Science.gov

Sample records for 3c-like protease 3clpro

  1. X-ray structure and inhibition of 3C-like protease from porcine epidemic diarrhea virus

    DOE PAGES

    St. John, Sarah E.; Anson, Brandon J.; Mesecar, Andrew D.

    2016-05-13

    Porcine epidemic diarrhea virus (PEDV) is a coronavirus that infects pigs and can have mortality rates approaching 100% in piglets, causing serious economic impact. The 3C-like protease (3CLpro) is essential for the coronaviral life cycle and is an appealing target for the development of therapeutics. We report the expression, purification, crystallization and 2.10 angstrom X-ray structure of 3CLpro from PEDV. Analysis of the PEDV 3CLpro structure and comparison to other coronaviral 3CLpro's from the same alpha-coronavirus phylogeny shows that the overall structures and active site architectures across 3CLpro's are conserved, with the exception of a loop that comprises the proteasemore » S-2 pocket. We found a known inhibitor of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CLpro, (R)-16, to have inhibitor activity against PEDV 3CLpro, despite that SARS-3CLpro and PEDV 3CLpro share only 45.4% sequence identity. Structural comparison reveals that the majority of residues involved in (R)-16 binding to SARS-3CLpro are conserved in PEDV-3CLpro; however, the sequence variation and positional difference in the loop forming the S-2 pocket may account for large observed difference in IC50 values. In conclusion, this work advances our understanding of the subtle, but important, differences in coronaviral 3CLpro architecture and contributes to the broader structural knowledge of coronaviral 3CLpro's.« less

  2. X-Ray Structure and Inhibition of 3C-like Protease from Porcine Epidemic Diarrhea Virus

    PubMed Central

    St. John, Sarah E.; Anson, Brandon J.; Mesecar, Andrew D.

    2016-01-01

    Porcine epidemic diarrhea virus (PEDV) is a coronavirus that infects pigs and can have mortality rates approaching 100% in piglets, causing serious economic impact. The 3C-like protease (3CLpro) is essential for the coronaviral life cycle and is an appealing target for the development of therapeutics. We report the expression, purification, crystallization and 2.10 Å X-ray structure of 3CLpro from PEDV. Analysis of the PEDV 3CLpro structure and comparison to other coronaviral 3CLpro’s from the same alpha-coronavirus phylogeny shows that the overall structures and active site architectures across 3CLpro’s are conserved, with the exception of a loop that comprises the protease S2 pocket. We found a known inhibitor of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CLpro, (R)-16, to have inhibitor activity against PEDV 3CLpro, despite that SARS-3CLpro and PEDV 3CLpro share only 45.4% sequence identity. Structural comparison reveals that the majority of residues involved in (R)-16 binding to SARS-3CLpro are conserved in PEDV-3CLpro; however, the sequence variation and positional difference in the loop forming the S2 pocket may account for large observed difference in IC50 values. This work advances our understanding of the subtle, but important, differences in coronaviral 3CLpro architecture and contributes to the broader structural knowledge of coronaviral 3CLpro’s. PMID:27173881

  3. Characterization of trans- and cis-cleavage activity of the SARS coronavirus 3CLpro protease: basis for the in vitro screening of anti-SARS drugs.

    PubMed

    Lin, Cheng-Wen; Tsai, Chang-Hai; Tsai, Fuu-Jen; Chen, Pei-Jer; Lai, Chien-Chen; Wan, Lei; Chiu, Hua-Hao; Lin, Kuan-Hsun

    2004-09-10

    Severe acute respiratory syndrome (SARS) has been globally reported. A novel coronavirus (CoV), SARS-CoV, was identified as the etiological agent of the disease. SARS-CoV 3C-like protease (3CLpro) mediates the proteolytic processing of replicase polypeptides 1a and 1ab into functional proteins, playing an important role in viral replication. In this study, we demonstrated the expression of the SARS-CoV 3CLpro in Escherichia coli and Vero cells, and then characterized the in vitro trans-cleavage and the cell-based cis-cleavage by the 3CLpro. Mutational analysis of the 3CLpro demonstrated the importance of His41, Cys145, and Glu166 in the substrate-binding subsite S1 for keeping the proteolytic activity. In addition, alanine substitution of the cleavage substrates indicated that Gln-(P1) in the substrates mainly determined the cleavage efficiency. Therefore, this study not only established the quantifiable and reliable assay for the in vitro and cell-based measurement of the 3CLpro activity, but also characterized the molecular interaction of the SARS-CoV 3CLpro with the substrates. The results will be useful for the rational development of the anti-SARS drugs.

  4. Broad-Spectrum Antivirals against 3C or 3C-Like Proteases of Picornaviruses, Noroviruses, and Coronaviruses

    PubMed Central

    Kim, Yunjeong; Lovell, Scott; Tiew, Kok-Chuan; Mandadapu, Sivakoteswara Rao; Alliston, Kevin R.; Battaile, Kevin P.; Groutas, William C.

    2012-01-01

    Phylogenetic analysis has demonstrated that some positive-sense RNA viruses can be classified into the picornavirus-like supercluster, which includes picornaviruses, caliciviruses, and coronaviruses. These viruses possess 3C or 3C-like proteases (3Cpro or 3CLpro, respectively), which contain a typical chymotrypsin-like fold and a catalytic triad (or dyad) with a Cys residue as a nucleophile. The conserved key sites of 3Cpro or 3CLpro may serve as attractive targets for the design of broad-spectrum antivirals for multiple viruses in the supercluster. We previously reported the structure-based design and synthesis of potent protease inhibitors of Norwalk virus (NV), a member of the Caliciviridae family. We report herein the broad-spectrum antiviral activities of three compounds possessing a common dipeptidyl residue with different warheads, i.e., an aldehyde (GC373), a bisulfite adduct (GC376), and an α-ketoamide (GC375), against viruses that belong to the supercluster. All compounds were highly effective against the majority of tested viruses, with half-maximal inhibitory concentrations in the high nanomolar or low micromolar range in enzyme- and/or cell-based assays and with high therapeutic indices. We also report the high-resolution X-ray cocrystal structures of NV 3CLpro-, poliovirus 3Cpro-, and transmissible gastroenteritis virus 3CLpro- GC376 inhibitor complexes, which show the compound covalently bound to a nucleophilic Cys residue in the catalytic site of the corresponding protease. We conclude that these compounds have the potential to be developed as antiviral therapeutics aimed at a single virus or multiple viruses in the picornavirus-like supercluster by targeting 3Cpro or 3CLpro. PMID:22915796

  5. Coronaviruses resistant to a 3C-like protease inhibitor are attenuated for replication and pathogenesis, revealing a low genetic barrier but high fitness cost of resistance.

    PubMed

    Deng, Xufang; StJohn, Sarah E; Osswald, Heather L; O'Brien, Amornrat; Banach, Bridget S; Sleeman, Katrina; Ghosh, Arun K; Mesecar, Andrew D; Baker, Susan C

    2014-10-01

    Viral protease inhibitors are remarkably effective at blocking the replication of viruses such as human immunodeficiency virus and hepatitis C virus, but they inevitably lead to the selection of inhibitor-resistant mutants, which may contribute to ongoing disease. Protease inhibitors blocking the replication of coronavirus (CoV), including the causative agents of severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS), provide a promising foundation for the development of anticoronaviral therapeutics. However, the selection and consequences of inhibitor-resistant CoVs are unknown. In this study, we exploited the model coronavirus, mouse hepatitis virus (MHV), to investigate the genotype and phenotype of MHV quasispecies selected for resistance to a broad-spectrum CoV 3C-like protease (3CLpro) inhibitor. Clonal sequencing identified single or double mutations within the 3CLpro coding sequence of inhibitor-resistant virus. Using reverse genetics to generate isogenic viruses with mutant 3CLpros, we found that viruses encoding double-mutant 3CLpros are fully resistant to the inhibitor and exhibit a significant delay in proteolytic processing of the viral replicase polyprotein. The inhibitor-resistant viruses also exhibited postponed and reduced production of infectious virus particles. Biochemical analysis verified double-mutant 3CLpro enzyme as impaired for protease activity and exhibiting reduced sensitivity to the inhibitor and revealed a delayed kinetics of inhibitor hydrolysis and activity restoration. Furthermore, the inhibitor-resistant virus was shown to be highly attenuated in mice. Our study provides the first insight into the pathogenicity and mechanism of 3CLpro inhibitor-resistant CoV mutants, revealing a low genetic barrier but high fitness cost of resistance. Importance: RNA viruses are infamous for their ability to evolve in response to selective pressure, such as the presence of antiviral drugs. For coronaviruses such as

  6. Mechanism for Controlling the Dimer-Monomer Switch and Coupling Dimerization to Catalysis of the Severe Acute Respiratory Syndrome Coronavirus 3C-Like Protease

    SciTech Connect

    Shi,J.; Sivaraman, J.; Song, J.

    2008-01-01

    Unlike 3C protease, the severe acute respiratory syndrome coronavirus (SARS-CoV) 3C-like protease (3CLpro) is only enzymatically active as a homodimer and its catalysis is under extensive regulation by the unique extra domain. Despite intense studies, two puzzles still remain: (i) how the dimer-monomer switch is controlled and (ii) why dimerization is absolutely required for catalysis. Here we report the monomeric crystal structure of the SARS-CoV 3CLpro mutant R298A at a resolution of 1.75 Angstroms . Detailed analysis reveals that Arg298 serves as a key component for maintaining dimerization, and consequently, its mutation will trigger a cooperative switch from a dimer to a monomer. The monomeric enzyme is irreversibly inactivated because its catalytic machinery is frozen in the collapsed state, characteristic of the formation of a short 310-helix from an active-site loop. Remarkably, dimerization appears to be coupled to catalysis in 3CLpro through the use of overlapped residues for two networks, one for dimerization and another for the catalysis.

  7. Steady-state and pre-steady-state kinetic evaluation of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CLpro cysteine protease: development of an ion-pair model for catalysis.

    PubMed

    Solowiej, James; Thomson, James A; Ryan, Kevin; Luo, Chun; He, Mingying; Lou, Jihong; Murray, Brion W

    2008-02-26

    Severe acute respiratory syndrome (SARS) was a worldwide epidemic caused by a coronavirus that has a cysteine protease (3CLpro) essential to its life cycle. Steady-state and pre-steady-state kinetic methods were used with highly active 3CLpro to characterize the reaction mechanism. We show that 3CLpro has mechanistic features common and disparate to the archetypical proteases papain and chymotrypsin. The kinetic mechanism for 3CLpro-mediated ester hydrolysis, including the individual rate constants, is consistent with a simple double displacement mechanism. The pre-steady-state burst rate was independent of ester substrate concentration indicating a high commitment to catalysis. When homologous peptidic amide and ester substrates were compared, a series of interesting observations emerged. Despite a 2000-fold difference in nonenzymatic reactivity, highly related amide and ester substrates were found to have similar kinetic parameters in both the steady-state and pre-steady-state. Steady-state solvent isotope effect (SIE) studies showed an inverse SIE for the amide but not ester substrates. Evaluation of the SIE in the pre-steady-state revealed normal SIEs for both amide and ester burst rates. Proton inventory (PI) studies on amide peptide hydrolysis were consistent with two proton-transfer reactions in the transition state while the ester data was consistent with a single proton-transfer reaction. Finally, the pH-inactivation profile of 3CLpro with iodoacetamide is indicative of an ion-pair mechanism. Taken together, the data are consistent with a 3CLpro mechanism that utilizes an "electrostatic" trigger to initiate the acylation reaction, a cysteine-histidine catalytic dyad ion pair, an enzyme-facilitated release of P1, and a general base-catalyzed deacylation reaction.

  8. Assessing Activity and Inhibition of Middle East Respiratory Syndrome Coronavirus Papain-Like and 3C-Like Proteases Using Luciferase-Based Biosensors

    PubMed Central

    Kilianski, Andy; Mielech, Anna M.; Deng, Xufang

    2013-01-01

    Middle East respiratory syndrome coronavirus (MERS-CoV) is associated with an outbreak of more than 90 cases of severe pneumonia with high mortality (greater than 50%). To date, there are no antiviral drugs or specific therapies to treat MERS-CoV. To rapidly identify potential inhibitors of MERS-CoV replication, we expressed the papain-like protease (PLpro) and the 3-chymotrypsin-like protease (3CLpro) from MERS-CoV and developed luciferase-based biosensors to monitor protease activity in cells. We show that the expressed MERS-CoV PLpro recognizes and processes the canonical CoV-PLpro cleavage site RLKGG in the biosensor. However, existing CoV PLpro inhibitors were unable to block MERS-CoV PLpro activity, likely due to the divergence of the amino acid sequence in the drug binding site. To investigate MERS-CoV 3CLpro activity, we expressed the protease in context with flanking nonstructural protein 4 (nsp4) and the amino-terminal portion of nsp6 and detected processing of the luciferase-based biosensors containing the canonical 3CLpro cleavage site VRLQS. Importantly, we found that a small-molecule inhibitor that blocks replication of severe acute respiratory syndrome (SARS) CoV and murine CoV also inhibits the activity of MERS-CoV 3CLpro. Overall, the protease expression and biosensor assays developed here allow for rapid evaluation of viral protease activity and the identification of protease inhibitors. These biosensor assays can now be used to screen for MERS-CoV-specific or broad-spectrum coronavirus PLpro and 3CLpro inhibitors. PMID:23986593

  9. Potent inhibition of feline coronaviruses with peptidyl compounds targeting coronavirus 3C-like protease.

    PubMed

    Kim, Yunjeong; Mandadapu, Sivakoteswara Rao; Groutas, William C; Chang, Kyeong-Ok

    2013-02-01

    Feline coronavirus infection is common among domestic and exotic felid species and usually associated with mild or asymptomatic enteritis; however, feline infectious peritonitis (FIP) is a fatal disease of cats that is caused by systemic infection with a feline infectious peritonitis virus (FIPV), a variant of feline enteric coronavirus (FECV). Currently, there is no specific treatment approved for FIP despite the importance of FIP as the leading infectious cause of death in young cats. During the replication process, coronavirus produces viral polyproteins that are processed into mature proteins by viral proteases, the main protease (3C-like [3CL] protease) and the papain-like protease. Since the cleavages of viral polyproteins are an essential step for virus replication, blockage of viral protease is an attractive target for therapeutic intervention. Previously, we reported the generation of broad-spectrum peptidyl inhibitors against viruses that possess a 3C or 3CL protease. In this study, we further evaluated the antiviral effects of the peptidyl inhibitors against feline coronaviruses, and investigated the interaction between our protease inhibitor and a cathepsin B inhibitor, an entry blocker, against a feline coronavirus in cell culture. Herein we report that our compounds behave as reversible, competitive inhibitors of 3CL protease, potently inhibited the replication of feline coronaviruses (EC(50) in a nanomolar range) and, furthermore, combination of cathepsin B and 3CL protease inhibitors led to a strong synergistic interaction against feline coronaviruses in a cell culture system.

  10. Porcine Epidemic Diarrhea Virus 3C-Like Protease Regulates Its Interferon Antagonism by Cleaving NEMO

    PubMed Central

    Wang, Dang; Fang, Liurong; Shi, Yanling; Zhang, Huan; Gao, Li; Peng, Guiqing; Chen, Huanchun; Li, Kui

    2015-01-01

    ABSTRACT Porcine epidemic diarrhea virus (PEDV) is an enteropathogenic coronavirus causing lethal watery diarrhea in piglets. Since 2010, a PEDV variant has spread rapidly in China, and it emerged in the United States in 2013, posing significant economic and public health concerns. The ability to circumvent the interferon (IFN) antiviral response, as suggested for PEDV, promotes viral survival and regulates pathogenesis of PEDV infections, but the underlying mechanisms remain obscure. Here, we show that PEDV-encoded 3C-like protease, nsp5, is an IFN antagonist that proteolytically cleaves the nuclear transcription factor kappa B (NF-κB) essential modulator (NEMO), an essential adaptor bridging interferon-regulatory factor and NF-κB activation. NEMO is cleaved at glutamine 231 (Q231) by PEDV, and this cleavage impaired the ability of NEMO to activate downstream IFN production and to act as a signaling adaptor of the RIG-I/MDA5 pathway. Mutations specifically disrupting the cysteine protease activity of PEDV nsp5 abrogated NEMO cleavage and the inhibition of IFN induction. Structural analysis suggests that several key residues outside the catalytic sites of PEDV nsp5 probably impact NEMO cleavage by modulating potential interactions of nsp5 with their substrates. These data show that PEDV nsp5 disrupts type I IFN signaling by cleaving NEMO. Previously, we and others demonstrated that NEMO is also cleaved by 3C or 3C-like proteinases of picornavirus and artertivirus. Thus, NEMO probably represents a prime target for 3C or 3C-like proteinases of different viruses. IMPORTANCE The continued emergence and reemergence of porcine epidemic diarrhea virus (PEDV) underscore the importance of studying how this virus manipulates the immune responses of its hosts. During coevolution with its hosts, PEDV has acquired mechanisms to subvert host innate immune responses for its survival advantage. At least two proteins encoded by PEDV have been identified as interferon (IFN

  11. X-ray structure and inhibition of 3C-like protease from porcine epidemic diarrhea virus

    SciTech Connect

    St. John, Sarah E.; Anson, Brandon J.; Mesecar, Andrew D.

    2016-05-13

    Porcine epidemic diarrhea virus (PEDV) is a coronavirus that infects pigs and can have mortality rates approaching 100% in piglets, causing serious economic impact. The 3C-like protease (3CLpro) is essential for the coronaviral life cycle and is an appealing target for the development of therapeutics. We report the expression, purification, crystallization and 2.10 angstrom X-ray structure of 3CLpro from PEDV. Analysis of the PEDV 3CLpro structure and comparison to other coronaviral 3CLpro's from the same alpha-coronavirus phylogeny shows that the overall structures and active site architectures across 3CLpro's are conserved, with the exception of a loop that comprises the protease S-2 pocket. We found a known inhibitor of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CLpro, (R)-16, to have inhibitor activity against PEDV 3CLpro, despite that SARS-3CLpro and PEDV 3CLpro share only 45.4% sequence identity. Structural comparison reveals that the majority of residues involved in (R)-16 binding to SARS-3CLpro are conserved in PEDV-3CLpro; however, the sequence variation and positional difference in the loop forming the S-2 pocket may account for large observed difference in IC50 values. In conclusion, this work advances our understanding of the subtle, but important, differences in coronaviral 3CLpro architecture and contributes to the broader structural knowledge of coronaviral 3CLpro's.

  12. Porcine Epidemic Diarrhea Virus 3C-Like Protease-Mediated Nucleocapsid Processing: Possible Link to Viral Cell Culture Adaptability.

    PubMed

    Jaru-Ampornpan, Peera; Jengarn, Juggragarn; Wanitchang, Asawin; Jongkaewwattana, Anan

    2017-01-15

    Porcine epidemic diarrhea virus (PEDV) causes severe diarrhea and high mortality rates in newborn piglets, leading to massive losses to the swine industry worldwide during recent epidemics. Intense research efforts are now focusing on defining viral characteristics that confer a growth advantage, pathogenicity, or cell adaptability in order to better understand the PEDV life cycle and identify suitable targets for antiviral or vaccine development. Here, we report a unique phenomenon of PEDV nucleocapsid (N) cleavage by the PEDV-encoded 3C-like protease (3Cpro) during infection. The identification of the 3Cpro cleavage site at the C terminus of N supported previous observations that PEDV 3Cpro showed a substrate requirement slightly different from that of severe acute respiratory syndrome coronavirus (SARS-CoV) 3Cpro and revealed a greater flexibility in its substrate recognition site. This cleavage motif is present in the majority of cell culture-adapted PEDV strains but is missing in emerging field isolates. Remarkably, reverse-genetics-derived cell culture-adapted PEDVAVCT12 harboring uncleavable N displayed growth retardation in Vero E6-APN cells compared to the wild-type virus. These observations altogether shed new light on the investigation and characterization of the PEDV nucleocapsid protein and its possible link to cell culture adaptation.

  13. Design, synthesis and crystallographic analysis of nitrile-based broad-spectrum peptidomimetic inhibitors for coronavirus 3C-like proteases.

    PubMed

    Chuck, Chi-Pang; Chen, Chao; Ke, Zhihai; Wan, David Chi-Cheong; Chow, Hak-Fun; Wong, Kam-Bo

    2013-01-01

    Coronaviral infection is associated with up to 5% of respiratory tract diseases. The 3C-like protease (3CL(pro)) of coronaviruses is required for proteolytic processing of polyproteins and viral replication, and is a promising target for the development of drugs against coronaviral infection. We designed and synthesized four nitrile-based peptidomimetic inhibitors with different N-terminal protective groups and different peptide length, and examined their inhibitory effect on the in-vitro enzymatic activity of 3CL(pro) of severe-acute-respiratory-syndrome-coronavirus. The IC(50) values of the inhibitors were in the range of 4.6-49 μM, demonstrating that the nitrile warhead can effectively inactivate the 3CL(pro) autocleavage process. The best inhibitor, Cbz-AVLQ-CN with an N-terminal carbobenzyloxy group, was ~10x more potent than the other inhibitors tested. Crystal structures of the enzyme-inhibitor complexes showed that the nitrile warhead inhibits 3CL(pro) by forming a covalent bond with the catalytic Cys145 residue, while the AVLQ peptide forms a number of favourable interactions with the S1-S4 substrate-binding pockets. We have further showed that the peptidomimetic inhibitor, Cbz-AVLQ-CN, has broad-spectrum inhibition against 3CL(pro) from human coronavirus strains 229E, NL63, OC43, HKU1, and infectious bronchitis virus, with IC(50) values ranging from 1.3 to 3.7 μM, but no detectable inhibition against caspase-3. In summary, we have shown that the nitrile-based peptidomimetic inhibitors are effective against 3CL(pro), and they inhibit 3CL(pro) from a broad range of coronaviruses. Our results provide further insights into the future design of drugs that could serve as a first line defence against coronaviral infection.

  14. 3C-like protease of rabbit hemorrhagic disease virus: identification of cleavage sites in the ORF1 polyprotein and analysis of cleavage specificity.

    PubMed Central

    Wirblich, C; Sibilia, M; Boniotti, M B; Rossi, C; Thiel, H J; Meyers, G

    1995-01-01

    Rabbit hemorrhagic disease virus, a positive-stranded RNA virus of the family Caliciviridae, encodes a trypsin-like cysteine protease as part of a large polyprotein. Upon expression in Escherichia coli, the protease releases itself from larger precursors by proteolytic cleavages at its N and C termini. Both cleavage sites were determined by N-terminal sequence analysis of the cleavage products. Cleavage at the N terminus of the protease occurred with high efficiency at an EG dipeptide at positions 1108 and 1109. Cleavage at the C terminus of the protease occurred with low efficiency at an ET dipeptide at positions 1251 and 1252. To study the cleavage specificity of the protease, amino acid substitutions were introduced at the P2, P1, and P1' positions at the cleavage site at the N-terminal boundary of the protease. This analysis showed that the amino acid at the P1 position is the most important determinant for substrate recognition. Only glutamic acid, glutamine, and aspartic acid were tolerated at this position. At the P1' position, glycine, serine, and alanine were the preferred substrates of the protease, but a number of amino acids with larger side chains were also tolerated. Substitutions at the P2 position had only little effect on the cleavage efficiency. Cell-free expression of the C-terminal half of the ORF1 polyprotein showed that the protease catalyzes cleavage at the junction of the RNA polymerase and the capsid protein. An EG dipeptide at positions 1767 and 1768 was identified as the putative cleavage site. Our data show that rabbit hemorrhagic disease virus encodes a trypsin-like cysteine protease that is similar to 3C proteases with regard to function and specificity but is more similar to 2A proteases with regard to size. PMID:7474137

  15. Synthesis, modification and docking studies of 5-sulfonyl isatin derivatives as SARS-CoV 3C-like protease inhibitors.

    PubMed

    Liu, Wei; Zhu, He-Min; Niu, Guo-Jun; Shi, En-Zhi; Chen, Jie; Sun, Bo; Chen, Wei-Qiang; Zhou, Hong-Gang; Yang, Cheng

    2014-01-01

    The Severe Acute Respiratory Syndrome (SARS) is a serious life-threatening and strikingly mortal respiratory illness caused by SARS-CoV. SARS-CoV which contains a chymotrypsin-like main protease analogous to that of the main picornavirus protease, 3CL(pro). 3CL(pro) plays a pivotal role in the viral replication cycle and is a potential target for SARS inhibitor development. A series of isatin derivatives as possible SARS-CoV 3CL(pro) inhibitors was designed, synthesized, and evaluated by in vitro protease assay using fluorogenic substrate peptide, in which several showed potent inhibition against the 3CL(pro). Structure-activity relationship was analyzed, and possible binding interaction modes were proposed by molecular docking studies. Among all compounds, 8k₁ showed most potent inhibitory activity against 3CL(pro) (IC₅₀=1.04 μM). These results indicated that these inhibitors could be potentially developed into anti-SARS drugs.

  16. Conformational Flexibility of a Short Loop near the Active Site of the SARS-3CLpro is Essential to Maintain Catalytic Activity

    PubMed Central

    Li, Chunmei; Teng, Xin; Qi, Yifei; Tang, Bo; Shi, Hailing; Ma, Xiaomin; Lai, Luhua

    2016-01-01

    The SARS 3C-like proteinase (SARS-3CLpro), which is the main proteinase of the SARS coronavirus, is essential to the virus life cycle. This enzyme has been shown to be active as a dimer in which only one protomer is active. However, it remains unknown how the dimer structure maintains an active monomer conformation. It has been observed that the Ser139-Leu141 loop forms a short 310-helix that disrupts the catalytic machinery in the inactive monomer structure. We have tried to disrupt this helical conformation by mutating L141 to T in the stable inactive monomer G11A/R298A/Q299A. The resulting tetra-mutant G11A/L141T/R298A/Q299A is indeed enzymatically active as a monomer. Molecular dynamics simulations revealed that the L141T mutation disrupts the 310-helix and helps to stabilize the active conformation. The coil-310-helix conformational transition of the Ser139-Leu141 loop serves as an enzyme activity switch. Our study therefore indicates that the dimer structure can stabilize the active conformation but is not a required structure in the evolution of the active enzyme, which can also arise through simple mutations. PMID:26879383

  17. Conformational Flexibility of a Short Loop near the Active Site of the SARS-3CLpro is Essential to Maintain Catalytic Activity

    NASA Astrophysics Data System (ADS)

    Li, Chunmei; Teng, Xin; Qi, Yifei; Tang, Bo; Shi, Hailing; Ma, Xiaomin; Lai, Luhua

    2016-02-01

    The SARS 3C-like proteinase (SARS-3CLpro), which is the main proteinase of the SARS coronavirus, is essential to the virus life cycle. This enzyme has been shown to be active as a dimer in which only one protomer is active. However, it remains unknown how the dimer structure maintains an active monomer conformation. It has been observed that the Ser139-Leu141 loop forms a short 310-helix that disrupts the catalytic machinery in the inactive monomer structure. We have tried to disrupt this helical conformation by mutating L141 to T in the stable inactive monomer G11A/R298A/Q299A. The resulting tetra-mutant G11A/L141T/R298A/Q299A is indeed enzymatically active as a monomer. Molecular dynamics simulations revealed that the L141T mutation disrupts the 310-helix and helps to stabilize the active conformation. The coil-310-helix conformational transition of the Ser139-Leu141 loop serves as an enzyme activity switch. Our study therefore indicates that the dimer structure can stabilize the active conformation but is not a required structure in the evolution of the active enzyme, which can also arise through simple mutations.

  18. Cinanserin is an inhibitor of the 3C-like proteinase of severe acute respiratory syndrome coronavirus and strongly reduces virus replication in vitro.

    PubMed

    Chen, Lili; Gui, Chunshan; Luo, Xiaomin; Yang, Qingang; Günther, Stephan; Scandella, Elke; Drosten, Christian; Bai, Donglu; He, Xichang; Ludewig, Burkhard; Chen, Jing; Luo, Haibin; Yang, Yiming; Yang, Yifu; Zou, Jianping; Thiel, Volker; Chen, Kaixian; Shen, Jianhua; Shen, Xu; Jiang, Hualiang

    2005-06-01

    The 3C-like proteinase (3CLpro) of severe acute respiratory syndrome-associated coronavirus (SARS-CoV) is one of the most promising targets for anti-SARS-CoV drugs due to its crucial role in the viral life cycle. In this study, a database containing structural information of more than 8,000 existing drugs was virtually screened by a docking approach to identify potential binding molecules of SARS-CoV 3CLpro. As a target for screening, both a homology model and the crystallographic structure of the binding pocket of the enzyme were used. Cinanserin (SQ 10,643), a well-characterized serotonin antagonist that has undergone preliminary clinical testing in humans in the 1960s, showed a high score in the screening and was chosen for further experimental evaluation. Binding of both cinanserin and its hydrochloride to bacterially expressed 3CLpro of SARS-CoV and the related human coronavirus 229E (HCoV-229E) was demonstrated by surface plasmon resonance technology. The catalytic activity of both enzymes was inhibited with 50% inhibitory concentration (IC50) values of 5 microM, as tested with a fluorogenic substrate. The antiviral activity of cinanserin was further evaluated in tissue culture assays, namely, a replicon system based on HCoV-229E and quantitative test assays with infectious SARS-CoV and HCoV-229E. All assays revealed a strong inhibition of coronavirus replication at nontoxic drug concentrations. The level of virus RNA and infectious particles was reduced by up to 4 log units, with IC50 values ranging from 19 to 34 microM. These findings demonstrate that the old drug cinanserin is an inhibitor of SARS-CoV replication, acting most likely via inhibition of the 3CL proteinase.

