Science.gov

Sample records for 3c protease 3cpro

  1. Broad-Spectrum Antivirals against 3C or 3C-Like Proteases of Picornaviruses, Noroviruses, and Coronaviruses

    PubMed Central

    Kim, Yunjeong; Lovell, Scott; Tiew, Kok-Chuan; Mandadapu, Sivakoteswara Rao; Alliston, Kevin R.; Battaile, Kevin P.; Groutas, William C.

    2012-01-01

    Phylogenetic analysis has demonstrated that some positive-sense RNA viruses can be classified into the picornavirus-like supercluster, which includes picornaviruses, caliciviruses, and coronaviruses. These viruses possess 3C or 3C-like proteases (3Cpro or 3CLpro, respectively), which contain a typical chymotrypsin-like fold and a catalytic triad (or dyad) with a Cys residue as a nucleophile. The conserved key sites of 3Cpro or 3CLpro may serve as attractive targets for the design of broad-spectrum antivirals for multiple viruses in the supercluster. We previously reported the structure-based design and synthesis of potent protease inhibitors of Norwalk virus (NV), a member of the Caliciviridae family. We report herein the broad-spectrum antiviral activities of three compounds possessing a common dipeptidyl residue with different warheads, i.e., an aldehyde (GC373), a bisulfite adduct (GC376), and an α-ketoamide (GC375), against viruses that belong to the supercluster. All compounds were highly effective against the majority of tested viruses, with half-maximal inhibitory concentrations in the high nanomolar or low micromolar range in enzyme- and/or cell-based assays and with high therapeutic indices. We also report the high-resolution X-ray cocrystal structures of NV 3CLpro-, poliovirus 3Cpro-, and transmissible gastroenteritis virus 3CLpro- GC376 inhibitor complexes, which show the compound covalently bound to a nucleophilic Cys residue in the catalytic site of the corresponding protease. We conclude that these compounds have the potential to be developed as antiviral therapeutics aimed at a single virus or multiple viruses in the picornavirus-like supercluster by targeting 3Cpro or 3CLpro. PMID:22915796

  2. Porcine Epidemic Diarrhea Virus 3C-Like Protease-Mediated Nucleocapsid Processing: Possible Link to Viral Cell Culture Adaptability.

    PubMed

    Jaru-Ampornpan, Peera; Jengarn, Juggragarn; Wanitchang, Asawin; Jongkaewwattana, Anan

    2017-01-15

    Porcine epidemic diarrhea virus (PEDV) causes severe diarrhea and high mortality rates in newborn piglets, leading to massive losses to the swine industry worldwide during recent epidemics. Intense research efforts are now focusing on defining viral characteristics that confer a growth advantage, pathogenicity, or cell adaptability in order to better understand the PEDV life cycle and identify suitable targets for antiviral or vaccine development. Here, we report a unique phenomenon of PEDV nucleocapsid (N) cleavage by the PEDV-encoded 3C-like protease (3Cpro) during infection. The identification of the 3Cpro cleavage site at the C terminus of N supported previous observations that PEDV 3Cpro showed a substrate requirement slightly different from that of severe acute respiratory syndrome coronavirus (SARS-CoV) 3Cpro and revealed a greater flexibility in its substrate recognition site. This cleavage motif is present in the majority of cell culture-adapted PEDV strains but is missing in emerging field isolates. Remarkably, reverse-genetics-derived cell culture-adapted PEDVAVCT12 harboring uncleavable N displayed growth retardation in Vero E6-APN cells compared to the wild-type virus. These observations altogether shed new light on the investigation and characterization of the PEDV nucleocapsid protein and its possible link to cell culture adaptation.

  3. A Novel Enterovirus 71 (EV71) Virulence Determinant: The 69th Residue of 3C Protease Modulates Pathogenicity

    PubMed Central

    Li, Bingqing; Yue, Yingying; Zhang, Yajie; Yuan, Zenglin; Li, Peng; Song, Nannan; Lin, Wei; Liu, Yan; Gu, Lichuan; Meng, Hong

    2017-01-01

    Human enterovirus type 71 (EV71), the major causative agent of hand-foot-and-mouth disease, has been known to cause fatal neurological complications. Unfortunately, the reason for neurological complications that have been seen in fatal cases of the disease and the relationship between EV71 virulence and viral genetic sequences remains largely undefined. The 3C protease (3Cpro) of EV71 plays an irreplaceable role in segmenting the precursor polyprotein during viral replication, and intervening with host life activity during viral infection. In this study, for the first time, the 69th residue of 3C protease has been identified as a novel virulence determinant of EV71. The recombinant virus with single point variation, in the 69th of 3Cpro, exhibited obvious decline in replication, and virulence. We further determined the crystal structure of 3C N69D at 1.39 Ǻ resolution and found that conformation of 3C N69D demonstrated significant changes compared with a normal 3C protein, in the substrate-binding site and catalytic active site. Strikingly, one of the switch loops, essential in fixing substrates, adopts an open conformation in the 3C N69D-rupintrivir complex. Consistent with this apparent structural disruption, the catalytic activity of 3C N69D decreased sharply for host derived and viral derived substrates, detected for both in vitro and in vivo. Interestingly, in addition to EV71, Asp69 was also found in 3C proteases of other virus strains, such as CAV16, and was conserved in nearly all C type human rhinovirus. Overall, we identified a natural virulence determinant of 3C protease and revealed the mechanism of attenuated virulence is mediated by N69D substitution. Our data provides new insight into the enzymatic mechanism of a subdued 3C protease and suggests a theoretical basis for virulence determinantion of picornaviridae. PMID:28217559

  4. Cleavage of eukaryotic initiation factor eIF5B by enterovirus 3C proteases

    PubMed Central

    de Breyne, Sylvain; Bonderoff, Jennifer M.; Chumakov, Konstantin M.; Lloyd, Richard E.; Hellen, Christopher U. T.

    2008-01-01

    The enteroviruses poliovirus (PV), Coxsackie B virus (CVB) and rhinovirus (HRV) are members of Picornaviridae that inhibit host cell translation early in infection. Enterovirus translation soon predominates in infected cells, but eventually also shuts off. This complex pattern of modulation of translation suggests regulation by a multifactorial mechanism. We report here that eIF5B is proteolytically cleaved during PV and CVB infection of cultured cells, beginning at 3 hours post-infection and increasing thereafter. Recombinant PV, CVB and HRV 3Cpro cleaved purified native rabbit eukaryotic initiation factor (eIF) 5B in vitro at a single site (VVEQ↓G, equivalent to VMEQ↓G479in human eIF5B) that is consistent with the cleavage specificity of enterovirus 3C proteases. Cleavage separates the N-terminal domain of eIF5B from its essential conserved central GTPase and C-terminal domains. 3Cpro-mediated cleavage of eIF5B may thus play an accessory role in the shut-off of translation that occurs in enterovirus-infected cells. PMID:18572216

  5. 3C Protease of Enterovirus 68: Structure-Based Design of Michael Acceptor Inhibitors and Their Broad-Spectrum Antiviral Effects against Picornaviruses

    PubMed Central

    Tan, Jinzhi; George, Shyla; Kusov, Yuri; Perbandt, Markus; Anemüller, Stefan; Mesters, Jeroen R.; Norder, Helene; Coutard, Bruno; Lacroix, Céline; Leyssen, Pieter; Neyts, Johan

    2013-01-01

    We have determined the cleavage specificity and the crystal structure of the 3C protease of enterovirus 68 (EV68 3Cpro). The protease exhibits a typical chymotrypsin fold with a Cys...His...Glu catalytic triad; its three-dimensional structure is closely related to that of the 3Cpro of rhinovirus 2, as well as to that of poliovirus. The phylogenetic position of the EV68 3Cpro between the corresponding enzymes of rhinoviruses on the one hand and classical enteroviruses on the other prompted us to use the crystal structure for the design of irreversible inhibitors, with the goal of discovering broad-spectrum antiviral compounds. We synthesized a series of peptidic α,β-unsaturated ethyl esters of increasing length and for each inhibitor candidate, we determined a crystal structure of its complex with the EV68 3Cpro, which served as the basis for the next design round. To exhibit inhibitory activity, compounds must span at least P3 to P1′; the most potent inhibitors comprise P4 to P1′. Inhibitory activities were found against the purified 3C protease of EV68, as well as with replicons for poliovirus and EV71 (50% effective concentration [EC50] = 0.5 μM for the best compound). Antiviral activities were determined using cell cultures infected with EV71, poliovirus, echovirus 11, and various rhinovirus serotypes. The most potent inhibitor, SG85, exhibited activity with EC50s of ≈180 nM against EV71 and ≈60 nM against human rhinovirus 14 in a live virus–cell-based assay. Even the shorter SG75, spanning only P3 to P1′, displayed significant activity (EC50 = 2 to 5 μM) against various rhinoviruses. PMID:23388726

  6. Foot-and-Mouth Disease Virus 3C Protease Cleaves NEMO To Impair Innate Immune Signaling

    PubMed Central

    Wang, Dang; Fang, Liurong; Li, Kui; Zhong, Huijuan; Fan, Jinxiu; Ouyang, Chao; Zhang, Huan; Duan, Erzhen; Luo, Rui; Zhang, Zhongming; Liu, Xiangtao; Chen, Huanchun

    2012-01-01

    Foot-and-mouth disease is a highly contagious viral illness of wild and domestic cloven-hoofed animals. The causative agent, foot-and-mouth disease virus (FMDV), replicates rapidly, efficiently disseminating within the infected host and being passed on to susceptible animals via direct contact or the aerosol route. To survive in the host, FMDV has evolved to block the host interferon (IFN) response. Previously, we and others demonstrated that the leader proteinase (Lpro) of FMDV is an IFN antagonist. Here, we report that another FMDV-encoded proteinase, 3Cpro, also inhibits IFN-α/β response and the expression of IFN-stimulated genes. Acting in a proteasome- and caspase-independent manner, the 3Cpro of FMDV proteolytically cleaved nuclear transcription factor kappa B (NF-κB) essential modulator (NEMO), a bridging adaptor protein essential for activating both NF-κB and interferon-regulatory factor signaling pathways. 3Cpro specifically targeted NEMO at the Gln 383 residue, cleaving off the C-terminal zinc finger domain from the protein. This cleavage impaired the ability of NEMO to activate downstream IFN production and to act as a signaling adaptor of the RIG-I/MDA5 pathway. Mutations specifically disrupting the cysteine protease activity of 3Cpro abrogated NEMO cleavage and the inhibition of IFN induction. Collectively, our data identify NEMO as a substrate for FMDV 3Cpro and reveal a novel mechanism evolved by a picornavirus to counteract innate immune signaling. PMID:22718831

  7. Peptidyl Aldehyde NK-1.8k Suppresses Enterovirus 71 and Enterovirus 68 Infection by Targeting Protease 3C

    PubMed Central

    Wang, Yaxin; Yang, Ben; Zhai, Yangyang; Rao, Zihe

    2015-01-01

    Enterovirus (EV) is one of the major causative agents of hand, foot, and mouth disease in the Pacific-Asia region. In particular, EV71 causes severe central nervous system infections, and the fatality rates from EV71 infection are high. Moreover, an outbreak of respiratory illnesses caused by an emerging EV, EV68, recently occurred among over 1,000 young children in the United States and was also associated with neurological infections. Although enterovirus has emerged as a considerable global public health threat, no antiviral drug for clinical use is available. In the present work, we screened our compound library for agents targeting viral protease and identified a peptidyl aldehyde, NK-1.8k, that inhibits the proliferation of different EV71 strains and one EV68 strain and that had a 50% effective concentration of 90 nM. Low cytotoxicity (50% cytotoxic concentration, >200 μM) indicated a high selective index of over 2,000. We further characterized a single amino acid substitution inside protease 3C (3Cpro), N69S, which conferred EV71 resistance to NK-1.8k, possibly by increasing the flexibility of the substrate binding pocket of 3Cpro. The combination of NK-1.8k and an EV71 RNA-dependent RNA polymerase inhibitor or entry inhibitor exhibited a strong synergistic anti-EV71 effect. Our findings suggest that NK-1.8k could potentially be developed for anti-EV therapy. PMID:25691647

  8. Seneca Valley Virus 3Cpro Substrate Optimization Yields Efficient Substrates for Use in Peptide-Prodrug Therapy.

    PubMed

    Miles, Linde A; Brennen, W Nathaniel; Rudin, Charles M; Poirier, John T

    2015-01-01

    The oncolytic picornavirus Seneca Valley Virus (SVV-001) demonstrates anti-tumor activity in models of small cell lung cancer (SCLC), but may ultimately need to be combined with cytotoxic therapies to improve responses observed in patients. Combining SVV-001 virotherapy with a peptide prodrug activated by the viral protease 3Cpro is a novel strategy that may increase the therapeutic potential of SVV-001. Using recombinant SVV-001 3Cpro, we measured cleavage kinetics of predicted SVV-001 3Cpro substrates. An efficient substrate, L/VP4 (kcat/KM = 1932 ± 183 M(-1)s(-1)), was further optimized by a P2' N→P substitution yielding L/VP4.1 (kcat/KM = 17446 ± 2203 M(-1)s(-1)). We also determined essential substrate amino acids by sequential N-terminal deletion and substitution of amino acids found in other picornavirus genera. A peptide corresponding to the L/VP4.1 substrate was selectively cleaved by SVV-001 3Cpro in vitro and was stable in human plasma. These data define an optimized peptide substrate for SVV-001 3Cpro, with direct implications for anti-cancer therapeutic development.

  9. Seneca Valley Virus 3Cpro Substrate Optimization Yields Efficient Substrates for Use in Peptide-Prodrug Therapy

    PubMed Central

    Miles, Linde A.; Brennen, W. Nathaniel; Rudin, Charles M.; Poirier, John T.

    2015-01-01

    The oncolytic picornavirus Seneca Valley Virus (SVV-001) demonstrates anti-tumor activity in models of small cell lung cancer (SCLC), but may ultimately need to be combined with cytotoxic therapies to improve responses observed in patients. Combining SVV-001 virotherapy with a peptide prodrug activated by the viral protease 3Cpro is a novel strategy that may increase the therapeutic potential of SVV-001. Using recombinant SVV-001 3Cpro, we measured cleavage kinetics of predicted SVV-001 3Cpro substrates. An efficient substrate, L/VP4 (kcat/KM = 1932 ± 183 M-1s-1), was further optimized by a P2’ N→P substitution yielding L/VP4.1 (kcat/KM = 17446 ± 2203 M-1s-1). We also determined essential substrate amino acids by sequential N-terminal deletion and substitution of amino acids found in other picornavirus genera. A peptide corresponding to the L/VP4.1 substrate was selectively cleaved by SVV-001 3Cpro in vitro and was stable in human plasma. These data define an optimized peptide substrate for SVV-001 3Cpro, with direct implications for anti-cancer therapeutic development. PMID:26069962

  10. Enterovirus 68 3C Protease Cleaves TRIF To Attenuate Antiviral Responses Mediated by Toll-Like Receptor 3

    PubMed Central

    Xiang, Zichun; Li, Linlin; Lei, Xiaobo; Zhou, Hongli; Zhou, Zhuo

    2014-01-01

    ABSTRACT Human enterovirus 68 (EV68) is a member of the EV-D species, which belongs to the EV genus of the Picornaviridae family. Over the past several years, there have been increasingly documented outbreaks of respiratory disease associated with EV68. As a globally emerging pathogen, EV68 infects both adults and children. However, the molecular basis of EV68 pathogenesis is unknown. Here we report that EV68 inhibits Toll-like receptor 3 (TLR3)-mediated innate immune responses by targeting the TIR domain-containing adaptor inducing beta interferon (TRIF). In infected HeLa cells, EV68 inhibits poly(I·C)-induced interferon regulatory factor 3 (IRF3) activation and beta interferon (IFN-β) expression. Further investigations revealed that TRIF, a critical adaptor downstream of TLR3, is targeted by EV68. When expressed alone, 3Cpro, an EV68-encoded protease, cleaves TRIF. 3Cpro mediates TRIF cleavage at Q312 and Q653, which are sites in the amino- and carboxyl-terminal domains, respectively. This cleavage relies on 3Cpro's cysteine protease activity. Cleavage of TRIF abolishes the capacity of TRIF to activate NF-κB and IFN-β signaling. These results suggest that control of TRIF by 3Cpro may be a mechanism by which EV68 subverts host innate immune responses. IMPORTANCE EV68 is a globally emerging pathogen, but the molecular basis of EV68 pathogenesis is unclear. Here we report that EV68 inhibits TLR3-mediated innate immune responses by targeting TRIF. Further investigations revealed that TRIF is cleaved by 3Cpro. These results suggest that control of TRIF by 3Cpro may be a mechanism by which EV68 impairs type I IFN production in response to TLR3 activation. PMID:24672048

  11. Poliovirus protease 3C(pro) kills cells by apoptosis.

    PubMed

    Barco, A; Feduchi, E; Carrasco, L

    2000-01-20

    The tetracycline-based Tet-Off expression system has been used to analyze the effects of poliovirus protease 3C(pro) on human cells. Stable HeLa cell clones that express this poliovirus protease under the control of an inducible, tightly regulated promoter were obtained. Tetracycline removal induces synthesis of 3C protease, followed by drastic morphological alterations and cellular death. Degradation of cellular DNA in nucleosomes and generation of apoptotic bodies are observed from the second day after 3C(pro) induction. The cleavage of poly(ADP-ribose) polymerase, an enzyme involved in DNA repair, occurs after induction of 3C(pro), indicating caspase activation by this poliovirus protease. The 3C(pro)-induced apoptosis is blocked by the caspase inhibitor z-VAD-fmk. Our findings suggest that the protease 3C is responsible for triggering apoptosis in poliovirus-infected cells by a mechanism that involves caspase activation.

  12. The encephalomyocarditis virus 3C protease is a substrate for the ubiquitin-mediated proteolytic system.

    PubMed

    Lawson, T G; Gronros, D L; Werner, J A; Wey, A C; DiGeorge, A M; Lockhart, J L; Wilson, J W; Wintrode, P L

    1994-11-11

    The encephalomyocarditis virus 3C protease has been shown to be rapidly degraded in infected cells and in vitro in rabbit reticulocyte lysate. The in vitro degradation, at least, is accomplished by a virus-independent, ATP-dependent proteolytic system. Here we identify this proteolytic system as the ubiquitin-mediated system. Incubation of the 3C protease in rabbit reticulocyte or cultured mouse cell lysate preparations, alone or in the presence of added ubiquitin or methylated ubiquitin, resulted in the generation of new higher molecular weight species. These new products were shown to be 3C protease-ubiquitin conjugates by their ability to bind antibodies against both the 3C protease and ubiquitin. Supplemental ubiquitin also stimulated the degradation of the 3C protease in these preparations. Large 3C protease-polyubiquitin conjugates were observed to accumulate in reticulocyte lysate in the presence of adenosine 5'-O-(3-thiotriphosphate), an inhibitor of the 26 S multicatalytic protease. This, combined with the fact that the proteolytic activity could be removed from the lysate by sedimentation, implicates the multicatalytic protease in the degradation of the 3C protease-ubiquitin conjugates. It was also found that the slow rate of degradation of a model polyprotein, which resembles the stable viral 3CD diprotein produced in vivo, is likely due to the fact that the polyprotein is a poor substrate for the ubiquitin-conjugating system.

  13. Roles of the Picornaviral 3C Proteinase in the Viral Life Cycle and Host Cells

    PubMed Central

    Sun, Di; Chen, Shun; Cheng, Anchun; Wang, Mingshu

    2016-01-01

    The Picornaviridae family comprises a large group of non-enveloped viruses that have a major impact on human and veterinary health. The viral genome contains one open reading frame encoding a single polyprotein that can be processed by viral proteinases. The crucial 3C proteinases (3Cpros) of picornaviruses share similar spatial structures and it is becoming apparent that 3Cpro plays a significant role in the viral life cycle and virus host interaction. Importantly, the proteinase and RNA-binding activity of 3Cpro are involved in viral polyprotein processing and the initiation of viral RNA synthesis. In addition, 3Cpro can induce the cleavage of certain cellular factors required for transcription, translation and nucleocytoplasmic trafficking to modulate cell physiology for viral replication. Due to interactions between 3Cpro and these essential factors, 3Cpro is also involved in viral pathogenesis to support efficient infection. Furthermore, based on the structural conservation, the development of irreversible inhibitors and discovery of non-covalent inhibitors for 3Cpro are ongoing and a better understanding of the roles played by 3Cpro may provide insights into the development of potential antiviral treatments. In this review, the current knowledge regarding the structural features, multiple functions in the viral life cycle, pathogen host interaction, and development of antiviral compounds for 3Cpro is summarized. PMID:26999188

  14. Potent inhibition of feline coronaviruses with peptidyl compounds targeting coronavirus 3C-like protease.

    PubMed

    Kim, Yunjeong; Mandadapu, Sivakoteswara Rao; Groutas, William C; Chang, Kyeong-Ok

    2013-02-01

    Feline coronavirus infection is common among domestic and exotic felid species and usually associated with mild or asymptomatic enteritis; however, feline infectious peritonitis (FIP) is a fatal disease of cats that is caused by systemic infection with a feline infectious peritonitis virus (FIPV), a variant of feline enteric coronavirus (FECV). Currently, there is no specific treatment approved for FIP despite the importance of FIP as the leading infectious cause of death in young cats. During the replication process, coronavirus produces viral polyproteins that are processed into mature proteins by viral proteases, the main protease (3C-like [3CL] protease) and the papain-like protease. Since the cleavages of viral polyproteins are an essential step for virus replication, blockage of viral protease is an attractive target for therapeutic intervention. Previously, we reported the generation of broad-spectrum peptidyl inhibitors against viruses that possess a 3C or 3CL protease. In this study, we further evaluated the antiviral effects of the peptidyl inhibitors against feline coronaviruses, and investigated the interaction between our protease inhibitor and a cathepsin B inhibitor, an entry blocker, against a feline coronavirus in cell culture. Herein we report that our compounds behave as reversible, competitive inhibitors of 3CL protease, potently inhibited the replication of feline coronaviruses (EC(50) in a nanomolar range) and, furthermore, combination of cathepsin B and 3CL protease inhibitors led to a strong synergistic interaction against feline coronaviruses in a cell culture system.

  15. Cleavage of Maize chlorotic dwarf virus R78 protein by the viral 3C protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maize chlorotic dwarf virus (MCDV) is a member of the genus Waikavirus and encodes a 389 kDa polyprotein from its 11784 nt genomic RNA. Like many polyprotein-encoding viruses, MCDV contains a 3C-like virus protease that is presumably responsible for maturation cleavages of the polyprotein. However,...

  16. Luteoloside Acts as 3C Protease Inhibitor of Enterovirus 71 In Vitro

    PubMed Central

    Cao, Zeyu; Ding, Yue; Ke, Zhipeng; Cao, Liang; Li, Na; Ding, Gang; Wang, Zhenzhong; Xiao, Wei

    2016-01-01

    Luteoloside is a member of the flavonoids family that exhibits several bioactivities including anti-microbial and anti-cancer activities. However, the antiviral activity of luteoloside against enterovirus 71 (EV71) and the potential mechanism(s) responsible for this effect remain unknown. In this study, the antiviral potency of luteoloside against EV71 and its inhibitory effects on 3C protease activity were evaluated. First, we investigated the cytotoxicity of luteoloside against rhabdomyosarcoma (RD) cells, which was the cell line selected for an in vitro infection model. In a subsequent antiviral assay, the cytopathic effect of EV71 was significantly and dose-dependently relieved by the administration of luteoloside (EC50 = 0.43 mM, selection index = 5.3). Using a plaque reduction assay, we administered luteoloside at various time points and found that the compound reduced EV71 viability in RD cells rather than increasing defensive mobilization or viral absorption. Moreover, biochemical studies focused on VP1 (a key structural protein of EV71) mRNA transcript and protein levels also revealed the inhibitory effects of luteoloside on the EV71 viral yield. Finally, we performed inhibition assays using luteoloside to evaluate its effect on recombinant 3C protease activity. Our results demonstrated that luteoloside blocked 3C protease enzymatic activity in a dose-dependent manner (IC50 = 0.36 mM) that was similar to the effect of rutin, which is a well-known C3 protease inhibitor. Collectively, the results from this study indicate that luteoloside can block 3C protease activity and subsequently inhibit EV71 production in vitro. PMID:26870944

  17. Porcine Epidemic Diarrhea Virus 3C-Like Protease Regulates Its Interferon Antagonism by Cleaving NEMO

    PubMed Central

    Wang, Dang; Fang, Liurong; Shi, Yanling; Zhang, Huan; Gao, Li; Peng, Guiqing; Chen, Huanchun; Li, Kui

    2015-01-01

    ABSTRACT Porcine epidemic diarrhea virus (PEDV) is an enteropathogenic coronavirus causing lethal watery diarrhea in piglets. Since 2010, a PEDV variant has spread rapidly in China, and it emerged in the United States in 2013, posing significant economic and public health concerns. The ability to circumvent the interferon (IFN) antiviral response, as suggested for PEDV, promotes viral survival and regulates pathogenesis of PEDV infections, but the underlying mechanisms remain obscure. Here, we show that PEDV-encoded 3C-like protease, nsp5, is an IFN antagonist that proteolytically cleaves the nuclear transcription factor kappa B (NF-κB) essential modulator (NEMO), an essential adaptor bridging interferon-regulatory factor and NF-κB activation. NEMO is cleaved at glutamine 231 (Q231) by PEDV, and this cleavage impaired the ability of NEMO to activate downstream IFN production and to act as a signaling adaptor of the RIG-I/MDA5 pathway. Mutations specifically disrupting the cysteine protease activity of PEDV nsp5 abrogated NEMO cleavage and the inhibition of IFN induction. Structural analysis suggests that several key residues outside the catalytic sites of PEDV nsp5 probably impact NEMO cleavage by modulating potential interactions of nsp5 with their substrates. These data show that PEDV nsp5 disrupts type I IFN signaling by cleaving NEMO. Previously, we and others demonstrated that NEMO is also cleaved by 3C or 3C-like proteinases of picornavirus and artertivirus. Thus, NEMO probably represents a prime target for 3C or 3C-like proteinases of different viruses. IMPORTANCE The continued emergence and reemergence of porcine epidemic diarrhea virus (PEDV) underscore the importance of studying how this virus manipulates the immune responses of its hosts. During coevolution with its hosts, PEDV has acquired mechanisms to subvert host innate immune responses for its survival advantage. At least two proteins encoded by PEDV have been identified as interferon (IFN

  18. Activity of the Human Rhinovirus 3C Protease Studied in Various Buffers, Additives and Detergents Solutions for Recombinant Protein Production

    PubMed Central

    Tufail, Soban; Ismat, Fouzia; Imran, Muhammad; Iqbal, Mazhar; Mirza, Osman; Rhaman, Moazur

    2016-01-01

    Proteases are widely used to remove affinity and solubility tags from recombinant proteins to avoid potential interference of these tags with the structure and function of the fusion partner. In recent years, great interest has been seen in use of the human rhinovirus 3C protease owing to its stringent sequence specificity and enhanced activity. Like other proteases, activity of the human rhinovirus 3C protease can be affected in part by the buffer components and additives that are generally employed for purification and stabilization of proteins, hence, necessitate their removal by tedious and time-consuming procedures before proteolysis can occur. To address this issue, we examined the effect of elution buffers used for common affinity based purifications, salt ions, stability/solubility and reducing agents, and detergents on the activity of the human rhinovirus 3C protease using three different fusion proteins at 4°C, a temperature of choice for purification of many proteins. The results show that the human rhinovirus 3C protease performs better at 4°C than the frequently used tobacco etch virus protease and its activity was insensitive to most of the experimental conditions tested. Though number of fusion proteins tested is limited, we expect that these finding will facilitate the use of the human rhinovirus 3C protease in recombinant protein production for pharmaceutical and biotechnological applications. PMID:27093053

  19. Activity of the Human Rhinovirus 3C Protease Studied in Various Buffers, Additives and Detergents Solutions for Recombinant Protein Production.

    PubMed

    Ullah, Raheem; Shah, Majid Ali; Tufail, Soban; Ismat, Fouzia; Imran, Muhammad; Iqbal, Mazhar; Mirza, Osman; Rhaman, Moazur

    2016-01-01

    Proteases are widely used to remove affinity and solubility tags from recombinant proteins to avoid potential interference of these tags with the structure and function of the fusion partner. In recent years, great interest has been seen in use of the human rhinovirus 3C protease owing to its stringent sequence specificity and enhanced activity. Like other proteases, activity of the human rhinovirus 3C protease can be affected in part by the buffer components and additives that are generally employed for purification and stabilization of proteins, hence, necessitate their removal by tedious and time-consuming procedures before proteolysis can occur. To address this issue, we examined the effect of elution buffers used for common affinity based purifications, salt ions, stability/solubility and reducing agents, and detergents on the activity of the human rhinovirus 3C protease using three different fusion proteins at 4°C, a temperature of choice for purification of many proteins. The results show that the human rhinovirus 3C protease performs better at 4°C than the frequently used tobacco etch virus protease and its activity was insensitive to most of the experimental conditions tested. Though number of fusion proteins tested is limited, we expect that these finding will facilitate the use of the human rhinovirus 3C protease in recombinant protein production for pharmaceutical and biotechnological applications.

  20. Design and synthesis of irreversible inhibitors of foot-and-mouth disease virus 3C protease.

    PubMed

    Roqué Rosell, Núria R; Mokhlesi, Ladan; Milton, Nicholas E; Sweeney, Trevor R; Zunszain, Patricia A; Curry, Stephen; Leatherbarrow, Robin J

    2014-01-15

    Foot-and-mouth disease virus (FMDV) causes a highly infectious and economically devastating disease of livestock. The FMDV genome is translated as a single polypeptide precursor that is cleaved into functional proteins predominantly by the highly conserved viral 3C protease, making this enzyme an attractive target for antiviral drugs. A peptide corresponding to an optimal substrate has been modified at the C-terminus, by the addition of a warhead, to produce irreversible inhibitors that react as Michael acceptors with the enzyme active site. Further investigation highlighted key structural determinants for inhibition, with a positively charged P2 being particularly important for potency.

  1. A Novel Enterovirus 71 (EV71) Virulence Determinant: The 69th Residue of 3C Protease Modulates Pathogenicity.

    PubMed

    Li, Bingqing; Yue, Yingying; Zhang, Yajie; Yuan, Zenglin; Li, Peng; Song, Nannan; Lin, Wei; Liu, Yan; Gu, Lichuan; Meng, Hong

    2017-01-01

    Human enterovirus type 71 (EV71), the major causative agent of hand-foot-and-mouth disease, has been known to cause fatal neurological complications. Unfortunately, the reason for neurological complications that have been seen in fatal cases of the disease and the relationship between EV71 virulence and viral genetic sequences remains largely undefined. The 3C protease (3C(pro)) of EV71 plays an irreplaceable role in segmenting the precursor polyprotein during viral replication, and intervening with host life activity during viral infection. In this study, for the first time, the 69th residue of 3C protease has been identified as a novel virulence determinant of EV71. The recombinant virus with single point variation, in the 69th of 3C(pro), exhibited obvious decline in replication, and virulence. We further determined the crystal structure of 3C N69D at 1.39 Ǻ resolution and found that conformation of 3C N69D demonstrated significant changes compared with a normal 3C protein, in the substrate-binding site and catalytic active site. Strikingly, one of the switch loops, essential in fixing substrates, adopts an open conformation in the 3C N69D-rupintrivir complex. Consistent with this apparent structural disruption, the catalytic activity of 3C N69D decreased sharply for host derived and viral derived substrates, detected for both in vitro and in vivo. Interestingly, in addition to EV71, Asp69 was also found in 3C proteases of other virus strains, such as CAV16, and was conserved in nearly all C type human rhinovirus. Overall, we identified a natural virulence determinant of 3C protease and revealed the mechanism of attenuated virulence is mediated by N69D substitution. Our data provides new insight into the enzymatic mechanism of a subdued 3C protease and suggests a theoretical basis for virulence determinantion of picornaviridae.

  2. Biochemical Characterization of Recombinant Enterovirus 71 3C Protease with Fluorogenic Model Peptide Substrates and Development of a Biochemical Assay

    PubMed Central

    Shang, Luqing; Zhang, Shumei; Yang, Xi; Sun, Jixue; Li, Linfeng; Cui, Zhengjie; He, Qiuhong; Guo, Yu

    2014-01-01

    Enterovirus 71 (EV71), a primary pathogen of hand, foot, and mouth disease (HFMD), affects primarily infants and children. Currently, there are no effective drugs against HFMD. EV71 3C protease performs multiple tasks in the viral replication, which makes it an ideal antiviral target. We synthesized a small set of fluorogenic model peptides derived from cleavage sites of EV71 polyprotein and examined their efficiencies of cleavage by EV71 3C protease. The novel peptide P08 [(2-(N-methylamino)benzoyl) (NMA)-IEALFQGPPK(DNP)FR] was determined to be the most efficiently cleaved by EV71 3C protease, with a kinetic constant kcat/Km of 11.8 ± 0.82 mM−1 min−1. Compared with literature reports, P08 gave significant improvement in the signal/background ratio, which makes it an attractive substrate for assay development. A Molecular dynamics simulation study elaborated the interactions between substrate P08 and EV71 3C protease. Arg39, which is located at the bottom of the S2 pocket of EV71 3C protease, may participate in the proteolysis process of substrates. With an aim to evaluate EV71 3C protease inhibitors, a reliable and robust biochemical assay with a Z′ factor of 0.87 ± 0.05 was developed. A novel compound (compound 3) (50% inhibitory concentration [IC50] = 1.89 ± 0.25 μM) was discovered using this assay, which effectively suppressed the proliferation of EV 71 (strain Fuyang) in rhabdomyosarcoma (RD) cells with a highly selective index (50% effective concentration [EC50] = 4.54 ± 0.51 μM; 50% cytotoxic concentration [CC50] > 100 μM). This fast and efficient assay for lead discovery and optimization provides an ideal platform for anti-EV71 drug development targeting 3C protease. PMID:25421478

  3. Biochemical characterization of recombinant Enterovirus 71 3C protease with fluorogenic model peptide substrates and development of a biochemical assay.

    PubMed

    Shang, Luqing; Zhang, Shumei; Yang, Xi; Sun, Jixue; Li, Linfeng; Cui, Zhengjie; He, Qiuhong; Guo, Yu; Sun, Yuna; Yin, Zheng

    2015-04-01

    Enterovirus 71 (EV71), a primary pathogen of hand, foot, and mouth disease (HFMD), affects primarily infants and children. Currently, there are no effective drugs against HFMD. EV71 3C protease performs multiple tasks in the viral replication, which makes it an ideal antiviral target. We synthesized a small set of fluorogenic model peptides derived from cleavage sites of EV71 polyprotein and examined their efficiencies of cleavage by EV71 3C protease. The novel peptide P08 [(2-(N-methylamino)benzoyl) (NMA)-IEALFQGPPK(DNP)FR] was determined to be the most efficiently cleaved by EV71 3C protease, with a kinetic constant kcat/Km of 11.8 ± 0.82 mM(-1) min(-1). Compared with literature reports, P08 gave significant improvement in the signal/background ratio, which makes it an attractive substrate for assay development. A Molecular dynamics simulation study elaborated the interactions between substrate P08 and EV71 3C protease. Arg39, which is located at the bottom of the S2 pocket of EV71 3C protease, may participate in the proteolysis process of substrates. With an aim to evaluate EV71 3C protease inhibitors, a reliable and robust biochemical assay with a Z' factor of 0.87 ± 0.05 was developed. A novel compound (compound 3) (50% inhibitory concentration [IC50] = 1.89 ± 0.25 μM) was discovered using this assay, which effectively suppressed the proliferation of EV 71 (strain Fuyang) in rhabdomyosarcoma (RD) cells with a highly selective index (50% effective concentration [EC50] = 4.54 ± 0.51 μM; 50% cytotoxic concentration [CC50] > 100 μM). This fast and efficient assay for lead discovery and optimization provides an ideal platform for anti-EV71 drug development targeting 3C protease.

  4. Degradation of the encephalomyocarditis virus and hepatitis A virus 3C proteases by the ubiquitin/26S proteasome system in vivo

    SciTech Connect

    Schlax, Peter E.; Zhang Jin; Lewis, Elizabeth; Planchart, Antonio; Lawson, T. Glen . E-mail: tlawson@bates.edu

    2007-04-10

    We have isolated stably transfected mouse embryonic fibroblast cell lines that inducibly express either the mature encephalomyocarditis virus (EMCV) or hepatitis A virus (HAV) 3C protease and have used these cells to demonstrate that both proteins are subject to degradation in vivo by the ubiquitin/26S proteasome system. The detection of 3C protease expression in these cells requires inducing conditions and the presence of one of several proteasome inhibitors. Both 3C proteases are incorporated into conjugates with ubiquitin in vivo. HAV 3C protease expression has deleterious effects on cell viability, as determined by observation and counting of cells cultured in the absence or presence of inducing conditions. The EMCV 3C protease was found to be preferentially localized to the nucleus of induced cells, while the HAV 3C protease remains in the cytoplasm. The absence of polyubiquitinated EMCV 3C protease conjugates in nuclear fraction preparations suggests that localization to the nucleus can protect this protein from ubiquitination.

  5. Antiviral activities of peptide-based covalent inhibitors of the Enterovirus 71 3C protease

    PubMed Central

    Tan, Yong Wah; Ang, Melgious Jin Yan; Lau, Qiu Ying; Poulsen, Anders; Ng, Fui Mee; Then, Siew Wen; Peng, Jianhe; Hill, Jeffrey; Hong, Wan Jin; Chia, Cheng San Brian; Chu, Justin Jang Hann

    2016-01-01

    Hand, Foot and Mouth Disease is a highly contagious disease caused by a range of human enteroviruses. Outbreaks occur regularly, especially in the Asia-Pacific region, putting a burden on public healthcare systems. Currently, there is no antiviral for treating this infectious disease and the only vaccines are limited to circulation in China, presenting an unmet medical need that needs to be filled urgently. The human enterovirus 3 C protease has been deemed a plausible drug target due to its essential roles in viral replication. In this study, we designed and synthesized 10 analogues of the Rhinovirus 3 C protease inhibitor, Rupintrivir, and tested their 3 C protease inhibitory activities followed by a cellular assay using human enterovirus 71 (EV71)-infected human RD cells. Our results revealed that a peptide-based compound containing a trifluoromethyl moiety to be the most potent analogue, with an EC50 of 65 nM, suggesting its potential as a lead for antiviral drug discovery. PMID:27645381

  6. Irreversible inhibitors of the 3C protease of Coxsackie virus through templated assembly of protein-binding fragments

    NASA Astrophysics Data System (ADS)

    Becker, Daniel; Kaczmarska, Zuzanna; Arkona, Christoph; Schulz, Robert; Tauber, Carolin; Wolber, Gerhard; Hilgenfeld, Rolf; Coll, Miquel; Rademann, Jörg

    2016-09-01

    Small-molecule fragments binding to biomacromolecules can be starting points for the development of drugs, but are often difficult to detect due to low affinities. Here we present a strategy that identifies protein-binding fragments through their potential to induce the target-guided formation of covalently bound, irreversible enzyme inhibitors. A protein-binding nucleophile reacts reversibly with a bis-electrophilic warhead, thereby positioning the second electrophile in close proximity of the active site of a viral protease, resulting in the covalent de-activation of the enzyme. The concept is implemented for Coxsackie virus B3 3C protease, a pharmacological target against enteroviral infections. Using an aldehyde-epoxide as bis-electrophile, active fragment combinations are validated through measuring the protein inactivation rate and by detecting covalent protein modification in mass spectrometry. The structure of one enzyme-inhibitor complex is determined by X-ray crystallography. The presented warhead activation assay provides potent non-peptidic, broad-spectrum inhibitors of enteroviral proteases.

  7. Irreversible inhibitors of the 3C protease of Coxsackie virus through templated assembly of protein-binding fragments

    PubMed Central

    Becker, Daniel; Kaczmarska, Zuzanna; Arkona, Christoph; Schulz, Robert; Tauber, Carolin; Wolber, Gerhard; Hilgenfeld, Rolf; Coll, Miquel; Rademann, Jörg

    2016-01-01

    Small-molecule fragments binding to biomacromolecules can be starting points for the development of drugs, but are often difficult to detect due to low affinities. Here we present a strategy that identifies protein-binding fragments through their potential to induce the target-guided formation of covalently bound, irreversible enzyme inhibitors. A protein-binding nucleophile reacts reversibly with a bis-electrophilic warhead, thereby positioning the second electrophile in close proximity of the active site of a viral protease, resulting in the covalent de-activation of the enzyme. The concept is implemented for Coxsackie virus B3 3C protease, a pharmacological target against enteroviral infections. Using an aldehyde-epoxide as bis-electrophile, active fragment combinations are validated through measuring the protein inactivation rate and by detecting covalent protein modification in mass spectrometry. The structure of one enzyme–inhibitor complex is determined by X-ray crystallography. The presented warhead activation assay provides potent non-peptidic, broad-spectrum inhibitors of enteroviral proteases. PMID:27677239

  8. Irreversible inhibitors of the 3C protease of Coxsackie virus through templated assembly of protein-binding fragments.

    PubMed

    Becker, Daniel; Kaczmarska, Zuzanna; Arkona, Christoph; Schulz, Robert; Tauber, Carolin; Wolber, Gerhard; Hilgenfeld, Rolf; Coll, Miquel; Rademann, Jörg

    2016-09-28

    Small-molecule fragments binding to biomacromolecules can be starting points for the development of drugs, but are often difficult to detect due to low affinities. Here we present a strategy that identifies protein-binding fragments through their potential to induce the target-guided formation of covalently bound, irreversible enzyme inhibitors. A protein-binding nucleophile reacts reversibly with a bis-electrophilic warhead, thereby positioning the second electrophile in close proximity of the active site of a viral protease, resulting in the covalent de-activation of the enzyme. The concept is implemented for Coxsackie virus B3 3C protease, a pharmacological target against enteroviral infections. Using an aldehyde-epoxide as bis-electrophile, active fragment combinations are validated through measuring the protein inactivation rate and by detecting covalent protein modification in mass spectrometry. The structure of one enzyme-inhibitor complex is determined by X-ray crystallography. The presented warhead activation assay provides potent non-peptidic, broad-spectrum inhibitors of enteroviral proteases.

  9. Secreted Aspergillus fumigatus Protease Alp1 Degrades Human Complement Proteins C3, C4, and C5▿

    PubMed Central

    Behnsen, Judith; Lessing, Franziska; Schindler, Susann; Wartenberg, Dirk; Jacobsen, Ilse D.; Thoen, Marcel; Zipfel, Peter F.; Brakhage, Axel A.

    2010-01-01

    The opportunistic human pathogenic fungus Aspergillus fumigatus is a major cause of fungal infections in immunocompromised patients. Innate immunity plays an important role in the defense against infections. The complement system represents an essential part of the innate immune system. This cascade system is activated on the surface of A. fumigatus conidia and hyphae and enhances phagocytosis of conidia. A. fumigatus conidia but not hyphae bind to their surface host complement regulators factor H, FHL-1, and CFHR1, which control complement activation. Here, we show that A. fumigatus hyphae possess an additional endogenous activity to control complement activation. A. fumigatus culture supernatant efficiently cleaved complement components C3, C4, C5, and C1q as well as immunoglobulin G. Secretome analysis and protease inhibitor studies identified the secreted alkaline protease Alp1, which is present in large amounts in the culture supernatant, as the central molecule responsible for this cleavage. An alp1 deletion strain was generated, and the culture supernatant possessed minimal complement-degrading activity. Moreover, protein extract derived from an Escherichia coli strain overproducing Alp1 cleaved C3b, C4b, and C5. Thus, the protease Alp1 is responsible for the observed cleavage and degrades a broad range of different substrates. In summary, we identified a novel mechanism in A. fumigatus that contributes to evasion from the host complement attack. PMID:20498262

  10. X-Ray Structure and Inhibition of 3C-like Protease from Porcine Epidemic Diarrhea Virus

    PubMed Central

    St. John, Sarah E.; Anson, Brandon J.; Mesecar, Andrew D.

    2016-01-01

    Porcine epidemic diarrhea virus (PEDV) is a coronavirus that infects pigs and can have mortality rates approaching 100% in piglets, causing serious economic impact. The 3C-like protease (3CLpro) is essential for the coronaviral life cycle and is an appealing target for the development of therapeutics. We report the expression, purification, crystallization and 2.10 Å X-ray structure of 3CLpro from PEDV. Analysis of the PEDV 3CLpro structure and comparison to other coronaviral 3CLpro’s from the same alpha-coronavirus phylogeny shows that the overall structures and active site architectures across 3CLpro’s are conserved, with the exception of a loop that comprises the protease S2 pocket. We found a known inhibitor of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CLpro, (R)-16, to have inhibitor activity against PEDV 3CLpro, despite that SARS-3CLpro and PEDV 3CLpro share only 45.4% sequence identity. Structural comparison reveals that the majority of residues involved in (R)-16 binding to SARS-3CLpro are conserved in PEDV-3CLpro; however, the sequence variation and positional difference in the loop forming the S2 pocket may account for large observed difference in IC50 values. This work advances our understanding of the subtle, but important, differences in coronaviral 3CLpro architecture and contributes to the broader structural knowledge of coronaviral 3CLpro’s. PMID:27173881

  11. X-ray structure and inhibition of 3C-like protease from porcine epidemic diarrhea virus

    SciTech Connect

    St. John, Sarah E.; Anson, Brandon J.; Mesecar, Andrew D.

    2016-05-13

    Porcine epidemic diarrhea virus (PEDV) is a coronavirus that infects pigs and can have mortality rates approaching 100% in piglets, causing serious economic impact. The 3C-like protease (3CLpro) is essential for the coronaviral life cycle and is an appealing target for the development of therapeutics. We report the expression, purification, crystallization and 2.10 angstrom X-ray structure of 3CLpro from PEDV. Analysis of the PEDV 3CLpro structure and comparison to other coronaviral 3CLpro's from the same alpha-coronavirus phylogeny shows that the overall structures and active site architectures across 3CLpro's are conserved, with the exception of a loop that comprises the protease S-2 pocket. We found a known inhibitor of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CLpro, (R)-16, to have inhibitor activity against PEDV 3CLpro, despite that SARS-3CLpro and PEDV 3CLpro share only 45.4% sequence identity. Structural comparison reveals that the majority of residues involved in (R)-16 binding to SARS-3CLpro are conserved in PEDV-3CLpro; however, the sequence variation and positional difference in the loop forming the S-2 pocket may account for large observed difference in IC50 values. In conclusion, this work advances our understanding of the subtle, but important, differences in coronaviral 3CLpro architecture and contributes to the broader structural knowledge of coronaviral 3CLpro's.

  12. 3C-like protease of rabbit hemorrhagic disease virus: identification of cleavage sites in the ORF1 polyprotein and analysis of cleavage specificity.

    PubMed Central

    Wirblich, C; Sibilia, M; Boniotti, M B; Rossi, C; Thiel, H J; Meyers, G

    1995-01-01

    Rabbit hemorrhagic disease virus, a positive-stranded RNA virus of the family Caliciviridae, encodes a trypsin-like cysteine protease as part of a large polyprotein. Upon expression in Escherichia coli, the protease releases itself from larger precursors by proteolytic cleavages at its N and C termini. Both cleavage sites were determined by N-terminal sequence analysis of the cleavage products. Cleavage at the N terminus of the protease occurred with high efficiency at an EG dipeptide at positions 1108 and 1109. Cleavage at the C terminus of the protease occurred with low efficiency at an ET dipeptide at positions 1251 and 1252. To study the cleavage specificity of the protease, amino acid substitutions were introduced at the P2, P1, and P1' positions at the cleavage site at the N-terminal boundary of the protease. This analysis showed that the amino acid at the P1 position is the most important determinant for substrate recognition. Only glutamic acid, glutamine, and aspartic acid were tolerated at this position. At the P1' position, glycine, serine, and alanine were the preferred substrates of the protease, but a number of amino acids with larger side chains were also tolerated. Substitutions at the P2 position had only little effect on the cleavage efficiency. Cell-free expression of the C-terminal half of the ORF1 polyprotein showed that the protease catalyzes cleavage at the junction of the RNA polymerase and the capsid protein. An EG dipeptide at positions 1767 and 1768 was identified as the putative cleavage site. Our data show that rabbit hemorrhagic disease virus encodes a trypsin-like cysteine protease that is similar to 3C proteases with regard to function and specificity but is more similar to 2A proteases with regard to size. PMID:7474137

  13. X-ray structure and inhibition of 3C-like protease from porcine epidemic diarrhea virus

    DOE PAGES

    St. John, Sarah E.; Anson, Brandon J.; Mesecar, Andrew D.

    2016-05-13

    Porcine epidemic diarrhea virus (PEDV) is a coronavirus that infects pigs and can have mortality rates approaching 100% in piglets, causing serious economic impact. The 3C-like protease (3CLpro) is essential for the coronaviral life cycle and is an appealing target for the development of therapeutics. We report the expression, purification, crystallization and 2.10 angstrom X-ray structure of 3CLpro from PEDV. Analysis of the PEDV 3CLpro structure and comparison to other coronaviral 3CLpro's from the same alpha-coronavirus phylogeny shows that the overall structures and active site architectures across 3CLpro's are conserved, with the exception of a loop that comprises the proteasemore » S-2 pocket. We found a known inhibitor of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CLpro, (R)-16, to have inhibitor activity against PEDV 3CLpro, despite that SARS-3CLpro and PEDV 3CLpro share only 45.4% sequence identity. Structural comparison reveals that the majority of residues involved in (R)-16 binding to SARS-3CLpro are conserved in PEDV-3CLpro; however, the sequence variation and positional difference in the loop forming the S-2 pocket may account for large observed difference in IC50 values. In conclusion, this work advances our understanding of the subtle, but important, differences in coronaviral 3CLpro architecture and contributes to the broader structural knowledge of coronaviral 3CLpro's.« less

  14. Efficient production of foot-and-mouth disease virus empty capsids in insect cells following down regulation of 3C protease activity

    PubMed Central

    Porta, Claudine; Xu, Xiaodong; Loureiro, Silvia; Paramasivam, Saravanan; Ren, Junyuan; Al-Khalil, Tara; Burman, Alison; Jackson, Terry; Belsham, Graham J.; Curry, Stephen; Lomonossoff, George P.; Parida, Satya; Paton, David; Li, Yanmin; Wilsden, Ginette; Ferris, Nigel; Owens, Ray; Kotecha, Abhay; Fry, Elizabeth; Stuart, David I.; Charleston, Bryan; Jones, Ian M.

    2013-01-01

    Foot-and-mouth disease virus (FMDV) is a significant economically and distributed globally pathogen of Artiodactyla. Current vaccines are chemically inactivated whole virus particles that require large-scale virus growth in strict bio-containment with the associated risks of accidental release or incomplete inactivation. Non-infectious empty capsids are structural mimics of authentic particles with no associated risk and constitute an alternate vaccine candidate. Capsids self-assemble from the processed virus structural proteins, VP0, VP3 and VP1, which are released from the structural protein precursor P1-2A by the action of the virus-encoded 3C protease. To date recombinant empty capsid assembly has been limited by poor expression levels, restricting the development of empty capsids as a viable vaccine. Here expression of the FMDV structural protein precursor P1-2A in insect cells is shown to be efficient but linkage of the cognate 3C protease to the C-terminus reduces expression significantly. Inactivation of the 3C enzyme in a P1-2A-3C cassette allows expression and intermediate levels of 3C activity resulted in efficient processing of the P1-2A precursor into the structural proteins which assembled into empty capsids. Expression was independent of the insect host cell background and leads to capsids that are recognised as authentic by a range of anti-FMDV bovine sera suggesting their feasibility as an alternate vaccine. PMID:23174161

  15. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  16. Coronaviruses resistant to a 3C-like protease inhibitor are attenuated for replication and pathogenesis, revealing a low genetic barrier but high fitness cost of resistance.

    PubMed

    Deng, Xufang; StJohn, Sarah E; Osswald, Heather L; O'Brien, Amornrat; Banach, Bridget S; Sleeman, Katrina; Ghosh, Arun K; Mesecar, Andrew D; Baker, Susan C

    2014-10-01

    Viral protease inhibitors are remarkably effective at blocking the replication of viruses such as human immunodeficiency virus and hepatitis C virus, but they inevitably lead to the selection of inhibitor-resistant mutants, which may contribute to ongoing disease. Protease inhibitors blocking the replication of coronavirus (CoV), including the causative agents of severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS), provide a promising foundation for the development of anticoronaviral therapeutics. However, the selection and consequences of inhibitor-resistant CoVs are unknown. In this study, we exploited the model coronavirus, mouse hepatitis virus (MHV), to investigate the genotype and phenotype of MHV quasispecies selected for resistance to a broad-spectrum CoV 3C-like protease (3CLpro) inhibitor. Clonal sequencing identified single or double mutations within the 3CLpro coding sequence of inhibitor-resistant virus. Using reverse genetics to generate isogenic viruses with mutant 3CLpros, we found that viruses encoding double-mutant 3CLpros are fully resistant to the inhibitor and exhibit a significant delay in proteolytic processing of the viral replicase polyprotein. The inhibitor-resistant viruses also exhibited postponed and reduced production of infectious virus particles. Biochemical analysis verified double-mutant 3CLpro enzyme as impaired for protease activity and exhibiting reduced sensitivity to the inhibitor and revealed a delayed kinetics of inhibitor hydrolysis and activity restoration. Furthermore, the inhibitor-resistant virus was shown to be highly attenuated in mice. Our study provides the first insight into the pathogenicity and mechanism of 3CLpro inhibitor-resistant CoV mutants, revealing a low genetic barrier but high fitness cost of resistance. Importance: RNA viruses are infamous for their ability to evolve in response to selective pressure, such as the presence of antiviral drugs. For coronaviruses such as

  17. Insights into cleavage specificity from the crystal structure of foot-and-mouth disease virus 3C protease complexed with a peptide substrate.

    PubMed

    Zunszain, Patricia A; Knox, Stephen R; Sweeney, Trevor R; Yang, Jingjie; Roqué-Rosell, Núria; Belsham, Graham J; Leatherbarrow, Robin J; Curry, Stephen

    2010-01-15

    Picornavirus replication is critically dependent on the correct processing of a polyprotein precursor by 3C protease(s) (3C(pro)) at multiple specific sites with related but non-identical sequences. To investigate the structural basis of its cleavage specificity, we performed the first crystallographic structural analysis of non-covalent complexes of a picornavirus 3C(pro) with peptide substrates. The X-ray crystal structure of the foot-and-mouth disease virus 3C(pro), mutated to replace the catalytic Cys by Ala and bound to a peptide (APAKQ|LLNFD) corresponding to the P5-P5' region of the VP1-2A cleavage junction in the viral polyprotein, was determined up to 2.5 A resolution. Comparison with free enzyme reveals significant conformational changes in 3C(pro) on substrate binding that lead to the formation of an extended interface of contact primarily involving the P4-P2' positions of the peptide. Strikingly, the deep S1' specificity pocket needed to accommodate P1'-Leu only forms when the peptide binds. Substrate specificity was investigated using peptide cleavage assays to show the impact of amino acid substitutions within the P5-P4' region of synthetic substrates. The structure of the enzyme-peptide complex explains the marked substrate preferences for particular P4, P2 and P1 residue types, as well as the relative promiscuity at P3 and on the P' side of the scissile bond. Furthermore, crystallographic analysis of the complex with a modified VP1-2A peptide (APAKE|LLNFD) containing a Gln-to-Glu substitution reveals an identical mode of peptide binding and explains the ability of foot-and-mouth disease virus 3C(pro) to cleave sequences containing either P1-Gln or P1-Glu. Structure-based mutagenesis was used to probe interactions within the S1' specificity pocket and to provide direct evidence of the important contribution made by Asp84 of the Cys-His-Asp catalytic triad to proteolytic activity. Our results provide a new level of detail in our understanding of the

  18. Sequence adaptations affecting cleavage of the VP1/2A junction by the 3C protease in foot-and-mouth disease virus-infected cells.

