (Pol II) into active elongation. It can assemble into a larger Super Elongation Complex (SEC) consisting of additional elongation factors. Here, we use a miRNA-based approach to knock down the maternal contribution of P-TEFb and SEC components in early Drosophila embryos. P-TEFb or SEC depletion results in loss of cells from the embryo posterior and in cellularization defects. Interestingly, the expression of many patterning genes containing promoter-proximal paused Pol II is relatively normal in P-TEFb embryos. Instead, P-TEFb and SEC are required for expression of some non-paused, rapidly transcribed genes in pre-cellular embryos, including the cellularization gene Serendipity-α. We also demonstrate that another P-TEFb regulated gene, terminus, has an essential function in embryo development. Similar morphological and gene expression phenotypes were observed upon knock down of Mediator subunits, providing in vivo evidence that P-TEFb, the SEC and Mediator collaborate in transcription control. Surprisingly, P-TEFb depletion does not affect the ratio of Pol II at the promoter versus the 3’ end, despite affecting global Pol II Ser2 phosphorylation levels. Instead, Pol II occupancy is reduced at P-TEFb down-regulated genes. We conclude that a subset of non-paused, pre-cellular genes are among the most susceptible to reduced P-TEFb, SEC and Mediator levels in Drosophila embryos. PMID:25679530

  9. Tachy-Brady Arrhythmias: The Critical Role of Adenosine-induced Sino-Atrial Conduction Block in Post-Tachycardia Pauses

    PubMed Central

    Lou, Qing; Glukhov, Alexey V.; Hansen, Brian; Hage, Lori; Vargas-Pinto, Pedro; Billman, George E.; Carnes, Cynthia A.; Fedorov, Vadim V.

    2012-01-01

    Background In patients with sinoatrial nodal (SAN) dysfunction, atrial pauses lasting several seconds may follow rapid atrial pacing or paroxysmal tachycardia (tachy-brady arrhythmias). Clinical studies suggest that adenosine may play an important role in SAN dysfunction, but the mechanism remains unclear. Objective To define the mechanism of SAN dysfunction induced by the combination of adenosine and tachycardia. Methods We studied the mechanism of SAN dysfunction produced by a combination of adenosine and rapid atrial pacing in isolated coronary-perfused canine atrial preparations using high-resolution optical mapping (n=9). Sinus cycle length (SCL) and sinoatrial conduction time (SACT) were measured during adenosine (1–100μM) and 1μM DPCPX (A1 receptor antagonist, n=7) perfusion. Sinoatrial node recovery time was measured after one minute of “slow” pacing (3.3Hz) or tachypacing (7–9Hz). Results Adenosine significantly increased SCL (477±62 vs. 778±114 ms, p<0.01), and SACT during sinus rhythm (41±11 vs. 86±16 ms, p<0.01) dose-dependently. Adenosine dramatically affected SACT of the first SAN beat after tachypacing (41±5 vs. 221±98ms, p<0.01). Moreover, at high concentrations of adenosine (10–100μM), termination of tachypacing or atrial flutter/fibrillation produced atrial pauses of 4.2±3.4 seconds (n=5) due to conduction block between the SAN and atria, despite a stable SAN intrinsic rate. Conduction block was preferentially related to depressed excitability in SAN conduction pathways. Adenosine-induced changes were reversible upon washout or DPCPX treatment. Conclusions These data directly demonstrate that adenosine contributes to post-tachycardia atrial pauses through SAN exit block rather than slowed pacemaker automaticity. Thus, these data suggest an important modulatory role of adenosine in tachy-brady syndrome. PMID:22985657

  10. Incidence, Predictors, and Clinical Outcomes of Postoperative Cardiac Tamponade in Patients Undergoing Heart Valve Surgery.

    PubMed

    You, Seng Chan; Shim, Chi Young; Hong, Geu-Ru; Kim, Darae; Cho, In Jeong; Lee, Sak; Chang, Hyuck-Jae; Ha, Jong-Won; Chang, Byung-Chul; Chung, Namsik

    2016-01-01

    This study aimed to investigate the incidence, predictors, and clinical outcomes of cardiac tamponade after heart valve surgery. A total of 556 patients who underwent heart valve surgery in a single tertiary center between January 2010 and March 2012 were studied. All patients underwent transthoracic echocardiography (TTE) about 5 days after surgery and TTE was repeated regularly. Patients with suspected acute pericardial hemorrhage were excluded. Cardiac tamponade occurred in twenty-four (4.3%) patients and all underwent surgical or percutaneous pericardial drainage. The median time of pericardial drainage after surgery was 17 (interquartile range, IQR, 13-30) days. Infective endocarditis, mechanical valve replacement of aortic or mitral valve, and any amount of pericardial effusion (PE) on the first postoperative TTE were related to the occurrence of cardiac tamponade (all p<0.05). After multivariate adjustment, occurrence of cardiac tamponade was associated with any amount of PE on the first postoperative TTE (hazard ratio, HR, 14.00, p<0.001) and mechanical valve replacement (HR 2.69, p = 0.025). The mean hospital days in patients with cardiac tamponade was higher than those without (34.9 vs. 13.5, p = 0.031). After pericardial drainage, there was no echocardiographic recurrence of significant PE during a median of 34.8 (IQR 14.9-43.7) months after surgery. Cardiac tamponade after heart valve surgery is not uncommon. Patients with any amount of PE at the first postoperative TTE or mechanical valve replacement should receive higher attention with regard to the occurrence of cardiac tamponade. Although it prolongs hospital stay, cardiac tamponade exhibits a benign clinical course without recurrence after timely intervention.