  19. SARS-CoV 3CL protease cleaves its C-terminal autoprocessing site by novel subsite cooperativity

    PubMed Central

    Muramatsu, Tomonari; Takemoto, Chie; Kim, Yong-Tae; Wang, Hongfei; Nishii, Wataru; Terada, Takaho; Shirouzu, Mikako

    2016-01-01

    The 3C-like protease (3CLpro) of severe acute respiratory syndrome coronavirus (SARS-CoV) cleaves 11 sites in the polyproteins, including its own N- and C-terminal autoprocessing sites, by recognizing P4–P1 and P1′. In this study, we determined the crystal structure of 3CLpro with the C-terminal prosequence and the catalytic-site C145A mutation, in which the enzyme binds the C-terminal prosequence of another molecule. Surprisingly, Phe at the P3′ position [Phe(P3′)] is snugly accommodated in the S3′ pocket. Mutations of Phe(P3′) impaired the C-terminal autoprocessing, but did not affect N-terminal autoprocessing. This difference was ascribed to the P2 residue, Phe(P2) and Leu(P2), in the C- and N-terminal sites, as follows. The S3′ subsite is formed by Phe(P2)-induced conformational changes of 3CLpro and the direct involvement of Phe(P2) itself. In contrast, the N-terminal prosequence with Leu(P2) does not cause such conformational changes for the S3′ subsite formation. In fact, the mutation of Phe(P2) to Leu in the C-terminal autoprocessing site abolishes the dependence on Phe(P3′). These mechanisms explain why Phe is required at the P3' position when the P2 position is occupied by Phe rather than Leu, which reveals a type of subsite cooperativity. Moreover, the peptide consisting of P4–P1 with Leu(P2) inhibits protease activity, whereas that with Phe(P2) exhibits a much smaller inhibitory effect, because Phe(P3′) is missing. Thus, this subsite cooperativity likely exists to avoid the autoinhibition of the enzyme by its mature C-terminal sequence, and to retain the efficient C-terminal autoprocessing by the use of Phe(P2). PMID:27799534

  20. Potential Broad Spectrum Inhibitors of the Coronavirus 3CLpro: A Virtual Screening and Structure-Based Drug Design Study

    PubMed Central

    Berry, Michael; Fielding, Burtram C.; Gamieldien, Junaid

    2015-01-01

    Human coronaviruses represent a significant disease burden; however, there is currently no antiviral strategy to combat infection. The outbreak of severe acute respiratory syndrome (SARS) in 2003 and Middle East respiratory syndrome (MERS) less than 10 years later demonstrates the potential of coronaviruses to cross species boundaries and further highlights the importance of identifying novel lead compounds with broad spectrum activity. The coronavirus 3CLpro provides a highly validated drug target and as there is a high degree of sequence homology and conservation in main chain architecture the design of broad spectrum inhibitors is viable. The ZINC drugs-now library was screened in a consensus high-throughput pharmacophore modeling and molecular docking approach by Vina, Glide, GOLD and MM-GBSA. Molecular dynamics further confirmed results obtained from structure-based techniques. A highly defined hit-list of 19 compounds was identified by the structure-based drug design methodologies. As these compounds were extensively validated by a consensus approach and by molecular dynamics, the likelihood that at least one of these compounds is bioactive is excellent. Additionally, the compounds segregate into 15 significantly dissimilar (p < 0.05) clusters based on shape and features, which represent valuable scaffolds that can be used as a basis for future anti-coronaviral inhibitor discovery experiments. Importantly though, the enriched subset of 19 compounds identified from the larger library has to be validated experimentally. PMID:26694449

  1. Reversal of the Progression of Fatal Coronavirus Infection in Cats by a Broad-Spectrum Coronavirus Protease Inhibitor

    PubMed Central

    Kim, Yunjeong; Liu, Hongwei; Galasiti Kankanamalage, Anushka C.; Weerasekara, Sahani; Hua, Duy H.; Groutas, William C.; Chang, Kyeong-Ok; Pedersen, Niels C.

    2016-01-01

    Coronaviruses infect animals and humans causing a wide range of diseases. The diversity of coronaviruses in many mammalian species is contributed by relatively high mutation and recombination rates during replication. This dynamic nature of coronaviruses may facilitate cross-species transmission and shifts in tissue or cell tropism in a host, resulting in substantial change in virulence. Feline enteric coronavirus (FECV) causes inapparent or mild enteritis in cats, but a highly fatal disease, called feline infectious peritonitis (FIP), can arise through mutation of FECV to FIP virus (FIPV). The pathogenesis of FIP is intimately associated with immune responses and involves depletion of T cells, features shared by some other coronaviruses like Severe Acute Respiratory Syndrome Coronavirus. The increasing risks of highly virulent coronavirus infections in humans or animals call for effective antiviral drugs, but no such measures are yet available. Previously, we have reported the inhibitors that target 3C-like protease (3CLpro) with broad-spectrum activity against important human and animal coronaviruses. Here, we evaluated the therapeutic efficacy of our 3CLpro inhibitor in laboratory cats with FIP. Experimental FIP is 100% fatal once certain clinical and laboratory signs become apparent. We found that antiviral treatment led to full recovery of cats when treatment was started at a stage of disease that would be otherwise fatal if left untreated. Antiviral treatment was associated with a rapid improvement in fever, ascites, lymphopenia and gross signs of illness and cats returned to normal health within 20 days or less of treatment. Significant reduction in viral titers was also observed in cats. These results indicate that continuous virus replication is required for progression of immune-mediated inflammatory disease of FIP. These findings may provide important insights into devising therapeutic strategies and selection of antiviral compounds for further

  2. Reversal of the Progression of Fatal Coronavirus Infection in Cats by a Broad-Spectrum Coronavirus Protease Inhibitor.

    PubMed

    Kim, Yunjeong; Liu, Hongwei; Galasiti Kankanamalage, Anushka C; Weerasekara, Sahani; Hua, Duy H; Groutas, William C; Chang, Kyeong-Ok; Pedersen, Niels C

    2016-03-01

    Coronaviruses infect animals and humans causing a wide range of diseases. The diversity of coronaviruses in many mammalian species is contributed by relatively high mutation and recombination rates during replication. This dynamic nature of coronaviruses may facilitate cross-species transmission and shifts in tissue or cell tropism in a host, resulting in substantial change in virulence. Feline enteric coronavirus (FECV) causes inapparent or mild enteritis in cats, but a highly fatal disease, called feline infectious peritonitis (FIP), can arise through mutation of FECV to FIP virus (FIPV). The pathogenesis of FIP is intimately associated with immune responses and involves depletion of T cells, features shared by some other coronaviruses like Severe Acute Respiratory Syndrome Coronavirus. The increasing risks of highly virulent coronavirus infections in humans or animals call for effective antiviral drugs, but no such measures are yet available. Previously, we have reported the inhibitors that target 3C-like protease (3CLpro) with broad-spectrum activity against important human and animal coronaviruses. Here, we evaluated the therapeutic efficacy of our 3CLpro inhibitor in laboratory cats with FIP. Experimental FIP is 100% fatal once certain clinical and laboratory signs become apparent. We found that antiviral treatment led to full recovery of cats when treatment was started at a stage of disease that would be otherwise fatal if left untreated. Antiviral treatment was associated with a rapid improvement in fever, ascites, lymphopenia and gross signs of illness and cats returned to normal health within 20 days or less of treatment. Significant reduction in viral titers was also observed in cats. These results indicate that continuous virus replication is required for progression of immune-mediated inflammatory disease of FIP. These findings may provide important insights into devising therapeutic strategies and selection of antiviral compounds for further

  3. The SARS-coronavirus papain-like protease: structure, function and inhibition by designed antiviral compounds.

    PubMed

    Báez-Santos, Yahira M; St John, Sarah E; Mesecar, Andrew D

    2015-03-01

    Over 10 years have passed since the deadly human coronavirus that causes severe acute respiratory syndrome (SARS-CoV) emerged from the Guangdong Province of China. Despite the fact that the SARS-CoV pandemic infected over 8500 individuals, claimed over 800 lives and cost billions of dollars in economic loss worldwide, there still are no clinically approved antiviral drugs, vaccines or monoclonal antibody therapies to treat SARS-CoV infections. The recent emergence of the deadly human coronavirus that causes Middle East respiratory syndrome (MERS-CoV) is a sobering reminder that new and deadly coronaviruses can emerge at any time with the potential to become pandemics. Therefore, the continued development of therapeutic and prophylactic countermeasures to potentially deadly coronaviruses is warranted. The coronaviral proteases, papain-like protease (PLpro) and 3C-like protease (3CLpro), are attractive antiviral drug targets because they are essential for coronaviral replication. Although the primary function of PLpro and 3CLpro are to process the viral polyprotein in a coordinated manner, PLpro has the additional function of stripping ubiquitin and ISG15 from host-cell proteins to aid coronaviruses in their evasion of the host innate immune responses. Therefore, targeting PLpro with antiviral drugs may have an advantage in not only inhibiting viral replication but also inhibiting the dysregulation of signaling cascades in infected cells that may lead to cell death in surrounding, uninfected cells. This review provides an up-to-date discussion on the SARS-CoV papain-like protease including a brief overview of the SARS-CoV genome and replication followed by a more in-depth discussion on the structure and catalytic mechanism of SARS-CoV PLpro, the multiple cellular functions of SARS-CoV PLpro, the inhibition of SARS-CoV PLpro by small molecule inhibitors, and the prospect of inhibiting papain-like protease from other coronaviruses. This paper forms part of a series of

  4. Discovery of N-(benzo[1,2,3]triazol-1-yl)-N-(benzyl)acetamido)phenyl) carboxamides as severe acute respiratory syndrome coronavirus (SARS-CoV) 3CLpro inhibitors: identification of ML300 and non-covalent nanomolar inhibitors with an induced-fit binding

    PubMed Central

    Turlington, Mark; Chun, Aspen; Tomar, Sakshi; Eggler, Aimee; Grum-Tokars, Valerie; Jacobs, Jon; Daniels, J. Scott; Dawson, Eric; Saldanha, Adrian; Chase, Peter; Baez-Santos, Yahira M.; Lindsley, Craig W.; Hodder, Peter; Mesecar, Andrew; Stauffer, Shaun R.

    2013-01-01

    Herein we report the discovery and SAR of a novel series of SARS-CoV 3CLpro inhibitors identified through the NIH Molecular Libraries Probe Production Centers Network (MLPCN). In addition to ML188, ML300 represents the second probe declared for 3CLpro from this collaborative effort. The X-ray structure of SARS-CoV 3CLpro bound with a ML300 analog highlights a unique induced-fit reorganization of the S2-S4 binding pockets leading to the first sub-micromolar non-covalent 3CLpro inhibitors retaining a single amide bond. PMID:24080461

  5. Development of Broad-Spectrum Halomethyl Ketone Inhibitors Against Coronavirus Main Protease 3CL(pro)

    SciTech Connect

    Bacha,U.; Barilla, J.; Gabelli, S.; Kiso, Y.; Amzel, L.; Freire, E.

    2008-01-01

    Coronaviruses comprise a large group of RNA viruses with diverse host specificity. The emergence of highly pathogenic strains like the SARS coronavirus (SARS-CoV), and the discovery of two new coronaviruses, NL-63 and HKU1, corroborates the high rate of mutation and recombination that have enabled them to cross species barriers and infect novel hosts. For that reason, the development of broad-spectrum antivirals that are effective against several members of this family is highly desirable. This goal can be accomplished by designing inhibitors against a target, such as the main protease 3CLpro (Mpro), which is highly conserved among all coronaviruses. Here 3CLpro derived from the SARS-CoV was used as the primary target to identify a new class of inhibitors containing a halomethyl ketone warhead. The compounds are highly potent against SARS 3CLpro with Ki's as low as 300 nm. The crystal structure of the complex of one of the compounds with 3CLpro indicates that this inhibitor forms a thioether linkage between the halomethyl carbon of the warhead and the catalytic Cys 145. Furthermore, Structure Activity Relationship (SAR) studies of these compounds have led to the identification of a pharmacophore that accurately defines the essential molecular features required for the high affinity.

  6. Discovery, Synthesis, And Structure-Based Optimization of a Series of N-(tert-Butyl)-2-(N-arylamido)-2-(pyridin-3-yl) Acetamides (ML188) as Potent Noncovalent Small Molecule Inhibitors of the Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) 3CL Protease

    SciTech Connect

    Jacobs, Jon; Grum-Tokars, Valerie; Zhou, Ya; Turlington, Mark; Saldanha, S. Adrian; Chase, Peter; Eggler, Aimee; Dawson, Eric S.; Baez-Santos, Yahira M.; Tomar, Sakshi; Mielech, Anna M.; Baker, Susan C.; Lindsley, Craig W.; Hodder, Peter; Mesecar, Andrew; Stauffer, Shaun R.

    2012-12-11

    A high-throughput screen of the NIH molecular libraries sample collection and subsequent optimization of a lead dipeptide-like series of severe acute respiratory syndrome (SARS) main protease (3CLpro) inhibitors led to the identification of probe compound ML188 (16-(R), (R)-N-(4-(tert-butyl)phenyl)-N-(2-(tert-butylamino)-2-oxo-1-(pyridin-3-yl)ethyl)furan-2-carboxamide, Pubchem CID: 46897844). But, unlike the majority of reported coronavirus 3CLpro inhibitors that act via covalent modification of the enzyme, 16-(R) is a noncovalent SARS-CoV 3CLpro inhibitor with moderate MW and good enzyme and antiviral inhibitory activity. A multicomponent Ugi reaction was utilized to rapidly explore structure–activity relationships within S1', S1, and S2enzyme binding pockets. Moreover, the X-ray structure of SARS-CoV 3CLpro bound with 16-(R) was instrumental in guiding subsequent rounds of chemistry optimization. 16-(R) provides an excellent starting point for the further design and refinement of 3CLpro inhibitors that act by a noncovalent mechanism of action.

  7. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  8. The N-terminal octapeptide acts as a dimerization inhibitor of SARS coronavirus 3C-like proteinase.

    PubMed

    Wei, Ping; Fan, Keqiang; Chen, Hao; Ma, Liang; Huang, Changkang; Tan, Lei; Xi, Dong; Li, Chunmei; Liu, Ying; Cao, Aoneng; Lai, Luhua

    2006-01-20

    The 3C-like proteinase of severe acute respiratory syndrome (SARS) coronavirus has been proposed to be a key target for structural-based drug design against SARS. Accurate determination of the dimer dissociation constant and the role of the N-finger (residues 1-7) will provide more insights into the enzyme catalytic mechanism of SARS 3CL proteinase. The dimer dissociation constant of the wild-type protein was determined to be 14.0microM by analytical ultracentrifugation method. The N-finger fragment of the enzyme plays an important role in enzyme dimerization as shown in the crystal structure. Key residues in the N-finger have been studied by site-directed mutagenesis, enzyme assay, and analytical ultracentrifugation. A single mutation of M6A was found to be critical to maintain the dimer structure of the enzyme. The N-terminal octapeptide N8 and its mutants were also synthesized and tested for their potency as dimerization inhibitors. Peptide cleavage assay confirms that peptide N8 is a dimerization inhibitor with a K(i) of 2.20mM. The comparison of the inhibitory activities of N8 and its mutants indicates that the hydrophobic interaction of Met-6 and the electrostatic interaction of Arg-4 contribute most for inhibitor binding. This study describes the first example of inhibitors targeting the dimeric interface of SARS 3CL proteinase, providing a novel strategy for drug design against SARS and other coronaviruses.

  9. X-ray structure and inhibition of the feline infectious peritonitis virus 3C-like protease: Structural implications for drug design.

    PubMed

    St John, Sarah E; Therkelsen, Matthew D; Nyalapatla, Prasanth R; Osswald, Heather L; Ghosh, Arun K; Mesecar, Andrew D

    2015-11-15

    Feline infectious peritonitis (FIP) is a deadly disease that effects both domestic and wild cats and is caused by a mutation in feline coronavirus (FCoV) that allows the virus to replicate in macrophages. Currently, there are no treatments or vaccines available for the treatment of FIP even though it kills approximately 5% of cats in multi-cat households per year. In an effort to develop small molecule drugs targeting FIP for the treatment of cats, we screened a small set of designed peptidomimetic inhibitors for inhibition of FIPV-3CL(pro), identifying two compounds with low to sub-micromolar inhibition, compound 6 (IC50=0.59±0.06 μM) and compound 7 (IC50=1.3±0.1 μM). We determined the first X-ray crystal structure of FIPV-3CL(pro) in complex with the best inhibitor identified, compound 6, to a resolution of 2.10 Å to better understand the structural basis for inhibitor specificity. Our study provides important insights into the structural requirements for the inhibition of FIPV-3CL(pro) by peptidomimetic inhibitors and expands the current structural knowledge of coronaviral 3CL(pro) architecture.

  10. NCI Scientists Solve Structure of Protein that Enables MERS Virus to Spread | Poster

    Cancer.gov

    Scientists at the Frederick National Lab have produced three crystal structures that reveal a specific part of a protein that can be targeted to fight the Middle East respiratory syndrome coronavirus (MERS-CoV), which causes an emerging viral respiratory illness. Senior Investigator David Waugh, Ph.D., Macromolecular Crystallography Laboratory, has solved the structure of an enzyme known as the 3C-like protease (3CLpro), which, if blocked, can prevent the virus from replicating...

  11. Cleavage of Maize chlorotic dwarf virus R78 protein by the viral 3C protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maize chlorotic dwarf virus (MCDV) is a member of the genus Waikavirus and encodes a 389 kDa polyprotein from its 11784 nt genomic RNA. Like many polyprotein-encoding viruses, MCDV contains a 3C-like virus protease that is presumably responsible for maturation cleavages of the polyprotein. However,...

  12. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  13. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  14. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  15. Structure-Guided Design and Optimization of Dipeptidyl Inhibitors of Norovirus 3CL Protease. Structure–Activity Relationships and Biochemical, X-ray Crystallographic, Cell-Based, and In Vivo Studies

    SciTech Connect

    Galasiti Kankanamalage, Anushka C.; Kim, Yunjeong; Weerawarna, Pathum M.; Uy, Roxanne Adeline Z.; Damalanka, Vishnu C.; Mandadapu, Sivakoteswara Rao; Alliston, Kevin R.; Mehzabeen, Nurjahan; Battaile, Kevin P.; Lovell, Scott; Chang, Kyeong-Ok; Groutas, William C.

    2015-04-09

    Norovirus infection constitutes the primary cause of acute viral gastroenteritis. There are currently no vaccines or norovirus-specific antiviral therapeutics available for the management of norovirus infection. Norovirus 3C-like protease is essential for viral replication, consequently, inhibition of this enzyme is a fruitful avenue of investigation that may lead to the emergence of antinorovirus therapeutics. We describe herein the optimization of dipeptidyl inhibitors of norovirus 3C-like protease using iterative SAR, X-ray crystallographic, and enzyme and cell-based studies. We also demonstrate herein in vivo efficacy of an inhibitor using the murine model of norovirus infection.

  16. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  17. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  18. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  19. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  20. Inhibition of norovirus 3CL protease by bisulfite adducts of transition state inhibitors.

    PubMed

    Mandadapu, Sivakoteswara Rao; Gunnam, Mallikarjuna Reddy; Tiew, Kok-Chuan; Uy, Roxanne Adeline Z; Prior, Allan M; Alliston, Kevin R; Hua, Duy H; Kim, Yunjeong; Chang, Kyeong-Ok; Groutas, William C

    2013-01-01

    Noroviruses are the most common cause of acute viral gastroenteritis, accounting for >21 million cases annually in the US alone. Norovirus infections constitute an important health problem for which there are no specific antiviral therapeutics or vaccines. In this study, a series of bisulfite adducts derived from representative transition state inhibitors (dipeptidyl aldehydes and α-ketoamides) was synthesized and shown to exhibit anti-norovirus activity in a cell-based replicon system. The ED(50) of the most effective inhibitor was 60 nM. This study demonstrates for the first time the utilization of bisulfite adducts of transition state inhibitors in the inhibition of norovirus 3C-like protease in vitro and in a cell-based replicon system. The approach described herein can be extended to the synthesis of the bisulfite adducts of other classes of transition state inhibitors of serine and cysteine proteases, such as α-ketoheterocycles and α-ketoesters.

  1. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  2. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  3. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  4. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  5. Laundry performance of subtilisin proteases.

    PubMed

    Wolff, A M; Showell, M S; Venegas, M G; Barnett, B L; Wertz, W C

    1996-01-01

    Effective laundry protease performance against susceptible stains depends upon both the enzyme itself and the environment in which it must work. In order to technically design superior laundry proteases, a model for protease's mechanism of action in detergents was developed which has been substantiated through-the-wash. While evaluation of this model and/or a given protease's effectiveness could be judged by a variety of methods, the utility of using visual wash performance comparisons, analytical, and stain characterization studies is described. Finally, data comparing the performance of wild type Subtilisin proteases with mutants designed via the projected model are given, demonstrating possible utility of the system.

  6. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  7. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  8. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  9. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  10. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  11. Potential Broad Spectrum Inhibitors of the Coronavirus 3CLpro: A Virtual Screening and Structure-Based Drug Design Study.

    PubMed

    Berry, Michael; Fielding, Burtram C; Gamieldien, Junaid

    2015-12-15

    Human coronaviruses represent a significant disease burden; however, there is currently no antiviral strategy to combat infection. The outbreak of severe acute respiratory syndrome (SARS) in 2003 and Middle East respiratory syndrome (MERS) less than 10 years later demonstrates the potential of coronaviruses to cross species boundaries and further highlights the importance of identifying novel lead compounds with broad spectrum activity. The coronavirus 3CL(pro) provides a highly validated drug target and as there is a high degree of sequence homology and conservation in main chain architecture the design of broad spectrum inhibitors is viable. The ZINC drugs-now library was screened in a consensus high-throughput pharmacophore modeling and molecular docking approach by Vina, Glide, GOLD and MM-GBSA. Molecular dynamics further confirmed results obtained from structure-based techniques. A highly defined hit-list of 19 compounds was identified by the structure-based drug design methodologies. As these compounds were extensively validated by a consensus approach and by molecular dynamics, the likelihood that at least one of these compounds is bioactive is excellent. Additionally, the compounds segregate into 15 significantly dissimilar (p < 0.05) clusters based on shape and features, which represent valuable scaffolds that can be used as a basis for future anti-coronaviral inhibitor discovery experiments. Importantly though, the enriched subset of 19 compounds identified from the larger library has to be validated experimentally.

  12. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  13. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  14. Identification of novel drug scaffolds for inhibition of SARS-CoV 3-Chymotrypsin-like protease using virtual and high-throughput screenings.

    PubMed

    Lee, Hyun; Mittal, Anuradha; Patel, Kavankumar; Gatuz, Joseph L; Truong, Lena; Torres, Jaime; Mulhearn, Debbie C; Johnson, Michael E

    2014-01-01

    We have used a combination of virtual screening (VS) and high-throughput screening (HTS) techniques to identify novel, non-peptidic small molecule inhibitors against human SARS-CoV 3CLpro. A structure-based VS approach integrating docking and pharmacophore based methods was employed to computationally screen 621,000 compounds from the ZINC library. The screening protocol was validated using known 3CLpro inhibitors and was optimized for speed, improved selectivity, and for accommodating receptor flexibility. Subsequently, a fluorescence-based enzymatic HTS assay was developed and optimized to experimentally screen approximately 41,000 compounds from four structurally diverse libraries chosen mainly based on the VS results. False positives from initial HTS hits were eliminated by a secondary orthogonal binding analysis using surface plasmon resonance (SPR). The campaign identified a reversible small molecule inhibitor exhibiting mixed-type inhibition with a K(i) value of 11.1 μM. Together, these results validate our protocols as suitable approaches to screen virtual and chemical libraries, and the newly identified compound reported in our study represents a promising structural scaffold to pursue for further SARS-CoV 3CLpro inhibitor development.

  15. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  16. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  17. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  18. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  19. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  20. Active protease mapping in 2DE gels.

    PubMed

    Zhao, Zhenjun; Russell, Pamela J

    2009-01-01

    Proteases act as the molecular mediators of many vital biological processes. To understand the function of each protease, it needs to be separated from other proteins and characterized in its natural, biologically active form. In the method described in this chapter, proteases in a biological sample are separated under nonreducing conditions in 2DE gels. A specific small protease substrate, tagged with a fluorescent dye, is copolymerized into the SDS gel in the second dimension. After electrophoresis, the proteins are renatured by washing the gel with Triton X-100 solution or Milli Q water to remove SDS. The gel is then incubated in a protease assay buffer. The hydrolysis of the tagged specific substrate by the renatured protease releases the free fluorescent dye, which fluoresces in situ. The fluorescent spots indicate the location of the specific proteases in the gel and the specificity of the proteases.

  1. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  2. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  3. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  4. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  5. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  6. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  7. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  8. Protease Profiling in Prostate Cancer

    DTIC Science & Technology

    2004-05-01

    acid synthase, which contains a serine hydrolase domain. We identified a lead inhibitor of this domain of fatty acid synthase, called Orlistat, which...SUBJECT TERMS 15. NUMBER OF PAGES Prostate cancer, tumor biology, protease, proteomics, transgenic, 20 animal model, fatty acid synthase, orlistat 16...the enzymes we identified is fatty acid synthase. Fatty acid synthase is the sole enzyme responsible for the cellular synthesis of fatty acids . This

  9. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  10. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  11. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents.

  12. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  13. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  14. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  15. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  16. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  17. Diversity, Replication, Pathogenicity and Cell Biology of Crimean Congo Hemorrhagic Fever Virus

    DTIC Science & Technology

    2007-10-01

    tool in the identification of small molecule inhibitors of other viral proteases such as HCV -NS3-4A and SARS-3CLpro. Difficulties may arise in trying...profiles of 84 genes per pathway that encode many important immunological molecules. Results: Experiments were performed to optimize assay

  18. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  19. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  20. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  1. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  2. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  3. A biotechnology perspective of fungal proteases.

    PubMed

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira Filho, Edivaldo Ximenes; Pessoa Junior, Adalberto; Magalhães, Pérola Oliveira

    2015-06-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  4. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  5. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  6. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  7. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application.

  8. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  9. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  10. Development of potent dipeptide-type SARS-CoV 3CL protease inhibitors with novel P3 scaffolds: design, synthesis, biological evaluation, and docking studies.

    PubMed

    Thanigaimalai, Pillaiyar; Konno, Sho; Yamamoto, Takehito; Koiwai, Yuji; Taguchi, Akihiro; Takayama, Kentaro; Yakushiji, Fumika; Akaji, Kenichi; Chen, Shen-En; Naser-Tavakolian, Aurash; Schön, Arne; Freire, Ernesto; Hayashi, Yoshio

    2013-10-01

    We report the design and synthesis of a series of dipeptide-type inhibitors with novel P3 scaffolds that display potent inhibitory activity against SARS-CoV 3CLpro. A docking study involving binding between the dipeptidic lead compound 4 and 3CLpro suggested the modification of a structurally flexible P3 N-(3-methoxyphenyl)glycine with various rigid P3 moieties in 4. The modifications led to the identification of several potent derivatives, including 5c-k and 5n with the inhibitory activities (Ki or IC50) in the submicromolar to nanomolar range. Compound 5h, in particular, displayed the most potent inhibitory activity, with a Ki value of 0.006 μM. This potency was 65-fold higher than the potency of the lead compound 4 (Ki=0.39 μM). In addition, the Ki value of 5h was in very good agreement with the binding affinity (16 nM) observed in isothermal titration calorimetry (ITC). A SAR study around the P3 group in the lead 4 led to the identification of a rigid indole-2-carbonyl unit as one of the best P3 moieties (5c). Further optimization showed that a methoxy substitution at the 4-position on the indole unit was highly favorable for enhancing the inhibitory potency.

  11. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  12. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  13. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  14. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  15. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  16. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  17. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  18. Bacterial proteases, untapped antimicrobial drug targets.

    PubMed

    Culp, Elizabeth; Wright, Gerard D

    2017-04-01

    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  19. Lysosomal protease expression in mature enamel.