    PubMed

    Gullberg, Maria; Polacek, Charlotta; Belsham, Graham J

    2014-11-01

    The foot-and-mouth disease virus (FMDV) capsid protein precursor P1-2A is cleaved by the virus-encoded 3C protease to VP0, VP3, VP1 and 2A. It was shown previously that modification of a single amino acid residue (K210E) within the VP1 protein and close to the VP1/2A cleavage site, inhibited cleavage of this junction and produced 'self-tagged' virus particles. A second site substitution (E83K) within VP1 was also observed within the rescued virus [Gullberg et al. (2013). J Virol 87: , 11591-11603]. It was shown here that introduction of this E83K change alone into a serotype O virus resulted in the rapid accumulation of a second site substitution within the 2A sequence (L2P), which also blocked VP1/2A cleavage. This suggests a linkage between the E83K change in VP1 and cleavage of the VP1/2A junction. Cells infected with viruses containing the VP1 K210E or the 2A L2P substitutions contained the uncleaved VP1-2A protein. The 2A L2P substitution resulted in the VP1/2A junction being highly resistant to cleavage by the 3C protease, hence it may be a preferred route for 'tagging' virus particles.

  19. Mechanism for Controlling the Dimer-Monomer Switch and Coupling Dimerization to Catalysis of the Severe Acute Respiratory Syndrome Coronavirus 3C-Like Protease

    SciTech Connect

    Shi,J.; Sivaraman, J.; Song, J.

    2008-01-01

    Unlike 3C protease, the severe acute respiratory syndrome coronavirus (SARS-CoV) 3C-like protease (3CLpro) is only enzymatically active as a homodimer and its catalysis is under extensive regulation by the unique extra domain. Despite intense studies, two puzzles still remain: (i) how the dimer-monomer switch is controlled and (ii) why dimerization is absolutely required for catalysis. Here we report the monomeric crystal structure of the SARS-CoV 3CLpro mutant R298A at a resolution of 1.75 Angstroms . Detailed analysis reveals that Arg298 serves as a key component for maintaining dimerization, and consequently, its mutation will trigger a cooperative switch from a dimer to a monomer. The monomeric enzyme is irreversibly inactivated because its catalytic machinery is frozen in the collapsed state, characteristic of the formation of a short 310-helix from an active-site loop. Remarkably, dimerization appears to be coupled to catalysis in 3CLpro through the use of overlapped residues for two networks, one for dimerization and another for the catalysis.

  20. PARP9-DTX3L ubiquitin ligase targets host histone H2BJ and viral 3C protease to enhance interferon signaling and control viral infection

    PubMed Central

    Zhang, Yong; Mao, Dailing; Roswit, William T.; Jin, Xiaohua; Patel, Anand C.; Patel, Dhara A.; Agapov, Eugene; Wang, Zhepeng; Tidwell, Rose M.; Atkinson, Jeffrey J.; Huang, Guangming; McCarthy, Ronald; Yu, Jinsheng; Yun, Nadezhda E.; Paessler, Slobodan; Lawson, T. Glen; Omattage, Natalie S.; Brett, Tom J.; Holtzman, Michael J.

    2015-01-01

    Enhancing the response to interferon could offer an immunological advantage to the host. In support of this concept, we used a modified form of the transcription factor STAT1 to achieve interferon hyperresponsiveness without toxicity and markedly improve antiviral function in transgenic mice and transduced human cells. We found that the improvement depends on expression of a PARP9-DTX3L complex with distinct domains for interaction with STAT1 and for activity as an E3 ubiquitin ligase that acts on host histone H2BJ to promote interferon-stimulated gene expression and on viral 3C proteases to initiate their degradation via the immunoproteasome. Together, PARP9-DTX3L acts on host and pathogen to achieve a double layer of immunity within a safe reserve in the interferon signaling pathway. PMID:26479788

  1. Design, synthesis and crystallographic analysis of nitrile-based broad-spectrum peptidomimetic inhibitors for coronavirus 3C-like proteases.

    PubMed

    Chuck, Chi-Pang; Chen, Chao; Ke, Zhihai; Wan, David Chi-Cheong; Chow, Hak-Fun; Wong, Kam-Bo

    2013-01-01

    Coronaviral infection is associated with up to 5% of respiratory tract diseases. The 3C-like protease (3CL(pro)) of coronaviruses is required for proteolytic processing of polyproteins and viral replication, and is a promising target for the development of drugs against coronaviral infection. We designed and synthesized four nitrile-based peptidomimetic inhibitors with different N-terminal protective groups and different peptide length, and examined their inhibitory effect on the in-vitro enzymatic activity of 3CL(pro) of severe-acute-respiratory-syndrome-coronavirus. The IC(50) values of the inhibitors were in the range of 4.6-49 μM, demonstrating that the nitrile warhead can effectively inactivate the 3CL(pro) autocleavage process. The best inhibitor, Cbz-AVLQ-CN with an N-terminal carbobenzyloxy group, was ~10x more potent than the other inhibitors tested. Crystal structures of the enzyme-inhibitor complexes showed that the nitrile warhead inhibits 3CL(pro) by forming a covalent bond with the catalytic Cys145 residue, while the AVLQ peptide forms a number of favourable interactions with the S1-S4 substrate-binding pockets. We have further showed that the peptidomimetic inhibitor, Cbz-AVLQ-CN, has broad-spectrum inhibition against 3CL(pro) from human coronavirus strains 229E, NL63, OC43, HKU1, and infectious bronchitis virus, with IC(50) values ranging from 1.3 to 3.7 μM, but no detectable inhibition against caspase-3. In summary, we have shown that the nitrile-based peptidomimetic inhibitors are effective against 3CL(pro), and they inhibit 3CL(pro) from a broad range of coronaviruses. Our results provide further insights into the future design of drugs that could serve as a first line defence against coronaviral infection.

  2. Assessing Activity and Inhibition of Middle East Respiratory Syndrome Coronavirus Papain-Like and 3C-Like Proteases Using Luciferase-Based Biosensors

    PubMed Central

    Kilianski, Andy; Mielech, Anna M.; Deng, Xufang

    2013-01-01

    Middle East respiratory syndrome coronavirus (MERS-CoV) is associated with an outbreak of more than 90 cases of severe pneumonia with high mortality (greater than 50%). To date, there are no antiviral drugs or specific therapies to treat MERS-CoV. To rapidly identify potential inhibitors of MERS-CoV replication, we expressed the papain-like protease (PLpro) and the 3-chymotrypsin-like protease (3CLpro) from MERS-CoV and developed luciferase-based biosensors to monitor protease activity in cells. We show that the expressed MERS-CoV PLpro recognizes and processes the canonical CoV-PLpro cleavage site RLKGG in the biosensor. However, existing CoV PLpro inhibitors were unable to block MERS-CoV PLpro activity, likely due to the divergence of the amino acid sequence in the drug binding site. To investigate MERS-CoV 3CLpro activity, we expressed the protease in context with flanking nonstructural protein 4 (nsp4) and the amino-terminal portion of nsp6 and detected processing of the luciferase-based biosensors containing the canonical 3CLpro cleavage site VRLQS. Importantly, we found that a small-molecule inhibitor that blocks replication of severe acute respiratory syndrome (SARS) CoV and murine CoV also inhibits the activity of MERS-CoV 3CLpro. Overall, the protease expression and biosensor assays developed here allow for rapid evaluation of viral protease activity and the identification of protease inhibitors. These biosensor assays can now be used to screen for MERS-CoV-specific or broad-spectrum coronavirus PLpro and 3CLpro inhibitors. PMID:23986593

  3. Synthesis, modification and docking studies of 5-sulfonyl isatin derivatives as SARS-CoV 3C-like protease inhibitors.

    PubMed

    Liu, Wei; Zhu, He-Min; Niu, Guo-Jun; Shi, En-Zhi; Chen, Jie; Sun, Bo; Chen, Wei-Qiang; Zhou, Hong-Gang; Yang, Cheng

    2014-01-01

    The Severe Acute Respiratory Syndrome (SARS) is a serious life-threatening and strikingly mortal respiratory illness caused by SARS-CoV. SARS-CoV which contains a chymotrypsin-like main protease analogous to that of the main picornavirus protease, 3CL(pro). 3CL(pro) plays a pivotal role in the viral replication cycle and is a potential target for SARS inhibitor development. A series of isatin derivatives as possible SARS-CoV 3CL(pro) inhibitors was designed, synthesized, and evaluated by in vitro protease assay using fluorogenic substrate peptide, in which several showed potent inhibition against the 3CL(pro). Structure-activity relationship was analyzed, and possible binding interaction modes were proposed by molecular docking studies. Among all compounds, 8k₁ showed most potent inhibitory activity against 3CL(pro) (IC₅₀=1.04 μM). These results indicated that these inhibitors could be potentially developed into anti-SARS drugs.

  4. Protection of guinea pigs and swine by a recombinant adenovirus expressing O serotype of foot-and-mouth disease virus whole capsid and 3C protease.

    PubMed

    Lu, Zengjun; Bao, Huifang; Cao, Yimei; Sun, Pu; Guo, Jianhun; Li, Pinghua; Bai, Xingwen; Chen, Yingli; Xie, Baoxia; Li, Dong; Liu, Zaixin; Xie, Qingge

    2008-12-19

    Two recombinant adenoviruses were constructed expressing foot-and-mouth disease virus (FMDV) capsid and 3C/3CD proteins in replicative deficient human adenovirus type 5 vector. Guinea pigs vaccinated with 1-3 x 10(8)TCID(50) Ad-P12x3C recombinant adenovirus were completely protected against 10,000GID(50) homologous virulent FMDV challenge 25 days post vaccination (dpv). Ad-P12x3CD vaccinated guinea pigs were only partially protected. Swine were vaccinated once with 1x10(9)TCID(50) Ad-P12x3C hybrid virus and challenged 28 days later. Three of four vaccinated swine were completely protected against 200 pig 50% infectious doses (ID(50)) of homologous FMDV challenge, and vaccinated pigs developed specific cellular and humoral immune responses. The immune effect of Ad-P12x3C in swine further indicated that the recombinant adenovirus was highly efficient in transferring the foreign gene. This approach may thus be a very hopeful tool for developing FMD live virus vector vaccine.

  5. The nuclear protein Sam68 is cleaved by the FMDV 3C protease redistributing Sam68 to the cytoplasm during FMDV infection of host cells

    SciTech Connect

    Lawrence, Paul; Schafer, Elizabeth A.; Rieder, Elizabeth

    2012-03-30

    Picornavirus infection can lead to disruption of nuclear pore traffic, shut-off of cell translation machinery, and cleavage of proteins involved in cellular signal transduction and the innate response to infection. Here, we demonstrated that the FMDV 3C{sup pro} induced the cleavage of nuclear RNA-binding protein Sam68 C-terminus containing the nuclear localization sequence (NLS). Consequently, it stimulated the redistribution of Sam68 to the cytoplasm. The siRNA knockdown of Sam68 resulted in a 1000-fold reduction in viral titers, which prompted us to study the effect of Sam68 on FMDV post-entry events. Interestingly, Sam68 interacts with the internal ribosomal entry site within the 5 Prime non-translated region of the FMDV genome, and Sam68 knockdown decreased FMDV IRES-driven activity in vitro suggesting that it could modulate translation of the viral genome. The results uncover a novel role for Sam68 in the context of picornaviruses and the proteolysis of a new cellular target of the FMDV 3C{sup pro}.

  6. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  7. INTEGRATED POLARIZATION PROPERTIES OF 3C48, 3C138, 3C147, AND 3C286

    SciTech Connect

    Perley, R. A.; Butler, B. J. E-mail: BButler@nrao.edu

    2013-06-01

    We present the integrated polarization properties of the four compact radio sources 3C48, 3C138, 3C147, and 3C286, from 1 to 50 GHz, over a 30 yr time frame spanning 1982-2012. Using the polarized emission of Mars, we have determined that the position angle of the linearly polarized emission of 3C286 rises from 33 Degree-Sign at 8 GHz to 36 Degree-Sign at 45 GHz. There is no evidence for a change in the position angle over time. Using these values, the position angles of the integrated polarized emission from the other three sources are determined as a function of frequency and time. The fractional polarization of 3C286 is found to be slowly rising, at all frequencies, at a rate of {approx}0.015% yr{sup -1}. The fractional polarizations of 3C48, 3C138, and 3C147 are all slowly variable, with the variations correlated with changes in the total flux densities of these sources.

  8. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  9. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  10. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  11. Efficient expression and purification of a protease from the common cold virus, human rhinovirus type 14

    NASA Astrophysics Data System (ADS)

    Leong, L. E.-C.; Walker, P. A.; Porter, A. G.

    1992-08-01

    The protease (3C pro) from human rhinovirus serotype-14 (HRV-14) has been cloned and efficiently expressed in E. coli. A straightforward single-step purification of the recombinant 3C pro has been achieved by fusing the protein to the car☐y-terminus of the glutathione-S-transferase from Schistosoma japonicum. Modifications made to the 5' end of the PCR fragment coding for the 3C pro have allowed the specific cleavage of the fusion protein using thrombin to yield mature 3C pro with the correct amino-terminal amino acid. This protease has been shown to be active when assayed using synthetic peptides corresponding to the natural cleavage recognition sequences within the polyprotein. Other substrates are being developed for this protease for possible use in the screening of inhibitors of 3C pro. Sufficient protease 3C pro has been purified for initial attempts at crystallization.

  12. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  13. An optical study of 3C 31, 3C 66B, 3C 120, and their jets

    SciTech Connect

    Fraix-burnet, D.; Golombek, D.; Macchetto, F.D. Space Telescope Science Institute, Baltimore, MD )

    1991-08-01

    The paper presents the results of BVRI CCD photometry of the radio galaxies 3C 31, 3C 66B, and 3C 120, and V polarimetry of 3C 120. The photometry of the jet of 3C 66B definitively establishes the synchrotron nature of the optical emission. No optical counterpart of the radio counterjet in 3C 66B and of the radio jets in 3C 31 and 3C 120 is found. A rotating ring and an ionized region are present, respectively, in 3C 31 (NGC 383) and its companion galaxy NGC 382, but no isophotal distortions are found which could have revealed a gravitational interaction between the two galaxies as is the case in 3C 66B. The elliptical isophotes of 3C 120 show a slight off-centering, roughly in the direction of the radio jet, very much like 3C 66B. An upper limit of 20 percent is found for the polarization level of the condensations in 3C 120. 50 refs.

  14. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  15. Curtiss XSO3C-1 Seagull

    NASA Technical Reports Server (NTRS)

    1940-01-01

    Curtiss XSO3C-1 Seagull: Although drag reduction was very important to radial engined aircraft, it was no less important to aircraft such as this inline Ranger powered Curtiss XSO3C-1 Seagull. Here the Seagull is shown in the 30 x 60 Full Scale Tunnel in October of 1940. The XSO3C-1 was also undergoing study to improve engine cooling. Published in Aircraft; FST; Curtiss XSO3C-1 Seagull; Full Scale Tunnel; Nicklas

  16. 18 CFR 3c.2 - Nonpublic information.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Nonpublic information. 3c.2 Section 3c.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES STANDARDS OF CONDUCT § 3c.2 Nonpublic information. (a) Section 1264(d)...

  17. 18 CFR 3c.2 - Nonpublic information.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Nonpublic information. 3c.2 Section 3c.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES STANDARDS OF CONDUCT § 3c.2 Nonpublic information. (a) Section 1264(d)...

  18. 18 CFR 3c.2 - Nonpublic information.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Nonpublic information. 3c.2 Section 3c.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES STANDARDS OF CONDUCT § 3c.2 Nonpublic information. (a) Section 1264(d)...

  19. 18 CFR 3c.2 - Nonpublic information.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Nonpublic information. 3c.2 Section 3c.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES STANDARDS OF CONDUCT § 3c.2 Nonpublic information. (a) Section 1264(d)...

  20. 18 CFR 3c.2 - Nonpublic information.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Nonpublic information. 3c.2 Section 3c.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES STANDARDS OF CONDUCT § 3c.2 Nonpublic information. (a) Section 1264(d)...

  1. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  2. The high energy source 3C 273

    NASA Technical Reports Server (NTRS)

    Vonmontigny, Corinna

    1990-01-01

    The properties of 3C 273 are reviewed and an attempt is made to find an answer to the question why 3C 273 is the only extragalactic source so far, which was detected at energies greater than or equal to 50 MeV.

  3. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  4. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  5. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  6. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  7. Laundry performance of subtilisin proteases.

    PubMed

    Wolff, A M; Showell, M S; Venegas, M G; Barnett, B L; Wertz, W C

    1996-01-01

    Effective laundry protease performance against susceptible stains depends upon both the enzyme itself and the environment in which it must work. In order to technically design superior laundry proteases, a model for protease's mechanism of action in detergents was developed which has been substantiated through-the-wash. While evaluation of this model and/or a given protease's effectiveness could be judged by a variety of methods, the utility of using visual wash performance comparisons, analytical, and stain characterization studies is described. Finally, data comparing the performance of wild type Subtilisin proteases with mutants designed via the projected model are given, demonstrating possible utility of the system.

  8. NATO-3C/Delta launch

    NASA Technical Reports Server (NTRS)

    1978-01-01

    NATO-3C, the third in a series of NATO defense-related communication satellites, is scheduled to be launched on a delta vehicle from the Eastern Test Range no earlier than November 15, 1978. NATO-3A and -3B were successfully launched by Delta vehicles in April 1976 and January 1977, respectively. The NATO-3C spacecraft will be capable of transmitting voice, data, facsimile, and telex messages among military ground stations. The launch vehicle for the NATO-3C mission will be the Delta 2914 configuration. The launch vehicle is to place the spacecraft in a synchronous transfer orbit. The spacecraft Apogee Kick motor is to be fired at fifth transfer orbit apogee to circularize its orbit at geosynchronous altitude of 35,900 km(22,260 miles) above the equator over the Atlantic Ocean somewhere between 45 and 50 degrees W longitude.

  9. EGRET observations of 3C 273

    NASA Technical Reports Server (NTRS)

    Von Montigny, C.; Bertsch, D. L.; Fichtel, C. E.; Hartman, R. C.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Kwok, P. W.; Lin, Y. C.; Mattox, J. R.

    1993-01-01

    The quasar 3C 273 was detected by COS-B in the 1970's. EGRET observations of this sky region in June and October 1991 revealed a flux from 3C 273 lower than that measured by COS-B. The flux observed by EGRET in the June period is approximately 3 x 10 exp -7/sq cm s for energies greater than 100 MeV. During the October observation it appears to be even lower. For the first observation a preliminary spectrum which has a photon index of 2.4 has been derived.

  10. EGRET observations of 3 C 273

    NASA Technical Reports Server (NTRS)

    Vonmontigny, C.; Bertsch, D. L.; Fichtel, C. E.; Hartman, R. C.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Kwok, P. W.; Lin, Y. C.; Mattox, J. R.

    1992-01-01

    The quasar 3C 273 was detected by the Compton Observatory Satellite (COS-B) in the 1970's. Energetic Gamma Ray Experiment Telescope (EGRET) observations of this sky region in Jun. and Oct. 1991 revealed a flux from 3C 273 lower than that measured by COS-B. The flux observed by EGRET in the June period is approximately 0.0000003/sq cm(exp -2) sec(exp -1) for energies greater than 100 MeV. During the Oct. observation it appears to be even lower. For the first observation a preliminary spectrum was derived which was a photon index of 2.4.

  11. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  12. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  13. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  14. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  15. Multifrequency observations of extended radio galaxies V - 3C 31, 3C 33.1, 3C 35, 3C 66B, 3C 129, 3C 130, 3C 223, 3C 310, 3C 390.3 and 4C 48.29

    NASA Astrophysics Data System (ADS)

    van Breugel, W.; Jagers, W.

    1982-08-01

    A sample of 3C radio sources of large angular size has been observed in total and polarized intensity at several wavelengths with the Westerbork Synthesis Radio Telescope. The sources were selected such that their largest angular size was greater than about 200 arcsec and their declination greater than about 25 degrees. Some additional sources with radio jets or peculiar morphology were also included. The name of each source, its structural type classification, wavelength of observation, and data references are given.

  16. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  17. A Tunable, Modular Approach to Fluorescent Protease-Activated Reporters

    PubMed Central

    Wu, Peng; Nicholls, Samantha B.; Hardy, Jeanne A.

    2013-01-01

    Proteases are one of the most important and historically utilized classes of drug targets. To effectively interrogate this class of proteins, which encodes nearly 2% of the human proteome, it is necessary to develop effective and cost-efficient methods that report on their activity both in vitro and in vivo. We have developed a robust reporter of caspase proteolytic activity, called caspase-activatable green fluorescent protein (CA-GFP). The caspases play central roles in homeostatic regulation, as they execute programmed cell death, and in drug design, as caspases are involved in diseases ranging from cancer to neurodegeneration. CA-GFP is a genetically encoded dark-to-bright fluorescent reporter of caspase activity in in vitro, cell-based, and animal systems. Based on the CA-GFP platform, we developed reporters that can discriminate the activities of caspase-6 and -7, two highly related proteases. A second series of reporters, activated by human rhinovirus 3C protease, demonstrated that we could alter the specificity of the reporter by reengineering the protease recognition sequence. Finally, we took advantage of the spectrum of known fluorescent proteins to generate green, yellow, cyan, and red reporters, paving the way for multiplex protease monitoring. PMID:23561537

  18. ALMA Polarization Science Verification: 3C 286

    NASA Astrophysics Data System (ADS)

    Nagai, H.; Nakanishi, K.; Paladino, R.; Moellenbrock, G.; Fomalont, E.; Amigano, A.; Vlahakis, C.; Remijan, A.; ALMA Polarization Team

    2015-12-01

    The ALMA polarization science verification results on 3C 286 are presented. The measured polarization percentage and polarization position angle of the continuum emission at 1.3 mm are about 16% and 39 degrees, respectively. They are quite similar to those at longer wavelength, but seem to increase slightly. Similar trends were also found in the previous measurement using the IRAM 30-m telescope (Agudo et al. 2012). The final image rms on the polarization image is better than 0.1% of the total intensity, demonstrating the very high polarization sensitivity of ALMA.

  19. Structure of the radio sources 3C 196 and 3C 280

    SciTech Connect

    Bovkun, V.; Zhuk, I.; Men', A.

    1981-05-01

    The structure of the quasar 3C 196 and the radio galaxy 3C 280 at 20- and 25-MHz frequency has been surveyed by the scintillation technique with the URAN-1 interferometer. Angular sizes are estimated for the scintillating components and the extended portions of each source. In 3C 196 these components have effective angular sizes of 2'' +- 1''.5 and 18'' x 25'', with the compact feature contributing 0.46 +- 0.20 of the total flux. Spectra of the various structural components of the source are compiled for the range 20--5000 MHz. In 3C 280 the effective angular size of the scintillating component is 1''.5 +- 1''.2; the extended region measures >10'' across. The compact feature contributes 0.35 +- 0.20 of the total flux.

  20. CHANDRA Observations OF The Shock Heated Gas Around 3c 288 And 3c 449

    NASA Astrophysics Data System (ADS)

    Lal, Dharam V.; Kraft, R. P.; Evans, D. A.; Hardcastle, M. J.; Nulsen, P. E. J.; Croston, J. H.; Forman, W. R.; Jones, C.; Lee, J. C.

    2010-03-01

    The inflation of radio bubbles in the hot gas atmospheres of clusters of galaxies plays an important role in the overall energy budget of the ICM. Regular gentle (i.e. subsonic) nuclear outbursts may be able to provide sufficient energy to the gas in the cool cores of clusters to offset radiative losses and regulate large cooling flows; and one method to supplement the total energy input into the gas is for the lobes to initially drive strong shocks into the gas. We present results from Chandra/ACIS-S observations of the hot gas atmospheres of two powerful, nearby radio galaxies in poor clusters: 3C 288 and 3C 449. We measure the total energy of the current outburst to be a few times 10^{59} ergs for 3C 288 (T = 2.8 keV, L_X = 1.4 × 10^{44} ergs) and ˜10^{58} ergs for 3C 449 (T = 1.5 keV, L_X = 2.0 × 10^{42} ergs). We find multiple surface brightness discontinuities in the gas, which are probably shocks and are indicative of supersonic heating by the inflation of the radio lobe. We do not find X-ray cavity in 3C 288, whereas cavities are associated with both the radio lobes in 3C 449.

  1. Double Faraday rotation toward 3C 27

    NASA Astrophysics Data System (ADS)

    Goldstein, S. J., Jr.; Reed, J. A.

    1984-08-01

    From observations of the integrated flux of 3C 27 with the NRAO 140 foot (43 m) telescope at 40 frequencies between 1250 and 1445 MHz, the authors deduce rotation measures of 165±15 and -104±4 rad m-2. Since the source (assumed to be a radio galaxy) has components 45arcsec apart, it is concluded that the net magnetic field reverses between these directions. One explanation is that a large magnetic field surrounding the central galaxy of the distant source covers one component but not the other. Another explanation is that our Galaxy contains a dipole field with a scale of order 1 pc. One component of the distant source is seen inside the current loop associated with the dipole field, while the other is seen outside the loop.

  2. Photometric reverberation mapping of 3C 120

    NASA Astrophysics Data System (ADS)

    Pozo Nuñez, F.; Ramolla, M.; Westhues, C.; Bruckmann, C.; Haas, M.; Chini, R.; Steenbrugge, K.; Murphy, M.

    2012-09-01

    We present the results of a five month monitoring campaign of the local active galactic nuclei (AGN) 3C 120. Observations with a median sampling of two days were conducted with the robotic 15 cm telescope VYSOS-6 located near Cerro Armazones in Chile. Broad band (B, V) and narrow band (NB) filters were used in order to measure fluxes of the AGN and the Hβ broad line region (BLR) emission line. The NB flux is constituted by about 50% continuum and 50% Hβ emission line. To disentangle line and continuum flux, a synthetic Hβ light curve was created by subtracting a scaled V-band light curve from the NB light curve. Here we show that the Hβ emission line responds to continuum variations with a rest frame lag of 23.6 ± 1.69 days. We estimate a virial mass of the central black hole MBH = 57 ± 27 × 106 M⊙, by combining the obtained lag with the velocity dispersion of a single contemporaneous spectrum. Using the flux variation gradient method, we determined the host galaxy subtracted rest frame 5100 Å luminosity at the time of our monitoring campaign with an uncertainty of 10% (LAGN = (6.94 ± 0.71) × 1043 erg s-1). Compared with recent spectroscopic reverberation results, 3C 120 shifts in the RBLR - LAGN diagram remarkably close to the theoretically expected relation of R ∝ L0.5. Our results demonstrate the performance of photometric AGN reverberation mapping, in particular for efficiently determining the BLR size and the AGN luminosity. Table 5 is available in electronic form at http://www.aanda.org

  3. FULL POLARIZATION SPECTRA OF 3C 279

    SciTech Connect

    Homan, D. C.; Lister, M. L.; Aller, H. D.; Aller, M. F.; Wardle, J. F. C. E-mail: mlister@physics.purdue.edu E-mail: mfa@umich.edu

    2009-05-01

    We report the results of parsec-scale, multifrequency Very Long Baseline Array observations of the core region of 3C 279 in Stokes I, linear polarization, and circular polarization. These full polarization spectra are modeled by radiative transfer simulations to constrain the magnetic field and particle properties of the parsec-scale jet in 3C 279. We find that the polarization properties of the core region, including the amount of linear polarization, the amount and sign of Faraday rotation, and the amount and sign of circular polarization can be explained by a consistent physical picture. The base of the jet, component D, is modeled as an inhomogeneous Blandford-Koenigl style conical jet dominated by a vector-ordered poloidal magnetic field along the jet axis, and we estimate its net magnetic flux. This poloidal field is responsible for the linear and circular polarization from this inhomogeneous component. Farther down the jet, the magnetic field in two homogeneous features is dominated by local shocks and a smaller fraction of vector-ordered poloidal field remains along the jet axis. This remaining poloidal field provides internal Faraday rotation which drives Faraday conversion of linear polarization into circular polarization from these components. In this picture, we find the jet to be kinetically dominated by protons with the radiating particles being dominated by electrons at an approximate fraction of {approx}>75%, still allowing the potential for a significant admixture of positrons. Based on the amounts of Faraday conversion deduced for the homogeneous components, we find a plausible range for the lower cutoff in the relativistic particle energy spectrum to be 5 {approx}< {gamma} {sub l} {approx}< 35. The physical picture described here is not unique if the observed Faraday rotation and depolarization occur in screens external to the jet; however, we find the joint explanation of linear and circular polarization observations from a single set of

  4. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  5. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  6. Multiwavelength observations of giant radio galaxy 3C 35 and 3C 284

    NASA Astrophysics Data System (ADS)

    Pal, Sabyasachi; Chakrabarti, Sandip Kumar; Patra, Dusmanta; Konar, Chiranjib

    2016-07-01

    We report multi wavelength observations of large radio galaxy 3C35 and 3C284. The low frequency observations were done with the Giant Metrewave Radio Telescope (GMRT) starting from 150 MHz. The high frequency observations were done with Jansky Very Large Array (JVLA). Our main motivation for these observations is to estimate the spectral ages of these galaxies and to examine any proof of extended emission at low radio frequencies due to an earlier cycle of activity. The spectral age is measured by fitting the spectra with different spectral ageing models e.g. Kardashev-Pacholczyk (KP), Jaffe-Perola (JP) and Continuous Injection (CI).

  7. THE SUZAKU VIEW OF 3C 382

    SciTech Connect

    Sambruna, R. M.; Gliozzi, M.; Tombesi, F.; Braito, V.; Ballo, L.; Reynolds, C. S.

    2011-06-20

    We present a long (116 ks) Suzaku observation of the broad-line radio galaxy (BLRG) 3C 382 acquired in 2007 April. A Swift BAT spectrum in 15-200 keV from the 58 month survey is also analyzed, together with an archival XMM-Newton EPIC exposure of 20 ks obtained one year after Suzaku. Our main result is the finding with Suzaku of a broad Fe K line with a relativistic profile consistent with emission from an accretion disk at tens of gravitational radii from the central black hole. The XIS data indicate emission from highly ionized iron and allow us to set tight, albeit model-dependent, constraints on the inner and outer radii of the disk reflecting region, r{sub in} {approx_equal} 10 r{sub g} and r{sub out} {approx_equal} 20 r{sub g} , respectively, and on the disk inclination, i {approx_equal} 30{sup 0}. Two ionized reflection components are possibly observed, with similar contributions of {approx}10% to the total continuum-a highly ionized one, with log{xi} {approx_equal} 3 erg s{sup -1} cm, which successfully models the relativistic line, and a mildly ionized one, with log{xi} {approx_equal} 1.5 erg s{sup -1} cm, which models the narrow Fe K{alpha} and high energy hump. When both these components are included, there is no further requirement for an additional blackbody soft excess below 2 keV. The Suzaku data confirm the presence of a warm absorber previously known from grating studies. After accounting for all the spectral features, the intrinsic photon index of the X-ray continuum is {Gamma}{sub x} {approx_equal} 1.8 with a cutoff energy at {approx}200 keV, consistent with Comptonization models and excluding jet-related emission up to these energies. Comparison of the X-ray properties of 3C 382 and other BLRGs to Seyferts recently observed with Suzaku and BAT confirms the idea that the distinction between radio-loud and radio-quiet active galactic nucleus at X-rays is blurred. The two classes form a continuum distribution in terms of X-ray photon index

  8. The resolved outflow from 3C 48

    SciTech Connect

    Shih, Hsin-Yi; Stockton, Alan E-mail: stockton@ifa.hawaii.edu

    2014-10-20

    We investigate the properties of the high-velocity outflow driven by the young radio jet of 3C 48, a compact-steep-spectrum source. We use the Space Telescope Imaging Spectrograph on board the Hubble Space Telecope to obtain (1) low-resolution UV and optical spectra and (2) multi-slit medium-resolution spectra of the ionized outflow. With supporting data from ground-based spectrographs, we are able to accurately measure the ratios of diagnostic emission lines such as [O III] λ5007, [O III] λ3727, [N II] λ6548, Hα, Hβ, [Ne V] λ3425, and [Ne III] λ3869. We fit the observed emission-line ratios using a range of ionization models, powered by active galactic nucleus (AGN) radiation and shocks, produced by the MAPPINGS code. We have determined that AGN radiation is likely the dominant ionization source. The outflow's density is estimated to be in the range n = 10{sup 3}-10{sup 4} cm{sup –3}, the mass is ∼6 × 10{sup 6} M {sub ☉}, and the metallicity is likely equal to or higher than solar. Compared with the typical outflows associated with more evolved radio jets, this young outflow is denser, less massive, and more metal rich. Multi-slit observations allow us to construct a two-dimensional velocity map of the outflow that shows a wide range of velocities with distinct velocity components, suggesting a wide-angle clumpy outflow.

  9. 3C 236: Radio Source, Interrupted?

    NASA Astrophysics Data System (ADS)

    O'Dea, Christopher P.; Koekemoer, Anton M.; Baum, Stefi A.; Sparks, William B.; Martel, André R.; Allen, Mark G.; Macchetto, Ferdinando D.; Miley, George K.

    2001-04-01

    We present new Hubble Space Telescope Space Telescope Imaging Spectrograph MAMA near-UV images and archival Wide Field Planetary Camera 2 (WFPC2) V- and R-band images that reveal the presence of four star-forming regions in an arc along the edge of the dust lane in the giant (4 Mpc) radio galaxy 3C 236. Two of the star-forming regions are relatively young, with ages of order ~107 yr, while the other two are older, with ages of order ~108-109 yr, which is comparable to the estimated age of the giant radio source. Based on dynamical and spectral aging arguments, we suggest that the fuel supply to the active galactic nucleus (AGN) was interrupted for ~107 yr and has now been restored, resulting in the formation of the inner 2 kpc-scale radio source. This timescale is similar to that of the age of the youngest of the star-forming regions. We suggest that the transport of gas in the disk is nonsteady and that this produces the multiple episodes of star formation in the disk, as well as the multiple epochs of radio source activity. If the inner radio source and the youngest star-forming region are related by the same event of gas transport, the gas must be transported from the hundreds of parsec scale to the subparsec scale on a timescale of ~107 yr, which is similar to the dynamical timescale of the gas on the hundreds of parsec scale.

  10. 3C236: Radio Source, Interrupted?

    NASA Astrophysics Data System (ADS)

    O'Dea, C. P.; Koekemoer, A. M.; Baum, S. A.; Sparks, W. B.

    We present highlights of the results of new HST STIS/MAMA near-UV images and archival WFPC2 V- and R-band images which reveal the presence of four apparently star forming regions in an arc along the edge of the dust lane in the giant (4 Mpc) radio galaxy 3C236. Two of the star forming regions are relatively young with ages of order ~107 yr, while the other two are older with ages of order ~108 -- 109 yr, which is comparable to the estimated age of the giant radio source. Based on dynamical and spectral aging arguments, we suggest that the fuel supply to the AGN was interrupted for ~107 yr and has now been restored, resulting in the formation of the inner 2 kpc scale radio source. This time scale is similar to that of the age of the youngest of the star forming regions. We suggest that the transport of gas in the disk is non-steady and that this produces both the multiple episodes of star formation in the disk as well as the multiple epochs of radio source activity. If the inner radio source and the youngest star forming region are related by the same event of gas transport, the gas must be transported from the hundreds of pc scale to the sub-parsec scale on a time scale of ~107 yr, which is similar to the dynamical timescale of the gas on the hundreds of pc scales.

  11. OSSE observations of 3C 273

    NASA Technical Reports Server (NTRS)

    Johnson, W. N.; Dermer, C. D.; Kinzer, R. L.; Kurfess, J. D.; Strickman, M. S.; Mcnaron-Brown, K.; Jourdain, E.; Jung, G. V.; Grabelsky, D. A.; Purcell, W. R.

    1995-01-01

    We report results of multiple observations of the quasar 3C 273 with the Oriented Scintillation Spectrometer Experiment (OSSE) instrument on the Compton Gamma Ray Observatory. These observations span the period from 1991 June through 1993 January and represent the most sensitive observations to date in low-energy gamma rays. The source was detected at historically weak 100 keV fluxes compared with previous measurements. Variability by factors of approximately 3 on timescales of approximately equal 2 months was observed in the energy band 50-150 keV. The data are well described by a single power law with a proton number index Gamma = 1.7 +/- 0.1. No significant change of Gamma was observed during changes in intensity. Thermal models do not provide acceptable fits to the data. When the OSSE data are combined with contemporaneous measurements by COMPTEL and EGRET, the spectrum is seen to break at an energy of 1.0(+0.9, -0.4) MeV to a softer power law with Delta Gamma = 0.7(+0.06, -0.11), forming a power law with Gamma = 2.4 between approximately 1 MeV and several GeV.

  12. HST And VLA Polarimetry Of 3C 264 And 3C 66B

    NASA Astrophysics Data System (ADS)

    Padgett, C. Alexander; Perlman, E. S.; Georganopoulos, M.; O'Dea, C. P.; Baum, S. A.; Sparks, W. B.; Biretta, J. A.

    2006-09-01

    We present new VLA A- and B-array radio polarimetry at 22.5 GHz, and images at 8.4GHz of 3C 264, a low luminosity FR I in Abell 1367. We also present high resolution VLA A-array polarimetry of the jet of 3C 66B, both at 22.5 GHz and 43 GHz. This is the latest addition to an ongoing study of these objects, which includes optical polarimetry in several bands and multiband imaging with HST, and X-ray observations with Chandra. We find further evidence for the hypothesis that 3C 264 falls into the category of low luminosity BL Lac objects (Rector, Stocke & Perlman, 1999) in significant variability of the polarization position angle in the core of this object in only 4 years (Lara et al, 2003). This variability, together with our measured value of its optical spectral index of alpha = 0.77, and a previously derived viewing angle of < 50 degrees (Baum et al, 1997; Lara et al, 2003), puts a fairly strong constraint on the classification of 3C 264 as a low luminosity BL Lac. We also present matched resolution HST and VLA data for both of these objects, allowing for direct morphological comparisons to be made, as well as full resolution radio to optical spectral index maps.

  13. Low-frequency study of two giant radio galaxies: 3C 35 and 3C 223

    NASA Astrophysics Data System (ADS)

    Orrù, E.; Murgia, M.; Feretti, L.; Govoni, F.; Giovannini, G.; Lane, W.; Kassim, N.; Paladino, R.

    2010-06-01

    Aims: Radio galaxies with a projected linear size ⪆1 Mpc are classified as giant radio sources. According to the current interpretation these are old sources which have evolved in a low-density ambient medium. Because radiative losses are negligible at low frequency, extending spectral aging studies in this frequency range will allow us to determine the zero-age electron spectrum injected and then to improve the estimate of the synchrotron age of the source. Methods: We present Very Large Array images at 74 MHz and 327 MHz of two giant radio sources: 3C 35 and 3C 223. We performed a spectral study using 74, 327, 608 and 1400 GHz images. The spectral shape is estimated in different positions along the source. Results: The radio spectrum follows a power-law in the hotspots, while in the inner region of the lobe the shape of the spectrum shows a curvature at high frequencies. This steepening agrees with synchrotron aging of the emitting relativistic electrons. In order to estimate the synchrotron age of the sources, the spectra were fitted with a synchrotron model of emission. They show that 3C 35 is an old source of 143 ± 20 Myr, while 3C 223 is a younger source of 72 ± 4 Myr.

  14. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  15. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  16. The Accelerating Jet of 3C 279

    NASA Astrophysics Data System (ADS)

    Bloom, S. D.; Fromm, C. M.; Ros, E.

    2013-01-01

    Analysis of the proper motions of the subparsec scale jet of the quasar 3C 279 at 15 GHz with the Very Long Baseline Array shows significant accelerations in four of nine superluminal features. Analysis of these motions is combined with the analysis of flux density light curves to constrain values of Lorentz factor and viewing angle (and their derivatives) for each component. The data for each of these components are consistent with significant changes to the Lorentz factor, viewing angle, and azimuthal angle, suggesting jet bending with changes in speed. We see that for these observed components Lorentz factors are in the range Γ = 10-41, viewing angles are in the range thetav = 0.°1-5.°0, and intrinsic (source frame) flux density is in the range, F ν, int = 1.5 × 10-9-1.5 × 10-5 Jy. Considering individual components, the Lorentz factors vary from Γ = 11-16 for C1, Γ = 31-41 for C5, Γ = 29-41 for C6, and Γ = 9-12 for C8, indicating that there is no single underlying flow speed to the jet and likely we are seeing pattern speeds from shocks in the jet. The viewing angles vary in time from 0.°6 to 1.°5 in the case of C1 (the least extreme example), from 0.°5 to 5.°0 in the case of C8, and from 0.°1 to 0.°9 for C5 (the last two being the most extreme examples). The intrinsic flux density varies by factors from 1.4 for C8 and 430 for C5. Theoretical analysis of the accelerations also indicates potential jet bending. In addition, for one component, C5, polarization measurements also set limits to the trajectory of the jet.

  17. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  18. Jet precession and its observational evidence: The cases of 3C 345 and 3C 120

    NASA Astrophysics Data System (ADS)

    Caproni, Anderson; Abraham, Zulema

    2004-11-01

    Several radio-loud objects exhibit a complex structure when observed at radio wavelengths: a stationary core, which is thought to harbour the central engine that powers the AGN phenomena, and a relativistic jet, formed by several superluminal components. In some cases, jet components are ejected with different apparent proper motions and directions on the plane of the sky. Moreover, these sources can also show signatures of long-term periodic variability in their historical optical light curve. In this work, we selected the objects 3C 120 and 3C 345, which exhibit both characteristics mentioned above, and interpret them in the framework of jet inlet precession. A brief discussion about what kind of mechanism could be responsible for jet precession is also presented.

  19. THE ACCELERATING JET OF 3C 279

    SciTech Connect

    Bloom, S. D.; Fromm, C. M.; Ros, E.

    2013-01-01

    Analysis of the proper motions of the subparsec scale jet of the quasar 3C 279 at 15 GHz with the Very Long Baseline Array shows significant accelerations in four of nine superluminal features. Analysis of these motions is combined with the analysis of flux density light curves to constrain values of Lorentz factor and viewing angle (and their derivatives) for each component. The data for each of these components are consistent with significant changes to the Lorentz factor, viewing angle, and azimuthal angle, suggesting jet bending with changes in speed. We see that for these observed components Lorentz factors are in the range {Gamma} = 10-41, viewing angles are in the range thetav = 0. Degree-Sign 1-5. Degree-Sign 0, and intrinsic (source frame) flux density is in the range, F{sub {nu},int} 1.5 Multiplication-Sign 10{sup -9}-1.5 Multiplication-Sign 10{sup -5} Jy. Considering individual components, the Lorentz factors vary from {Gamma} = 11-16 for C1, {Gamma} = 31-41 for C5, {Gamma} = 29-41 for C6, and {Gamma} = 9-12 for C8, indicating that there is no single underlying flow speed to the jet and likely we are seeing pattern speeds from shocks in the jet. The viewing angles vary in time from 0. Degree-Sign 6 to 1. Degree-Sign 5 in the case of C1 (the least extreme example), from 0. Degree-Sign 5 to 5. Degree-Sign 0 in the case of C8, and from 0. Degree-Sign 1 to 0. Degree-Sign 9 for C5 (the last two being the most extreme examples). The intrinsic flux density varies by factors from 1.4 for C8 and 430 for C5. Theoretical analysis of the accelerations also indicates potential jet bending. In addition, for one component, C5, polarization measurements also set limits to the trajectory of the jet.

  20. The Resolved Outflow from 3C 48

    NASA Astrophysics Data System (ADS)

    Shih, Hsin-Yi; Stockton, Alan

    2014-10-01

    We investigate the properties of the high-velocity outflow driven by the young radio jet of 3C 48, a compact-steep-spectrum source. We use the Space Telescope Imaging Spectrograph on board the Hubble Space Telecope to obtain (1) low-resolution UV and optical spectra and (2) multi-slit medium-resolution spectra of the ionized outflow. With supporting data from ground-based spectrographs, we are able to accurately measure the ratios of diagnostic emission lines such as [O III] λ5007, [O III] λ3727, [N II] λ6548, Hα, Hβ, [Ne V] λ3425, and [Ne III] λ3869. We fit the observed emission-line ratios using a range of ionization models, powered by active galactic nucleus (AGN) radiation and shocks, produced by the MAPPINGS code. We have determined that AGN radiation is likely the dominant ionization source. The outflow's density is estimated to be in the range n = 103-104 cm-3, the mass is ~6 × 106 M ⊙, and the metallicity is likely equal to or higher than solar. Compared with the typical outflows associated with more evolved radio jets, this young outflow is denser, less massive, and more metal rich. Multi-slit observations allow us to construct a two-dimensional velocity map of the outflow that shows a wide range of velocities with distinct velocity components, suggesting a wide-angle clumpy outflow. Based in part on observations made with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations are associated with program GO-11574. Some of the data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation. Some of the

  1. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  2. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  3. VLBA Monitoring of 3C 273 and 3C 279 During INTEGRAL Campaigns

    NASA Astrophysics Data System (ADS)

    Savolainen, T.; Wiik, K.; Valtaoja, E.

    2004-10-01

    The gamma-ray blazars 3C 273 and 3C 279 were ob- served with the Very Long Baseline Array (VLBA) over seven epochs during the year 2003 as a part of support- ing observations for two INTEGRAL campaigns targeted on these sources. The VLBA observations were carried out in a full multi-wavelength polarimetric mode yield- ing total and polarized intensity maps at six frequencies ranging from 5 to 86 GHz. The VLBA maps probe the emission of the parsec scale jets in the angular scales of 0.1 - 50 mas, providing information about the dynam- ical state of the jets close to the central engine. As the gamma-ray emission above 100 keV is likely to be jet related, the co-ordinated VLBA observations give a pos- sibility to correlate the gamma-ray flux variations with the structural changes in the jet and, furthermore, with the flux and spectral variations of the individual syn- chrotron emitting components. Possible correlations can help to pinpoint the region where the gamma-ray emis- sion originates, and also establish the source of seed pho- tons for the inverse Compton process. We describe here the VLBA observations and present the first fully cali- brated maps together with a preliminary analysis.

  4. Active protease mapping in 2DE gels.

    PubMed

    Zhao, Zhenjun; Russell, Pamela J

    2009-01-01

    Proteases act as the molecular mediators of many vital biological processes. To understand the function of each protease, it needs to be separated from other proteins and characterized in its natural, biologically active form. In the method described in this chapter, proteases in a biological sample are separated under nonreducing conditions in 2DE gels. A specific small protease substrate, tagged with a fluorescent dye, is copolymerized into the SDS gel in the second dimension. After electrophoresis, the proteins are renatured by washing the gel with Triton X-100 solution or Milli Q water to remove SDS. The gel is then incubated in a protease assay buffer. The hydrolysis of the tagged specific substrate by the renatured protease releases the free fluorescent dye, which fluoresces in situ. The fluorescent spots indicate the location of the specific proteases in the gel and the specificity of the proteases.

  5. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  6. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  7. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  8. Molecular cloning of complementary DNA for human medullasin: an inflammatory serine protease in bone marrow cells.

    PubMed

    Okano, K; Aoki, Y; Sakurai, T; Kajitani, M; Kanai, S; Shimazu, T; Shimizu, H; Naruto, M

    1987-07-01

    Medullasin, an inflammatory serine protease in bone marrow cells, modifies the functions of natural killer cells, monocytes, and granulocytes. We have cloned a medullasin cDNA from a human acute promyelocytic cell (ML3) cDNA library using oligonucleotide probes synthesized from the information of N-terminal amino acid sequence of natural medullasin. The cDNA contained a long open reading frame encoding 237 amino acid residues beginning from the second amino acid of natural meduallasin. The deduced amino acid sequence of medullasin shows a typical serine protease structure, with 41% homology with pig elastase 1.

  9. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  10. New redshift determinations for three 3C radio sources.

    NASA Astrophysics Data System (ADS)

    Reynaldi, V.

    2017-01-01

    I report the new redshift determinations of three radio sources 3C 196.1, 3C 268.2 and 3C 303.1 by using GMOS/Gemini North long-slit optical spectroscopy. The details of the observations are summarized in the following table (the B600 grating was used for the three observations): Object | RA(J2000) | DEC(J2000) | Date of obs. | width-slit(arcsec) | PA(deg) | Exp.Time(sec) 3C 196.1 | 8:15:27.8 | -03:08:27 | Mar 2012 | 0.5 | 50 | 2560 3C 268.2| |12:00:59.1 | 31:33:28 | Feb 2011 | 0.5 | 165 | 2576 3C 303.1 | 14:43:14.5 | 77:07:28 | Feb 2012 | 1 | 145 | 2560 The three of the sources have extended regions of ionized gas that do not obey a spherical distribution.

  11. Extended Optical Flaring of the Blazar 3C 279

    NASA Astrophysics Data System (ADS)

    Turner, C. S.; Miller, H. R.

    2017-03-01

    The blazar, 3C 279, was previously reported to be undergoing a major optical outburst (ATEL#10121 and ATEL#10161). We report optical observations of 3C 279 on March 19 when it was observed with the 24-inch telescope at Georgia State University's Hard Labor Creek Observatory with R=13.46+/-0.01 mag. These observations indicate that 3C 279 continues to be in an extremely bright state.

  12. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  13. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  14. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  15. Protease Profiling in Prostate Cancer

    DTIC Science & Technology

    2004-05-01

    acid synthase, which contains a serine hydrolase domain. We identified a lead inhibitor of this domain of fatty acid synthase, called Orlistat, which...SUBJECT TERMS 15. NUMBER OF PAGES Prostate cancer, tumor biology, protease, proteomics, transgenic, 20 animal model, fatty acid synthase, orlistat 16...the enzymes we identified is fatty acid synthase. Fatty acid synthase is the sole enzyme responsible for the cellular synthesis of fatty acids . This

  16. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  17. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  18. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents.

  19. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  20. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  1. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  2. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  3. 17 CFR 270.3c-6 - Certain transfers of interests in section 3(c)(1) and section 3(c)(7) funds.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES AND REGULATIONS, INVESTMENT COMPANY ACT OF... gift or bequest or pursuant to an agreement relating to a legal separation or divorce. (2) The term Section 3(c)(1) Company means a company that would be an investment company but for the exclusion...

  4. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  5. Spatially Resolved Spectra of 3C Galaxy Nuclei

    NASA Technical Reports Server (NTRS)

    Hutchings, J. B.; Baum, S. A.; Weistrop, D.; Nelson, C.; Kaiser, M. E.; Gelderman, R. F.

    1998-01-01

    We present and discuss visible-wavelength long-slit spectra of four low-redshift 3C galaxies obtained with the Space Telescope Imaging Spectrograph on the Hubble Space Telescope (HST). The slit was aligned with near-nuclear jet-like structure seen in HST images of the galaxies, to give unprecedented spatial resolution of their inner regions. In 3C 135 and 3C 171, the spectra reveal clumpy emission-line structures that indicate outward motions of a few hundred kilometers per second within a centrally illuminated and ionized biconical region. There may also be some low-ionization, high-velocity material associated with 3C 135. In 3C 264 and 3C 78, the jets have blue featureless spectra consistent with their proposed synchrotron origin. There is weak associated line emission in the innermost part of the jets with mild outflow velocity. These jets are bright and highly collimated only within a circumnuclear region of lower galaxy luminosity, which is not dusty. We discuss the origins of these central regions and their connection with relativistic jets.

  6. Fine Structure in 3C 120 and 3C 84. Ph.D. Thesis - Maryland Univ., 24 Aug. 1976

    NASA Technical Reports Server (NTRS)

    Hutton, L. K.

    1976-01-01

    Seven epochs of very long baseline radio interferometric observations of the Seyfert galaxies 3C 120 and 3C 84, at 3.8-cm wave length using stations at Westford, Massachusetts, Goldstone, California, Green Bank, West Virginia, and Onsala, Sweden, have been analyzed for source structure. An algorithm for reconstructing the brightness distribution of a spatially confined source from fringe amplitude and so called closure phase data has been developed and successfully applied to artificially generated test data and to data on the above mentioned sources. Over the two year time period of observation, 3C 120 was observed to consist of a double source showing apparent super relativistic expansion and separation velocities. The total flux changes comprising one outburst can be attributed to one of these components. 3C 84 showed much slower changes, evidently involving flux density changes in individual stationary components rather than relative motion.

  7. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  8. Peptide aldehyde inhibitors of hepatitis A virus 3C proteinase.

    PubMed

    Malcolm, B A; Lowe, C; Shechosky, S; McKay, R T; Yang, C C; Shah, V J; Simon, R J; Vederas, J C; Santi, D V

    1995-06-27

    Picornaviral 3C proteinases are a group of closely related thiol proteinases responsible for processing of the viral polyprotein into its component proteins. These proteinases adopt a chymotrypsin-like fold [Allaire et al. (1994) Nature 369, 72-77; Matthews et al. (1994) Cell 77, 761-771] and a display an active-site configuration like those of the serine proteinases. Peptide-aldehydes based on the preferred peptide substrates for hepatitis A virus (HAV) 3C proteinase were synthesized by reduction of a thioester precursor. Acetyl-Leu-Ala-Ala-(N,N'-dimethylglutaminal) was found to be a reversible, slow-binding inhibitor for HAV 3C with a Ki* of (4.2 +/- 0.8) x 10(-8) M. This inhibitor showed 50-fold less activity against the highly homologous human rhinovirus (strain 14) 3C proteinase, whose peptide substrate specificity is slightly different, suggesting a high degree of selectivity. NMR spectrometry of the adduct of the 13C-labeled inhibitor with the HAV-3C proteinase indicate that a thiohemiacetal is formed between the enzyme and the aldehyde carbon as previously noted for peptide-aldehyde inhibitors of papain [Lewis & Wolfenden (1977) Biochemistry 16,4890-4894; Gamcsik et al. (1983) J. Am. Chem. Soc. 105, 6324-6325]. The adduct can also be observed by electrospray mass spectrometry.