  11. Incidence, Predictors, and Clinical Outcomes of Postoperative Cardiac Tamponade in Patients Undergoing Heart Valve Surgery

    PubMed Central

    You, Seng Chan; Shim, Chi Young; Hong, Geu-Ru; Kim, Darae; Cho, In Jeong; Lee, Sak; Chang, Hyuck-Jae; Ha, Jong-Won; Chang, Byung-Chul; Chung, Namsik

    2016-01-01

    This study aimed to investigate the incidence, predictors, and clinical outcomes of cardiac tamponade after heart valve surgery. A total of 556 patients who underwent heart valve surgery in a single tertiary center between January 2010 and March 2012 were studied. All patients underwent transthoracic echocardiography (TTE) about 5 days after surgery and TTE was repeated regularly. Patients with suspected acute pericardial hemorrhage were excluded. Cardiac tamponade occurred in twenty-four (4.3%) patients and all underwent surgical or percutaneous pericardial drainage. The median time of pericardial drainage after surgery was 17 (interquartile range, IQR, 13–30) days. Infective endocarditis, mechanical valve replacement of aortic or mitral valve, and any amount of pericardial effusion (PE) on the first postoperative TTE were related to the occurrence of cardiac tamponade (all p<0.05). After multivariate adjustment, occurrence of cardiac tamponade was associated with any amount of PE on the first postoperative TTE (hazard ratio, HR, 14.00, p<0.001) and mechanical valve replacement (HR 2.69, p = 0.025). The mean hospital days in patients with cardiac tamponade was higher than those without (34.9 vs. 13.5, p = 0.031). After pericardial drainage, there was no echocardiographic recurrence of significant PE during a median of 34.8 (IQR 14.9–43.7) months after surgery. Cardiac tamponade after heart valve surgery is not uncommon. Patients with any amount of PE at the first postoperative TTE or mechanical valve replacement should receive higher attention with regard to the occurrence of cardiac tamponade. Although it prolongs hospital stay, cardiac tamponade exhibits a benign clinical course without recurrence after timely intervention. PMID:27855225

  12. Kidney Function Alters the Relationship between Postoperative Troponin T Level and Death

    PubMed Central

    Wang, Chew-Yin; Ong, Gracie S.Y.; Tan, Alvin S.B.; Mansor, Marzida; Shariffuddin, Ina I.; Hashim, Noorjahan H.M.; Lai, Hou Yee; Undok, A. Wahab; Kolandaivel, Ushananthini N.; Vajiravelu, Vasanthan; Garg, Amit X.; Cuerden, Meaghan; Guyatt, Gordon; Thabane, Lehana; Mooney, John; Lee, Vincent; Chow, Clara; Devereaux, Phillip J.

    2015-01-01

    Cardiac troponin T (cTnT), even at low concentrations, is a risk factor for 30-day mortality in patients undergoing noncardiac surgery, but it is uncertain whether that risk is generalizable to patients with poor kidney function. We, therefore, evaluated the relationship between cTnT concentration and kidney function on the outcome of 30-day mortality in a post hoc analysis of a prospective cohort study of patients undergoing noncardiac surgery. cTnT was measured for 3 days after surgery and considered abnormal if the peak was ≥0.02 ng/ml. Of the included 14,037 patients, 267 (1.9%) patients died within 30 days of surgery. The adjusted hazard ratios for death with an abnormal cTnT concentration were 4.37 (95% confidence intervals [95% CI], 3.21 to 6.22), 6.15 (95% CI, 2.95 to 140.9), 6.30 (95% CI, 3.12 to 21.23), 1.33 (95% CI, 0.56 to 4.85), and 1.46 (95% CI, 0.46 to 9.21) for eGFR≥60, 45 to <60, 30 to <45, 15 to <30, and <15 ml/min per 1.73 m2 or on dialysis, respectively. Compared with patients with eGFR≥60 ml/min per 1.73 m2, the adjusted hazard ratio was significantly lower for patients with eGFR=15 to <30 ml/min per 1.73 m2 (interaction P value=0.02). Redefining abnormal cTnT concentration as ≥0.03 ng/ml or a change of ≥0.02 ng/ml did not alter results. Because the risk associated with postoperative cTnT levels may be different for patients with eGFR<30 ml/min per 1.73 m2, additional research is required to determine how to interpret perioperative cTnT values for patients with low kidney function. PMID:25711126

  13. Nursing documentation of postoperative pain management.

    PubMed

    Idvall, Ewa; Ehrenberg, Anna

    2002-11-01

    Previous studies have shown that nursing documentation is often deficient in its recording of pain assessment and treatment. In Sweden, documentation of the care process, including assessment, is a legal obligation. The aim of this study was to describe nursing documentation of postoperative pain management and nurses' perceptions of the records in relation to current regulations and guidelines. The sample included nursing records of postoperative care on the second postoperative day from 172 patients and 63 Registered Nurses from surgical wards in a central county hospital in Sweden. The records were reviewed for content and comprehensiveness based on regulations and guidelines for postoperative pain management. Three different auditing instruments were used. The nurses were asked if the documentation concurred with current regulations and guidelines. The result showed that pain assessment was based mainly on patients' self-report, but less than 10% of the records contained notes on systematic assessment with a pain assessment instrument. Pain location was documented in 50% of the records and pain character in 12%. About 73% of the nurses reported that the documentation concurred with current regulations and guidelines. The findings indicate that significant flaws existed in nurses' recording of postoperative pain management, of which the nurses were not aware.