    PubMed

    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D

    2009-01-01

    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  20. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  1. Cleavage Entropy as Quantitative Measure of Protease Specificity

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Margreiter, Michael A.; Spitzer, Gudrun M.; Wallnoefer, Hannes G.; Liedl, Klaus R.

    2013-01-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity. PMID:23637583

  2. Cleavage entropy as quantitative measure of protease specificity.

    PubMed

    Fuchs, Julian E; von Grafenstein, Susanne; Huber, Roland G; Margreiter, Michael A; Spitzer, Gudrun M; Wallnoefer, Hannes G; Liedl, Klaus R

    2013-04-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity.

  3. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  4. Current and Novel Inhibitors of HIV Protease

    PubMed Central

    Pokorná, Jana; Machala, Ladislav; Řezáčová, Pavlína; Konvalinka, Jan

    2009-01-01

    The design, development and clinical success of HIV protease inhibitors represent one of the most remarkable achievements of molecular medicine. This review describes all nine currently available FDA-approved protease inhibitors, discusses their pharmacokinetic properties, off-target activities, side-effects, and resistance profiles. The compounds in the various stages of clinical development are also introduced, as well as alternative approaches, aiming at other functional domains of HIV PR. The potential of these novel compounds to open new way to the rational drug design of human viruses is critically assessed. PMID:21994591

  5. Seminal and colostral protease inhibitors on leukocytes.

    PubMed

    Veselský, L; Cechová, D; Hruban, V; Klaudy, J

    1982-01-01

    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  6. Detection of protease and protease activity using a single nanoscrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2013-01-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  7. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh

    2017-01-01

    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  8. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  9. Transient ECM protease activity promotes synaptic plasticity

    PubMed Central

    Magnowska, Marta; Gorkiewicz, Tomasz; Suska, Anna; Wawrzyniak, Marcin; Rutkowska-Wlodarczyk, Izabela; Kaczmarek, Leszek; Wlodarczyk, Jakub

    2016-01-01

    Activity-dependent proteolysis at a synapse has been recognized as a pivotal factor in controlling dynamic changes in dendritic spine shape and function; however, excessive proteolytic activity is detrimental to the cells. The exact mechanism of control of these seemingly contradictory outcomes of protease activity remains unknown. Here, we reveal that dendritic spine maturation is strictly controlled by the proteolytic activity, and its inhibition by the endogenous inhibitor (Tissue inhibitor of matrix metalloproteinases-1 – TIMP-1). Excessive proteolytic activity impairs long-term potentiation of the synaptic efficacy (LTP), and this impairment could be rescued by inhibition of protease activity. Moreover LTP is altered persistently when the ability of TIMP-1 to inhibit protease activity is abrogated, further demonstrating the role of such inhibition in the promotion of synaptic plasticity under well-defined conditions. We also show that dendritic spine maturation involves an intermediate formation of elongated spines, followed by their conversion into mushroom shape. The formation of mushroom-shaped spines is accompanied by increase in AMPA/NMDA ratio of glutamate receptors. Altogether, our results identify inhibition of protease activity as a critical regulatory mechanism for dendritic spines maturation. PMID:27282248

  10. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry

    2015-01-01

    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  11. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central

    2011-01-01

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  12. Comparative study on the protease inhibitors from fish eggs

    NASA Astrophysics Data System (ADS)

    Ustadi; Kim, K. Y.; Kim, S. M.

    2005-07-01

    The protease inhibitor was purified from five different fish eggs. The molecular weights of Pacific herring, chum salmon, pond smelt, glassfish, and Alaska pollock egg protease inhibitors were 120, 89, 84.5, 17, and l6.8kDa, respectively. The specific inhibitory activity of glassfish egg protease inhibitor was the highest followed by those of Pacific herring and Alaska pollock in order. The specific inhibitory activity and purity of glassfish egg protease inhibitor were 19.70 Umg-1 protein and 164.70 folds of purification, respectively. Glassfish egg protease inhibitor was reasonably stable at 50-65°C and pH 8, which was more stable at high temperature and pH than protease inhibitors from the other fish species. Glassfish egg protease inhibitor was noncompetitive with inhibitor constant ( K i) of 4.44 nmolL-1.

  13. Management of protease inhibitor-associated hyperlipidemia.

    PubMed

    Penzak, Scott R; Chuck, Susan K

    2002-01-01

    Dyslipidemia, characterized by elevated serum levels of triglycerides and reduced levels of total cholesterol, low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol, has been recognized in patients with human immunodeficiency virus (HIV) infection. It is thought that elevated levels of circulating cytokines, such as tumor necrosis factor-alpha and interferon-alpha, may alter lipid metabolism in patients with HIV infection. Protease inhibitors, such as saquinavir, indinavir and ritonavir, have been found to decrease mortality and improve quality of life in patients with HIV infection. However, these drugs have been associated with a syndrome of fat redistribution, insulin resistance, and hyperlipidemia. Elevations in serum total cholesterol and triglyceride levels, along with dyslipidemia that typically occurs in patients with HIV infection, may predispose patients to complications such as premature atherosclerosis and pancreatitis. It has been estimated that hypercholesterolemia and hypertriglyceridemia occur in greater than 50% of protease inhibitor recipients after 2 years of therapy, and that the risk of developing hyperlipidemia increases with the duration of treatment with protease inhibitors. In general, treatment of hyperlipidemia should follow National Cholesterol Education Program guidelines; efforts should be made to modify/control coronary heart disease risk factors (i.e. smoking; hypertension; diabetes mellitus) and maximize lifestyle modifications, primarily dietary intervention and exercise, in these patients. Where indicated, treatment usually consists of either pravastatin or atorvastatin for patients with elevated serum levels of LDL-C and/or total cholesterol. Atorvastatin is more potent in lowering serum total cholesterol and triglycerides compared with other hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, but it is also associated with more drug interactions compared with pravastatin. Simvastatin

  14. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-01-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  15. Enteropeptidase, a type II transmembrane serine protease.

    PubMed

    Zheng, X Long; Kitamoto, Yasunori; Sadler, J Evan

    2009-06-01

    Enteropeptidase, a type II transmembrane serine protease, is localized to the brush border of the duodenal and jejunal mucosa. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. Trypsin, in turn, activates other digestive zymogens such as chymotrypsinogen, proelastase, procarboxypeptidase and prolipase in the lumen of the gut. The important biological function of enteropeptidase is highlighted by the manifestation of severe diarrhea, failure to thrive, hypoproteinemia and edema as a result of congenital deficiency of enteropeptidase activity in the gut. Conversely, duodenopancreatic reflux of proteolytically active enteropeptidase may cause acute and chronic pancreatitis.

  16. Functional interplay between tetraspanins and proteases.

    PubMed

    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos

    2011-10-01

    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  17. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  18. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  19. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  20. Extracellular proteases from eight psychrotolerant Antarctic strains.

    PubMed

    Vazquez, Susana C; Coria, Silvia H; MacCormack, Walter P

    2004-01-01

    Extracellular proteases from 8 Antarctic psychrotolerant Pseudomonas sp. strains were purified and characterised. All of them are neutral metalloproteases, have an apparent molecular mass of 45kDa, optimal activity at 40 degrees C and pH 7-9, retaining significant activity at pH 5-11. With the exception of P96-18, which is less stable, all retain more than 50% activity after 3 h of incubation at pH 5-9 and show low thermal stability (their half-life times range from 20 to 60 min at 40 degrees C and less than 5 min at 50 degrees C). These proteases can be used in commercial processes carried out at neutral pH and moderate temperatures, and are of special interest for their application in mixtures of enzymes where final thermal selective inactivation is needed. Results also highlight the relevance of Antarctic biotopes for the isolation of protease-producing enzymes active at low temperatures.

  1. Corruption of Innate Immunity by Bacterial Proteases

    PubMed Central

    Potempa, Jan; Pike, Robert N.

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host’s innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections. PMID:19756242

  2. Effect of lanthanides on Porphyromonas gingivalis proteases.

    PubMed

    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T

    2010-01-01

    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  3. Corruption of innate immunity by bacterial proteases.

    PubMed

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  4. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  5. Structural determinants of tobacco vein mottling virus protease substrate specificity.

    PubMed

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-11-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1' position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k(cat) and K(m) for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  6. Structural determinants of tobacco vein mottling virus protease substrate specificity

    SciTech Connect

    Sun, Ping; Austin, Brian P.; Tozer, Jozsef; Waugh, David

    2010-10-28

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-{angstrom} resolution. As observed in several crystal structures of TEV protease, the C-terminus ({approx}20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by {approx}10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1{prime} position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k{sub cat} and K{sub m} for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  7. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.

    2000-01-01

    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  8. Cystatins, serpins and other families of protease inhibitors in plants.

    PubMed

    Volpicella, Mariateresa; Leoni, Claudia; Costanza, Alessandra; De Leo, Francesca; Gallerani, Raffaele; Ceci, Luigi R

    2011-08-01

    Plant protease inhibitors (PIs) are generally small proteins present in high concentrations in storage tissues (tubers and seeds), and to a lower level in leaves. Even if most of them are active against serine and cysteine proteases, PIs active against aspartic proteases and carboxypeptidases have also been identified. Inhibitors of serine proteases are further classifiable in several families on the basis of their structural features. They comprise the families known as Bowman-Birk, Kunitz, Potato I and Potato II, which are the subject of review articles included in this special issue. In the present article we aim to give an overview of other families of plant PIs, active either against serine proteases or other class of proteases, describing their distribution, activity and main structural characteristics.

  9. Diversity of both the cultivable protease-producing bacteria and bacterial extracellular proteases in the coastal sediments of King George Island, Antarctica.

    PubMed

    Zhou, Ming-Yang; Wang, Guang-Long; Li, Dan; Zhao, Dian-Li; Qin, Qi-Long; Chen, Xiu-Lan; Chen, Bo; Zhou, Bai-Cheng; Zhang, Xi-Ying; Zhang, Yu-Zhong

    2013-01-01

    Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5) cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%), Flavobacterium (21.0%) and Lacinutrix (16.2%). Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.

  10. Economic Methods of Ginger Protease'sextraction and Purification

    NASA Astrophysics Data System (ADS)

    Qiao, Yuanyuan; Tong, Junfeng; Wei, Siqing; Du, Xinyong; Tang, Xiaozhen

    This article reports the ginger protease extraction and purification methods from fresh ginger rhizome. As to ginger protease extraction, we adapt the steps of organic solvent dissolving, ammonium sulfate depositing and freeze-drying, and this method can attain crude enzyme powder 0.6% weight of fresh ginger rhizome. The purification part in this study includes two steps: cellulose ion exchange (DEAE-52) and SP-Sephadex 50 chromatography, which can purify crude ginger protease through ion and molecular weight differences respectively.

  11. Engineering Environmentally-Stable Proteases to Specifically Neutralize Protein Toxins

    DTIC Science & Technology

    2013-10-01

    agents , such as Soman and Sarin . 2. Linkage to binding molecules Conjugating an antibody (or any other binding module) with an initiating protease...to develop the tools and principles necessary to engineer subtilisin proteases which specifically target and deactivate biological warfare agent (BWA...warfare agent (BWA) toxins. We have engineered and evolved subtilisin proteases to specifically target and deactivate BoNT, SEB, ricin, and B

  12. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  13. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed Central

    Suleman, Louise

    2016-01-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes. PMID:27785379

  14. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae

    2011-09-01

    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  15. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed

    Suleman, Louise

    2016-10-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes.

  16. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  17. Reversible Unfolding of Rhomboid Intramembrane Proteases

    PubMed Central

    Panigrahi, Rashmi; Arutyunova, Elena; Panwar, Pankaj; Gimpl, Katharina; Keller, Sandro; Lemieux, M. Joanne

    2016-01-01

    Denaturant-induced unfolding of helical membrane proteins provides insights into their mechanism of folding and domain organization, which take place in the chemically heterogeneous, anisotropic environment of a lipid membrane. Rhomboid proteases are intramembrane proteases that play key roles in various diseases. Crystal structures have revealed a compact helical bundle with a buried active site, which requires conformational changes for the cleavage of transmembrane substrates. A dimeric form of the rhomboid protease has been shown to be important for activity. In this study, we examine the mechanism of refolding for two distinct rhomboids to gain insight into their secondary structure-activity relationships. Although helicity is largely abolished in the unfolded states of both proteins, unfolding is completely reversible for HiGlpG but only partially reversible for PsAarA. Refolding of both proteins results in reassociation of the dimer, with a 90% regain of catalytic activity for HiGlpG but only a 70% regain for PsAarA. For both proteins, a broad, gradual transition from the native, folded state to the denatured, partly unfolded state was revealed with the aid of circular dichroism spectroscopy as a function of denaturant concentration, thus arguing against a classical two-state model as found for many globular soluble proteins. Thermal denaturation has irreversible destabilizing effects on both proteins, yet reveals important functional details regarding substrate accessibility to the buried active site. This concerted biophysical and functional analysis demonstrates that HiGlpG, with a simple six-transmembrane-segment organization, is more robust than PsAarA, which has seven predicted transmembrane segments, thus rendering HiGlpG amenable to in vitro studies of membrane-protein folding. PMID:27028647

  18. Multiple Proteases to Localize Oxidation Sites

    PubMed Central

    Gu, Liqing; Robinson, Renã A. S.

    2015-01-01

    Proteins present in cellular environments with high levels of reactive oxygen and nitrogen species and/or low levels of antioxidants are highly susceptible to oxidative post-translational modification (PTM). Irreversible oxidative PTMs can generate a complex distribution of modified protein molecules, recently termed as proteoforms. Using ubiquitin as a model system, we mapped oxidative modification sites using trypsin, Lys-C, and Glu-C peptides. Several M+16 Da proteoforms were detected as well as proteoforms that include other previously unidentified oxidative modifications. This work highlights the use of multiple protease digestions to give insights to the complexity of oxidative modifications possible in bottom-up analyses. PMID:25775238

  19. Rapid Release of Protease Inhibitors from Soybeans

    PubMed Central

    Hwang, David L.; Yang, Wen-Kuang; Foard, Donald E.; Lin, K.-T. -Davis

    1978-01-01

    Specific antisera were prepared against the Bowman-Birk trypsin inhibitor and four other trypsin inhibitors of low molecular weight isolated from soybeans (Glycine max L. cv. Tracy). These antisera were used to detect the presence and amount of the inhibitors in: (a) seeds and protein extracts of soybean meal; (b) seedlings; and (c) the water surrounding the seeds and roots of seedlings. Lectin activities in seeds, seedlings, and water were also determined at the same time as the protease inhibitor activities. By competitive inhibition of immunoprecipitation, the combined five low molecular weight protease inhibitors were found to constitute the following percentages of proteins (w/w): 6.3% in defatted soybean meal; 8.1% of the protein extracted from the meal by a buffer of pH 8.6; 8.3, 14.7, 15.2, 16.1, 17.2, and 18.9% of the protein in a lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, respectively; 8.2% in a lyophilisate of water in which roots of seedlings grew for 20 days; 1.5% in cotyledons; and less than 0.1% in epicotyls, hypocotyls, and roots of 12-day-old seedlings. Hemagglutination activities, expressed as the lowest amount of protein required to give a positive agglutination of 0.2 ml of 2% rabbit red blood cells, were as follows: purified soybean lectin, 0.08 μg; lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, 10, 2.5, 5, 5, and 2.5 μg, respectively; lyophilisate of water in which roots grew for 20 days, 5 μg; 12-day-old cotyledons, roots, epicotyls, and hypocotyls, 12.5, 100, >1,000, and >500 μg, respectively. The results indicate that a large amount of protease inhibitors as well as lectins are released from seeds during the first 8 hours of imbibition. Neither lima bean trypsin inhibitor (mol wt, 10,000) nor Kunitz soybean trypsin inhibitor (mol wt, 21,500) showed competitive inhibition in tests with antisera against low molecular weight soybean protease inhibitors

  20. Increased activity of unlinked Zika virus NS2B/NS3 protease compared to linked Zika virus protease.

    PubMed

    Kuiper, Benjamin D; Slater, Kristin; Spellmon, Nicholas; Holcomb, Joshua; Medapureddy, Prasanna; Muzzarelli, Kendall M; Yang, Zhe; Ovadia, Reuben; Amblard, Franck; Kovari, Iulia A; Schinazi, Raymond F; Kovari, Ladislau C

    2017-03-22

    Zika virus (ZIKV) is a flavivirus spread by daytime-active Aedes spp. mosquitoes such as A. aegypti and A. albopictus. Previously thought to be a mild infection, the latest ZIKV outbreak in the Americas is causally associated with more severe symptoms as well as severe birth defects, such as microcephaly. Currently no vaccine or antiviral exists. However, recent progress has demonstrated the viral NS2B/NS3 protease may be a suitable target for the development of small-molecule antiviral agents. To better understand the ZIKV protease, we expressed, purified, and characterized unlinked and linked NS2B/NS3 protease corresponding to an isolate from the recent outbreak in Puerto Rico. Unlinked ZIKV protease is more active and binds substrate with greater affinity than linked ZIKV protease. Therefore, we propose that unlinked ZIKV protease be used when evaluating or designing ZIKV protease inhibitors. Additionally, potent inhibitors of related viral proteases, like West Nile Virus and Dengue virus, may serve as advanced starting points to identify and develop ZIKV protease inhibitors.

  1. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-06-30

    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  2. Regulated proteolysis by cortical granule serine protease 1 at fertilization.

    PubMed

    Haley, Sheila A; Wessel, Gary M

    2004-05-01

    Cortical granules are specialized organelles whose contents interact with the extracellular matrix of the fertilized egg to form the block to polyspermy. In sea urchins, the granule contents form a fertilization envelope (FE), and this construction is critically dependent upon protease activity. An autocatalytic serine protease, cortical granule serine protease 1 (CGSP1), has been identified in the cortical granules of Strongylocentrotus purpuratus eggs, and here we examined the regulation of the protease activity and tested potential target substrates of CGSP1. We found that CGSP1 is stored in its full-length, enzymatically quiescent form in the granule, and is inactive at pH 6.5 or below. We determined the pH of the cortical granule by fluorescent indicators and micro-pH probe measurements and found the granules to be pH 5.5, a condition inhibitory to CGSP1 activity. Exposure of the protease to the pH of seawater (pH 8.0) at exocytosis immediately activates the protease. Activation of eggs at pH 6.5 or lower blocks activation of the protease and the resultant FE phenotypes are indistinguishable from a protease-null phenotype. We find that native cortical granule targets of the protease are beta-1,3 glucanase, ovoperoxidase, and the protease itself, but the structural proteins of the granule are not proteolyzed by CGSP1. Whole mount immunolocalization experiments demonstrate that inhibition of CGSP1 activity affects the localization of ovoperoxidase but does not alter targeting of structural proteins to the FE. The mistargeting of ovoperoxidase may lead to spurious peroxidative cross-linking activity and contribute to the lethality observed in protease-null cells. Thus, CGSP1 is proteolytically active only when secreted, due to the low pH of the cortical granules, and it has a small population of targets for cleavage within the cortical granules.

  3. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum

    PubMed Central

    Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5–75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases. PMID:28060882

  4. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum.

    PubMed

    Han, Zhiping; Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5-75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases.

  5. Structural determinants of MALT1 protease activity.

    PubMed

    Wiesmann, Christian; Leder, Lukas; Blank, Jutta; Bernardi, Anna; Melkko, Samu; Decock, Arnaud; D'Arcy, Allan; Villard, Frederic; Erbel, Paulus; Hughes, Nicola; Freuler, Felix; Nikolay, Rainer; Alves, Juliano; Bornancin, Frederic; Renatus, Martin

    2012-05-25

    The formation of the CBM (CARD11-BCL10-MALT1) complex is pivotal for antigen-receptor-mediated activation of the transcription factor NF-κB. Signaling is dependent on MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1), which not only acts as a scaffolding protein but also possesses proteolytic activity mediated by its caspase-like domain. It remained unclear how the CBM activates MALT1. Here, we provide biochemical and structural evidence that MALT1 activation is dependent on its dimerization and show that mutations at the dimer interface abrogate activity in cells. The unliganded protease presents itself in a dimeric yet inactive state and undergoes substantial conformational changes upon substrate binding. These structural changes also affect the conformation of the C-terminal Ig-like domain, a domain that is required for MALT1 activity. Binding to the active site is coupled to a relative movement of caspase and Ig-like domains. MALT1 binding partners thus may have the potential of tuning MALT1 protease activity without binding directly to the caspase domain.

  6. Effect of proteases on the. beta. -thromboglobulin radioimmunoassay

    SciTech Connect

    Donlon, J.A.; Helgeson, E.A.; Donlon, M.A.

    1985-02-11

    Rat peritoneal mast cells and mast cell granules were evaluated by radioimmunoassay for the presence of ..beta..-thromboglobulin and platelet factor 4. The initial assays indicated that a ..beta..-thromboglobulin cross reacting material was released from mast cells by compound 48/80 in a similar dose-dependent manner as histamine release. The material was also found to be associated with purified granules. However, the use of protease inhibitors in the buffers completely abolished the positive assays. Further evaluation of the effects of various proteases on the ..beta..-thromboglobulin assay indicated that elastase would also generate a false positive assay which could then be neutralized by the use of ..cap alpha../sub 1/-antitrypsin as a protease inhibitor. There was no protease effect on the platelet factor 4 radioimmunoassay which always showed no detectable amounts with mast cells, granules or proteases. These results clearly indicate the artifactual positive assays which can arise when using certain radioimmunoassay tests in the presence of cell proteases. The use of protease inhibitors is a necessary control when applying a radioimmunoassay to a system with potentially active proteases. 24 references, 2 figures, 4 tables.

  7. Serine protease activities in Leishmania (Leishmania) chagasi promastigotes.

    PubMed

    da Silva-López, Raquel Elisa; dos Santos, Tatiana Resende; Morgado-Díaz, José Andrés; Tanaka, Marcelo Neves; de Simone, Salvatore Giovanni

    2010-10-01

    The present work reports the isolation, biochemical characterization, and subcellular location of serine proteases from aqueous, detergent soluble, and culture supernatant of Leishmania chagasi promastigote extracts, respectively, LCSII, LCSI, and LCSIII. The active enzyme molecular masses of LCSII were about 105, 66, and 60 kDa; of LCSI, 60 and 58 kDa; and of LCSIII, approximately 76 and 68 kDa. Optimal pH for the enzymes was 7.0 for LCSI and LCSIII and 8.5 for LCSII, and the optimal temperature for all enzymes was 37°C, using α-N-ρ-tosyl-L: -arginine methyl ester as substrate. Assay of thermal stability indicated that LCSIII is the more stable enzyme. Hemoglobin, bovine serum albumin, and ovalbumin were hydrolyzed by LCSII and LCSI but not by LCSIII. Inhibition studies suggested that enzymes belong to the serine protease class modulated by divalent cations. Rabbit antiserum against 56-kDa serine protease of Leishmania amazonensis identified proteins in all extracts of L. chagasi. Furthermore, immunocytochemistry demonstrated that serine proteases are located in flagellar pocket region and cytoplasmic vesicles of L. chagasi promastigotes. These findings indicate that L. chagasi serine proteases differ from L. amazonensis proteases and all known flagellate proteases, but display some similarities with serine proteases from other Leishmania species, suggesting a conservation of this enzymatic activity in the genus.

  8. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  9. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.

    PubMed

    Panigrahi, Rashmi; Lemieux, M Joanne

    2015-01-01

    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  10. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma

    2006-07-01

    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  11. Poliovirus protease 3C(pro) kills cells by apoptosis.

    PubMed

    Barco, A; Feduchi, E; Carrasco, L

    2000-01-20

    The tetracycline-based Tet-Off expression system has been used to analyze the effects of poliovirus protease 3C(pro) on human cells. Stable HeLa cell clones that express this poliovirus protease under the control of an inducible, tightly regulated promoter were obtained. Tetracycline removal induces synthesis of 3C protease, followed by drastic morphological alterations and cellular death. Degradation of cellular DNA in nucleosomes and generation of apoptotic bodies are observed from the second day after 3C(pro) induction. The cleavage of poly(ADP-ribose) polymerase, an enzyme involved in DNA repair, occurs after induction of 3C(pro), indicating caspase activation by this poliovirus protease. The 3C(pro)-induced apoptosis is blocked by the caspase inhibitor z-VAD-fmk. Our findings suggest that the protease 3C is responsible for triggering apoptosis in poliovirus-infected cells by a mechanism that involves caspase activation.

  12. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin

    2005-07-01

    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  13. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1988-10-16

    Tenebria molitor MIDGUT PROTEASES; LOCUST CAECAL PROTEASES; BOWMAN-BIRK TRYPSIN-CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN...and Kunitz (STI) from soybeans, CI from chickpeas , chicken ovomucoid and turkey ovomucoid. It was Jnactivated by phenylemthvsulfonyl fluoride (PMSF...soybeans and Cl from chickpeas , by chicken ovomucoid and turkey overmucoid, as well as by the Kunitz (STI) soybean trypsin inhibitor that hardly

  14. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  15. Novel pseudosymmetric inhibitors of HIV-1 protease

    SciTech Connect

    Faessler, A.; Roesel, J.; Gruetter, M.; Tintelnot-Blomley, M.; Alteri, E.; Bold, G.; Lang, M.

    1993-12-31

    Taking into account the unique C-2 symmetric nature of the HIV-1 protease homodimer, the authors have designed and synthesized novel inhibitors featuring an almost symmetric structure. Compounds containing the easily accessible Phe[CH(OH)CH{sub 2}N(NH)]Cha dipeptide isostere as a nonhydrolyzable replacement of the scissile amide bond of the natural substrate are potent inhibitors in vitro with IC{sub 50} values of 9 to 50 nM. The antiviral activity depends mainly on the nature of the anylated valine residues linked to the dipeptide mimic. In this series, CGP 53820 combines both high potency and excellent specificity. Its predicted symmetric binding pattern is illustrated by the X-ray structure analysis performed with the corresponding enzyme-inhibitor complex.

  16. Highly potent fibrinolytic serine protease from Streptomyces.

    PubMed

    Uesugi, Yoshiko; Usuki, Hirokazu; Iwabuchi, Masaki; Hatanaka, Tadashi

    2011-01-05

    We introduce a highly potent fibrinolytic serine protease from Streptomyces omiyaensis (SOT), which belongs to the trypsin family. The fibrinolytic activity of SOT was examined using in vitro assays and was compared with those of known fibrinolytic enzymes such as plasmin, tissue-type plasminogen activator (t-PA), urokinase, and nattokinase. Compared to other enzymes, SOT showed remarkably higher hydrolytic activity toward mimic peptides of fibrin and plasminogen. The fibrinolytic activity of SOT is about 18-fold higher than that of plasmin, and is comparable to that of t-PA by fibrin plate assays. Furthermore, SOT had some plasminogen activator-like activity. Results show that SOT and nattokinase have very different fibrinolytic and fibrinogenolytic modes, engendering significant synergetic effects of SOT and nattokinase on fibrinolysis. These results suggest that SOT presents important possibilities for application in the therapy of thrombosis.

  17. Effects of detergents on the West Nile virus protease activity.

    PubMed

    Ezgimen, Manolya D; Mueller, Niklaus H; Teramoto, Tadahisa; Padmanabhan, R

    2009-05-01

    Detergents such as Triton X-100 are often used in drug discovery research to weed out small molecule promiscuous and non-specific inhibitors which act by aggregation in solution and undesirable precipitation in aqueous assay buffers. We evaluated the effects of commonly used detergents, Triton X-100, Tween-20, Nonidet-40 (NP-40), Brij-35, and CHAPS, on the enzymatic activity of West Nile virus (WNV) protease. Unexpectedly, Triton X-100, Tween-20, and NP-40 showed an enhancement of in vitro WNV protease activity from 2 to 2.5-fold depending on the detergent and its concentration. On the other hand, Brij-35, at 0.001% enhanced the protease activity by 1.5-fold and CHAPS had the least enhancing effect. The kinetic analysis showed that the increase in protease activity by Triton X-100 was dose-dependent. Furthermore, at Triton X-100 and Tween-20 concentrations higher than 0.001%, the inhibition of compound B, one of the lead compounds against WNV protease identified in a high throughput screen (IC(50) value of 5.7+/-2.5 microM), was reversed. However, in the presence of CHAPS, compound B still showed good inhibition of WNV protease. Our results, taken together, indicate that nonionic detergents, Triton X-100, Tween, and NP-40 are unsuitable for the purpose of discrimination of true versus promiscuous inhibitors of WNV protease in high throughput assays.