  9. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  10. A Sema3C Mutant Resistant to Cleavage by Furin (FR-Sema3C) Inhibits Choroidal Neovascularization

    PubMed Central

    Toledano, Shira; Lu, Huayi; Palacio, Agustina; Ziv, Keren; Kessler, Ofra; Schaal, Shlomit; Neufeld, Gera; Barak, Yoreh

    2016-01-01

    In age-related macular degeneration (AMD), abnormal sub retinal choroidal neovascularization (CNV) is a major cause of blindness. FR-sema3C is a point mutated form of semaphorin-3C that is resistant to cleavage by furin like pro-protein convertases (FPPC). We have found in previous work that FR-sema3C functions as an anti-angiogenic factor. In this study we investigated the possible use of FR-sema3C as an inhibitor of CNV. FR-sema3C inhibits VEGF as well as PDGF-BB signal transduction in endothelial cells and to less extent bFGF induced signal transduction using a mechanism that does not depend upon the binding of VEGF like the drugs that are currently the mainstay treatment for AMD. CNV was induced in eyes of C57 black mice by laser photocoagulation. Intravitreal injection of FR-Sema3C or aflibercept (VEGF-trap) was then used to inhibit CNV formation. Invading choroidal vessels were visualized a week later by injection of FITC-dextran into the circulation, followed by the measurement of the area of the invading blood vessels. Injection of 0.1 μg FR-Sema3C inhibited CNV by 55% (P<0.01) and was as effective as 5 μg aflibercept. FR-sema3C did not display any adverse effects on retinal function following its injection into eyes of healthy mice as assessed by optokinetic reflex (OKR) and Electro-retinogram (ERG) criteria. Furthermore, FR-sema3C did not induce apoptosis in the retina as determined by TUNEL nor was there any discernable structural damage to the retina as assessed by several immuno-histochemical criteria. Our results suggest that FR-sema3C could perhaps be used for the treatment of AMD, and that it may perhaps be of benefit to patients that do not respond well to current treatments relying on VEGF sequestering agents. PMID:28036336

  11. Viability of Stored Rabbit Erythrocytes Carrying Number C3c.

    DTIC Science & Technology

    1984-05-31

    A-A165 440 VIABILITY OF STORED RABBIT ERYTHROCYTES CARRYING NUBR V no C3C(U) MASSACHUSETTS UNIV MEDICAL SCHOOL MORCESTER UNCLRSSIFI 0 SZYMANSKI 31...Carrying No C3c 0 Annual and Final Report Irma 0. Szymanski, M.D. Ln CD May 31, 1984 I Supported by U.S. ARMY MEDICAL RESEARCH AND DEVELOPMENT COMMAND...Fort Detrick, Frederick, Maryland 21701-5012 Contract No. DAMD17-82-C-2150 .TICD ET University of Massachusetts Medical Center .EC, Worcester

  12. The Radio Spectral Index and Expansion of 3C 58

    DTIC Science & Technology

    2001-10-20

    it has often been described as morphologically similar to the Crab Nebula , the Crab being the prototype for this class. 3C 58 is at a similar distance...the Ðla- ments. This last situation does seem to obtain in the Crab Nebula , where strong circumstantial evidence points to the existence of such a...the surrounding material. We are then brought to a crucial di†erence between 3C 58 and the Crab Nebula : in the case of the Crab, the synchro- tron

  13. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  14. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  15. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  16. A biotechnology perspective of fungal proteases.

    PubMed

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira Filho, Edivaldo Ximenes; Pessoa Junior, Adalberto; Magalhães, Pérola Oliveira

    2015-06-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  17. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  18. VLBI Observations of the Radio Jet in 3C273

    NASA Astrophysics Data System (ADS)

    Unwin, S. C.; Davis, R. J.

    The authors present a new high dynamic range map of the quasar 3C 273, made from observations with a VLBI network of 12 telescopes. This new map at 18 cm wavelength has one of the highest dynamic ranges yet achieved with VLBI, and it shows the 'jet' extending to at least 180 milliarcsec, or 330 pc from the nucleus of the quasar.

  19. Microwave Radiometer – 3 Channel (MWR3C) Handbook

    SciTech Connect

    Cadeddu, MP

    2012-05-04

    The microwave radiometer 3-channel (MWR3C) provides time-series measurements of brightness temperatures from three channels centered at 23.834, 30, and 89 GHz. These three channels are sensitive to the presence of liquid water and precipitable water vapor.

  20. 223 GHz VLBI observations of 3C 273

    NASA Astrophysics Data System (ADS)

    Padin, S.; Woody, D. P.; Hodges, M. W.; Rogers, A. E. E.; Emerson, D. T.; Jewell, P. R.; Lamb, J.; Perfetto, A.; Wright, M. C. H.

    1990-09-01

    In the first 1.4 mm wavelength VLBI test observations, fringes have been detected on the active nucleus of 3C 273 on a baseline from Owens Valley Radio Observatory to Kitt Peak. The observations are consistent with a source whose angular size is smaller than 0.5 mas.

  1. Connection Between X-Ray Emission and Relativistic Jets in the Radio Galaxies 3C 111 and 3C 120

    NASA Technical Reports Server (NTRS)

    Aller, Margo F.

    2005-01-01

    This work represents a part of a longterm study of the X-ray flux variability in radio galaxies and its relation to flux and structural changes in the associated radio jet. The work described here included: 1) continued study of the emission properties of the FR I radio galaxy 3C 120 known to exhibit a jet/disk connection from our past work; and 2) the commencement of monitoring of a second radio galaxy, the FR I1 object 3C 111 which was selected because of similar radio and X-ray properties to 3C 120, including the presence of Fe K a emission. The association between X-ray dips and new superluminal components, suggesting a picture in which the radio jet is fed by accretion events near the black hole, was identified in 3C 120 using combined RXTE and radio flux monitoring data and bi-monthly to monthly imaging data from the VLBA at 43 GHz. Such data were also obtained for both targets during the period described here. Specific goals were to more broadly investigate the X-ray dip/superluminal connection in 3C 120, thereby determining the epochs of X-ray minima and superluminal ejections more accurately (and hence more precisely determining the distance between the accretion disk and the core of the radio jet), and to determine whether a similar pattern is present in the data for a second radio galaxy. In 3C 111 a different time scale (longer time delays between X-ray dips and superluminal ejections) was expected due to the higher black hole mass implied by its higher radio luminosity: no black hole mass is published for this object but one can be determined from a PDS analysis of the RXTE data. The addition of the second source to the study would identify whether a similar connection was present in other sources and, if found, would provide important information on how time scale (and hence size scale) of accretion disk/jet systems depends on black hole mass. The grant included funding for the reduction and analysis of data obtained during the time period of Rossi

  2. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  3. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  4. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application.

  5. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  6. HST Polarimetry of the 3C 273 Jet

    NASA Astrophysics Data System (ADS)

    Clautice, Devon; Perlman, Eric S.; Sparks, William B.; Biretta, John A.; O'Dea, Christopher P.; Baum, Stefi Alison; Cheung, Chi C.; Birkinshaw, Mark; Worrall, Diana M.; Martel, Andre; Urry, C. Megan; Stawarz, Lukasz; Coppi, Paolo S.; Uchiyama, Yasunobu; Cara, Mihai; Meisenheimer, Klaus; Begelman, Mitchell C.

    2017-01-01

    We present preliminary results using HST polarimetry of the jet of 3C 273. Polarization is a critical parameter for understanding jet flows, and has proven essential in characterizing the physics of FR I jets; high-quality HST polarimetry has been done for just two other FR II jets previously. Our recent work on two quasar jets, where we measured high optical polarization in the brightest X-ray knots, has favored the synchrotron emission model over the alternative IC/CMB model for their optical to X-ray emission. These new observations of 3C 273 allow for the determination of the magnetic field structure and confirmation of which emission mechanisms are operating to create its optical to X-ray emission, and will allow us to greatly advance modeling efforts for this jet and nail down its kinetic power, a key unknown parameter for understanding quasars and their cosmological effects.

  7. A decade of 3C technologies: insights into nuclear organization

    PubMed Central

    de Wit, Elzo; de Laat, Wouter

    2012-01-01

    Over the past 10 years, the development of chromosome conformation capture (3C) technology and the subsequent genomic variants thereof have enabled the analysis of nuclear organization at an unprecedented resolution and throughput. The technology relies on the original and, in hindsight, remarkably simple idea that digestion and religation of fixed chromatin in cells, followed by the quantification of ligation junctions, allows for the determination of DNA contact frequencies and insight into chromosome topology. Here we evaluate and compare the current 3C-based methods (including 4C [chromosome conformation capture-on-chip], 5C [chromosome conformation capture carbon copy], HiC, and ChIA-PET), summarize their contribution to our current understanding of genome structure, and discuss how shape influences genome function. PMID:22215806

  8. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  9. Enhancing superconductivity in A3C60 fullerides

    NASA Astrophysics Data System (ADS)

    Kim, Minjae; Nomura, Yusuke; Ferrero, Michel; Seth, Priyanka; Parcollet, Olivier; Georges, Antoine

    2016-10-01

    Motivated by the recent experimental report of a possible light-induced superconductivity in K3C60 at high temperature [Mitrano et al., Nature 530, 451 (2016), 10.1038/nature16522], we investigate theoretical mechanisms for enhanced superconductivity in A3C60 fullerenes. We find that an "interaction imbalance" corresponding to a smaller value of the Coulomb matrix element for two of the molecular orbitals in comparison to the third one, efficiently enhances superconductivity. Furthermore, we perform first-principle calculations of the changes in the electronic structure and in the screened Coulomb matrix elements of K3C60 , brought in by the deformation associated with the pumped T1 u intramolecular mode. We find that an interaction imbalance is indeed induced, with a favorable sign and magnitude for superconductivity enhancement. The physical mechanism responsible for this enhancement consists of a stabilization of the intramolecular states containing a singlet pair, while preserving the orbital fluctuations allowing for a coherent interorbital delocalization of the pair. Other perturbations have also been considered and found to be detrimental to superconductivity. The light-induced deformation and ensuing interaction imbalance is shown to bring superconductivity further into the strong-coupling regime.

  10. The Trails of Superluminal Jet Components in 3C 111

    NASA Technical Reports Server (NTRS)

    Kadler, M.; Ros, E.; Perucho, M.; Kovalev, Y. Y.; Homan, D. C.; Agudo, I.; Kellermann, K. I.; Aller, M. F.; Aller, H. D.; Lister, M. L.; Zensus, J. A.

    2007-01-01

    The parsec-scale radio jet of the broad-line radio galaxy 3C 111 has been monitored since 1995 as part of the 2cm Survey and MOJAVE monitoring observations conducted with the VLBA. Here, we present results from 18 epochs of VLBA observations of 3C 111 and from 18 years of radio flux density monitoring observations conducted at the University of Michigan. A major radio flux-density outburst of 3C 111 occurred in 1996 and was followed by a particularly bright plasma ejection associated with a superluminal jet component. This major event allows us to study a variety of processes associated with outbursts of radio-loud AGN in much greater detail than possible in other cases: the primary perturbation gives rise to the formation of a forward and a backward-shock, which both evolve in characteristically different ways and allow us to draw conclusions about the workflow of jet-production events; the expansion, acceleration and recollimation of the ejected jet plasma in an environment with steep pressure and density gradients are revealed; trailing components are formed in the wake of the primary perturbation as a result of Kelvin- Helmholtz instabilities from the interaction of the jet with the external medium. The jet-medium interaction is further scrutinized by the linear-polarization signature of jet components traveling along the jet and passing a region of steep pressure/density gradients.

  11. Variability studies of 3C 371. [extragalactic radio source

    NASA Technical Reports Server (NTRS)

    Worrall, D. M.

    1986-01-01

    The compact extragalactic radio source, 3C 371, was observed with the X-ray detectors of the EXOSAT satellite for 19.5 hours in 2 observing periods separated by 18 days. This resulted in the discovery of X-ray variability of the source on time scales between 8 hours and about 25 minutes and the confirmation of earlier reports of variability on longer time scales. The short time scale variability agrees remarkably well with earlier predictions based on fitting multifrequency data from the source to a relativistically beamed inhomogeneous synchrotron self-Compton (SSC) jet model. This SSC model is frequently applied to BL Lac objects and related sources, such as 3C 371. However, the number of free parameters in model fits tends to be large, and so independent support such as from this work is important. The X-ray spectral results for 3C 371 also may provide qualitative support for the SSC model in that the spectrum probably consists of two components, with the steeper one at low photon energies. In terms of the model, the low-energy spectrum would be dominated by synchrotron emission extending down to radio energies, whereas the higher energy X-rays would be dominated by Compton radiation.

  12. Hydrodynamical Simulations of Colliding Jets: Modeling 3C 75

    NASA Astrophysics Data System (ADS)

    Molnar, S. M.; Schive, H.-Y.; Birkinshaw, M.; Chiueh, T.; Musoke, G.; Young, A. J.

    2017-01-01

    Radio observations suggest that 3C 75, located in the dumbbell shaped galaxy NGC 1128 at the center of Abell 400, hosts two colliding jets. Motivated by this source, we perform three-dimensional hydrodynamical simulations using a modified version of the GPU-accelerated Adaptive-MEsh-Refinement hydrodynamical parallel code (GAMER) to study colliding extragalactic jets. We find that colliding jets can be cast into two categories: (1) bouncing jets, in which case the jets bounce off each other keeping their identities, and (2) merging jets, when only one jet emerges from the collision. Under some conditions the interaction causes the jets to break up into oscillating filaments of opposite helicity, with consequences for their downstream stability. When one jet is significantly faster than the other and the impact parameter is small, the jets merge; the faster jet takes over the slower one. In the case of merging jets, the oscillations of the filaments, in projection, may show a feature that resembles a double helix, similar to the radio image of 3C 75. Thus we interpret the morphology of 3C 75 as a consequence of the collision of two jets with distinctly different speeds at a small impact parameter, with the faster jet breaking up into two oscillating filaments.

  13. Optimal High-TC Superconductivity in Cs3C60

    NASA Astrophysics Data System (ADS)

    Harshman, Dale; Fiory, Anthony

    The highest superconducting transition temperatures in the (A1-xBx)3C60 superconducting family are seen in the A15 and FCC structural phases of Cs3C60 (optimized under hydrostatic pressure), exhibiting measured values for near-stoichiometric samples of TC0 meas . = 37.8 K and 35.7 K, respectively. It is argued these two Cs-intercalated C60 compounds represent the optimal materials of their respective structures, with superconductivity originating from Coulombic e- h interactions between the C60 molecules, which host the n-type superconductivity, and mediating holes associated with the Cs cations. A variation of the interlayer Coulombic pairing model [Harshman and Fiory, J. Supercond. Nov. Magn. 28 ̲, 2967 (2015), and references therein] is introduced in which TC0 calc . ~ 1 / lζ , where l relates to the mean spacing between interacting charges on surfaces of the C60 molecules, and ζ is the average radial distance between the surface of the C60 molecules and the neighboring Cs cations. For stoichiometric Cs3C60, TC0 calc . = 38.08 K and 35.67 K for the A15 and FCC macrostructures, respectively; the dichotomy is attributable to differences in ζ.

  14. How 3-D, 3-C seismic characterized a carbonate reservoir

    SciTech Connect

    Arestad, J.F.; Mattocks, B.W.; Davis, T.L.; Benson, R.D.

    1995-04-01

    The Reservoir Characterization Project (RCP) at the Colorado School of Mines has pioneered research into 3-D, 3-C (multicomponent) reflection seismology for nearly a decade utilizing both P-wave and S-wave sources. Multicomponent-seismic surveys provide significantly more information about petroleum reservoirs than compressional-wave surveys. Initial 3-D, 3-C surveys acquired by RCP were targeted at characterizing naturally fractured reservoirs. The current phase of the project is oriented towards utilizing shear waves to discriminate lithologic and diagenetic changes within stratigraphic reservoirs where compressional-seismic data has not be effective. The Joffre field, Nisku reservoir, is the site of RCP`s ongoing multidisciplinary research effort in Western Canada. The research team is directed by Colorado School of Mines faculty with graduate team members from geology, geophysics and petroleum engineering departments. While this study is still in progress, some key findings and directions of this research are reported here. The following topics will be discussed: Joffre field 3-D, 3-C survey; compressional wave 3-D technique; shear-wave 3-D technique; converted-wave 3-D technique; reservoir characterization, and future directions.

  15. Infrared spectrophotometry of three Seyfert galaxies and 3C 273

    NASA Technical Reports Server (NTRS)

    Cutri, R. M.; Puetter, R. C.; Rudy, R. J.; Willner, S. P.; Aitken, D. K.; Jones, B.; Merrill, K. M.; Roche, P. F.; Russell, R. W.; Soifer, B. T.

    1981-01-01

    Spectrophotometry in the range 2.1-4.0 microns is presented for the Seyfert galaxies NGC 1068, NGC 4151 and Mrk 231 and the quasar 3C 273, together with broadband and narrowband observations of the Seyfert galaxies in the range 8-13 microns. The spectra of NGC 1068 and NGC 4151 are found to contain a significant component due to starlight, especially at shorter wavelengths. The nonstellar component in NGC 1068 is observed to fall off rapidly at wavelengths shorter than 4 microns, consistent with the interpretation of the excess beyond 5 microns as thermal reradiation by dust. Observations confirm the variability of NGC 4151, and indicate the presence of two components of the flux other than starlight: a nonthermal variable component predominant at shorter wavelengths and a constant, probably thermal component at wavelengths greater than 3 microns. Mrk 231 and 3C 273 exhibit no discernable stellar component and were not observed to vary by more than 10%. Evidence is obtained for a broad minimum in the 8 to 13 micron spectrum of Mrk 231, as well as possible structure between rest wavelengths of 2.8 and 2.9 microns, and the spectrum is not a power law. The spectrum of 3C 273 is consistent with a power law from 1.2 to 10 microns, with small but significant deviations.

  16. The milliarcsecond structure of 3C 273 at 22 GHz

    SciTech Connect

    Zensus, J.A.; Biretta, J.A.; Unwin, S.C.; Cohen, M.H. Owens Valley Radio Observatory, Pasadena, CA )

    1990-12-01

    The first VLBI images at 22 GHz of the jet in the quasar 3C 273 are presented. In addition to the compact core region, two emission regions can be identified with features seen at lower frequencies; they separate from the core with constant speeds of 0.65 + or - 0.09 and 0.92 + or - 0.11 mas/yr, corresponding to apparent superluminal motion of 4.3 + or - 0.3c and 6.1 + or - 0.3c (for Ho = 100 km/s Mpc, qo = 0.5). The core region brightened at about the estimated epoch of zero separation for the latest superluminal component, suggesting a causal relationship. The curved ridge line of the jet smoothly extends inward towards the core, although no pronounced bends in the range of core distance 0.5-2.5 mas are seen. No significant evidence is found against a common path of subsequent superluminal features. An apparent frequency dependence in the position of one superluminal feature tentatively suggests that opacity effects across the jet direction are present. The results are consistent with an interpretation of the superluminal features as shocks in an underlying relativistic flow, although alternative explanations cannot be ruled out. 43 refs.

  17. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  18. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  19. An Overview of the 3C-STAR project

    NASA Astrophysics Data System (ADS)

    Zhang, Y.

    2009-04-01

    Over the past three decades, city clusters have played a leading role in the economic growth of China, owing to their collective economic capacity and interdependency. However, pollution prevention lags behind the economic boom, led to a general decline in air quality in city clusters. As a result, industrial emissions and traffic exhausts together contribute to high levels of ozone (O3) and fine particulate matter (PM2.5) pollution problems ranging from urban to regional scale. Such high levels of both primary and secondary airborne pollutants lead to the development of a (perhaps typically Chinese) "air pollution complex" concept. Air pollution complex is particularly true and significant in Beijing-Tianjin area, Pearl River Delta (PRD) and Yangtze River Delta. The concurrent high concentrations of O3 and PM2.5 in PRD as well as in other China city clusters have led to rather unique pollution characteristics due to interactions between primary emissions and photochemical processes, between gaseous compounds and aerosol phase species, and between local and regional scale processes. The knowledge and experience needed to find solutions to the unique pollution complex in China are still lacking. Starting from 2007, we launch a major project "Synthesized Prevention Techniques for Air Pollution Complex and Integrated Demonstration in Key City-Cluster Region" (3C-STAR) to address those problems scientifically and technically. The purpose of the project is to build up the capacity of regional air pollution control and to establish regional coordination mechanism for joint implementation of pollution control. The project includes a number of key components technically: regional air quality monitoring network and super-sites, regional dynamic emission inventory of multi-pollutants, regional ensemble air quality forecasting model system, and regional management system supported by decision making platform. The 3C-STAR project selected PRD as a core area to have technical

  20. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  1. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  2. Multiwavelength and polarimetric analysis of the flat spectrum radio quasars 3C 273 and 3C 279

    NASA Astrophysics Data System (ADS)

    Fernandes, Sunil Anthony

    This dissertation presents results of multiwavelength analyses of 3C 273 and 3C 279. The main goals were to identify the gamma-ray emission region and dominant high-energy emission processes. Our methodology consisted of analyzing light curves from radio to gamma-rays over 6 - 8 years and polarimetric, spectral and line emission behavior. In 3C 279, we found that the emission from millimeter to ultraviolet was simultaneous and therefore co-spatial. We identified two active states where different high-energy emission processes were dominant. We found multiwavelength flaring events consistent with component ejections and shocks. We proposed that the gamma-ray emission region changed over time based on observations of both simultaneous and delayed gamma-rays emission with respect to low-energy emission during different time-frames. In 3C 273, we identified a non-thermal flare related to a component ejection and a thermal flare related to accretion. From reverberation mapping we found that the broad line region dynamical behavior over time possibly affects the derived supermassive black hole mass. In both objects we found that the gamma-ray spectral index was variable, and a trend of harder spectral index with higher gamma-ray luminosity. From the identification of different dominant high-energy emission processes, we concluded that the dominant high-energy emission mechanism changes with time. Overall, we concluded that similar results from both objects points to behavior that is potentially common to flat spectrum radio quasars. Increasing the sample size of objects analyzed with similar methodologies will provide more results to confirm or refine our conclusions.

  3. Multiwavelength and Polarimetric Analysis of the Flat Spectrum Radio Quasars 3C 273 and 3C 279

    NASA Astrophysics Data System (ADS)

    Fernandes, Sunil; Patiño-Álvarez, Victor; Chavushyan, Vahram; Schlegel, Eric M.; Lopez-Rodriguez, Enrique; León-Tavares, Jonathan; Carrasco, Luis; Valdés, José; Carramiñana, Alberto

    2017-01-01

    This poster presents results of multiwavelength analyses of 3C 273 and 3C 279. The main goals were to identify the gamma-ray emission region and dominant high-energy emission processes. Our methodology consisted of analyzing light curves from radio to gamma-rays over 6 - 8 years and polarimetric, spectral and line emission behavior.In 3C 279, we found that the emission from millimeter to ultraviolet was simultaneous and therefore co-spatial. We identified two active states where different high-energy emission processes were dominant. We found multiwavelength flaring events consistent with component ejections and shocks. We proposed that the gamma-ray emission region changed over time based on observations of both simultaneous and delayed gamma-rays emission with respect to low-energy emission during different time-frames.In 3C 273, we identified a non-thermal flare related to a component ejection and a thermal flare related to accretion. From reverberation mapping we found that the broad line region dynamical behavior over time possibly affects the derived supermassive black hole mass.In both objects we found that the gamma-ray spectral index was variable, and a trend of harder spectral index with higher gamma-ray luminosity. From the identification of different dominant high-energy emission processes, we concluded that the dominant high-energy emission mechanism changes with time. Overall, we concluded that similar results from both objects points to behavior that is potentially common to flat spectrum radio quasars. Increasing the sample size of objects analyzed with similar methodologies will provide more results to confirm or refine our conclusions.

  4. Inhibition of norovirus 3CL protease by bisulfite adducts of transition state inhibitors.

    PubMed

    Mandadapu, Sivakoteswara Rao; Gunnam, Mallikarjuna Reddy; Tiew, Kok-Chuan; Uy, Roxanne Adeline Z; Prior, Allan M; Alliston, Kevin R; Hua, Duy H; Kim, Yunjeong; Chang, Kyeong-Ok; Groutas, William C

    2013-01-01

    Noroviruses are the most common cause of acute viral gastroenteritis, accounting for >21 million cases annually in the US alone. Norovirus infections constitute an important health problem for which there are no specific antiviral therapeutics or vaccines. In this study, a series of bisulfite adducts derived from representative transition state inhibitors (dipeptidyl aldehydes and α-ketoamides) was synthesized and shown to exhibit anti-norovirus activity in a cell-based replicon system. The ED(50) of the most effective inhibitor was 60 nM. This study demonstrates for the first time the utilization of bisulfite adducts of transition state inhibitors in the inhibition of norovirus 3C-like protease in vitro and in a cell-based replicon system. The approach described herein can be extended to the synthesis of the bisulfite adducts of other classes of transition state inhibitors of serine and cysteine proteases, such as α-ketoheterocycles and α-ketoesters.

  5. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  6. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  7. Multiwavelength Observations of 3C 66A in 2003 -- 2004

    NASA Astrophysics Data System (ADS)

    Böttcher, M.

    2006-07-01

    The BL Lac object 3C 66A was the target of an extensive multiwavelength campaign from July 2003 through April 2004. Radio, infrared, and optical observations were carried out by the WEBT-ENIGMA collaboration. At higher energies, 3C 66A was observed in X-rays (RXTE), and at very-high-energy (VHE) γ-rays (STACEE, VERITAS). In addition, the source has been observed with the VLBA at 9 epochs throughout the period September 2003 -- December 2004, including 3 epochs contemporaneous with the core campaign. The source was in an optically bright state, with several bright flares on time scales of several days and microvariability with flux changes of ˜ 5 % on time scales as short as ˜ 2 hr. Spectral variability indicating a softening throughout both the rising and decaying phases of flares, has been found. The spectral energy distribution (SED) indicates a ν Fν peak in the optical regime. The 3 -- 10 keV X-ray flux of 3C 66A during the core campaign was historically high and its spectrum very soft, indicating that the low-frequency component of the broadband SED extends beyond ˜ 10 keV. No significant X-ray flux and/or spectral variability was detected. STACEE and Whipple observations provided upper flux limits at > 150 GeV and > 390 GeV, respectively. The 22 and 43 GHz VLBA data indicate a rather smooth jet with only moderate internal structure. Evidence for superluminal motion (8.5 ± 5.6 h-1 c) was found in only one out of 6 components, while all other components are consistent with 0 proper motion. The radial brightness profile suggests a magnetic field decay ∝ r-1 and, thus, a predominantly perpendicular magnetic field orientation.

  8. Optical flare of the Quasar 3C279

    NASA Astrophysics Data System (ADS)

    Jorstad, Svetlana; Savchenko, Sergey

    2017-02-01

    The quasar 3C279 shows significant activity at optical wavelengths. According to our observations at the Perkins telescope of Lowell Obs. (Flagstaff, AZ) on February 23 R band magnitude of the quasar reached 14.088+-0.004 with the degree of polarization P=8.82+-0.11%, while observations at the AZT-8 telescope of Crimean Astrophysical Obs. show that the source was more than 1 mag fainter on February 20, R=15.237+-0.005, with P=6.45+0.88%.

  9. Discovery of an optical synchrotron jet in 3C 264

    NASA Technical Reports Server (NTRS)

    Crane, P.; Peletier, R.; Baxter, D.; Sparks, W. B.; Albrecht, R.; Barbieri, C.; Blades, J. C.; Boksenberg, A.; Deharveng, J. M.; Disney, M. J.

    1993-01-01

    Observations with the Faint Object Camera on board the Hubble Space Telescope have revealed a new optical jet in the core of the elliptical galaxy NGC 3862 (3C 264). Morphologically, this jet is similar to the synchrotron jets seen in other galaxies, as it shows knots and bifurcations. The optical spectral index is also similar to that found in other jets. Thus, the nucleus of NGC 3862 appears to contain the fifth known example of an optical synchrotron jet. Since NGC 3862 is a typical radio-loud elliptical galaxy, it seems likely that many nonthermal jets found in the radio continuum may also have optical counterparts.

  10. Multiwavelength variability analysis of the FSRQ 3C 279

    NASA Astrophysics Data System (ADS)

    Patiño-Álvarez, V.; Chavushyan, V.; León-Tavares, J.; Carramiñana, A.; Carrasco, L.; Fernandes, S.; Schlegel, E. M.; López-Rodríguez, E.

    2015-03-01

    We present a multifrequency analysis of the variability in the flat-spectrum radio quasar 3C 279 from 2008 to 2014. Our multiwavelength dataset includes gamma-ray data from Fermi/LAT (Abdo et al. 2009), observations in 1mm from SMA (Gurwell et al. 2007), Near Infrared from OAGH (Carramiñana & Carrasco 2009) and SMARTS (Bonning et al. 2012); optical V band from the Steward Observatory (Smith et al. 2009) and SMARTS; optical spectra from OAGH (Patiño-Álvarez et al. 2013) and the Steward Observatory; and polarization spectra from the Steward Observatory. The light curves are shown in Fig. 1. Six out of seven optical activity periods identified within our dataset show clear counterparts in mm, NIR and gamma-rays, however, the late 2011 - early 2012 optical flare does not have a counterpart in the GeV regime. In this contribution, we discuss the flaring evolution of 3C 279 and speculate about the production of the anomalous activity period.

  11. A Radio-Jet-Galaxy Interaction in 3C441

    NASA Technical Reports Server (NTRS)

    Lacy, Mark; Rawlings, Steve; Blundell, Katherine M.; Ridgway, Susan E.

    1998-01-01

    Multi-wavelength imaging and spectroscopy of the zeta = 0.708 radio galaxy 3C441 and a red aligned optical/infrared component are used to show that the most striking aspect of the radio-optical "alignment effect" in this object is due to the interaction of the radio jet with a companion galaxy in the same group or cluster. The stellar population of the red aligned continuum component is predominately old, but with a small post-starburst population superposed, and it is surrounded by a low surface- brightness halo, possibly a face-on spiral disc. The [OIII]500.7/[OII]372.7 emission line ratio changes dramatically from one side of the component to the other, with the low-ionisation material apparently having passed through the bow shock of the radio source and been compressed. A simple model for the interaction is used to explain the velocity shifts in the emission line gas, and to predict that the ISM of the interacting galaxy is likely to escape once the radio source bow shock has passed though. We also discuss another, much fainter, aligned component, and the sub-arcsecond scale alignment of the radio source host galaxy. Finally we comment on the implications of our explanation of 3C441 for theories of the alignment effect.

  12. The Warped Nuclear Disk of Radio Galaxy 3C 449

    NASA Astrophysics Data System (ADS)

    Tremblay, G. R.; Quillen, A. C.; Floyd, D. J. E.; Noel-Storr, J.; Baum, S. A.; Axon, D. J.; O'Dea, C. P.; Chiaberge, M.; Macchetto, F. D.; Sparks, W. B.; Miley, G. K.; Capetti, A.; Madrid, J. P.; Perlman, E.

    2005-12-01

    Among radio galaxies containing nuclear dust disks, the bipolar jet axis is generally expected to be perpendicular to the disk major axis. However, the FR I radio source 3C 449, possessing a nearly parallel jet/disk orientation on the sky, is an extreme example of a system that does not conform to this expectation. We examine the 600 pc dusty disk in this galaxy with images from the Hubble Space Telescope. We find that a colormap of the disk exhibits a twist in its isocolor contours (isochromes). We model the colormap by integrating galactic starlight through an absorptive disk, and find that the anomalous twist in the isochromes can be reproduced in the model with a vertically thin, warped disk. The model predicts that the disk is nearly perpendicular to the jet axis within 100 pc of the nucleus. We discuss physical mechanisms capable of causing such a warp. We show that a torque on the disk arising from a possible binary black hole in the AGN or radiation pressure from the AGN causes precession on a timescale that is too long to generate such a warp. However, we estimate that the pressure in the X-ray emitting interstellar medium is large enough to perturb the disk. The warped disk in 3C 449 may be a new manifestation of feedback from an active galactic nucleus.

  13. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  14. Bacterial proteases, untapped antimicrobial drug targets.

    PubMed

    Culp, Elizabeth; Wright, Gerard D

    2017-04-01

    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  15. Lysosomal protease expression in mature enamel.

    PubMed

    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D

    2009-01-01

    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  16. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  17. Cleavage Entropy as Quantitative Measure of Protease Specificity

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Margreiter, Michael A.; Spitzer, Gudrun M.; Wallnoefer, Hannes G.; Liedl, Klaus R.

    2013-01-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity. PMID:23637583

  18. Cleavage entropy as quantitative measure of protease specificity.

    PubMed

    Fuchs, Julian E; von Grafenstein, Susanne; Huber, Roland G; Margreiter, Michael A; Spitzer, Gudrun M; Wallnoefer, Hannes G; Liedl, Klaus R

    2013-04-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity.

  19. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  20. 17 CFR 270.3c-4 - Definition of “common trust fund” as used in section 3(c)(3) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 1940 § 270.3c-4 Definition of “common trust fund” as used in section 3(c)(3) of the Act. The term common trust fund as used in section 3(c)(3) of the Act (15 U.S.C. 80a-3(c)(3)) shall include a common...; Provided, That: (a) The common trust fund is operated in compliance with the same State and...

  1. Angular Structure of FrII Radio Sources 3C169.1 and 3C263 at Decameter Wavelengths

    NASA Astrophysics Data System (ADS)

    Vashchishin, R. V.; Shepelev, V. A.; Lozinskyy, A. B.; Lytvynenko, O. A.

    The radio galaxy 3C169.1 and the quasar 3C263, located at nearly the same distance with red shift z>0.6, have similar morphological and spectral characteristics. The maps of the sources obtained at decimeter and centimeter wavelengths have shown they are FRII radio sources with steep spectra and approximately equal angular sizes. The very first investigation of the sources structure at decameter wavelengths is presented in the report. Observations were made using a network of the URAN decameter interferometers with baselines 42 to 950 km and with maximum angular resolution of arcsec order of magnitude. The models of the image of these sources based on visibility functions measured have been obtained at frequencies of 20 and 25 MHz. They were composed of elliptical components with Gaussian brightness distribution. To facilitate the comparison of these lowfrequency models with high-frequency radio images, the latter were converted to the similar models by fitting the Gaussian components to lobes and hot spots selected at the maps. Comparison of the models revealed changes in a structure of the sources caused by the frequency decrease.

  2. The Galactic Magnetic Field in the Quasar 3C 216

    NASA Astrophysics Data System (ADS)

    Venturi, T.; Taylor, G. B.

    1999-11-01

    Multifrequency polarimetric observations made with the Very Long Baseline Array of the quasar 3C 216 reveal the presence of Faraday rotation measures (RMs) in excess of 2000 rad m-2 in the source rest frame in the arc of emission located at ~140 mas from the core. Rotation measures in the range -300 to +300 rad m-2 are detected in the inner 5 mas (~30 pc). While the rotation measure near the core can be explained as being caused by a magnetic field in the narrow-line region, we favor the interpretation for the high RM in the arc that it is caused by a ``local'' Faraday screen produced in a shock where the jet is deflected by the interstellar medium of the host galaxy. Our results indicate that a galactic magnetic field of the order of ~50 μG on a scale greater than 100 pc must be present in the ambient medium.

  3. 3C 279 - The case for 'superluminal' expansion

    NASA Technical Reports Server (NTRS)

    Cotton, W. D.; Counselman, C. C., III; Geller, R. B.; Shapiro, I. I.; Wittels, J. J.; Hinteregger, H. F.; Knight, C. A.; Rogers, A. E. E.; Whitney, A. R.; Clark, T. A.

    1979-01-01

    The compact extragalactic radio source 3C 279 was observed with the Haystack-Goldstone interferometer (wavelength approximately 3.8 cm) during six separate sessions spread between October 1970 and April 1972. The fringe amplitudes from each of these observation sessions were consistent with a two-component model of the brightness distribution of the source. The position angle of the line joining the components remained at 38 + or - 2 deg, while the angular separation between the components increased nearly linearly at the rate of 0.5 + or 0.1 milliarcsec/yr during this period. The corresponding apparent expansion speed is (21 + or - 4)c, for H = 50 km/s per Mpc and q = 0.05

  4. Multifrequency observations of the superluminal quasar 3C 345

    NASA Technical Reports Server (NTRS)

    Bregman, J. N.; Glassgold, A. E.; Huggins, P. J.; Neugebauer, G.; Soifer, B. T.; Matthews, K.; Roellig, T. P. L.; Bregman, J. D.; Witteborn, F. C.; Lester, D. F.

    1986-01-01

    Attention is given to the continuum properties of the superluminal quasar 3C 345, on the basis of radio, optical, IR, and X-ray frequency monitorings, as well as by means of simultaneous multifrequency spectra extending from the radio through the X-ray bands. Radio outbursts, which appear to follow IR-optical outbursts by about one year, first occur at the highest frequencies, as expected from optical depth effects; the peak flux is nevertheless often reached at several frequencies at once. The beginning of outbursts, as defined by mm-measurements, corresponds to the appearance of the three known 'superluminal' components. An increase in the X-ray flux during 1979-1980 corresponds to increased radio flux, while the IR flux changes in the opposite sense.

  5. Extended Ly-alpha emission associated with 3C 294

    NASA Technical Reports Server (NTRS)

    Mccarthy, Patrick J.; Spinrad, Hyron; Dickinson, Mark; Van Breugel, Wil; Liebert, James; Djorgovski, S.; Eisenhardt, Peter

    1990-01-01

    Optical, IR, and radio observations of the powerful radio source 3C 294, which is surrounded by a large cloud of ionized gas, are presented. The galaxy is faint in the rest-frame UV, yet has a near-IR luminosity that is typical of radio galaxies at redshifts of order two. In contrast to the large extent of the ionized gas, the K-band image is quite compact. The emission-line cloud is closely aligned with the radio source axis and has an ionization state indicative of ionization by a nonstellar source. The velocity field of the gas has both large ordered motions and large turbulent components. The total mass required to keep the gas bound to the system is comparable to present-day massive galaxies and their halos. The velocity fields of the high-ionization lines are systematically different from Ly-alpha in a manner that is not easily understood.

  6. Trisodium citrate, Na3(C6H5O7)

    PubMed Central

    Rammohan, Alagappa; Kaduk, James A.

    2016-01-01

    The crystal structure of anhydrous tris­odium citrate, Na3(C6H5O7), has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional theory (DFT). There are two independent five-coordinate Na+ and one six-coordinate Na+ cations in the asymmetric unit. The [NaO5] and [NaO6] polyhedra share edges and corners to form a three-dimensional framework. There are channels parallel to the a and b axes in which the remainder of the citrate anions reside. The only hydrogen bonds are an intra­molecular one between the hy­droxy group and one of the terminal carboxyl­ate O atoms and an intermolecular one between a methylene group and the hydroxyl O atom. PMID:27308044

  7. NIR Flaring of the Quasar 3C454.3

    NASA Astrophysics Data System (ADS)

    Carrasco, L.; Carramiñana, A.; Recillas, E.; Escobedo, G.; Porras, A.; Mayya, Y. D.; Valdes, J. R.

    2010-10-01

    We report the ongoing NIR flare of the quasar 3C454.3, also known as [HB89]2251+158. It is likely associated with a gamma ray source CGRaBSJ2253+1608 and the radio source WMAP055. It is an intermediate redshift FRSQSO Z=0.859 (RA=22:53:57.75, Dec=+16:08:53.6(J2000). On October 31th,2010 (JD 2455500.781451), we determined the NIR flux from this object to correspond to H = 11.190 +/- 0.03, 0.63mag brighter than it was two days earlier(JD 2455498.821166) when we determined it to have H = 11.820 +/- 0.03.

  8. Extended component in the quasar 3C 380

    NASA Astrophysics Data System (ADS)

    Megn, A. V.; Rashkovskiĭ, S. L.; Shepelev, V. A.; Inyutin, G. A.; Brazhenko, A. I.; Bulatsen, V. G.; Vashchishin, R. V.; Koshevoĭ, V. V.; Lozinskiĭ, A. B.; Kassim, N. E.

    2006-09-01

    Results of radio interferometric observations of the quasar 3C 380 carried out on the URAN interferometers at decameter wavelengths and on the aperture synthesis radio telescope VLA at meter wavelengths are reported. The spectral index of an extended lobe about 10″ in size is considerably lower than at decimeter wavelengths. Below ˜ 100 MHz, the ratio of the emission from the compact components associated with hot spots in the radio lobe to the total flux of the source decreases due to synchrotron self-absorption at hot spots, whose flux density at 20 MHz does not exceed 65 Jy. A halo with a full width at a half-maximum of about 40″ was detected, whose angular extent considerably exceeds the total source size measured at shorter wavelengths.

  9. Structural Variability of 3C 111 on Parsec Scales

    NASA Technical Reports Server (NTRS)

    Grossberger, C.; Kadler, M.; Wilms, J.; Muller, C.; Beuchert, T.; Ros, E.; Ojha, R.; Aller, M.; Aller, H.; Angelakis, E.; Fuhrmann, L.; Nestoras, I.; Schmidt, R.; Zensus, J. A.; Krichbaum, T. P.; Ungerechts, H.; Sievers, A.; Riquelme, D.

    2011-01-01

    We discuss the parsec-scale structural variability of the extragalactic jet 3C 111 related to a major radio flux density outburst in 2007, The data analyzed were taken within the scope of the MOJAVE, UMRAO, and F-GAMMA programs, which monitor a large sample of the radio brightest compact extragalactic jets with the VLBA, the University of Michigan 26 m, the Effelsberg 100 m, and the IRAM 30 m radio telescopes. The analysis of the VLBA data is performed by fitting Gaussian model components in the visibility domain, We associate the ejection of bright features in the radio jet with a major flux-density outburst in 2007, The evolution of these features suggests the formation of a leading component and multiple trailing components

  10. Current and Novel Inhibitors of HIV Protease

    PubMed Central

    Pokorná, Jana; Machala, Ladislav; Řezáčová, Pavlína; Konvalinka, Jan

    2009-01-01

    The design, development and clinical success of HIV protease inhibitors represent one of the most remarkable achievements of molecular medicine. This review describes all nine currently available FDA-approved protease inhibitors, discusses their pharmacokinetic properties, off-target activities, side-effects, and resistance profiles. The compounds in the various stages of clinical development are also introduced, as well as alternative approaches, aiming at other functional domains of HIV PR. The potential of these novel compounds to open new way to the rational drug design of human viruses is critically assessed. PMID:21994591

  11. Seminal and colostral protease inhibitors on leukocytes.

    PubMed

    Veselský, L; Cechová, D; Hruban, V; Klaudy, J

    1982-01-01

    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  12. Detection of protease and protease activity using a single nanoscrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2013-01-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  13. Structure-Guided Design and Optimization of Dipeptidyl Inhibitors of Norovirus 3CL Protease. Structure–Activity Relationships and Biochemical, X-ray Crystallographic, Cell-Based, and In Vivo Studies

    SciTech Connect

    Galasiti Kankanamalage, Anushka C.; Kim, Yunjeong; Weerawarna, Pathum M.; Uy, Roxanne Adeline Z.; Damalanka, Vishnu C.; Mandadapu, Sivakoteswara Rao; Alliston, Kevin R.; Mehzabeen, Nurjahan; Battaile, Kevin P.; Lovell, Scott; Chang, Kyeong-Ok; Groutas, William C.

    2015-04-09

    Norovirus infection constitutes the primary cause of acute viral gastroenteritis. There are currently no vaccines or norovirus-specific antiviral therapeutics available for the management of norovirus infection. Norovirus 3C-like protease is essential for viral replication, consequently, inhibition of this enzyme is a fruitful avenue of investigation that may lead to the emergence of antinorovirus therapeutics. We describe herein the optimization of dipeptidyl inhibitors of norovirus 3C-like protease using iterative SAR, X-ray crystallographic, and enzyme and cell-based studies. We also demonstrate herein in vivo efficacy of an inhibitor using the murine model of norovirus infection.

  14. 50 CFR Table 3c to Part 680 - Crab Product Codes for Economic Data Reports

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Crab Product Codes for Economic Data Reports 3c Table 3c to Part 680 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL... EXCLUSIVE ECONOMIC ZONE OFF ALASKA Pt. 680, Table 3c Table 3c to Part 680—Crab Product Codes for...

  15. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh

    2017-01-01

    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  16. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  17. Transient ECM protease activity promotes synaptic plasticity

    PubMed Central

    Magnowska, Marta; Gorkiewicz, Tomasz; Suska, Anna; Wawrzyniak, Marcin; Rutkowska-Wlodarczyk, Izabela; Kaczmarek, Leszek; Wlodarczyk, Jakub

    2016-01-01

    Activity-dependent proteolysis at a synapse has been recognized as a pivotal factor in controlling dynamic changes in dendritic spine shape and function; however, excessive proteolytic activity is detrimental to the cells. The exact mechanism of control of these seemingly contradictory outcomes of protease activity remains unknown. Here, we reveal that dendritic spine maturation is strictly controlled by the proteolytic activity, and its inhibition by the endogenous inhibitor (Tissue inhibitor of matrix metalloproteinases-1 – TIMP-1). Excessive proteolytic activity impairs long-term potentiation of the synaptic efficacy (LTP), and this impairment could be rescued by inhibition of protease activity. Moreover LTP is altered persistently when the ability of TIMP-1 to inhibit protease activity is abrogated, further demonstrating the role of such inhibition in the promotion of synaptic plasticity under well-defined conditions. We also show that dendritic spine maturation involves an intermediate formation of elongated spines, followed by their conversion into mushroom shape. The formation of mushroom-shaped spines is accompanied by increase in AMPA/NMDA ratio of glutamate receptors. Altogether, our results identify inhibition of protease activity as a critical regulatory mechanism for dendritic spines maturation. PMID:27282248

  18. Effluent sampling of Titan 3 C vehicle exhaust

    NASA Technical Reports Server (NTRS)

    Gregory, G. L.; Storey, R. W., Jr.

    1975-01-01

    Downwind in situ ground-level measurements of the exhaust from a Titan 3 C launch vehicle were made during a normal launch. The measurement activity was conducted as part of an overall program to obtain field data for comparison with the multilayer dispersion model currently being used to predict the behavior of rocket vehicle exhaust clouds. All measurements were confined to land, ranging from the launch pad to approximately 2 kilometers downwind from the pad. Measurement systems included detectors for hydrogen chloride (HCl), carbon dioxide (CO2), and particulates (Al2O3). Airborne and ground-based optical systems were employed to monitor exhaust cloud rise, growth, and movement. These measurement systems, located along the ground track (45 deg azimuth from the launch pad) of the exhaust cloud, showed no effluents attributable to the launch. Some hydrogen chloride and aluminum oxide were detected in the surface wind direction (15 deg azimuth) from the pad. Comparisons with the model were made in three areas: (1) assumption of cloud geometry at stabilization; (2) prediction of cloud stabilization altitude; and (3) prediction of the path of cloud travel. In addition, the importance of elemental analyses of the particulate samples is illustrated.

  19. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry

    2015-01-01

    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  20. Microvariability in the optical polarization of 3C 279

    NASA Astrophysics Data System (ADS)

    Andruchow, I.; Cellone, S. A.; Romero, G. E.; Dominici, T. P.; Abraham, Z.

    2003-10-01

    We present results of a microvariability polarization study in the violently variable quasar 3C279. We have resolved the polarization curves in the V band for this object down to timescales of minutes. We found two main components in the evolution of the degree of linear polarization, one consisting of a flicker with timescales of several tens of minutes and other component with far more significant variations on timescales of a few days. The linear polarization descended from ~ 17% down to ~ 8% in three nights. The polarization angle underwent a sudden change of more that 10 degrees in a few hours, perhaps indicating the injection of a new shock in the jet. The amplitude of the intranight flickering in the degree of polarization is at the level of ~ 1%. These are probably the best sampled polarization data ever obtained for this object. We also performed IR observations and we provide a follow-up of the evolution of this source at such energies after the main polarization outburst. Based on observations made at the Complejo Astronómico El Leoncito, which is operated under agreement between CONICET and the National Universities of La Plata, Córdoba, and San Juan, as well as at the Laboratório Nacional de Astrofísica, LNA-CNPq, Brazil.}\\fnmsep\\thanks{Table 2 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via \\ http://cdsweb.u-strasbg.fr/cgi-bin/qcat?J/A+A/409/857

  1. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central

    2011-01-01

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  2. Comparative study on the protease inhibitors from fish eggs

    NASA Astrophysics Data System (ADS)

    Ustadi; Kim, K. Y.; Kim, S. M.

    2005-07-01

    The protease inhibitor was purified from five different fish eggs. The molecular weights of Pacific herring, chum salmon, pond smelt, glassfish, and Alaska pollock egg protease inhibitors were 120, 89, 84.5, 17, and l6.8kDa, respectively. The specific inhibitory activity of glassfish egg protease inhibitor was the highest followed by those of Pacific herring and Alaska pollock in order. The specific inhibitory activity and purity of glassfish egg protease inhibitor were 19.70 Umg-1 protein and 164.70 folds of purification, respectively. Glassfish egg protease inhibitor was reasonably stable at 50-65°C and pH 8, which was more stable at high temperature and pH than protease inhibitors from the other fish species. Glassfish egg protease inhibitor was noncompetitive with inhibitor constant ( K i) of 4.44 nmolL-1.

  3. Management of protease inhibitor-associated hyperlipidemia.

    PubMed

    Penzak, Scott R; Chuck, Susan K

    2002-01-01

    Dyslipidemia, characterized by elevated serum levels of triglycerides and reduced levels of total cholesterol, low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol, has been recognized in patients with human immunodeficiency virus (HIV) infection. It is thought that elevated levels of circulating cytokines, such as tumor necrosis factor-alpha and interferon-alpha, may alter lipid metabolism in patients with HIV infection. Protease inhibitors, such as saquinavir, indinavir and ritonavir, have been found to decrease mortality and improve quality of life in patients with HIV infection. However, these drugs have been associated with a syndrome of fat redistribution, insulin resistance, and hyperlipidemia. Elevations in serum total cholesterol and triglyceride levels, along with dyslipidemia that typically occurs in patients with HIV infection, may predispose patients to complications such as premature atherosclerosis and pancreatitis. It has been estimated that hypercholesterolemia and hypertriglyceridemia occur in greater than 50% of protease inhibitor recipients after 2 years of therapy, and that the risk of developing hyperlipidemia increases with the duration of treatment with protease inhibitors. In general, treatment of hyperlipidemia should follow National Cholesterol Education Program guidelines; efforts should be made to modify/control coronary heart disease risk factors (i.e. smoking; hypertension; diabetes mellitus) and maximize lifestyle modifications, primarily dietary intervention and exercise, in these patients. Where indicated, treatment usually consists of either pravastatin or atorvastatin for patients with elevated serum levels of LDL-C and/or total cholesterol. Atorvastatin is more potent in lowering serum total cholesterol and triglycerides compared with other hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, but it is also associated with more drug interactions compared with pravastatin. Simvastatin

  4. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-01-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  5. Simultaneous Multiwavelength Monitoring of 3C66A

    NASA Technical Reports Server (NTRS)

    Boettcher, M.

    2004-01-01

    The radio-selected BL Lac object 3C66A was the target of an intensive multiwavelength campaign from Sept. 2003 through Feb. 2004. It was monitored by the Whole Earth Blazar Telescope (WEBT) collaboration, in tandem with 20 X-ray monitoring observations by the Rossi X-Ray Timing Explorer (RXTE), VHE gamma-ray observations by STACEE and VERITAS, and long-term monitoring at radio frequencies. In addition. 9 observations using the VLBA are being carried out during the campaign and throughout the year 2004 to follow possible structural changes of the source. 21 pointings with RXTE during the period Sept. 15 - Dec. 27, 2003. All collected data have been fully analyzed, and first results have already been published at the 8th HEAD Meeting in New Orleans, LA, in Sept. 2004, and will also be presented at the 205th AAS Meeting in San Diego, CA, in Jan. 2005. A first Journal paper, to be submitted to the Astrophysical Journal, is currently in preparation, and we plan to have it ready for submission in January 2005. A gradual brightening of the source over the course of the campaign was observed at all optical frequencies, culminating in a very bright flare at the end of January 2004. Optical light curves indicate intraday microvariability on time scales down to about 1.3 hours. No significant color-magnitude correlation for the entire data set was evident, but there is a slight indication of a gradual spectral softening in the optical over the entire duration of multi-day outbursts (in both the rising and decaying phase). The X-ray spectrum is consistent with a power-law with a photon spectral index of approx. 2.1, indicating that the RXTE energy band might be located right at the intersection of the synchrotron and the high-energy emission components. No significant flux or spectral variability at X-ray energies was detected, though there seems to be a trend of very modest brightening in tandem with the optical flux. The first 4 VLBA epochs indicate a rather smooth jet with

  6. Enteropeptidase, a type II transmembrane serine protease.

    PubMed

    Zheng, X Long; Kitamoto, Yasunori; Sadler, J Evan

    2009-06-01

    Enteropeptidase, a type II transmembrane serine protease, is localized to the brush border of the duodenal and jejunal mucosa. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. Trypsin, in turn, activates other digestive zymogens such as chymotrypsinogen, proelastase, procarboxypeptidase and prolipase in the lumen of the gut. The important biological function of enteropeptidase is highlighted by the manifestation of severe diarrhea, failure to thrive, hypoproteinemia and edema as a result of congenital deficiency of enteropeptidase activity in the gut. Conversely, duodenopancreatic reflux of proteolytically active enteropeptidase may cause acute and chronic pancreatitis.

  7. Functional interplay between tetraspanins and proteases.

    PubMed

    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos

    2011-10-01

    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  8. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  9. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  10. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  11. Extracellular proteases from eight psychrotolerant Antarctic strains.

    PubMed

    Vazquez, Susana C; Coria, Silvia H; MacCormack, Walter P

    2004-01-01

    Extracellular proteases from 8 Antarctic psychrotolerant Pseudomonas sp. strains were purified and characterised. All of them are neutral metalloproteases, have an apparent molecular mass of 45kDa, optimal activity at 40 degrees C and pH 7-9, retaining significant activity at pH 5-11. With the exception of P96-18, which is less stable, all retain more than 50% activity after 3 h of incubation at pH 5-9 and show low thermal stability (their half-life times range from 20 to 60 min at 40 degrees C and less than 5 min at 50 degrees C). These proteases can be used in commercial processes carried out at neutral pH and moderate temperatures, and are of special interest for their application in mixtures of enzymes where final thermal selective inactivation is needed. Results also highlight the relevance of Antarctic biotopes for the isolation of protease-producing enzymes active at low temperatures.

  12. Corruption of Innate Immunity by Bacterial Proteases

    PubMed Central

    Potempa, Jan; Pike, Robert N.

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host’s innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections. PMID:19756242

  13. Effect of lanthanides on Porphyromonas gingivalis proteases.

    PubMed

    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T

    2010-01-01

    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  14. Corruption of innate immunity by bacterial proteases.

    PubMed

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  15. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  16. Structural determinants of tobacco vein mottling virus protease substrate specificity.