  14. Mice expressing an error-prone DNA polymerase in mitochondria display elevated replication pausing and chromosomal breakage at fragile sites of mitochondrial DNA

    PubMed Central

    Bailey, Laura J.; Cluett, Tricia J.; Reyes, Aurelio; Prolla, Tom A.; Poulton, Joanna; Leeuwenburgh, Christiaan; Holt, Ian J.

    2009-01-01

    Expression of a proof-reading deficient form of mitochondrial DNA (mtDNA) polymerase γ, POLG, causes early death accompanied by features of premature ageing in mouse. However, the mechanism of cellular senescence remains unresolved. In addition to high levels of point mutations of mtDNA, the POLG mutator mouse harbours linear mtDNAs. Using one- and two-dimensional agarose gel electrophoresis, we show that the linear mtDNAs derive from replication intermediates and are indicative of replication pausing and chromosomal breakage at the accompanying fragile sites. Replication fork arrest is not random but occurs at specific sites close to two cis-elements known as OH and OL. Pausing at these sites may be enhanced in the case of exonuclease-deficient POLG owing to delayed resumption of DNA replication, or replisome instability. In either case, the mtDNA replication cycle is perturbed and this might explain the progeroid features of the POLG mutator mouse. PMID:19244310

  15. How laser damage resistance of HfO2/SiO2 optical coatings is affected by embedded contamination caused by pausing the deposition process

    NASA Astrophysics Data System (ADS)

    Field, Ella; Bellum, John; Kletecka, Damon

    2015-07-01

    Reducing contamination is essential for producing optical coatings with high resistance to laser damage. One aspect of this principle is to make every effort to limit long interruptions during the coating's deposition. Otherwise, contamination may accumulate during the pause and become embedded in the coating after the deposition is restarted, leading to a lower laser-induced damage threshold (LIDT). However, pausing a deposition is sometimes unavoidable, despite our best efforts. For example, a sudden hardware or software glitch may require hours or even overnight to solve. In order to broaden our understanding of the role of embedded contamination on LIDT, and determine whether a coating deposited under such non-ideal circumstances could still be acceptable, this study explores how halting a deposition overnight impacts the LIDT, and whether ion cleaning can be used to mitigate any negative effects on the LIDT. The coatings investigated are a beam splitter design for high reflection at 1054 nm and high transmission at 527 nm, at 22.5° angle of incidence in S-polarization. LIDT tests were conducted in the nanosecond regime.

  16. VLAP: results immediately post-op

    NASA Astrophysics Data System (ADS)

    Cowles, Robert S.

    1996-05-01

    Visual laser ablation of the prostate (VLAP) has been shown to be as effective with fewer complications than TURP in the treatment of bladder outlet obstruction secondary to benign prostatic hyperplasia. Questions have been raised about VLAP regarding prolonged irritative and obstructive voiding symptoms postoperatively. It is postulated that these symptoms are due to the slow slough of necrotic debris following VLAP. In an effort to improve upon the technique of VLAP, patients underwent lasing of the prostate in the routine manner (2, 4, 8, and 10 o'clock positions with sixty watts for sixty seconds) using Nd:YAG free beam energy. A bladder neck incision was then performed using a contact laser fiber. International prostate symptom score assessments were done preoperatively; one week and six weeks postoperatively. Post void residual urine volumes and prostate size were also evaluated. The findings indicate that symptom scores and post void residual urine volumes have significantly improved within ten days postoperatively using this technique.

  17. Postoperative maladaptive behavioral changes in children.

    PubMed

    Yuki, Koichi; Daaboul, Dima G

    2011-06-01

    Induction of anesthesia can be a very stressful period for a child and his family and can be associated with increased risk of psychological disturbances. These disturbances are categorized as preoperative anxiety, emergence delirium and postoperative behavioral changes. Several tools have been developed to measure these psychological manifestations as well as the baseline personality traits of these patients. Postoperative negative behavioral changes, such as sleep and eating disorders, separation anxiety, temper tantrum, aggression toward authorities, may occur in up to 60% of all children undergoing general anesthesia. Several studies found a strong association between these postoperative behavioral changes, the distress of the child on induction and his individual personality characteristics, although a cause-effect relationship could not be determined. Understanding the risk factors for behavior changes helps us determine the best way for prevention and treatment of these changes in the perioperative period.

  18. Management of postoperative complications: general approach.

    PubMed

    Sanguineti, V Ana; Wild, Jason R; Fain, Mindy J

    2014-05-01

    The goal of postoperative management is to promote early mobility and avoid postoperative complications, recognizing the potentially devastating impact of complications on elderly patients with hip fracture. The recommended approach involves early mobilization; freedom from tethers (indwelling urinary catheters and other devices); effective pain control; treating malnutrition; preventing pressure ulcers; reducing risk for pulmonary, urinary, and wound infections; and managing cognition. This carefully structured and patient-centered management provides older, vulnerable patients their best chance of returning to their previous level of functioning as quickly and safety as possible.

  19. Pathogenesis of postoperative oral surgical pain.

    PubMed Central

    Ong, Cliff K. S.; Seymour, R. A.

    2003-01-01

    Pain is a major postoperative symptom in many oral surgical procedures. It is a complex and variable phenomenon that can be influenced by many factors. Good management of oral surgical pain requires a detailed understanding of the pathogenesis of surgical pain. This article aims at reviewing postoperative pain from a broad perspective by looking into the nociception, neuroanatomy, neurophysiology, and neuropharmacology of pain. Therapeutic recommendations are made after reviewing the evidence from the literature for maximizing the efficacy of pain management techniques for oral surgical pain. PMID:12722900

  20. Postoperative global amnesia reversed with flumazenil.

    PubMed

    Rinehart, Joseph B; Baker, Brandee; Raphael, Darren

    2012-07-01

    Global postoperative amnesia (profound anterograde and retrograde amnesia) is rare and usually attributed to transient global amnesia-a poorly understood condition with no broadly accepted mechanism. We report an incident of probable transient global amnesia in a patient after endoscopic retrograde cholangiopancreatogram under general anesthesia, which was successfully treated with flumazenil. On the basis of the results of flumazenil administration in this and a previous case report, we would recommend a trial dose of 0.2 mg for cases of global postoperative amnesia, repeated if the first dose seems effective.