  18. Exploring a new serine protease from Cucumis sativus L.

    PubMed

    Nafeesa, Zohara; Shivalingu, B R; Vivek, H K; Priya, B S; Swamy, S Nanjunda

    2015-03-01

    Coagulation is an important physiological process in hemostasis which is activated by sequential action of proteases. This study aims to understand the involvement of aqueous fruit extract of Cucumis sativus L. (AqFEC) European burp less variety in blood coagulation cascade. AqFEC hydrolyzed casein in a dose-dependent manner. The presence of protease activity was further confirmed by casein zymography which revealed the possible presence of two high molecular weight protease(s). The proteolytic activity was inhibited only by phenyl methyl sulphonyl fluoride suggesting the presence of serine protease(s). In a dose-dependent manner, AqFEC also hydrolysed Aα and Bβ subunits of fibrinogen, whereas it failed to degrade the γ subunit of fibrinogen even at a concentration as high as 100 μg and incubation time up to 4 h. AqFEC reduced the clotting time of citrated plasma by 87.65%. The protease and fibrinogenolytic activity of AqFEC suggests its possible role in stopping the bleeding and ensuing wound healing process.

  19. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  20. Screening and characterization of protease producing actinomycetes from marine saltern.

    PubMed

    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva

    2014-10-01

    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries.

  1. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.

    PubMed

    Hughes, Valerie S; Page, Kristen

    2007-01-01

    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  2. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.

    PubMed

    Banik, Rathindra Mohan; Prakash, Monika

    2004-01-01

    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  3. Rabbit endogenous retrovirus-H encodes a functional protease.

    PubMed

    Voisset, Cécile; Myers, Richard E; Carne, Alex; Kellam, Paul; Griffiths, David J

    2003-01-01

    Recent studies have revealed that 'human retrovirus-5' sequences found in human samples belong to a rabbit endogenous retrovirus family named RERV-H. A part of the gag-pro region of the RERV-H genome was amplified by PCR from DNA in human samples and several forms of RERV-H protease were expressed in bacteria. The RERV-H protease was able to cleave itself from a precursor protein and was also able to cleave the RERV-H Gag polyprotein precursor in vitro whereas a form of the protease with a mutation engineered into the active site was inactive. Potential N- and C-terminal autocleavage sites were characterized. The RERV-H protease was sensitive to pepstatin A, showing it to be an aspartic protease. Moreover, it was strongly inhibited by PYVPheStaAMT, a pseudopeptide inhibitor specific for Mason-Pfizer monkey virus and avian myeloblastosis-associated virus. A structural model of the RERV-H protease was constructed that, together with the activity data, confirms that this is a retroviral aspartic protease.

  4. Characterization of the protease activity of detergents: laboratory practicals for studying the protease profile and activity of various commercial detergents.

    PubMed

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-07-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body fluids, and food soils. This article describes two easy and cheap laboratory exercises to study the presence, profile, and basic enzymology of detergent proteases. These laboratory practicals are based on the determination of the detergent protease activity of various commercial detergents using the N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide method and the bovine serum albumin degradation capacity. Students are also required to elucidate the enzymatic subtype of detergent proteases by studying the inhibitory potential of several types of protease inhibitors revealed by the same experimental methodology. Additionally, the results of the exercises can be used to provide additional insights on elementary enzymology by studying the influence of several important parameters on protease activity such as temperature (in this article) and the influence of pH and effects of surfactants and oxidizers (proposed). Students also develop laboratory skills, problem-solving capacities, and the ability to write a laboratory report. The exercises are mainly designed for an advanced undergraduate project in the biochemistry and biotechnology sciences. Globally, these laboratory practicals show students the biotechnological applications of proteases in the detergent industry and also reinforce important enzymology concepts.

  5. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Mixed carbohydrase and protease enzyme product... Substances Affirmed as GRAS § 184.1027 Mixed carbohydrase and protease enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes carbohydrase and protease...

  6. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  7. The role of proteases in regulating Eph/ephrin signaling

    PubMed Central

    Atapattu, Lakmali; Lackmann, Martin; Janes, Peter W

    2014-01-01

    Proteases regulate a myriad of cell functions, both in normal and disease states. In addition to protein turnover, they regulate a range of signaling processes, including those mediated by Eph receptors and their ephrin ligands. A variety of proteases is reported to directly cleave Ephs and/or ephrins under different conditions, to promote receptor and/or ligand shedding, and regulate receptor/ligand internalisation and signaling. They also cleave other adhesion proteins in response to Eph-ephrin interactions, to indirectly facilitate Eph-mediated functions. Proteases thus contribute to Eph/ephrin mediated changes in cell-cell and cell-matrix interactions, in cell morphology and in cell migration and invasion, in a manner which appears to be tightly regulated by, and co-ordinated with, Eph signaling. This review summarizes the current literature describing the function and regulation of protease activities during Eph/ephrin-mediated cell signaling. PMID:25482632

  8. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.

    2016-01-01

    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  9. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan

    2014-01-01

    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  10. Photoactivated Spatiotemporally-Responsive Nanosensors of in Vivo Protease Activity.

    PubMed

    Dudani, Jaideep S; Jain, Piyush K; Kwong, Gabriel A; Stevens, Kelly R; Bhatia, Sangeeta N

    2015-12-22

    Proteases play diverse and important roles in physiology and disease, including influencing critical processes in development, immune responses, and malignancies. Both the abundance and activity of these enzymes are tightly regulated and highly contextual; thus, in order to elucidate their specific impact on disease progression, better tools are needed to precisely monitor in situ protease activity. Current strategies for detecting protease activity are focused on functionalizing synthetic peptide substrates with reporters that emit detection signals following peptide cleavage. However, these activity-based probes lack the capacity to be turned on at sites of interest and, therefore, are subject to off-target activation. Here we report a strategy that uses light to precisely control both the location and time of activity-based sensing. We develop photocaged activity-based sensors by conjugating photolabile molecules directly onto peptide substrates, thereby blocking protease cleavage by steric hindrance. At sites of disease, exposure to ultraviolet light unveils the nanosensors to allow proteases to cleave and release a reporter fragment that can be detected remotely. We apply this spatiotemporally controlled system to probe secreted protease activity in vitro and tumor protease activity in vivo. In vitro, we demonstrate the ability to dynamically and spatially measure metalloproteinase activity in a 3D model of colorectal cancer. In vivo, veiled nanosensors are selectively activated at the primary tumor site in colorectal cancer xenografts to capture the tumor microenvironment-enriched protease activity. The ability to remotely control activity-based sensors may offer a valuable complement to existing tools for measuring biological activity.

  11. Effects of cultural conditions on protease production by Aeromonas hydrophila.

    PubMed Central

    O'Reilly, T; Day, D F

    1983-01-01

    Production of extracellular proteolytic activity by Aeromonas hydrophila was influenced by temperature, pH, and aeration. Conditions which produced maximal growth also resulted in maximal protease production. Enzyme production appeared to be modulated by an inducer catabolite repression system whereby NH4+ and glucose repressed enzyme production and complex nitrogen and nonglucose, carbon energy sources promoted it. Under nutritional stress, protease production was high, despite poor growth. PMID:6342534

  12. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  13. The roles of intramembrane proteases in protozoan parasites.

    PubMed

    Sibley, L David

    2013-12-01

    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases.

  14. Insights into the Cyanobacterial Deg/HtrA Proteases

    PubMed Central

    Cheregi, Otilia; Wagner, Raik; Funk, Christiane

    2016-01-01

    Proteins are the main machinery for all living processes in a cell; they provide structural elements, regulate biochemical reactions as enzymes, and are the interface to the outside as receptors and transporters. Like any other machinery proteins have to be assembled correctly and need maintenance after damage, e.g., caused by changes in environmental conditions, genetic mutations, and limitations in the availability of cofactors. Proteases and chaperones help in repair, assembly, and folding of damaged and misfolded protein complexes cost-effective, with low energy investment compared with neo-synthesis. Despite their importance for viability, the specific biological role of most proteases in vivo is largely unknown. Deg/HtrA proteases, a family of serine-type ATP-independent proteases, have been shown in higher plants to be involved in the degradation of the Photosystem II reaction center protein D1. The objective of this review is to highlight the structure and function of their cyanobacterial orthologs. Homology modeling was used to find specific features of the SynDeg/HtrA proteases of Synechocystis sp. PCC 6803. Based on the available data concerning their location and their physiological substrates we conclude that these Deg proteases not only have important housekeeping and chaperone functions within the cell, but also are needed for remodeling the cell exterior. PMID:27252714

  15. Temporal dependence of cysteine protease activation following excitotoxic hippocampal injury.

    PubMed

    Berry, J N; Sharrett-Field, L J; Butler, T R; Prendergast, M A

    2012-10-11

    Excitotoxic insults can lead to intracellular signaling cascades that contribute to cell death, in part by activation of proteases, phospholipases, and endonucleases. Cysteine proteases, such as calpains, are calcium (Ca(2+))-activated enzymes which degrade cytoskeletal proteins, including microtubule-associated proteins, tubulin, and spectrin, among others. The current study used the organotypic hippocampal slice culture model to examine whether pharmacologic inhibition of cysteine protease activity inhibits N-methyl-D-aspartate- (NMDA-) induced excitotoxic (20 μM NMDA) cell death and changes in synaptophysin immunoreactivity. Significant NMDA-induced cytotoxicity (as measured by propidium iodide [PI] uptake) was found in the CA1 region of the hippocampus at all timepoints examined (24, 72, 120 h), an effect significantly attenuated by co-exposure to the selective NMDA receptor antagonist DL-2-Amino-5-phosphonopentanoic acid (APV), but not MDL-28170, a potent cysteine protease inhibitor. Results indicated sparing of NMDA-induced loss of the synaptic vesicular protein synaptophysin in all regions of the hippocampus by MDL-28170, though only at early timepoints after injury. These results suggest Ca(2+)-dependent recruitment of cysteine proteases within 24h of excitotoxic insult, but activation of alternative cellular degrading mechanisms after 24h. Further, these data suggest that synaptophysin may be a substrate for calpains and related proteases.

  16. Pnserpin: A Novel Serine Protease Inhibitor from Extremophile Pyrobaculum neutrophilum

    PubMed Central

    Zhang, Huan; Fei, Rui; Xue, Baigong; Yu, Shanshan; Zhang, Zuoming; Zhong, Sheng; Gao, Yuanqi; Zhou, Xiaoli

    2017-01-01

    Serine protease inhibitors (serpins) are native inhibitors of serine proteases, constituting a large protein family with members spread over eukaryotes and prokaryotes. However, only very few prokaryotic serpins, especially from extremophiles, have been characterized to date. In this study, Pnserpin, a putative serine protease inhibitor from the thermophile Pyrobaculum neutrophilum, was overexpressed in Escherichia coli for purification and characterization. It irreversibly inhibits chymotrypsin-, trypsin-, elastase-, and subtilisin-like proteases in a temperature range from 20 to 100 °C in a concentration-dependent manner. The stoichiometry of inhibition (SI) of Pnserpin for proteases decreases as the temperature increases, indicating that the inhibitory activity of Pnserpin increases with the temperature. SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) showed that Pnserpin inhibits proteases by forming a SDS-resistant covalent complex. Homology modeling and molecular dynamic simulations predicted that Pnserpin can form a stable common serpin fold. Results of the present work will help in understanding the structural and functional characteristics of thermophilic serpin and will broaden the current knowledge about serpins from extremophiles. PMID:28067849

  17. The Inflammatory Actions of Coagulant and Fibrinolytic Proteases in Disease

    PubMed Central

    Schuliga, Michael

    2015-01-01

    Aside from their role in hemostasis, coagulant and fibrinolytic proteases are important mediators of inflammation in diseases such as asthma, atherosclerosis, rheumatoid arthritis, and cancer. The blood circulating zymogens of these proteases enter damaged tissue as a consequence of vascular leak or rupture to become activated and contribute to extravascular coagulation or fibrinolysis. The coagulants, factor Xa (FXa), factor VIIa (FVIIa), tissue factor, and thrombin, also evoke cell-mediated actions on structural cells (e.g., fibroblasts and smooth muscle cells) or inflammatory cells (e.g., macrophages) via the proteolytic activation of protease-activated receptors (PARs). Plasmin, the principle enzymatic mediator of fibrinolysis, also forms toll-like receptor-4 (TLR-4) activating fibrin degradation products (FDPs) and can release latent-matrix bound growth factors such as transforming growth factor-β (TGF-β). Furthermore, the proteases that convert plasminogen into plasmin (e.g., urokinase plasminogen activator) evoke plasmin-independent proinflammatory actions involving coreceptor activation. Selectively targeting the receptor-mediated actions of hemostatic proteases is a strategy that may be used to treat inflammatory disease without the bleeding complications of conventional anticoagulant therapies. The mechanisms by which proteases of the coagulant and fibrinolytic systems contribute to extravascular inflammation in disease will be considered in this review. PMID:25878399

  18. The Crystal Structure of GXGD Membrane Protease FlaK

    SciTech Connect

    J Hu; Y Xue; S Lee; Y Ha

    2011-12-31

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  19. The crystal structure of GXGD membrane protease FlaK

    SciTech Connect

    Hu, Jian; Xue, Yi; Lee, Sangwon; Ha, Ya

    2011-09-20

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  20. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed

    Schauperl, Michael; Fuchs, Julian E; Waldner, Birgit J; Huber, Roland G; Kramer, Christian; Liedl, Klaus R

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4') with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design.

  1. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y

    2017-01-01

    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases.

  2. Protease inhibitors and proteolytic signalling cascades in insects.

    PubMed

    Gubb, David; Sanz-Parra, Arantza; Barcena, Laura; Troxler, Laurent; Fullaondo, Ane

    2010-12-01

    Proteolytic signalling cascades control a wide range of physiological responses. In order to respond rapidly, protease activity must be maintained at a basal level: the component zymogens must be sequentially activated and actively degraded. At the same time, signalling cascades must respond precisely: high target specificity is required. The insects have a wide range of trapping- and tight-binding protease inhibitors, which can regulate the activity of individual proteases. In addition, the interactions between component proteases of a signalling cascade can be modified by serine protease homologues. The suicide-inhibition mechanism of serpin family inhibitors gives rapid turnover of both protease and inhibitor, but target specificity is inherently broad. Similarly, the TEP/macroglobulins have extremely broad target specificity, which suits them for roles as hormone transport proteins and sensors of pathogenic virulence factors. The tight-binding inhibitors, on the other hand, have a lock-and-key mechanism capable of high target specificity. In addition, proteins containing multiple tight-binding inhibitory domains may act as scaffolds for the assembly of signalling complexes. Proteolytic cascades regulated by combinations of different types of inhibitor could combine the rapidity of suicide-inhibitors with the specificity lock-and-key inhibitors. This would allow precise control of physiological responses and may turn out to be a general rule.

  3. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed Central

    Schauperl, Michael; Fuchs, Julian E.; Waldner, Birgit J.; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4’) with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design. PMID:26559682

  4. Protease inhibitors from several classes work synergistically against Callosobruchus maculatus.

    PubMed

    Amirhusin, Bahagiawati; Shade, Richard E; Koiwa, Hisashi; Hasegawa, Paul M; Bressan, Ray A; Murdock, Larry L; Zhu-Salzman, Keyan

    2007-07-01

    Targeting multiple digestive proteases may be more effective in insect pest control than inhibition of a single enzyme class. We therefore explored possible interactions of three antimetabolic protease inhibitors fed to cowpea bruchids in artificial diets, using a recombinant soybean cysteine protease inhibitor scN, an aspartic protease inhibitor pepstatin A, and soybean Kunitz trypsin inhibitor KI. scN and pepstatin, inhibiting major digestive cysteine and aspartic proteases, respectively, significantly prolonged the developmental time of cowpea bruchids individually. When combined, the anti-insect effect was synergistic, i.e., the toxicity of the mixture was markedly greater than that of scN or pepstatin alone. KI alone did not impact insect development even at relatively high concentrations, but its anti-insect properties became apparent when acting jointly with scN or scN plus pepstatin. Incubating KI with bruchid midgut extract showed that it was partially degraded. This instability may explain its lack of anti-insect activity. However, this proteolytic degradation was inhibited by scN and/or pepstatin. Protection of KI from proteolysis in the insect digestive tract thus could be the basis for the synergistic effect. These observations support the concept that cowpea bruchid gut proteases play a dual role; digesting protein for nutrient needs and protecting insects by inactivating dietary proteins that may otherwise be toxic. Our results also suggest that transgenic resistance strategies that involve multigene products are likely to have enhanced efficacy and durability.

  5. 2-D zymographic analysis of Broccoli (Brassica oleracea L. var. Italica) florets proteases: follow up of cysteine protease isotypes in the course of post-harvest senescence.

    PubMed

    Rossano, Rocco; Larocca, Marilena; Riccio, Paolo

    2011-09-01

    Zymographic analysis of Broccoli florets (Brassica oleracea L. var. Italica) revealed the presence of acidic metallo-proteases, serine proteases and cysteine proteases. Under conditions which were denaturing for the other proteases, the study was restricted to cysteine proteases. 2-D zymography, a technique that combines IEF and zymography was used to show the presence of 11 different cysteine protease spots with molecular mass of 44 and 47-48kDa and pIs ranging between 4.1 and 4.7. pI differences could be ascribed to different degrees of phosphorylation that partly disappeared in the presence of alkaline phosphatase. Post-harvest senescence of Broccoli florets was characterized by decrease in protein and chlorophyll contents and increase of protease activity. In particular, as determined by 2-D zymography, the presence of cysteine protease clearly increased during senescence, a finding that may represent a useful tool for the control of the aging process.

  6. Dual origin of gut proteases in Formosan subterranean termites (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae).

    PubMed

    Sethi, Amit; Xue, Qing-Gang; La Peyre, Jerome F; Delatte, Jennifer; Husseneder, Claudia

    2011-07-01

    Cellulose digestion in lower termites, mediated by carbohydrases originating from both termite and endosymbionts, is well characterized. In contrast, limited information exists on gut proteases of lower termites, their origins and roles in termite nutrition. The objective of this study was to characterize gut proteases of the Formosan subterranean termite (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae). The protease activity of extracts from gut tissues (fore-, mid- and hindgut) and protozoa isolated from hindguts of termite workers was quantified using hide powder azure as a substrate and further characterized by zymography with gelatin SDS-PAGE. Midgut extracts showed the highest protease activity followed by the protozoa extracts. High level of protease activity was also detected in protozoa culture supernatants after 24 h incubation. Incubation of gut and protozoa extracts with class-specific protease inhibitors revealed that most of the proteases were serine proteases. All proteolytic bands identified after gelatin SDS-PAGE were also inhibited by serine protease inhibitors. Finally, incubation with chromogenic substrates indicated that extracts from fore- and hindgut tissues possessed proteases with almost exclusively trypsin-like activity while both midgut and protozoa extracts possessed proteases with trypsin-like and subtilisin/chymotrypsin-like activities. However, protozoa proteases were distinct from midgut proteases (with different molecular mass). Our results suggest that the Formosan subterranean termite not only produces endogenous proteases in its gut tissues, but also possesses proteases originating from its protozoan symbionts.

  7. Protease Production by Different Thermophilic Fungi

    NASA Astrophysics Data System (ADS)

    Macchione, Mariana M.; Merheb, Carolina W.; Gomes, Eleni; da Silva, Roberto

    A comparative study was carried out to evaluate protease production in solid-state fermentation (SSF) and submerged fermentation (SmF) by nine different thermophilic fungi — Thermoascus aurantiacus Miehe, Thermomyces lanuginosus, T. lanuginosus TO.03, Aspergillus flavus 1.2, Aspergillus sp. 13.33, Aspergillus sp. 13.34, Aspergillus sp. 13.35, Rhizomucor pusillus 13.36 and Rhizomucor sp. 13.37 — using substrates containing proteins to induce enzyme secretion. Soybean extract (soybean milk), soybean flour, milk powder, rice, and wheat bran were tested. The most satisfactory results were obtained when using wheat bran in SSF. The fungi that stood out in SSF were T. lanuginosus, T. lanuginosus TO.03, Aspergillus sp. 13.34, Aspergillus sp. 13.35, and Rhizomucor sp. 13.37, and those in SmF were T. aurantiacus, T. lanuginosus TO.03, and 13.37. In both fermentation systems, A. flavus 1.2 and R. pusillus 13.36 presented the lowest levels of proteolytic activity.

  8. German cockroach frass proteases modulate the innate immune response via activation of protease-activated receptor-2.

    PubMed

    Day, Scottie B; Zhou, Ping; Ledford, John R; Page, Kristen

    2010-01-01

    Allergen exposure can induce an early innate immune response; however, the mechanism by which this occurs has not been addressed. In this report, we demonstrate a role for the active serine proteases in German cockroach (GC) feces (frass) and protease-activated receptor (PAR)-2 in modulating the innate immune response. A single exposure of GC frass induced inflammatory cytokine production and cellular infiltration in the airways of mice. In comparison, exposure to protease-depleted GC frass resulted in diminution of inflammatory cytokine production and airway neutrophilia, but had no effect on macrophage infiltration. Selective activation of PAR-2 confirmed that PAR-2 was sufficient to induce airway inflammation. Exposure of GC frass to PAR-2-deficient mice led to decreased immune responses to GC frass compared to wild-type mice. Using the macrophage as an early marker of the innate immune response, we found that GC frass induced significant release of tumor necrosis factor-alpha from primary alveolar macrophages. This effect was dependent on the intrinsic proteases in GC frass. We confirmed GC frass-induced cytokine expression was mediated by activation of NF-kappaB and ERK in a macrophage cell line. Collectively, these data suggest a central role for GC frass protease-PAR-2 activation in regulating the innate immune response through the activation of alveolar macrophages. Understanding the potential role of protease-PAR-2 activation as a danger signal or adjuvant could yield attractive therapeutic targets.

  9. Protease induced plasticity: matrix metalloproteinase-1 promotes neurostructural changes through activation of protease activated receptor 1

    PubMed Central

    Allen, Megan; Ghosh, Suhasini; Ahern, Gerard P.; Villapol, Sonia; Maguire-Zeiss, Kathleen A.; Conant, Katherine

    2016-01-01

    Matrix metalloproteinases (MMPs) are a family of secreted endopeptidases expressed by neurons and glia. Regulated MMP activity contributes to physiological synaptic plasticity, while dysregulated activity can stimulate injury. Disentangling the role individual MMPs play in synaptic plasticity is difficult due to overlapping structure and function as well as cell-type specific expression. Here, we develop a novel system to investigate the selective overexpression of a single MMP driven by GFAP expressing cells in vivo. We show that MMP-1 induces cellular and behavioral phenotypes consistent with enhanced signaling through the G-protein coupled protease activated receptor 1 (PAR1). Application of exogenous MMP-1, in vitro, stimulates PAR1 dependent increases in intracellular Ca2+ concentration and dendritic arborization. Overexpression of MMP-1, in vivo, increases dendritic complexity and induces biochemical and behavioral endpoints consistent with increased GPCR signaling. These data are exciting because we demonstrate that an astrocyte-derived protease can influence neuronal plasticity through an extracellular matrix independent mechanism. PMID:27762280

  10. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.

    PubMed

    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal

    2016-08-09

    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  11. Characterization of a chemostable serine alkaline protease from Periplaneta americana

    PubMed Central

    2013-01-01

    Background Proteases are important enzymes involved in numerous essential physiological processes and hold a strong potential for industrial applications. The proteolytic activity of insects’ gut is endowed by many isoforms with diverse properties and specificities. Thus, insect proteases can act as a tool in industrial processes. Results In the present study, purification and properties of a serine alkaline protease from Periplaneta americana and its potential application as an additive in various bio-formulations are reported. The enzyme was purified near to homogeneity by using acetone precipitation and Sephadex G-100 gel filtration chromatography. Enzyme activity was increased up to 4.2 fold after gel filtration chromatography. The purified enzyme appeared as single protein-band with a molecular mass of ~ 27.8 kDa in SDS-PAGE. The optimum pH and temperature for the proteolytic activity for purified protein were found around pH 8.0 and 60°C respectively. Complete inhibition of the purified enzyme by phenylmethylsulfonyl fluoride confirmed that the protease was of serine-type. The purified enzyme revealed high stability and compatibility towards detergents, oxidizing, reducing, and bleaching agents. In addition, enzyme also showed stability towards organic solvents and commercial detergents. Conclusion Several important properties of a serine protease from P. Americana were revealed. Moreover, insects can serve as excellent and alternative source of industrially important proteases with unique properties, which can be utilized as additives in detergents, stain removers and other bio-formulations. Properties of the P. americana protease accounted in the present investigation can be exploited further in various industrial processes. As an industrial prospective, identification of enzymes with varying essential properties from different insect species might be good approach and bioresource. PMID:24229392

  12. Kinetics of alkaline protease production by Streptomyces griseoflavus PTCC1130

    PubMed Central

    Hosseini, Seyed Vesal; Saffari, Zahra; Farhanghi, Ali; Atyabi, Seyed Mohammad; Norouzian, Dariush

    2016-01-01

    Background and Objectives: Proteases are a group of enzymes that catalyze the degradation of proteins resulting in the production of their amino acid constituents. They are the most important group of industrial enzymes which account for about 60% of total enzymes in the market and produced mainly by microorganisms. The attempts were made to study the kinetic parameters of protease produced by Streptomyces griseoflavus PTCC1130. Materials and Methods: Streptomyces griseoflavus PTCC1130 was grown on casein agar. Different media such as BM1, BM2, BM3 and BM4 were prepared. Data obtained from growth and protease production were subjected to kinetics evaluation. Casein was used as substrate for protease activity and the released soluble peptide bearing aromatic amino acid were quantified by Folin Cioclateaue reagent. Protein content of the enzyme and the sugar utilized by the organism were estimated by Bradford and Miller’s methods respectively. Results: Basal Medium named as BM1, BM2, BM3 and BM4(50 mL in 250 mL Erlen Meyer flasks) were screened out to evaluate protease production by Streptomyces griseoflavus PTCC1130. They were inoculated with known amount of seed culture and kept on rotary shaker. To obtain the specific growth rate, wet weight of biomass was plotted against the time. The clarified supernatant was used for the analysis of protease by measuring the soluble peptide containing aromatic amino acid residues employing Folin Cioclateaue reagent. Our results showed that maximum level of enzyme production (14035 U/L) was occurred at late exponential phase using Basal Medium supplemented with zinc sulfate (0.5g/L), casein (10g/L) at pH 6.5. Conclusions: A kinetic study of protease production by Streptomyces griseoflavus PTCC1130 provided highly quantitative information regarding the behavior of a system, which is essential to study the fermentation process. Exploitation of such kinetics analysis would be useful in commercialization of microbial enzyme

  13. Protease increases fermentation rate and ethanol yield in dry-grind ethanol production.

    PubMed

    Johnston, David B; McAloon, Andrew J

    2014-02-01

    The effects of acid protease and urea addition during the fermentation step were evaluated. The fermentations were also tested with and without the addition of urea to determine if protease altered the nitrogen requirements of the yeast. Results show that the addition of the protease had a statistically significant effect on the fermentation rate and yield. Fermentation rates and yields were improved with the addition of the protease over the corresponding controls without protease. Protease addition either with or with added urea resulted in a higher final ethanol yield than without the protease addition. Urea addition levels >1200 ppm of supplemental nitrogen inhibited ethanol production. The economic effects of the protease addition were evaluated by using process engineering and economic models developed at the Eastern Regional Research Center. The decrease in overall processing costs from protease addition was as high as $0.01/L (4 ¢/gal) of denatured ethanol produced.

  14. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.

    PubMed

    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R

    2013-01-01

    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  15. The structure of a universally employed enzyme: V8 protease from Staphylococcus aureus

    SciTech Connect

    Prasad, Lata; Leduc, Yvonne; Hayakawa, Koto; Delbaere, Louis T.J.

    2008-06-27

    V8 protease, an extracellular protease of Staphylococcus aureus, is related to the pancreatic serine proteases. The enzyme cleaves peptide bonds exclusively on the carbonyl side of aspartate and glutamate residues. Unlike the pancreatic serine proteases, V8 protease possesses no disulfide bridges. This is a major evolutionary difference, as all pancreatic proteases have at least two disulfide bridges. The structure of V8 protease shows structural similarity with several other serine proteases, specifically the epidermolytic toxins A and B from S. aureus and trypsin, in which the conformation of the active site is almost identical. V8 protease is also unique in that the positively charged N-terminus is involved in determining the substrate-specificity of the enzyme.

  16. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases.

    PubMed

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang; Chen, Xiu-Lan

    2015-09-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed.