    PubMed

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-11-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1' position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k(cat) and K(m) for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  17. Structural determinants of tobacco vein mottling virus protease substrate specificity

    SciTech Connect

    Sun, Ping; Austin, Brian P.; Tozer, Jozsef; Waugh, David

    2010-10-28

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-{angstrom} resolution. As observed in several crystal structures of TEV protease, the C-terminus ({approx}20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by {approx}10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1{prime} position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k{sub cat} and K{sub m} for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  18. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.

    2000-01-01

    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  19. Quantitative Analysis of Intra-chromosomal Contacts: The 3C-qPCR Method.

    PubMed

    Ea, Vuthy; Court, Franck; Forné, Thierry

    2017-01-01

    The chromosome conformation capture (3C) technique is fundamental to many population-based methods investigating chromatin dynamics and organization in eukaryotes. Here, we provide a modified quantitative 3C (3C-qPCR) protocol for improved quantitative analyses of intra-chromosomal contacts. We also describe an algorithm for data normalization which allows more accurate comparisons between contact profiles.

  20. 18 CFR 3c.3 - Reporting fraud, waste, abuse, and corruption and cooperation with official inquiries.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., abuse, and corruption and cooperation with official inquiries. 3c.3 Section 3c.3 Conservation of Power... OF CONDUCT § 3c.3 Reporting fraud, waste, abuse, and corruption and cooperation with official..., abuse, and corruption in Commission programs, including on the part of Commission employees,...

  1. 18 CFR 3c.3 - Reporting fraud, waste, abuse, and corruption and cooperation with official inquiries.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., abuse, and corruption and cooperation with official inquiries. 3c.3 Section 3c.3 Conservation of Power... OF CONDUCT § 3c.3 Reporting fraud, waste, abuse, and corruption and cooperation with official..., abuse, and corruption in Commission programs, including on the part of Commission employees,...

  2. Crystallization and preliminary crystallographic study of Feline infectious peritonitis virus main protease in complex with an inhibitor.

    PubMed

    Wang, Jinshan; Wang, Fenghua; Tan, Yusheng; Chen, Xia; Zhao, Qi; Fu, Sheng; Li, Shuang; Chen, Cheng; Yang, Haitao

    2014-12-01

    Feline infectious peritonitis virus (FIPV) causes a lethal systemic granulomatous disease in wild and domestic cats around the world. Currently, no effective vaccines or drugs have been developed against it. As a member of the genus Alphacoronavirus, FIPV encodes two polyprotein precursors required for genome replication and transcription. Each polyprotein undergoes extensive proteolytic processing, resulting in functional subunits. This process is mainly mediated by its genome-encoded main protease, which is an attractive target for antiviral drug design. In this study, the main protease of FIPV in complex with a Michael acceptor-type inhibitor was crystallized. The complex crystals diffracted to 2.5 Å resolution and belonged to space group I422, with unit-cell parameters a = 112.3, b = 112.3, c = 102.1 Å. There is one molecule per asymmetric unit.

  3. X-ray structure and inhibition of the feline infectious peritonitis virus 3C-like protease: Structural implications for drug design.

    PubMed

    St John, Sarah E; Therkelsen, Matthew D; Nyalapatla, Prasanth R; Osswald, Heather L; Ghosh, Arun K; Mesecar, Andrew D

    2015-11-15

    Feline infectious peritonitis (FIP) is a deadly disease that effects both domestic and wild cats and is caused by a mutation in feline coronavirus (FCoV) that allows the virus to replicate in macrophages. Currently, there are no treatments or vaccines available for the treatment of FIP even though it kills approximately 5% of cats in multi-cat households per year. In an effort to develop small molecule drugs targeting FIP for the treatment of cats, we screened a small set of designed peptidomimetic inhibitors for inhibition of FIPV-3CL(pro), identifying two compounds with low to sub-micromolar inhibition, compound 6 (IC50=0.59±0.06 μM) and compound 7 (IC50=1.3±0.1 μM). We determined the first X-ray crystal structure of FIPV-3CL(pro) in complex with the best inhibitor identified, compound 6, to a resolution of 2.10 Å to better understand the structural basis for inhibitor specificity. Our study provides important insights into the structural requirements for the inhibition of FIPV-3CL(pro) by peptidomimetic inhibitors and expands the current structural knowledge of coronaviral 3CL(pro) architecture.

  4. The nuclear protein Sam68 is cleaved by the FMDV 3C protease redistributing Sam68 to the cytoplasm during FMDV infection of host cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infection by a variety of viruses alters the nuclear-cytoplasmic trafficking of certain host cell proteins. In our continued search for interacting factors, we reported the re-localization of RNA helicase A (RHA) from the nucleus to the cytoplasm in cells infected with foot-and-mouth disease virus ...

  5. Cystatins, serpins and other families of protease inhibitors in plants.

    PubMed

    Volpicella, Mariateresa; Leoni, Claudia; Costanza, Alessandra; De Leo, Francesca; Gallerani, Raffaele; Ceci, Luigi R

    2011-08-01

    Plant protease inhibitors (PIs) are generally small proteins present in high concentrations in storage tissues (tubers and seeds), and to a lower level in leaves. Even if most of them are active against serine and cysteine proteases, PIs active against aspartic proteases and carboxypeptidases have also been identified. Inhibitors of serine proteases are further classifiable in several families on the basis of their structural features. They comprise the families known as Bowman-Birk, Kunitz, Potato I and Potato II, which are the subject of review articles included in this special issue. In the present article we aim to give an overview of other families of plant PIs, active either against serine proteases or other class of proteases, describing their distribution, activity and main structural characteristics.

  6. Diversity of both the cultivable protease-producing bacteria and bacterial extracellular proteases in the coastal sediments of King George Island, Antarctica.

    PubMed

    Zhou, Ming-Yang; Wang, Guang-Long; Li, Dan; Zhao, Dian-Li; Qin, Qi-Long; Chen, Xiu-Lan; Chen, Bo; Zhou, Bai-Cheng; Zhang, Xi-Ying; Zhang, Yu-Zhong

    2013-01-01

    Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5) cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%), Flavobacterium (21.0%) and Lacinutrix (16.2%). Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.

  7. Economic Methods of Ginger Protease'sextraction and Purification

    NASA Astrophysics Data System (ADS)

    Qiao, Yuanyuan; Tong, Junfeng; Wei, Siqing; Du, Xinyong; Tang, Xiaozhen

    This article reports the ginger protease extraction and purification methods from fresh ginger rhizome. As to ginger protease extraction, we adapt the steps of organic solvent dissolving, ammonium sulfate depositing and freeze-drying, and this method can attain crude enzyme powder 0.6% weight of fresh ginger rhizome. The purification part in this study includes two steps: cellulose ion exchange (DEAE-52) and SP-Sephadex 50 chromatography, which can purify crude ginger protease through ion and molecular weight differences respectively.

  8. Engineering Environmentally-Stable Proteases to Specifically Neutralize Protein Toxins

    DTIC Science & Technology

    2013-10-01

    agents , such as Soman and Sarin . 2. Linkage to binding molecules Conjugating an antibody (or any other binding module) with an initiating protease...to develop the tools and principles necessary to engineer subtilisin proteases which specifically target and deactivate biological warfare agent (BWA...warfare agent (BWA) toxins. We have engineered and evolved subtilisin proteases to specifically target and deactivate BoNT, SEB, ricin, and B

  9. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  10. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed Central

    Suleman, Louise

    2016-01-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes. PMID:27785379

  11. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae

    2011-09-01

    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  12. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed

    Suleman, Louise

    2016-10-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes.

  13. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  14. Epstein–Barr virus nuclear antigen 3C regulated genes in lymphoblastoid cell lines

    PubMed Central

    Zhao, Bo; Mar, Jessica C.; Maruo, Seiji; Lee, Sungwook; Gewurz, Benjamin E.; Johannsen, Eric; Holton, Kristina; Rubio, Renee; Takada, Kenzo; Quackenbush, John; Kieff, Elliott

    2011-01-01

    EBV nuclear antigen 3C (EBNA3C) is an essential transcription factor for EBV transformed lymphoblast cell line (LCL) growth. To identify EBNA3C-regulated genes in LCLs, microarrays were used to measure RNA abundances in each of three different LCLs that conditionally express EBNA3C fused to a 4-OH-Tamoxifen–dependent estrogen receptor hormone binding domain (EBNA3CHT). At least three RNAs were assayed for each EBNA3CHT LCL under nonpermissive conditions, permissive conditions, and nonpermissive conditions with wild-type EBNA3C transcomplementation. Using a two-way ANOVA model of EBNA3C levels, we identified 550 regulated genes that were at least 1.5-fold up- or down-regulated with false discovery rates < 0.01. EBNA3C-regulated genes overlapped significantly with genes regulated by EBNA2 and EBNA3A consistent with coordinated effects on cell gene transcription. Of the 550 EBNA3C-regulated genes, 106 could be placed in protein networks. A seeded Bayesian network analysis of the 80 most significant EBNA3C-regulated genes suggests that RAC1, LYN, and TNF are upstream of other EBNA3C-regulated genes. Gene set enrichment analysis found enrichment for MAP kinase signaling, cytokine–cytokine receptor interactions, JAK-STAT signaling, and cell adhesion molecules, implicating these pathways in EBNA3C effects on LCL growth or survival. EBNA3C significantly up-regulated the CXCL12 ligand and its CXCR4 receptor and increased LCL migration. CXCL12 up-regulation depended on EBNA3C's interaction with the cell transcription factor, RBPJ, which is essential for LCL growth. EBNA3C also up-regulated MYC 1.3-fold and down-regulated CDKN2A exons 2 and 3, shared by p16 and p14, 1.4-fold, with false discovery rates < 5 × 10−4. PMID:21173222

  15. Reversible Unfolding of Rhomboid Intramembrane Proteases

    PubMed Central

    Panigrahi, Rashmi; Arutyunova, Elena; Panwar, Pankaj; Gimpl, Katharina; Keller, Sandro; Lemieux, M. Joanne

    2016-01-01

    Denaturant-induced unfolding of helical membrane proteins provides insights into their mechanism of folding and domain organization, which take place in the chemically heterogeneous, anisotropic environment of a lipid membrane. Rhomboid proteases are intramembrane proteases that play key roles in various diseases. Crystal structures have revealed a compact helical bundle with a buried active site, which requires conformational changes for the cleavage of transmembrane substrates. A dimeric form of the rhomboid protease has been shown to be important for activity. In this study, we examine the mechanism of refolding for two distinct rhomboids to gain insight into their secondary structure-activity relationships. Although helicity is largely abolished in the unfolded states of both proteins, unfolding is completely reversible for HiGlpG but only partially reversible for PsAarA. Refolding of both proteins results in reassociation of the dimer, with a 90% regain of catalytic activity for HiGlpG but only a 70% regain for PsAarA. For both proteins, a broad, gradual transition from the native, folded state to the denatured, partly unfolded state was revealed with the aid of circular dichroism spectroscopy as a function of denaturant concentration, thus arguing against a classical two-state model as found for many globular soluble proteins. Thermal denaturation has irreversible destabilizing effects on both proteins, yet reveals important functional details regarding substrate accessibility to the buried active site. This concerted biophysical and functional analysis demonstrates that HiGlpG, with a simple six-transmembrane-segment organization, is more robust than PsAarA, which has seven predicted transmembrane segments, thus rendering HiGlpG amenable to in vitro studies of membrane-protein folding. PMID:27028647

  16. Multiple Proteases to Localize Oxidation Sites

    PubMed Central

    Gu, Liqing; Robinson, Renã A. S.

    2015-01-01

    Proteins present in cellular environments with high levels of reactive oxygen and nitrogen species and/or low levels of antioxidants are highly susceptible to oxidative post-translational modification (PTM). Irreversible oxidative PTMs can generate a complex distribution of modified protein molecules, recently termed as proteoforms. Using ubiquitin as a model system, we mapped oxidative modification sites using trypsin, Lys-C, and Glu-C peptides. Several M+16 Da proteoforms were detected as well as proteoforms that include other previously unidentified oxidative modifications. This work highlights the use of multiple protease digestions to give insights to the complexity of oxidative modifications possible in bottom-up analyses. PMID:25775238

  17. Rapid Release of Protease Inhibitors from Soybeans

    PubMed Central

    Hwang, David L.; Yang, Wen-Kuang; Foard, Donald E.; Lin, K.-T. -Davis

    1978-01-01

    Specific antisera were prepared against the Bowman-Birk trypsin inhibitor and four other trypsin inhibitors of low molecular weight isolated from soybeans (Glycine max L. cv. Tracy). These antisera were used to detect the presence and amount of the inhibitors in: (a) seeds and protein extracts of soybean meal; (b) seedlings; and (c) the water surrounding the seeds and roots of seedlings. Lectin activities in seeds, seedlings, and water were also determined at the same time as the protease inhibitor activities. By competitive inhibition of immunoprecipitation, the combined five low molecular weight protease inhibitors were found to constitute the following percentages of proteins (w/w): 6.3% in defatted soybean meal; 8.1% of the protein extracted from the meal by a buffer of pH 8.6; 8.3, 14.7, 15.2, 16.1, 17.2, and 18.9% of the protein in a lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, respectively; 8.2% in a lyophilisate of water in which roots of seedlings grew for 20 days; 1.5% in cotyledons; and less than 0.1% in epicotyls, hypocotyls, and roots of 12-day-old seedlings. Hemagglutination activities, expressed as the lowest amount of protein required to give a positive agglutination of 0.2 ml of 2% rabbit red blood cells, were as follows: purified soybean lectin, 0.08 μg; lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, 10, 2.5, 5, 5, and 2.5 μg, respectively; lyophilisate of water in which roots grew for 20 days, 5 μg; 12-day-old cotyledons, roots, epicotyls, and hypocotyls, 12.5, 100, >1,000, and >500 μg, respectively. The results indicate that a large amount of protease inhibitors as well as lectins are released from seeds during the first 8 hours of imbibition. Neither lima bean trypsin inhibitor (mol wt, 10,000) nor Kunitz soybean trypsin inhibitor (mol wt, 21,500) showed competitive inhibition in tests with antisera against low molecular weight soybean protease inhibitors

  18. The SARS-coronavirus papain-like protease: structure, function and inhibition by designed antiviral compounds.

    PubMed

    Báez-Santos, Yahira M; St John, Sarah E; Mesecar, Andrew D

    2015-03-01

    Over 10 years have passed since the deadly human coronavirus that causes severe acute respiratory syndrome (SARS-CoV) emerged from the Guangdong Province of China. Despite the fact that the SARS-CoV pandemic infected over 8500 individuals, claimed over 800 lives and cost billions of dollars in economic loss worldwide, there still are no clinically approved antiviral drugs, vaccines or monoclonal antibody therapies to treat SARS-CoV infections. The recent emergence of the deadly human coronavirus that causes Middle East respiratory syndrome (MERS-CoV) is a sobering reminder that new and deadly coronaviruses can emerge at any time with the potential to become pandemics. Therefore, the continued development of therapeutic and prophylactic countermeasures to potentially deadly coronaviruses is warranted. The coronaviral proteases, papain-like protease (PLpro) and 3C-like protease (3CLpro), are attractive antiviral drug targets because they are essential for coronaviral replication. Although the primary function of PLpro and 3CLpro are to process the viral polyprotein in a coordinated manner, PLpro has the additional function of stripping ubiquitin and ISG15 from host-cell proteins to aid coronaviruses in their evasion of the host innate immune responses. Therefore, targeting PLpro with antiviral drugs may have an advantage in not only inhibiting viral replication but also inhibiting the dysregulation of signaling cascades in infected cells that may lead to cell death in surrounding, uninfected cells. This review provides an up-to-date discussion on the SARS-CoV papain-like protease including a brief overview of the SARS-CoV genome and replication followed by a more in-depth discussion on the structure and catalytic mechanism of SARS-CoV PLpro, the multiple cellular functions of SARS-CoV PLpro, the inhibition of SARS-CoV PLpro by small molecule inhibitors, and the prospect of inhibiting papain-like protease from other coronaviruses. This paper forms part of a series of

  19. Increased activity of unlinked Zika virus NS2B/NS3 protease compared to linked Zika virus protease.

    PubMed

    Kuiper, Benjamin D; Slater, Kristin; Spellmon, Nicholas; Holcomb, Joshua; Medapureddy, Prasanna; Muzzarelli, Kendall M; Yang, Zhe; Ovadia, Reuben; Amblard, Franck; Kovari, Iulia A; Schinazi, Raymond F; Kovari, Ladislau C

    2017-03-22

    Zika virus (ZIKV) is a flavivirus spread by daytime-active Aedes spp. mosquitoes such as A. aegypti and A. albopictus. Previously thought to be a mild infection, the latest ZIKV outbreak in the Americas is causally associated with more severe symptoms as well as severe birth defects, such as microcephaly. Currently no vaccine or antiviral exists. However, recent progress has demonstrated the viral NS2B/NS3 protease may be a suitable target for the development of small-molecule antiviral agents. To better understand the ZIKV protease, we expressed, purified, and characterized unlinked and linked NS2B/NS3 protease corresponding to an isolate from the recent outbreak in Puerto Rico. Unlinked ZIKV protease is more active and binds substrate with greater affinity than linked ZIKV protease. Therefore, we propose that unlinked ZIKV protease be used when evaluating or designing ZIKV protease inhibitors. Additionally, potent inhibitors of related viral proteases, like West Nile Virus and Dengue virus, may serve as advanced starting points to identify and develop ZIKV protease inhibitors.

  20. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-06-30

    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  1. Timing of Events in the Central Engine and Jets of the Radio Galaxies 3c 111 and 3c 120 (core Program)

    NASA Astrophysics Data System (ADS)

    The investigators request continuation of their long-term monitoring of the X-ray flux of the radio galaxies 3C 111 (FR 2) and 3C 120 (FR 1) 2 and 4 times per week, respectively, throughout Cycle 12, as well as a 90 days of daily monitoring of 3C 111. In both objects, dips in X-ray flux precede the appearance of bright superluminal knots in the radio jet. The long-term multiwaveband light curves and sequences of 7 mm VLBA images will record the changing pattern of multiwaveband emission in these two AGN. 3C 111 is a probable EGRET source; if the ID is correct, GLAST will measure its flux daily, allowing relative timing of gamma-ray variations with X-ray and optical events from the central engine plus radio events in the jet.

  2. Regulated proteolysis by cortical granule serine protease 1 at fertilization.

    PubMed

    Haley, Sheila A; Wessel, Gary M

    2004-05-01

    Cortical granules are specialized organelles whose contents interact with the extracellular matrix of the fertilized egg to form the block to polyspermy. In sea urchins, the granule contents form a fertilization envelope (FE), and this construction is critically dependent upon protease activity. An autocatalytic serine protease, cortical granule serine protease 1 (CGSP1), has been identified in the cortical granules of Strongylocentrotus purpuratus eggs, and here we examined the regulation of the protease activity and tested potential target substrates of CGSP1. We found that CGSP1 is stored in its full-length, enzymatically quiescent form in the granule, and is inactive at pH 6.5 or below. We determined the pH of the cortical granule by fluorescent indicators and micro-pH probe measurements and found the granules to be pH 5.5, a condition inhibitory to CGSP1 activity. Exposure of the protease to the pH of seawater (pH 8.0) at exocytosis immediately activates the protease. Activation of eggs at pH 6.5 or lower blocks activation of the protease and the resultant FE phenotypes are indistinguishable from a protease-null phenotype. We find that native cortical granule targets of the protease are beta-1,3 glucanase, ovoperoxidase, and the protease itself, but the structural proteins of the granule are not proteolyzed by CGSP1. Whole mount immunolocalization experiments demonstrate that inhibition of CGSP1 activity affects the localization of ovoperoxidase but does not alter targeting of structural proteins to the FE. The mistargeting of ovoperoxidase may lead to spurious peroxidative cross-linking activity and contribute to the lethality observed in protease-null cells. Thus, CGSP1 is proteolytically active only when secreted, due to the low pH of the cortical granules, and it has a small population of targets for cleavage within the cortical granules.

  3. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum

    PubMed Central

    Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5–75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases. PMID:28060882

  4. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum.

    PubMed

    Han, Zhiping; Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5-75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases.

  5. Roles of the Picornaviral 3C Proteinase in the Viral Life Cycle and Host Cells.

    PubMed

    Sun, Di; Chen, Shun; Cheng, Anchun; Wang, Mingshu

    2016-03-17

    The Picornaviridae family comprises a large group of non-enveloped viruses that have a major impact on human and veterinary health. The viral genome contains one open reading frame encoding a single polyprotein that can be processed by viral proteinases. The crucial 3C proteinases (3C(pro)s) of picornaviruses share similar spatial structures and it is becoming apparent that 3C(pro) plays a significant role in the viral life cycle and virus host interaction. Importantly, the proteinase and RNA-binding activity of 3C(pro) are involved in viral polyprotein processing and the initiation of viral RNA synthesis. In addition, 3C(pro) can induce the cleavage of certain cellular factors required for transcription, translation and nucleocytoplasmic trafficking to modulate cell physiology for viral replication. Due to interactions between 3C(pro) and these essential factors, 3C(pro) is also involved in viral pathogenesis to support efficient infection. Furthermore, based on the structural conservation, the development of irreversible inhibitors and discovery of non-covalent inhibitors for 3C(pro) are ongoing and a better understanding of the roles played by 3C(pro) may provide insights into the development of potential antiviral treatments. In this review, the current knowledge regarding the structural features, multiple functions in the viral life cycle, pathogen host interaction, and development of antiviral compounds for 3C(pro) is summarized.

  6. CFD Growth of 3C-SiC on 4H/6H Mesas

    NASA Technical Reports Server (NTRS)

    Neudeck, Philip G.; Trunek, Andrew J.; Spry, David J.; Powell, J. Anthony; Du, Hui; Skowronski, Marek; Huang, XianRong; Dudley, Michael

    2006-01-01

    This article describes growth and characterization of the highest quality reproducible 3C-SiC heteroepitaxial films ever reported. By properly nucleating 3C-SiC growth on top of perfectly on-axis (0001) 4H-SiC mesa surfaces completely free of atomic scale steps and extended defects, growth of 3C-SiC mesa heterofilms completely free of extended crystal defects can be achieved. In contrast, nucleation and growth of 3C-SiC mesa heterofilms on top of 4H-SiC mesas with atomic-scale steps always results in numerous observable dislocations threading through the 3C-SiC epilayer. High-resolution X-ray diffraction and transmission electron microscopy measurements indicate non-trivial in-plane lattice mismatch between the 3C and 4H layers. This mismatch is somewhat relieved in the step-free mesa case via misfit dislocations confined to the 3C/4H interfacial region without dislocations threading into the overlying 3C-SiC layer. These results indicate that the presence or absence of steps at the 3C/4H heteroepitaxial interface critically impacts the quality, defect structure, and relaxation mechanisms of single-crystal heteroepitaxial 3C-SiC films.

  7. Vibrational and Geometric Structures of La{_3}C{_2}O and La{_3}C{_2}O^+ from Masse-Analyzed Threshold Ionization

    NASA Astrophysics Data System (ADS)

    Mourad, Roudjane; Wu, Lu; Yang, D. S.

    2011-06-01

    La{_3}C{_2}O is produced for the first time by laser vaporization in a pulsed cluster source and identified by photoionization time-of-flight mass spectrometry. Vibrationally-resolved ion spectra are obtained with mass-analyzed threshold ionization (MATI) spectroscopy. The adiabatic ionization energy of La{_3}C{_2}O is measured to be 30891(5) Cm-1. The spectra display several short vibrational progressions, and these progressions are associated mainly with La-La, La-C and La{_3}C{_2}O stretching excitations. The electron-spin multiplicities and molecular symmetries of La{_3}C{_2}O and La{_3}C{_2}O^+ are determined by combining the experimental measurements with ab initio calculations at MP2 level. Preliminary data analysis shows that the ^1A_1 ← ^2A_1 transition is responsible for the observed MATI spectra. The cluster has C2v symmetry with La{_3}C{_2}O in a bi-pyramid structure and oxygen being attached to the La_3 plane.

  8. Structural determinants of MALT1 protease activity.

    PubMed

    Wiesmann, Christian; Leder, Lukas; Blank, Jutta; Bernardi, Anna; Melkko, Samu; Decock, Arnaud; D'Arcy, Allan; Villard, Frederic; Erbel, Paulus; Hughes, Nicola; Freuler, Felix; Nikolay, Rainer; Alves, Juliano; Bornancin, Frederic; Renatus, Martin

    2012-05-25

    The formation of the CBM (CARD11-BCL10-MALT1) complex is pivotal for antigen-receptor-mediated activation of the transcription factor NF-κB. Signaling is dependent on MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1), which not only acts as a scaffolding protein but also possesses proteolytic activity mediated by its caspase-like domain. It remained unclear how the CBM activates MALT1. Here, we provide biochemical and structural evidence that MALT1 activation is dependent on its dimerization and show that mutations at the dimer interface abrogate activity in cells. The unliganded protease presents itself in a dimeric yet inactive state and undergoes substantial conformational changes upon substrate binding. These structural changes also affect the conformation of the C-terminal Ig-like domain, a domain that is required for MALT1 activity. Binding to the active site is coupled to a relative movement of caspase and Ig-like domains. MALT1 binding partners thus may have the potential of tuning MALT1 protease activity without binding directly to the caspase domain.

  9. Effect of proteases on the. beta. -thromboglobulin radioimmunoassay

    SciTech Connect

    Donlon, J.A.; Helgeson, E.A.; Donlon, M.A.

    1985-02-11

    Rat peritoneal mast cells and mast cell granules were evaluated by radioimmunoassay for the presence of ..beta..-thromboglobulin and platelet factor 4. The initial assays indicated that a ..beta..-thromboglobulin cross reacting material was released from mast cells by compound 48/80 in a similar dose-dependent manner as histamine release. The material was also found to be associated with purified granules. However, the use of protease inhibitors in the buffers completely abolished the positive assays. Further evaluation of the effects of various proteases on the ..beta..-thromboglobulin assay indicated that elastase would also generate a false positive assay which could then be neutralized by the use of ..cap alpha../sub 1/-antitrypsin as a protease inhibitor. There was no protease effect on the platelet factor 4 radioimmunoassay which always showed no detectable amounts with mast cells, granules or proteases. These results clearly indicate the artifactual positive assays which can arise when using certain radioimmunoassay tests in the presence of cell proteases. The use of protease inhibitors is a necessary control when applying a radioimmunoassay to a system with potentially active proteases. 24 references, 2 figures, 4 tables.

  10. Serine protease activities in Leishmania (Leishmania) chagasi promastigotes.

    PubMed

    da Silva-López, Raquel Elisa; dos Santos, Tatiana Resende; Morgado-Díaz, José Andrés; Tanaka, Marcelo Neves; de Simone, Salvatore Giovanni

    2010-10-01

    The present work reports the isolation, biochemical characterization, and subcellular location of serine proteases from aqueous, detergent soluble, and culture supernatant of Leishmania chagasi promastigote extracts, respectively, LCSII, LCSI, and LCSIII. The active enzyme molecular masses of LCSII were about 105, 66, and 60 kDa; of LCSI, 60 and 58 kDa; and of LCSIII, approximately 76 and 68 kDa. Optimal pH for the enzymes was 7.0 for LCSI and LCSIII and 8.5 for LCSII, and the optimal temperature for all enzymes was 37°C, using α-N-ρ-tosyl-L: -arginine methyl ester as substrate. Assay of thermal stability indicated that LCSIII is the more stable enzyme. Hemoglobin, bovine serum albumin, and ovalbumin were hydrolyzed by LCSII and LCSI but not by LCSIII. Inhibition studies suggested that enzymes belong to the serine protease class modulated by divalent cations. Rabbit antiserum against 56-kDa serine protease of Leishmania amazonensis identified proteins in all extracts of L. chagasi. Furthermore, immunocytochemistry demonstrated that serine proteases are located in flagellar pocket region and cytoplasmic vesicles of L. chagasi promastigotes. These findings indicate that L. chagasi serine proteases differ from L. amazonensis proteases and all known flagellate proteases, but display some similarities with serine proteases from other Leishmania species, suggesting a conservation of this enzymatic activity in the genus.

  11. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  12. Theoretical understanding of magnetic and electronic structures of Ti3C2 monolayer and its derivatives

    NASA Astrophysics Data System (ADS)

    Wu, Fang; Luo, Kang; Huang, Chengxi; Wu, Wenjuan; Meng, Peiwen; Liu, Yunfei; Kan, Erjun

    2015-11-01

    First-principles calculations were performed to investigate the electronic and magnetic properties of Ti3C2 monolayer and its derivatives. We found that pristine Ti3C2 monolayer acts as a magnetic metal, and magnetic moments come from Ti2+ ions at two sides. Through doping nitrogen atoms, the spin moments is significantly reduced. On other hand, when two surfaces of Ti3C2 monolayer are saturated by external groups, the magnetism will be spontaneously annihilated. Even for the saturation of one side, we also found that the magnetism of Ti3C2Y (Y is O and OH) monolayer is removed because of the invalidation of stoner instability. More importantly, we explored that both doping and surface modification will reduce the Curie temperature of Ti3C2 monolayer. Therefore, our results shed a light on the way to get high-temperature magnetism in Ti3C2 monolayer.

  13. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.

    PubMed

    Panigrahi, Rashmi; Lemieux, M Joanne

    2015-01-01

    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  14. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma

    2006-07-01

    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  15. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin

    2005-07-01

    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  16. The peculiar hydrogen cloud in the Virgo Cluster and 3C 273

    NASA Technical Reports Server (NTRS)

    Arp, H. C.; Burbidge, G.

    1990-01-01

    It is shown that the nearest bright extragalactic object to the peculiar hydrogen cloud recently discovered in the Virgo Cluster by Giovanelli and Haynes is the bright QSO 3C 273. Further, it is pointed out that the jet in 3C 273 points in almost the same direction as the major axis of the cloud. Despite the redshift difference, possible physical connections between the cloud and 3C 273 are explored.

  17. Terminal Interface Conformations Modulate Dimer Stability Prior to Amino Terminal Autoprocessing of HIV-1 Protease

    SciTech Connect

    Agniswamy, Johnson; Sayer, Jane M.; Weber, Irene T.; Louis, John M.

    2012-04-17

    The HIV-1 protease (PR) mediates its own release (autoprocessing) from the polyprotein precursor, Gag-Pol, flanked by the transframe region (TFR) and reverse transcriptase at its N- and C-termini, respectively. Autoprocessing at the N-terminus of PR mediates stable dimer formation essential for catalytic activity, leading to the formation of infectious virus. An antiparallel {beta}-sheet interface formed by the four N- and C-terminal residues of each subunit is important for dimer stability. Here, we present the first high-resolution crystal structures of model protease precursor-clinical inhibitor (PI darunavir or saquinavir) complexes, revealing varying conformations of the N-terminal flanking (S{sup -4}FNF{sup -1}) and interface residues (P{sup 1}QIT{sup 4}). A 180{sup o} rotation of the T{sup 4}-L{sup 5} peptide bond is accompanied by a new Q{sup 2}-L{sup 5} hydrogen bond and complete disengagement of PQIT from the {beta}-sheet dimer interface, which may be a feature for intramolecular autoprocessing. This result is consistent with drastically lower thermal stability by 14-20 C of PI complexes of precursors and the mature PR lacking its PQIT residues (by 18.3 C). Similar to the TFR-PR precursor, this deletion also results in a darunavir dissociation constant (2 x 10{sup 4})-fold higher and a markedly increased dimer dissociation constant relative to the mature PR. The terminal {beta}-sheet perturbations of the dimeric structure likely account for the drastically poorer inhibition of autoprocessing of TFR-PR relative to the mature PR, even though significant differences in active site-PI interactions in these structures were not observed. The novel conformations of the dimer interface may be exploited to target selectively the protease precursor prior to its N-terminal cleavage.

  18. The nature of the optical variations of Seyfert galaxy 3C 120

    SciTech Connect

    Webb, J.R. Austin State Univ., TX )

    1990-01-01

    Results are presented from 61 years of optical observations of the Seyfert galaxy 3C 120. A previously published model of the 3C 120 light curve, derived from power spectrum analysis, is found to be valid for historical as well as current data. It is concluded that the optical variations of 3C 120 can be separated into a linear component, a sinusoidal component, and rapid, high-amplitude flares. Possible sources of the regular variations observed in 3C 120 are also suggested in the context of accretion models and other theoretical models. 15 refs.

  19. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1988-10-16

    Tenebria molitor MIDGUT PROTEASES; LOCUST CAECAL PROTEASES; BOWMAN-BIRK TRYPSIN-CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN...and Kunitz (STI) from soybeans, CI from chickpeas , chicken ovomucoid and turkey ovomucoid. It was Jnactivated by phenylemthvsulfonyl fluoride (PMSF...soybeans and Cl from chickpeas , by chicken ovomucoid and turkey overmucoid, as well as by the Kunitz (STI) soybean trypsin inhibitor that hardly

  20. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  1. Novel pseudosymmetric inhibitors of HIV-1 protease

    SciTech Connect

    Faessler, A.; Roesel, J.; Gruetter, M.; Tintelnot-Blomley, M.; Alteri, E.; Bold, G.; Lang, M.

    1993-12-31

    Taking into account the unique C-2 symmetric nature of the HIV-1 protease homodimer, the authors have designed and synthesized novel inhibitors featuring an almost symmetric structure. Compounds containing the easily accessible Phe[CH(OH)CH{sub 2}N(NH)]Cha dipeptide isostere as a nonhydrolyzable replacement of the scissile amide bond of the natural substrate are potent inhibitors in vitro with IC{sub 50} values of 9 to 50 nM. The antiviral activity depends mainly on the nature of the anylated valine residues linked to the dipeptide mimic. In this series, CGP 53820 combines both high potency and excellent specificity. Its predicted symmetric binding pattern is illustrated by the X-ray structure analysis performed with the corresponding enzyme-inhibitor complex.

  2. Highly potent fibrinolytic serine protease from Streptomyces.

    PubMed

    Uesugi, Yoshiko; Usuki, Hirokazu; Iwabuchi, Masaki; Hatanaka, Tadashi

    2011-01-05

    We introduce a highly potent fibrinolytic serine protease from Streptomyces omiyaensis (SOT), which belongs to the trypsin family. The fibrinolytic activity of SOT was examined using in vitro assays and was compared with those of known fibrinolytic enzymes such as plasmin, tissue-type plasminogen activator (t-PA), urokinase, and nattokinase. Compared to other enzymes, SOT showed remarkably higher hydrolytic activity toward mimic peptides of fibrin and plasminogen. The fibrinolytic activity of SOT is about 18-fold higher than that of plasmin, and is comparable to that of t-PA by fibrin plate assays. Furthermore, SOT had some plasminogen activator-like activity. Results show that SOT and nattokinase have very different fibrinolytic and fibrinogenolytic modes, engendering significant synergetic effects of SOT and nattokinase on fibrinolysis. These results suggest that SOT presents important possibilities for application in the therapy of thrombosis.

  3. Pharmacokinetic/Pharmacodynamic predictors of clinical potency for hepatitis C virus nonnucleoside polymerase and protease inhibitors.

    PubMed

    Reddy, Micaela B; Morcos, Peter N; Le Pogam, Sophie; Ou, Ying; Frank, Karl; Lave, Thierry; Smith, Patrick

    2012-06-01

    This analysis was conducted to determine whether the hepatitis C virus (HCV) viral kinetics (VK) model can predict viral load (VL) decreases for nonnucleoside polymerase inhibitors (NNPolIs) and protease inhibitors (PIs) after 3-day monotherapy studies of patients infected with genotype 1 chronic HCV. This analysis includes data for 8 NNPolIs and 14 PIs, including VL decreases from 3-day monotherapy, total plasma trough concentrations on day 3 (C(min)), replicon data (50% effective concentration [EC(50)] and protein-shifted EC(50) [EC(50,PS)]), and for PIs, liver-to-plasma ratios (LPRs) measured in vivo in preclinical species. VK model simulations suggested that achieving additional log(10) VL decreases greater than one required 10-fold increases in the C(min). NNPolI and PI data further supported this result. The VK model was successfully used to predict VL decreases in 3-day monotherapy for NNPolIs based on the EC(50,PS) and the day 3 C(min). For PIs, however, predicting VL decreases using the same model and the EC(50,PS) and day 3 C(min) was not successful; a model including LPR values and the EC(50) instead of the EC(50,PS) provided a better prediction of VL decrease. These results are useful for designing phase 1 monotherapy studies for NNPolIs and PIs by clarifying factors driving VL decreases, such as the day 3 C(min) and the EC(50,PS) for NNPolIs or the EC(50) and LPR for PIs. This work provides a framework for understanding the pharmacokinetic/pharmacodynamic relationship for other HCV drug classes. The availability of mechanistic data on processes driving the target concentration, such as liver uptake transporters, should help to improve the predictive power of the approach.

  4. 18 CFR 3c.3 - Reporting fraud, waste, abuse, and corruption and cooperation with official inquiries.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Reporting fraud, waste, abuse, and corruption and cooperation with official inquiries. 3c.3 Section 3c.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES...

  5. 18 CFR 3c.3 - Reporting fraud, waste, abuse, and corruption and cooperation with official inquiries.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Reporting fraud, waste, abuse, and corruption and cooperation with official inquiries. 3c.3 Section 3c.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES...

  6. 18 CFR 3c.3 - Reporting fraud, waste, abuse, and corruption and cooperation with official inquiries.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Reporting fraud, waste, abuse, and corruption and cooperation with official inquiries. 3c.3 Section 3c.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES...

  7. 50 CFR Table 3c to Part 680 - Crab Product Codes for Economic Data Reports

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Crab Product Codes for Economic Data Reports 3c Table 3c to Part 680 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE (CONTINUED) SHELLFISH FISHERIES OF...

  8. 50 CFR Table 3c to Part 680 - Crab Product Codes for Economic Data Reports

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Crab Product Codes for Economic Data Reports 3c Table 3c to Part 680 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE (CONTINUED) SHELLFISH FISHERIES OF...

  9. Glomerular C3c localization indicates ongoing immune deposit formation and complement activation in experimental glomerulonephritis.

    PubMed Central

    Schulze, M.; Pruchno, C. J.; Burns, M.; Baker, P. J.; Johnson, R. J.; Couser, W. G.

    1993-01-01

    In antibody-mediated glomerular disease, deposits of C3 (C3b) are common and are degraded by factor I to C3c and C3d. However, the kinetics of C3b degradation in glomerulonephritis have not been defined. To do this, we studied three models of complement-dependent glomerulonephritis with established C3 deposits (passive Heymann nephritis, cationized immunoglobulin G membranous nephropathy, and concanavalin A-anticoncanavalin A glomerulonephritis). C3b deposition was halted by administration of cobra venom factor, and the disappearance of C3c and C3d from glomeruli was measured with specific antibodies and quantitative fluorescence densitometry. Results showed that C3c deposits were reduced by over 85% within 24 hours in all three models. C3c clearance was unaffected by site or mechanism of deposit formation. C3d deposits persisted despite lack of ongoing complement activation. In passive Heymann nephritis when disease activity was monitored by urinary C5b-9 excretion, C3c was cleared in parallel with return of urine C5b-9 excretion to normal values. We conclude that glomerular deposits of C3c are cleared within 24 hours of cessation of complement activation. Positive staining for C3 utilizing antibody specific for the C3c portion documents recent complement activation usually reflecting new immune deposit formation. Images Figure 1 Figure 2 Figure 3 PMID:7678717

  10. Effects of detergents on the West Nile virus protease activity.

    PubMed

    Ezgimen, Manolya D; Mueller, Niklaus H; Teramoto, Tadahisa; Padmanabhan, R

    2009-05-01

    Detergents such as Triton X-100 are often used in drug discovery research to weed out small molecule promiscuous and non-specific inhibitors which act by aggregation in solution and undesirable precipitation in aqueous assay buffers. We evaluated the effects of commonly used detergents, Triton X-100, Tween-20, Nonidet-40 (NP-40), Brij-35, and CHAPS, on the enzymatic activity of West Nile virus (WNV) protease. Unexpectedly, Triton X-100, Tween-20, and NP-40 showed an enhancement of in vitro WNV protease activity from 2 to 2.5-fold depending on the detergent and its concentration. On the other hand, Brij-35, at 0.001% enhanced the protease activity by 1.5-fold and CHAPS had the least enhancing effect. The kinetic analysis showed that the increase in protease activity by Triton X-100 was dose-dependent. Furthermore, at Triton X-100 and Tween-20 concentrations higher than 0.001%, the inhibition of compound B, one of the lead compounds against WNV protease identified in a high throughput screen (IC(50) value of 5.7+/-2.5 microM), was reversed. However, in the presence of CHAPS, compound B still showed good inhibition of WNV protease. Our results, taken together, indicate that nonionic detergents, Triton X-100, Tween, and NP-40 are unsuitable for the purpose of discrimination of true versus promiscuous inhibitors of WNV protease in high throughput assays.

  11. Exploring a new serine protease from Cucumis sativus L.

    PubMed

    Nafeesa, Zohara; Shivalingu, B R; Vivek, H K; Priya, B S; Swamy, S Nanjunda

    2015-03-01

    Coagulation is an important physiological process in hemostasis which is activated by sequential action of proteases. This study aims to understand the involvement of aqueous fruit extract of Cucumis sativus L. (AqFEC) European burp less variety in blood coagulation cascade. AqFEC hydrolyzed casein in a dose-dependent manner. The presence of protease activity was further confirmed by casein zymography which revealed the possible presence of two high molecular weight protease(s). The proteolytic activity was inhibited only by phenyl methyl sulphonyl fluoride suggesting the presence of serine protease(s). In a dose-dependent manner, AqFEC also hydrolysed Aα and Bβ subunits of fibrinogen, whereas it failed to degrade the γ subunit of fibrinogen even at a concentration as high as 100 μg and incubation time up to 4 h. AqFEC reduced the clotting time of citrated plasma by 87.65%. The protease and fibrinogenolytic activity of AqFEC suggests its possible role in stopping the bleeding and ensuing wound healing process.

  12. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  13. Screening and characterization of protease producing actinomycetes from marine saltern.

    PubMed

    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva

    2014-10-01

    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries.

  14. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.

    PubMed

    Hughes, Valerie S; Page, Kristen

    2007-01-01

    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  15. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.

    PubMed

    Banik, Rathindra Mohan; Prakash, Monika

    2004-01-01

    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  16. Rabbit endogenous retrovirus-H encodes a functional protease.

    PubMed

    Voisset, Cécile; Myers, Richard E; Carne, Alex; Kellam, Paul; Griffiths, David J

    2003-01-01

    Recent studies have revealed that 'human retrovirus-5' sequences found in human samples belong to a rabbit endogenous retrovirus family named RERV-H. A part of the gag-pro region of the RERV-H genome was amplified by PCR from DNA in human samples and several forms of RERV-H protease were expressed in bacteria. The RERV-H protease was able to cleave itself from a precursor protein and was also able to cleave the RERV-H Gag polyprotein precursor in vitro whereas a form of the protease with a mutation engineered into the active site was inactive. Potential N- and C-terminal autocleavage sites were characterized. The RERV-H protease was sensitive to pepstatin A, showing it to be an aspartic protease. Moreover, it was strongly inhibited by PYVPheStaAMT, a pseudopeptide inhibitor specific for Mason-Pfizer monkey virus and avian myeloblastosis-associated virus. A structural model of the RERV-H protease was constructed that, together with the activity data, confirms that this is a retroviral aspartic protease.

  17. CVD growth and properties of boron phosphide on 3C-SiC

    NASA Astrophysics Data System (ADS)

    Padavala, Balabalaji; Frye, C. D.; Wang, Xuejing; Raghothamachar, Balaji; Edgar, J. H.

    2016-09-01

    Improving the crystalline quality of boron phosphide (BP) is essential for realizing its full potential in semiconductor device applications. In this study, 3C-SiC was tested as a substrate for BP epitaxy. BP films were grown on 3C-SiC(100)/Si, 3C-SiC(111)/Si, and 3C-SiC(111)/4H-SiC(0001) substrates in a horizontal chemical vapor deposition (CVD) system. Films were produced with good crystalline orientation and morphological features in the temperature range of 1000-1200 °C using a PH3+B2H6+H2 mixture. Rotational twinning was absent in the BP due to the crystal symmetry-matching with 3C-SiC. Confocal 3D Raman imaging of BP films revealed primarily uniform peak shift and peak widths across the scanned area, except at defects on the surface. Synchrotron white beam X-ray topography showed the epitaxial relationship between BP and 3C-SiC was (100) < 011 > BP||(100) < 011 > 3C-SiC and (111) < 11 2 ̅ > BP||(111) < 11 2 ̅ > 3C-SiC. Scanning electron microscopy, Raman spectroscopy and X-ray diffraction analysis indicated residual tensile strain in the films and improved crystalline quality at temperatures below 1200 °C. These results indicated that BP properties could be further enhanced by employing high quality bulk 3C-SiC or 3C-SiC epilayers on 4H-SiC substrates.

  18. Characterization of the protease activity of detergents: laboratory practicals for studying the protease profile and activity of various commercial detergents.

    PubMed

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-07-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body fluids, and food soils. This article describes two easy and cheap laboratory exercises to study the presence, profile, and basic enzymology of detergent proteases. These laboratory practicals are based on the determination of the detergent protease activity of various commercial detergents using the N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide method and the bovine serum albumin degradation capacity. Students are also required to elucidate the enzymatic subtype of detergent proteases by studying the inhibitory potential of several types of protease inhibitors revealed by the same experimental methodology. Additionally, the results of the exercises can be used to provide additional insights on elementary enzymology by studying the influence of several important parameters on protease activity such as temperature (in this article) and the influence of pH and effects of surfactants and oxidizers (proposed). Students also develop laboratory skills, problem-solving capacities, and the ability to write a laboratory report. The exercises are mainly designed for an advanced undergraduate project in the biochemistry and biotechnology sciences. Globally, these laboratory practicals show students the biotechnological applications of proteases in the detergent industry and also reinforce important enzymology concepts.

  19. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Mixed carbohydrase and protease enzyme product... Substances Affirmed as GRAS § 184.1027 Mixed carbohydrase and protease enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes carbohydrase and protease...

  20. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  1. Vibrational properties of Ti3C2 and Ti3C2T2 (T = O, F, OH) monosheets by first-principles calculations: a comparative study.

    PubMed

    Hu, Tao; Wang, Jiemin; Zhang, Hui; Li, Zhaojin; Hu, Minmin; Wang, Xiaohui

    2015-04-21

    We present a comparative study on the static and dynamical properties of bare Ti3C2 and T-terminated Ti3C2T2 (T = O, F, OH) monosheets using density functional theory calculations. First, the crystal structures are optimized to be of trigonal configurations (P3[combining macron]m1), which are thermodynamically and dynamically stable. It is demonstrated that the terminations modulate the crystal structures through valence electron density redistribution of the atoms, particularly surface Ti (Ti2) in the monosheets. Second, lattice dynamical properties including phonon dispersion and partial density of states (PDOS) are investigated. Phonon PDOS analysis shows a clear collaborative feature in the vibrations, reflecting the covalent nature of corresponding bonds in the monosheets. In the bare Ti3C2 monosheet, there is a phonon band gap between 400 and 500 cm(-1), while it disappears in Ti3C2O2 and Ti3C2(OH)2 as the vibrations associated with the terminal atoms (O and OH) bridge the gap. Third, both Raman (Eg and A1g) and infrared-active (Eu and A2u) vibrational modes are predicted and conclusively assigned. A comparative study indicates that the terminal atoms remarkably influence the vibrational frequencies. Generally, the terminal atoms weaken the vibrations in which surface Ti atoms are involved while strengthening the out-of-plane vibration of C atoms. Temperature-dependent micro Raman measurements agree with the theoretical prediction if the complexity in the experimentally obtained lamellae for the Raman study is taken into account.

  2. The role of proteases in regulating Eph/ephrin signaling

    PubMed Central

    Atapattu, Lakmali; Lackmann, Martin; Janes, Peter W

    2014-01-01

    Proteases regulate a myriad of cell functions, both in normal and disease states. In addition to protein turnover, they regulate a range of signaling processes, including those mediated by Eph receptors and their ephrin ligands. A variety of proteases is reported to directly cleave Ephs and/or ephrins under different conditions, to promote receptor and/or ligand shedding, and regulate receptor/ligand internalisation and signaling. They also cleave other adhesion proteins in response to Eph-ephrin interactions, to indirectly facilitate Eph-mediated functions. Proteases thus contribute to Eph/ephrin mediated changes in cell-cell and cell-matrix interactions, in cell morphology and in cell migration and invasion, in a manner which appears to be tightly regulated by, and co-ordinated with, Eph signaling. This review summarizes the current literature describing the function and regulation of protease activities during Eph/ephrin-mediated cell signaling. PMID:25482632

  3. Antiferromagnetic resonance in the Mott insulator fcc-Cs3C60.

    PubMed

    Suzuki, Yuta; Shibasaki, Seiji; Kubozono, Yoshihiro; Kambe, Takashi

    2013-09-11

    The magnetic ground state of the fcc phase of the Mott insulator Cs3C60 was studied using a low-temperature electron spin resonance technique, and antiferromagnetic resonance (AFMR) below 1.57 K was directly observed at ambient pressure. The AFMR modes for the fcc phase of Cs3C60 were investigated using a conventional two-sublattice model with uniaxial anisotropy, and the spin-flop field was determined to be 4.7 kOe at 1.57 K. The static magnetic exchange interactions and anisotropy field for fcc-Cs3C60 were also estimated.

  4. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.

    2016-01-01

    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  5. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan

    2014-01-01

    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  6. Photoactivated Spatiotemporally-Responsive Nanosensors of in Vivo Protease Activity.

    PubMed

    Dudani, Jaideep S; Jain, Piyush K; Kwong, Gabriel A; Stevens, Kelly R; Bhatia, Sangeeta N

    2015-12-22

    Proteases play diverse and important roles in physiology and disease, including influencing critical processes in development, immune responses, and malignancies. Both the abundance and activity of these enzymes are tightly regulated and highly contextual; thus, in order to elucidate their specific impact on disease progression, better tools are needed to precisely monitor in situ protease activity. Current strategies for detecting protease activity are focused on functionalizing synthetic peptide substrates with reporters that emit detection signals following peptide cleavage. However, these activity-based probes lack the capacity to be turned on at sites of interest and, therefore, are subject to off-target activation. Here we report a strategy that uses light to precisely control both the location and time of activity-based sensing. We develop photocaged activity-based sensors by conjugating photolabile molecules directly onto peptide substrates, thereby blocking protease cleavage by steric hindrance. At sites of disease, exposure to ultraviolet light unveils the nanosensors to allow proteases to cleave and release a reporter fragment that can be detected remotely. We apply this spatiotemporally controlled system to probe secreted protease activity in vitro and tumor protease activity in vivo. In vitro, we demonstrate the ability to dynamically and spatially measure metalloproteinase activity in a 3D model of colorectal cancer. In vivo, veiled nanosensors are selectively activated at the primary tumor site in colorectal cancer xenografts to capture the tumor microenvironment-enriched protease activity. The ability to remotely control activity-based sensors may offer a valuable complement to existing tools for measuring biological activity.

  7. Effects of cultural conditions on protease production by Aeromonas hydrophila.

    PubMed Central

    O'Reilly, T; Day, D F

    1983-01-01

    Production of extracellular proteolytic activity by Aeromonas hydrophila was influenced by temperature, pH, and aeration. Conditions which produced maximal growth also resulted in maximal protease production. Enzyme production appeared to be modulated by an inducer catabolite repression system whereby NH4+ and glucose repressed enzyme production and complex nitrogen and nonglucose, carbon energy sources promoted it. Under nutritional stress, protease production was high, despite poor growth. PMID:6342534

  8. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  9. The roles of intramembrane proteases in protozoan parasites.

    PubMed

    Sibley, L David

    2013-12-01

    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases.

  10. Insights into the Cyanobacterial Deg/HtrA Proteases

    PubMed Central

    Cheregi, Otilia; Wagner, Raik; Funk, Christiane

    2016-01-01

    Proteins are the main machinery for all living processes in a cell; they provide structural elements, regulate biochemical reactions as enzymes, and are the interface to the outside as receptors and transporters. Like any other machinery proteins have to be assembled correctly and need maintenance after damage, e.g., caused by changes in environmental conditions, genetic mutations, and limitations in the availability of cofactors. Proteases and chaperones help in repair, assembly, and folding of damaged and misfolded protein complexes cost-effective, with low energy investment compared with neo-synthesis. Despite their importance for viability, the specific biological role of most proteases in vivo is largely unknown. Deg/HtrA proteases, a family of serine-type ATP-independent proteases, have been shown in higher plants to be involved in the degradation of the Photosystem II reaction center protein D1. The objective of this review is to highlight the structure and function of their cyanobacterial orthologs. Homology modeling was used to find specific features of the SynDeg/HtrA proteases of Synechocystis sp. PCC 6803. Based on the available data concerning their location and their physiological substrates we conclude that these Deg proteases not only have important housekeeping and chaperone functions within the cell, but also are needed for remodeling the cell exterior. PMID:27252714

  11. Temporal dependence of cysteine protease activation following excitotoxic hippocampal injury.

    PubMed

    Berry, J N; Sharrett-Field, L J; Butler, T R; Prendergast, M A

    2012-10-11

    Excitotoxic insults can lead to intracellular signaling cascades that contribute to cell death, in part by activation of proteases, phospholipases, and endonucleases. Cysteine proteases, such as calpains, are calcium (Ca(2+))-activated enzymes which degrade cytoskeletal proteins, including microtubule-associated proteins, tubulin, and spectrin, among others. The current study used the organotypic hippocampal slice culture model to examine whether pharmacologic inhibition of cysteine protease activity inhibits N-methyl-D-aspartate- (NMDA-) induced excitotoxic (20 μM NMDA) cell death and changes in synaptophysin immunoreactivity. Significant NMDA-induced cytotoxicity (as measured by propidium iodide [PI] uptake) was found in the CA1 region of the hippocampus at all timepoints examined (24, 72, 120 h), an effect significantly attenuated by co-exposure to the selective NMDA receptor antagonist DL-2-Amino-5-phosphonopentanoic acid (APV), but not MDL-28170, a potent cysteine protease inhibitor. Results indicated sparing of NMDA-induced loss of the synaptic vesicular protein synaptophysin in all regions of the hippocampus by MDL-28170, though only at early timepoints after injury. These results suggest Ca(2+)-dependent recruitment of cysteine proteases within 24h of excitotoxic insult, but activation of alternative cellular degrading mechanisms after 24h. Further, these data suggest that synaptophysin may be a substrate for calpains and related proteases.