  1. Air leakage on the postoperative day: powerful factor of postoperative recurrence after thoracoscopic bullectomy

    PubMed Central

    Jeon, Hyun Woo; Kye, Yeo Kon; Kim, Kyung Soo

    2016-01-01

    Background Primary spontaneous pneumothorax (PSP) is a relatively common disorder in young patients. Although various surgical techniques have been introduced, recurrence after video-assisted thoracoscopic surgery (VATS) remains high. The aim of study was to identify the risk factors for postoperative recurrence after thoracoscopic bullectomy in the spontaneous pneumothorax. Methods From January 2011 through March 2013, two hundreds and thirty two patients underwent surgery because of pneumothorax. Patients with a secondary pneumothorax, as well as cases of single port surgery, an open procedure, additional pleural procedure (pleurectomy, pleural abrasion) or lack of medical records were excluded. The records of 147 patients with PSP undergoing 3-port video-assisted thoracoscopic bullectomy with staple line coverage using an absorbable polyglycolic acid (PGA) sheet were retrospectively reviewed. Results The median age was 19 years (range, 11−34 years) with male predominance (87.8%). Median postoperative hospital stay was 3 days (range, 1−10 days) without mortality. Complications were developed in five patients. A total of 24 patients showed postoperative recurrence (16.3%). Younger age less than 17 years old and immediate postoperative air leakage were risk factors for postoperative recurrence after thoracoscopic bullectomy by multivariate analysis. Conclusions Immediate postoperative air leakage was the risk factor for postoperative recurrence. However, further study will be required for the correlation of air leakage with recurrence. PMID:26904217

  2. Postoperative chylothorax: a case for recycling?

    PubMed

    Thomson, I A; Simms, M H

    1993-08-01

    Postoperative chylothorax in a patient who was rapidly deteriorating despite conservative treatment is described. A system of recycling chyle from the pleural space through a filter and pump into the subclavian vein is discussed. The history of reinfusion of chyle is reviewed.

  3. Postoperative nausea and vomiting following orthognathic surgery

    PubMed Central

    Phillips, C.; Brookes, C. D.; Rich, J.; Arbon, J.; Turvey, T. A.

    2015-01-01

    The purpose of this study was to assess the incidence and risk factors associated with postoperative nausea (PON) and vomiting (POV) after orthognathic surgery. A review of the clinical records of consecutively enrolled subjects (2008–2012) at a single academic institution was conducted between 9/2013 and 3/2014. Data on the occurrence of PON and POV and potential patient-related, intraoperative, and postoperative explanatory factors were extracted from the medical records. Logistic models were used for the presence/absence of postoperative nausea and vomiting separately. Data from 204 subjects were analyzed: 63% were female, 72% Caucasian, and the median age was 19 years. Thirty-three percent had a mandibular osteotomy alone, 27% a maxillary osteotomy alone, and 40% had bimaxillary osteotomies. Sixty-seven percent experienced PON and 27% experienced POV. The most important risk factors for PON in this series were female gender, increased intravenous fluids, and the use of nitrous oxide, and for POV were race, additional procedures, and morphine administration. The incidence of PON and POV following orthognathic surgery in the current cohort of patients, after the introduction of the updated 2007 consensus guidelines for the management of postoperative nausea and vomiting, has not decreased substantially from that reported in 2003–2004. PMID:25655765

  4. Combining the ASA Physical Classification System and Continuous Intraoperative Surgical Apgar Score Measurement in Predicting Postoperative Risk.

    PubMed

    Jering, Monika Zdenka; Marolen, Khensani N; Shotwell, Matthew S; Denton, Jason N; Sandberg, Warren S; Ehrenfeld, Jesse Menachem

    2015-11-01

    The surgical Apgar score predicts major 30-day postoperative complications using data assessed at the end of surgery. We hypothesized that evaluating the surgical Apgar score continuously during surgery may identify patients at high risk for postoperative complications. We retrospectively identified general, vascular, and general oncology patients at Vanderbilt University Medical Center. Logistic regression methods were used to construct a series of predictive models in order to continuously estimate the risk of major postoperative complications, and to alert care providers during surgery should the risk exceed a given threshold. Area under the receiver operating characteristic curve (AUROC) was used to evaluate the discriminative ability of a model utilizing a continuously measured surgical Apgar score relative to models that use only preoperative clinical factors or continuously monitored individual constituents of the surgical Apgar score (i.e. heart rate, blood pressure, and blood loss). AUROC estimates were validated internally using a bootstrap method. 4,728 patients were included. Combining the ASA PS classification with continuously measured surgical Apgar score demonstrated improved discriminative ability (AUROC 0.80) in the pooled cohort compared to ASA (0.73) and the surgical Apgar score alone (0.74). To optimize the tradeoff between inadequate and excessive alerting with future real-time notifications, we recommend a threshold probability of 0.24. Continuous assessment of the surgical Apgar score is predictive for major postoperative complications. In the future, real-time notifications might allow for detection and mitigation of changes in a patient's accumulating risk of complications during a surgical procedure.