  17. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases

    PubMed Central

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang

    2015-01-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed. PMID:26150451

  18. HIV-1 protease-induced apoptosis

    PubMed Central

    2014-01-01

    Background Apoptosis is one of the presumptive causes of CD4+ T cell depletion during HIV infection and progression to AIDS. However, the precise role of HIV-1 in this process remains unexplained. HIV-1 protease (PR) has been suggested as a possible factor, but a direct link between HIV-1 PR enzymatic activity and apoptosis has not been established. Results Here, we show that expression of active HIV-1 PR induces death in HeLa and HEK-293 cells via the mitochondrial apoptotic pathway. This conclusion is based on in vivo observations of the direct localization of HIV-1 PR in mitochondria, a key player in triggering apoptosis. Moreover, we observed an HIV-1 PR concentration-dependent decrease in mitochondrial membrane potential and the role of HIV-1 PR in activation of caspase 9, PARP cleavage and DNA fragmentation. In addition, in vitro data demonstrated that HIV-1 PR mediates cleavage of mitochondrial proteins Tom22, VDAC and ANT, leading to release of AIF and Hsp60 proteins. By using yeast two-hybrid screening, we also identified a new HIV-1 PR interaction partner, breast carcinoma-associated protein 3 (BCA3). We found that BCA3 accelerates p53 transcriptional activity on the bax promoter, thus elevating the cellular level of pro-apoptotic Bax protein. Conclusion In summary, our results describe the involvement of HIV-1 PR in apoptosis, which is caused either by a direct effect of HIV-1 PR on mitochondrial membrane integrity or by its interaction with cellular protein BCA3. PMID:24886575

  19. Protease inhibitor from Moringa oleifera with potential for use as therapeutic drug and as seafood preservative

    PubMed Central

    Bijina, B.; Chellappan, Sreeja; Krishna, Jissa G.; Basheer, Soorej M.; Elyas, K.K.; Bahkali, Ali H.; Chandrasekaran, M.

    2011-01-01

    Protease inhibitors are well known to have several applications in medicine and biotechnology. Several plant sources are known to return potential protease inhibitors. In this study plants belonging to different families of Leguminosae, Malvaceae, Rutaceae, Graminae and Moringaceae were screened for the protease inhibitor. Among them Moringa oleifera, belonging to the family Moringaceae, recorded high level of protease inhibitor activity after ammonium sulfate fractionation. M. oleifera, which grows throughout most of the tropics and having several industrial and medicinal uses, was selected as a source of protease inhibitor since so far no reports were made on isolation of the protease inhibitor. Among the different parts of M. oleifera tested, the crude extract isolated from the mature leaves and seeds showed the highest level of inhibition against trypsin. Among the various extraction media evaluated, the crude extract prepared in phosphate buffer showed maximum recovery of the protease inhibitor. The protease inhibitor recorded high inhibitory activity toward the serine proteases thrombin, elastase, chymotrypsin and the cysteine proteases cathepsin B and papain which have more importance in pharmaceutical industry. The protease inhibitor also showed complete inhibition of activities of the commercially available proteases of Bacillus licheniformis and Aspergillus oryzae. However, inhibitory activities toward subtilisin, esperase, pronase E and proteinase K were negligible. Further, it was found that the protease inhibitor could prevent proteolysis in a commercially valuable shrimp Penaeus monodon during storage indicating the scope for its application as a seafood preservative. This is the first report on isolation of a protease inhibitor from M. oleifera. PMID:23961135

  20. Alkaline protease from Thermoactinomyces sp. RS1 mitigates industrial pollution.

    PubMed

    Verma, Amit; Ansari, Mohammad W; Anwar, Mohmmad S; Agrawal, Ruchi; Agrawal, Sanjeev

    2014-05-01

    Proteases have found a wide application in the several industrial processes, such as laundry detergents, protein recovery or solubilization, prion degradation, meat tenderizations, and in bating of hides and skins in leather industries. But the main hurdle in industrial application of proteases is their economical production on a large scale. The present investigation aimed to exploit the locally available inexpensive agricultural and household wastes for alkaline protease production using Thermoactinomyces sp. RS1 via solid-state fermentation (SSF) technique. The alkaline enzyme is potentially useful as an additive in commercial detergents to mitigate pollution load due to extensive use of caustic soda-based detergents. Thermoactinomyces sp. RS1 showed good protease production under SSF conditions of 55 °C, pH 9, and 50 % moisture content with potato peels as solid substrate. The presented findings revealed that crude alkaline protease produced by Thermoactinomyces sp. RS1 via SSF is of potential application in silver recovery from used X-ray films.

  1. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  2. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-01-01

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  3. Mitochondrial cereblon functions as a Lon-type protease.

    PubMed

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-07-15

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  4. Hydrophobic Core Flexibility Modulates Enzyme Activity in HIV-1 Protease

    SciTech Connect

    Mittal, Seema; Cai, Yufeng; Nalam, Madhavi N.L.; Bolon, Daniel N.A.; Schiffer, Celia A.

    2012-09-11

    Human immunodeficiency virus Type-1 (HIV-1) protease is crucial for viral maturation and infectivity. Studies of protease dynamics suggest that the rearrangement of the hydrophobic core is essential for enzyme activity. Many mutations in the hydrophobic core are also associated with drug resistance and may modulate the core flexibility. To test the role of flexibility in protease activity, pairs of cysteines were introduced at the interfaces of flexible regions remote from the active site. Disulfide bond formation was confirmed by crystal structures and by alkylation of free cysteines and mass spectrometry. Oxidized and reduced crystal structures of these variants show the overall structure of the protease is retained. However, cross-linking the cysteines led to drastic loss in enzyme activity, which was regained upon reducing the disulfide cross-links. Molecular dynamics simulations showed that altered dynamics propagated throughout the enzyme from the engineered disulfide. Thus, altered flexibility within the hydrophobic core can modulate HIV-1 protease activity, supporting the hypothesis that drug resistant mutations distal from the active site can alter the balance between substrate turnover and inhibitor binding by modulating enzyme activity.

  5. A Tunable, Modular Approach to Fluorescent Protease-Activated Reporters

    PubMed Central

    Wu, Peng; Nicholls, Samantha B.; Hardy, Jeanne A.

    2013-01-01

    Proteases are one of the most important and historically utilized classes of drug targets. To effectively interrogate this class of proteins, which encodes nearly 2% of the human proteome, it is necessary to develop effective and cost-efficient methods that report on their activity both in vitro and in vivo. We have developed a robust reporter of caspase proteolytic activity, called caspase-activatable green fluorescent protein (CA-GFP). The caspases play central roles in homeostatic regulation, as they execute programmed cell death, and in drug design, as caspases are involved in diseases ranging from cancer to neurodegeneration. CA-GFP is a genetically encoded dark-to-bright fluorescent reporter of caspase activity in in vitro, cell-based, and animal systems. Based on the CA-GFP platform, we developed reporters that can discriminate the activities of caspase-6 and -7, two highly related proteases. A second series of reporters, activated by human rhinovirus 3C protease, demonstrated that we could alter the specificity of the reporter by reengineering the protease recognition sequence. Finally, we took advantage of the spectrum of known fluorescent proteins to generate green, yellow, cyan, and red reporters, paving the way for multiplex protease monitoring. PMID:23561537

  6. Plant proteases for bioactive peptides release: A review.

    PubMed

    Mazorra-Manzano, M A; Ramírez-Suarez, J C; Yada, R Y

    2017-04-10

    Proteins are a potential source of health promoting biomolecules with medical, nutraceutical and food applications. Nowadays, bioactive peptides production, its isolation, characterization and strategies for its delivery to target sites are a matter of intensive research. In vitro and in vivo studies regarding the bioactivity of peptides has generated strong evidence of their health benefits. Dairy proteins are considered the richest source of bioactive peptides, however proteins from animal and vegetable origin also have been shown to be important sources. Enzymatic hydrolysis has been the process most commonly used for bioactive peptide production. Most commercial enzymatic preparations frequently used are from animal (e.g., trypsin and pepsin) and microbial (e.g., Alcalase® and Neutrase®) sources. Although the use of plant proteases is still relatively limited to papain and bromelain from papaya and pineapple, respectively, the application of new plant proteases is increasing. This review presents the latest knowledge in the use and diversity of plant proteases for bioactive peptides release from food-proteins including both available commercial plant proteases as well as new potential plant sources. Furthermore, the properties of peptides released by plant proteases and health benefits associated in the control of disorders such as hypertension, diabetes, obesity, and cancer are reviewed.

  7. Non-proteolytic functions of microbial proteases increase pathological complexity.

    PubMed

    Jarocki, Veronica M; Tacchi, Jessica L; Djordjevic, Steven P

    2015-03-01

    Proteases are enzymes that catalyse hydrolysis of peptide bonds thereby controlling the shape, size, function, composition, turnover and degradation of other proteins. In microbes, proteases are often identified as important virulence factors and as such have been targets for novel drug design. It is emerging that some proteases possess additional non-proteolytic functions that play important roles in host epithelia adhesion, tissue invasion and in modulating immune responses. These additional "moonlighting" functions have the potential to obfuscate data interpretation and have implications for therapeutic design. Moonlighting enzymes comprise a subcategory of multifunctional proteins that possess at least two distinct biological functions on a single polypeptide chain. Presently, identifying moonlighting proteins relies heavily on serendipitous empirical data with clues arising from proteins lacking signal peptides that are localised to the cell surface. Here, we describe examples of microbial proteases with additional non-proteolytic functions, including streptococcal pyrogenic exotoxin B, PepO and C5a peptidases, mycoplasmal aminopeptidases, mycobacterial chaperones and viral papain-like proteases. We explore how these non-proteolytic functions contribute to host cell adhesion, modulate the coagulation pathway, assist in non-covalent folding of proteins, participate in cell signalling, and increase substrate repertoire. We conclude by describing how proteomics has aided in moonlighting protein discovery, focusing attention on potential moonlighters in microbial exoproteomes.

  8. Microbial aspartic proteases: current and potential applications in industry.

    PubMed

    Theron, Louwrens W; Divol, Benoit

    2014-11-01

    Aspartic proteases are a relatively small group of proteolytic enzymes that are active in acidic environments and are found across all forms of life. Certain microorganisms secrete such proteases as virulence agents and/or in order to break down proteins thereby liberating assimilable sources of nitrogen. Some of the earlier applications of these proteolytic enzymes are found in the manufacturing of cheese where they are used as milk-clotting agents. Over the last decade, they have received tremendous research interest because of their involvement in human diseases. Furthermore, there has also been a growing interest on these enzymes for their applications in several other industries. Recent research suggests in particular that they could be used in the wine industry to prevent the formation of protein haze while preserving the wines' organoleptic properties. In this mini-review, the properties and mechanisms of action of aspartic proteases are summarized. Thereafter, a brief overview of the industrial applications of this specific class of proteases is provided. The use of aspartic proteases as alternatives to clarifying agents in various beverage industries is mentioned, and the potential applications in the wine industry are thoroughly discussed.

  9. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.

    PubMed

    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2009-10-01

    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  10. Continuous Proteolysis with a stabilized stabilized protease. I. Chemical stabilization of an alkaline protease.

    PubMed

    Boudrant, J; Cuq, J L; Cheftel, C

    1976-12-01

    Due to the loss of enzymatic activity as a function of time, an alkaline protease, selected for the continuous preparation of protein hydrolysates (J. Boudrant and C. Cheftel, Biotechnol. Bioeng., 18,1735, 1976), was chemically stabilized by a simple treatment with glutaraldehyde. Two fractions, soluble and insoluble, were obtained. The activities of these two fractions were measured with casein and N-benzoyl-L-arginine ethyl ester (BAEE) as a function of glutaraldehyde concentration used. It was noted that the insoluble fraction was practically inactive with the first substrate and that the heat stability of the soluble form was likewise enhanced. Molecular weights of these two forms were unchanged, but the uv-spectrum of the soluble form was modified. From amino acid analysis, it appears that this treatment mainly provokes a decrease in lysine content.

  11. Evidence for Reduced Drug Susceptibility without Emergence of Major Protease Mutations following Protease Inhibitor Monotherapy Failure in the SARA Trial

    PubMed Central

    Sutherland, Katherine A.; Parry, Chris M.; McCormick, Adele; Kapaata, Anne; Lyagoba, Fred; Kaleebu, Pontiano; Gilks, Charles F.; Goodall, Ruth; Spyer, Moira; Kityo, Cissy; Pillay, Deenan; Gupta, Ravindra K.

    2015-01-01

    Background Major protease mutations are rarely observed following failure with protease inhibitors (PI), and other viral determinants of failure to PI are poorly understood. We therefore characterized Gag-Protease phenotypic susceptibility in subtype A and D viruses circulating in East Africa following viral rebound on PIs. Methods Samples from baseline and treatment failure in patients enrolled in the second line LPV/r trial SARA underwent phenotypic susceptibility testing. Data were expressed as fold-change in susceptibility relative to a LPV-susceptible reference strain. Results We cloned 48 Gag-Protease containing sequences from seven individuals and performed drug resistance phenotyping from pre-PI and treatment failure timepoints in seven patients. For the six patients where major protease inhibitor resistance mutations did not emerge, mean fold-change EC50 to LPV was 4.07 fold (95% CI, 2.08–6.07) at the pre-PI timepoint. Following viral failure the mean fold-change in EC50 to LPV was 4.25 fold (95% CI, 1.39–7.11, p = 0.91). All viruses remained susceptible to DRV. In our assay system, the major PI resistance mutation I84V, which emerged in one individual, conferred a 10.5-fold reduction in LPV susceptibility. One of the six patients exhibited a significant reduction in susceptibility between pre-PI and failure timepoints (from 4.7 fold to 9.6 fold) in the absence of known major mutations in protease, but associated with changes in Gag: V7I, G49D, R69Q, A120D, Q127K, N375S and I462S. Phylogenetic analysis provided evidence of the emergence of genetically distinct viruses at the time of treatment failure, indicating ongoing viral evolution in Gag-protease under PI pressure. Conclusions Here we observe in one patient the development of significantly reduced susceptibility conferred by changes in Gag which may have contributed to treatment failure on a protease inhibitor containing regimen. Further phenotype-genotype studies are required to elucidate genetic

  12. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  13. New therapeutic strategies in HCV: second-generation protease inhibitors.

    PubMed

    Clark, Virginia C; Peter, Joy A; Nelson, David R

    2013-02-01

    Telaprevir and boceprevir are the first direct-acting antiviral agents approved for use in HCV treatment and represent a significant advance in HCV therapy. However, these first-generation drugs also have significant limitations related to thrice-daily dosing, clinically challenging side-effect profiles, low barriers to resistance and a lack of pan-genotype activity. A second wave of protease inhibitors are in phase II and III trials and promise to provide a drug regimen with a better dosing schedule and improved tolerance. These second-wave protease inhibitors will probably be approved in combination with PEG-IFN and Ribavirin (RBV), as well as future all-oral regimens. The true second-generation protease inhibitors are in earlier stages of development and efficacy data are anxiously awaited as they may provide pan-genotypic antiviral activity and a high genetic barrier to resistance.

  14. Membrane-anchored serine proteases in health and disease

    PubMed Central

    Bugge, Thomas; Wu, Qingyu

    2013-01-01

    Serine proteases of the trypsin-like family have long been recognized to be critical effectors of biological processes as diverse as digestion, blood coagulation, fibrinolysis, and immunity. In recent years, a subgroup of these enzymes has been identified that are anchored directly to plasma membranes, either by a carboxy-terminal transmembrane domain (Type I), an amino-terminal transmembrane domain with a cytoplasmic extension (Type II or TTSP), or through a glycosyl-phosphatidylinositol (GPI) linkage. Recent biochemical, cellular, and in vivo analyses have now established that membrane-anchored serine proteases are key pericellular contributors to processes vital for development and the maintenance of homeostasis. This chapter will review our current knowledge of the biological and physiological functions of these proteases, their molecular substrates, and their contributions to disease. PMID:21238933

  15. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  16. Peptide synthesis in neat organic solvents with novel thermostable proteases.

    PubMed

    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B

    2015-06-01

    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  17. Tobacco Etch Virus protease: A shortcut across biotechnologies.

    PubMed

    Cesaratto, Francesca; Burrone, Oscar R; Petris, Gianluca

    2016-08-10

    About thirty years ago, studies on the RNA genome of Tobacco Etch Virus revealed the presence of an efficient and specific protease, called Tobacco Etch Virus protease (TEVp), that was part of the Nuclear Inclusion a (NIa) enzyme. TEVp is an efficient and specific protease of 27kDa that has become a valuable biotechnological tool. Nowadays TEVp is a unique endopeptidase largely exploited in biotechnology from industrial applications to in vitro and in vivo cellular studies. A number of TEVp mutants with different rate of cleavage, stability and specificity have been reported. Similarly, a panel of different target cleavage sites, derived from the canonical ENLYFQ-G/S site, has been established. In this review we describe these aspects of TEVp and some of its multiple applications. A particular focus is on the use and molecular biology of TEVp in living cells and organisms.

  18. Cleaning protocols for crystallization robots: preventing protease contamination.

    PubMed

    Naschberger, Andreas; Fürnrohr, Barbara G; Dunzendorfer-Matt, Theresia; Bonagura, Christopher A; Wright, David; Scheffzek, Klaus; Rupp, Bernhard

    2015-01-01

    The protease in the commonly used commercial low-foam enzyme cleaner Zymit cannot be completely blocked by EDTA, a widely used inhibitor of metalloproteases, at concentrations of up to 5 mM. Severe protein degradation was observed in crystallization drops after EDTA-containing wash steps unless residual Zymit protease was removed with NaOH at a concentration of at least 0.1 M. Wash steps with 0.1% SDS were also ineffective in completely removing the remaining Zymit activity. Protocols including wash steps with at least 0.1 M NaOH, as for example specified in the original ZENM protocol, are recommended to completely deactivate Zymit protease activity.

  19. Lvserpin3 is involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

    PubMed

    Liu, Yongjie; Liu, Tao; Hou, Fujun; Wang, Xianzong; Liu, Xiaolin

    2016-01-01

    Serine protease inhibitor, represented by serpin, plays an important inhibitory role on proteases involved in the immune responses. To clarify the immune characterizations of serpin, a novel serpin (Lvserpin3) encoding for 410 amino acids with a 23-amino acid signal peptide and a serpin domain was identified from the Pacific white shrimp Litopenaeus vannamei. Lvserpin3 expressed strongest in hepatopancreas, and was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Suppression of Lvserpin3 by dsRNA led to a significant increase in the transcripts of LvPPAF, LvproPO and phenoloxidase (PO) activity, and also led to the high cumulative mortality. The recombinant Lvserpin3 protein (rLvserpin3) inhibited the proteases secreted by M. lysodeikticus and Bacillus subtilis, and further exhibited inhibitory role on the growth of B. subtilis and M. lysodeikticu. Moreover, rLvserpin3 was found to be able to block the activation of prophenoloxidase system. Taken together, the results imply that Lvserpin3 may be involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

  20. Taspase1: a 'misunderstood' protease with translational cancer relevance.

    PubMed

    Wünsch, D; Hahlbrock, A; Jung, S; Schirmeister, T; van den Boom, J; Schilling, O; Knauer, S K; Stauber, R H

    2016-06-30

    Proteolysis is not only a critical requirement for life, but the executing enzymes also play important roles in numerous pathological conditions, including cancer. Therefore, targeting proteases is clearly relevant for improving cancer patient care. However, to effectively control proteases, a profound knowledge of their mechanistic function as well as their regulation and downstream signalling in health and disease is required. The highly conserved protease Threonine Aspartase1 (Taspase1) is overexpressed in numerous liquid and solid malignancies and was characterized as a 'non-oncogene addiction' protease. Although Taspase1 was shown to cleave various regulatory proteins in humans as well as leukaemia provoking mixed lineage leukaemia fusions, our knowledge on its detailed functions and the underlying mechanisms contributing to cancer is still incomplete. Despite superficial similarity to type 2 asparaginases as well as Ntn proteases, such as the proteasome, Taspase1-related research so far gives us the picture of a unique protease exhibiting special features. Moreover, neither effective genetic nor chemical inhibitors for this enzyme are available so far, thus hampering not only to further dissect Taspase1's pathobiological functions but also precluding the assessment of its clinical impact. Based on recent insights, we here critically review the current knowledge of Taspase1's structure-function relationship and its mechanistic relevance for tumorigenesis obtained from in vitro and in vivo cancer models. We provide a comprehensive overview of tumour entities for which Taspase1 might be of predictive and therapeutic value, and present the respective experimental evidence. To stimulate progress in the field, a comprehensive overview of Taspase1 targeting approaches is presented, including coverage of Taspase1-related patents. We conclude by discussing future inhibition strategies and relevant challenges, which need to be resolved by the field.

  1. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  2. Association of a protease with polytene chromosomes of Drosophila melanogaster.

    PubMed

    Cavagnaro, J; Pierce, D A; Lucchesi, J C; Chae, C B

    1980-11-01

    Incubation of Drosophila salivary glands with radioactive diisopropyl fluorophosphate results in the uniform labeling of polytene chromosomes. Extensive labeling is seen only when chromosome squashes are prepared by a formaldehyde fixation procedure and not by standard acetic acid techniques. The labeling is inhibited in the presence of tosylphenylalanine chloromethyl ketone and phenylmethane sulfonylfluoride but not by tosyllysine chloromethyl ketone, suggesting that a chymotrypsin-like serine protease is associated with the chromosomes. Protease inhibitors show no apparent effect on heat-shock specific puffing.

  3. [Cytokines and proteases involved in pathogenesis of COPD].

    PubMed

    Yamaya, Atsuyo; Osanai, Kazuhiro

    2011-10-01

    COPD is characterized by persistence of chronic inflammation in small airways and alveoli. Macrophages, neutrophils, and a specialized subset of T lymphocytes orchestrate the mild inflammation. This article focuses on humoral factors such as cytokines and chemokines that recruit these inflammatory and immune cells to the lungs, and proteases/antiproteases that ultimately cause structural derangement in the terminal respiratory zones. In addition to the classical protease and antiprotease imbalance hypothesis, alveolar homeostasis abnormality that comes from imbalance of lung constitutional cell apoptosis and regeneration may play a role in emphysema development. Also, autoimmunity to elastin degradation products may take part in the disease.

  4. The chlamydial protease CPAF: important or not, important for what?

    PubMed

    Häcker, Georg

    2014-05-01

    The protease CPAF is only found in Chlamydiales and in at least most bacteria that share with Chlamydia the biphasic life-style in a cytosolic inclusion. CPAF is intriguing: it appears to be secreted from the inclusion across the inclusion membrane into the cytosol. A bacterial protease ravaging in the cytosol of a human cell may cause a plethora of effects. Curiously, very few are known. The current discussion is bogged down by a focus on experimental artifact, while proposed functions of CPAF remain speculative. I here make the attempt to summarize what we know about CPAF.

  5. Regulation by proteolysis: energy-dependent proteases and their targets.

    PubMed Central

    Gottesman, S; Maurizi, M R

    1992-01-01

    A number of critical regulatory proteins in both prokaryotic and eukaryotic cells are subject to rapid, energy-dependent proteolysis. Rapid degradation combined with control over biosynthesis provides a mechanism by which the availability of a protein can be limited both temporally and spatially. Highly unstable regulatory proteins are involved in numerous biological functions, particularly at the commitment steps in developmental pathways and in emergency responses. The proteases involved in energy-dependent proteolysis are large proteins with the ability to use ATP to scan for appropriate targets and degrade complete proteins in a processive manner. These cytoplasmic proteases are also able to degrade many abnormal proteins in the cell. PMID:1480111

  6. Identification of Genotypic Changes in Human Immunodeficiency Virus Protease That Correlate with Reduced Susceptibility to the Protease Inhibitor Lopinavir among Viral Isolates from Protease Inhibitor-Experienced Patients

    PubMed Central

    Kempf, Dale J.; Isaacson, Jeffrey D.; King, Martin S.; Brun, Scott C.; Xu, Yi; Real, Kathryn; Bernstein, Barry M.; Japour, Anthony J.; Sun, Eugene; Rode, Richard A.

    2001-01-01

    The association of genotypic changes in human immunodeficiency virus (HIV) protease with reduced in vitro susceptibility to the new protease inhibitor lopinavir (previously ABT-378) was explored using a panel of viral isolates from subjects failing therapy with other protease inhibitors. Two statistical tests showed that specific mutations at 11 amino acid positions in protease (L10F/I/R/V, K20M/R, L24I, M46I/L, F53L, I54L/T/V, L63P, A71I/L/T/V, V82A/F/T, I84V, and L90M) were associated with reduced susceptibility. Mutations at positions 82, 54, 10, 63, 71, and 84 were most closely associated with relatively modest (4- and 10-fold) changes in phenotype, while the K20M/R and F53L mutations, in conjunction with multiple other mutations, were associated with >20- and >40-fold-reduced susceptibility, respectively. The median 50% inhibitory concentrations (IC50) of lopinavir against isolates with 0 to 3, 4 or 5, 6 or 7, and 8 to 10 of the above 11 mutations were 0.8-, 2.7-, 13.5-, and 44.0-fold higher, respectively, than the IC50 against wild-type HIV. On average, the IC50 of lopinavir increased by 1.74-fold per mutation in isolates containing three or more mutations. Each of the 16 viruses that displayed a >20-fold change in susceptibility contained mutations at residues 10, 54, 63, and 82 and/or 84, along with a median of three mutations at residues 20, 24, 46, 53, 71, and 90. The number of protease mutations from the 11 identified in these analyses (the lopinavir mutation score) may be useful for the interpretation of HIV genotypic resistance testing with respect to lopinavir-ritonavir (Kaletra) regimens and may provide insight into the genetic barrier to resistance to lopinavir-ritonavir in both antiretroviral therapy-naive and protease inhibitor-experienced patients. PMID:11462018

  7. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases.

    PubMed

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers.

  8. A New Subtilase-Like Protease Deriving from Fusarium equiseti with High Potential for Industrial Applications.

    PubMed

    Juntunen, Kari; Mäkinen, Susanna; Isoniemi, Sari; Valtakari, Leena; Pelzer, Alexander; Jänis, Janne; Paloheimo, Marja

    2015-09-01

    A gene encoding a novel extracellular subtilisin-like protease was cloned from the ascomycete Fusarium equiseti and expressed in Trichoderma reesei. The F. equiseti protease (Fe protease) showed excellent performance in stain removal and good compatibility with several commercial laundry detergent formulations, suggesting that it has high potential for use in various industrial applications. The recombinant enzyme was purified and characterized. The temperature optimum of the Fe protease was 60 °C and it showed high activity in the pH range of 6-10, with a sharp decline in activity at pH above 10. The amino acid specificity of the Fe protease was studied using casein, cytochrome c, and ubiquitin as substrates. The Fe protease had broad substrate specificity: almost all amino acid residues were accepted at position P1, even though it showed some preference for cleavage at the C-terminal side of asparagine and histidine residues. The S4 subsite of Fe protease favors aspartic acid and threonine. The other well-characterized proteases from filamentous fungi, Proteinase K from Engyodontium album, Thermomycolin from Malbranchea sulfurea, and alkaline subtilisins from Bacillus species prefer hydrophobic amino acids in both the S1 and S4 subsites. Due to its different specificity compared to the members of the S8 family of clan SB of proteases, we consider that the Fe protease is a new protease. It does not belong to any previously defined IUBMB groups of proteases.

  9. The effects of bioprocess parameters on extracellular proteases in a recombinant Aspergillus niger B1-D.

    PubMed

    Li, Qiang; Harvey, Linda M; McNeil, Brian

    2008-02-01

    Although host proteases are often considered to have a negative impact upon heterologous protein production by filamentous fungi, relatively little is known about the pattern of their appearance in recombinant fungal bioprocesses. In the present study, we investigated extracellular proteases from a filamentous fungus, Aspergillus niger B1-D, genetically modified to secrete hen egg white lysozyme (HEWL). Our findings indicate that extracellular protease activity is only detected after the carbon source is completely utilised in batch cultures. The proteases are predominantly acid proteases and have optimal temperature for activity at around 45 degrees C. Their activity could be partially inhibited by protease inhibitors, indicating the existence of at least four kinds of proteases in these culture fluids, aspartic-, serine-, cysteine-, and metallo-proteases. Oxygen enrichment does not have any noticeable effects on extracellular protease activity except that the onset of protease activity appears earlier in oxygen enrichment runs. Oxygen enrichment stimulates HEWL production substantially, and we propose that it is related to fungal morphology. Thermal stress imposed by raising process temperature (from 25 to 30 and 35 degrees C) in early exponential phase, led to appearance of protease activity in the medium following the heat shock. Continued cultivation at high temperatures significantly reduced HEWL production, which was associated with increased activity of the extracellular proteases in these cultures.