  12. Pnserpin: A Novel Serine Protease Inhibitor from Extremophile Pyrobaculum neutrophilum

    PubMed Central

    Zhang, Huan; Fei, Rui; Xue, Baigong; Yu, Shanshan; Zhang, Zuoming; Zhong, Sheng; Gao, Yuanqi; Zhou, Xiaoli

    2017-01-01

    Serine protease inhibitors (serpins) are native inhibitors of serine proteases, constituting a large protein family with members spread over eukaryotes and prokaryotes. However, only very few prokaryotic serpins, especially from extremophiles, have been characterized to date. In this study, Pnserpin, a putative serine protease inhibitor from the thermophile Pyrobaculum neutrophilum, was overexpressed in Escherichia coli for purification and characterization. It irreversibly inhibits chymotrypsin-, trypsin-, elastase-, and subtilisin-like proteases in a temperature range from 20 to 100 °C in a concentration-dependent manner. The stoichiometry of inhibition (SI) of Pnserpin for proteases decreases as the temperature increases, indicating that the inhibitory activity of Pnserpin increases with the temperature. SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) showed that Pnserpin inhibits proteases by forming a SDS-resistant covalent complex. Homology modeling and molecular dynamic simulations predicted that Pnserpin can form a stable common serpin fold. Results of the present work will help in understanding the structural and functional characteristics of thermophilic serpin and will broaden the current knowledge about serpins from extremophiles. PMID:28067849

  13. The Inflammatory Actions of Coagulant and Fibrinolytic Proteases in Disease

    PubMed Central

    Schuliga, Michael

    2015-01-01

    Aside from their role in hemostasis, coagulant and fibrinolytic proteases are important mediators of inflammation in diseases such as asthma, atherosclerosis, rheumatoid arthritis, and cancer. The blood circulating zymogens of these proteases enter damaged tissue as a consequence of vascular leak or rupture to become activated and contribute to extravascular coagulation or fibrinolysis. The coagulants, factor Xa (FXa), factor VIIa (FVIIa), tissue factor, and thrombin, also evoke cell-mediated actions on structural cells (e.g., fibroblasts and smooth muscle cells) or inflammatory cells (e.g., macrophages) via the proteolytic activation of protease-activated receptors (PARs). Plasmin, the principle enzymatic mediator of fibrinolysis, also forms toll-like receptor-4 (TLR-4) activating fibrin degradation products (FDPs) and can release latent-matrix bound growth factors such as transforming growth factor-β (TGF-β). Furthermore, the proteases that convert plasminogen into plasmin (e.g., urokinase plasminogen activator) evoke plasmin-independent proinflammatory actions involving coreceptor activation. Selectively targeting the receptor-mediated actions of hemostatic proteases is a strategy that may be used to treat inflammatory disease without the bleeding complications of conventional anticoagulant therapies. The mechanisms by which proteases of the coagulant and fibrinolytic systems contribute to extravascular inflammation in disease will be considered in this review. PMID:25878399

  14. The Crystal Structure of GXGD Membrane Protease FlaK

    SciTech Connect

    J Hu; Y Xue; S Lee; Y Ha

    2011-12-31

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  15. The crystal structure of GXGD membrane protease FlaK

    SciTech Connect

    Hu, Jian; Xue, Yi; Lee, Sangwon; Ha, Ya

    2011-09-20

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  16. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed

    Schauperl, Michael; Fuchs, Julian E; Waldner, Birgit J; Huber, Roland G; Kramer, Christian; Liedl, Klaus R

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4') with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design.

  17. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y

    2017-01-01

    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases.

  18. Protease inhibitors and proteolytic signalling cascades in insects.

    PubMed

    Gubb, David; Sanz-Parra, Arantza; Barcena, Laura; Troxler, Laurent; Fullaondo, Ane

    2010-12-01

    Proteolytic signalling cascades control a wide range of physiological responses. In order to respond rapidly, protease activity must be maintained at a basal level: the component zymogens must be sequentially activated and actively degraded. At the same time, signalling cascades must respond precisely: high target specificity is required. The insects have a wide range of trapping- and tight-binding protease inhibitors, which can regulate the activity of individual proteases. In addition, the interactions between component proteases of a signalling cascade can be modified by serine protease homologues. The suicide-inhibition mechanism of serpin family inhibitors gives rapid turnover of both protease and inhibitor, but target specificity is inherently broad. Similarly, the TEP/macroglobulins have extremely broad target specificity, which suits them for roles as hormone transport proteins and sensors of pathogenic virulence factors. The tight-binding inhibitors, on the other hand, have a lock-and-key mechanism capable of high target specificity. In addition, proteins containing multiple tight-binding inhibitory domains may act as scaffolds for the assembly of signalling complexes. Proteolytic cascades regulated by combinations of different types of inhibitor could combine the rapidity of suicide-inhibitors with the specificity lock-and-key inhibitors. This would allow precise control of physiological responses and may turn out to be a general rule.

  19. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed Central

    Schauperl, Michael; Fuchs, Julian E.; Waldner, Birgit J.; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4’) with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design. PMID:26559682

  20. Protease inhibitors from several classes work synergistically against Callosobruchus maculatus.

    PubMed

    Amirhusin, Bahagiawati; Shade, Richard E; Koiwa, Hisashi; Hasegawa, Paul M; Bressan, Ray A; Murdock, Larry L; Zhu-Salzman, Keyan

    2007-07-01

    Targeting multiple digestive proteases may be more effective in insect pest control than inhibition of a single enzyme class. We therefore explored possible interactions of three antimetabolic protease inhibitors fed to cowpea bruchids in artificial diets, using a recombinant soybean cysteine protease inhibitor scN, an aspartic protease inhibitor pepstatin A, and soybean Kunitz trypsin inhibitor KI. scN and pepstatin, inhibiting major digestive cysteine and aspartic proteases, respectively, significantly prolonged the developmental time of cowpea bruchids individually. When combined, the anti-insect effect was synergistic, i.e., the toxicity of the mixture was markedly greater than that of scN or pepstatin alone. KI alone did not impact insect development even at relatively high concentrations, but its anti-insect properties became apparent when acting jointly with scN or scN plus pepstatin. Incubating KI with bruchid midgut extract showed that it was partially degraded. This instability may explain its lack of anti-insect activity. However, this proteolytic degradation was inhibited by scN and/or pepstatin. Protection of KI from proteolysis in the insect digestive tract thus could be the basis for the synergistic effect. These observations support the concept that cowpea bruchid gut proteases play a dual role; digesting protein for nutrient needs and protecting insects by inactivating dietary proteins that may otherwise be toxic. Our results also suggest that transgenic resistance strategies that involve multigene products are likely to have enhanced efficacy and durability.

  1. 2-D zymographic analysis of Broccoli (Brassica oleracea L. var. Italica) florets proteases: follow up of cysteine protease isotypes in the course of post-harvest senescence.

    PubMed

    Rossano, Rocco; Larocca, Marilena; Riccio, Paolo

    2011-09-01

    Zymographic analysis of Broccoli florets (Brassica oleracea L. var. Italica) revealed the presence of acidic metallo-proteases, serine proteases and cysteine proteases. Under conditions which were denaturing for the other proteases, the study was restricted to cysteine proteases. 2-D zymography, a technique that combines IEF and zymography was used to show the presence of 11 different cysteine protease spots with molecular mass of 44 and 47-48kDa and pIs ranging between 4.1 and 4.7. pI differences could be ascribed to different degrees of phosphorylation that partly disappeared in the presence of alkaline phosphatase. Post-harvest senescence of Broccoli florets was characterized by decrease in protein and chlorophyll contents and increase of protease activity. In particular, as determined by 2-D zymography, the presence of cysteine protease clearly increased during senescence, a finding that may represent a useful tool for the control of the aging process.

  2. Dual origin of gut proteases in Formosan subterranean termites (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae).

    PubMed

    Sethi, Amit; Xue, Qing-Gang; La Peyre, Jerome F; Delatte, Jennifer; Husseneder, Claudia

    2011-07-01

    Cellulose digestion in lower termites, mediated by carbohydrases originating from both termite and endosymbionts, is well characterized. In contrast, limited information exists on gut proteases of lower termites, their origins and roles in termite nutrition. The objective of this study was to characterize gut proteases of the Formosan subterranean termite (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae). The protease activity of extracts from gut tissues (fore-, mid- and hindgut) and protozoa isolated from hindguts of termite workers was quantified using hide powder azure as a substrate and further characterized by zymography with gelatin SDS-PAGE. Midgut extracts showed the highest protease activity followed by the protozoa extracts. High level of protease activity was also detected in protozoa culture supernatants after 24 h incubation. Incubation of gut and protozoa extracts with class-specific protease inhibitors revealed that most of the proteases were serine proteases. All proteolytic bands identified after gelatin SDS-PAGE were also inhibited by serine protease inhibitors. Finally, incubation with chromogenic substrates indicated that extracts from fore- and hindgut tissues possessed proteases with almost exclusively trypsin-like activity while both midgut and protozoa extracts possessed proteases with trypsin-like and subtilisin/chymotrypsin-like activities. However, protozoa proteases were distinct from midgut proteases (with different molecular mass). Our results suggest that the Formosan subterranean termite not only produces endogenous proteases in its gut tissues, but also possesses proteases originating from its protozoan symbionts.

  3. Protease Production by Different Thermophilic Fungi

    NASA Astrophysics Data System (ADS)

    Macchione, Mariana M.; Merheb, Carolina W.; Gomes, Eleni; da Silva, Roberto

    A comparative study was carried out to evaluate protease production in solid-state fermentation (SSF) and submerged fermentation (SmF) by nine different thermophilic fungi — Thermoascus aurantiacus Miehe, Thermomyces lanuginosus, T. lanuginosus TO.03, Aspergillus flavus 1.2, Aspergillus sp. 13.33, Aspergillus sp. 13.34, Aspergillus sp. 13.35, Rhizomucor pusillus 13.36 and Rhizomucor sp. 13.37 — using substrates containing proteins to induce enzyme secretion. Soybean extract (soybean milk), soybean flour, milk powder, rice, and wheat bran were tested. The most satisfactory results were obtained when using wheat bran in SSF. The fungi that stood out in SSF were T. lanuginosus, T. lanuginosus TO.03, Aspergillus sp. 13.34, Aspergillus sp. 13.35, and Rhizomucor sp. 13.37, and those in SmF were T. aurantiacus, T. lanuginosus TO.03, and 13.37. In both fermentation systems, A. flavus 1.2 and R. pusillus 13.36 presented the lowest levels of proteolytic activity.

  4. Are 3C 120 and Other Active Galactic Nuclei Overweight Microquasars?

    NASA Astrophysics Data System (ADS)

    Marscher, Alan P.

    2005-11-01

    The appearance of superluminal radio knots follows drops in the X-ray flux in the FR1 radio galaxy 3C 120 and possibly the FR2 source 3C 111. This corresponds in a very general way to the behavior of the X-ray binary GRS 1915 + 105, but the light curves of the microquasar are much richer in detail. Starting in 2003.7, the character of the radio and X-ray light curves of 3C 120 changed, perhaps signaling a new stage of activity. I discuss here what one might expect when a microquasar is scaled up to AGN dimensions, and compare this with what we see in 3C 120. There is a mismatch between expectations and observations.

  5. Thermodynamic properties of solid face centered cubic Rb3C60 at high temperature and pressure

    NASA Astrophysics Data System (ADS)

    Yang, W.; Sun, J. X.; Liu, H.; Yan, G. F.

    2014-03-01

    Analytic equation of state and thermodynamic quantities of solid fcc Rb3C60 are derived by using an analytic mean field potential method. For intermolecular forces, the double-exponential potential is utilized. Four potential parameters are determined by fitting experimental compression data of Rb3C60 up to 14 GPa at 296 K. Various physical quantities including isothermals, thermal expansion, isochoric heat capacity, Helmholtz free energy and internal energy are calculated and analyzed. Calculated results are consistent with available experimental data in literature. Furthermore, spinodal temperature for Rb3C60 is found to be 2,860 K. Results verify that analytic mean field potential method is a useful approach to consider the anharmonic effect at high temperatures. Numerous reasonable predictions and the change trend of the properties for Rb3C60 at high temperature and pressure have been given.

  6. Structural Basis for Molecular Discrimination by a 3',3'-cGAMP Sensing Riboswitch

    SciTech Connect

    Ren, Aiming; Wang, Xin  C.; Kellenberger, Colleen  A.; Rajashankar, Kanagalaghatta  R.; Jones, Roger  A.; Hammond, Ming  C.; Patel, Dinshaw  J.

    2015-04-07

    Cyclic dinucleotides are second messengers that target the adaptor STING and stimulate the innate immune response in mammals. Besides protein receptors, there are bacterial riboswitches that selectively recognize cyclic dinucleotides. We recently discovered a natural riboswitch that targets 3',3'-cGAMP, which is distinguished from the endogenous mammalian signal 2',3'-cGAMP by its backbone connectivity. Here, we report on structures of the aptamer domain of the 3',3'-cGAMP riboswitch from Geobacter in the 3',3'-cGAMP and c-di-GMP bound states. The riboswitch adopts a tuning forklike architecture with a junctional ligand-binding pocket and different orientations of the arms are correlated with the identity of the bound cyclic dinucleotide. Subsequent biochemical experiments revealed that specificity of ligand recognition can be affected by point mutations outside of the binding pocket, which has implications for both the assignment and reengineering of riboswitches in this structural class.

  7. Two new 3-C-carboxylated flavones from the rhizomes of Caragana conferta.

    PubMed

    Khan, Rehan; Malika, Abdul; Yasmeen, Shazia; Afza, Nighat

    2010-12-01

    Confertins A (1) and B (2), new 3-C-carboxylated flavones, have been isolated from the ethyl acetate soluble fraction of the rhizomes of Caragana conferta. Their structures have been assigned on the basis of spectroscopic studies.

  8. Bright optical outburst with rapid optical variability of the blazar 3C 279

    NASA Astrophysics Data System (ADS)

    Jankowsky, F.; Glawion, D.; Schwemmer, S.; Wagner, S.

    2017-03-01

    Optical observations of the gamma-ray bright, flat-spectrum radio quasar 3C 279 (z=0.536) with the Automatic Telescope for Optical Monitoring (ATOM) confirm a very bright optical state and rapid flares.

  9. Epstein-Barr Virus Essential Antigen EBNA3C Attenuates H2AX Expression

    PubMed Central

    Jha, Hem C.; AJ, Mahadesh Prasad; Saha, Abhik; Banerjee, Shuvomoy; Lu, Jie

    2014-01-01

    Epstein-Barr virus (EBV) latent antigen EBNA3C is implicated in B-cell immortalization and linked to several B-cell malignancies. Deregulation of H2AX can induce genomic instability with increased chromosomal aberrations, which ultimately leads to tumorigenesis. Here we demonstrated that EBNA3C can attenuate H2AX expression at the transcript and protein levels. A reduction of total H2AX levels was clearly observed upon infection of primary B cells with wild-type EBV but not with EBNA3C knockout recombinant EBV. H2AX also interacted with EBNA3C through its N-terminal domain (residues 1 to 100). Furthermore, H2AX mutated at Ser139 failed to interact with EBNA3C. Luciferase-based reporter assays also revealed that the binding domain of EBNA3C is sufficient for transcriptional inhibition of the H2AX promoter. EBNA3C also facilitated H2AX degradation through recruitment of components of the ubiquitin proteasome pathway. We further demonstrated that knockdown of H2AX in lymphoblastoid cell lines (LCLs) led to the upregulation of the Bub1 oncoprotein and downregulated expression of p53. Overall, our study provides additional insights into EBV-associated B-cell lymphomas, which are linked to the regulation of the DNA damage response system in infected cells. The importance of these insights are as follows: (i) EBNA3C downregulates H2AX expression at the protein and transcript levels in epithelial cells, B cells, and EBV-transformed LCLs, (ii) EBNA3C binds with wild-type H2AX but not with the Ser139 mutant of H2AX, (iii) the N terminus (residues 1 to 100) of EBNA3C is critical for binding to H2AX, (iv) localization of H2AX is predominantly nuclear in the presence of EBNA3C, and (v) H2AX knocked down in LCLs led to enhanced expression of Bub1 and downregulation of the tumor suppressor p53, which are both important for driving the oncogenic process. PMID:24429368

  10. Magnetic and Electronic Properties of Nanocrystalline Fe2B and Fe3C Compounds

    NASA Astrophysics Data System (ADS)

    Dorolti, E.; Vlaic, P.; Burzo, E.; Djéga-Mariadassou, C.

    2007-04-01

    The nanocrystalline Fe3C and Fe2B samples were prepared by high energy ball milling and subsequent annealing. The saturation magnetization at 4.2 K is 1.94 μB/ f.u. for Fe3C and 1.75 μB/ f.u. for Fe2B. Band structure calculations show a negative polarization at B and C sites. The computed iron moments are close to experimentally determined values.

  11. Efficient femtosecond laser micromachining of bulk 3C-SiC

    NASA Astrophysics Data System (ADS)

    Farsari, M.; Filippidis, G.; Zoppel, S.; Reider, G. A.; Fotakis, C.

    2005-09-01

    We demonstrate surface micromachining of bulk 3C silicon carbide (3C-SiC) wafers by employing tightly focused infrared femtosecond laser pulses of energy less than 10 nJ directly from a femtosecond laser oscillator, thus eliminating the need for an amplified system and increasing the micromachining speed by more than four orders of magnitude. In addition, we show that high aspect ratio through-tapered vias can be drilled in 400 µm thick wafers using an amplified femtosecond laser.

  12. 40 CFR Appendix A-2 to Part 60 - Test Methods 2G through 3C

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 8 2012-07-01 2012-07-01 false Test Methods 2G through 3C A Appendix A-2 to Part 60 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) STANDARDS OF PERFORMANCE FOR NEW STATIONARY SOURCES (CONTINUED) Pt. 60, App. A-2 Appendix A-2 to Part 60—Test Methods 2G through 3C Method...

  13. 40 CFR Appendix A-2 to Part 60 - Test Methods 2G through 3C

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 7 2011-07-01 2011-07-01 false Test Methods 2G through 3C A Appendix A-2 to Part 60 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) STANDARDS OF PERFORMANCE FOR NEW STATIONARY SOURCES (CONTINUED) Pt. 60, App. A-2 Appendix A-2 to Part 60—Test Methods 2G through 3C Method...

  14. 40 CFR Appendix A-2 to Part 60 - Test Methods 2G through 3C

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 7 2010-07-01 2010-07-01 true Test Methods 2G through 3C A Appendix A-2 to Part 60 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) STANDARDS OF PERFORMANCE FOR NEW STATIONARY SOURCES (CONTINUED) Pt. 60, App. A-2 Appendix A-2 to Part 60—Test Methods 2G through 3C...

  15. 40 CFR Appendix A-2 to Part 60 - Test Methods 2G through 3C

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 8 2013-07-01 2013-07-01 false Test Methods 2G through 3C A Appendix A-2 to Part 60 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) STANDARDS OF PERFORMANCE FOR NEW STATIONARY SOURCES (CONTINUED) Pt. 60, App. A-2 Appendix A-2 to Part 60—Test Methods 2G through 3C Method...

  16. AN ASYMMETRICAL SYNCHROTRON MODEL FOR KNOTS IN THE 3C 273 JET

    SciTech Connect

    Liu, Wen-Po; Chen, Y. J.; Wang, Chun-Cheng

    2015-06-20

    To interpret the emission of knots in the 3C 273 jet from radio to X-rays, we propose a synchrotron model in which, owing to the shock compression effect, the injection spectra from a shock into the upstream and downstream emission regions are asymmetric. Our model could well explain the spectral energy distributions of knots in the 3C 273 jet, and predictions regarding the knots’ spectra could be tested by future observations.

  17. Focusing of 3C144 Source Radiation by the Solar Corona

    NASA Astrophysics Data System (ADS)

    Galanin, V. V.; Derevjagin, V. G.; Kravetz, R. O.

    The research of solar corona by the compact cosmic source radiation was made on URAN-4 radio telescope. In the period from June 6 to June 20 2012 the flow of Crab nebula was measured on the 20 MHz and 25 MHz frequencies. During the eclipse we observe the great increase of 3C144 flow, which is compare with the flow of 3C461 source. Data and results of measurement analysis is presented.

  18. Cleavage of Interferon Regulatory Factor 7 by Enterovirus 71 3C Suppresses Cellular Responses

    PubMed Central

    Lei, Xiaobo; Xiao, Xia; Xue, Qinghua; Jin, Qi

    2013-01-01

    Enterovirus 71 (EV71) is a positive-stranded RNA virus which is capable of inhibiting innate immunity. Among virus-encoded proteins, the 3C protein compromises the type I interferon (IFN-I) response mediated by retinoid acid-inducible gene-I (RIG-I) or Toll-like receptor 3 that activates interferon regulatory 3 (IRF3) and IRF7. In the present study, we report that enterovirus 71 downregulates IRF7 through the 3C protein, which inhibits the function of IRF7. When expressed in mammalian cells, the 3C protein mediates cleavage of IRF7 rather than that of IRF3. This process is insensitive to inhibitors of caspase, proteasome, lysosome, and autophagy. H40D substitution in the 3C active site abolishes its activity, whereas R84Q or V154S substitution in the RNA binding motif has no effect. Furthermore, 3C-mediated cleavage occurs at the Q189-S190 junction within the constitutive activation domain of IRF7, resulting in two cleaved IRF7 fragments that are incapable of activating IFN expression. Ectopic expression of wild-type IRF7 limits EV71 replication. On the other hand, expression of the amino-terminal domain of IRF7 enhances EV71 infection, which correlates with its ability to interact with and inhibit IRF3. These results suggest that control of IRF7 by the 3C protein may represent a viral mechanism to escape cellular responses. PMID:23175366

  19. Picornaviral 3C cysteine proteinases have a fold similar to the chymotrypsin-like serine proteinases

    SciTech Connect

    Allaire,M.; Chernaia, M.; Malcolm, B.; James, M.

    1994-01-01

    The picornavirus family includes several pathogens such as poliovirus, rhinovirus (the major cause of the common cold), hepatitis A virus and the foot-and-mouth disease virus. Picornaviral proteins are expressed by direct translation of the genomic RNA into a single, large polyprotein precursor. Proteolysis of the viral polyprotein into the mature proteins is assured by the viral 3C enzymes, which are cysteine proteinases. Here we report the X-ray crystal structure at 2.3 {angstrom} resolution of the 3C proteinase from hepatitis A virus (HAV-3C). The overall architecture of HAV-3C reveals a fold resembling that of the chymotrypsin family of serine proteinases, which is consistent with earlier predictions. Catalytic residues include Cys 172 as nucleophile and His 44 as general base. The 3C cleavage specificity for glutamine residues is defined primarily by His 191. The overall structure suggests that an inter-molecular (trans) cleavage releases 3C and that there is an active proteinase in the polyprotein.

  20. Atomic-scale recognition of surface structure and intercalation mechanism of Ti3C2X.

    PubMed

    Wang, Xuefeng; Shen, Xi; Gao, Yurui; Wang, Zhaoxiang; Yu, Richeng; Chen, Liquan

    2015-02-25

    MXenes represent a large family of functionalized two-dimensional (2D) transition-metal carbides and carbonitrides. However, most of the understanding on their unique structures and applications stops at the theoretical suggestion and lack of experimental support. Herein, the surface structure and intercalation chemistry of Ti3C2X are clarified at the atomic scale by aberration-corrected scanning transmission electron microscope (STEM) and density functional theory (DFT) calculations. The STEM studies show that the functional groups (e.g., OH(-), F(-), O(-)) and the intercalated sodium (Na) ions prefer to stay on the top sites of the centro-Ti atoms and the C atoms of the Ti3C2 monolayer, respectively. Double Na-atomic layers are found within the Ti3C2X interlayer upon extensive Na intercalation via two-phase transition and solid-solution reactions. In addition, aluminum (Al)-ion intercalation leads to horizontal sliding of the Ti3C2X monolayer. On the basis of these observations, the previous monolayer surface model of Ti3C2X is modified. DFT calculations using the new modeling help to understand more about their physical and chemical properties. These findings enrich the understanding of the MXenes and shed light on future material design and applications. Moreover, the Ti3C2X exhibits prominent rate performance and long-term cycling stability as an anode material for Na-ion batteries.

  1. 43 and 86 GHz VLBI Polarimetry of 3C454.3

    NASA Astrophysics Data System (ADS)

    Hunacek, A.; Attridge, J. M.

    2004-12-01

    Very Long Baseline Array (VLBA) observations of the quasar 3C454.3 were made at epoch 2003.75, at 43 and 86 GHz in full polarization mode. Very Long Baseline Polarimetry (VLBP) is used to determine magnetic field structures in the jets of extragalactic radio sources at very high angular resolution - on the order of 0.3 milliarcseconds at 86 GHz. As Faraday rotation decreases with decreasing wavelength, high-frequency, high-resolution VLBP observations allow us to probe the polarization properties of Active Galactic Nuclei (AGNs) close to the super-massive black holes thought to be the central engines of these objects. New total intensity and linear polarization images of 3C454.3 at both 43 and 86 GHz are presented here, along with historical images for comparison. The new images include the first 86 GHz linear polarization images ever made of the source 3C454.3, and these results bring the number of sources for which successful 86 GHz polarimetry has been accomplished to three. As 3C454.3 is fainter at 86 GHz than its counterparts 3C273 and 3C279, the new observations are quite promising for the success of 86 GHz VLBP on weaker sources. This research was carried out as part of MIT Haystack Observatory's Research Experiences for Undergraduates program funded by the National Science Foundation.

  2. Synthesis and electrochemical performance of Ti3C2Tx with hydrothermal process

    NASA Astrophysics Data System (ADS)

    Wang, Libo; Zhang, Heng; Wang, Bo; Shen, Changjie; Zhang, Chuanxiang; Hu, Qianku; Zhou, Aiguo; Liu, Baozhong

    2016-09-01

    In this study, a simple hydrothermal method has been developed to prepare Ti3C2Tx from Ti3AlC2 as a high-performance electrode material for supercapacitors. This method is environmentally friendly and has a low level of danger. The morphology and structure of the Ti3C2Tx can be controlled by hydrothermal reaction time, temperature and NH4F amounts. The prepared Ti3C2Tx was characterized by X-ray diffraction, field emission scanning electron microscopy, Raman spectroscopy, X-ray photoelectron spectroscopy and Brunauer-Emmet-Teller. The results show that the prepared Ti3C2Tx is terminated by O, OH, and F groups. The electrochemical properties of the Ti3C2Tx sample exhibit specific capacitance up to 141 Fcm-3 in 3 M KOH aqueous electrolyte, and even after 1000 cycles, no significant degradation of the volumetric capacitance was observed. These results indicate that the Ti3C2Tx material prepared by this hydrothermal method can be used in high performance supercapacitors.

  3. Despite phylogenetic effects, C3-C4 lineages bridge the ecological gap to C4 photosynthesis.

    PubMed

    Lundgren, Marjorie R; Christin, Pascal-Antoine

    2017-01-01

    C4 photosynthesis is a physiological innovation involving several anatomical and biochemical components that emerged recurrently in flowering plants. This complex trait evolved via a series of physiological intermediates, broadly termed 'C3-C4', which have been widely studied to understand C4 origins. While this research program has focused on biochemistry, physiology, and anatomy, the ecology of these intermediates remains largely unexplored. Here, we use global occurrence data and local habitat descriptions to characterize the niches of multiple C3-C4 lineages, as well as their close C3 and C4 relatives. While C3-C4 taxa tend to occur in warm climates, their abiotic niches are spread along other dimensions, making it impossible to define a universal C3-C4 niche. Phylogeny-based comparisons suggest that, despite shifts associated with photosynthetic types, the precipitation component of the C3-C4 niche is particularly lineage specific, being highly correlated with that of closely related C3 and C4 taxa. Our large-scale analyses suggest that C3-C4 lineages converged toward warm habitats, which may have facilitated the transition to C4 photosynthesis, effectively bridging the ecological gap between C3 and C4 plants. The intermediates retained some precipitation aspects of their C3 ancestors' habitat, and likely transmitted them to their C4 descendants, contributing to the diversity among C4 lineages seen today.

  4. VLBI observations of a complete sample of radio galaxies. 4: The radio galaxies NGC 2484, 3C 109, and 3C 382

    NASA Technical Reports Server (NTRS)

    Giovannini, G.; Feretti, L.; Venturi, T.; Lara, L.; Marcaide, J.; Rioja, M.; Spangler, S. R.; Wehrle, A. E.

    1994-01-01

    We present here new Very Long Base Interferometry (VLBI) observations of one Fanaroff and Riley (F-R) I radio galaxy (NGC 2484) and two broad-line F-R II radio galaxies (3C 109 and 3C 382). For 3C 109 new Very Large Array (VLA) maps are also shown. These sources belong to a complete sample of radio galaxies under study for a better knowledge of their structures at parsec resolution. The parsec structure of these three objects is very similar: asymmetric emission, which we interpret as the core plus a one-side jet. The parsec-scale jet is always on the same side of the main kiloparsec-scale jet. The limit on the jet to counterjet brightness ratio, the ratio of the core radio power to the total radio power and the synchrotron-self Compton model allow us to derive some constraints on the jet velocity and orientation with respect to the line of sight. From these data and from those published on two other sources of our sample, we suggest that parsec-scale jets are relativistic in both F-R I and F-R II radio galaxies and that parsec scale properties in F-R I and F-R II radio galaxies are very similar despite the large difference between these two classes of radio galaxies on the kiloparsec scale.

  5. German cockroach frass proteases modulate the innate immune response via activation of protease-activated receptor-2.

    PubMed

    Day, Scottie B; Zhou, Ping; Ledford, John R; Page, Kristen

    2010-01-01

    Allergen exposure can induce an early innate immune response; however, the mechanism by which this occurs has not been addressed. In this report, we demonstrate a role for the active serine proteases in German cockroach (GC) feces (frass) and protease-activated receptor (PAR)-2 in modulating the innate immune response. A single exposure of GC frass induced inflammatory cytokine production and cellular infiltration in the airways of mice. In comparison, exposure to protease-depleted GC frass resulted in diminution of inflammatory cytokine production and airway neutrophilia, but had no effect on macrophage infiltration. Selective activation of PAR-2 confirmed that PAR-2 was sufficient to induce airway inflammation. Exposure of GC frass to PAR-2-deficient mice led to decreased immune responses to GC frass compared to wild-type mice. Using the macrophage as an early marker of the innate immune response, we found that GC frass induced significant release of tumor necrosis factor-alpha from primary alveolar macrophages. This effect was dependent on the intrinsic proteases in GC frass. We confirmed GC frass-induced cytokine expression was mediated by activation of NF-kappaB and ERK in a macrophage cell line. Collectively, these data suggest a central role for GC frass protease-PAR-2 activation in regulating the innate immune response through the activation of alveolar macrophages. Understanding the potential role of protease-PAR-2 activation as a danger signal or adjuvant could yield attractive therapeutic targets.

  6. Protease induced plasticity: matrix metalloproteinase-1 promotes neurostructural changes through activation of protease activated receptor 1

    PubMed Central

    Allen, Megan; Ghosh, Suhasini; Ahern, Gerard P.; Villapol, Sonia; Maguire-Zeiss, Kathleen A.; Conant, Katherine

    2016-01-01

    Matrix metalloproteinases (MMPs) are a family of secreted endopeptidases expressed by neurons and glia. Regulated MMP activity contributes to physiological synaptic plasticity, while dysregulated activity can stimulate injury. Disentangling the role individual MMPs play in synaptic plasticity is difficult due to overlapping structure and function as well as cell-type specific expression. Here, we develop a novel system to investigate the selective overexpression of a single MMP driven by GFAP expressing cells in vivo. We show that MMP-1 induces cellular and behavioral phenotypes consistent with enhanced signaling through the G-protein coupled protease activated receptor 1 (PAR1). Application of exogenous MMP-1, in vitro, stimulates PAR1 dependent increases in intracellular Ca2+ concentration and dendritic arborization. Overexpression of MMP-1, in vivo, increases dendritic complexity and induces biochemical and behavioral endpoints consistent with increased GPCR signaling. These data are exciting because we demonstrate that an astrocyte-derived protease can influence neuronal plasticity through an extracellular matrix independent mechanism. PMID:27762280

  7. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.

    PubMed

    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal

    2016-08-09

    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  8. Image reconstruction algorithm for optically stimulated luminescence 2D dosimetry using laser-scanned Al2O3:C and Al2O3:C,Mg films

    NASA Astrophysics Data System (ADS)

    Ahmed, M. F.; Schnell, E.; Ahmad, S.; Yukihara, E. G.

    2016-10-01

    The objective of this work was to develop an image reconstruction algorithm for 2D dosimetry using Al2O3:C and Al2O3:C,Mg optically stimulated luminescence (OSL) films imaged using a laser scanning system. The algorithm takes into account parameters associated with detector properties and the readout system. Pieces of Al2O3:C films (~8 mm  ×  8 mm  ×  125 µm) were irradiated and used to simulate dose distributions with extreme dose gradients (zero and non-zero dose regions). The OSLD film pieces were scanned using a custom-built laser-scanning OSL reader and the data obtained were used to develop and demonstrate a dose reconstruction algorithm. The algorithm includes corrections for: (a) galvo hysteresis, (b) photomultiplier tube (PMT) linearity, (c) phosphorescence, (d) ‘pixel bleeding’ caused by the 35 ms luminescence lifetime of F-centers in Al2O3, (e) geometrical distortion inherent to Galvo scanning system, and (f) position dependence of the light collection efficiency. The algorithm was also applied to 6.0 cm  ×  6.0 cm  ×  125 μm or 10.0 cm  ×  10.0 cm  ×  125 µm Al2O3:C and Al2O3:C,Mg films exposed to megavoltage x-rays (6 MV) and 12C beams (430 MeV u-1). The results obtained using pieces of irradiated films show the ability of the image reconstruction algorithm to correct for pixel bleeding even in the presence of extremely sharp dose gradients. Corrections for geometric distortion and position dependence of light collection efficiency were shown to minimize characteristic limitations of this system design. We also exemplify the application of the algorithm to more clinically relevant 6 MV x-ray beam and a 12C pencil beam, demonstrating the potential for small field dosimetry. The image reconstruction algorithm described here provides the foundation for laser-scanned OSL applied to 2D dosimetry.

  9. Image reconstruction algorithm for optically stimulated luminescence 2D dosimetry using laser-scanned Al2O3:C and Al2O3:C,Mg films.

    PubMed

    Ahmed, M F; Schnell, E; Ahmad, S; Yukihara, E G

    2016-10-21

    The objective of this work was to develop an image reconstruction algorithm for 2D dosimetry using Al2O3:C and Al2O3:C,Mg optically stimulated luminescence (OSL) films imaged using a laser scanning system. The algorithm takes into account parameters associated with detector properties and the readout system. Pieces of Al2O3:C films (~8 mm  ×  8 mm  ×  125 µm) were irradiated and used to simulate dose distributions with extreme dose gradients (zero and non-zero dose regions). The OSLD film pieces were scanned using a custom-built laser-scanning OSL reader and the data obtained were used to develop and demonstrate a dose reconstruction algorithm. The algorithm includes corrections for: (a) galvo hysteresis, (b) photomultiplier tube (PMT) linearity, (c) phosphorescence, (d) 'pixel bleeding' caused by the 35 ms luminescence lifetime of F-centers in Al2O3, (e) geometrical distortion inherent to Galvo scanning system, and (f) position dependence of the light collection efficiency. The algorithm was also applied to 6.0 cm  ×  6.0 cm  ×  125 μm or 10.0 cm  ×  10.0 cm  ×  125 µm Al2O3:C and Al2O3:C,Mg films exposed to megavoltage x-rays (6 MV) and (12)C beams (430 MeV u(-1)). The results obtained using pieces of irradiated films show the ability of the image reconstruction algorithm to correct for pixel bleeding even in the presence of extremely sharp dose gradients. Corrections for geometric distortion and position dependence of light collection efficiency were shown to minimize characteristic limitations of this system design. We also exemplify the application of the algorithm to more clinically relevant 6 MV x-ray beam and a (12)C pencil beam, demonstrating the potential for small field dosimetry. The image reconstruction algorithm described here provides the foundation for laser-scanned OSL applied to 2D dosimetry.

  10. Characterization of a chemostable serine alkaline protease from Periplaneta americana

    PubMed Central

    2013-01-01

    Background Proteases are important enzymes involved in numerous essential physiological processes and hold a strong potential for industrial applications. The proteolytic activity of insects’ gut is endowed by many isoforms with diverse properties and specificities. Thus, insect proteases can act as a tool in industrial processes. Results In the present study, purification and properties of a serine alkaline protease from Periplaneta americana and its potential application as an additive in various bio-formulations are reported. The enzyme was purified near to homogeneity by using acetone precipitation and Sephadex G-100 gel filtration chromatography. Enzyme activity was increased up to 4.2 fold after gel filtration chromatography. The purified enzyme appeared as single protein-band with a molecular mass of ~ 27.8 kDa in SDS-PAGE. The optimum pH and temperature for the proteolytic activity for purified protein were found around pH 8.0 and 60°C respectively. Complete inhibition of the purified enzyme by phenylmethylsulfonyl fluoride confirmed that the protease was of serine-type. The purified enzyme revealed high stability and compatibility towards detergents, oxidizing, reducing, and bleaching agents. In addition, enzyme also showed stability towards organic solvents and commercial detergents. Conclusion Several important properties of a serine protease from P. Americana were revealed. Moreover, insects can serve as excellent and alternative source of industrially important proteases with unique properties, which can be utilized as additives in detergents, stain removers and other bio-formulations. Properties of the P. americana protease accounted in the present investigation can be exploited further in various industrial processes. As an industrial prospective, identification of enzymes with varying essential properties from different insect species might be good approach and bioresource. PMID:24229392

  11. Kinetics of alkaline protease production by Streptomyces griseoflavus PTCC1130

    PubMed Central

    Hosseini, Seyed Vesal; Saffari, Zahra; Farhanghi, Ali; Atyabi, Seyed Mohammad; Norouzian, Dariush

    2016-01-01

    Background and Objectives: Proteases are a group of enzymes that catalyze the degradation of proteins resulting in the production of their amino acid constituents. They are the most important group of industrial enzymes which account for about 60% of total enzymes in the market and produced mainly by microorganisms. The attempts were made to study the kinetic parameters of protease produced by Streptomyces griseoflavus PTCC1130. Materials and Methods: Streptomyces griseoflavus PTCC1130 was grown on casein agar. Different media such as BM1, BM2, BM3 and BM4 were prepared. Data obtained from growth and protease production were subjected to kinetics evaluation. Casein was used as substrate for protease activity and the released soluble peptide bearing aromatic amino acid were quantified by Folin Cioclateaue reagent. Protein content of the enzyme and the sugar utilized by the organism were estimated by Bradford and Miller’s methods respectively. Results: Basal Medium named as BM1, BM2, BM3 and BM4(50 mL in 250 mL Erlen Meyer flasks) were screened out to evaluate protease production by Streptomyces griseoflavus PTCC1130. They were inoculated with known amount of seed culture and kept on rotary shaker. To obtain the specific growth rate, wet weight of biomass was plotted against the time. The clarified supernatant was used for the analysis of protease by measuring the soluble peptide containing aromatic amino acid residues employing Folin Cioclateaue reagent. Our results showed that maximum level of enzyme production (14035 U/L) was occurred at late exponential phase using Basal Medium supplemented with zinc sulfate (0.5g/L), casein (10g/L) at pH 6.5. Conclusions: A kinetic study of protease production by Streptomyces griseoflavus PTCC1130 provided highly quantitative information regarding the behavior of a system, which is essential to study the fermentation process. Exploitation of such kinetics analysis would be useful in commercialization of microbial enzyme

  12. Protease increases fermentation rate and ethanol yield in dry-grind ethanol production.

    PubMed

    Johnston, David B; McAloon, Andrew J

    2014-02-01

    The effects of acid protease and urea addition during the fermentation step were evaluated. The fermentations were also tested with and without the addition of urea to determine if protease altered the nitrogen requirements of the yeast. Results show that the addition of the protease had a statistically significant effect on the fermentation rate and yield. Fermentation rates and yields were improved with the addition of the protease over the corresponding controls without protease. Protease addition either with or with added urea resulted in a higher final ethanol yield than without the protease addition. Urea addition levels >1200 ppm of supplemental nitrogen inhibited ethanol production. The economic effects of the protease addition were evaluated by using process engineering and economic models developed at the Eastern Regional Research Center. The decrease in overall processing costs from protease addition was as high as $0.01/L (4 ¢/gal) of denatured ethanol produced.

  13. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.

    PubMed

    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R

    2013-01-01

    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  14. The structure of a universally employed enzyme: V8 protease from Staphylococcus aureus

    SciTech Connect

    Prasad, Lata; Leduc, Yvonne; Hayakawa, Koto; Delbaere, Louis T.J.

    2008-06-27

    V8 protease, an extracellular protease of Staphylococcus aureus, is related to the pancreatic serine proteases. The enzyme cleaves peptide bonds exclusively on the carbonyl side of aspartate and glutamate residues. Unlike the pancreatic serine proteases, V8 protease possesses no disulfide bridges. This is a major evolutionary difference, as all pancreatic proteases have at least two disulfide bridges. The structure of V8 protease shows structural similarity with several other serine proteases, specifically the epidermolytic toxins A and B from S. aureus and trypsin, in which the conformation of the active site is almost identical. V8 protease is also unique in that the positively charged N-terminus is involved in determining the substrate-specificity of the enzyme.

  15. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases.

    PubMed

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang; Chen, Xiu-Lan

    2015-09-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed.

  16. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases

    PubMed Central

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang

    2015-01-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed. PMID:26150451

  17. HIV-1 protease-induced apoptosis

    PubMed Central

    2014-01-01

    Background Apoptosis is one of the presumptive causes of CD4+ T cell depletion during HIV infection and progression to AIDS. However, the precise role of HIV-1 in this process remains unexplained. HIV-1 protease (PR) has been suggested as a possible factor, but a direct link between HIV-1 PR enzymatic activity and apoptosis has not been established. Results Here, we show that expression of active HIV-1 PR induces death in HeLa and HEK-293 cells via the mitochondrial apoptotic pathway. This conclusion is based on in vivo observations of the direct localization of HIV-1 PR in mitochondria, a key player in triggering apoptosis. Moreover, we observed an HIV-1 PR concentration-dependent decrease in mitochondrial membrane potential and the role of HIV-1 PR in activation of caspase 9, PARP cleavage and DNA fragmentation. In addition, in vitro data demonstrated that HIV-1 PR mediates cleavage of mitochondrial proteins Tom22, VDAC and ANT, leading to release of AIF and Hsp60 proteins. By using yeast two-hybrid screening, we also identified a new HIV-1 PR interaction partner, breast carcinoma-associated protein 3 (BCA3). We found that BCA3 accelerates p53 transcriptional activity on the bax promoter, thus elevating the cellular level of pro-apoptotic Bax protein. Conclusion In summary, our results describe the involvement of HIV-1 PR in apoptosis, which is caused either by a direct effect of HIV-1 PR on mitochondrial membrane integrity or by its interaction with cellular protein BCA3. PMID:24886575

  18. Mutations of 3c and spike protein genes correlate with the occurrence of feline infectious peritonitis.

    PubMed

    Bank-Wolf, Barbara Regina; Stallkamp, Iris; Wiese, Svenja; Moritz, Andreas; Tekes, Gergely; Thiel, Heinz-Jürgen

    2014-10-10

    The genes encoding accessory proteins 3a, 3b, 3c, 7a and 7b, the S2 domain of the spike (S) protein gene and the membrane (M) protein gene of feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV) samples were amplified, cloned and sequenced. For this faeces and/or ascites samples from 19 cats suffering from feline infectious peritonitis (FIP) as well as from 20 FECV-infected healthy cats were used. Sequence comparisons revealed that 3c genes of animals with FIP were heavily affected by nucleotide deletions and point mutations compared to animals infected with FECV; these alterations resulted either in early termination or destruction of the translation initiation codon. Two ascites-derived samples of cats with FIP which displayed no alterations of ORF3c harboured mutations in the S2 domain of the S protein gene which resulted in amino acid exchanges or deletions. Moreover, changes in 3c were often accompanied by mutations in S2. In contrast, in samples obtained from faeces of healthy cats, the ORF3c was never affected by such mutations. Similarly ORF3c from faecal samples of the cats with FIP was mostly intact and showed only in a few cases the same mutations found in the respective ascites samples. The genes encoding 3a, 3b, 7a and 7b displayed no mutations linked to the feline coronavirus (FCoV) biotype. The M protein gene was found to be conserved between FECV and FIPV samples. Our findings suggest that mutations of 3c and spike protein genes correlate with the occurrence of FIP.

  19. Antifungal effects of synthetic human β-defensin 3-C15 peptide

    PubMed Central

    Ahn, Ki-Bum; Kim, Christine; Kum, Jong-Won; Gu, Yu; Han, Seung Hyun; Shon, Won-Jun; Lee, Woocheol; Zhu, Qiang

    2016-01-01

    Objectives The purpose of this ex vivo study was to compare the antifungal activity of a synthetic peptide consisting of 15 amino acids at the C-terminus of human β-defensin 3 (HBD3-C15) with calcium hydroxide (CH) and Nystatin (Nys) against Candida albicans (C. albicans) biofilm. Materials and Methods C. albicans were grown on cover glass bottom dishes or human dentin disks for 48 hr, and then treated with HBD3-C15 (0, 12.5, 25, 50, 100, 150, 200, and 300 µg/mL), CH (100 µg/mL), and Nys (20 µg/mL) for 7 days at 37℃. On cover glass, live and dead cells in the biomass were measured by the FilmTracer Biofilm viability assay, and observed by confocal laser scanning microscopy (CLSM). On dentin, normal, diminished and ruptured cells were observed by field-emission scanning electron microscopy (FE-SEM). The results were subjected to a two-tailed t-test, a one way analysis variance and a post hoc test at a significance level of p = 0.05. Results C. albicans survival on dentin was inhibited by HBD3-C15 in a dose-dependent manner. There were fewer aggregations of C. albicans in the groups of Nys and HBD3-C15 (≥ 100 µg/mL). CLSM showed C. albicans survival was reduced by HBD3-C15 in a dose dependent manner. Nys and HBD3-C15 (≥ 100 µg/mL) showed significant fungicidal activity compared to CH group (p < 0.05). Conclusions Synthetic HBD3-C15 peptide (≥ 100 µg/mL) and Nys exhibited significantly higher antifungal activity than CH against C. albicans by inhibiting cell survival and biofilm. PMID:27200276

  20. Protease inhibitor from Moringa oleifera with potential for use as therapeutic drug and as seafood preservative

    PubMed Central

    Bijina, B.; Chellappan, Sreeja; Krishna, Jissa G.; Basheer, Soorej M.; Elyas, K.K.; Bahkali, Ali H.; Chandrasekaran, M.

    2011-01-01

    Protease inhibitors are well known to have several applications in medicine and biotechnology. Several plant sources are known to return potential protease inhibitors. In this study plants belonging to different families of Leguminosae, Malvaceae, Rutaceae, Graminae and Moringaceae were screened for the protease inhibitor. Among them Moringa oleifera, belonging to the family Moringaceae, recorded high level of protease inhibitor activity after ammonium sulfate fractionation. M. oleifera, which grows throughout most of the tropics and having several industrial and medicinal uses, was selected as a source of protease inhibitor since so far no reports were made on isolation of the protease inhibitor. Among the different parts of M. oleifera tested, the crude extract isolated from the mature leaves and seeds showed the highest level of inhibition against trypsin. Among the various extraction media evaluated, the crude extract prepared in phosphate buffer showed maximum recovery of the protease inhibitor. The protease inhibitor recorded high inhibitory activity toward the serine proteases thrombin, elastase, chymotrypsin and the cysteine proteases cathepsin B and papain which have more importance in pharmaceutical industry. The protease inhibitor also showed complete inhibition of activities of the commercially available proteases of Bacillus licheniformis and Aspergillus oryzae. However, inhibitory activities toward subtilisin, esperase, pronase E and proteinase K were negligible. Further, it was found that the protease inhibitor could prevent proteolysis in a commercially valuable shrimp Penaeus monodon during storage indicating the scope for its application as a seafood preservative. This is the first report on isolation of a protease inhibitor from M. oleifera. PMID:23961135

  1. A Serine Protease Isolated from the Bristles of the Amazonic Caterpillar, Premolis semirufa, Is a Potent Complement System Activator

    PubMed Central

    Villas Boas, Isadora Maria; Pidde-Queiroz, Giselle; Magnoli, Fabio Carlos; Gonçalves-de-Andrade, Rute M.; van den Berg, Carmen W.; Tambourgi, Denise V.

    2015-01-01

    Background The caterpillar of the moth Premolis semirufa, commonly named pararama, is found in the Brazilian Amazon region. Accidental contact with the caterpillar bristles causes an intense itching sensation, followed by symptoms of an acute inflammation, which last for three to seven days after the first incident. After multiple accidents a chronic inflammatory reaction, called “Pararamose”, characterized by articular synovial membrane thickening with joint deformities common to chronic synovitis, frequently occurs. Although complement mediated inflammation may aid the host defense, inappropriate or excessive activation of the complement system and generation of anaphylatoxins can lead to inflammatory disorder and pathologies. The aim of the present study was to evaluate, in vitro, whether the Premolis semirufa’s bristles extract could interfere with the human complement system. Results The bristles extract was able to inhibit the haemolytic activity of the alternative pathway, as well as the activation of the lectin pathway, but had no effect on the classical pathway, and this inhibition seemed to be caused by activation and consumption of complement components. The extract induced the production of significant amounts of all three anaphylatoxins, C3a, C4a and C5a, promoted direct cleavage of C3, C4 and C5 and induced a significant generation of terminal complement complexes in normal human serum. By using molecular exclusion chromatography, a serine protease of 82 kDa, which activates complement, was isolated from P. semirufa bristles extract. The protease, named here as Ps82, reduced the haemolytic activity of the alternative and classical pathways and inhibited the lectin pathway. In addition, Ps82 induced the cleavage of C3, C4 and C5 and the generation of C3a and C4a in normal human serum and it was capable to cleave human purified C5 and generate C5a. The use of Phenanthroline, metalloprotease inhibitor, in the reactions did not significantly

  2. Comparative analysis of complete genome sequences of three avian coronaviruses reveals a novel group 3c coronavirus.

    PubMed

    Woo, Patrick C Y; Lau, Susanna K P; Lam, Carol S F; Lai, Kenneth K Y; Huang, Yi; Lee, Paul; Luk, Geraldine S M; Dyrting, Kitman C; Chan, Kwok-Hung; Yuen, Kwok-Yung

    2009-01-01

    In this territory-wide molecular epidemiology study of coronaviruses (CoVs) in Hong Kong involving 1,541 dead wild birds, three novel CoVs were identified in three different bird families (bulbul CoV HKU11 [BuCoV HKU11], thrush CoV HKU12 [ThCoV HKU12], and munia CoV HKU13 [MuCoV HKU13]). Four complete genomes of the three novel CoVs were sequenced. Their genomes (26,396 to 26,552 bases) represent the smallest known CoV genomes. In phylogenetic trees constructed using chymotrypsin-like protease (3CL(pro)), RNA-dependent RNA polymerase (Pol), helicase, spike, and nucleocapsid proteins, BuCoV HKU11, ThCoV HKU12, and MuCoV HKU13 formed a cluster distantly related to infectious bronchitis virus and turkey CoV (group 3a CoVs). For helicase, spike, and nucleocapsid, they were also clustered with a CoV recently discovered in Asian leopard cats, for which the complete genome sequence was not available. The 3CL(pro), Pol, helicase, and nucleocapsid of the three CoVs possessed higher amino acid identities to those of group 3a CoVs than to those of group 1 and group 2 CoVs. Unique genomic features distinguishing them from other group 3 CoVs include a distinct transcription regulatory sequence and coding potential for small open reading frames. Based on these results, we propose a novel CoV subgroup, group 3c, to describe this distinct subgroup of CoVs under the group 3 CoVs. Avian CoVs are genetically more diverse than previously thought and may be closely related to some newly identified mammalian CoVs. Further studies would be important to delineate whether the Asian leopard cat CoV was a result of interspecies jumping from birds, a situation analogous to that of bat and civet severe acute respiratory syndrome CoVs.

  3. Antiviral Activity of Chrysin Derivatives against Coxsackievirus B3 in vitro and in vivo

    PubMed Central

    Song, Jae-Hyoung; Kwon, Bo-Eun; Jang, Hongjun; Kang, Hyunju; Cho, Sungchan; Park, Kwisung; Ko, Hyun-Jeong; Kim, Hyoungsu

    2015-01-01

    Chrysin is a 5,7-dihydroxyflavone and was recently shown to potently inhibit enterovirus 71 (EV71) by suppressing viral 3C protease (3Cpro) activity. In the current study, we investigated whether chrysin also shows antiviral activity against coxsackievirus B3 (CVB3), which belongs to the same genus (Enterovirus) as EV71, and assessed its ability to prevent the resulting acute pancreatitis and myocarditis. We found that chrysin showed antiviral activity against CVB3 at 10 μM, but exhibited mild cellular cytotoxicity at 50 μM, prompting us to synthesize derivatives of chrysin to increase the antiviral activity and reduce its cytotoxicity. Among four 4-substituted benzyl derivatives derived from C(5) benzyl-protected derivatives 7, 9–11 had significant antiviral activity and showed the most potent activity against CVB3 with low cytotoxicity in Vero cells. Intraperitoneal injection of CVB3 in BALB/c mice with 1×106 TCID50 (50% tissue culture infective dose) of CVB3 induced acute pancreatitis with ablation of acinar cells and increased serum CXCL1 levels, whereas the daily administration of 9 for 5 days significantly alleviated the pancreatic inflammation and reduced the elevation in serum CXCL1 levels. Collectively, we assessed the anti-CVB3 activities of chrysin and its derivatives, and found that among 4-substituted benzyl derivatives, 9 exhibited the highest activity against CVB3 in vivo, and protected mice from CVB3-induced pancreatic damage, simultaneously lowering serum CXCL1 levels. PMID:26336587

  4. EBNA3C regulates p53 through induction of Aurora kinase B.

    PubMed

    Jha, Hem C; Yang, Karren; El-Naccache, Darine W; Sun, Zhiguo; Robertson, Erle S

    2015-03-20

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation.

  5. Capacitance of Ti3C2Tx MXene in ionic liquid electrolyte

    NASA Astrophysics Data System (ADS)

    Lin, Zifeng; Barbara, Daffos; Taberna, Pierre-Louis; Van Aken, Katherine L.; Anasori, Babak; Gogotsi, Yury; Simon, Patrice

    2016-09-01

    Ti3C2Tx MXene, a two-dimensional (2D) early transition metal carbide, has shown an extremely high volumetric capacitance in aqueous electrolytes, but in a narrow voltage window (less than 1.23 V). The utilization of MXene materials in ionic liquid electrolytes with a large voltage window has never been addressed. Here, we report the preparation of the Ti3C2Tx MXene ionogel film by vacuum filtration for use as supercapacitor electrodes operating in 1-Ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (EMI-TFSI) neat ionic liquid electrolyte. Due to the disordered structure of the Ti3C2Tx hydrogel film and a stable spacing after vacuum drying, achieved through ionic liquid electrolyte immersion of the Ti3C2Tx hydrogel film, the Ti3C2Tx surface became accessible to EMI+ and TFSI- ions. A capacitance of 70 F g-1 together with a large voltage window of 3 V was obtained at a scan rate of 20 mV s-1 in neat EMI-TFSI electrolyte. The electrochemical signature indicates a capacitive behavior even at a high scan rate (500 mV s-1) and a high power performance. This work opens up the possibilities of using MXene materials with various ionic liquid electrolytes.