  5. Patient characteristics associated with increased postoperative length of stay and readmission after elective laminectomy for lumbar spinal stenosis

    PubMed Central

    Basques, Bryce A.; Varthi, Arya G.; Golinvaux, Nicholas S.; Bohl, Daniel D.; Grauer, Jonathan N.

    2014-01-01

    Study Design Retrospective cohort. Objective To identify factors that were independently associated with increased postoperative length of stay (LOS) and readmission in patients who underwent elective laminectomy for lumbar spinal stenosis (LSS). Summary of Background Data LSS is a common pathology that is traditionally treated with decompressive laminectomy. Risk factors associated with increased LOS and readmission have not been fully characterized for laminectomy. Methods Patients who underwent laminectomy for LSS during 2011 and 2012 were identified from the American College of Surgeons National Surgical Quality Improvement Program (ACS-NSQIP) database. Patient characteristics were tested for association with LOS and readmission using bivariate and multivariate analyses. Patients with LOS > 10 days were excluded from the readmission analysis as the ACS-NSQIP only captures readmissions within 30 postoperative days, and the window for potential readmission was deemed too short for patients staying longer than 10 days. Results A total of 2,358 laminectomy patients met inclusion criteria. The average age was 66.4 ± 11.7 years (mean ± standard deviation). Average postoperative LOS was 2.1 ± 2.6 days. Of those meeting criteria for readmission analysis, 3.7% of patients (86 of 2,339) were readmitted within 30 days postoperatively. Independent risk factors for prolonged LOS were increased age (p < 0.001), increased body mass index (p = 0.004), American Society of Anesthesiologists class 3–4 (p = 0.005), and preoperative hematocrit < 36.0 (p = 0.001). Independent risk factors for readmission were increased age (p = 0.013), increased body mass index (p = 0.040), ASA class 3–4 (p < 0.001), and steroid use (p = 0.001). The most common reason for readmission was surgical site-related infections (25.0% of patients readmitted in 2012). Conclusion The identified factors associated with LOS and readmission following lumbar laminectomy may be useful for optimizing patient

  6. Postoperative red blood cell transfusion strategy in frail anemic elderly with hip fracture. A randomized controlled trial.

    PubMed

    Gregersen, Merete

    2016-04-01

    Hip fracture in the elderly is associated with poor recovery from physical disability and mortality. Perioperative blood loss is common, and anemia might be fatal in the frail elderly. Red blood cell transfusions might increase the risk of infection. In an observational study, a liberal transfusion strategy with hemoglobin (Hb) target of 7 mmol/l (11.3 g/dl) seemed to improve survival in nursing home residents with hip fracture compared to the recommended restrictive strategy with a Hb target of 6 mmol/l (9.7 g/dl) according to the Danish Health Authority. Our aim was to compare these two strategies in the frail elderly in a randomized controlled trial on the outcomes: recovery from physical disabilities, mortality, infection, infection biomarkers, and overall Quality of Life (OQoL). We included 284 elderly admitted to hospital for surgical hip fracture repair from nursing homes or sheltered housing facilities. The anemic patients were assigned postoperatively to the liberal or the restrictive transfusion strategy. Randomization divided each transfusion group into two equal blocks with regard to type of the residence. Hb was measured daily during the first three postoperative days, at least once during the following 4-6 days, then at least once a week during the subsequent three weeks. The transfusions were administered according to group assignments, but no later than 24 hours after the Hb determination, one unit at a time, and no more than two units per day. The intervention lasted for 30 days after surgery. Outcome measurements were performed on days 10, 30, 90, and 365. Blinded assessors evaluated physical performance and OQoL. The liberal transfusion strategy did not improve recovery from physical disabilities, mortality, infection rate, or OQoL compared to the restrictive strategy. However, in nursing home residents, 90-day mortality rate (20%) following the liberal strategy was statistically significantly lower than that (36%) after the restrictive strategy

  7. Postoperative adjuvant therapy of breast cancer. Oncology Overview

    SciTech Connect

    Not Available

    1984-12-01

    Oncology Overviews are a service of the International Cancer Research Data Bank (ICRDB) Program of the National Cancer Institute, intended to facilitate and promote the exchange of information between cancer scientists by keeping them aware of literature related to their research being published by other laboratories throughout the world. Each Oncology Overview represents a survey of the literature associated with a selected area of cancer research. It contains abstracts of articles which have been selected and organized by researchers associated with the field. Contents: Postoperative chemotherapy; Postoperative radiotherapy; Postoperative hormone therapy; Postoperative immunotherapy and chemoimmunotherapy; Postoperative multimodal therapy; Prognostic factors in postoperative adjuvant therapy.

  8. Development and implementation of a dedicated postoperative evaluation service to improve compliance of postoperative visits

    PubMed Central

    Vacanti, Joshua Charles; Urman, Richard Dennis; Sarin, Pankaj; Liu, Xiaoxia; Kodali, Bhavani Shankar

    2015-01-01

    Background and Aims: Postoperative patient evaluation is an integral component of perioperative care. An audit of our anesthesia department's records demonstrated a compliance rate of <50%. We postulated that the development of clinical anesthesia service dedicated to performing such evaluations would improve compliance significantly. Materials and Methods: This retrospective study examined postoperative follow-up completion rate at a large academic center. Data were collected from 58,000 anesthetics during three periods, between each of which an intervention was introduced. The first period examined completion rate when postoperative evaluations were left to the team performing the anesthetic. During the second period, this task was delegated to groups of anesthesiologists based on surgical subspecialty; these smaller groups utilized rotating residents. The third period examined completion rate after implementation of a postoperative evaluation service. All periods utilized the department's electronics database to identify operative patients. The number of adverse anesthesia events reported was also recorded. Results: A significant difference in the proportions of compliance with postoperative evaluations among all three periods was detected. Compliance was 47% during period one and improved to 66% during period two. During period three, which employed a postoperative evaluation service, compliance was 83%. The number of adverse events reported per month increased significantly following the first study period from 95 reported monthly events to 215 and 201 in the second and third periods, respectively. Conclusion: By creating a dedicated postoperative evaluation service using available technology, we improved postoperative evaluation completion rate from 47% to 83%, and demonstrated a significant increase in the number of adverse events reported. Based on this, we support the deployment of a dedicated service as a quality improvement initiative. PMID:25788778