  10. Teaching Foundational Topics and Scientific Skills in Biochemistry within the Conceptual Framework of HIV Protease

    ERIC Educational Resources Information Center

    Johnson, R. Jeremy

    2014-01-01

    HIV protease has served as a model protein for understanding protein structure, enzyme kinetics, structure-based drug design, and protein evolution. Inhibitors of HIV protease are also an essential part of effective HIV/AIDS treatment and have provided great societal benefits. The broad applications for HIV protease and its inhibitors make it a…

  11. Emerging technologies for protease engineering: New tools to clear out disease.

    PubMed

    Guerrero, Jennifer L; Daugherty, Patrick S; O'Malley, Michelle A

    2017-01-01

    Proteases regulate many biological processes through their ability to activate or inactive their target substrates. Because proteases catalytically turnover proteins and peptides, they present unique opportunities for use in biotechnological and therapeutic applications. However, many proteases are capable of cleaving multiple physiological substrates. Therefore their activity, expression, and localization are tightly controlled to prevent unwanted proteolysis. Currently, the use of protease therapeutics has been limited to a handful of proteases with narrow substrate specificities, which naturally limits their toxicity. Wider application of proteases is contingent upon the development of methods for engineering protease selectivity, activity, and stability. Recent advances in the development of high-throughput, bacterial and yeast-based methods for protease redesign have yielded protease variants with novel specificities, reduced toxicity, and increased resistance to inhibitors. Here, we highlight new tools for protease engineering, including methods suitable for the redesign of human secreted proteases, and future opportunities to exploit the catalytic activity of proteases for therapeutic benefit. Biotechnol. Bioeng. 2017;114: 33-38. © 2016 Wiley Periodicals, Inc.

  12. A novel serine protease inhibitor from Bungarus fasciatus venom.

    PubMed

    Lu, Jia; Yang, Hailong; Yu, Haining; Gao, Weikai; Lai, Ren; Liu, Jingze; Liang, Xingcai

    2008-03-01

    By Sephadex G-50 gel filtration, cation-exchange CM-Sephadex C-25 chromatography and reversed phase high-performance liquid chromatography (HPLC), a novel serine protease inhibitor named bungaruskunin was purified and characterized from venom of Bungarus fasciatus. Its cDNA was also cloned from the cDNA library of B. fasciatus venomous glands. The predicted precursor is composed of 83 amino acid (aa) residues including a 24-aa signal peptide and a 59-aa mature bungaruskunin. Bungaruskunin showed maximal similarity (64%) with the predicted serine protease inhibitor blackelin deduced from the cDNA sequence of the red-bellied black snake Pseudechis porphyriacus. Bungaruskunin is a Kunitz protease inhibitor with a conserved Kunitz domain and could exert inhibitory activity against trypsin, chymotrypsin, and elastase. By screening the cDNA library, two new B chains of beta-bungarotoxin are also identified. The overall structures of bungaruskunin and beta-bungarotoxin B chains are similar; especially they have highly conserved signal peptide sequences. These findings strongly suggest that snake Kunitz/BPTI protease inhibitors and neurotoxic homologs may have originated from a common ancestor.

  13. The non-death role of metacaspase proteases.

    PubMed

    Shrestha, Amit; Megeney, Lynn A

    2012-01-01

    The activation of caspase proteases and the targeting of protein substrates act as key steps in the engagement and conduct of apoptosis/programmed cell death. However, the discovery of caspase involvement in diverse non-apoptotic cellular functions strongly suggests that these proteins may have evolved from a core behavior unrelated to the induction of cell death. The presence of similar proteases, termed metacaspases, in single cell organisms supports the contention that such proteins may have co-evolved or derived from a critical non-death function. Indeed, the benefit(s) for single cell life forms to retain proteins solely dedicated to self destruction would be countered by a strong selection pressure to curb or eliminate such processes. Examination of metacaspase biology provides evidence that these ancient protease forerunners of the caspase family also retain versatility in function, i.e., death and non-death cell functions. Here, we provide a critical review that highlights the non-death roles of metacaspases that have been described thus far, and the impact that these observations have for our understanding of the evolution and cellular utility of this protease family.

  14. Design, synthesis, and activity of nanocellulosic protease sensors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Here we contrast the molecular assembly, and biochemical utility of nanocellulosic materials prepared from cotton and wood as protease sensors. The cotton-based nanocellulosic substrates were prepared in a variety of ways to produce nanocrystals, films and aerogels, which were derivatized with eithe...

  15. Protease inhibitors interfere with the necessary factors of carcinogenesis.

    PubMed

    Troll, W

    1989-05-01

    Many tumor promoters are inflammatory agents that stimulate the formation of oxygen radicals (.O2-) and hydrogen peroxide (H2O2) in phagocytic neutrophils. The neutrophils use the oxygen radicals to kill bacteria, which are recognized by the cell membrane of phagocytic cells causing a signal to mount the oxygen response. The tumor promoter isolated from croton oil, 12-O-tetradecanoylphorbol-13-acetate (TPA), mimics the signal, causing an oxygen radical release that is intended to kill bacteria; instead, it injures cells in the host. Oxygen radicals cause single strand breaks in DNA and modify DNA bases. These damaging reactions appear to be related to tumor promotion, as three types of chemopreventive agents, retinoids, onion oil, and protease inhibitors, suppress the induction of oxygen radicals in phagocytic neutrophils and suppress tumor promotion in skin cancer in mice. Protease inhibitors also suppress breast and colon cancers in mice. Protease inhibitors capable of inhibiting chymotrypsin show a greater suppression of the oxygen effect and are better suppressors of tumor promotion. In addition, oxygen radicals may be one of the many agents that cause activation of oncogenes. Since retinoids and protease inhibitors suppress the expression of the ras oncogene in NIH 3T3 cells, NIH 3T3 cells may serve as a relatively facile model for finding and measuring chemopreventive agents that interfere with the carcinogenic process.

  16. Botulinum neurotoxin: a deadly protease with applications to human medicine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Botulinum neurotoxins (BoNTs) are some of the most potent biological toxins to humans. They are synthesized by the gram-positive, spore-forming bacterium Clostridium botulinum. BoNT is secreted from the bacterium as a ~150 kDa polypeptide which is cleaved by bacterial or host proteases into a ~50 kD...

  17. Processing and targeting of the thiol protease aleurain: Progress report

    SciTech Connect

    Rogers, J.C.

    1988-01-01

    This study addresses the processing and targeting of the thiol protease aleurain in monocots. A probe derived from the aleurain cDNA specific for the 5'-most 400 bp (a region encoding the first 140 amino acids of the preprotein hybridized to at least 3 separate elements in the barley genome; only one represented the aleurain gene. In contrast, a probe specific for the remaining 2/23 of the cDNA (representing the protease domain) hybridized to only a single copy sequence. To know if this pattern pertained in other, closely related, monocots, we probed Southern blots of genomic DNA from maize, rye, oats, sorghum, and pearl millet with each probe. In each instance except for maize DNA, the 5' domain probe hybridizes to several fragments in addition to those identified by the protease domain probe. Presumable the darkest hybridization in each represents the fragment carrying the sequences homologous to barley aleurain. The fragments from a given restriction enzyme identified by the protease domain probe in sorghum, millet, and maize, were indistinguishable in size indicating that the gene sequences, as well as flanking DNA, are so well conserved among the group that the location of the hexanucleotide sequences have not diverged. (3 refs., 3 figs.)

  18. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.

    PubMed

    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui

    2017-02-27

    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  19. Post-translational control of genetic circuits using Potyvirus proteases

    PubMed Central

    Fernandez-Rodriguez, Jesus; Voigt, Christopher A.

    2016-01-01

    Genetic engineering projects often require control over when a protein is degraded. To this end, we use a fusion between a degron and an inactivating peptide that can be added to the N-terminus of a protein. When the corresponding protease is expressed, it cleaves the peptide and the protein is degraded. Three protease:cleavage site pairs from Potyvirus are shown to be orthogonal and active in exposing degrons, releasing inhibitory domains and cleaving polyproteins. This toolbox is applied to the design of genetic circuits as a means to control regulator activity and degradation. First, we demonstrate that a gate can be constructed by constitutively expressing an inactivated repressor and having an input promoter drive the expression of the protease. It is also shown that the proteolytic release of an inhibitory domain can improve the dynamic range of a transcriptional gate (200-fold repression). Next, we design polyproteins containing multiple repressors and show that their cleavage can be used to control multiple outputs. Finally, we demonstrate that the dynamic range of an output can be improved (8-fold to 190-fold) with the addition of a protease-cleaved degron. Thus, controllable proteolysis offers a powerful tool for modulating and expanding the function of synthetic gene circuits. PMID:27298256

  20. Mast Cell Proteases as Protective and Inflammatory Mediators

    PubMed Central

    Caughey, George H.

    2014-01-01

    Proteases are the most abundant class of proteins produced by mast cells. Many of these are stored in membrane-enclosed intracellular granules until liberated by degranulating stimuli, which include cross-linking of high affinity IgE receptor FcεRI by IgE bound to multivalent allergen. Understanding and separating the functions of the proteases is important because expression differs among mast cells in different tissue locations. Differences between laboratory animals and humans in protease expression also influence the degree of confidence with which results obtained in animal models of mast cell function can be extrapolated to humans. The inflammatory potential of mast cell proteases was the first aspect of their biology to be explored and has received the most attention, in part because some of them—notably tryptases and chymases—are biomarkers of local and systemic mast cell degranulation and anaphylaxis. Although some of the proteases indeed augment allergic inflammation and are potential targets for inhibition to treat asthma and related allergic disorders, they are protective and even anti-inflammatory in some settings. For example, mast cell tryptases may protect from serious bacterial lung infections and may limit the “rubor” component of inflammation caused by vasodilating neuropeptides in the skin. Chymases help to maintain intestinal barrier function and to expel parasitic worms, and may support blood pressure during anaphylaxis by generating angiotensin II. In other life-or-death examples, carboxypeptidase A3 and other mast cell peptidases limit systemic toxicity of endogenous peptides like endothelin and neurotensin during septic peritonitis, and inactivate venom-associated peptides. On the other hand, mast cell peptidase-mediated destruction of protective cytokines, like IL-6, can enhance mortality from sepsis. Peptidases released from mast cells also influence non-mast cell proteases, such as by activating matrix metalloproteinase cascades

  1. Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

    SciTech Connect

    Fischer, Katja; Langendorf, Christopher G.; Irving, James A.; Reynolds, Simone; Willis, Charlene; Beckham, Simone; Law, Ruby H.P.; Yang, Sundy; Bashtannyk-Puhalovich, Tanya A.; McGowan, Sheena; Whisstock, James C.; Pike, Robert N.; Kemp, David J.; Buckle, Ashley M.

    2009-08-07

    The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalytically inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.

  2. Highly efficient and easy protease-mediated protein purification.

    PubMed

    Last, Daniel; Müller, Janett; Dawood, Ayad W H; Moldenhauer, Eva J; Pavlidis, Ioannis V; Bornscheuer, Uwe T

    2016-02-01

    As both research on and application of proteins are rarely focused on the resistance towards nonspecific proteases, this property remained widely unnoticed, in particular in terms of protein purification and related fields. In the present study, diverse aspects of protease-mediated protein purification (PMPP) were explored on the basis of the complementary proteases trypsin and proteinase K as well as the model proteins green fluorescent protein (GFP) from Aequorea victoria, lipase A from Candida antarctica (CAL-A), a transaminase from Aspergillus fumigatus (AspFum), quorum quenching lactonase AiiA from Bacillus sp., and an alanine dehydrogenase from Thermus thermophilus (AlaDH). While GFP and AiiA were already known to be protease resistant, the thermostable enzymes CAL-A, AspFum, and AlaDH were selected due to the documented correlation between thermostability and protease resistance. As proof of principle for PMPP, recombinant GFP remained unaffected whereas most Escherichia coli (E. coli) host proteins were degraded by trypsin. PMPP was highly advantageous compared to the widely used heat-mediated purification of commercial CAL-A. The resistance of AspFum towards trypsin was improved by rational protein design introducing point mutation R20Q. Trypsin also served as economical and efficient substitute for site-specific endopeptidases for the removal of a His-tag fused to AiiA. Moreover, proteolysis of host enzymes with interfering properties led to a strongly improved sensitivity and accuracy of the NADH assay in E. coli cell lysate for AlaDH activity measurements. Thus, PMPP is an attractive alternative to common protein purification methods and facilitates also enzyme characterization in cell lysate.

  3. Nematicidal Bacteria Associated to Pinewood Nematode Produce Extracellular Proteases

    PubMed Central

    Francisco, Romeu; Verissimo, Paula; Santos, Susana S.; Fonseca, Luís; Abrantes, Isabel M. O.; Morais, Paula V.

    2013-01-01

    Bacteria associated with the nematode Bursaphelenchus xylophilus, a pathogen of trees and the causal agent of pine wilt disease (PWD) may play a role in the disease. In order to evaluate their role (positive or negative to the tree), strains isolated from the track of nematodes from infected Pinus pinaster trees were screened, in vitro, for their nematicidal potential. The bacterial products, from strains more active in killing nematodes, were screened in order to identify and characterize the nematicidal agent. Forty-seven strains were tested and, of these, 21 strains showed capacity to produce extracellular products with nematicidal activity. All Burkholderia strains were non-toxic. In contrast, all Serratia strains except one exhibited high toxicity. Nematodes incubated with Serratia strains showed, by SEM observation, deposits of bacteria on the nematode cuticle. The most nematicidal strain, Serratia sp. A88copa13, produced proteases in the supernatant. The use of selective inhibitors revealed that a serine protease with 70 kDa was majorly responsible for the toxicity of the supernatant. This extracellular serine protease is different phylogenetically, in size and biochemically from previously described proteases. Nematicidal assays revealed differences in nematicidal activity of the proteases to different species of Bursaphelenchus, suggesting its usefulness in a primary screen of the nematodes. This study offers the basis for further investigation of PWD and brings new insights on the role bacteria play in the defense of pine trees against B. xylophilus. Understanding all the factors involved is important in order to develop strategies to control B. xylophilus dispersion. PMID:24244546

  4. Crystal structure of Clostridium botulinum neurotoxin protease in a product-bound state: Evidence for noncanonical zinc protease activity.

    PubMed

    Segelke, Brent; Knapp, Mark; Kadkhodayan, Saloumeh; Balhorn, Rod; Rupp, Bernhard

    2004-05-04

    Clostridium botulinum neurotoxins (BoNTs), the most potent toxins known, disrupt neurotransmission through proteolysis of proteins involved in neuroexocytosis. The light chains of BoNTs are unique zinc proteases that have stringent substrate specificity and require exceptionally long substrates. We have determined the crystal structure of the protease domain from BoNT serotype A (BoNT/A). The structure reveals a homodimer in a product-bound state, with loop F242-V257 from each monomer deeply buried in its partner's catalytic site. The loop, which acts as a substrate, is oriented in reverse of the canonical direction for other zinc proteases. The Y249-Y250 peptide bond of the substrate loop is hydrolyzed, leaving the Y249 product carboxylate coordinated to the catalytic zinc. From the crystal structure of the BoNT/A protease, detailed models of noncanonical binding and proteolysis can be derived which we propose are also consistent with BoNT/A binding and proteolysis of natural substrate synaptosome-associated protein of 25 kDa (SNAP-25). The proposed BoNT/A substrate-binding mode and catalytic mechanism are markedly different from those previously proposed for the BoNT serotype B.

  5. Characterization of the Protease Activity of Detergents: Laboratory Practicals for Studying the Protease Profile and Activity of Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-01-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body…

  6. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  7. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  8. Proteases of Wood Rot Fungi with Emphasis on the Genus Pleurotus

    PubMed Central

    Inácio, Fabíola Dorneles; Ferreira, Roselene Oliveira; de Araujo, Caroline Aparecida Vaz; Brugnari, Tatiane; Castoldi, Rafael; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

    2015-01-01

    Proteases are present in all living organisms and they play an important role in physiological conditions. Cell growth and death, blood clotting, and immune defense are all examples of the importance of proteases in maintaining homeostasis. There is growing interest in proteases due to their use for industrial purposes. The search for proteases with specific characteristics is designed to reduce production costs and to find suitable properties for certain industrial sectors, as well as good producing organisms. Ninety percent of commercialized proteases are obtained from microbial sources and proteases from macromycetes have recently gained prominence in the search for new enzymes with specific characteristics. The production of proteases from saprophytic basidiomycetes has led to the identification of various classes of proteases. The genus Pleurotus has been extensively studied because of its ligninolytic enzymes. The characteristics of this genus are easy cultivation techniques, high yield, low nutrient requirements, and excellent adaptation. There are few studies in the literature about proteases of Pleurotus spp. This review gathers together information about proteases, especially those derived from basidiomycetes, and aims at stimulating further research about fungal proteases because of their physiological importance and their application in various industries such as biotechnology and medicine. PMID:26180792

  9. Identification and characterization of a chymotrypsin-like serine protease from periodontal pathogen, Tannerella forsythia.

    PubMed

    Hockensmith, K; Dillard, K; Sanders, B; Harville, B A

    2016-11-01

    Tannerella forsythia is a bacteria associated with severe periodontal disease. This study reports identification and characterization of a membrane-associated serine protease from T. forsythia. The protease was isolated from T. forsythia membrane fractions and shown to cleave both gelatin and type I collagen. The protease was able to cleave both substrates over a wide range of pH values, however optimal cleavage occurred at pH 7.5 for gelatin and 8.0 for type I collagen. The protease was also shown to cleave both gelatin and type I collagen at the average reported temperature for the gingival sulcus however it showed a lack of thermal stability with a complete loss of activity by 60 °C. When treated with protease inhibitors the enzyme's activity could only be completely inhibited by serine protease inhibitors antipain and phenylmethanesulfonyl fluoride (PMSF). Further characterization of the protease utilized serine protease synthetic peptides. The protease cleaved N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide but not Nα-benzoyl-dl-arginine p-nitroanilide (BAPNA) or N-methoxysuccinyl-Ala-Ala-Pro-Val p-nitroanilide indicating that the protease is a chymotrypsin-like serine protease. Since type I collagen is a major component in the gingival tissues and periodontal ligament, identification and characterization of this enzyme provides important information regarding the role of T. forsythia in periodontal disease.

  10. Fungal fermentation of whey incorporated with certain supplements for the production of proteases.

    PubMed

    Ashour, S A; el-Shora, H M; Metwally, M; Habib, S A

    1996-01-01

    The pattern and the extent of formation of proteases and secretion varied with the fungus, age and/or the nature of the co-supplement. Addition of yeast extract induced the best yield of proteases from both Aspergillus niger and A. terreus. Proteases from A. niger were highly induced by glutamic acid, alanine or albumin, with minor differences, whereas gelatin, peptone, aspartic acid, casein or acetamide stimulated the accumulation of proteases in the culture medium of A. terreus. Galactose stimulated the yield of the enzyme particularly with A. terreus while most C-supplements inhibited such processes, more prominently in the presence of cellulose or starch. Incorporation of nicotinic acid and wheat bran initiated the maximum productivity of proteases from A. niger and A. terreus, respectively. Co+2 and Cu+2 highly stimulated the output of proteases from A. niger and A. terreus, respectively. Co+2 and Ca+2 stimulated the enzyme activity of alkaline and acid proteases from A. terreus and acid proteases from A. niger. The other six cations and DTT inhibited variably the three proteases particularly alkaline proteases from A. terreus indicating that proteases from various sources even from closely related species showed different properties.

  11. Purification and biochemical characterization of an alkaline protease from marine bacteria Pseudoalteromonas sp. 129-1.

    PubMed

    Wu, Shimei; Liu, Ge; Zhang, Dechao; Li, Chaoxu; Sun, Chaomin

    2015-12-01

    An extracellular alkaline protease produced by marine bacteria strain Pseudoalteromonas sp. 129-1 was purified by ammonium sulphate precipitation, anion exchange chromatography, and gel filtration. The purity of the protease was confirmed by SDS-PAGE and molecular mass was estimated to be 35 kDa. The protease maintained considerable activity and stability at a wide temperature range of 10-60 °C and pH range of 6-11, and optimum activity was detected at temperature of 50 °C and pH of 8. Metallo-protease inhibitor, EDTA, had no inhibitory effect on protease activity even at concentration up to 15 mM, whereas 15 mM PMSF, a common serine protease inhibitor, greatly inactivated the protease. The high stability of the protease in the presence of surfactants (SDS, Tween 80, and Triton X-100), oxidizing agent H(2)O(2), and commercial detergents was observed. Moreover, the protease was tolerant to most of the tested organic solvents, and saline tolerant up to 30%. Interestingly, biofilm of Pseudomonas aeruginosa PAO1 was greatly reduced by 0.01 mg ml(-1) of the protease, and nearly completely abolished with the concentration of 1 mg ml(-1). Collectively, the protease showed valuable feathers as an additive in laundry detergent and non-toxic anti-biofilm agent.

  12. Copper inhibits the HIV-1 protease by both oxygen-dependent and oxygen-independent mechanisms

    SciTech Connect

    Karlstroem, A.R.; Levine, R.L. )

    1991-03-11

    The protease encoded by HIV-1 is essential for the processing of the viral polyproteins encoded by the gag and pol genes into mature viral proteins. Mutation or deletion of the protease gene blocks replication of the virus, making the protease an attractive target for antiviral therapy. The authors found that the HIV-1 protease is inhibited by micromolar concentrations of Cu{sup 2+}. Protease was 50% inhibited by exposure to 5 {mu}M copper for 5 min while exposure to 25 {mu}M caused complete inhibition. This inhibition was not oxygen-dependent and was not reversed by treatment with EDTA, presumably due to the slow off-rate of copper from the protease. Consistent with this interpretation, enzyme activity was recovered after denaturation and refolding of the copper exposed protease. Titration of the inactivated enzyme with Ellman's reagent demonstrated a loss of one of the two sulfhydryl groups present in the molecule, suggesting that copper inhibition was mediated through binding to a cysteine. This was confirmed in studies with a chemically synthesize, mutant protease in which the two cysteine residues were replaced by {alpha}-amino butyrate: The mutant protease was not inhibited by copper. However, both the wild-type and mutant protease were inactivated when exposed to copper, oxygen, and dithiothreitol. This inactivation required oxygen. Thus, the protease can also be inactivated by metal catalyzed oxidation (MCO), a presumably irreversible covalent modification.

  13. Development of marine biotechnology as a resource for novel proteases and their role in modern biotechnology.

    PubMed

    Homaei, Ahmad; Lavajoo, Fatemeh; Sariri, Reyhaneh

    2016-07-01

    Marine environment consists of the largest sources diversified genetic pool of material with an enormous potential for a wide variety of enzymes including proteases. A protease hydrolyzes the peptide bond and most of proteases possess many industrial applications. Marine proteases differ considerably from those found in internal or external organs of invertebrates and vertebrates. In common with all enzymes, external factors such as temperature, pH and type of media are important for the activity, catalytic efficiency, stability and proper functioning of proteases. In this review valuable characteristics of proteases in marine organisms and their applications are gathered from a wide literature survey. Considering their biochemical significance and their increasing importance in biotechnology, a thorough understanding of marine proteases functioning could be of prime importance.

  14. Production of plant proteases in vivo and in vitro--a review.

    PubMed

    González-Rábade, Nuria; Badillo-Corona, Jesús Agustín; Aranda-Barradas, Juan Silvestre; Oliver-Salvador, María Del Carmen

    2011-01-01

    In the latest two decades, the interest received by plant proteases has increased significantly. Plant enzymes such as proteases are widely used in medicine and the food industry. Some proteases, like papain, bromelain and ficin are used in various processes such as brewing, meat softening, milk-clotting, cancer treatment, digestion and viral disorders. These enzymes can be obtained from their natural source or through in vitro cultures, in order to ensure a continuous source of plant enzymes. The focus of this review will be the production of plant proteases both in vivo and in vitro, with particular emphasis on the different types of commercially important plant proteases that have been isolated and characterized from naturally grown plants. In vitro approaches for the production of these proteases is also explored, focusing on the techniques that do not involve genetic transformation of the plants and the attempts that have been made in order to enhance the yield of the desired proteases.

  15. Robust substrate profiling method reveals striking differences in specificities of serum and lung fluid proteases.

    PubMed

    Watson, Douglas S; Jambunathan, Kalyani; Askew, David S; Kodukula, Krishna; Galande, Amit K

    2011-08-01

    Proteases are candidate biomarkers and therapeutic targets for many diseases. Sensitive and robust techniques are needed to quantify proteolytic activities within the complex biological milieu. We hypothesized that a combinatorial protease substrate library could be used effectively to identify similarities and differences between serum and bronchoalveolar lavage fluid (BALF), two body fluids that are clinically important for developing targeted therapies and diagnostics. We used a concise library of fluorogenic probes to map the protease substrate specificities of serum and BALF from guinea pigs. Differences in the proteolytic fingerprints of the two fluids were striking: serum proteases cleaved substrates containing cationic residues and proline, whereas BALF proteases cleaved substrates containing aliphatic and aromatic residues. Notably, cleavage of proline-containing substrates dominated all other protease activities in both human and guinea pig serum. This substrate profiling approach provides a foundation for quantitative comparisons of protease specificities between complex biological samples.

  16. Protease Substrate Profiling by N-Terminal COFRADIC.

    PubMed

    Staes, An; Van Damme, Petra; Timmerman, Evy; Ruttens, Bart; Stes, Elisabeth; Gevaert, Kris; Impens, Francis

    2017-01-01

    Detection of (neo-)N-terminal peptides is essential for identifying protease cleavage sites . We here present an update of a well-established and efficient selection method for enriching N-terminal peptides out of peptide mixtures: N-terminal COFRADIC (COmbined FRActional DIagonal Chromatography). This method is based on the old concept of diagonal chromatography, which involves a peptide modification step in between otherwise identical chromatographic separations, with this modification step finally allowing for the isolation of N-terminal peptides by longer retention of non-N-terminal peptides on the resin. N-terminal COFRADIC has been successfully applied in many protease-centric studies, as well as for studies on protein alpha-N-acetylation and on characterizing alternative translation initiation events.

  17. Acquisition of accurate data from intramolecular quenched fluorescence protease assays.

    PubMed

    Arachea, Buenafe T; Wiener, Michael C

    2017-04-01

    The Intramolecular Quenched Fluorescence (IQF) protease assay utilizes peptide substrates containing donor-quencher pairs that flank the scissile bond. Following protease cleavage, the dequenched donor emission of the product is subsequently measured. Inspection of the IQF literature indicates that rigorous treatment of systematic errors in observed fluorescence arising from inner-filter absorbance (IF) and non-specific intermolecular quenching (NSQ) is incompletely performed. As substrate and product concentrations vary during the time-course of enzyme activity, iterative solution of the kinetic rate equations is, generally, required to obtain the proper time-dependent correction to the initial velocity fluorescence data. Here, we demonstrate that, if the IQF assay is performed under conditions where IF and NSQ are approximately constant during the measurement of initial velocity for a given initial substrate concentration, then a simple correction as a function of initial substrate concentration can be derived and utilized to obtain accurate initial velocity data for analysis.

  18. A high molecular weight protease in liver cytosol.

    PubMed

    Rose, I A; Warms, J V; Hershko, A

    1979-09-10

    A high molecular weight (greater than 400,000) protease active with [3H]leucine-labeled globin has been found in the postmicrosomal fraction of mouse kidney, brain, heart, spleen, and tumor cells and is most active in liver. The presence in liver was unexpected because liver cytosol is very ineffective in the breakdown of endogenous, labeled proteins. The enzyme has a number of properties that distinguish it from known cathepsins in addition to its high molecular weight. It is most active at pH approximately 7.5. When purified, it is unstable above 20 degrees C and is stabilized by metal chelating agents such as citrate, creatine-P, and glycerate-3-P. It is an -SH protease, but its thermal instability is not affected by 1 mM dithiothreitol. The enzyme is not lysosomal.

  19. Cold Denaturation of the HIV-1 Protease Monomer.

    PubMed

    Rösner, Heike I; Caldarini, Martina; Prestel, Andreas; Vanoni, Maria A; Broglia, Ricardo A; Aliverti, Alessandro; Tiana, Guido; Kragelund, Birthe B

    2017-02-28

    The human immunodeficiency virus-1 (HIV-1) protease is a complex protein that in its active form adopts a homodimer dominated by β-sheet structures. We have discovered a cold-denatured state of the monomeric subunit of HIV-1 protease that is populated above 0 °C and therefore directly accessible to various spectroscopic approaches. Using nuclear magnetic resonance secondary chemical shifts, temperature coefficients, and protein dynamics, we suggest that the cold-denatured state populates a compact wet globule containing transient non-native-like α-helical elements. From the linearity of the temperature coefficients and the hydrodynamic radii, we propose that the overall architecture of the cold-denatured state is maintained over the temperature range studied.

  20. Neural ECM proteases in learning and synaptic plasticity.

    PubMed

    Tsilibary, Effie; Tzinia, Athina; Radenovic, Lidija; Stamenkovic, Vera; Lebitko, Tomasz; Mucha, Mariusz; Pawlak, Robert; Frischknecht, Renato; Kaczmarek, Leszek

    2014-01-01

    Recent studies implicate extracellular proteases in synaptic plasticity, learning, and memory. The data are especially strong for such serine proteases as thrombin, tissue plasminogen activator, neurotrypsin, and neuropsin as well as matrix metalloproteinases, MMP-9 in particular. The role of those enzymes in the aforementioned phenomena is supported by the experimental results on the expression patterns (at the gene expression and protein and enzymatic activity levels) and functional studies, including knockout mice, specific inhibitors, etc. Counterintuitively, the studies have shown that the extracellular proteolysis is not responsible mainly for an overall degradation of the extracellular matrix (ECM) and loosening perisynaptic structures, but rather allows for releasing signaling molecules from the ECM, transsynaptic proteins, and latent form of growth factors. Notably, there are also indications implying those enzymes in the major neuropsychiatric disorders, probably by contributing to synaptic aberrations underlying such diseases as schizophrenia, bipolar, autism spectrum disorders, and drug addiction.