  6. A Single Nucleotide Polymorphism in Human APOBEC3C Enhances Restriction of Lentiviruses

    PubMed Central

    Wittkopp, Cristina J.; Adolph, Madison B.; Wu, Lily I.; Chelico, Linda; Emerman, Michael

    2016-01-01

    Humans express seven human APOBEC3 proteins, which can inhibit viruses and endogenous retroelements through cytidine deaminase activity. The seven paralogs differ in the potency of their antiviral effects, as well as in their antiviral targets. One APOBEC3, APOBEC3C, is exceptional as it has been found to only weakly block viruses and endogenous retroelements compared to other APOBEC3s. However, our positive selection analyses suggest that APOBEC3C has played a role in pathogen defense during primate evolution. Here, we describe a single nucleotide polymorphism in human APOBEC3C, a change from serine to isoleucine at position 188 (I188) that confers potent antiviral activity against HIV-1. The gain-of-function APOBEC3C SNP results in increased enzymatic activity and hypermutation of target sequences when tested in vitro, and correlates with increased dimerization of the protein. The I188 is widely distributed in human African populations, and is the ancestral primate allele, but is not found in chimpanzees or gorillas. Thus, while other hominids have lost activity of this antiviral gene, it has been maintained, or re-acquired, as a more active antiviral gene in a subset of humans. Taken together, our results suggest that APOBEC3C is in fact involved in protecting hosts from lentiviruses. PMID:27732658

  7. Capacitance of Ti3C2Tx MXene in Ionic Liquid Electrolyte

    DOE PAGES

    Lin, Zifeng; Barbara, Daffos; Taberna, Pierre-Louis; ...

    2016-04-14

    Ti3C2Tx MXene, a two-dimensional (2D) early transition metal carbide, has shown an extremely high volumetric capacitance in aqueous electrolytes, but in a narrow voltage window (less than 1.23 V). The utilization of MXene materials in ionic liquid electrolytes with a large voltage window has never been addressed. Here, we report the preparation of the Ti3C2Tx MXene ionogel film by vacuum filtration for use as supercapacitor electrodes operating in 1-Ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (EMI-TFSI) neat ionic liquid electrolyte. Due to the disordered structure of the Ti3C2Tx hydrogel film and a stable spacing after vacuum drying, achieved through ionic liquid electrolyte immersion of themore » Ti3C2Tx hydrogel film, the Ti3C2Tx surface became accessible to EMI+ and TFSI- ions. A capacitance of 70 F g-1 together with a large voltage window of 3 V was obtained at a scan rate of 20 mV s-1 in neat EMI-TFSI electrolyte. The electrochemical signature indicates a capacitive behavior even at a high scan rate (500 mV s-1) and a high power performance. This work opens up the possibilities of using MXene materials with various ionic liquid electrolytes.« less

  8. Metagenomic chromosome conformation capture (meta3C) unveils the diversity of chromosome organization in microorganisms

    PubMed Central

    Marbouty, Martial; Cournac, Axel; Flot, Jean-François; Marie-Nelly, Hervé; Mozziconacci, Julien; Koszul, Romain

    2014-01-01

    Genomic analyses of microbial populations in their natural environment remain limited by the difficulty to assemble full genomes of individual species. Consequently, the chromosome organization of microorganisms has been investigated in a few model species, but the extent to which the features described can be generalized to other taxa remains unknown. Using controlled mixes of bacterial and yeast species, we developed meta3C, a metagenomic chromosome conformation capture approach that allows characterizing individual genomes and their average organization within a mix of organisms. Not only can meta3C be applied to species already sequenced, but a single meta3C library can be used for assembling, scaffolding and characterizing the tridimensional organization of unknown genomes. By applying meta3C to a semi-complex environmental sample, we confirmed its promising potential. Overall, this first meta3C study highlights the remarkable diversity of microorganisms chromosome organization, while providing an elegant and integrated approach to metagenomic analysis. DOI: http://dx.doi.org/10.7554/eLife.03318.001 PMID:25517076

  9. Path-integral molecular dynamics simulation of 3C-SiC

    NASA Astrophysics Data System (ADS)

    Ramírez, Rafael; Herrero, Carlos P.; Hernández, Eduardo R.; Cardona, Manuel

    2008-01-01

    Molecular dynamics simulations of 3C-SiC have been performed as a function of pressure and temperature. These simulations treat both electrons and atomic nuclei by quantum mechanical methods. While the electronic structure of the solid is described by an efficient tight-binding Hamiltonian, the nuclei dynamics is treated by the path-integral formulation of statistical mechanics. To assess the relevance of nuclear quantum effects, the results of quantum simulations are compared to others where either the Si nuclei, the C nuclei, or both atomic nuclei are treated as classical particles. We find that the experimental thermal expansion of 3C-SiC is realistically reproduced by our simulations. The calculated bulk modulus of 3C-SiC and its pressure derivative at room temperature show also good agreement with the available experimental data. The effect of the electron-phonon interaction on the direct electronic gap of 3C-SiC has been calculated as a function of temperature and related to results obtained for bulk diamond and Si. Comparison to available experimental data shows satisfactory agreement, although we observe that the employed tight-binding model tends to overestimate the magnitude of the electron-phonon interaction. The effect of treating the atomic nuclei as classical particles on the direct gap of 3C-SiC has been assessed. We find that nonlinear quantum effects related to the atomic masses are particularly relevant at temperatures below 250K .

  10. Alkaline protease from Thermoactinomyces sp. RS1 mitigates industrial pollution.

    PubMed

    Verma, Amit; Ansari, Mohammad W; Anwar, Mohmmad S; Agrawal, Ruchi; Agrawal, Sanjeev

    2014-05-01

    Proteases have found a wide application in the several industrial processes, such as laundry detergents, protein recovery or solubilization, prion degradation, meat tenderizations, and in bating of hides and skins in leather industries. But the main hurdle in industrial application of proteases is their economical production on a large scale. The present investigation aimed to exploit the locally available inexpensive agricultural and household wastes for alkaline protease production using Thermoactinomyces sp. RS1 via solid-state fermentation (SSF) technique. The alkaline enzyme is potentially useful as an additive in commercial detergents to mitigate pollution load due to extensive use of caustic soda-based detergents. Thermoactinomyces sp. RS1 showed good protease production under SSF conditions of 55 °C, pH 9, and 50 % moisture content with potato peels as solid substrate. The presented findings revealed that crude alkaline protease produced by Thermoactinomyces sp. RS1 via SSF is of potential application in silver recovery from used X-ray films.

  11. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  12. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-01-01

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  13. Mitochondrial cereblon functions as a Lon-type protease.

    PubMed

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-07-15

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  14. Hydrophobic Core Flexibility Modulates Enzyme Activity in HIV-1 Protease

    SciTech Connect

    Mittal, Seema; Cai, Yufeng; Nalam, Madhavi N.L.; Bolon, Daniel N.A.; Schiffer, Celia A.

    2012-09-11

    Human immunodeficiency virus Type-1 (HIV-1) protease is crucial for viral maturation and infectivity. Studies of protease dynamics suggest that the rearrangement of the hydrophobic core is essential for enzyme activity. Many mutations in the hydrophobic core are also associated with drug resistance and may modulate the core flexibility. To test the role of flexibility in protease activity, pairs of cysteines were introduced at the interfaces of flexible regions remote from the active site. Disulfide bond formation was confirmed by crystal structures and by alkylation of free cysteines and mass spectrometry. Oxidized and reduced crystal structures of these variants show the overall structure of the protease is retained. However, cross-linking the cysteines led to drastic loss in enzyme activity, which was regained upon reducing the disulfide cross-links. Molecular dynamics simulations showed that altered dynamics propagated throughout the enzyme from the engineered disulfide. Thus, altered flexibility within the hydrophobic core can modulate HIV-1 protease activity, supporting the hypothesis that drug resistant mutations distal from the active site can alter the balance between substrate turnover and inhibitor binding by modulating enzyme activity.

  15. Plant proteases for bioactive peptides release: A review.

    PubMed

    Mazorra-Manzano, M A; Ramírez-Suarez, J C; Yada, R Y

    2017-04-10

    Proteins are a potential source of health promoting biomolecules with medical, nutraceutical and food applications. Nowadays, bioactive peptides production, its isolation, characterization and strategies for its delivery to target sites are a matter of intensive research. In vitro and in vivo studies regarding the bioactivity of peptides has generated strong evidence of their health benefits. Dairy proteins are considered the richest source of bioactive peptides, however proteins from animal and vegetable origin also have been shown to be important sources. Enzymatic hydrolysis has been the process most commonly used for bioactive peptide production. Most commercial enzymatic preparations frequently used are from animal (e.g., trypsin and pepsin) and microbial (e.g., Alcalase® and Neutrase®) sources. Although the use of plant proteases is still relatively limited to papain and bromelain from papaya and pineapple, respectively, the application of new plant proteases is increasing. This review presents the latest knowledge in the use and diversity of plant proteases for bioactive peptides release from food-proteins including both available commercial plant proteases as well as new potential plant sources. Furthermore, the properties of peptides released by plant proteases and health benefits associated in the control of disorders such as hypertension, diabetes, obesity, and cancer are reviewed.

  16. Non-proteolytic functions of microbial proteases increase pathological complexity.

    PubMed

    Jarocki, Veronica M; Tacchi, Jessica L; Djordjevic, Steven P

    2015-03-01

    Proteases are enzymes that catalyse hydrolysis of peptide bonds thereby controlling the shape, size, function, composition, turnover and degradation of other proteins. In microbes, proteases are often identified as important virulence factors and as such have been targets for novel drug design. It is emerging that some proteases possess additional non-proteolytic functions that play important roles in host epithelia adhesion, tissue invasion and in modulating immune responses. These additional "moonlighting" functions have the potential to obfuscate data interpretation and have implications for therapeutic design. Moonlighting enzymes comprise a subcategory of multifunctional proteins that possess at least two distinct biological functions on a single polypeptide chain. Presently, identifying moonlighting proteins relies heavily on serendipitous empirical data with clues arising from proteins lacking signal peptides that are localised to the cell surface. Here, we describe examples of microbial proteases with additional non-proteolytic functions, including streptococcal pyrogenic exotoxin B, PepO and C5a peptidases, mycoplasmal aminopeptidases, mycobacterial chaperones and viral papain-like proteases. We explore how these non-proteolytic functions contribute to host cell adhesion, modulate the coagulation pathway, assist in non-covalent folding of proteins, participate in cell signalling, and increase substrate repertoire. We conclude by describing how proteomics has aided in moonlighting protein discovery, focusing attention on potential moonlighters in microbial exoproteomes.

  17. Microbial aspartic proteases: current and potential applications in industry.

    PubMed

    Theron, Louwrens W; Divol, Benoit

    2014-11-01

    Aspartic proteases are a relatively small group of proteolytic enzymes that are active in acidic environments and are found across all forms of life. Certain microorganisms secrete such proteases as virulence agents and/or in order to break down proteins thereby liberating assimilable sources of nitrogen. Some of the earlier applications of these proteolytic enzymes are found in the manufacturing of cheese where they are used as milk-clotting agents. Over the last decade, they have received tremendous research interest because of their involvement in human diseases. Furthermore, there has also been a growing interest on these enzymes for their applications in several other industries. Recent research suggests in particular that they could be used in the wine industry to prevent the formation of protein haze while preserving the wines' organoleptic properties. In this mini-review, the properties and mechanisms of action of aspartic proteases are summarized. Thereafter, a brief overview of the industrial applications of this specific class of proteases is provided. The use of aspartic proteases as alternatives to clarifying agents in various beverage industries is mentioned, and the potential applications in the wine industry are thoroughly discussed.

  18. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.

    PubMed

    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2009-10-01

    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  19. Anti-enterovirus 71 effects of chrysin and its phosphate ester.

    PubMed

    Wang, Jianmin; Zhang, Ting; Du, Jiang; Cui, Sheng; Yang, Fan; Jin, Qi

    2014-01-01

    Enterovirus 71 (EV71) can cause severe disease and even lead to death in children, and an effective antiviral drug is currently unavailable. The anti-EV71 effect of chrysin (5,7-dihydroxyflavone), a natural flavonoid commonly found in many plants, was tested in this report. By using the predicting program Autodock 4.0 and an in vitro protease inhibition assay, we found that chrysin could suppress viral 3Cpro activity. Replication of viral RNA and production of viral capsid protein and the infectious virion were strongly inhibited by chrysin, without noticeable cytotoxicity. Cytopathic effects on cells were also prevented. Diisopropyl chrysin-7-yl phosphate (CPI), the phosphate ester for chrysin, was generated through a simplified Atheron-Todd reaction to achieve stronger anti-viral activity. CPI was also able to bind with and inhibit viral 3Cpro activity in vitro. As expected, CPI demonstrated more potent antiviral activity against EV71.

  20. Anti-Enterovirus 71 Effects of Chrysin and Its Phosphate Ester

    PubMed Central

    Du, Jiang; Cui, Sheng; Yang, Fan; Jin, Qi

    2014-01-01

    Enterovirus 71 (EV71) can cause severe disease and even lead to death in children, and an effective antiviral drug is currently unavailable. The anti-EV71 effect of chrysin (5,7-dihydroxyflavone), a natural flavonoid commonly found in many plants, was tested in this report. By using the predicting program Autodock 4.0 and an in vitro protease inhibition assay, we found that chrysin could suppress viral 3Cpro activity. Replication of viral RNA and production of viral capsid protein and the infectious virion were strongly inhibited by chrysin, without noticeable cytotoxicity. Cytopathic effects on cells were also prevented. Diisopropyl chrysin-7-yl phosphate (CPI), the phosphate ester for chrysin, was generated through a simplified Atheron-Todd reaction to achieve stronger anti-viral activity. CPI was also able to bind with and inhibit viral 3Cpro activity in vitro. As expected, CPI demonstrated more potent antiviral activity against EV71. PMID:24598537

  1. Characterization of chirally-coupled-core (3C) fibers fabricated with direct nanoparticle deposition (DND)

    NASA Astrophysics Data System (ADS)

    Ye, Changgeng; Koponen, Joona; Kimmelma, Ossi; Aallos, Ville; McComb, Timothy S.; Lowder, Tyson L.

    2016-03-01

    We report detailed characterization results of Yb-doped Chirally-Coupled-Core (3C) fibers fabricated with Direct Nanoparticle Deposition (DND) technique. Two types of 3C fibers with core/clad geometries of 34/250μm and 55/400μm and another 25/250μm conventional large-mode-area (LMA) fiber are measured and the results are compared in terms of modal content, transmission spectrum, etc. A picosecond fiber amplifier is built based on 55/400μm 3C fiber, showing robust single-mode operation with peak power >1MW with no sign of stimulated Raman scattering (SRS).

  2. Ab initio study of optical and vibrational properties of Ni3C

    NASA Astrophysics Data System (ADS)

    Golivand, Mohammad Bagher; Boochani, Arash; Akhtar, Arsalan; Torkashvand, Maryam; Karimian, Nashmyl

    2017-01-01

    The structural, electronic, optical and vibrational properties of Ni3C have been studied by density functional theory (DFT) framework with first-principles study. The obtained structural parameters are in good agreement with other works. The electronic study demonstrates metallic behavior of Ni3C since it has no energy gap at Fermi level. The optical parameters such as real and imaginary dielectric functions, loss function, conductivity, reflection, refraction indexes and absorption coefficients are studied. The phonon investigations confirm that the Ni3C bulk is dynamically stable and carbon has a major role in optical spectrum of the material at infrared region. Finally, the T3 behavior of Cv at low temperatures is obtained, as expected.

  3. Superconductivity at 28 K in CaB3C3 predicted from first-principles

    NASA Astrophysics Data System (ADS)

    Chen, Wanjin

    2013-11-01

    The structural parameters, electronic properties, and superconducting state in the graphite-like BxC1-x intercalation compound, CaB3C3, have been studied using pseudopotential density functional theory within the generalized gradient approximation. Electronic and electron-phonon coupling calculations reveal that CaB3C3 is hole conducting and superconducting with critical temperature 28.2 K, which is much higher than that of CaC6 (11.5 K). The excellent superconducting state in CaB3C3 stems from the simultaneous presence of highly mobile and extremely confined conduction electrons, which enhances electron pairing and superconductivity. The current calculations might stimulate further theoretical and experimental investigation in search of new superconducting states in graphite-like BxC1-x intercalated compounds.

  4. Spitzer and near-infrared observations of the young supernova remnant 3C397

    NASA Astrophysics Data System (ADS)

    Rho, Jeonghee; Jarrett, Tom

    2016-06-01

    We present Spitzer IRS, IRAC and MIPS observations and near-infrared imaging and spectroscopy of the young supernova remnant 3C397 (G41.1-0.2). Near-infrared observations were made using the Palomar 200 inch telescope. Both mid- and near-infrared spectra are dominated by Fe lines and near-infrared imaging shows bright Fe emission with a shell-like morphology. There is no molecular hydrogen line belong to the SNR and some are in background. The Ni, Ar, S and Si lines are detected using IRS and hydrogen recombination lines are detected in near-infrared. Two nickel lines at 18.24 and 10.69 micron are detected. 3C397 is ejecta-dominated, and our observations support 3C397 to be a Type Ia supernova.

  5. Continuous Proteolysis with a stabilized stabilized protease. I. Chemical stabilization of an alkaline protease.

    PubMed

    Boudrant, J; Cuq, J L; Cheftel, C

    1976-12-01

    Due to the loss of enzymatic activity as a function of time, an alkaline protease, selected for the continuous preparation of protein hydrolysates (J. Boudrant and C. Cheftel, Biotechnol. Bioeng., 18,1735, 1976), was chemically stabilized by a simple treatment with glutaraldehyde. Two fractions, soluble and insoluble, were obtained. The activities of these two fractions were measured with casein and N-benzoyl-L-arginine ethyl ester (BAEE) as a function of glutaraldehyde concentration used. It was noted that the insoluble fraction was practically inactive with the first substrate and that the heat stability of the soluble form was likewise enhanced. Molecular weights of these two forms were unchanged, but the uv-spectrum of the soluble form was modified. From amino acid analysis, it appears that this treatment mainly provokes a decrease in lysine content.

  6. Evidence for Reduced Drug Susceptibility without Emergence of Major Protease Mutations following Protease Inhibitor Monotherapy Failure in the SARA Trial

    PubMed Central

    Sutherland, Katherine A.; Parry, Chris M.; McCormick, Adele; Kapaata, Anne; Lyagoba, Fred; Kaleebu, Pontiano; Gilks, Charles F.; Goodall, Ruth; Spyer, Moira; Kityo, Cissy; Pillay, Deenan; Gupta, Ravindra K.

    2015-01-01

    Background Major protease mutations are rarely observed following failure with protease inhibitors (PI), and other viral determinants of failure to PI are poorly understood. We therefore characterized Gag-Protease phenotypic susceptibility in subtype A and D viruses circulating in East Africa following viral rebound on PIs. Methods Samples from baseline and treatment failure in patients enrolled in the second line LPV/r trial SARA underwent phenotypic susceptibility testing. Data were expressed as fold-change in susceptibility relative to a LPV-susceptible reference strain. Results We cloned 48 Gag-Protease containing sequences from seven individuals and performed drug resistance phenotyping from pre-PI and treatment failure timepoints in seven patients. For the six patients where major protease inhibitor resistance mutations did not emerge, mean fold-change EC50 to LPV was 4.07 fold (95% CI, 2.08–6.07) at the pre-PI timepoint. Following viral failure the mean fold-change in EC50 to LPV was 4.25 fold (95% CI, 1.39–7.11, p = 0.91). All viruses remained susceptible to DRV. In our assay system, the major PI resistance mutation I84V, which emerged in one individual, conferred a 10.5-fold reduction in LPV susceptibility. One of the six patients exhibited a significant reduction in susceptibility between pre-PI and failure timepoints (from 4.7 fold to 9.6 fold) in the absence of known major mutations in protease, but associated with changes in Gag: V7I, G49D, R69Q, A120D, Q127K, N375S and I462S. Phylogenetic analysis provided evidence of the emergence of genetically distinct viruses at the time of treatment failure, indicating ongoing viral evolution in Gag-protease under PI pressure. Conclusions Here we observe in one patient the development of significantly reduced susceptibility conferred by changes in Gag which may have contributed to treatment failure on a protease inhibitor containing regimen. Further phenotype-genotype studies are required to elucidate genetic

  7. Self-diffusion of molecular hydrogen in clathrasils compared: dodecasil 3C versus sodalite.

    PubMed

    van den Berg, A W C; Flikkema, E; Jansen, J C; Bromley, S T

    2005-05-22

    The self-diffusion coefficient of molecular hydrogen through the all-silica microporous dodecasil 3C structure is calculated by means of molecular-dynamics (MD) calculations, allowing for full framework flexibility, in order to assess the material's feasibility as a hydrogen storage medium. The hydrogen uptake rate into dodecasil 3C is compared to that previously calculated for sodalite and it is found that the latter performs significantly better. The reason for this variation in performance is found to lie in intrinsic topological differences between each framework type. This is explicitly demonstrated by means of a simplified version of transition state theory helping to succinctly rationalize the MD data.

  8. New Filling Technique and Performance Evaluations of the Cr3C2-C Peritectic Fixed Point

    NASA Astrophysics Data System (ADS)

    Sasajima, N.; Lowe, D.; Bai, C.; Yamada, Y.; Ara, C.

    2011-12-01

    The Cr3C2-C peritectic fixed point was investigated to test its capability to serve as a practical high-temperature fixed point. An improved filling technique where C/C sheet works as a wick and graphite paper as a hopper was applied successfully, and the long-term stability of the peritectic cell was evaluated by means of radiation thermometry. The repeatability of the melting point in one day was 7 mK with a melting range of approximately 100 mK. The cell was aged for 7 days, and the evaluated 56 melting temperatures during this period all fall within 90 mK, with a standard deviation of 19 mK. X-ray transmission photos showed that the ingot was filled uniformly in the crucible. After the evaluation of long-term stability, no clear degradation of the ingot shape and no leakage of molten metal were observed. From these results, it can be concluded that the Cr3C2-C peritectic cell has good stability and robustness, and the new filling technique was established. The impurity effect on the Cr3C2-C peritectic cell was also investigated by adding tungsten powder to another cell as the impurity component. After the observation of melting and freezing plateaux, the cell was cut in half to analyze the microstructure by means of electron probe microanalysis (EPMA) and laser ablation inductively coupled plasma mass spectrometer (LA-ICP-MS). The high concentration of impurity was observed in the area of the chromium-rich domain (eutectic mixture of Cr7C3 and Cr3C2), which suggests that impurities were rejected from the Cr3C2 peritectic phase during the peritectic freezing and were accumulated in the Cr7C3-Cr3C2 eutectic phase. This explains why the impurity effect is more severe for the Cr7C3-Cr3C2 eutectic point than for the Cr3C2-C peritectic point.

  9. Structure of Nanocrystalline Ti3C2 MXene Using Atomic Pair Distribution Function

    NASA Astrophysics Data System (ADS)

    Shi, Chenyang; Beidaghi, Majid; Naguib, Michael; Mashtalir, Olha; Gogotsi, Yury; Billinge, Simon J. L.

    2014-03-01

    The structures of nanocrystalline pristine, potassium hydroxide and sodium acetate intercalated new two-dimensional materials Ti3C2 MXenes were studied using the x-ray atomic pair distribution function technique. Pristine MXene has a hexagonal structure with a =b=3.0505(5) Å, c =19.86(2) Å (S.G. P63/mmc No. 194). Both hydroxyl and fluoride terminating species are present. The intercalation of K+ or Na+ ions expands the Ti3C2 layers perpendicular to the planes but shrinks the in-plane a and b lattice parameters.

  10. Structure of nanocrystalline Ti3C2 MXene using atomic pair distribution function.

    PubMed

    Shi, Chenyang; Beidaghi, Majid; Naguib, Michael; Mashtalir, Olha; Gogotsi, Yury; Billinge, Simon J L

    2014-03-28

    The structures of nanocrystalline pristine, potassium hydroxide and sodium acetate intercalated new two-dimensional materials Ti3C2 MXenes were studied using the x-ray atomic pair distribution function technique. Pristine MXene has a hexagonal structure with a=b=3.0505(5)  Å, c=19.86(2)  Å (S.G. P63/mmc No. 194). Both hydroxyl and fluoride terminating species are present. The intercalation of K+ or Na+ ions expands the Ti3C2 layers perpendicular to the planes but shrinks the in-plane a and b lattice parameters.

  11. Polymorphism control of superconductivity and magnetism in Cs(3)C(60) close to the Mott transition.

    PubMed

    Ganin, Alexey Y; Takabayashi, Yasuhiro; Jeglic, Peter; Arcon, Denis; Potocnik, Anton; Baker, Peter J; Ohishi, Yasuo; McDonald, Martin T; Tzirakis, Manolis D; McLennan, Alec; Darling, George R; Takata, Masaki; Rosseinsky, Matthew J; Prassides, Kosmas

    2010-07-08

    The crystal structure of a solid controls the interactions between the electronically active units and thus its electronic properties. In the high-temperature superconducting copper oxides, only one spatial arrangement of the electronically active Cu(2+) units-a two-dimensional square lattice-is available to study the competition between the cooperative electronic states of magnetic order and superconductivity. Crystals of the spherical molecular C(60)(3-) anion support both superconductivity and magnetism but can consist of fundamentally distinct three-dimensional arrangements of the anions. Superconductivity in the A(3)C(60) (A = alkali metal) fullerides has been exclusively associated with face-centred cubic (f.c.c.) packing of C(60)(3-) (refs 2, 3), but recently the most expanded (and thus having the highest superconducting transition temperature, T(c); ref. 4) composition Cs(3)C(60) has been isolated as a body-centred cubic (b.c.c.) packing, which supports both superconductivity and magnetic order. Here we isolate the f.c.c. polymorph of Cs(3)C(60) to show how the spatial arrangement of the electronically active units controls the competing superconducting and magnetic electronic ground states. Unlike all the other f.c.c. A(3)C(60) fullerides, f.c.c. Cs(3)C(60) is not a superconductor but a magnetic insulator at ambient pressure, and becomes superconducting under pressure. The magnetic ordering occurs at an order of magnitude lower temperature in the geometrically frustrated f.c.c. polymorph (Néel temperature T(N) = 2.2 K) than in the b.c.c.-based packing (T(N) = 46 K). The different lattice packings of C(60)(3-) change T(c) from 38 K in b.c.c. Cs(3)C(60) to 35 K in f.c.c. Cs(3)C(60) (the highest found in the f.c.c. A(3)C(60) family). The existence of two superconducting packings of the same electronically active unit reveals that T(c) scales universally in a structure-independent dome-like relationship with proximity to the Mott metal-insulator transition

  12. Synthesis of WC powder through microwave heating of WO3-C mixture

    NASA Astrophysics Data System (ADS)

    Behnami, Amir Karimzadeh; Hoseinpur, Arman; Sakaki, Masoud; Bafghi, Mohammad Sh.; Yanagisawa, Kazumichi

    2017-02-01

    A simple, easy, and low-cost process for the fabrication of tungsten carbide (WC) powder through microwave heating of WO3-C mixtures was developed. Thermodynamic calculations and experimental investigations were carried out for WO3-C and W-C systems, and a formation mechanism was proposed. In the results, for the synthesis of WC, the use of over stoichiometric amount of C together with a specially assembled experimental setup (which effectively retains heat in the system) is necessary. The WC powder is successfully obtained by heating WO3:5C mixture for 900 s in a domestic microwave oven.

  13. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  14. New therapeutic strategies in HCV: second-generation protease inhibitors.

    PubMed

    Clark, Virginia C; Peter, Joy A; Nelson, David R

    2013-02-01

    Telaprevir and boceprevir are the first direct-acting antiviral agents approved for use in HCV treatment and represent a significant advance in HCV therapy. However, these first-generation drugs also have significant limitations related to thrice-daily dosing, clinically challenging side-effect profiles, low barriers to resistance and a lack of pan-genotype activity. A second wave of protease inhibitors are in phase II and III trials and promise to provide a drug regimen with a better dosing schedule and improved tolerance. These second-wave protease inhibitors will probably be approved in combination with PEG-IFN and Ribavirin (RBV), as well as future all-oral regimens. The true second-generation protease inhibitors are in earlier stages of development and efficacy data are anxiously awaited as they may provide pan-genotypic antiviral activity and a high genetic barrier to resistance.

  15. Membrane-anchored serine proteases in health and disease

    PubMed Central

    Bugge, Thomas; Wu, Qingyu

    2013-01-01

    Serine proteases of the trypsin-like family have long been recognized to be critical effectors of biological processes as diverse as digestion, blood coagulation, fibrinolysis, and immunity. In recent years, a subgroup of these enzymes has been identified that are anchored directly to plasma membranes, either by a carboxy-terminal transmembrane domain (Type I), an amino-terminal transmembrane domain with a cytoplasmic extension (Type II or TTSP), or through a glycosyl-phosphatidylinositol (GPI) linkage. Recent biochemical, cellular, and in vivo analyses have now established that membrane-anchored serine proteases are key pericellular contributors to processes vital for development and the maintenance of homeostasis. This chapter will review our current knowledge of the biological and physiological functions of these proteases, their molecular substrates, and their contributions to disease. PMID:21238933

  16. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  17. Peptide synthesis in neat organic solvents with novel thermostable proteases.

    PubMed

    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B

    2015-06-01

    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  18. Tobacco Etch Virus protease: A shortcut across biotechnologies.

    PubMed

    Cesaratto, Francesca; Burrone, Oscar R; Petris, Gianluca

    2016-08-10

    About thirty years ago, studies on the RNA genome of Tobacco Etch Virus revealed the presence of an efficient and specific protease, called Tobacco Etch Virus protease (TEVp), that was part of the Nuclear Inclusion a (NIa) enzyme. TEVp is an efficient and specific protease of 27kDa that has become a valuable biotechnological tool. Nowadays TEVp is a unique endopeptidase largely exploited in biotechnology from industrial applications to in vitro and in vivo cellular studies. A number of TEVp mutants with different rate of cleavage, stability and specificity have been reported. Similarly, a panel of different target cleavage sites, derived from the canonical ENLYFQ-G/S site, has been established. In this review we describe these aspects of TEVp and some of its multiple applications. A particular focus is on the use and molecular biology of TEVp in living cells and organisms.

  19. Cleaning protocols for crystallization robots: preventing protease contamination.

    PubMed

    Naschberger, Andreas; Fürnrohr, Barbara G; Dunzendorfer-Matt, Theresia; Bonagura, Christopher A; Wright, David; Scheffzek, Klaus; Rupp, Bernhard

    2015-01-01

    The protease in the commonly used commercial low-foam enzyme cleaner Zymit cannot be completely blocked by EDTA, a widely used inhibitor of metalloproteases, at concentrations of up to 5 mM. Severe protein degradation was observed in crystallization drops after EDTA-containing wash steps unless residual Zymit protease was removed with NaOH at a concentration of at least 0.1 M. Wash steps with 0.1% SDS were also ineffective in completely removing the remaining Zymit activity. Protocols including wash steps with at least 0.1 M NaOH, as for example specified in the original ZENM protocol, are recommended to completely deactivate Zymit protease activity.

  20. Lvserpin3 is involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

    PubMed

    Liu, Yongjie; Liu, Tao; Hou, Fujun; Wang, Xianzong; Liu, Xiaolin

    2016-01-01

    Serine protease inhibitor, represented by serpin, plays an important inhibitory role on proteases involved in the immune responses. To clarify the immune characterizations of serpin, a novel serpin (Lvserpin3) encoding for 410 amino acids with a 23-amino acid signal peptide and a serpin domain was identified from the Pacific white shrimp Litopenaeus vannamei. Lvserpin3 expressed strongest in hepatopancreas, and was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Suppression of Lvserpin3 by dsRNA led to a significant increase in the transcripts of LvPPAF, LvproPO and phenoloxidase (PO) activity, and also led to the high cumulative mortality. The recombinant Lvserpin3 protein (rLvserpin3) inhibited the proteases secreted by M. lysodeikticus and Bacillus subtilis, and further exhibited inhibitory role on the growth of B. subtilis and M. lysodeikticu. Moreover, rLvserpin3 was found to be able to block the activation of prophenoloxidase system. Taken together, the results imply that Lvserpin3 may be involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

  1. Taspase1: a 'misunderstood' protease with translational cancer relevance.

    PubMed

    Wünsch, D; Hahlbrock, A; Jung, S; Schirmeister, T; van den Boom, J; Schilling, O; Knauer, S K; Stauber, R H

    2016-06-30

    Proteolysis is not only a critical requirement for life, but the executing enzymes also play important roles in numerous pathological conditions, including cancer. Therefore, targeting proteases is clearly relevant for improving cancer patient care. However, to effectively control proteases, a profound knowledge of their mechanistic function as well as their regulation and downstream signalling in health and disease is required. The highly conserved protease Threonine Aspartase1 (Taspase1) is overexpressed in numerous liquid and solid malignancies and was characterized as a 'non-oncogene addiction' protease. Although Taspase1 was shown to cleave various regulatory proteins in humans as well as leukaemia provoking mixed lineage leukaemia fusions, our knowledge on its detailed functions and the underlying mechanisms contributing to cancer is still incomplete. Despite superficial similarity to type 2 asparaginases as well as Ntn proteases, such as the proteasome, Taspase1-related research so far gives us the picture of a unique protease exhibiting special features. Moreover, neither effective genetic nor chemical inhibitors for this enzyme are available so far, thus hampering not only to further dissect Taspase1's pathobiological functions but also precluding the assessment of its clinical impact. Based on recent insights, we here critically review the current knowledge of Taspase1's structure-function relationship and its mechanistic relevance for tumorigenesis obtained from in vitro and in vivo cancer models. We provide a comprehensive overview of tumour entities for which Taspase1 might be of predictive and therapeutic value, and present the respective experimental evidence. To stimulate progress in the field, a comprehensive overview of Taspase1 targeting approaches is presented, including coverage of Taspase1-related patents. We conclude by discussing future inhibition strategies and relevant challenges, which need to be resolved by the field.

  2. Jet-induced star formation in 3C 285 and Minkowski's Object

    NASA Astrophysics Data System (ADS)

    Salomé, Q.; Salomé, P.; Combes, F.

    2015-02-01

    How efficiently star formation proceeds in galaxies is still an open question. Recent studies suggest that active galactic nucleus (AGN) can regulate the gas accretion and thus slow down star formation (negative feedback). However, evidence of AGN positive feedback has also been observed in a few radio galaxies (e.g. Centaurus A, Minkowski's Object, 3C 285, and the higher redshift 4C 41.17). Here we present CO observations of 3C 285 and Minkowski's Object, which are examples of jet-induced star formation. A spot (named 3C 285/09.6 in the present paper) aligned with the 3C 285 radio jet at a projected distance of ~70 kpc from the galaxy centre shows star formation that is detected in optical emission. Minkowski's Object is located along the jet of NGC 541 and also shows star formation. Knowing the distribution of molecular gas along the jets is a way to study the physical processes at play in the AGN interaction with the intergalactic medium. We observed CO lines in 3C 285, NGC 541, 3C 285/09.6, and Minkowski's Object with the IRAM 30 m telescope. In the central galaxies, the spectra present a double-horn profile, typical of a rotation pattern, from which we are able to estimate the molecular gas density profile of the galaxy. The molecular gas appears to be in a compact reservoir, which could be evidence of an early phase of the gas accretion after a recent merger event in 3C 285. No kinematic signature of a molecular outflow is detected by the 30 m telescope. Interestingly, 3C 285/09.6 and Minkowski's Object are not detected in CO. The cold gas mass upper limits are consistent with a star formation induced by the compression of dense ambient material by the jet. The depletion time scales in 3C 285/09.6 and Minkowski's Object are of the order of and even shorter than what is found in 3C 285, NGC 541, and local spiral galaxies (109 yr). The upper limit of the molecular gas surface density in 3C 285/09.6 at least follows a Schmidt-Kennicutt law if the emitting region

  3. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  4. Association of a protease with polytene chromosomes of Drosophila melanogaster.

    PubMed

    Cavagnaro, J; Pierce, D A; Lucchesi, J C; Chae, C B

    1980-11-01

    Incubation of Drosophila salivary glands with radioactive diisopropyl fluorophosphate results in the uniform labeling of polytene chromosomes. Extensive labeling is seen only when chromosome squashes are prepared by a formaldehyde fixation procedure and not by standard acetic acid techniques. The labeling is inhibited in the presence of tosylphenylalanine chloromethyl ketone and phenylmethane sulfonylfluoride but not by tosyllysine chloromethyl ketone, suggesting that a chymotrypsin-like serine protease is associated with the chromosomes. Protease inhibitors show no apparent effect on heat-shock specific puffing.

  5. [Cytokines and proteases involved in pathogenesis of COPD].

    PubMed

    Yamaya, Atsuyo; Osanai, Kazuhiro

    2011-10-01

    COPD is characterized by persistence of chronic inflammation in small airways and alveoli. Macrophages, neutrophils, and a specialized subset of T lymphocytes orchestrate the mild inflammation. This article focuses on humoral factors such as cytokines and chemokines that recruit these inflammatory and immune cells to the lungs, and proteases/antiproteases that ultimately cause structural derangement in the terminal respiratory zones. In addition to the classical protease and antiprotease imbalance hypothesis, alveolar homeostasis abnormality that comes from imbalance of lung constitutional cell apoptosis and regeneration may play a role in emphysema development. Also, autoimmunity to elastin degradation products may take part in the disease.

  6. The chlamydial protease CPAF: important or not, important for what?

    PubMed

    Häcker, Georg

    2014-05-01

    The protease CPAF is only found in Chlamydiales and in at least most bacteria that share with Chlamydia the biphasic life-style in a cytosolic inclusion. CPAF is intriguing: it appears to be secreted from the inclusion across the inclusion membrane into the cytosol. A bacterial protease ravaging in the cytosol of a human cell may cause a plethora of effects. Curiously, very few are known. The current discussion is bogged down by a focus on experimental artifact, while proposed functions of CPAF remain speculative. I here make the attempt to summarize what we know about CPAF.

  7. Regulation by proteolysis: energy-dependent proteases and their targets.

    PubMed Central

    Gottesman, S; Maurizi, M R

    1992-01-01

    A number of critical regulatory proteins in both prokaryotic and eukaryotic cells are subject to rapid, energy-dependent proteolysis. Rapid degradation combined with control over biosynthesis provides a mechanism by which the availability of a protein can be limited both temporally and spatially. Highly unstable regulatory proteins are involved in numerous biological functions, particularly at the commitment steps in developmental pathways and in emergency responses. The proteases involved in energy-dependent proteolysis are large proteins with the ability to use ATP to scan for appropriate targets and degrade complete proteins in a processive manner. These cytoplasmic proteases are also able to degrade many abnormal proteins in the cell. PMID:1480111

  8. Identification of Genotypic Changes in Human Immunodeficiency Virus Protease That Correlate with Reduced Susceptibility to the Protease Inhibitor Lopinavir among Viral Isolates from Protease Inhibitor-Experienced Patients

    PubMed Central

    Kempf, Dale J.; Isaacson, Jeffrey D.; King, Martin S.; Brun, Scott C.; Xu, Yi; Real, Kathryn; Bernstein, Barry M.; Japour, Anthony J.; Sun, Eugene; Rode, Richard A.

    2001-01-01

    The association of genotypic changes in human immunodeficiency virus (HIV) protease with reduced in vitro susceptibility to the new protease inhibitor lopinavir (previously ABT-378) was explored using a panel of viral isolates from subjects failing therapy with other protease inhibitors. Two statistical tests showed that specific mutations at 11 amino acid positions in protease (L10F/I/R/V, K20M/R, L24I, M46I/L, F53L, I54L/T/V, L63P, A71I/L/T/V, V82A/F/T, I84V, and L90M) were associated with reduced susceptibility. Mutations at positions 82, 54, 10, 63, 71, and 84 were most closely associated with relatively modest (4- and 10-fold) changes in phenotype, while the K20M/R and F53L mutations, in conjunction with multiple other mutations, were associated with >20- and >40-fold-reduced susceptibility, respectively. The median 50% inhibitory concentrations (IC50) of lopinavir against isolates with 0 to 3, 4 or 5, 6 or 7, and 8 to 10 of the above 11 mutations were 0.8-, 2.7-, 13.5-, and 44.0-fold higher, respectively, than the IC50 against wild-type HIV. On average, the IC50 of lopinavir increased by 1.74-fold per mutation in isolates containing three or more mutations. Each of the 16 viruses that displayed a >20-fold change in susceptibility contained mutations at residues 10, 54, 63, and 82 and/or 84, along with a median of three mutations at residues 20, 24, 46, 53, 71, and 90. The number of protease mutations from the 11 identified in these analyses (the lopinavir mutation score) may be useful for the interpretation of HIV genotypic resistance testing with respect to lopinavir-ritonavir (Kaletra) regimens and may provide insight into the genetic barrier to resistance to lopinavir-ritonavir in both antiretroviral therapy-naive and protease inhibitor-experienced patients. PMID:11462018

  9. Fe3C nanoparticle decorated Fe/N doped graphene for efficient oxygen reduction reaction electrocatalysis

    NASA Astrophysics Data System (ADS)

    Niu, Yanli; Huang, Xiaoqin; Hu, Weihua

    2016-11-01

    Oxygen reduction reaction (ORR) electrocatalysts with high activity, low cost and good durability are crucial to promote the large-scale practical application of fuel cells. Particularly, iron carbide (Fe3C) supported on nitrogen-doped carbon has recently demonstrated compelling promise for ORR electrocatalysis. In this paper, we report the facile synthesis of mesoporous Fe/N-doped graphene with encapsulated Fe3C nanoparticles (Fe3C@Fe/N-graphene) and its superior ORR catalytic activity. This hybrid material was synthesized by the spontaneous oxidative polymerization of dopamine on graphene oxide (GO) sheets in the presence of iron ion, followed by thermal annealing in Argon (Ar) atmosphere. As-prepared material shows high ORR catalytic activity with overwhelming four-electron reduction pathway, long-term durability and high methanol tolerance in alkaline media. This work reports a facile method to synthesize promising ORR electrocatalysis with multiple components and hierarchical architecture, and may offer valuable insight into the underlying mechanism of Fe3C-boosted ORR activity of Fe/N doped carbon.

  10. Fermi LAT detection of renewed GeV activity from blazar 3C 279

    NASA Astrophysics Data System (ADS)

    Ciprini, Stefano; Gonzalez, Josefa Becerra

    2014-04-01

    The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed high-level gamma-ray activity from a source positionally consistent with the blazar 3C 279 (RA: 194.046527 deg, Dec: -5.789312 deg, J2000; Johnston et al.1995, AJ, 110, 880). ...

  11. Evidence-Based Nursing of the 3C Therapeutic Regimen for Type 1 Diabetes.

    PubMed

    Wu, Jianya; Zou, Ling

    2015-05-01

    The aim of this study is to explore the efficacy of the 3C therapeutic regimen for type 1 diabetes. Thirty-nine patients with type 1 diabetes, who were hospitalized from January 2013 to April 2014, were included to receive 3C therapeutic regimen. Evidence-based nursing was performed in the treatment period and the efficacy was observed 6 days after therapy. Six days after the administration of the 3C therapeutic regimen, the fasting glucose levels in all 39 patients were controlled to be 4.4-6.0 mmol/L and 2h-postprandial glucose levels to be 4.4-7.8 mmol/L. Three patients had a glucose level <3.9 mmol/L, which was corrected after adjusting the dose of insulin infusion. Evidence-based nursing was provided in the treatment period and no nursing-associated complication occurred. All patients were satisfied with the nursing service. The efficacy of the 3C therapeutic regimen for type 1 diabetes is satisfactory. The evidence-based nursing can help to ensure the efficacy and improve the quality of nursing service.

  12. Brightening of 3C 279 observed by INTEGRAL at hard X-rays

    NASA Astrophysics Data System (ADS)

    Bottacini, E.; Ferrigno, C.; Fotopoulou, S.; Collmar, W.; Pian, E.

    2015-06-01

    The flat spectrum radio quasar 3C 279 at z=0.536 is flaring in the gamma-ray band, as announced by AGILE and FERMI (ATels #7631 and #7633); a Swift/XRT follow-up showed a significant brightening in the X-ray band as well (ATel #7639).

  13. Optical monitoring of the superluminal quasar 3C 345 in 1984-1991

    NASA Astrophysics Data System (ADS)

    Babadzhanyants, M. K.; Belokon', E. T.; Gamm, N. G.

    1995-08-01

    This article continues a series of publications containing results of a program of optical monitoring of OVV quasars, blazars, and similar objects (the Petersburg Quasar Monitoring Program), which has been conducted at the Byurakan station of the St. Petersburg Astronomical Institute since 1968. Results of long-term monitoring of the quasar 3C 345 in 1984-1991 are presented. The observations were conducted in the B band and consist of 365 brightness estimates obtained on 219 nights. The optical variability of 3C 345 on time scales from tens of years to tens of minutes is discussed. In 1991, the appearance of a new large amplitude slow outburst is noted (the characteristic time for brightness variation is of the order of a year). This outburst is similar to outbursts in 1967-1968, 1970-1972, 1976-1977, and 1982-1983, which were associated with the emergence of superluminal components in the milliarcsecond radio jet of 3C 345. The 1991 outburst suggests the emergence from the core of a new superluminal component. Analysis of the full known optical brightness curve for 3C 345 (1965-1993) shows the possible existence of a (quasi-)period of 700 days, which implies the appearance of a new brightness maximum in the 1994 observing season.

  14. NMR reveals the surface functionalisation of Ti3C2 MXene.

    PubMed

    Hope, Michael A; Forse, Alexander C; Griffith, Kent J; Lukatskaya, Maria R; Ghidiu, Michael; Gogotsi, Yury; Grey, Clare P

    2016-02-21

    (1)H and (19)F NMR experiments have identified and quantified the internal surface terminations of Ti3C2Tx MXene. -F and -OH terminations are shown to be intimately mixed and there are found to be significantly fewer -OH terminations than -F and -O, with the proportions highly dependent on the synthesis method.

  15. Vip3C, a Novel Class of Vegetative Insecticidal Proteins from Bacillus thuringiensis

    PubMed Central

    Palma, Leopoldo; Hernández-Rodríguez, Carmen Sara; Maeztu, Mireya; Hernández-Martínez, Patricia; Ruiz de Escudero, Iñigo; Escriche, Baltasar; Muñoz, Delia; Van Rie, Jeroen; Ferré, Juan

    2012-01-01

    Three vip3 genes were identified in two Bacillus thuringiensis Spanish collections. Sequence analysis revealed a novel Vip3 protein class (Vip3C). Preliminary bioassays of larvae from 10 different lepidopteran species indicated that Vip3Ca3 caused more than 70% mortality in four species after 10 days at 4 μg/cm2. PMID:22865065

  16. Chandra Detection of a Parsec Scale Wind in the Broad Line Radio Galaxy 3C 382

    NASA Technical Reports Server (NTRS)

    Reeves, J. N.; Sambruna, R. M.; Braito, V.; Eracleous, Michael

    2009-01-01

    We present unambiguous evidence for a parsec scale wind in the Broad-Line Radio Galaxy (BLRG) 3C 382, the first radio-loud AGN whereby an outflow has been measured with X-ray grating spectroscopy. A 118 ks Chandra grating (HETG) observation of 3C 382 has revealed the presence of several high ionization absorption lines in the soft X-ray band, from Fe, Ne, Mg and Si. The absorption lines are blue-shifted with respect to the systemic velocity of 3C 382 by -840+/-60 km/s and are resolved by Chandra with a velocity width of sigma = 340+/-70 km/s. The outflow appears to originate from a single zone of gas of column density N(sub H) = 1.3 x 10(exp 21)/sq cm and ionization parameter log(E/erg/cm/s) = 2.45. From the above measurements we calculate that the outflow is observed on parsec scales, within the likely range from 10-1000 pc, i.e., consistent with an origin in the Narrow Line Region. Finally we also discuss the possibility of a much faster (0.1c) outflow component, based on a blue-shifted iron K(alpha) emission line in the Suzaku observation of 3C 382, which could have an origin in an accretion disk wind.

  17. The Multi-component X-ray Emission of 3C 273

    NASA Astrophysics Data System (ADS)

    Soldi, S.; Türler, M.; Paltani, S.; Courvoisier, T. J.-L.

    2009-05-01

    3C 273 is the brightest quasar in the sky and among the most extensively observed and studied AGN, therefore one of the most suitable targets for a long-term, multi-frequency study. The superposition of a thermal Comptonisation component, similar to that observed in Seyfert galaxies, and of a non-thermal component, related to the jet emission, seems to explain some of the spectral and timing properties of the X-ray emission of 3C 273. Yet, during some observations this dichotomy has not been observed and the variability properties could also be consistent with a single-component scenario, characterised by two parameters varying independently. In order to understand the nature of the X-ray emission in 3C 273, a series of observations up to 80-100 keV, possibly catching the source in different flux states, are essential. Simbol-X will be able to study the emission of 3C 273 in the broad 0.5-80 keV band with high sensitivity, allowing us to disentangle the emission from different spectral components, with 20-30 ks long observations. In addition, the shape and the origin of the high-energy emission of this quasar will be further constrained thanks to the AGILE and Fermi satellites, monitoring the γ-ray sky in the MeV-GeV energy domain.

  18. Single-step non-thermal plasma synthesis of 3C-SiC nanoparticles

    NASA Astrophysics Data System (ADS)

    Chaukulkar, Rohan P.; de Peuter, Koen; Ghodes, Jacob A.; Pylypenko, Svitlana; Cloud, Jacqueline E.; Yang, Yongan; Stradins, Paul; Agarwal, Sumit

    2015-01-01

    We present a scalable, single-step, non-thermal plasma synthesis technique for the growth of sub-5 nm, hydrogenated amorphous carbon (a-C:H) coated 3C-SiC nanoparticles (NPs). In a tubular flow reactor, we first nucleate and grow c-Si NPs upstream in a SiH4/Ar plasma. These c-Si NPs are then transported by gas flow to a downstream C2H2/Ar plasma, and carburized in-flight by carbon-containing radicals and ions to 3C-SiC NPs. X-ray diffraction and transmission electron microscopy indicate an NP size of ˜4 nm. X-ray photoelectron spectroscopy analysis confirms that the c-Si NPs are completely carburized to 3C-SiC. Fourier transform infrared spectroscopy shows that the surface of the 3C-SiC NPs is coated with a-C:H with some alkenyl termination, which can facilitate further solution-based surface functionalization for biomedical applications.

  19. 880 μm SMA Polarization Observations of the Quasar 3C 286

    NASA Astrophysics Data System (ADS)

    Hull, Charles L. H.; Girart, Josep M.; Zhang, Qizhou

    2016-10-01

    For decades, the bright radio quasar 3C 286 has been widely recognized as one of the most reliable polarization calibrators at centimeter wavelengths because of its unchanging polarization position angle and high polarization percentage. However, it has become clear in recent years that the polarization position angle of 3C 286 changes with increasing frequency, increasing from ˜33° at λ ≳ 3 cm to ˜38° at λ ≈ 1 mm. With the advent of high-sensitivity polarization observations by current and future (sub)millimeter telescopes, knowledge of the position angle of 3C 286 at higher frequencies is critical for calibration. We report the first polarization observations of 3C 286 at submillimeter wavelengths, taken at 880 μm (340 GHz) with the Submillimeter Array. We find a polarization position angle and percentage of 37\\buildrel{\\circ}\\over{.} 4+/- 1\\buildrel{\\circ}\\over{.} 5 and 15.7% ± 0.8%, respectively, which is consistent with previous measurements at 1 mm.

  20. Structural Basis for Molecular Discrimination by a 3',3'-cGAMP Sensing Riboswitch

    DOE PAGES

    Ren, Aiming; Wang, Xin  C.; Kellenberger, Colleen  A.; ...

    2015-04-07

    Cyclic dinucleotides are second messengers that target the adaptor STING and stimulate the innate immune response in mammals. Besides protein receptors, there are bacterial riboswitches that selectively recognize cyclic dinucleotides. We recently discovered a natural riboswitch that targets 3',3'-cGAMP, which is distinguished from the endogenous mammalian signal 2',3'-cGAMP by its backbone connectivity. Here, we report on structures of the aptamer domain of the 3',3'-cGAMP riboswitch from Geobacter in the 3',3'-cGAMP and c-di-GMP bound states. The riboswitch adopts a tuning forklike architecture with a junctional ligand-binding pocket and different orientations of the arms are correlated with the identity of the boundmore » cyclic dinucleotide. Subsequent biochemical experiments revealed that specificity of ligand recognition can be affected by point mutations outside of the binding pocket, which has implications for both the assignment and reengineering of riboswitches in this structural class.« less

  1. The extreme ultraviolet spectrum of the kinetically dominated quasar 3C 270.1

    NASA Astrophysics Data System (ADS)

    Punsly, Brian; Marziani, Paola

    2015-10-01

    Only a handful of quasars have been identified as kinetically dominated, their long-term time-averaged jet power, overline{Q}, exceeds the bolometric thermal emission, Lbol, associated with the accretion flow. This Letter presents the first extreme ultraviolet (EUV) spectrum of a kinetically dominated quasar, 3C 270.1. The EUV continuum flux density of 3C 270.1 is very steep, F_{ν } ˜ ν ^{-α _{EUV}}, αEUV = 2.98 ± 0.15. This value is consistent with the correlation of overline{Q}/L_{bol} and αEUV found in previous studies of the EUV continuum of quasars, the EUV deficit of radio loud quasars. Curiously, although ultraviolet broad absorption line (BAL) troughs in quasar spectra are anticorrelated with overline{Q}, 3C 270.1 has been considered a BAL quasar based on an SDSS spectrum. This claim is examined in terms of the EUV spectrum of O VI and the highest resolution C IV spectrum in the archival data and the SDSS spectrum. First, from [O III]4959,5007 (IR) observations and the UV spectral lines, it is concluded that the correct redshift for 3C 270.1 is 1.5266. It is then found that the standard measure of broad absorption, BALnicity = 0, for Mg II 2800, C IV 1549 and O VI 1032 in all epochs.

  2. Pressure Balance between Thermal and Non-Thermal Plasmas in the 3C129 Cluster

    NASA Astrophysics Data System (ADS)

    Harris, D. E.; Krawczynski, H.

    With new Chandra observations of the cluster containing the two radio galaxies 3C129 and 3C129.1, we have made a fit to the X-ray surface brightness to obtain thermal pressures. VLA data at 1.4 GHz have been obtained to complement previous maps at 0.33 GHz (Lane et al. 2002) and at 5 and 8 GHz (Taylor et al. 2001). From these radio data, we are able to derive the minimum non-thermal pressure of various emitting volumes along the tail of 3C129 and in the lobes of 3C129.1. Under the assumption that the non-thermal plasma excludes significant thermal plasma, we may expect pressure balance for most features since ram pressure should be important only close to the cores of the galaxies. Since we find that the minimum non-thermal pressures are generally only a factor of a few below estimates of the ambient thermal pressure, we conclude that it is unlikely that relativistic protons contribute significantly to the total pressure. Reasonable contributions from low energy electrons and filling factors in the range 0.1 to 1 suffice to achieve pressure balance. Although we do not find strong signatures for the exclusion of hot gas from the radio structures, we find soft features near the cores of both galaxies suggestive of cool gas stripping and hard features associated with radio jets and possibly a leading bow shock.