  9. Minocycline improves postoperative cognitive impairment in aged mice by inhibiting astrocytic activation.

    PubMed

    Jin, Wen-Jie; Feng, Shan-Wu; Feng, Zhou; Lu, Shun-Mei; Qi, Tao; Qian, Yan-Ning

    2014-01-08

    Astrocytes are proving to be critical for the development of cognitive functions. In addition, astrocytic activation contributes to cognitive impairment induced by chronic cerebral hypoperfusion. Minocycline has been shown to exhibit long-term neuroprotective effects in vascular cognitive impairment rat models through the inhibition of astrogliosis, and has demonstrated potential for the prevention and treatment of postoperative cognitive decline in elderly patients. This study aimed to examine the effect of minocycline on hippocampal astrocytes and long-term postoperative cognitive dysfunction in aged mice. Mice were intraperitoneally injected with 45 mg/kg minocycline once a day for 30 days after 70% hepatectomy. Hippocampus-dependent spatial memory ability was evaluated using the Morris water maze test. The expression levels of hippocampal glial fibrillary acidic protein (GFAP) and ionized calcium-binding adaptor molecule-1 were evaluated by western blotting, and the hippocampal mRNA relative expression levels of tumor necrosis factor-α, interleukin-1β, and interleukin-6 were tested using real-time PCR. The Morris water maze test showed that escape latency and swim distance were significantly prolonged by the surgery, but the extent of impairment was mitigated by minocycline treatment. Hippocampal GFAP levels and mRNA levels of tumor necrosis factor-α, interleukin-1β, and interleukin-6 showed corresponding changes that were consistent with the variations in spatial memory. Minocycline was able to alleviate hepatectomy-related long-term spatial memory impairment in aged mice, and was associated with reduced levels of hippocampal GFAP and proinflammatory cytokines resulting from astrocytic activation.

  10. Factors affecting postoperative range of motion after total knee arthroplasty.

    PubMed

    Gatha, Nehal M; Clarke, Henry D; Fuchs, Robin; Scuderi, Giles R; Insall, John N

    2004-10-01

    One hundred thirty five patients with osteoarthritis who underwent total knee arthroplasty (TKA) were evaluated to determine whether specific pre- and postoperative variables were correlated with the postoperative range of motion. Age, sex, pre- and postoperative range of motion, pre- and postoperative Knee Society scores, intraoperative patellar thickness before and after resurfacing, pre- and postoperative radiographic patellar height (as determined by the Insall-Salvati and Blackburn-Peel ratios), and preoperative radiographic alignment were recorded for each patient. Regression analysis was performed to identify whether any variables were correlated with the postoperative range of motion or Knee Society scores. The only variable that was significantly correlated with postoperative range of motion was the preoperative range of motion. This study suggests that among the variables evaluated, the preoperative range of motion was the only significant predictor of postoperative range of motion.

  11. [The endoscopic management of postoperative biliary fistulae].

    PubMed

    Uribarrena, R; Simón, M A; Sebastián, J J; Gomollón, F; Bajador, E; Botella, M T; Cabrera, T

    1994-10-01

    We report a series of 15 patients with a postoperative biliary fistula treated by endoscopic sphincterotomy. The exact location of the bile leak was revealed by ERCP in 13 cases (87%): cystic duct remnant in 6 (39%), intrahepatic biliary tree in 4 (26%), and main bile duct in 3 (20%). In all cases a distal obstacle (ie: retained stones, hydatid material) to bile flow was also found in ERCP. Treatment consisted of endoscopic sphincterotomy and subsequent removal of the distal obstacle, and could be completed in 13 (87%) cases. In our experience the treatment of postoperative biliary fistula with a distal obstruction bile flow by endoscopic sphincterotomy is a safe and effective procedure, and should be recommended as the first option in those patients.

  12. Post-operative pulmonary complications after thoracotomy

    PubMed Central

    Sengupta, Saikat

    2015-01-01

    Pulmonary complications are a major cause of morbidity and mortality in the post-operative period after thoracotomy. The type of complications and the severity of complications depend on the type of thoracic surgery that has been performed as well as on the patient's pre-operative medical status. Risk stratification can help in predicting the possibility of the post-operative complications. Certain airway complications are more prone to develop with thoracic surgery. Vocal cord injuries, bronchopleural fistulae, pulmonary emboli and post-thoracic surgery non-cardiogenic pulmonary oedema are some of the unique complications that occur in this subset of patients. The major pulmonary complications such as atelectasis, bronchospasm and pneumonia can lead to respiratory failure. This review was compiled after a search for search terms within ‘post-operative pulmonary complications after thoracic surgery and thoracotomy’ on search engines including PubMed and standard text references on the subject from 2000 to 2015. PMID:26556921

  13. Modeling the Temporal Evolution of Postoperative Complications

    PubMed Central

    Feld, Shara I.; Cobian, Alexander G.; Tevis, Sarah E.; Kennedy, Gregory D.; Craven, Mark W.