  1. Intestinal proteases of free-living and parasitic astigmatid mites.

    PubMed

    Holt, Deborah C; Burgess, Stewart T G; Reynolds, Simone L; Mahmood, Wajahat; Fischer, Katja

    2013-02-01

    Among arthropod pests, mites are responsible for considerable damage to crops, humans and other animals. However, detailed physiological data on these organisms remain sparse, mainly because of their small size but possibly also because of their extreme diversity. Focusing on intestinal proteases, we draw together information from three distinct mite species that all feed on skin but have separately adapted to a free-living, a strictly ecto-parasitic and a parasitic lifestyle. A wide range of studies involving immunohistology, molecular biology, X-ray crystallography and enzyme biochemistry of mite gut proteases suggests that these creatures have diverged considerably as house dust mites, sheep scab mites and scabies mites. Each species has evolved a particular variation of a presumably ancestral repertoire of digestive enzymes that have become specifically adapted to their individual environmental requirements.

  2. Mitochondrial proteases and protein quality control in ageing and longevity.

    PubMed

    Hamon, Marie-Paule; Bulteau, Anne-Laure; Friguet, Bertrand

    2015-09-01

    Mitochondria have been implicated in the ageing process and the lifespan modulation of model organisms. Mitochondria are the main providers of energy in eukaryotic cells but also represent both a major source of reactive oxygen species and targets for protein oxidative damage. Since protein damage can impair mitochondrial function, mitochondrial proteases are critically important for protein maintenance and elimination of oxidized protein. In the mitochondrial matrix, protein quality control is mainly achieved by the Lon and Clp proteases which are also key players in damaged mitochondrial proteins degradation. Accumulation of damaged macromolecules resulting from oxidative stress and failure of protein maintenance constitutes a hallmark of cellular and organismal ageing and is believed to participate to the age-related decline of cellular function. Hence, age-related impairment of mitochondrial protein quality control may therefore contribute to the age-associated build-up of oxidized protein and alterations of mitochondrial redox and protein homeostasis.

  3. Cockroach induces inflammatory responses through protease-dependent pathways.

    PubMed

    Wada, Kota; Matsuwaki, Yoshinori; Moriyama, Hiroshi; Kita, Hirohito

    2011-01-01

    Exposure to cockroaches is a major risk factor for asthma. Products from cockroaches may contain proteases and ligands for pattern recognition receptors. These molecules may activate airway inflammatory cells, such as eosinophils, that are involved in asthma. Among inner-city children, cockroach allergens play an especially important role in increasing asthma morbidity. The molecular mechanism for this association between cockroach exposure and asthma is not fully understood. Enzymatic activities from cockroaches activate inflammatory cells in the airways and may also exacerbate certain human airway diseases, such as asthma. We recently reported that cockroach extracts contain pepstatin A-sensitive proteases that activate PAR-2 and induce activation and degranulation of human eosinophils. This review focuses on the effects of cockroach on various inflammatory cells, including eosinophils, epithelial cells, fibroblasts, dendritic cells, and T cells, in allergic reactions.

  4. Design and Validation of Novel Chikungunya Virus Protease Inhibitors.

    PubMed

    Das, Pratyush Kumar; Puusepp, Laura; Varghese, Finny S; Utt, Age; Ahola, Tero; Kananovich, Dzmitry G; Lopp, Margus; Merits, Andres; Karelson, Mati

    2016-12-01

    Chikungunya virus (CHIKV; genus Alphavirus) is the causative agent of chikungunya fever. CHIKV replication can be inhibited by some broad-spectrum antiviral compounds; in contrast, there is very little information about compounds specifically inhibiting the enzymatic activities of CHIKV replication proteins. These proteins are translated in the form of a nonstructural (ns) P1234 polyprotein precursor from the CHIKV positive-strand RNA genome. Active forms of replicase enzymes are generated using the autoproteolytic activity of nsP2. The available three-dimensional (3D) structure of nsP2 protease has made it a target for in silico drug design; however, there is thus far little evidence that the designed compounds indeed inhibit the protease activity of nsP2 and/or suppress CHIKV replication. In this study, a set of 12 compounds, predicted to interact with the active center of nsP2 protease, was designed using target-based modeling. The majority of these compounds were shown to inhibit the ability of nsP2 to process recombinant protein and synthetic peptide substrates. Furthermore, all compounds found to be active in these cell-free assays also suppressed CHIKV replication in cell culture, the 50% effective concentration (EC50) of the most potent inhibitor being ∼1.5 μM. Analysis of stereoisomers of one compound revealed that inhibition of both the nsP2 protease activity and CHIKV replication depended on the conformation of the inhibitor. Combining the data obtained from different assays also indicates that some of the analyzed compounds may suppress CHIKV replication using more than one mechanism.

  5. Botulinum neurotoxin A protease: discovery of natural product exosite inhibitors.

    PubMed

    Silhár, Peter; Capková, Katerina; Salzameda, Nicholas T; Barbieri, Joseph T; Hixon, Mark S; Janda, Kim D

    2010-03-10

    A new mechanistic class of BoNT/A zinc metalloprotease inhibitors, from Echinacea, exemplified by the natural product d-chicoric acid (I1) is disclosed. A detailed evaluation of chicoric acid's mechanism of inhibition reveals that the inhibitor binds to an exosite, displays noncompetitive partial inhibition, and is synergistic with a competitive active site inhibitor when used in combination. Other components found in Echinacea, I3 and I4, were also inhibitors of the protease.

  6. Epsilon substituted lysinol derivatives as HIV-1 protease inhibitors.

    PubMed

    Jones, Kristen L G; Holloway, M Katharine; Su, Hua-Poo; Carroll, Steven S; Burlein, Christine; Touch, Sinoeun; DiStefano, Daniel J; Sanchez, Rosa I; Williams, Theresa M; Vacca, Joseph P; Coburn, Craig A

    2010-07-15

    A series of HIV-1 protease inhibitors containing an epsilon substituted lysinol backbone was synthesized. Two novel synthetic routes using N-boc-L-glutamic acid alpha-benzyl ester and 2,6-diaminopimelic acid were developed. Incorporation of this epsilon substituent enabled access to the S2 pocket of the enzyme, affording high potency inhibitors. Modeling studies and synthetic efforts suggest the potency increase is due to both conformational bias and van der Waals interactions with the S2 pocket.

  7. Enhanced Thermostability of a Fungal Alkaline Protease by Different Additives

    PubMed Central

    Nirmal, Nilesh P.; Laxman, R. Seeta

    2014-01-01

    A fungal strain (Conidiobolus brefeldianus MTCC 5184) isolated from plant detritus secreted a high activity alkaline protease. Thermostability studies of the fungal alkaline protease (FAP) revealed that the protease is stable up to 50°C with 40% residual activity after one hour. Effect of various additives such as sugars, sugar alcohols, polyols, and salts, on the thermostability of FAP was evaluated. Among the additives tested, glycerol, mannitol, xylitol, sorbitol, and trehalose were found to be very effective in increasing the stability of FAP, which was found to be concentration dependent. Fivefold increase in residual activity of FAP was observed in the presence of trehalose (50%) and sorbitol (50%) at 50°C for 4 h, compared to FAP without additive. Other additives like calcium at 20 mM and 10–15% ammonium sulphate showed lower stability improvement than trehalose and sorbitol. NaCl, MgCl2, K2HPO4, and glycine were found to be poor stabilizers and showed only a marginal improvement. PEG 6000 did not show any increase in stability but was found to be slightly inhibitory. PMID:25105022

  8. New roles for perforins and proteases in apicomplexan egress.

    PubMed

    Roiko, Marijo S; Carruthers, Vern B

    2009-10-01

    Egress is a pivotal step in the life cycle of intracellular pathogens initiating the transition from an expiring host cell to a fresh target cell. While much attention has been focused on understanding cell invasion by intracellular pathogens, recent work is providing a new appreciation of mechanisms and therapeutic potential of microbial egress. This review highlights recent insight into cell egress by apicomplexan parasites and emerging contributions of membranolytic and proteolytic secretory products, along with host proteases. New findings suggest that Toxoplasma gondii secretes a pore-forming protein, TgPLP1, during egress that facilitates parasite escape from the cell by perforating the parasitophorous membrane. Also, in a cascade of proteolytic events, Plasmodium falciparum late-stage schizonts activate and secrete a subtilisin, PfSUB1, which processes enigmatic putative proteases called serine-repeat antigens that contribute to merozoite egress. A new report also suggests that calcium-activated host proteases called calpains aid parasite exit, possibly by acting upon the host cytoskeleton. Together these discoveries reveal important new molecular players involved in the principal steps of egress by apicomplexans.

  9. Luminal Cathepsin G and Protease-Activated Receptor 4

    PubMed Central

    Dabek, Marta; Ferrier, Laurent; Roka, Richard; Gecse, Krisztina; Annahazi, Anita; Moreau, Jacques; Escourrou, Jean; Cartier, Christel; Chaumaz, Gilles; Leveque, Mathilde; Ait-Belgnaoui, Afifa; Wittmann, Tibor; Theodorou, Vassilia; Bueno, Lionel

    2009-01-01

    Impairment of the colonic epithelial barrier and neutrophil infiltration are common features of inflammatory bowel disease. Luminal proteases affect colonic permeability through protease-activated receptors (PARs). We evaluated: (i) whether fecal supernatants from patients with ulcerative colitis (UC) trigger alterations of colonic paracellular permeability and inflammation, and (ii) the roles of cathepsin G (Cat-G), a neutrophil serine protease, and its selective receptor, PAR4, in these processes. Expression levels of both PAR4 and Cat-G were determined in colonic biopsies from UC and healthy subjects. The effects of UC fecal supernatants on colonic paracellular permeability were measured in murine colonic strips. Involvement of Cat-G and PAR4 was evaluated using pepducin P4pal-10 and specific Cat-G inhibitor (SCGI), respectively. In addition, the effect of PAR4-activating peptide was assessed. UC fecal supernatants, either untreated or pretreated with SCGI, were infused into mice, and myeloperoxidase activity was determined. PAR4 was found to be overexpressed in UC colonic biopsies. Increased colonic paracellular permeability that was triggered by UC fecal supernatants was blocked by both SCGI (77%) and P4pal-10 (85%). Intracolonic infusion of UC fecal supernatants into mice increased myeloperoxidase activity. This effect was abolished by SCGI. These observations support that both Cat-G and PAR4 play key roles in generating and/or amplifying relapses in UC and provide a rationale for the development of new therapeutic agents in the treatment of this disease. PMID:19528350

  10. Functional Divergence of Two Secreted Immune Proteases of Tomato.

    PubMed

    Ilyas, Muhammad; Hörger, Anja C; Bozkurt, Tolga O; van den Burg, Harrold A; Kaschani, Farnusch; Kaiser, Markus; Belhaj, Khaoula; Smoker, Matthew; Joosten, Matthieu H A J; Kamoun, Sophien; van der Hoorn, Renier A L

    2015-08-31

    Rcr3 and Pip1 are paralogous secreted papain-like proteases of tomato. Both proteases are inhibited by Avr2 from the fungal pathogen Cladosporium fulvum, but only Rcr3 acts as a co-receptor for Avr2 recognition by the tomato Cf-2 immune receptor. Here, we show that Pip1-depleted tomato plants are hyper-susceptible to fungal, bacterial, and oomycete plant pathogens, demonstrating that Pip1 is an important broad-range immune protease. By contrast, in the absence of Cf-2, Rcr3 depletion does not affect fungal and bacterial infection levels but causes increased susceptibility only to the oomycete pathogen Phytophthora infestans. Rcr3 and Pip1 reside on a genetic locus that evolved over 36 million years ago. These proteins differ in surface-exposed residues outside the substrate-binding groove, and Pip1 is 5- to 10-fold more abundant than Rcr3. We propose a model in which Rcr3 and Pip1 diverged functionally upon gene duplication, possibly driven by an arms race with pathogen-derived inhibitors or by coevolution with the Cf-2 immune receptor detecting inhibitors of Rcr3, but not of Pip1.

  11. Pathogen-secreted proteases activate a novel plant immune pathway.

    PubMed

    Cheng, Zhenyu; Li, Jian-Feng; Niu, Yajie; Zhang, Xue-Cheng; Woody, Owen Z; Xiong, Yan; Djonović, Slavica; Millet, Yves; Bush, Jenifer; McConkey, Brendan J; Sheen, Jen; Ausubel, Frederick M

    2015-05-14

    Mitogen-activated protein kinase (MAPK) cascades play central roles in innate immune signalling networks in plants and animals. In plants, however, the molecular mechanisms of how signal perception is transduced to MAPK activation remain elusive. Here we report that pathogen-secreted proteases activate a previously unknown signalling pathway in Arabidopsis thaliana involving the Gα, Gβ, and Gγ subunits of heterotrimeric G-protein complexes, which function upstream of an MAPK cascade. In this pathway, receptor for activated C kinase 1 (RACK1) functions as a novel scaffold that binds to the Gβ subunit as well as to all three tiers of the MAPK cascade, thereby linking upstream G-protein signalling to downstream activation of an MAPK cascade. The protease-G-protein-RACK1-MAPK cascade modules identified in these studies are distinct from previously described plant immune signalling pathways such as that elicited by bacterial flagellin, in which G proteins function downstream of or in parallel to an MAPK cascade without the involvement of the RACK1 scaffolding protein. The discovery of the new protease-mediated immune signalling pathway described here was facilitated by the use of the broad host range, opportunistic bacterial pathogen Pseudomonas aeruginosa. The ability of P. aeruginosa to infect both plants and animals makes it an excellent model to identify novel immunoregulatory strategies that account for its niche adaptation to diverse host tissues and immune systems.

  12. Proteases at work: cues for understanding neural development and degeneration

    PubMed Central

    Saftig, Paul; Bovolenta, Paola

    2015-01-01

    Proteolytical processing of membrane bound molecules is a fundamental mechanism for the degradation of these proteins as well as for controlling cell-to-cell communication, which is at the basis of tissue development and homeostasis. Members of families of metalloproteinases and intra-membrane proteases are major effectors of these events. A recent workshop in Baeza, Spain, was devoted to discuss how this mechanism coordinates brain development and how its dysfunction leads to brain pathologies. Herein we summarize the findings presented during this workshop, which illuminate the role of metalloproteinases, including matrix metalloproteinase, A Disintegrin and Metalloproteinase-proteases and intra-membrane proteases, in the regulation of neurogenesis, axon guidance, and synaptogenesis as well as in neurodegeneration. Indeed, there is increasing evidence that proteolysis at the membrane is directly linked to neuropathologies such as Alzheimer Disease and autism spectrum or prion disorders. These proteolytic events are tightly regulated and we are just at the beginning of understanding how these processes could be exploited to design therapeutic treatments aimed at alleviating psychiatric and neurodegenerative pathologies. PMID:25999813

  13. Evolution of the protease-activated receptor family in vertebrates

    PubMed Central

    JIN, MIN; YANG, HAI-WEI; TAO, AI-LIN; WEI, JI-FU

    2016-01-01

    Belonging to the G protein-coupled receptor (GPcr) family, the protease-activated receptors (Pars) consist of 4 members, PAR1-4. PARs mediate the activation of cells via thrombin, serine and other proteases. Such protease-triggered signaling events are thought to be critical for hemostasis, thrombosis and other normal pathological processes. In the present study, we examined the evolution of PARs by analyzing phylogenetic trees, chromosome location, selective pressure and functional divergence based on the 169 functional gene alignment sequences from 57 vertebrate gene sequences. We found that the 4 PARs originated from 4 invertebrate ancestors by phylogenetic trees analysis. The selective pressure results revealed that only PAR1 appeared by positive selection during its evolution, while the other PAR members did not. In addition, we noticed that although these PARs evolved separately, the results of functional divergence indicated that their evolutional rates were similar and their functions did not significantly diverge. The findings of our study provide valuable insight into the evolutionary history of the vertebrate PAR family. PMID:26820116

  14. [Extracellular proteases of mycelial fungi as participants of pathogenic processes].

    PubMed

    Dunaevskiĭ, Ia E; Matveeva, A R; Fatkhullina, G N; Beliakova, G A; Kolomiets, T M; Kovalenko, E D; Belozerskiĭ, M A

    2008-01-01

    The interest in proteases secreted by mycelial fungi is due to several reasons of which one of the most important is their involvement in the initiation and development of the pathogenic process. A comparison of saprophytic and phytopathogenic mycelial fungi revealed one characteristic feature, namely, the appearance of a new trypsin-like activity in phytopathogens that is absent in saprophytes. To clear up the question of whether the degree of pathogenicity of a fungus is related to the activity of secreted trypsin-like protease, several species of Fusarium of various pathogenicity were compared. In two species, F. sporotrichioides (which causes ear fusa-riosis of rye) and F. heterosporum (the causative agent of root rot in wheat), a clear correlation between the activity and pathogenicity was revealed: the more pathogenetic F. sporotrichioides exhibited a higher extracellular trypsin-like activity than the less pathogenetic species F. heterosporum. Thus, the presence of trypsin-like activity in a saprotroph-pathogen pair may be an indicator of the pathogenicity of a fungus; in some cases, the value of this activity may indicate the degree of its pathogenicity. This suggests that trypsin-like proteases specific to phytopathogens are directly involved in the pathogenetic process, probably, through interaction with the "sentry" protein or the product of the resistance gene.

  15. Optimum production and characterization of an acid protease from marine yeast Metschnikowia reukaufii W6b

    NASA Astrophysics Data System (ADS)

    Li, Jing; Peng, Ying; Wang, Xianghong; Chi, Zhenming

    2010-12-01

    The marine yeast strain W6b isolated from sediment of the South China Sea was found to produce a cell-bound acid protease. The crude acid protease produced by this marine yeast showed the highest activity at pH 3.5 and 40 °C. The optimal pH and temperature for the crude acid protease were in agreement with those for acid protease produced by the terrestrial yeasts. The optimal medium of the acid protease production was seawater containing 1.0% glucose, 1.5% casein, and 0.5% yeast extract, and the optimal cultivation conditions of the acid protease production were pH 4.0, a temperature of 25 °C and a shaking speed of 140 rmin-1. Under the optimal conditions, 72.5 UmL-1 of acid protease activity could be obtained in cell suspension within 48 h of fermentation at shake flask level. The acid protease production was induced by high-molecular-weight nitrogen sources and repressed by low-molecular-weight nitrogen sources. Skimmed-milk-clotting test showed that the crude acid protease from the cell suspension of the yeast W6b had high skimmed milk coagulability. The acid protease produced by M. reukaufii W6b may have highly potential applications in cheese, food and fermentation industries.

  16. Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

    PubMed Central

    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

    2013-01-01

    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

  17. A Culture-Based Method for Determining the Production of Secreted Protease Inhibitors

    PubMed Central

    Quintero, David; Bermudes, David

    2014-01-01

    We have developed a culture-based method for determining the production of secreted protease inhibitors. The assay utilizes standard proteolysis detection plates to support microbial growth followed by infiltrating the plate with a protease and subsequently detecting the remaining protein by trichloroacetic acid (TCA) precipitation, or by bromocreosol green (BCG) or Ponseau S (PS) staining. The presence of a protease inhibitor can be observed in the form of a protected zone of protein around the protease inhibitor-producing strain. Using the protease inhibitors α-2-macroglobulin, aprotinin, leupeptin, and bestatin and the primary and secondary forms of Photorhabdus luminescens in combination with the protease trypsin, we were able to demonstrate that the assay is specific for the cognate inhibitor of the protease and for bacteria secreting protease inhibitors. In addition, when casein-containing plates were used, the size of the diffusion zone was inversely correlated with the molecular weight of the inhibitor allowing a relative estimation of the protease inhibitor molecular weight. This assay is useful for detecting the presence of microbial secreted protease inhibitors and may reveal their production by microorganisms that were not previously recognized to produce them. PMID:24632514

  18. Enteric bacterial proteases in inflammatory bowel disease- pathophysiology and clinical implications.

    PubMed

    Carroll, Ian M; Maharshak, Nitsan

    2013-01-01

    Numerous reports have identified a dysbiosis in the intestinal microbiota in patients suffering from inflammatory bowel diseases (IBD), yet the mechanism(s) in which this complex microbial community initiates or perpetuates inflammation remains unclear. The purpose of this review is to present evidence for one such mechanism that implicates enteric microbial derived proteases in the pathogenesis of IBD. We highlight and discuss studies demonstrating that proteases and protease receptors are abundant in the digestive system. Additionally, we investigate studies demonstrating an association between increased luminal protease activity and activation of protease receptors, ultimately resulting in increased intestinal permeability and exacerbation of colitis in animal models as well as in human IBD. Proteases are essential for the normal functioning of bacteria and in some cases can serve as virulence factors for pathogenic bacteria. Although not classified as traditional virulence factors, proteases originating from commensal enteric bacteria also have a potential association with intestinal inflammation via increased enteric permeability. Reports of increased protease activity in stools from IBD patients support a possible mechanism for a dysbiotic enteric microbiota in IBD. A better understanding of these pathways and characterization of the enteric bacteria involved, their proteases, and protease receptors may pave the way for new therapeutic approaches for these diseases.

  19. Detergent-compatible proteases: microbial production, properties, and stain removal analysis.

    PubMed

    Niyonzima, Francois Niyongabo; More, Sunil

    2015-01-01

    Proteases are one of the most important commercial enzymes used in various industrial domains such as detergent and leather industries. The alkaline proteases as well as other detergent-compatible enzymes such as lipases and amylases serve now as the key components in detergent formulations. They break down various stains during fabric washing. The search for detergent-compatible proteases with better properties is a continuous exercise. The current trend is to use detergent-compatible proteases that are stable over a wide temperature range. Although the proteases showing stability at elevated pH have the capacity to be used in detergent formulations, their usage can be significant if they are also stable and compatible with detergent and detergent ingredients, and also able to remove protein stains. Despite the existence of some reviews on alkaline proteases, there is no specification for the use of alkaline proteases as detergent additives. The present review describes the detergent-compatible proteases tested as detergent additives. An overview was provided for screening, optimization, purification, and properties of detergent compatible proteases, with an emphasis on the stability and compatibility of the alkaline proteases with the detergent and detergent compounds, as well as stain removal examination methods.

  20. In vivo sequence diversity of the protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant variants in untreated subjects.

    PubMed Central

    Lech, W J; Wang, G; Yang, Y L; Chee, Y; Dorman, K; McCrae, D; Lazzeroni, L C; Erickson, J W; Sinsheimer, J S; Kaplan, A H

    1996-01-01

    We have evaluated the sequence diversity of the protease human immunodeficiency virus type 1 in vivo. Our analysis of 246 protease coding domain sequences obtained from 12 subjects indicates that amino acid substitutions predicted to give rise to protease inhibitor resistance may be present in patients who have not received protease inhibitors. In addition, we demonstrated that amino acid residues directly involved in enzyme-substrate interactions may be varied in infected individuals. Several of these substitutions occurred in combination either more or less frequently than would be expected if their appearance was independent, suggesting that one substitution may compensate for the effects of another. Taken together, our analysis indicates that the human immunodeficiency virus type 1 protease has flexibility sufficient to vary critical subsites in vivo, thereby retaining enzyme function and viral pathogenicity. PMID:8627733

  1. Contribution of Gag and protease to variation in susceptibility to protease inhibitors between different strains of subtype B human immunodeficiency virus type 1.

    PubMed

    Sutherland, Katherine A; Mbisa, Jean L; Cane, Patricia A; Pillay, Deenan; Parry, Chris M

    2014-01-01

    Recent reports have shown that human immunodeficiency virus type 1 (HIV-1) Gag can directly affect susceptibility to protease inhibitors (PIs) in the absence of known resistance mutations in protease. Inclusion of co-evolved Gag alongside protease in phenotypic drug susceptibility assays can alter PI susceptibility in comparison with protease with a WT Gag. Using a single-replication-cycle assay encompassing full-length Gag together with protease we demonstrated significant variation in PI susceptibility between a number of PI-naïve subtype B viruses. Six publicly available subtype B molecular clones, namely HXB2, NL4-3, SF2, YU2, JRFL and 89.6, displayed up to nine-fold reduced PI susceptibility in comparison with the assay reference strain. For two molecular clones, YU2 and JRFL, Gag contributed solely to the observed reduction in susceptibility, with the N-terminal region of Gag contributing significantly. Gag and protease from treatment-naïve, patient-derived viruses also demonstrated significant variation in susceptibility, with up to a 17-fold reduction to atazanavir in comparison with the assay reference strain. In contrast to the molecular clones, protease was the main determinant of the reduced susceptibility. Common polymorphisms in protease, including I13V, L63P and A71T, were shown to contribute to this reduction in PI susceptibility, in the absence of major resistance mutations. This study demonstrated significant variation in PI susceptibility of treatment-naïve patient viruses, and provided further evidence of the independent role of Gag, the protease substrate and in particular the N-terminus of Gag in PI susceptibility. It also highlighted the importance of considering co-evolved Gag and protease when assessing PI susceptibility.

  2. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-01-31

    CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT...could be fully inhibited at a 1:1 molar ratio by the naturally-occuring proteinaceous trypsin inhibitors BBI from soybeans and CI from chickpeas ...substrates. These activities were fully inhibited by the proteinaceous trypsin-chymotrypsin inhibitors BBI from soybeans and CI from chickpeas when assayed

  3. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain.

    DTIC Science & Technology

    1987-06-30

    CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT (Coninue, on reverse aide It necessary...CI from chickpeas . Attempts are now in progress to separate and isolate these trypsin-and chymotrypsin-like enzymes. (3) Locust proteinases...and from chickpeas (CI). In addition, a specific Tribolium proteinase inhibitor from soybeans was separated. SIGNIFICANT FINDINGS A. The detection of

  4. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain.

    DTIC Science & Technology

    1988-01-31

    PROTEASES; INSECT TRYPSINS and CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBLTOR; SOYBEAN...inhibitors from legume .seeds, such as the Bowman-Birk inhibitor (BBI) from soybeans and CI from chickpeas . The purified and partially-characterized insect DD...inhibited by the trypsin - chymotrypsin inhibitors BBI from soybeans and CI from chickpeas . Separation and purification of these enzymes by gel

  5. Identification of novel malarial cysteine protease inhibitors using structure-based virtual screening of a focused cysteine protease inhibitor library.

    PubMed

    Shah, Falgun; Mukherjee, Prasenjit; Gut, Jiri; Legac, Jennifer; Rosenthal, Philip J; Tekwani, Babu L; Avery, Mitchell A

    2011-04-25

    Malaria, in particular that caused by Plasmodium falciparum , is prevalent across the tropics, and its medicinal control is limited by widespread drug resistance. Cysteine proteases of P. falciparum , falcipain-2 (FP-2) and falcipain-3 (FP-3), are major hemoglobinases, validated as potential antimalarial drug targets. Structure-based virtual screening of a focused cysteine protease inhibitor library built with soft rather than hard electrophiles was performed against an X-ray crystal structure of FP-2 using the Glide docking program. An enrichment study was performed to select a suitable scoring function and to retrieve potential candidates against FP-2 from a large chemical database. Biological evaluation of 50 selected compounds identified 21 diverse nonpeptidic inhibitors of FP-2 with a hit rate of 42%. Atomic Fukui indices were used to predict the most electrophilic center and its electrophilicity in the identified hits. Comparison of predicted electrophilicity of electrophiles in identified hits with those in known irreversible inhibitors suggested the soft-nature of electrophiles in the selected target compounds. The present study highlights the importance of focused libraries and enrichment studies in structure-based virtual screening. In addition, few compounds were screened against homologous human cysteine proteases for selectivity analysis. Further evaluation of structure-activity relationships around these nonpeptidic scaffolds could help in the development of selective leads for antimalarial chemotherapy.

  6. Using C. elegans to Identify the Protease Targets of Serpins In Vivo

    PubMed Central

    Bhatia, Sangeeta R.; Miedel, Mark T.; Chotoo, Cavita K.; Graf, Nathan J.; Hood, Brian L.; Conrads, Thomas P.; Silverman, Gary A.; Luke, Cliff J.