  3. The Angular Structure of Quasar 3C 47 in the Decameter Waveband

    NASA Astrophysics Data System (ADS)

    Lozinskiy, A. B.; Lozinskiy, R. A.; Ivantishin, O. L.; Romanchev, Y. V.; Rashkovskiy, S. L.; Shepelev, V. A.; Brazhenko, A. I.; Vashchishin, R. V.; Litvinenko, O. A.

    The quasar 3C47 was observed with the URAN network at decameter wavelengths. A model of its angular structure consisting of four components was fitted. Lobes of the source are enlarged significantly in the range if compare with their high frequency dimensions. The hot spots emission is detected at low frequencies but a radio core is disappeared completely due to its flat spectrum.

  4. Semipolar (202̅3) nitrides grown on 3C-SiC/(001) Si substrates

    NASA Astrophysics Data System (ADS)

    Dinh, Duc V.; Presa, S.; Akhter, M.; Maaskant, P. P.; Corbett, B.; Parbrook, P. J.

    2015-12-01

    Heteroepitaxial growth of GaN buffer layers on 3C-SiC/(001) Si templates (4°-offcut towards [110]) by metalorganic vapour phase epitaxy has been investigated. High-temperature grown Al0.5Ga0.5N/AlN interlayers were employed to produce a single (202̅3) GaN surface orientation. Specular crack-free GaN layers showed undulations along [11̅0]{}3{{C}-{SiC}/{Si}} with a root mean square roughness of about 13.5 nm (50 × 50 μm2). The orientation relationship determined by x-ray diffraction (XRD) was found to be [1̅21̅0]GaN ∥[11̅0]{}3{{C}-{SiC}/{Si}} and [3̅034]GaN ∥[110]3C - SiC/Si . Low-temperature photoluminescence (PL) and XRD measurements showed the presence of basal-plane stacking faults in the layers. PL measurements of (202̅3) multiple-quantum-well and light-emitting diode structures showed uniform luminescence at about 500 nm emission wavelength. A small peak shift of about 3 nm was observed in the electroluminescence when the current was increased from 5 to 50 mA (25-250 A cm-2).

  5. Vip3C, a novel class of vegetative insecticidal proteins from Bacillus thuringiensis.

    PubMed

    Palma, Leopoldo; Hernández-Rodríguez, Carmen Sara; Maeztu, Mireya; Hernández-Martínez, Patricia; Ruiz de Escudero, Iñigo; Escriche, Baltasar; Muñoz, Delia; Van Rie, Jeroen; Ferré, Juan; Caballero, Primitivo

    2012-10-01

    Three vip3 genes were identified in two Bacillus thuringiensis Spanish collections. Sequence analysis revealed a novel Vip3 protein class (Vip3C). Preliminary bioassays of larvae from 10 different lepidopteran species indicated that Vip3Ca3 caused more than 70% mortality in four species after 10 days at 4 μg/cm(2).

  6. PIK3C2B inhibition improves function and prolongs survival in myotubular myopathy animal models

    PubMed Central

    Sabha, Nesrin; Volpatti, Jonathan R.; Gonorazky, Hernan; Davidson, Ann E.; Li, Xingli; Eltayeb, Nadine M.; Dall’Armi, Claudia; Di Paolo, Gilbert; Brooks, Susan V.; Buj-Bello, Ana; Feldman, Eva L.; Dowling, James J.

    2016-01-01

    Myotubular myopathy (MTM) is a devastating pediatric neuromuscular disorder of phosphoinositide (PIP) metabolism resulting from mutations of the PIP phosphatase MTM1 for which there are no treatments. We have previously shown phosphatidylinositol-3-phosphate (PI3P) accumulation in animal models of MTM. Here, we tested the hypothesis that lowering PI3P levels may prevent or reverse the MTM disease process. To test this, we targeted class II and III PI3 kinases (PI3Ks) in an MTM1-deficient mouse model. Muscle-specific ablation of Pik3c2b, but not Pik3c3, resulted in complete prevention of the MTM phenotype, and postsymptomatic targeting promoted a striking rescue of disease. We confirmed this genetic interaction in zebrafish, and additionally showed that certain PI3K inhibitors prevented development of the zebrafish mtm phenotype. Finally, the PI3K inhibitor wortmannin improved motor function and prolonged lifespan of the Mtm1-deficient mice. In all, we have identified Pik3c2b as a genetic modifier of Mtm1 mutation and demonstrated that PIK3C2B inhibition is a potential treatment strategy for MTM. In addition, we set the groundwork for similar reciprocal inhibition approaches for treating other PIP metabolic disorders and highlight the importance of modifier gene pathways as therapeutic targets. PMID:27548528

  7. 40 CFR 59.1 - Final determinations under Section 183(e)(3)(C) of the CAA.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... COMMERCIAL PRODUCTS General § 59.1 Final determinations under Section 183(e)(3)(C) of the CAA. This section identifies the consumer and commercial product categories for which EPA has determined that CTGs will be... paneling coatings; (h) Industrial cleaning solvents; (i) Paper, film, and foil coatings; (j)...

  8. Synthetic ciguatoxin CTX 3C induces a rapid imbalance in neuronal excitability.

    PubMed

    Martín, Victor; Vale, Carmen; Hirama, Masahiro; Yamashita, Shuji; Rubiolo, Juan Andrés; Vieytes, Mercedes R; Botana, Luis M

    2015-06-15

    Ciguatera is a human global disease caused by the consumption of contaminated fish that have accumulated ciguatoxins (CTXs), sodium channel activator toxins. Symptoms of ciguatera include neurological alterations such as paraesthesiae, dysaesthesiae, depression, and heightened nociperception, among others. An important issue to understand these long-term neurological alterations is to establish the role that changes in activity produced by CTX 3C represent to neurons. Here, the effects of synthetic ciguatoxin CTX 3C on membrane potential, spontaneous spiking, and properties of synaptic transmission in cultured cortical neurons of 11-18 days in vitro (DIV) were evaluated using electrophysiological approaches. CTX 3C induced a large depolarization that decreased neuronal firing and caused a rapid inward tonic current that was primarily GABAergic. Moreover, the toxin enhanced the amplitude of miniature postsynaptic inhibitory currents (mIPSCs), whereas it decreased the amplitude of miniature postsynaptic excitatory currents (mEPSCs). The frequency of mIPSCs increased, whereas the frequency of mEPSCs remained unaltered. We describe, for the first time, that a rapid membrane depolarization caused by CTX 3C in cortical neurons activates mechanisms that tend to suppress electrical activity by shifting the balance between excitatory and inhibitory synaptic transmission toward inhibition. Indeed, these results suggest that the acute effects of CTX on synaptic transmission could underlie some of the neurological symptoms caused by ciguatera in humans.

  9. Brightening of FSRQ 3C 454.3 with an intense optical micro-variability.

    NASA Astrophysics Data System (ADS)

    Kaur, Navpreet; Baliyan, KS; Mukesh, CM; Ganesh, S.; Janaka, A.

    2016-11-01

    On the behalf of blazar monitoring group at Mt Abu InfraRed Observatory operated by the Physical Research Laboratory, India, we report detection of micro-variability in FSRQ 3C 454.3 on November 03, 2016 during which it decays by 0.1 mag in R band.

  10. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases.

    PubMed

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers.

  11. Poliovirus polypeptide precursors: expression in vitro and processing by exogenous 3C and 2A proteinases.

    PubMed Central

    Nicklin, M J; Kräusslich, H G; Toyoda, H; Dunn, J J; Wimmer, E

    1987-01-01

    Plasmids have been constructed to generate substrates for the study of proteinases 2A and 3C of poliovirus. They contain the P1 (capsomer precursor) region of the poliovirus genome or P1 and part of P2 (a nonstructural precursor), which can be transcribed and translated in vitro. A transcript containing the entire 5' nontranslated region and the P1 region of the viral RNA gave poor translation in a reticulocyte translation system. Truncation of the 5' nontranslated region to its 3'-most segment gave acceptably good yields of radiolabeled P1. P1 was specifically processed to yield capsomer proteins by enzymes supplied in a postmitochondrial supernatant from poliovirus-infected cells. Thus, proteinase 3C can be supplied exogenously (in trans) and effect processing. This system may be used to provide P1 for the assay of proteinase 3C. Precursors that lacked either the 1A or 1D regions were poor substrates for proteinase 3C--observations that demonstrated a stringent structural requirement in processing by 3C. The translation product of a transcript encoding P1 and part of P2 was rapidly cleaved at the P1-P2 site in the absence of infected-cell extract. A transcript that contained a mutated 2A region gave a stable P1-P2 precursor that could be processed specifically by exogenous proteinase from infected-cell fractions. Processing of P1 appeared to require cleavage of the P1-P2 bond. These results support our previous data that 2A is the second polioviral proteinase and also provides a means of assaying proteinase 2A in vitro. Images PMID:3035560

  12. Gamma-Ray Emission from the Broad-Line Radio Galaxy 3C 111

    NASA Technical Reports Server (NTRS)

    Hartman, Robert C.; Kadler, M.; Tueller, Jack

    2008-01-01

    The broad-line radio galaxy 3C 111 has been suggested as the counterpart of the y-ray source 3EG J0416+3650. While 3C 111 meets most of the criteria for a high-probability identification, like a bright flat-spectrum radio core and a blazar-like broadband SED, in the Third EGRET Catalog, the large positional offset of about 1.5' put 3C 111 outside the 99% probability region for 3EG J0416+3650, making this association questionable. We present a re-analysis of all available archival data for 3C 111 from the EGRET archives, resulting in detection of variable hard-spectrum high-energy gamma-ray emission above 1000 MeV from a position close to the nominal position of 3C 111, in three separate viewing periods (VPs), at a 3sigma level in each. A second variable hard-spectrum source is present nearby. At >100 MeV, one variable soft-spectrum source seems to account for most of the EGRET-detected emission of 3EG J0416+3650. A follow-up Swift UVOT/XRT observation reveals one moderately bright X-ray source in the error box of 3EG J0416+3650, but because of the large EGRET position uncertainty, it is not certain that the X-ray and gamma-ray sources are associated. Another Swift observation near the second (unidentified) hard gamma-ray source detected no X-ray source nearby.

  13. Gamma-Ray Emision from the Broad-Line Radio Galaxy 3C 111

    NASA Technical Reports Server (NTRS)

    Hartman, Robert C.; Kadler, Matthias; Tueller, Jack

    2008-01-01

    The broad-line radio galaxy 3C 111 has been suggested as the counterpart of the Gamma-ray source 3EGJ0416+3650. While 3C 111 meets most of the criteria for a high-probability identification, like a bright fla t-spectrum radio core and a blazarlike broadband SED, in the Third EG RET Catalog, the large positional offset of about 1.5 degrees put 3C1 11 outside the 99% probability region for 3EG J0416+3650, making this association questionable. We present a re-analysis of all available data for 3C111 from the EGRET archives, resulting in probable detection of high-energy Gamma-ray emission above 1000MeV from a position clo se to the nominal position of 3C 111, in two separate viewing periods (VPs), at a 3sigma level in each. A new source, GROJ0426+3747, appea rs to be present nearby, seen only in the >1000MeV data. For >100MeV, the data are in agreement with only one source (at the original cata log position) accounting for most of the EGRET-detected emission of 3 EGJ0416+3650. A follow-up Swift UVOT/XRT observation reveals one mode rately bright X-ray source in the error box of 3EGJ0416+3650, but bec ause of the large EGRET position uncertainty, it is not certain that the X-ray and Gamma-ray sources are associated. A Swift observation of GROJ0426+3747 detected no X.ray source nearby.

  14. Digital holography particle image velocimetry for the measurement of 3D t-3c flows

    NASA Astrophysics Data System (ADS)

    Shen, Gongxin; Wei, Runjie

    2005-10-01

    In this paper a digital in-line holographic recording and reconstruction system was set up and used in the particle image velocimetry for the 3D t-3c (the three-component (3c), velocity vector field measurements in a three-dimensional (3D), space field with time history ( t)) flow measurements that made up of the new full-flow field experimental technique—digital holographic particle image velocimetry (DHPIV). The traditional holographic film was replaced by a CCD chip that records instantaneously the interference fringes directly without the darkroom processing, and the virtual image slices in different positions were reconstructed by computation using Fresnel-Kirchhoff integral method from the digital holographic image. Also a complex field signal filter (analyzing image calculated by its intensity and phase from real and image parts in fast fourier transform (FFT)) was applied in image reconstruction to achieve the thin focus depth of image field that has a strong effect with the vertical velocity component resolution. Using the frame-straddle CCD device techniques, the 3c velocity vector was computed by 3D cross-correlation through space interrogation block matching through the reconstructed image slices with the digital complex field signal filter. Then the 3D-3c-velocity field (about 20 000 vectors), 3D-streamline and 3D-vorticiry fields, and the time evolution movies (30 field/s) for the 3D t-3c flows were displayed by the experimental measurement using this DHPIV method and techniques.

  15. Light-Driven Au-WO3@C Janus Micromotors for Rapid Photodegradation of Dye Pollutants.

    PubMed

    Zhang, Qilu; Dong, Renfeng; Wu, Yefei; Gao, Wei; He, Zihan; Ren, Biye

    2017-02-08

    A novel light-driven Au-WO3@C Janus micromotor based on colloidal carbon WO3 nanoparticle composite spheres (WO3@C) prepared by one-step hydrothermal treatment is described. The Janus micromotors can move in aqueous media at a speed of 16 μm/s under 40 mW/cm(2) UV light due to diffusiophoretic effects. The propulsion of such Au-WO3@C Janus micromotors (diameter ∼ 1.0 μm) can be generated by UV light in pure water without any external chemical fuels and readily modulated by light intensity. After depositing a paramagnetic Ni layer between the Au layer and WO3, the motion direction of the micromotor can be precisely controlled by an external magnetic field. Such magnetic micromotors not only facilitate recycling of motors but also promise more possibility of practical applications in the future. Moreover, the Au-WO3@C Janus micromotors show high sensitivity toward extremely low concentrations of sodium-2,6-dichloroindophenol (DCIP) and Rhodamine B (RhB). The moving speed of motors can be significantly accelerated to 26 and 29 μm/s in 5 × 10(-4) wt % DCIP and 5 × 10(-7) wt % RhB aqueous solutions, respectively, due to the enhanced diffusiophoretic effect, which results from the rapid photocatalytic degradation of DCIP and RhB by WO3. This photocatalytic acceleration of the Au-WO3@C Janus micromotors confirms the self-diffusiophoretic mechanism and opens an opportunity to tune the motility of the motors. This work also offers the light-driven micromotors a considerable potential for detection and rapid photodegradation of dye pollutants in water.

  16. Medical morbidities and DNA methylation of NR3C1 in preterm infants

    PubMed Central

    Giarraputo, James; DeLoach, Jordan; Padbury, James; Uzun, Alper; Marsit, Carmen; Hawes, Katheleen; Lester, Barry

    2017-01-01

    Background: Although there are no accepted “normal” levels of circulating cortisol in preterm infants, critically ill preterm infants show lower cortisol levels than healthy preterm infants. The regulation of cortisol reactivity by epigenetic changes in glucocorticoid receptor gene (NR3C1) expression has been demonstrated. This study aims to examine the relationship between medical morbidities in preterm infants and DNA methylation of NR3C1. Methods: Pyrosequencing was used to determine DNA methylation in CpG sites 1-4 of promoter region 1F of NR3C1. Cluster analysis placed 67 preterm infants born <1,500 g into groups based on medical morbidities. The DNA methylation pattern was compared across groups. Results: Cluster analysis identified a high medical risk cluster and a low medical risk cluster. A Mann-Whitney U-test showed lower methylation at CpG1 for infants in the high-risk group (M = 0.336, SE = 0.084) than infants in the low-risk group (M = 0.617, SE = 0.109, P = 0.032). The false discovery rate was low (q = 0.025). Cohen's D effect size was moderate (0.525). Conclusion: Decreased DNA methylation of CpG1 of NR3C1 in high-risk infants may allow for increased binding of transcription factors involved in the stress response, repair and regulation of NR3C1. This may ensure healthy growth in high-risk preterm infants over increasing cortisol levels. PMID:27653086

  17. A Prime-Boost Vaccination Strategy in Cattle to Prevent Foot-and-Mouth Disease Using a “Single-Cycle” Alphavirus Vector and Empty Capsid Particles

    PubMed Central

    Gullberg, Maria; Lohse, Louise; Bøtner, Anette; McInerney, Gerald M.; Burman, Alison; Jackson, Terry; Polacek, Charlotta

    2016-01-01

    Foot-and-mouth disease (FMD) remains one of the most economically important infectious diseases of production animals globally. Vaccination can successfully control this disease, however, current vaccines are imperfect. They are made using chemically inactivated FMD virus (FMDV) that is produced in large-scale mammalian cell culture under high containment conditions. Here, we have expressed the FMDV capsid protein precursor (P1-2A) of strain O1 Manisa alone or with the FMDV 3C protease (3Cpro) using a “single cycle” packaged alphavirus self-replicating RNA based on Semliki Forest virus (SFV). When the FMDV P1-2A was expressed with 3Cpro then processing of the FMDV capsid precursor protein is observed within cells and the proteins assemble into empty capsid particles. The products interact with anti-FMDV antibodies in an ELISA and bind to the integrin αvβ6 (a cellular receptor for FMDV). In cattle vaccinated with these rSFV-FMDV vectors alone, anti-FMDV antibodies were elicited but the immune response was insufficient to give protection against FMDV challenge. However, the prior vaccination with these vectors resulted in a much stronger immune response against FMDV post-challenge and the viremia observed was decreased in level and duration. In subsequent experiments, cattle were sequentially vaccinated with a rSFV-FMDV followed by recombinant FMDV empty capsid particles, or vice versa, prior to challenge. Animals given a primary vaccination with the rSFV-FMDV vector and then boosted with FMDV empty capsids showed a strong anti-FMDV antibody response prior to challenge, they were protected against disease and no FMDV RNA was detected in their sera post-challenge. Initial inoculation with empty capsids followed by the rSFV-FMDV was much less effective at combating the FMDV challenge and a large post-challenge boost to the level of anti-FMDV antibodies was observed. This prime-boost system, using reagents that can be generated outside of high

  18. A New Subtilase-Like Protease Deriving from Fusarium equiseti with High Potential for Industrial Applications.

    PubMed

    Juntunen, Kari; Mäkinen, Susanna; Isoniemi, Sari; Valtakari, Leena; Pelzer, Alexander; Jänis, Janne; Paloheimo, Marja

    2015-09-01

    A gene encoding a novel extracellular subtilisin-like protease was cloned from the ascomycete Fusarium equiseti and expressed in Trichoderma reesei. The F. equiseti protease (Fe protease) showed excellent performance in stain removal and good compatibility with several commercial laundry detergent formulations, suggesting that it has high potential for use in various industrial applications. The recombinant enzyme was purified and characterized. The temperature optimum of the Fe protease was 60 °C and it showed high activity in the pH range of 6-10, with a sharp decline in activity at pH above 10. The amino acid specificity of the Fe protease was studied using casein, cytochrome c, and ubiquitin as substrates. The Fe protease had broad substrate specificity: almost all amino acid residues were accepted at position P1, even though it showed some preference for cleavage at the C-terminal side of asparagine and histidine residues. The S4 subsite of Fe protease favors aspartic acid and threonine. The other well-characterized proteases from filamentous fungi, Proteinase K from Engyodontium album, Thermomycolin from Malbranchea sulfurea, and alkaline subtilisins from Bacillus species prefer hydrophobic amino acids in both the S1 and S4 subsites. Due to its different specificity compared to the members of the S8 family of clan SB of proteases, we consider that the Fe protease is a new protease. It does not belong to any previously defined IUBMB groups of proteases.

  19. The effects of bioprocess parameters on extracellular proteases in a recombinant Aspergillus niger B1-D.

    PubMed

    Li, Qiang; Harvey, Linda M; McNeil, Brian

    2008-02-01

    Although host proteases are often considered to have a negative impact upon heterologous protein production by filamentous fungi, relatively little is known about the pattern of their appearance in recombinant fungal bioprocesses. In the present study, we investigated extracellular proteases from a filamentous fungus, Aspergillus niger B1-D, genetically modified to secrete hen egg white lysozyme (HEWL). Our findings indicate that extracellular protease activity is only detected after the carbon source is completely utilised in batch cultures. The proteases are predominantly acid proteases and have optimal temperature for activity at around 45 degrees C. Their activity could be partially inhibited by protease inhibitors, indicating the existence of at least four kinds of proteases in these culture fluids, aspartic-, serine-, cysteine-, and metallo-proteases. Oxygen enrichment does not have any noticeable effects on extracellular protease activity except that the onset of protease activity appears earlier in oxygen enrichment runs. Oxygen enrichment stimulates HEWL production substantially, and we propose that it is related to fungal morphology. Thermal stress imposed by raising process temperature (from 25 to 30 and 35 degrees C) in early exponential phase, led to appearance of protease activity in the medium following the heat shock. Continued cultivation at high temperatures significantly reduced HEWL production, which was associated with increased activity of the extracellular proteases in these cultures.

  20. Teaching Foundational Topics and Scientific Skills in Biochemistry within the Conceptual Framework of HIV Protease

    ERIC Educational Resources Information Center

    Johnson, R. Jeremy

    2014-01-01

    HIV protease has served as a model protein for understanding protein structure, enzyme kinetics, structure-based drug design, and protein evolution. Inhibitors of HIV protease are also an essential part of effective HIV/AIDS treatment and have provided great societal benefits. The broad applications for HIV protease and its inhibitors make it a…

  1. Emerging technologies for protease engineering: New tools to clear out disease.

    PubMed

    Guerrero, Jennifer L; Daugherty, Patrick S; O'Malley, Michelle A

    2017-01-01

    Proteases regulate many biological processes through their ability to activate or inactive their target substrates. Because proteases catalytically turnover proteins and peptides, they present unique opportunities for use in biotechnological and therapeutic applications. However, many proteases are capable of cleaving multiple physiological substrates. Therefore their activity, expression, and localization are tightly controlled to prevent unwanted proteolysis. Currently, the use of protease therapeutics has been limited to a handful of proteases with narrow substrate specificities, which naturally limits their toxicity. Wider application of proteases is contingent upon the development of methods for engineering protease selectivity, activity, and stability. Recent advances in the development of high-throughput, bacterial and yeast-based methods for protease redesign have yielded protease variants with novel specificities, reduced toxicity, and increased resistance to inhibitors. Here, we highlight new tools for protease engineering, including methods suitable for the redesign of human secreted proteases, and future opportunities to exploit the catalytic activity of proteases for therapeutic benefit. Biotechnol. Bioeng. 2017;114: 33-38. © 2016 Wiley Periodicals, Inc.

  2. Protease-sensitive transfection of Bacillus subtilis with bacteriophage GA-1 DNA: a probable case of heterologous transfection.

    PubMed

    Arwert, F; Venema, G

    1974-03-01

    The host bacterium of bacteriophage GA-1, Bacillus sp. G1R, was compared with respect to its taxonomic relationship to Bacillus subtilis, B. licheniformis, and B. pumilis. The physiological-biochemical properties of Bacillus sp. G1R are equal to those of B. licheniformis, but the thermal denaturation midpoint of G1R DNA differs by 3 C and the buoyant density by 0.005 g/cm(3) from that of B. licheniformis. Transformation with G1R donor DNA was neither observed in B. licheniformis nor in B. subtilis-competent recipients. Bacteriophage GA-1 shows neither infectivity on B. licheniformis nor on B. subtilis. However, infection of competent B. subtilis cultures with phenol-extracted GA-1 DNA results in the production of infective GA-1 particles. The transfecting activity of GA-1 DNA is destroyed by treatment with proteolytic enzymes. Resistance of transfecting DNA to inactivation by trypsin develops earlier than that to inactivation by DNase. Protease-treated GA-1 DNA competes with transforming DNA to approximately the same extent as does untreated GA-1 DNA, suggesting that uptake of GA-1 DNA is not affected by protease treatment. CsCl density gradient centrifugation reveals that the density of trypsinized GA-1 DNA is 0.004 g/cm(3) greater than that of untreated DNA.

  3. A novel serine protease inhibitor from Bungarus fasciatus venom.

    PubMed

    Lu, Jia; Yang, Hailong; Yu, Haining; Gao, Weikai; Lai, Ren; Liu, Jingze; Liang, Xingcai

    2008-03-01

    By Sephadex G-50 gel filtration, cation-exchange CM-Sephadex C-25 chromatography and reversed phase high-performance liquid chromatography (HPLC), a novel serine protease inhibitor named bungaruskunin was purified and characterized from venom of Bungarus fasciatus. Its cDNA was also cloned from the cDNA library of B. fasciatus venomous glands. The predicted precursor is composed of 83 amino acid (aa) residues including a 24-aa signal peptide and a 59-aa mature bungaruskunin. Bungaruskunin showed maximal similarity (64%) with the predicted serine protease inhibitor blackelin deduced from the cDNA sequence of the red-bellied black snake Pseudechis porphyriacus. Bungaruskunin is a Kunitz protease inhibitor with a conserved Kunitz domain and could exert inhibitory activity against trypsin, chymotrypsin, and elastase. By screening the cDNA library, two new B chains of beta-bungarotoxin are also identified. The overall structures of bungaruskunin and beta-bungarotoxin B chains are similar; especially they have highly conserved signal peptide sequences. These findings strongly suggest that snake Kunitz/BPTI protease inhibitors and neurotoxic homologs may have originated from a common ancestor.

  4. The non-death role of metacaspase proteases.

    PubMed

    Shrestha, Amit; Megeney, Lynn A

    2012-01-01

    The activation of caspase proteases and the targeting of protein substrates act as key steps in the engagement and conduct of apoptosis/programmed cell death. However, the discovery of caspase involvement in diverse non-apoptotic cellular functions strongly suggests that these proteins may have evolved from a core behavior unrelated to the induction of cell death. The presence of similar proteases, termed metacaspases, in single cell organisms supports the contention that such proteins may have co-evolved or derived from a critical non-death function. Indeed, the benefit(s) for single cell life forms to retain proteins solely dedicated to self destruction would be countered by a strong selection pressure to curb or eliminate such processes. Examination of metacaspase biology provides evidence that these ancient protease forerunners of the caspase family also retain versatility in function, i.e., death and non-death cell functions. Here, we provide a critical review that highlights the non-death roles of metacaspases that have been described thus far, and the impact that these observations have for our understanding of the evolution and cellular utility of this protease family.

  5. Design, synthesis, and activity of nanocellulosic protease sensors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Here we contrast the molecular assembly, and biochemical utility of nanocellulosic materials prepared from cotton and wood as protease sensors. The cotton-based nanocellulosic substrates were prepared in a variety of ways to produce nanocrystals, films and aerogels, which were derivatized with eithe...

  6. Protease inhibitors interfere with the necessary factors of carcinogenesis.

    PubMed

    Troll, W

    1989-05-01

    Many tumor promoters are inflammatory agents that stimulate the formation of oxygen radicals (.O2-) and hydrogen peroxide (H2O2) in phagocytic neutrophils. The neutrophils use the oxygen radicals to kill bacteria, which are recognized by the cell membrane of phagocytic cells causing a signal to mount the oxygen response. The tumor promoter isolated from croton oil, 12-O-tetradecanoylphorbol-13-acetate (TPA), mimics the signal, causing an oxygen radical release that is intended to kill bacteria; instead, it injures cells in the host. Oxygen radicals cause single strand breaks in DNA and modify DNA bases. These damaging reactions appear to be related to tumor promotion, as three types of chemopreventive agents, retinoids, onion oil, and protease inhibitors, suppress the induction of oxygen radicals in phagocytic neutrophils and suppress tumor promotion in skin cancer in mice. Protease inhibitors also suppress breast and colon cancers in mice. Protease inhibitors capable of inhibiting chymotrypsin show a greater suppression of the oxygen effect and are better suppressors of tumor promotion. In addition, oxygen radicals may be one of the many agents that cause activation of oncogenes. Since retinoids and protease inhibitors suppress the expression of the ras oncogene in NIH 3T3 cells, NIH 3T3 cells may serve as a relatively facile model for finding and measuring chemopreventive agents that interfere with the carcinogenic process.

  7. Botulinum neurotoxin: a deadly protease with applications to human medicine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Botulinum neurotoxins (BoNTs) are some of the most potent biological toxins to humans. They are synthesized by the gram-positive, spore-forming bacterium Clostridium botulinum. BoNT is secreted from the bacterium as a ~150 kDa polypeptide which is cleaved by bacterial or host proteases into a ~50 kD...

  8. Processing and targeting of the thiol protease aleurain: Progress report

    SciTech Connect

    Rogers, J.C.

    1988-01-01

    This study addresses the processing and targeting of the thiol protease aleurain in monocots. A probe derived from the aleurain cDNA specific for the 5'-most 400 bp (a region encoding the first 140 amino acids of the preprotein hybridized to at least 3 separate elements in the barley genome; only one represented the aleurain gene. In contrast, a probe specific for the remaining 2/23 of the cDNA (representing the protease domain) hybridized to only a single copy sequence. To know if this pattern pertained in other, closely related, monocots, we probed Southern blots of genomic DNA from maize, rye, oats, sorghum, and pearl millet with each probe. In each instance except for maize DNA, the 5' domain probe hybridizes to several fragments in addition to those identified by the protease domain probe. Presumable the darkest hybridization in each represents the fragment carrying the sequences homologous to barley aleurain. The fragments from a given restriction enzyme identified by the protease domain probe in sorghum, millet, and maize, were indistinguishable in size indicating that the gene sequences, as well as flanking DNA, are so well conserved among the group that the location of the hexanucleotide sequences have not diverged. (3 refs., 3 figs.)

  9. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.

    PubMed

    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui

    2017-02-27

    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  10. Post-translational control of genetic circuits using Potyvirus proteases

    PubMed Central

    Fernandez-Rodriguez, Jesus; Voigt, Christopher A.

    2016-01-01

    Genetic engineering projects often require control over when a protein is degraded. To this end, we use a fusion between a degron and an inactivating peptide that can be added to the N-terminus of a protein. When the corresponding protease is expressed, it cleaves the peptide and the protein is degraded. Three protease:cleavage site pairs from Potyvirus are shown to be orthogonal and active in exposing degrons, releasing inhibitory domains and cleaving polyproteins. This toolbox is applied to the design of genetic circuits as a means to control regulator activity and degradation. First, we demonstrate that a gate can be constructed by constitutively expressing an inactivated repressor and having an input promoter drive the expression of the protease. It is also shown that the proteolytic release of an inhibitory domain can improve the dynamic range of a transcriptional gate (200-fold repression). Next, we design polyproteins containing multiple repressors and show that their cleavage can be used to control multiple outputs. Finally, we demonstrate that the dynamic range of an output can be improved (8-fold to 190-fold) with the addition of a protease-cleaved degron. Thus, controllable proteolysis offers a powerful tool for modulating and expanding the function of synthetic gene circuits. PMID:27298256

  11. Semaphorin 3C Released from a Biocompatible Hydrogel Guides and Promotes Axonal Growth of Rodent and Human Dopaminergic Neurons

    PubMed Central

    Carballo-Molina, Oscar A.; Sánchez-Navarro, Andrea; López-Ornelas, Adolfo; Lara-Rodarte, Rolando; Salazar, Patricia; Campos-Romo, Aurelio; Ramos-Mejía, Verónica

    2016-01-01

    Cell therapy in experimental models of Parkinson's disease replaces the lost dopamine neurons (DAN), but we still need improved methods to guide dopaminergic axons (DAx) of grafted neurons to make proper connections. The protein Semaphorin 3C (Sema3C) attracts DAN axons and enhances their growth. In this work, we show that the hydrogel PuraMatrix, a self-assembling peptide-based matrix, incorporates Sema3C and releases it steadily during 4 weeks. We also tested if hydrogel-delivered Sema3C attracts DAx using a system of rat midbrain explants embedded in collagen gels. We show that Sema3C released by this hydrogel attracts DAx, in a similar way to pretectum, which is known to attract growing DAN axons. We assessed the effect of Sema3C on the growth of DAx using microfluidic devices. DAN from rat midbrain or those differentiated from human embryonic stem cells showed enhanced axonal extension when exposed to hydrogel-released Sema3C, similar to soluble Sema3C. Notably, DAN of human origin express the cognate Sema3C receptors, Neuropilin1 and Neuropilin2. These results show that PuraMatrix is able to incorporate and release Sema3C, and such delivery guides and promotes the axonal growth of DAN. This biocompatible hydrogel might be useful as a Sema3C carrier for in vivo studies in parkinsonian animal models. PMID:27174503

  12. Semaphorin 3C Released from a Biocompatible Hydrogel Guides and Promotes Axonal Growth of Rodent and Human Dopaminergic Neurons.

    PubMed

    Carballo-Molina, Oscar A; Sánchez-Navarro, Andrea; López-Ornelas, Adolfo; Lara-Rodarte, Rolando; Salazar, Patricia; Campos-Romo, Aurelio; Ramos-Mejía, Verónica; Velasco, Iván

    2016-06-01

    Cell therapy in experimental models of Parkinson's disease replaces the lost dopamine neurons (DAN), but we still need improved methods to guide dopaminergic axons (DAx) of grafted neurons to make proper connections. The protein Semaphorin 3C (Sema3C) attracts DAN axons and enhances their growth. In this work, we show that the hydrogel PuraMatrix, a self-assembling peptide-based matrix, incorporates Sema3C and releases it steadily during 4 weeks. We also tested if hydrogel-delivered Sema3C attracts DAx using a system of rat midbrain explants embedded in collagen gels. We show that Sema3C released by this hydrogel attracts DAx, in a similar way to pretectum, which is known to attract growing DAN axons. We assessed the effect of Sema3C on the growth of DAx using microfluidic devices. DAN from rat midbrain or those differentiated from human embryonic stem cells showed enhanced axonal extension when exposed to hydrogel-released Sema3C, similar to soluble Sema3C. Notably, DAN of human origin express the cognate Sema3C receptors, Neuropilin1 and Neuropilin2. These results show that PuraMatrix is able to incorporate and release Sema3C, and such delivery guides and promotes the axonal growth of DAN. This biocompatible hydrogel might be useful as a Sema3C carrier for in vivo studies in parkinsonian animal models.

  13. A CHANDRA SNAPSHOT SURVEY FOR 3C RADIO GALAXIES WITH REDSHIFTS BETWEEN 0.3 AND 0.5

    SciTech Connect

    Massaro, F.; Harris, D. E.; Paggi, A.; Tremblay, G. R.; Liuzzo, E.; Bonafede, A.

    2013-05-01

    This paper contains an analysis of short Chandra observations of 19 3C sources with redshifts between 0.3 and 0.5 not previously observed in the X-rays. This sample is part of a project to obtain Chandra data for all of the extragalactic sources in the 3C catalog. Nuclear X-ray intensities as well as any X-ray emission associated with radio jet knots, hotspots, or lobes have been measured in three energy bands: soft, medium, and hard. Standard X-ray spectral analysis for the four brightest nuclei has also been performed. X-ray emission was detected for all the nuclei of the radio sources in the current sample with the exception of 3C 435A. There is one compact steep spectrum source while all the others are FR II radio galaxies. X-ray emission from two galaxy clusters (3C 19 and 3C 320), from six hotspots in four radio galaxies (3C 16, 3C 19, 3C 268.2, 3C 313), and extended X-ray emission on kiloparsec scales in 3C 187 and 3C 313, has been detected.

  14. Mast Cell Proteases as Protective and Inflammatory Mediators

    PubMed Central

    Caughey, George H.

    2014-01-01

    Proteases are the most abundant class of proteins produced by mast cells. Many of these are stored in membrane-enclosed intracellular granules until liberated by degranulating stimuli, which include cross-linking of high affinity IgE receptor FcεRI by IgE bound to multivalent allergen. Understanding and separating the functions of the proteases is important because expression differs among mast cells in different tissue locations. Differences between laboratory animals and humans in protease expression also influence the degree of confidence with which results obtained in animal models of mast cell function can be extrapolated to humans. The inflammatory potential of mast cell proteases was the first aspect of their biology to be explored and has received the most attention, in part because some of them—notably tryptases and chymases—are biomarkers of local and systemic mast cell degranulation and anaphylaxis. Although some of the proteases indeed augment allergic inflammation and are potential targets for inhibition to treat asthma and related allergic disorders, they are protective and even anti-inflammatory in some settings. For example, mast cell tryptases may protect from serious bacterial lung infections and may limit the “rubor” component of inflammation caused by vasodilating neuropeptides in the skin. Chymases help to maintain intestinal barrier function and to expel parasitic worms, and may support blood pressure during anaphylaxis by generating angiotensin II. In other life-or-death examples, carboxypeptidase A3 and other mast cell peptidases limit systemic toxicity of endogenous peptides like endothelin and neurotensin during septic peritonitis, and inactivate venom-associated peptides. On the other hand, mast cell peptidase-mediated destruction of protective cytokines, like IL-6, can enhance mortality from sepsis. Peptidases released from mast cells also influence non-mast cell proteases, such as by activating matrix metalloproteinase cascades

  15. Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

    SciTech Connect

    Fischer, Katja; Langendorf, Christopher G.; Irving, James A.; Reynolds, Simone; Willis, Charlene; Beckham, Simone; Law, Ruby H.P.; Yang, Sundy; Bashtannyk-Puhalovich, Tanya A.; McGowan, Sheena; Whisstock, James C.; Pike, Robert N.; Kemp, David J.; Buckle, Ashley M.

    2009-08-07

    The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalytically inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.

  16. Highly efficient and easy protease-mediated protein purification.

    PubMed

    Last, Daniel; Müller, Janett; Dawood, Ayad W H; Moldenhauer, Eva J; Pavlidis, Ioannis V; Bornscheuer, Uwe T

    2016-02-01

    As both research on and application of proteins are rarely focused on the resistance towards nonspecific proteases, this property remained widely unnoticed, in particular in terms of protein purification and related fields. In the present study, diverse aspects of protease-mediated protein purification (PMPP) were explored on the basis of the complementary proteases trypsin and proteinase K as well as the model proteins green fluorescent protein (GFP) from Aequorea victoria, lipase A from Candida antarctica (CAL-A), a transaminase from Aspergillus fumigatus (AspFum), quorum quenching lactonase AiiA from Bacillus sp., and an alanine dehydrogenase from Thermus thermophilus (AlaDH). While GFP and AiiA were already known to be protease resistant, the thermostable enzymes CAL-A, AspFum, and AlaDH were selected due to the documented correlation between thermostability and protease resistance. As proof of principle for PMPP, recombinant GFP remained unaffected whereas most Escherichia coli (E. coli) host proteins were degraded by trypsin. PMPP was highly advantageous compared to the widely used heat-mediated purification of commercial CAL-A. The resistance of AspFum towards trypsin was improved by rational protein design introducing point mutation R20Q. Trypsin also served as economical and efficient substitute for site-specific endopeptidases for the removal of a His-tag fused to AiiA. Moreover, proteolysis of host enzymes with interfering properties led to a strongly improved sensitivity and accuracy of the NADH assay in E. coli cell lysate for AlaDH activity measurements. Thus, PMPP is an attractive alternative to common protein purification methods and facilitates also enzyme characterization in cell lysate.

  17. Nematicidal Bacteria Associated to Pinewood Nematode Produce Extracellular Proteases

    PubMed Central

    Francisco, Romeu; Verissimo, Paula; Santos, Susana S.; Fonseca, Luís; Abrantes, Isabel M. O.; Morais, Paula V.

    2013-01-01

    Bacteria associated with the nematode Bursaphelenchus xylophilus, a pathogen of trees and the causal agent of pine wilt disease (PWD) may play a role in the disease. In order to evaluate their role (positive or negative to the tree), strains isolated from the track of nematodes from infected Pinus pinaster trees were screened, in vitro, for their nematicidal potential. The bacterial products, from strains more active in killing nematodes, were screened in order to identify and characterize the nematicidal agent. Forty-seven strains were tested and, of these, 21 strains showed capacity to produce extracellular products with nematicidal activity. All Burkholderia strains were non-toxic. In contrast, all Serratia strains except one exhibited high toxicity. Nematodes incubated with Serratia strains showed, by SEM observation, deposits of bacteria on the nematode cuticle. The most nematicidal strain, Serratia sp. A88copa13, produced proteases in the supernatant. The use of selective inhibitors revealed that a serine protease with 70 kDa was majorly responsible for the toxicity of the supernatant. This extracellular serine protease is different phylogenetically, in size and biochemically from previously described proteases. Nematicidal assays revealed differences in nematicidal activity of the proteases to different species of Bursaphelenchus, suggesting its usefulness in a primary screen of the nematodes. This study offers the basis for further investigation of PWD and brings new insights on the role bacteria play in the defense of pine trees against B. xylophilus. Understanding all the factors involved is important in order to develop strategies to control B. xylophilus dispersion. PMID:24244546

  18. The picornaviral 3C proteinases: cysteine nucleophiles in serine proteinase folds.

    PubMed

    Malcolm, B A

    1995-08-01

    The 3C proteinases are a novel group of cysteine proteinases with a serine proteinase-like fold that are responsible for the bulk of polyprotein processing in the Picornaviridae. Because members of this viral family are to blame for several ongoing global pandemic problems (rhinovirus, hepatitis A virus) as well as sporadic outbreaks of more serious pathologies (poliovirus), there has been continuing interest over the last two decades in the development of antiviral therapies. The recent determination of the structure of two of the 3C proteinases by X-ray crystallography opens the door for the application of the latest advances in computer-assisted identification and design of anti-proteinase therapeutic/chemoprophylactic agents.

  19. Effects of collision cascade density on radiation defect dynamics in 3C-SiC

    PubMed Central

    Bayu Aji, L. B.; Wallace, J. B.; Kucheyev, S. O.

    2017-01-01

    Effects of the collision cascade density on radiation damage in SiC remain poorly understood. Here, we study damage buildup and defect interaction dynamics in 3C-SiC bombarded at 100 °C with either continuous or pulsed beams of 500 keV Ne, Ar, Kr, or Xe ions. We find that bombardment with heavier ions, which create denser collision cascades, results in a decrease in the dynamic annealing efficiency and an increase in both the amorphization cross-section constant and the time constant of dynamic annealing. The cascade density behavior of these parameters is non-linear and appears to be uncorrelated. These results demonstrate clearly (and quantitatively) an important role of the collision cascade density in dynamic radiation defect processes in 3C-SiC. PMID:28304397

  20. Optical and Hubble Space Telescope ultraviolet spectropolarimetry of 3C 273 and PG 1114+445

    NASA Technical Reports Server (NTRS)

    Smith, Paul S.; Schmidt, Gary D.; Allen, Richard G.

    1993-01-01

    New optical spectropolarimetry and broad-band measurements, made during periods when the linear polarization of the quasar 3C 273 was no greater than 1 pct, are combined with ultraviolet polarization measurements made with the Faint Object Spectrograph of the Hubble Space Telescope. Very weak UV polarization during the time of observation is seen in the HST measurements, which is consistent with the completely unpolarized UV continuum and emission lines. Optical spectropolarimetry, however, reveals polarized light, the source of which is consistent with a nonthermal component, diluted by other unpolarized emission sources, such as the 'big blue bump'. Optical spectropolarimetry of the radio-quiet quasar PG 1114+445 is also presented. The polarization of this QSO is thought to result from scattering by dust external to the narrow-line region. 3C 273 and PG 1114+445 are useful in illustrating the range of polarizing mechanisms which can operate in low-polarization QSOs.

  1. Fermi large area telescope observations of blazar 3C 279 occultations by the sun

    SciTech Connect

    Barbiellini, G.; Bastieri, D.; Buson, S.; Bechtol, K.; Blandford, R. D.; Borgland, A. W.; Buehler, R.; Cameron, R. A.; Chiang, J.; Bellazzini, R.; Bregeon, J.; Bruel, P.; Caraveo, P. A.; Cavazzuti, E.; Ciprini, S.; Cecchi, C.; Chaves, R. C. G.; Cheung, C. C. E-mail: phdmitry@stanford.edu; and others

    2014-04-01

    Observations of occultations of bright γ-ray sources by the Sun may reveal predicted pair halos around blazars and/or new physics, such as, e.g., hypothetical light dark matter particles—axions. We use Fermi Gamma-Ray Space Telescope (Fermi) data to analyze four occultations of blazar 3C 279 by the Sun on October 8 each year from 2008 to 2011. A combined analysis of the observations of these occultations allows a point-like source at the position of 3C 279 to be detected with significance of ≈3σ, but does not reveal any significant excess over the flux expected from the quiescent Sun. The likelihood ratio test rules out complete transparency of the Sun to the blazar γ-ray emission at a 3σ confidence level.

  2. Grade 3C open femur fractures with vascular repair in adults.

    PubMed

    Balci, Halil I; Saglam, Yavuz; Tunali, Onur; Akgul, Turgut; Aksoy, Murat; Dikici, Fatih

    2015-06-01

    Grade 3C open femur fractures are challenging injuries with higher rates of complications. This is a retrospective review of grade 3C open femur fractures with vascular repair between 2002 and 2012. Outcomes included initial MESS score, additional injuries, duration of operation, complications, secondary operations or amputations, and social life implications. Thirty-one of 39 total patients were selected for revascularization and fracture fixation based on soft tissue injury and MESS score. The intra-operative approach included temporary arterial shunt replacement, orthopedic fixation, arterial reconstruction venous and/or nerve repair and routine fasciotomies. An external fixation and reverse saphenous vein graft was used in a majority of the patients (respectively; 93.5%, 90.3%). The mean follow up was 5.4 years (range 2.2-10). The decision to amputate versus salvage should be left up to patients and their care teams after discussing options and future possibilities rather than using a scoring system.

  3. A high state of activity of the quasar 3C454.3

    NASA Astrophysics Data System (ADS)

    Jorstad, S.; Larionov, V.; Mokrushina, A.; Troitsky, I.; Morozova, D.

    2015-08-01

    The quasar 3c454.3 shows a new state of high activity. According to the Fermi LAT Collaboration it is brighter than 1.0e-05 ph/cm2/sec at gamma-rays: TITLE: GCN/FERMI NOTICE NOTICE_DATE: Fri 21 Aug 15 14:47:48 UT NOTICE_TYPE: Fermi-LAT Monitor SOURCE_OBJ: 3C454.3 CURR_FLUX: 1.40e-05 +- 6.09e-07 [ph/cm2/sec] BASE_FLUX: 2.60e-06 +- 4.59e-07 [ph/cm2/sec] The BU group monitors the source with the VLBA at 43 GHz.

  4. Optical measurements during increased gamma-ray activity in 3C 454.3

    NASA Astrophysics Data System (ADS)

    Smith, Paul S.; Wehrle, Ann E.

    2010-04-01

    Observations obtained with the Steward Observatory 2.3m Bok Telescope show 3C 454.3 to be optically bright and highly linear polarized during a period of increased gamma-ray activity (ATel #2534). Differential spectrophotometry yield a V-band magnitude of 15.02 ± 0.02 and an R-band (Kron-Cousins bandpass) magnitude of 14.53 ± 0.01 on 2010 April 5, 12:10 UT. Spectropolarimetry of 3C 454.3 with the SPOL instrument find an average linear polarization of 9.85 ± 0.17% at a position angle of 23.0 ± 0.5 degrees over a 5000-7000 Angstrom spectral bin.

  5. Precipitation Retrievals in typhoon domain combining of FY3C MWHTS Observations and WRF Predicted Models

    NASA Astrophysics Data System (ADS)

    Jieying, HE; Shengwei, ZHANG; Na, LI

    2017-02-01

    A passive sub-millimeter precipitation retrievals algorithm is provided based on Microwave Humidity and Temperature Sounder (MWHTS) onboard the Chinese Feng Yun 3C (FY-3C) satellite. Using the validated global reference physical model NCEP/WRF/VDISORT), NCEP data per 6 hours are downloaded to run the Weather Research and Forecast model WRF, and derive the typical precipitation data from the whole world. The precipitation retrieval algorithm can operate either on land or on seawater for global. To simply the calculation procedure and save the training time, principle component analysis (PCA) was adapted to filter out the redundancy caused by scanning angle and surface effects, as well as system noise. According to the comparison and validation combing with other precipitation sources, it is demonstrated that the retrievals are reliable for surface precipitation rate higher than 0.1 mm/h at 15km resolution.

  6. Spin frustration and magnetic ordering in the Mott insulating fcc-Cs3C60

    NASA Astrophysics Data System (ADS)

    Kasahara, Yuichi; Takeuchi, Yuki; Itou, Tatsuaki; Iwasa, Yoshihiro; Arcon, Denis; Rosseinsky, Matthew; Prassides, Kosmas

    2014-03-01

    The low-temperature magnetic state at ambient pressure has been investigated by specific heat and nuclear magnetic resonance (NMR) measurements in face-centered-cubic (fcc-) Cs3C60, which is characterized by a Mott insulating state with S = 1 / 2 spins in C603- anions and a geometrical spin frustration inherent in the fcc lattice. Specific heat exhibited no sharp anomaly down to 0.4 K, but both magnetic specific heat and NMR relaxation rate revealed a broad peak around 2.5 K, indicating that the reported antiferromagnetic ordering is accompanied by a gradual freezing of electronic spins with distributed transition temperatures. These results are unexpected in the conventional fcc antiferromagnets. Interplay of geometrical frustration, orientational disorder of C60 molecules, and weak Mottness gives rise to the unique magnetic ground state in fcc-Cs3C60.

  7. Effects of collision cascade density on radiation defect dynamics in 3C-SiC

    NASA Astrophysics Data System (ADS)

    Bayu Aji, L. B.; Wallace, J. B.; Kucheyev, S. O.

    2017-03-01

    Effects of the collision cascade density on radiation damage in SiC remain poorly understood. Here, we study damage buildup and defect interaction dynamics in 3C-SiC bombarded at 100 °C with either continuous or pulsed beams of 500 keV Ne, Ar, Kr, or Xe ions. We find that bombardment with heavier ions, which create denser collision cascades, results in a decrease in the dynamic annealing efficiency and an increase in both the amorphization cross-section constant and the time constant of dynamic annealing. The cascade density behavior of these parameters is non-linear and appears to be uncorrelated. These results demonstrate clearly (and quantitatively) an important role of the collision cascade density in dynamic radiation defect processes in 3C-SiC.

  8. Time constant of defect relaxation in ion-irradiated 3C-SiC

    NASA Astrophysics Data System (ADS)

    Wallace, J. B.; Bayu Aji, L. B.; Shao, L.; Kucheyev, S. O.

    2015-05-01

    Above room temperature, the buildup of radiation damage in SiC is a dynamic process governed by the mobility and interaction of ballistically generated point defects. Here, we study the dynamics of radiation defects in 3C-SiC bombarded at 100 °C with 500 keV Ar ions, with the total ion dose split into a train of equal pulses. Damage-depth profiles are measured by ion channeling for a series of samples irradiated under identical conditions except for different durations of the passive part of the beam cycle. Results reveal an effective defect relaxation time constant of ˜ 3 ms (for second order kinetics) and a dynamic annealing efficiency of ˜ 40 % for defects in both Si and C sublattices. This demonstrates a crucial role of dynamic annealing at elevated temperatures and provides evidence of the strong coupling of defect accumulation processes in the two sublattices of 3C-SiC.

  9. Effects of collision cascade density on radiation defect dynamics in 3C-SiC.

    PubMed

    Bayu Aji, L B; Wallace, J B; Kucheyev, S O

    2017-03-17

    Effects of the collision cascade density on radiation damage in SiC remain poorly understood. Here, we study damage buildup and defect interaction dynamics in 3C-SiC bombarded at 100 °C with either continuous or pulsed beams of 500 keV Ne, Ar, Kr, or Xe ions. We find that bombardment with heavier ions, which create denser collision cascades, results in a decrease in the dynamic annealing efficiency and an increase in both the amorphization cross-section constant and the time constant of dynamic annealing. The cascade density behavior of these parameters is non-linear and appears to be uncorrelated. These results demonstrate clearly (and quantitatively) an important role of the collision cascade density in dynamic radiation defect processes in 3C-SiC.

  10. Crystal structure of Clostridium botulinum neurotoxin protease in a product-bound state: Evidence for noncanonical zinc protease activity.

    PubMed

    Segelke, Brent; Knapp, Mark; Kadkhodayan, Saloumeh; Balhorn, Rod; Rupp, Bernhard

    2004-05-04

    Clostridium botulinum neurotoxins (BoNTs), the most potent toxins known, disrupt neurotransmission through proteolysis of proteins involved in neuroexocytosis. The light chains of BoNTs are unique zinc proteases that have stringent substrate specificity and require exceptionally long substrates. We have determined the crystal structure of the protease domain from BoNT serotype A (BoNT/A). The structure reveals a homodimer in a product-bound state, with loop F242-V257 from each monomer deeply buried in its partner's catalytic site. The loop, which acts as a substrate, is oriented in reverse of the canonical direction for other zinc proteases. The Y249-Y250 peptide bond of the substrate loop is hydrolyzed, leaving the Y249 product carboxylate coordinated to the catalytic zinc. From the crystal structure of the BoNT/A protease, detailed models of noncanonical binding and proteolysis can be derived which we propose are also consistent with BoNT/A binding and proteolysis of natural substrate synaptosome-associated protein of 25 kDa (SNAP-25). The proposed BoNT/A substrate-binding mode and catalytic mechanism are markedly different from those previously proposed for the BoNT serotype B.

  11. Characterization of the Protease Activity of Detergents: Laboratory Practicals for Studying the Protease Profile and Activity of Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-01-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body…

  12. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  13. Fermi LAT detection of renewed and strong GeV activity from blazar 3C 279

    NASA Astrophysics Data System (ADS)

    Cutini, Sara

    2015-06-01

    The Large Area Telescope (LAT), one of two instruments on the Fermi Gamma-ray Space Telescope, has observed an intense gamma-ray flare from a source positionally consistent with the flat spectrum radio quasar 3C 279, also known as 3FGL J1256.1-0547 (Acero et al. 2015, APJS, 218, 23), with radio coordinates R.A.: 194.0465271 deg, Dec: -5.7893119 deg (J2000.0; Johnston et al. 1995, AJ, 110, 880).

  14. VizieR Online Data Catalog: VRIJHK photometry of 3C 279 (Sandrinelli+, 2016)

    NASA Astrophysics Data System (ADS)

    Sandrinelli, A.; Covino, S.; Dotti, M.; Treves, A.

    2016-07-01

    The starting point of the present investigation is the VRIJHK photometric observations obtained with the robotic Rapid Eye Mounting telescope (REM) at La Silla, which are described in detail in Sandrinelli et al. 2014 (cat. J/A+A/562/A79). We add to the data available in the above mentioned paper the REM photometry of 3C 279 (see Table2), which is unpublished thus far. (2 data files).