    2016-01-01

    Post-operative complications have a significant impact on patient morbidity and mortality; these impacts are exacerbated when patients experience multiple complications. However, the task of modeling the temporal sequencing of complications has not been previously addressed. We present an approach based on Markov chain models for characterizing the temporal evolution of post-operative complications represented in the American College of Surgeons National Surgery Quality Improvement Program database. Our work demonstrates that the models have significant predictive value. In particular, an inhomogenous Markov chain model effectively predicts the development of serious complications (coma longer than a day, cardiac arrest, myocardial infarction, septic shock, renal failure, pneumonia) and interventional complications (unplanned re-intubation, longer than 2 days on a ventilator and bleeding transfusion). PMID:28269851

  14. Postoperative pelvic pain: An imaging approach.

    PubMed

    Farah, H; Laurent, N; Phalippou, J; Bazot, M; Giraudet, G; Serb, T; Poncelet, E

    2015-10-01

    Postoperative pelvic pain after gynecological surgery is a readily detected but unspecific sign of complication. Imaging as a complement to physical examination helps establish the etiological diagnosis. In the context of emergency surgery, vascular, urinary and digestive injuries constitute the most frequent intraoperative complications. During the follow-up of patients who had undergone pelvic surgery, imaging should be performed to detect recurrent disease, postoperative fibrosis, adhesions and more specific complications related to prosthetic material. Current guidelines recommend using pelvic ultrasonography as the first line imaging modality whereas the use of pelvic computed tomography and/or magnetic resonance imaging should be restricted to specific situations, depending on local availability of equipment and suspected disease.

  15. Postoperative Rehabilitation After Rotator Cuff Repair

    PubMed Central

    Mollison, Scott; Shin, Jason J.; Glogau, Alexander; Beavis, R. Cole

    2017-01-01

    Background: Postoperative rehabilitation after arthroscopic rotator cuff repair (ARCR) remains controversial and suffers from limited high-quality evidence. Therefore, appropriate use criteria must partially depend on expert opinion. Hypothesis/Purpose: The purpose of the study was to determine and report on the standard and modified rehabilitation protocols after ARCR used by member orthopaedic surgeons of the American Orthopaedic Society for Sports Medicine (AOSSM) and the Arthroscopy Association of North America (AANA). We hypothesized that there will exist a high degree of variability among rehabilitation protocols. We also predict that surgeons will be prescribing accelerated rehabilitation. Study Design: Cross-sectional study; Level of evidence, 4. Methods: A 29-question survey in English language was sent to all 3106 associate and active members of the AOSSM and the AANA. The questionnaire consisted of 4 categories: standard postoperative protocol, modification to postoperative rehabilitation, operative technique, and surgeon demographic data. Via email, the survey was sent on September 4, 2013. Results: The average response rate per question was 22.7%, representing an average of 704 total responses per question. The most common immobilization device was an abduction pillow sling with the arm in neutral or slight internal rotation (70%). Surgeons tended toward later unrestricted passive shoulder range of motion at 6 to 7 weeks (35%). Strengthening exercises were most commonly prescribed between 6 weeks and 3 months (56%). Unrestricted return to activities was most commonly allowed at 5 to 6 months. The majority of the respondents agreed that they would change their protocol based on differences expressed in this survey. Conclusion: There is tremendous variability in postoperative rehabilitation protocols after ARCR. Five of 10 questions regarding standard rehabilitation reached a consensus statement. Contrary to our hypothesis, there was a trend toward later

  16. Postoperative radiation and implant capsule contraction

    SciTech Connect

    Caffee, H.H.; Mendenhall, N.P.; Mendenhall, W.M.; Bova, F.J.

    1988-01-01

    Occasionally radiation is required as adjunctive therapy following mastectomy for breast cancer. The effects of radiation on a developing implant capsule are unknown, but they are very important in relation to the increased use of immediate reconstruction. Experiments were performed on rabbits to study the effects of postoperative radiation therapy on capsule contraction and thickness. The results of these experiments suggest that radiation has no effect on implant capsules.

  17. Postoperative Chemoradiotherapy for Extrahepatic Bile Duct Cancer

    SciTech Connect

    Park, Jin-hong; Choi, Eun Kyung; Ahn, Seung Do; Lee, Sang-wook; Song, Si Yeol; Yoon, Sang Min; Kim, Young Seok; Lee, Yu Sun; Lee, Sung-Gyu; Hwang, Shin; Lee, Young-Joo; Park, Kwang-Min; Kim, Tae Won; Chang, Heung Moon; Lee, Jae-Lyun; Kim, Jong Hoon

    2011-03-01

    Purpose: To evaluate the effect of postoperative concurrent chemoradiotherapy using three-dimensional conformal radiotherapy and to identify the prognostic factors that influence survival in patients with extrahepatic bile duct cancer. Methods and Materials: We retrospectively analyzed the data from 101 patients with extrahepatic bile duct cancer who had undergone postoperative concurrent chemoradiotherapy using three-dimensional conformal radiotherapy. Of the 101 patients, 52 (51%) had undergone complete resection (R0 resection) and 49 (49%) had microscopic or macroscopic residual tumors (R1 or R2 resection). The median radiation dose was 50 Gy. Also, 85 patients (84%) underwent concurrent chemotherapy with 5-fluorouracil. Results: The median follow-up period was 47 months for the surviving patients. The 5-year overall survival rate was 34% for all patients. A comparison between patients with R0 and R1 resection indicated no significant difference in the 5-year overall survival (44% vs. 33%, p = .2779), progression-free survival (35% vs. 22%, p = .3107), or locoregional progression-free survival (75% vs. 63%, p = .2784) rates. An analysis of the first failure site in the 89 patients with R0 or R1 resection indicated isolated locoregional recurrence in 7 patients. Elevated postoperative carbohydrate antigen 19-9 level was an independent prognostic factor for overall survival (p = .001) and progression-free survival (p = .033). A total of 3 patients developed Grade 3 or greater late toxicity. Conclusion: Adjuvant concurrent chemoradiotherapy using three-dimensional conformal radiotherapy appears to improve locoregional control and survival in extrahepatic bile duct cancer patients with R1 resection. The postoperative carbohydrate antigen 19-9 level might be a useful prognostic marker to select patients for more intensified adjuvant therapy.

  18. Predicting postoperative gait in cerebral palsy.

    PubMed

    Galarraga C, Omar A; Vigneron, Vincent; Dorizzi, Bernadette; Khouri, Néjib; Desailly, Eric

    2016-11-09

    In this work, postoperative lower limb kinematics are predicted with respect to preoperative kinematics, physical examination and surgery data. Data of 115 children with cerebral palsy that have undergone single-event multilevel surgery were considered. Preoperative data dimension was reduced utilizing principal component analysis. Then, multiple linear regressions with 80% confidence intervals were performed between postoperative kinematics and bilateral preoperative kinematics, 36 physical examination variables and combinations of 9 different surgical procedures. The mean prediction errors on test vary from 4° (pelvic obliquity and hip adduction) to 10° (hip rotation and foot progression), depending on the kinematic angle. The unilateral mean sizes of the confidence intervals vary from 5° to 15°. Frontal plane angles are predicted with the lowest errors, however the same performance is achieved when considering the postoperative average signals. Sagittal plane angles are better predicted than transverse plane angles, with statistical differences with respect to the average postoperative kinematics for both plane's angles except for ankle dorsiflexion. The mean prediction errors are smaller than the variability of gait parameters in cerebral palsy. The performance of the system is independent of the preoperative state severity of the patient. Even if the system is not yet accurate enough to define a surgery plan, it shows an unbiased estimation of the most likely outcome, which can be useful for both the clinician and the patient. More patients' data are necessary for improving the precision of the model in order to predict the kinematic outcome of a large number of possible surgeries and gait patterns.

  19. Relationship between anesthesia and postoperative endophthalmitis

    PubMed Central

    Lai, Hou-Chuan; Tseng, Wei-Cheng; Pao, Shu-I; Wong, Chih-Shung; Huang, Ren-Chih; Chan, Wei-Hung; Wu, Zhi-Fu

    2017-01-01

    Abstract Previous study showed that patients under general anesthesia (GA) had nasopharyngeal secretions on the face at the end of ocular surgery, especially in propofol-based total intravenous anesthesia (TIVA), it might induce postoperative endophthalmitis. Therefore, we conducted a retrospective study to compare the incidence of endophthalmitis after ocular surgery under topical, inhalation anesthesia, and propofol-based TIVA in our medical center from 2011 to 2015. A total of 21,032 patients were included, and we evaluated epidemiologic factors, systemic diseases, other ocular pathologic characteristics, complications during the surgery, technique of ocular surgery, method of antibiotic prophylaxis, vitreous culture, and vision outcome in these patients. Fifteen endophthalmitis cases among 21,032 operations reported, equaling an incidence of 0.071%. The incidence rates under topical, inhalation anesthesia, and propofol-based TIVA were 0.083%, 0.039%, and 0%, respectively (P = 0.39). Moreover, the risk of endophthalmitis under GA (0.024%) was significantly lower than topical anesthesia (0.083%) (P < 0.001). We also found that elder was the risk factor for endophthalmitis following ocular surgery. In conclusion, propofol-based TIVA or inhalation anesthesia did not increase the risk of endophthalmitis after ocular surgery. Thus, GA was not a risk factor for postoperative endophthalmitis. By contrast, elder was the risk factor for postoperative endophthalmitis. PMID:28328861

  20. Takotsubo Cardiomyopathy Occurring in the Postoperative Period.

    PubMed

    Deniz, Süleyman; Bakal, Ömer; İnangil, Gökhan; Şen, Hüseyin; Özkan, Sezai

    2015-02-01

    Takotsubo cardiomyopathy simulates acute myocardial infarction, and it is characterised by reversible left ventricular failure. A case of Takotsubo cardiomyopathy diagnosed after emergency angiography performed in a patient with evidence of acute myocardial infarction in the postoperative period will be described in this report. Transurethral resection of a bladder tumour (TUR-BT) was performed in a 92-year-old male patient by the urology clinic. The patient was transferred to the post-anaesthesia care unit after the operation. An echocardiography was performed because of the sudden onset of dyspnoea, tachycardia (140-150 beats per minute, rhythm-atrial fibrillation) and ST-segment elevation on electrocardiography (ECG) at the first postoperative hour, and midapical dyskinesia was detected at the patient. An immediate angiography was performed due to suspicion of acute coronary syndrome. Patent coronary arteries and temporary aneurysmatic dilatation of the apex of the heart were revealed by angiography. As a result of these findings, the patient was diagnosed with Takotsubo cardiomyopathy by the cardiology service. The patient was discharged uneventfully following 10 days in the intensive care unit. Aneurysm of the apex of the left ventricle and normal anatomy of the coronary arteries in the angiography have diagnostic value for Takotsubo cardiomyopathy. Diuretics (furosemide) and beta-blockers (metoprolol) are commonly used for the treatment of Takotsubo cardiomyopathy. Even though Takotsubo cardiomyopathy is a rare and benign disease, it should be kept in mind in patients suspected for acute myocardial infarction in the postoperative period.