  15. An imaging and spectroscopic study of the peculiar SNR 3C397 with XMM-Newton

    NASA Astrophysics Data System (ADS)

    Safi-Harb, Samar; Franzmann, Erica

    The SNR 3C 397 has a peculiar box-like morphology with a central X-ray `hot spot' and a sharp boundary in the west. Earlier X-ray spectroscopy with ASCA and Chandra showed that the central spot is thermal in nature, that the column density increases from east to west, and that the X-ray spectrum is dominated by thermal emission from (at least) two compo-nents: a low-temperature plasma characterized by a high ionization timescale, mixed with a high-temperature, ejecta-dominated plasma (mainly Fe-K), characterized by a low ionization timescale. This, together with millimeter observations of the environs of 3C 397, led to the suggestion that 3C 397 is a ˜5 kyr old SNR expanding in an inhomogeneous medium, en-countering a molecular cloud towards the west, and evolving into a mixed-morphology SNR. Most recently, new CO observations showed that the SNR is well confined in a cavity of molec-ular gas and embedded at the edge of a molecular cloud at VLSR ˜32 km/s. The 12 CO line broadening of the 32 km/s component provided direct evidence of interaction between the SNR and a molecular cloud at the western boundary of the remnant. To date, there is no evidence of a compact object or a pulsar wind nebula associated with this remnant. We here present an XMM-Newton imaging and spectroscopic analysis of 3C 397 targeted to 1) map the ejecta distribution (in particular of Mg, Si, S and Fe) across the SNR, 2) constrain the spectral and physical properties of the supernova and its progenitor star, and 3) address the absence of a neutron star or wind nebula associated with the SNR.

  16. NMR Study of the Superconducting Gap Variation near the Mott Transition in Cs3C60

    NASA Astrophysics Data System (ADS)

    Wzietek, P.; Mito, T.; Alloul, H.; Pontiroli, D.; Aramini, M.; Riccò, M.

    2014-02-01

    Former extensive studies of superconductivity in the A3C60 compounds, where A is an alkali metal, have led one to consider that Bardeen-Cooper-Schrieffer electron-phonon pairing prevails in those compounds, though the incidence of electronic Coulomb repulsion has been highly debated. The discovery of two isomeric fulleride compounds Cs3C60 which exhibit a transition with pressure from a Mott insulator (MI) to a superconducting (SC) state clearly reopens that question. Using pressure (p) as a single control parameter of the C60 balls lattice spacing, one can now study the progressive evolution of the SC properties when the electronic correlations are increased towards the critical pressure pc of the Mott transition. We have used C13 and Cs133 NMR measurements on the cubic phase A15-Cs3C60 just above pc=5.0(3) kbar, where the SC transition temperature Tc displays a dome shape with decreasing cell volume. From the T dependence below Tc of the nuclear spin lattice relaxation rate (T1)-1 we determine the electronic excitations in the SC state, that is 2Δ, the gap value. The latter is found to be largely enhanced with respect to the Bardeen-Cooper-Schrieffer value established in the case of dense A3C60 compounds. It even increases slightly with decreasing p towards pc, where Tc decreases on the SC dome, so that 2Δ /kBTc increases regularly upon approaching the Mott transition. These results bring clear evidence that the increasing correlations near the Mott transition are not significantly detrimental to superconductivity. They rather suggest that repulsive electron interactions might even reinforce elecron-phonon superconductivity, being then partly responsible for the large Tc values, as proposed by theoretical models taking the electronic correlations as a key ingredient.

  17. 3. 'C.P. Reconstruction Rocklin to Colfax, Standard Double Track Tunnel ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. 'C.P. Reconstruction Rocklin to Colfax, Standard Double Track Tunnel Portal Stones, Wings Parallel to Center Line, Ring Stones,' Southern Pacific Standard Double-Track Tunnel, ca. 1909. Compare to photos in documentation sets for Tunnel 18 (HAER No. CA-197), Tunnel 34 (HAER No. CA-206), and Tunnel 1 (HAER No. CA-207). - Central Pacific Transcontinental Railroad, Sacramento to Nevada state line, Sacramento, Sacramento County, CA

  18. Photographic photometry of compact extragalactic objects Optical variability of the quasar 3C 345

    NASA Astrophysics Data System (ADS)

    Babadzhanyants, M. K.; Belokon, E. T.; Denisenko, N. S.; Semenova, E. V.

    1985-08-01

    The results of 11-years photographic observations of optical variability of the quasar 3C 345 are presented. A flare with a timescale of the order of one year, similar to those of 1967 and 1971, was observed in 1982. From a comparison of the obtained series of observations with those of the Rosemary Hill Observatory, a conclusion is drawn on the absence of systematic variability at a timescale of 5 - 20 hours exceeding 0m.2 in magnitude.

  19. Photographic photometry of compact extragalactic objects Optical variability of the quasar 3C 345

    SciTech Connect

    Babadzhaniants, M.K.; Belokon, E.T.; Denisenko, N.S.; Semenova, E.V.

    1985-08-01

    An 11-yr (1973-1983) program of photographic observations at the Leningrad Byurakan station is reported, tracing the optical variability of the quasar 3C 345. A roughly 1-yr flare resembling those of 1967 and 1971 occurred in 1982. Comparison with the concurrent observations at Rosemary Hill, Florida, shows no appreciable systematic B-band fluctuations on time scales of 5-20 h. 10 references.

  20. Resolution of the southern radio lobe of 3C 33 at 660 nm

    NASA Technical Reports Server (NTRS)

    Crane, Phillipe; Stiavelli, Massimo

    1992-01-01

    A strand of emission coincident with the peak in the radio emission at 2 and 6 cm was revealed by an HST planetary camera image of the southern radio lobe of 3C 33. The detailed morphological similarity between the optical and radio data conclusively confirms the common origin of the radio and optical emission. The question of whether or not the detailed correlations in emission seen in the jets can also be observed on the larger scales of radio lobes is addressed.

  1. Parsec-scale jet properties of the gamma-ray quasar 3C 286

    NASA Astrophysics Data System (ADS)

    An, T.; Lao, B.-Q.; Zhao, W.; Mohan, P.; Cheng, X.-P.; Cui, Y.-Z.; Zhang, Z.-L.

    2017-04-01

    The quasar 3C 286 is one of two compact steep-spectrum sources detected by the Fermi/Large Area Telescope. Here, we investigate the radio properties of the parsec(pc)-scale jet and its (possible) association with the gamma-ray emission in 3C 286. The Very Long Baseline Interferometry (VLBI) images at various frequencies reveal a one-sided core-jet structure extending to the south-west at a projected distance of ∼1 kpc. The component at the jet base showing an inverted spectrum is identified as the core, with a mean brightness temperature of 2.8 × 109 K. The jet bends at about 600 pc (in projection) away from the core, from a position angle of -135° to -115°. Based on the available VLBI data, we inferred the proper-motion speed of the inner jet as 0.013 ± 0.011 mas yr-1 (βapp = 0.6 ± 0.5), corresponding to a jet speed of about 0.5 c at an inclination angle of 48° between the jet and the line of sight of the observer. The brightness temperature, jet speed and Lorentz factor are much lower than those of gamma-ray-emitting blazars, implying that the pc-scale jet in 3C 286 is mildly relativistic. Unlike blazars in which gamma-ray emission is in general thought to originate from the beamed innermost jet, the location and mechanism of gamma-ray emission in 3C 286 may be different as indicated by the current radio data. Multiband spectrum fitting may offer a complementary diagnostic clue of the gamma-ray production mechanism in this source.

  2. OPTICAL MONITORING OF TWO BRIGHTEST NEARBY QUASARS, PHL 1811 AND 3C 273

    SciTech Connect

    Fan, J. H.; Liu, Y.; Yuan, Y. H.; Kurtanidze, O.; Chanishvili, R.; Richter, G. M.

    2014-08-01

    Variability is one of the most observable characteristics of active galactic nuclei, and it is important when considering the emission mechanism. In this paper, we report optical photometry monitoring of two nearby brightest quasars, PHL 1811 and 3C 273, using the ST-6 camera attached to the Newtonian focus and the Ap6E CCD camera attached to the primary focus of the 70 cm meniscus telescope at the Abastumani Observatory, Georgia. PHL 1811 was monitored during the period from 2002 September to 2012 December, while 3C 273 was monitored during the period from 1998 February to 2008 May. During our monitoring period, the two sources did not show any significant intra-day variability. The largest detected variations are ΔR = 0.112 ± 0.010 mag. for PHL 1811, ΔB = 0.595 ± 0.099 mag, ΔV = 0.369 ± 0.028 mag, ΔR = 0.495 ± 0.076 mag, and ΔI = 0.355 ± 0.009 mag for 3C 273. When the periodicity analysis methods are adopted for the observations of the sources, a period of p = 5.80 ± 1.12 yr is obtained for PHL 1811 in the R light curve in the present work, and periods of p = 21.10 ± 0.14, 10.00 ± 0.14, 7.30 ± 0.09, 13.20 ± 0.09, 2.10 ± 0.06, and 0.68 ± 0.05 yr are obtained for 3C 273 based on the data in the present work combined with historical works.

  3. The radio structure of the quasar 3C154 at decameter wavelengths

    NASA Astrophysics Data System (ADS)

    Meg'n, A. V.; Braude, S. Ya.; Rashkovskii, S. L.; Sharykyn, N. K.; Shepelev, V. A.; Inyutin, G. A.; Khristenko, A. D.; Brazhenko, A. I.; Bulatsen, V. G.

    1998-11-01

    The results of studies of the radio structure of the quasar 3C154 at 25 and 20 MHz using the URAN-1 and URAN-2 radio interferometers are presented. The object probably has a core-halo structure, consisting of a compact component with a size of about 4'' and a more extended component roughly 45'' in size, detected for the first time at these wavelengths. This extended component contributes most of the decameter emission.

  4. Fluoreno[4,3-c]fluorene: a closed-shell, fully conjugated hydrocarbon.

    PubMed

    Rose, Bradley D; Vonnegut, Chris L; Zakharov, Lev N; Haley, Michael M

    2012-05-04

    The synthesis and optoelectronic properties of 24 π-electron, formally antiaromatic 4,11-di-t-butyl-1,8-dimesitylfluoreno[4,3-c]fluorene (FF) are presented. The solid-state structure shows that the outer rings are aromatic, while the central four rings possess a bond-localized 2,6-naphthoquinone dimethide motif (in red). The biradical character of FF is assessed experimentally and computationally; the results of which implicate a closed-shell ground state.

  5. Superconductivity of Rb 3 C 60 : breakdown of the Migdal-Eliashberg theory

    NASA Astrophysics Data System (ADS)

    Cappelluti, E.; Grimaldi, C.; Pietronero, L.; Strässler, S.; Ummarino, G. A.

    2001-06-01

    In this paper, through an exhaustive analysis within the Migdal-Eliashberg theory, we show the incompatibility of experimental data of Rb3C60 with the basic assumptions of the standard theory of superconductivity. For different models of the electron-phonon spectral function α2F(Ω) we solve numerically the Eliashberg equations to find which values of the electron-phonon coupling λ, of the logarithmic phonon frequency and of the Coulomb pseudopotential μ* reproduce the experimental data of Rb3C60. We find that the solutions are essentially independent of the particular shape of α2F(Ω) and that, to explain the experimental data of Rb3C60, one has to resort to extremely large couplings: λ = 3.0+/-0.8. This results differs from the usual partial analyses reported up to now and we claim that this value exceeds the maximum allowed λ compatible with the crystal lattice stability. Moreover, we show quantitatively that the obtained values of λ and strongly violate Migdal's theorem and consequently are incompatible with the Migdal-Eliashberg theory. One has therefore to consider the generalization of the theory of superconductivity in the nonadiabatic regime to account for the experimental properties of fullerides.

  6. Feline Coronavirus 3c Protein: A Candidate for a Virulence Marker?

    PubMed Central

    Hora, A. S.; Tonietti, P. O.; Taniwaki, S. A.; Asano, K. M.; Maiorka, P.; Richtzenhain, L. J.; Brandão, P. E.

    2016-01-01

    Feline infectious peritonitis virus (FIPV) is highly virulent and responsible for the highly fatal disease feline infectious peritonitis (FIP), whereas feline enteric coronavirus (FECV) is widespread among the feline population and typically causes asymptomatic infections. Some candidates for genetic markers capable of differentiating these two pathotypes of a unique virus (feline coronavirus) have been proposed by several studies. In the present survey, in order to search for markers that can differentiate FECV and FIPV, several clones of the 3a–c, E, and M genes were sequenced from samples obtained from cats with or without FIP. All genes showed genetic diversity and suggested the presence of FCoV mutant spectrum capable of producing a virulent pathotype in an individual-specific way. In addition, all the feline coronavirus FIPV strains demonstrated a truncated 3c protein, and the 3c gene was the only observed pathotypic marker for FCoVs, showing that 3c gene is a candidate marker for the distinction between the two pathotypes when the mutant spectrum is taken into account. PMID:27243037

  7. Ni3C-assisted growth of carbon nanofibres 300 °C by thermal CVD

    NASA Astrophysics Data System (ADS)

    Yu, Bowen; Wang, Shiliang; Zhang, Qiankun; He, Yuehui; Huang, Han; Zou, Jin

    2014-08-01

    Ni-assisted thermal chemical vapor deposition (TCVD) is one of the most common techniques for the growth of carbon nanofibres/nanotubes (CNFs/CNTs). However, some fundamental issues related to the catalytic growth of CNFs/CNTs, such as the low-limit growth temperature, the limiting steps and the state of Ni, are still controversial. Here, we report the growth of CNFs at 300 °C that is the lowest temperature for the growth of CNFs by TCVD using Ni as the catalyst so far. The results showed that the Ni existed in rhombohedral Ni3C, not in the normal form of face-centered cubic Ni, and the C atoms for building the CNFs were precipitated from the (001) planes of the faceted Ni3C nanoparticles. The CNFs are believed to be formed by the decomposition-formation cycle of metastable Ni3C that has a low-limit decomposition temperature of about 300 °C. Our results strongly suggest that TCVD is a valuable tool for the synthesis of CNFs/CNTs at temperatures below 400 °C, which is generally considered as the upper-limit temperature for fabricating complementary metal oxide semiconductor devices but is the low-limit temperature for growing CNFs/CNTs by TCVD at present.

  8. Positron annihilation spectroscopy investigation of vacancy defects in neutron-irradiated 3 C -SiC

    NASA Astrophysics Data System (ADS)

    Hu, Xunxiang; Koyanagi, Takaaki; Katoh, Yutai; Wirth, Brian D.

    2017-03-01

    Positron annihilation spectroscopy characterization results for neutron-irradiated 3 C -SiC are described here, with a specific focus on explaining the size and character of vacancy clusters as a complement to the current understanding of the neutron irradiation response of 3 C -SiC. Positron annihilation lifetime spectroscopy was used to capture the irradiation temperature and dose dependence of vacancy defects in 3 C -SiC following neutron irradiation from 0.01 to 31 dpa in the temperature range from 380°C to 790°C . The neutral and negatively charged vacancy clusters were identified and quantified. The results suggest that the vacancy defects that were measured by positron annihilation spectroscopy technique contribute very little to the transient swelling of SiC. In addition, coincidence Doppler broadening measurement was used to investigate the chemical identity surrounding the positron trapping sites. It was found that silicon vacancy-related defects dominate in the studied materials and the production of the antisite defect CSi may result in an increase in the probability of positron annihilation with silicon core electrons.

  9. Mass-Analyzed Threshold Ionization and Structures of M_3C_2(M=Sc, La)

    NASA Astrophysics Data System (ADS)

    Wu, Lu; Mourad, Roudjane; Yang, D. S.

    2011-06-01

    M_3C_2 (M=Sc, La) clusters are produced by laser vaporization in a pulsed metal-cluster source and identified by photoionization mass spectrometry. Vibrationally resolved ion spectra are obtained with mass-analyzed threshold ionization (MATI) spectroscopy. The MATI spectra of M_3C_2 (M=Sc, La) exhibit a weak 0-0 transition, indicating a significant geometry difference between the neutral and ionized clusters. The ionization energies of Sc_2C_2 and La_3C_2 are measured to be 36398 (5) and 30051(5) Cm-1, respectively. In addition, the spectra of the two clusters display a number of vibrational intervals that are associated with M_3 deformations. Preliminary data analysis shows that both clusters have a C2v bi-pyramid structure in the neutral state and a D3h bi-pyramid structure in the ion state, and the spectra may be assigned to the ^1A'_1 (D3h)← ^2B_2 (C2v) transitions.

  10. Possible light-induced superconductivity in K3C60 at high temperature.

    PubMed

    Mitrano, M; Cantaluppi, A; Nicoletti, D; Kaiser, S; Perucchi, A; Lupi, S; Di Pietro, P; Pontiroli, D; Riccò, M; Clark, S R; Jaksch, D; Cavalleri, A

    2016-02-25

    The non-equilibrium control of emergent phenomena in solids is an important research frontier, encompassing effects such as the optical enhancement of superconductivity. Nonlinear excitation of certain phonons in bilayer copper oxides was recently shown to induce superconducting-like optical properties at temperatures far greater than the superconducting transition temperature, Tc (refs 4-6). This effect was accompanied by the disruption of competing charge-density-wave correlations, which explained some but not all of the experimental results. Here we report a similar phenomenon in a very different compound, K3C60. By exciting metallic K3C60 with mid-infrared optical pulses, we induce a large increase in carrier mobility, accompanied by the opening of a gap in the optical conductivity. These same signatures are observed at equilibrium when cooling metallic K3C60 below Tc (20 kelvin). Although optical techniques alone cannot unequivocally identify non-equilibrium high-temperature superconductivity, we propose this as a possible explanation of our results.

  11. Diffuse radio emission around FR II sources as exemplified by 3C452

    NASA Astrophysics Data System (ADS)

    Wiita, Paul J.; Sirothia, S. K.; Gopal-Krishna, ..

    2014-01-01

    We have discovered a pair of megaparsec size radio lobes of extremely steep spectrum straddling the well-known classical double radio source 3C452. For the past several decades 3C452 has been regarded as a textbook example of an edge-brightened double radio source of Fanaroff-Riley type II (FR II) but we show it to be a bonafide "double-double" radio galaxy (DDRG). The inner double fed by the jets has evolved into a perfectly normal FR II radio source. Thus, 3C452 presents a uniquely robust example of recurrent nuclear activity in which the restarted jets are expanding non-relativistically within the relic synchrotron plasma from an earlier active phase. This situation contrasts markedly with the strikingly narrow inner doubles observed in a few other DDRGs that have been interpreted in terms of compression of the synchrotron plasma of the relic outer lobes at the relativistic bow-shocks driven by the near ballistic propagation of the two inner jets through the relic plasma. We also present additional examples of the occurrence of faded outer lobes around well defined FRII sources, using our deep GMRT images at meter wavelengths processed with AIPS++ software. We also examine the statistics of the occurrence of such sources using a flux density limited sample. A key ramification of our findings are that they caution against the use of FR II classical double radio sources for testing cosmological models and unification schemes for active galactic nuclei.

  12. An HST Proper-motion Study of the Large-scale Jet of 3C273

    NASA Astrophysics Data System (ADS)

    Meyer, Eileen T.; Sparks, William B.; Georganopoulos, Markos; Anderson, Jay; van der Marel, Roeland; Biretta, John; Sohn, Sangmo Tony; Chiaberge, Marco; Perlman, Eric; Norman, Colin

    2016-02-01

    The radio galaxy 3C 273 hosts one of the nearest and best-studied powerful quasar jets. Having been imaged repeatedly by the Hubble Space Telescope (HST) over the past twenty years, it was chosen for an HST program to measure proper motions in the kiloparsec-scale resolved jets of nearby radio-loud active galaxies. The jet in 3C 273 is highly relativistic on sub-parsec scales, with apparent proper motions up to 15c observed by very long baseline interferometry. In contrast, we find that the kiloparsec-scale knots are compatible with being stationary, with a mean speed of -0.2 ± 0.5c over the whole jet. Assuming the knots are packets of moving plasma, an upper limit of 1c implies a bulk Lorentz factor Γ < 2.9. This suggests that the jet has either decelerated significantly by the time it reaches the kiloparsec scale, or that the knots in the jet are standing shock features. The second scenario is incompatible with the inverse Compton off the Cosmic Microwave Background (IC/CMB) model for the X-ray emission of these knots, which requires the knots to be in motion, but IC/CMB is also disfavored in the first scenario due to energetic considerations, in agreement with the recent finding of Meyer & Georganopoulos which ruled out the IC/CMB model for the X-ray emission of 3C 273 via gamma-ray upper limits.

  13. Feline Coronavirus 3c Protein: A Candidate for a Virulence Marker?

    PubMed

    Hora, A S; Tonietti, P O; Taniwaki, S A; Asano, K M; Maiorka, P; Richtzenhain, L J; Brandão, P E

    2016-01-01

    Feline infectious peritonitis virus (FIPV) is highly virulent and responsible for the highly fatal disease feline infectious peritonitis (FIP), whereas feline enteric coronavirus (FECV) is widespread among the feline population and typically causes asymptomatic infections. Some candidates for genetic markers capable of differentiating these two pathotypes of a unique virus (feline coronavirus) have been proposed by several studies. In the present survey, in order to search for markers that can differentiate FECV and FIPV, several clones of the 3a-c, E, and M genes were sequenced from samples obtained from cats with or without FIP. All genes showed genetic diversity and suggested the presence of FCoV mutant spectrum capable of producing a virulent pathotype in an individual-specific way. In addition, all the feline coronavirus FIPV strains demonstrated a truncated 3c protein, and the 3c gene was the only observed pathotypic marker for FCoVs, showing that 3c gene is a candidate marker for the distinction between the two pathotypes when the mutant spectrum is taken into account.

  14. Contemporaneous IUE, EUVE, and High-Energy Observations of 3C 273

    NASA Technical Reports Server (NTRS)

    Ramos, E.; Kafatos, M.; Fruscione, A.; Bruhweiler, F. C.; McHardy, I. M.; Hartman, R. C.; Titarchuk, L. G.; vonMontigny, C.

    1997-01-01

    We present the results of our 1994 January and 1995 January observations of the quasar 3C 273 obtained with the International Ultraviolet Explorer (IUE) and the Extreme-Ultraviolet Explorer (EUVE). These observations were part of a large multiwavelength campaign to observe 3C 273 from radio through gamma-rays. Our 1995 January photometric observations with the EUVE Lexan/B Deep Survey (DS) instrument indicate strong evidence for variability, at a 99% confidence level, during the 12 day observing period. We have utilized ROSAT PSPC soft X-ray power-law models to correlate with EUVE count rates. Besides variations in the normalization level between both observations, our EUV count rates are consistent with a simple power-law model with spectral index alpha approx. 1.77 (F(sub upsilon) proportional to upsilon(sup -alpha) that can be extrapolated from the soft X-rays to the EUV range. The active galactic nucleus 3C 273 is an important blazar to study because in our picture it reveals the presence of both disk and relativistic beam spectral contributions.

  15. Controllable magnitude and anisotropy of the electrical conductivity of Hf3C2O2 MXene

    NASA Astrophysics Data System (ADS)

    Zha, Xian-Hu; Zhou, Jie; Luo, Kan; Lang, Jiajian; Huang, Qing; Zhou, Xiaobing; Francisco, Joseph S.; He, Jian; Du, Shiyu

    2017-04-01

    Hf3C2O2, a new MXene member synthesized recently, was predicted to be a semi-metal with high mechanical strength. Based on the unique electronic structure, the energy bands and electrical conductivities of the MXene under various strains are comprehensively investigated in this paper. Biaxial and two orthogonal uniaxial strains in both compressive and tensile manners are studied. Results from this study suggest that Hf3C2O2 shows a transition between semi-metal and semi-conductor under both biaxial and uniaxial strains. A compressive strain generally induces a larger energy overlap between the conduction band minimum and the valance band maximum, while a tensile strain reduces the energy band overlap and even opens a band gap. As a consequence, the magnitude of electrical conductivity decreases drastically from compressive to tensile strains applied. Moreover, the uniaxial strains are determined to be efficient in manipulating the anisotropy of the electrical conductivity. These data imply that the Hf3C2O2 MXene is a promising candidate material for devices such as strain sensors.

  16. Multi-Epoch Multiwavelength Spectra and Models for Blazar 3C 279

    NASA Technical Reports Server (NTRS)

    Hartman, R. C.; Boettcher, M.; Aldering, G.; Aller, H.; Aller, M.; Backman, D. E.; Balonek, T. J.; Bertsch, D. L.; Bloom, S. D.; Bock, H.; White, Nicholas E. (Technical Monitor)

    2001-01-01

    Of the blazars detected by EGRET in GeV gamma-rays, 3C 279 is not only the best-observed by EGRET, but also one of the best-monitored at lower frequencies. We have assembled eleven spectra, from GHz radio through GeV gamma-rays, from the time intervals of EGRET observations. Although some of the data have appeared in previous publications, most are new, including data taken during the high states in early 1999 and early 2000. All of the spectra show substantial gamma-ray contribution to the total luminosity of the object; in a high state, the gamma-ray luminosity dominates over that at all other frequencies by a factor of more than 10. There is no clear pattern of time correlation; different bands do not always rise and fall together, even in the optical, X-ray, and gamma-ray bands. The spectra are modeled using a leptonic jet, with combined synchrotron self-Compton + external Compton gamma-ray production. Spectral variability of 3C 279 is consistent with variations of the bulk Lorentz factor of the jet, accompanied by changes in the spectral shape of the electron distribution. Our modeling results are consistent with the UV spectrum of 3C 279 being dominated by accretion disk radiation during times of low gamma-ray intensity.

  17. A short-time fading study of Al2O3:C

    NASA Astrophysics Data System (ADS)

    Nascimento, L. F.; Vanhavere, F.; Silva, E. H.; Deene, Y. De

    2015-01-01

    This paper studies the short-time fading from Al2O3:C by measuring optically stimulated luminescence (OSL) signals (Total OSL: TOSL, and Peak OSL: POSL) from droplets and Luxel™ pellets. The influence of various bleaching regimes (blue, green and white) and light power is compared. The fading effect is the decay of the OSL signal in the dark at room temperature. Al2O3:C detectors were submitted to various bleaching regimes, irradiated with a reference dose and read out after different time spans. Investigations were carried out using 2 mm size droplet detectors, made of thin Al2O3:C powder mixed with a photocured polymer. Tests were compared to Luxel™-type detectors (Landauer Inc.). Short-time post-irradiation fading is present in OSL results (TOSL and POSL) droplets for time spans up to 200 s. The effect of short-time fading can be lowered/removed when treating the detectors with high-power and/or long time bleaching regimes; this result was observed in both TOSL and POSL from droplets and Luxel™.

  18. The compact radio sources in 4C 39.25 and 3C 345. [quasars

    NASA Technical Reports Server (NTRS)

    Shaffer, D. B.; Kellermann, K. I.; Purcell, G. H.; Pauliny-Toth, I. I. K.; Preuss, E.; Witzel, A.; Graham, D.; Schilizzi, R. T.; Cohen, M. H.; Niell, A. E.

    1977-01-01

    Long-baseline interferometry of the quasars 4C 39.25 and 3C 345 at 10.65 and 14.77 GHz shows that the centimeter radio source in each object is double, with component separations of 0.0020 arcsec (4C 39.25) and 0.0013 arcsec (3C 345 at 1974.5). For each source, the separation is the same at both frequencies, as well as similar to the structure observed at 7.85 GHz (and 5.0 GHz for 4C 39.25). The spectra of the individual components are derived and shown to vary with time approximately as expected for expanding self-absorbed synchrotron sources. The magnetic fields in the components are estimated to be as high as 0.1 gauss, but the structure of the sources appears to be unrelated to the magnetic-field orientation derived from low-resolution polarization measurements. The component separation in 4C 39.25 has not changed for several years, whereas 3C 345 shows rapid expansion.

  19. The second decade of 3C technologies: detailed insights into nuclear organization

    PubMed Central

    Denker, Annette; de Laat, Wouter

    2016-01-01

    The relevance of three-dimensional (3D) genome organization for transcriptional regulation and thereby for cellular fate at large is now widely accepted. Our understanding of the fascinating architecture underlying this function is based on microscopy studies as well as the chromosome conformation capture (3C) methods, which entered the stage at the beginning of the millennium. The first decade of 3C methods rendered unprecedented insights into genome topology. Here, we provide an update of developments and discoveries made over the more recent years. As we discuss, established and newly developed experimental and computational methods enabled identification of novel, functionally important chromosome structures. Regulatory and architectural chromatin loops throughout the genome are being cataloged and compared between cell types, revealing tissue invariant and developmentally dynamic loops. Architectural proteins shaping the genome were disclosed, and their mode of action is being uncovered. We explain how more detailed insights into the 3D genome increase our understanding of transcriptional regulation in development and misregulation in disease. Finally, to help researchers in choosing the approach best tailored for their specific research question, we explain the differences and commonalities between the various 3C-derived methods. PMID:27340173

  20. S3C Active Archive Services and Capabilities Relevant to the eGY

    NASA Astrophysics Data System (ADS)

    McGuire, R.; Bilitza, D.; Candey, R.; Chimiak, R.; Cooper, J.; Fung, S.; Han, D.; Harris, B.; Johnson, R.; Kessel, R.; Klipsch, C.; Kovalick, T.; Leckner, H.; Liu, M.; Papitashvili, N.

    2005-05-01

    The next advances in Sun Solar System Connections (S3C) / Solar-Terrestrial science require an increasingly integrated and transparent data environment, where data can be easily accessed and used across the boundaries of both missions and traditional disciplines. The S3C Active Archive center in the Space Physics Data Facility (SPDF), in close coordination with the National Space Science Data Center (NSSDC), supports uniquely important multi-mission data services and archiving activities. This paper discusses the range of services supported, how they are evolving to meet the needs of programs like LWS/ILWS and the eGY initiative, and how we envision their future actively contributing to the success of the thrust towards virtual discipline-centered observatories (VxOs). The Coordinated Data Analysis [Workshop] Web (CDAWeb) and Satellite Situation Center Web (SSCWeb), critically supported by the Common Data Format (CDF) effort and supplemented by more focused services such as data format translations, COHOWeb, ATMOWeb, FTPBrowser, ModelWeb and HelioWeb, are important current examples suggestive of the scope and functionality needed in the future. These systems serve broad communities now and are already capable of significant contributions to eGY. A new Java-based CDAWeb interface integrates unified user access to this combined set, and key services have already been extended with new web services APIs to allow ready invocation from distributed external middleware and clients expected to form the framework of a new VxO infrastructure in S3C.

  1. Recombining plasma in the gamma-ray-emitting mixed-morphology supernova remnant 3C 391

    SciTech Connect

    Ergin, T.; Sezer, A.; Saha, L.; Majumdar, P.; Chatterjee, A.; Bayirli, A.; Ercan, E. N.

    2014-07-20

    A group of middle-aged mixed-morphology (MM) supernova remnants (SNRs) interacting with molecular clouds (MCs) has been discovered to be strong GeV gamma-ray emitters by the Large Area Telescope (LAT) on board the Fermi Gamma-Ray Space Telescope (Fermi-LAT). The recent observations of the Suzaku X-ray satellite have revealed that some of these interacting gamma-ray-emitting SNRs, such as IC443, W49B, W44, and G359.1-0.5, have overionized plasmas. 3C 391 (G31.9+0.0) is another Galactic MM SNR interacting with MCs. It was observed in GeV gamma rays by Fermi-LAT as well as in the 0.3-10.0 keV X-ray band by Suzaku. In this work, 3C 391 was detected in GeV gamma rays with a significance of ∼18σ and we showed that the GeV emission is point-like in nature. The GeV gamma-ray spectrum was shown to be best explained by the decay of neutral pions assuming that the protons follow a broken power-law distribution. We revealed radiative recombination structures of silicon and sulfur from 3C 391 using Suzaku data. In this paper, we discuss the possible origin of this type of radiative plasma and hadronic gamma rays.

  2. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  3. Proteases of Wood Rot Fungi with Emphasis on the Genus Pleurotus

    PubMed Central

    Inácio, Fabíola Dorneles; Ferreira, Roselene Oliveira; de Araujo, Caroline Aparecida Vaz; Brugnari, Tatiane; Castoldi, Rafael; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

    2015-01-01

    Proteases are present in all living organisms and they play an important role in physiological conditions. Cell growth and death, blood clotting, and immune defense are all examples of the importance of proteases in maintaining homeostasis. There is growing interest in proteases due to their use for industrial purposes. The search for proteases with specific characteristics is designed to reduce production costs and to find suitable properties for certain industrial sectors, as well as good producing organisms. Ninety percent of commercialized proteases are obtained from microbial sources and proteases from macromycetes have recently gained prominence in the search for new enzymes with specific characteristics. The production of proteases from saprophytic basidiomycetes has led to the identification of various classes of proteases. The genus Pleurotus has been extensively studied because of its ligninolytic enzymes. The characteristics of this genus are easy cultivation techniques, high yield, low nutrient requirements, and excellent adaptation. There are few studies in the literature about proteases of Pleurotus spp. This review gathers together information about proteases, especially those derived from basidiomycetes, and aims at stimulating further research about fungal proteases because of their physiological importance and their application in various industries such as biotechnology and medicine. PMID:26180792

  4. Identification and characterization of a chymotrypsin-like serine protease from periodontal pathogen, Tannerella forsythia.

    PubMed

    Hockensmith, K; Dillard, K; Sanders, B; Harville, B A

    2016-11-01

    Tannerella forsythia is a bacteria associated with severe periodontal disease. This study reports identification and characterization of a membrane-associated serine protease from T. forsythia. The protease was isolated from T. forsythia membrane fractions and shown to cleave both gelatin and type I collagen. The protease was able to cleave both substrates over a wide range of pH values, however optimal cleavage occurred at pH 7.5 for gelatin and 8.0 for type I collagen. The protease was also shown to cleave both gelatin and type I collagen at the average reported temperature for the gingival sulcus however it showed a lack of thermal stability with a complete loss of activity by 60 °C. When treated with protease inhibitors the enzyme's activity could only be completely inhibited by serine protease inhibitors antipain and phenylmethanesulfonyl fluoride (PMSF). Further characterization of the protease utilized serine protease synthetic peptides. The protease cleaved N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide but not Nα-benzoyl-dl-arginine p-nitroanilide (BAPNA) or N-methoxysuccinyl-Ala-Ala-Pro-Val p-nitroanilide indicating that the protease is a chymotrypsin-like serine protease. Since type I collagen is a major component in the gingival tissues and periodontal ligament, identification and characterization of this enzyme provides important information regarding the role of T. forsythia in periodontal disease.

  5. Fungal fermentation of whey incorporated with certain supplements for the production of proteases.

    PubMed

    Ashour, S A; el-Shora, H M; Metwally, M; Habib, S A

    1996-01-01

    The pattern and the extent of formation of proteases and secretion varied with the fungus, age and/or the nature of the co-supplement. Addition of yeast extract induced the best yield of proteases from both Aspergillus niger and A. terreus. Proteases from A. niger were highly induced by glutamic acid, alanine or albumin, with minor differences, whereas gelatin, peptone, aspartic acid, casein or acetamide stimulated the accumulation of proteases in the culture medium of A. terreus. Galactose stimulated the yield of the enzyme particularly with A. terreus while most C-supplements inhibited such processes, more prominently in the presence of cellulose or starch. Incorporation of nicotinic acid and wheat bran initiated the maximum productivity of proteases from A. niger and A. terreus, respectively. Co+2 and Cu+2 highly stimulated the output of proteases from A. niger and A. terreus, respectively. Co+2 and Ca+2 stimulated the enzyme activity of alkaline and acid proteases from A. terreus and acid proteases from A. niger. The other six cations and DTT inhibited variably the three proteases particularly alkaline proteases from A. terreus indicating that proteases from various sources even from closely related species showed different properties.

  6. Purification and biochemical characterization of an alkaline protease from marine bacteria Pseudoalteromonas sp. 129-1.

    PubMed

    Wu, Shimei; Liu, Ge; Zhang, Dechao; Li, Chaoxu; Sun, Chaomin

    2015-12-01

    An extracellular alkaline protease produced by marine bacteria strain Pseudoalteromonas sp. 129-1 was purified by ammonium sulphate precipitation, anion exchange chromatography, and gel filtration. The purity of the protease was confirmed by SDS-PAGE and molecular mass was estimated to be 35 kDa. The protease maintained considerable activity and stability at a wide temperature range of 10-60 °C and pH range of 6-11, and optimum activity was detected at temperature of 50 °C and pH of 8. Metallo-protease inhibitor, EDTA, had no inhibitory effect on protease activity even at concentration up to 15 mM, whereas 15 mM PMSF, a common serine protease inhibitor, greatly inactivated the protease. The high stability of the protease in the presence of surfactants (SDS, Tween 80, and Triton X-100), oxidizing agent H(2)O(2), and commercial detergents was observed. Moreover, the protease was tolerant to most of the tested organic solvents, and saline tolerant up to 30%. Interestingly, biofilm of Pseudomonas aeruginosa PAO1 was greatly reduced by 0.01 mg ml(-1) of the protease, and nearly completely abolished with the concentration of 1 mg ml(-1). Collectively, the protease showed valuable feathers as an additive in laundry detergent and non-toxic anti-biofilm agent.

  7. Copper inhibits the HIV-1 protease by both oxygen-dependent and oxygen-independent mechanisms

    SciTech Connect

    Karlstroem, A.R.; Levine, R.L. )

    1991-03-11

    The protease encoded by HIV-1 is essential for the processing of the viral polyproteins encoded by the gag and pol genes into mature viral proteins. Mutation or deletion of the protease gene blocks replication of the virus, making the protease an attractive target for antiviral therapy. The authors found that the HIV-1 protease is inhibited by micromolar concentrations of Cu{sup 2+}. Protease was 50% inhibited by exposure to 5 {mu}M copper for 5 min while exposure to 25 {mu}M caused complete inhibition. This inhibition was not oxygen-dependent and was not reversed by treatment with EDTA, presumably due to the slow off-rate of copper from the protease. Consistent with this interpretation, enzyme activity was recovered after denaturation and refolding of the copper exposed protease. Titration of the inactivated enzyme with Ellman's reagent demonstrated a loss of one of the two sulfhydryl groups present in the molecule, suggesting that copper inhibition was mediated through binding to a cysteine. This was confirmed in studies with a chemically synthesize, mutant protease in which the two cysteine residues were replaced by {alpha}-amino butyrate: The mutant protease was not inhibited by copper. However, both the wild-type and mutant protease were inactivated when exposed to copper, oxygen, and dithiothreitol. This inactivation required oxygen. Thus, the protease can also be inactivated by metal catalyzed oxidation (MCO), a presumably irreversible covalent modification.

  8. Targeting prostate carcinoma by G3-C12 peptide conjugated N-(2-hydroxypropyl)methacrylamide copolymers.

    PubMed

    Yang, Yang; Li, Lian; Zhou, Zhou; Yang, Qingqing; Liu, Chong; Huang, Yuan

    2014-10-06

    Prostate carcinoma is the second leading cause of cancer-related deaths. Increased expression of membrane-bound galectin-3 by prostate carcinoma cell has been found to correlate with more poorly differentiated and increased metastatic potential. In the present study, different amount of galectin-3-binding peptide, G3-C12 (the sequence ANTPCGPYTHDCPVKR), was attached to N-(2-hydroxypropyl)methacrylamide (HPMA) copolymers as targeting moiety. The results of qPCR and competitive binding test indicated that the expression level of galectin-3 in two metastatic prostate carcinoma cell lines (PC-3 and DU145 cells) could be significantly suppressed by the addition of G3-C12-modified HPMA copolymers (PG1 and PG2), demonstrating the high affinity of PG1 and PG2 to galectin-3. Due to the multivalent effects of moieties, the uptake of copolymers was remarkably enhanced with the increasing amount of conjugated G3-C12 peptide. A higher internalization of PG1 and PG2 occurred in PC-3 cells via caveolin- and clathrin-mediated endocytosis, whereas a clathrin-mediated uptake process was involved in DU145 cells. The in vivo biodistribution and pharmacokinetics of nonmodified ((131)I-pHPMA) and G3-C12-modified ((131)I-PG1 and (131)I-PG2) copolymers were estimated on a well-established mice model bearing PC-3 xenografts by (131)I-SPECT-imaging. Higher tumor accumulation of (131)I-PG1 (1.60 ± 0.08% ID/g, p < 0.05) and (131)I-PG2 (1.54 ± 0.06% ID/g, p < 0.05) was observed compared with (131)I-pHPMA (1.19 ± 0.04% ID/g) at 2 h post-intravenous injection. Although the amount of conjugated G3-C12 peptide performed a remarkable in vitro effect on the affinity and internalization of HPMA copolymers to the galectin-3 overexpressed prostate carcinoma cells, the molecular weight and ligand modification all play important roles on their in vivo tumor accumulation.

  9. Test results for the Oasis 3C high performance water-pumping windmill

    SciTech Connect

    Eggleston, D.M.

    1997-12-31

    The WINDTech International, L.L.C. Oasis 3C, a 3 m diameter, high-performance water-pumping windmill, was tested at the DME Engineering Wind Test Site just south of Midland, Texas from August through December, 1996. This machine utilizes a 3:1 gearbox with rotating counterweights, similar to a conventional oilfield pumping unit, driven by a multibladed rotor. The rotating counterweight system balances most of the pumping loads and reduces gear loads and starting torque by a factor of at least two and often by a factor of four or more. The torque reduction substantially extends gear and bearing life, and reduces wind speeds required for starting by 30 to 50% or more. The O3C was tested pumping from a quiescent fluid depth of 12.2 m (40 ft) from a 28.3 m (93 ft)-deep well, with additional pumping depth simulated using a pressure regulator valve system. A 9.53 cm (3.75 in.) diameter Harbison-Fischer seal-less single-acting piston pump was used to eliminate pump seal friction as a variable, and standard O3C stroke lengths of 30.5 and 15.2 cm (12 and 6 inches) were used. The regulator spring was set to give a maximum stroke rate of 33 strokes per minute. The water pumped was returned to the well after flowing through a settling tank. The tests were performed in accordance with AWEA WECS testing standards. Instrumentation provided 16 channels of data to accurately measure machine performance, including starting wind speeds, flow rates, O3C azimuth, tail furl angle, wind direction tracking errors, RPM, sucker rod loads, and other variables. The most significant performance data is summarized herein. A mathematical model of machine performance was developed that fairly accurately predicts performance for each of three test conditions. The results verify that the O3C is capable of pumping water at wind speeds from 30% to more than 50% lower than comparable un-counterbalanced units.

  10. Development of marine biotechnology as a resource for novel proteases and their role in modern biotechnology.

    PubMed

    Homaei, Ahmad; Lavajoo, Fatemeh; Sariri, Reyhaneh

    2016-07-01

    Marine environment consists of the largest sources diversified genetic pool of material with an enormous potential for a wide variety of enzymes including proteases. A protease hydrolyzes the peptide bond and most of proteases possess many industrial applications. Marine proteases differ considerably from those found in internal or external organs of invertebrates and vertebrates. In common with all enzymes, external factors such as temperature, pH and type of media are important for the activity, catalytic efficiency, stability and proper functioning of proteases. In this review valuable characteristics of proteases in marine organisms and their applications are gathered from a wide literature survey. Considering their biochemical significance and their increasing importance in biotechnology, a thorough understanding of marine proteases functioning could be of prime importance.

  11. Production of plant proteases in vivo and in vitro--a review.

    PubMed

    González-Rábade, Nuria; Badillo-Corona, Jesús Agustín; Aranda-Barradas, Juan Silvestre; Oliver-Salvador, María Del Carmen

    2011-01-01

    In the latest two decades, the interest received by plant proteases has increased significantly. Plant enzymes such as proteases are widely used in medicine and the food industry. Some proteases, like papain, bromelain and ficin are used in various processes such as brewing, meat softening, milk-clotting, cancer treatment, digestion and viral disorders. These enzymes can be obtained from their natural source or through in vitro cultures, in order to ensure a continuous source of plant enzymes. The focus of this review will be the production of plant proteases both in vivo and in vitro, with particular emphasis on the different types of commercially important plant proteases that have been isolated and characterized from naturally grown plants. In vitro approaches for the production of these proteases is also explored, focusing on the techniques that do not involve genetic transformation of the plants and the attempts that have been made in order to enhance the yield of the desired proteases.

  12. Robust substrate profiling method reveals striking differences in specificities of serum and lung fluid proteases.

    PubMed

    Watson, Douglas S; Jambunathan, Kalyani; Askew, David S; Kodukula, Krishna; Galande, Amit K

    2011-08-01

    Proteases are candidate biomarkers and therapeutic targets for many diseases. Sensitive and robust techniques are needed to quantify proteolytic activities within the complex biological milieu. We hypothesized that a combinatorial protease substrate library could be used effectively to identify similarities and differences between serum and bronchoalveolar lavage fluid (BALF), two body fluids that are clinically important for developing targeted therapies and diagnostics. We used a concise library of fluorogenic probes to map the protease substrate specificities of serum and BALF from guinea pigs. Differences in the proteolytic fingerprints of the two fluids were striking: serum proteases cleaved substrates containing cationic residues and proline, whereas BALF proteases cleaved substrates containing aliphatic and aromatic residues. Notably, cleavage of proline-containing substrates dominated all other protease activities in both human and guinea pig serum. This substrate profiling approach provides a foundation for quantitative comparisons of protease specificities between complex biological samples.

  13. Structures and energies of Cu clusters on Fe and Fe3C surfaces from density functional theory computation.

    PubMed

    Tian, Xinxin; Wang, Tao; Yang, Yong; Li, Yong-Wang; Wang, Jianguo; Jiao, Haijun

    2014-12-28

    Spin-polarized density functional theory computations have been carried out to study the stable adsorption configurations of Cun (n = 1-7, 13) on Fe and Fe3C surfaces for understanding the initial stages of copper promotion in catalysis. At low coverage, two-dimensional aggregation is more preferred over dispersion and three-dimensional aggregation on the Fe(110) and Fe(100) surfaces as well as the metallic Fe3C(010) surfaces, while dispersion is more favorable over aggregation on the Fe(111) surface. On the Fe3C(001) and Fe3C(100) surfaces with exposed iron and carbon atoms, the adsorbed Cu atoms prefer dispersion at low coverage, while aggregation along the iron regions at high coverage. On the iron surfaces, the adsorption energies of Cun (n = 2-7) are highest on Fe(111), medium on Fe(100) and lowest on Fe(110). On the Fe3C surfaces, the adsorption energies of Cun (n = 1-3) are highest on Fe3C(100), medium on Fe3C(010) and lowest on Fe3C(001), while, for n = 4-7 and 13, Fe3C(010) has stronger adsorption than Fe3C(100). On the basis of their differences in electronegativity, the adsorbed Cu atoms can oxidize the metallic Fe(110), Fe(100) and Fe3C(010) surfaces and become negatively charged. On the Fe3C(001) and Fe3C(100) surfaces with exposed iron and carbon atoms, the adsorbed Cu atoms interacting with surface carbon atoms are oxidized and positively charged. Unlike the most stable Fe(110) and Fe3C(001) surfaces, where the Fe(110) surface has stronger Cu affinity than the Fe3C(001) surface, which is in agreement with the experimental finding, the less and least stable Fe3C(010) and Fe3C(100) surfaces have stronger Cu affinities than the Fe(110) and Fe(100) surfaces. Since less stable facets are not preferably formed thermodynamically, it is crucial to prepare such surfaces to explore Cu adsorption and promotion, and this provides challenges to surface sciences.

  14. The kinesin-2 family member KIF3C regulates microtubule dynamics and is required for axon growth and regeneration.

    PubMed

    Gumy, Laura F; Chew, Daniel J; Tortosa, Elena; Katrukha, Eugene A; Kapitein, Lukas C; Tolkovsky, Aviva M; Hoogenraad, Casper C; Fawcett, James W

    2013-07-10

    Axon regeneration after injury requires the extensive reconstruction, reorganization, and stabilization of the microtubule cytoskeleton in the growth cones. Here, we identify KIF3C as a key regulator of axonal growth and regeneration by controlling microtubule dynamics and organization in the growth cone. KIF3C is developmentally regulated. Rat embryonic sensory axons and growth cones contain undetectable levels of KIF3C protein that is locally translated immediately after injury. In adult neurons, KIF3C is axonally transported from the cell body and is enriched at the growth cone where it preferentially binds to tyrosinated microtubules. Functionally, the interaction of KIF3C with EB3 is necessary for its localization at the microtubule plus-ends in the growth cone. Depletion of KIF3C in adult neurons leads to an increase in stable, overgrown and looped microtubules because of a strong decrease in the microtubule frequency of catastrophes, suggesting that KIF3C functions as a microtubule-destabilizing factor. Adult axons lacking KIF3C, by RNA interference or KIF3C gene knock-out, display an impaired axonal outgrowth in vitro and a delayed regeneration after injury both in vitro and in vivo. Murine KIF3C knock-out embryonic axons grow normally but do not regenerate after injury because they are unable to locally translate KIF3C. These data show that KIF3C is an injury-specific kinesin that contributes to axon growth and regeneration by regulating and organizing the microtubule cytoskeleton in the growth cone.

  15. Protease Substrate Profiling by N-Terminal COFRADIC.

    PubMed

    Staes, An; Van Damme, Petra; Timmerman, Evy; Ruttens, Bart; Stes, Elisabeth; Gevaert, Kris; Impens, Francis

    2017-01-01

    Detection of (neo-)N-terminal peptides is essential for identifying protease cleavage sites . We here present an update of a well-established and efficient selection method for enriching N-terminal peptides out of peptide mixtures: N-terminal COFRADIC (COmbined FRActional DIagonal Chromatography). This method is based on the old concept of diagonal chromatography, which involves a peptide modification step in between otherwise identical chromatographic separations, with this modification step finally allowing for the isolation of N-terminal peptides by longer retention of non-N-terminal peptides on the resin. N-terminal COFRADIC has been successfully applied in many protease-centric studies, as well as for studies on protein alpha-N-acetylation and on characterizing alternative translation initiation events.

  16. Acquisition of accurate data from intramolecular quenched fluorescence protease assays.

    PubMed

    Arachea, Buenafe T; Wiener, Michael C

    2017-04-01

    The Intramolecular Quenched Fluorescence (IQF) protease assay utilizes peptide substrates containing donor-quencher pairs that flank the scissile bond. Following protease cleavage, the dequenched donor emission of the product is subsequently measured. Inspection of the IQF literature indicates that rigorous treatment of systematic errors in observed fluorescence arising from inner-filter absorbance (IF) and non-specific intermolecular quenching (NSQ) is incompletely performed. As substrate and product concentrations vary during the time-course of enzyme activity, iterative solution of the kinetic rate equations is, generally, required to obtain the proper time-dependent correction to the initial velocity fluorescence data. Here, we demonstrate that, if the IQF assay is performed under conditions where IF and NSQ are approximately constant during the measurement of initial velocity for a given initial substrate concentration, then a simple correction as a function of initial substrate concentration can be derived and utilized to obtain accurate initial velocity data for analysis.

  17. A high molecular weight protease in liver cytosol.

    PubMed

    Rose, I A; Warms, J V; Hershko, A

    1979-09-10

    A high molecular weight (greater than 400,000) protease active with [3H]leucine-labeled globin has been found in the postmicrosomal fraction of mouse kidney, brain, heart, spleen, and tumor cells and is most active in liver. The presence in liver was unexpected because liver cytosol is very ineffective in the breakdown of endogenous, labeled proteins. The enzyme has a number of properties that distinguish it from known cathepsins in addition to its high molecular weight. It is most active at pH approximately 7.5. When purified, it is unstable above 20 degrees C and is stabilized by metal chelating agents such as citrate, creatine-P, and glycerate-3-P. It is an -SH protease, but its thermal instability is not affected by 1 mM dithiothreitol. The enzyme is not lysosomal.

  18. Cold Denaturation of the HIV-1 Protease Monomer.

    PubMed

    Rösner, Heike I; Caldarini, Martina; Prestel, Andreas; Vanoni, Maria A; Broglia, Ricardo A; Aliverti, Alessandro; Tiana, Guido; Kragelund, Birthe B

    2017-02-28

    The human immunodeficiency virus-1 (HIV-1) protease is a complex protein that in its active form adopts a homodimer dominated by β-sheet structures. We have discovered a cold-denatured state of the monomeric subunit of HIV-1 protease that is populated above 0 °C and therefore directly accessible to various spectroscopic approaches. Using nuclear magnetic resonance secondary chemical shifts, temperature coefficients, and protein dynamics, we suggest that the cold-denatured state populates a compact wet globule containing transient non-native-like α-helical elements. From the linearity of the temperature coefficients and the hydrodynamic radii, we propose that the overall architecture of the cold-denatured state is maintained over the temperature range studied.

  19. Neural ECM proteases in learning and synaptic plasticity.

    PubMed

    Tsilibary, Effie; Tzinia, Athina; Radenovic, Lidija; Stamenkovic, Vera; Lebitko, Tomasz; Mucha, Mariusz; Pawlak, Robert; Frischknecht, Renato; Kaczmarek, Leszek

    2014-01-01

    Recent studies implicate extracellular proteases in synaptic plasticity, learning, and memory. The data are especially strong for such serine proteases as thrombin, tissue plasminogen activator, neurotrypsin, and neuropsin as well as matrix metalloproteinases, MMP-9 in particular. The role of those enzymes in the aforementioned phenomena is supported by the experimental results on the expression patterns (at the gene expression and protein and enzymatic activity levels) and functional studies, including knockout mice, specific inhibitors, etc. Counterintuitively, the studies have shown that the extracellular proteolysis is not responsible mainly for an overall degradation of the extracellular matrix (ECM) and loosening perisynaptic structures, but rather allows for releasing signaling molecules from the ECM, transsynaptic proteins, and latent form of growth factors. Notably, there are also indications implying those enzymes in the major neuropsychiatric disorders, probably by contributing to synaptic aberrations underlying such diseases as schizophrenia, bipolar, autism spectrum disorders, and drug addiction.

  20. Intestinal proteases of free-living and parasitic astigmatid mites.

    PubMed

    Holt, Deborah C; Burgess, Stewart T G; Reynolds, Simone L; Mahmood, Wajahat; Fischer, Katja

    2013-02-01

    Among arthropod pests, mites are responsible for considerable damage to crops, humans and other animals. However, detailed physiological data on these organisms remain sparse, mainly because of their small size but possibly also because of their extreme diversity. Focusing on intestinal proteases, we draw together information from three distinct mite species that all feed on skin but have separately adapted to a free-living, a strictly ecto-parasitic and a parasitic lifestyle. A wide range of studies involving immunohistology, molecular biology, X-ray crystallography and enzyme biochemistry of mite gut proteases suggests that these creatures have diverged considerably as house dust mites, sheep scab mites and scabies mites. Each species has evolved a particular variation of a presumably ancestral repertoire of digestive enzymes that have become specifically adapted to their individual environmental requirements.