    2015-01-01

    Most serpins inhibit serine and/or cysteine proteases, and their inhibitory activities are usually defined in vitro. However, the physiological protease targets of most serpins are unknown despite many years of research. This may be due to the rapid degradation of the inactive serpin:protease complexes and/or the conditions under which the serpin inhibits the protease. The model organism Caenorhabditis elegans is an ideal system for identifying protease targets due to powerful forward and reverse genetics, as well as the ease of creating transgenic animals. Using combinatorial approaches of genetics and biochemistry in C. elegans, the true in vivo protease targets of the endogenous serpins can be elucidated. PMID:21683259

  7. Recent developments in production and biotechnological applications of cold-active microbial proteases.

    PubMed

    Kuddus, Mohammed; Ramteke, Pramod W

    2012-11-01

    Microbial proteases that occupy a pivotal position with respect to their commercial applications are most important hydrolytic enzymes and have been studied extensively since the advent of enzymology. Cold-adapted microorganisms are potential source of cold-active proteases and they have been isolated from the cold regions. Although there are many microbial sources available for producing proteases, only few are recognized as commercial producer. Cold-active proteases along with their producing microbes are of commercial value and find multiple applications in various industrial and biotechnological sectors such as additives in detergents, additives in food industries, environmental bioremediations, biotransformation and molecular biology applications. Therefore, cold-active proteases are the enzymes of choice for many biotechnologists, microbiologists, biochemists, environmentalists and biochemical engineers. In the present review, we discuss some novel sources along with recent developments in production and biotechnological applications of cold-active microbial proteases.

  8. A tobacco etch virus protease with increased substrate tolerance at the P1' position.

    PubMed

    Renicke, Christian; Spadaccini, Roberta; Taxis, Christof

    2013-01-01

    Site-specific proteases are important tools for in vitro and in vivo cleavage of proteins. They are widely used for diverse applications, like protein purification, assessment of protein-protein interactions or regulation of protein localization, abundance or activity. Here, we report the development of a procedure to select protease variants with altered specificity based on the well-established Saccharomyces cerevisiae adenine auxotrophy-dependent red/white colony assay. We applied this method on the tobacco etch virus (TEV) protease to obtain a protease variant with altered substrate specificity at the P1' Position. In vivo experiments with tester substrates showed that the mutated TEV protease still efficiently recognizes the sequence ENLYFQ, but has almost lost all bias for the amino acid at the P1' Position. Thus, we generated a site-specific protease for synthetic approaches requiring in vivo generation of proteins or peptides with a specific N-terminal amino acid.

  9. A survey of IgA protease production among clinical isolates of Proteeae.

    PubMed

    Senior, B W; Albrechtsen, M; Kerr, M A

    1988-01-01

    A collection of 100 strains of Proteeae, in which all species within the tribe were represented, was examined for IgA protease production. The strains were isolated from various clinical specimens from sick and healthy persons in several countries. IgA protease-producing strains were not found amongst species of Providencia and Morganella but were common in Proteus spp. All the strains of P. mirabilis and P. penneri and many of the strains of P. vulgaris examined produced an EDTA-sensitive protease that cleaved the IgA heavy chain outside the hinge region. The proteus enzyme was different in this respect from the EDTA-sensitive, hinge-cutting proteases of other bacteria. The ability to produce IgA protease was unrelated to the O antigenicity, biotype or bacteriocin type of the strain. IgA protease production may be an important virulence mechanism for Proteus strains.

  10. Targeting Proteases in Cardiovascular Diseases by Mass Spectrometry-Based Proteomics

    PubMed Central

    Klingler, Diana; Hardt, Markus

    2012-01-01

    Proteases hydrolyze peptide bonds, thereby controlling the function of proteins and peptides on the posttranslational level. In the cardiovascular system, proteases play pivotal roles in the regulation of blood pressure, coagulation and other essential physiological processes. Accordingly, proteases are prime targets for therapeutic interventions and diagnostics. Proteases are part of complex proteolytic networks comprised of enzymes, inhibitors, activators, substrates and cleavage products. Analyzing these networks on a system-wide level is essential to understanding cardiovascular function and how dysregulation can lead to pathological conditions. Mass spectrometry-based quantitative and dynamic proteomics approaches are leading the way to enhance our knowledge of proteolytic networks such as the renin-angiotensin-system. Here, we critically review proteomics tools utilized in protease biology and provide an overview on how these methods can be used to characterize and validate protease function. PMID:22511707

  11. Purification, characterization and identification of a senescence related serine protease in dark-induced senescent wheat leaves.

    PubMed

    Wang, Renxian; Liu, Shaowei; Wang, Jin; Dong, Qiang; Xu, Langlai; Rui, Qi

    2013-11-01

    Senescence-related proteases play important roles in leaf senescence by regulating protein degradation and nutrient recycling. A 98.9kDa senescence-related protease EP3 in wheat leaves was purified by ammonium sulfate precipitation, Q-Sepharose fast flow anion exchange chromatography and gel slicing after gel electrophoresis. Due to its relatively high thermal stability, its protease activity did not decrease after incubation at 40°C for 1-h. EP3 protease was suggested to be a metal-dependent serine protease, because its activity was inhibited by serine protease inhibitors PMSF and AEBSF and metal related protease inhibitor EGTA. It was identified as a subtilisin-like serine protease of the S8A family based on data from both mass spectrometry and the cloned cDNA sequence. Therefore, these data suggest that a serine protease of the S8A subfamily with specific biochemical properties is involved in senescence-associated protein degradation.

  12. Purification and characterization of organic solvent stable serine alkaline protease from newly isolated Bacillus circulans M34.

    PubMed

    Sari, Esma; Loğoğlu, Elif; Öktemer, Atilla

    2015-09-01

    A protease from newly isolated Bacillus circulans M34 was purified by Q-Sepharose anion exchange chromatography and Sepharose-bacitracin affinity chromatography followed by (NH4)2SO4 precipitation. The molecular mass of the purified enzyme was determined using SDS-PAGE. The optimum pH and temperature for protease activity were 11 and 50°C, respectively. The effect of various metal ions on protease activity was investigated. Alkaline protease from Bacillus circulans M34 wase activated by Zn(2+), Cu(2+) and Co(2+) up to 31%. The purified protease was found to be stable in the organic solvents, surfactants and oxidizing agent. The substrate specificity of purified protease was investigated towards different substrates. The protease was almost completely inhibited by the serine protease inhibitor phenylmethanesulfonyl fluoride. The kinetic parameters of the purified protease, maximum rate (Vmax) and Michaelis constant (Km), were determined using a Lineweaver-Burk plot.

  13. A New Class of Serine and Cysteine Protease Inhibitor with Chemotherapeutic Potential

    DTIC Science & Technology

    1999-06-01

    also be used to produce a serine protease inhibitor. Similar to the cysteine inhibitors, a dipeptide side chain is attached to the ring which is...which relieves the 7 strain (Figure 3). Serine and cysteine proteases use a mechanism to cleave peptide bonds which involves addition of a catalytic...serine and cysteine proteases share a similar mechanism for hydrolyzing amide bonds , we expect that 4-heterocyclohexanones should be good inhibitors

  14. Development of activity-based probes for trypsin-family serine proteases.

    PubMed

    Pan, Zhengying; Jeffery, Douglas A; Chehade, Kareem; Beltman, Jerlyn; Clark, James M; Grothaus, Paul; Bogyo, Matthew; Baruch, Amos

    2006-06-01

    A series of diphenylphosphonate-based probes were developed for the trypsin-like serine proteases. These probes selectively target serine proteases rather than general serine hydrolases that are targets for fluorophosphonate-based probes. This increased selectivity allows detection of low abundance serine proteases in complex proteomes using simple SDS-PAGE methods. We present here the application of multiple probes in enzyme activity profiling of intact mast cells, a type of inflammatory cell implicated in allergy and autoimmune diseases.

  15. MALT1 Protease Activity Is Required for Innate and Adaptive Immune Responses.

    PubMed

    Yu, Jong W; Hoffman, Sandy; Beal, Allison M; Dykon, Angela; Ringenberg, Michael A; Hughes, Anna C; Dare, Lauren; Anderson, Amber D; Finger, Joshua; Kasparcova, Viera; Rickard, David; Berger, Scott B; Ramanjulu, Joshi; Emery, John G; Gough, Peter J; Bertin, John; Foley, Kevin P

    2015-01-01

    CARMA-BCL10-MALT1 signalosomes play important roles in antigen receptor signaling and other pathways. Previous studies have suggested that as part of this complex, MALT1 functions as both a scaffolding protein to activate NF-κB through recruitment of ubiquitin ligases, and as a protease to cleave and inactivate downstream inhibitory signaling proteins. However, our understanding of the relative importance of these two distinct MALT1 activities has been hampered by a lack of selective MALT1 protease inhibitors with suitable pharmacologic properties. To fully investigate the role of MALT1 protease activity, we generated mice homozygous for a protease-dead mutation in MALT1. We found that some, but not all, MALT1 functions in immune cells were dependent upon its protease activity. Protease-dead mice had defects in the generation of splenic marginal zone and peritoneal B1 B cells. CD4+ and CD8+ T cells displayed decreased T cell receptor-stimulated proliferation and IL-2 production while B cell receptor-stimulated proliferation was partially dependent on protease activity. In dendritic cells, stimulation of cytokine production through the Dectin-1, Dectin-2, and Mincle C-type lectin receptors was also found to be partially dependent upon protease activity. In vivo, protease-dead mice had reduced basal immunoglobulin levels, and showed defective responses to immunization with T-dependent and T-independent antigens. Surprisingly, despite these decreased responses, MALT1 protease-dead mice, but not MALT1 null mice, developed mixed inflammatory cell infiltrates in multiple organs, suggesting MALT1 protease activity plays a role in immune homeostasis. These findings highlight the importance of MALT1 protease activity in multiple immune cell types, and in integrating immune responses in vivo.

  16. A Novel Apoptotic Protease Activated in Human Breast Cancer Cells After Poisoning Topoisomerase I

    DTIC Science & Technology

    1999-10-01

    tocopherol, N- acetyl -L- cysteine ( NAC ) or pyrrolidinedithiocarbamate (PDTC)) did not significantly affect lethality caused by B-lap exposure (data not...will be required for the cloning of this novel noncaspase cysteine protease. The new hypothesis being tested is that B- lap activates calpain, which...caspase cysteine protease was activated within 4-8 hours, concomitant with the appearance of DNA fragmentation, measured by TUNEL assays; (e) protease

  17. Cysteine Proteases: Modes of Activation and Future Prospects as Pharmacological Targets

    PubMed Central

    Verma, Sonia; Dixit, Rajnikant; Pandey, Kailash C.

    2016-01-01

    Proteolytic enzymes are crucial for a variety of biological processes in organisms ranging from lower (virus, bacteria, and parasite) to the higher organisms (mammals). Proteases cleave proteins into smaller fragments by catalyzing peptide bonds hydrolysis. Proteases are classified according to their catalytic site, and distributed into four major classes: cysteine proteases, serine proteases, aspartic proteases, and metalloproteases. This review will cover only cysteine proteases, papain family enzymes which are involved in multiple functions such as extracellular matrix turnover, antigen presentation, processing events, digestion, immune invasion, hemoglobin hydrolysis, parasite invasion, parasite egress, and processing surface proteins. Therefore, they are promising drug targets for various diseases. For preventing unwanted digestion, cysteine proteases are synthesized as zymogens, and contain a prodomain (regulatory) and a mature domain (catalytic). The prodomain acts as an endogenous inhibitor of the mature enzyme. For activation of the mature enzyme, removal of the prodomain is necessary and achieved by different modes. The pro-mature domain interaction can be categorized as protein–protein interactions (PPIs) and may be targeted in a range of diseases. Cysteine protease inhibitors are available that can block the active site but no such inhibitor available yet that can be targeted to block the pro-mature domain interactions and prevent it activation. This review specifically highlights the modes of activation (processing) of papain family enzymes, which involve auto-activation, trans-activation and also clarifies the future aspects of targeting PPIs to prevent the activation of cysteine proteases. PMID:27199750

  18. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  19. A primitive enzyme for a primitive cell: the protease required for excystation of Giardia.

    PubMed

    Ward, W; Alvarado, L; Rawlings, N D; Engel, J C; Franklin, C; McKerrow, J H

    1997-05-02

    Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells. To initiate infection, trophozoites emerge from a cyst in the host. Excystation is blocked by specific cysteine protease inhibitors. Using a biotinylated inhibitor, the target protease was identified and its corresponding gene cloned. The protease was localized to vesicles that release their contents just prior to excystation. The Giardia protease is the earliest known branch of the cathepsin B family. Its phylogeny confirms that the cathepsin B lineage evolved in primitive eukaryotic cells, prior to the divergence of plant and animal kingdoms, and underscores the diversity of cellular functions that this enzyme family facilitates.

  20. Characterization of bacterial proteases with a panel of fluorescent peptide substrates.

    PubMed

    Wildeboer, Dirk; Jeganathan, Fiona; Price, Robert G; Abuknesha, Ramadan A

    2009-01-15

    Bacteria produce a range of proteolytic enzymes. In an attempt to detect and identify bacteria on the basis of their protease activity, a panel of protease substrates was investigated. Peptides conjugated to the fluorophore 7-amino-4-methylcoumarin (AMC) are well-established substrates for measuring protease activity. Although peptide-AMC substrates are generally not specific for a single protease, a unique pattern can be achieved for both highly specific enzymes and those with a broader substrate range by comparing different peptide substrates. The panel of 7 peptide-AMC substrates chosen exhibited a unique pattern for nine microbial proteases. The selected peptides were used to determine protease activity in cultured strains of Pseudomonas aeruginosa and Staphylococcus aureus. A signal pattern obtained with peptides with arginine, lysine, and tyrosine in the P1 position characterized the bacterial protease activities in these samples. The kinetic parameters for the three best substrates for the P. aeruginosa sample were calculated. Further information about substrate specificity was gained by the selective use of protease inhibitors. The results presented show that peptide-AMC substrates provide a simple and sensitive tool to characterize protease activity in microbiological samples and that they have the potential to identify and distinguish different bacterial species.

  1. Proteochemometrics mapping of the interaction space for retroviral proteases and their substrates.

    PubMed

    Kontijevskis, Aleksejs; Petrovska, Ramona; Yahorava, Sviatlana; Komorowski, Jan; Wikberg, Jarl E S

    2009-07-15

    Understanding the complex interactions of retroviral proteases with their ligands is an important scientific challenge in efforts to achieve control of retroviral infections. Development of drug resistance because of high mutation rates and extensive polymorphisms causes major problems in treating the deadly diseases these viruses cause, and prompts efforts to identify new strategies. Here we report a comprehensive analysis of the interaction of 63 retroviral proteases from nine different viral species with their substrates and inhibitors based on publicly available data from the past 17years of retroviral research. By correlating physico-chemical descriptions of retroviral proteases and substrates to their biological activities we constructed a highly statistically valid 'proteochemometric' model for the interactome of retroviral proteases. Analysis of the model indicated amino acid positions in retroviral proteases with the highest influence on ligand activity and revealed general physicochemical properties essential for tight binding of substrates across multiple retroviral proteases. Hexapeptide inhibitors developed based on the discovered general properties effectively inhibited HIV-1 proteases in vitro, and some exhibited uniformly high inhibitory activity against all HIV-1 proteases mutants evaluated. A generalized proteochemometric model for retroviral proteases interactome has been created and analysed in this study. Our results demonstrate the feasibility of using the developed general strategy in the design of inhibitory peptides that can potentially serve as templates for drug resistance-improved HIV retardants.

  2. Immobilized protease on the magnetic nanoparticles used for the hydrolysis of rapeseed meals

    NASA Astrophysics Data System (ADS)

    Jin, Xin; Li, Ju-Fang; Huang, Ping-Ying; Dong, Xu-Yan; Guo, Lu-Lu; Yang, Liang; Cao, Yuan-Cheng; Wei, Fang; Zhao, Yuan-Di; Chen, Hong

    2010-07-01

    (3-aminopropl) triethoxysilaneand modified magnetic nanoparticles with the average diameter of 25.4 nm were synthesized in water-phase co-precipitation method. And then these nanoparticles were covalently coupled with alkaline protease as enzyme carrier by using 1,4-phenylene diisothlocyanate as coupling agent. Experiments showed that the immobilized protease can keep the catalytic bioactivity, which can reach to 47.8% when casein was served as substrate. Results showed that the catalytic activity of immobilized protease on these magnetic nanoparticles could retain 98.63±2.37% after 60 days. And it is more stable than the free protease during the shelf-life test. The enzyme reaction conditions such as optimum reaction temperature and pH are the same as free protease. Furthermore, mix-and-separate experiments showed that the immobilized protease could be recycled through the magnetic nanoparticles after the biocatalysis process. When the rapeseed meals were used as substrate, the degree of hydrolysis of immobilized alkaline protease achieved 9.86%, while it was 10.41% for the free protease. The macromolecular proteins of rapeseed meals were hydrolyzed by immobilized protease into small molecules such as polypeptides or amino acids. Thus, a novel efficient and economic way for the recycling of enzymes in the application of continuous production of active peptides was provided based on these magnetic nanoparticles.

  3. Scouring Potential of Mesophile Acidic Proteases of Pseudomonas aeruginosa for Grey Cotton Fabrics

    NASA Astrophysics Data System (ADS)

    Saravanan, D.

    2013-04-01

    Mesophile, acidic proteases were produced using the microbial source, Pseudomonas aeruginosa, with wider thermal tolerances. Process conditions of scouring treatment were optimized using Taguchi method for optimum temperature, time, pH and concentration of protease. Treatment with the protease lower weight loss values compared to the alkali scouring, however, significant improvement in the absorbency compared to the grey samples was observed. Large amounts of pectin left out in the samples resulted in higher extractable impurities, substantiated by the FTIR results. Relatively, lower reduction in the tear strengths was observed in both warp and weft directions after protease treatment of the cotton fabrics.

  4. A metagenomic alkaline protease from saline habitat: cloning, over-expression and functional attributes.

    PubMed

    Purohit, Megha K; Singh, Satya P

    2013-02-01

    Metagenomics has opened new horizon to unlock the biotechnological potential for novel enzymes. An alkaline protease gene was obtained from the total environmental DNA extracted from a saline habitat. After cloning and sequencing, it was identified that the protease gene related to uncultivable bacteria (HM219181). The protease was over expressed at 6h of induction with optimum induction at 1mM IPTG and 27°C. The purified enzyme was characterized with respect to various factors; temperature, pH, NaCl and chemical denaturant. The sequence analysis indicated a hydrophobic tendency of the protein, while the predicted 3D structure indicated the enzyme as a serine protease.

  5. Synthesis and herbicidal evaluation of novel benzothiazole derivatives as potential inhibitors of D1 protease.

    PubMed

    Huang, Tonghui; Sun, Jie; An, Lin; Zhang, Lixian; Han, Cuiping

    2016-04-01

    D1 protease is a C-terminal processing protease that has been predicted to be an ideal herbicidal target. Three novel series of benzothiazole derivatives were synthesized and evaluated for their herbicidal activities against Brassica napus (rape) and Echinochloa crusgalli (barnyard grass). The preliminary bioassay indicated that most of the synthesized compounds possess promising D1 protease inhibitory activities and considerable herbicidal activities. Molecular docking was performed to position representative compounds into the active site of D1 protease to determine a probable binding model.

  6. Purification and characterization of an alkaline protease from Micrococcus sp. isolated from the South China Sea

    NASA Astrophysics Data System (ADS)

    Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao

    2017-04-01

    Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.

  7. Nine Crystal Structures Determine the Substrate Envelope of the MDR HIV-1 Protease

    SciTech Connect

    Liu, Zhigang; Wang, Yong; Brunzelle, Joseph; Kovari, Iulia A.; Kovari, Ladislau C.

    2012-03-27

    Under drug selection pressure, emerging mutations render HIV-1 protease drug resistant, leading to the therapy failure in anti-HIV treatment. It is known that nine substrate cleavage site peptides bind to wild type (WT) HIV-1 protease in a conserved pattern. However, how the multidrug-resistant (MDR) HIV-1 protease binds to the substrate cleavage site peptides is yet to be determined. MDR769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, and 90) was selected for present study to understand the binding to its natural substrates. MDR769 HIV-1 protease was co-crystallized with nine substrate cleavage site hepta-peptides. Crystallographic studies show that MDR769 HIV-1 protease has an expanded substrate envelope with wide open flaps. Furthermore, ligand binding energy calculations indicate weaker binding in MDR769 HIV-1 protease-substrate complexes. These results help in designing the next generation of HIV-1 protease inhibitors by targeting the MDR HIV-1 protease.

  8. The encephalomyocarditis virus 3C protease is a substrate for the ubiquitin-mediated proteolytic system.

    PubMed

    Lawson, T G; Gronros, D L; Werner, J A; Wey, A C; DiGeorge, A M; Lockhart, J L; Wilson, J W; Wintrode, P L

    1994-11-11

    The encephalomyocarditis virus 3C protease has been shown to be rapidly degraded in infected cells and in vitro in rabbit reticulocyte lysate. The in vitro degradation, at least, is accomplished by a virus-independent, ATP-dependent proteolytic system. Here we identify this proteolytic system as the ubiquitin-mediated system. Incubation of the 3C protease in rabbit reticulocyte or cultured mouse cell lysate preparations, alone or in the presence of added ubiquitin or methylated ubiquitin, resulted in the generation of new higher molecular weight species. These new products were shown to be 3C protease-ubiquitin conjugates by their ability to bind antibodies against both the 3C protease and ubiquitin. Supplemental ubiquitin also stimulated the degradation of the 3C protease in these preparations. Large 3C protease-polyubiquitin conjugates were observed to accumulate in reticulocyte lysate in the presence of adenosine 5'-O-(3-thiotriphosphate), an inhibitor of the 26 S multicatalytic protease. This, combined with the fact that the proteolytic activity could be removed from the lysate by sedimentation, implicates the multicatalytic protease in the degradation of the 3C protease-ubiquitin conjugates. It was also found that the slow rate of degradation of a model polyprotein, which resembles the stable viral 3CD diprotein produced in vivo, is likely due to the fact that the polyprotein is a poor substrate for the ubiquitin-conjugating system.

  9. A biochemical comparison of proteases from pathogenic naegleria fowleri and non-pathogenic Naegleria gruberi.

    PubMed

    Serrano-Luna, Jesús; Cervantes-Sandoval, Isaac; Tsutsumi, Victor; Shibayama, Mineko

    2007-01-01

    Naegleria fowleri is the etiologic agent of primary amoebic meningoencephalitis (PAM). Proteases have been suggested to be involved in tissue invasion and destruction during infection. We analyzed and compared the complete protease profiles of total crude extract and conditioned medium of both pathogenic N. fowleri and non-pathogenic Naegleria gruberi trophozoites. Using SDS-PAGE, we found differences in the number and molecular weight of proteolytic bands between the two strains. The proteases showed optimal activity at pH 7.0 and 35 degrees C for both strains. Inhibition assays showed that the main proteolytic activity in both strains is due to cysteine proteases although serine proteases were also detected. Both N. fowleri and N. gruberi have a variety of different protease activities at different pH levels and temperatures. These proteases may allow the amoebae to acquire nutrients from different sources, including those from the host. Although, the role of the amoebic proteases in the pathogenesis of PAM is not clearly defined, it seems that proteases and other molecules of the parasite as well as those from the host, could be participating in the damage to the human central nervous system.

  10. Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein

    PubMed Central

    Azarnezhad, Asaad; Sharifi, Zohreh; Seyedabadi, Rahmatollah; Hosseini, Arshad; Johari, Behrooz; Sobhani Fard, Mahsa

    2016-01-01

    Background: As a drug target and an antigenic agent, HIV-1 protease (HIV-1 PR) is at the center of attention for designing anti-AIDS inhibitors and diagnostic tests. In previous studies, the production of the recombinant protease has been faced with several difficulties; therefore, the aims of this study were the easy production, purification of the soluble form of protease in E. coli and investigation of its immunoreactivity. Methods: Protease coding region was isolated from the serum of an infected individual, amplified by RT-PCR and cloned into PTZ57R using TA-cloning. Protease coding frame was isolated by PCR and cloned in pET102/D. TOPO expression vector and cloned protease was expressed in Escherichia coli (E. coli) BL21. Produced recombinant protein was purified by affinity Ni-NTA column and protein concentration was checked by BCA protein assay kit. Subsequently, immunoreactivity of recombinant protease (rPR) was assayed by Western blotting and ELISA. Results: Cloning of the HIV protease by TOPO cloning system in pET102/D.TOPO was confirmed with PCR and sequencing. The concentration range of purified recombinant protein was 85 to 100 μg/ml. Immunogenicity of rPR was confirmed by Western blotting and ELISA. Conclusion: Soluble production of recombinant HIV-1 protease (HIV-1 rPR) was performed successfully. This recombinant protein disclosed 86% specificity and 90% sensitivity in immunoassay tests. PMID:27920885

  11. Visceral hypersensitivity in inflammatory bowel diseases and irritable bowel syndrome: The role of proteases

    PubMed Central

    Ceuleers, Hannah; Van Spaendonk, Hanne; Hanning, Nikita; Heirbaut, Jelena; Lambeir, Anne-Marie; Joossens, Jurgen; Augustyns, Koen; De Man, Joris G; De Meester, Ingrid; De Winter, Benedicte Y

    2016-01-01

    Proteases, enzymes catalyzing the hydrolysis of peptide bonds, are present at high concentrations in the gastrointestinal tract. Besides their well-known role in the digestive process, they also function as signaling molecules through the activation of protease-activated receptors (PARs). Based on their chemical mechanism for catalysis, proteases can be classified into several classes: serine, cysteine, aspartic, metallo- and threonine proteases represent the mammalian protease families. In particular, the class of serine proteases will play a significant role in this review. In the last decades, proteases have been suggested to play a key role in the pathogenesis of visceral hypersensitivity, which is a major factor contributing to abdominal pain in patients with inflammatory bowel diseases and/or irritable bowel syndrome. So far, only a few preclinical animal studies have investigated the effect of protease inhibitors specifically on visceral sensitivity while their effect on inflammation is described in more detail. In our accompanying review we describe their effect on gastrointestinal permeability. On account of their promising results in the field of visceral hypersensitivity, further research is warranted. The aim of this review is to give an overview on the concept of visceral hypersensitivity as well as on the physiological and pathophysiological functions of proteases herein. PMID:28058009

  12. Pseudomonas aeruginosa protease IV degrades surfactant proteins and inhibits surfactant host defense and biophysical functions.

    PubMed

    Malloy, Jaret L; Veldhuizen, Ruud A W; Thibodeaux, Brett A; O'Callaghan, Richard J; Wright, Jo Rae

    2005-02-01

    Pulmonary surfactant has two distinct functions within the lung: reduction of surface tension at the air-liquid interface and participation in innate host defense. Both functions are dependent on surfactant-associated proteins. Pseudomonas aeruginosa is primarily responsible for respiratory dysfunction and death in cystic fibrosis patients and is also a leading pathogen in nosocomial pneumonia. P. aeruginosa secretes a number of proteases that contribute to its virulence. We hypothesized that P. aeruginosa protease IV degrades surfactant proteins and results in a reduction in pulmonary surfactant host defense and biophysical functions. Protease IV was isolated from cultured supernatant of P. aeruginosa by gel chromatography. Incubation of cell-free bronchoalveolar lavage fluid with protease IV resulted in degradation of surfactant proteins (SP)-A, -D, and -B. SPs were degraded in a time- and dose-dependent fashion by protease IV, and degradation was inhibited by the trypsin-like serine protease inhibitor Nalpha-p-tosyl-L-lysine-chloromethyl ketone (TLCK). Degradation by protease IV inhibited SP-A- and SP-D-mediated bacterial aggregation and uptake by macrophages. Surfactant treated with protease IV was unable to reduce surface tension as effectively as untreated surfactant, and this effect was inhibited by TLCK. We speculate that protease IV may be an important contributing factor to the development and propagation of acute lung injury associated with P. aeruginosa via loss of surfactant function within the lung.

  13. Determination of the protease cleavage site repertoire—The RNase H but not the RT domain is essential for foamy viral protease activity

    SciTech Connect

    Spannaus, Ralf; Bodem, Jochen

    2014-04-15

    In contrast to orthoretroviruses, the foamy virus protease is only active as a protease-reverse transcriptase fusion protein and requires viral RNA for activation. Maturation of foamy viral proteins seems to be restricted to a single cleavage site in Gag and Pol. We provide evidence that unprocessed Gag is required for optimal infectivity, which is unique among retroviruses. Analyses of the cleavage site sequences of the Gag and Pol cleavage sites revealed a high similarity compared to those of Lentiviruses. We show that positions P2' and P2 are invariant and that Gag and Pol cleavage sites are processed with similar efficiencies. The RNase H domain is essential for protease activity, but can functionally be substituted by RNase H domains of other retroviruses. Thus, the RNase H domain might be involved in the stabilization of the protease dimer, while the RT domain is essential for RNA dependent protease activation. - Highlights: • Unprocessed Gag is required for optimal infectivity of foamy viruses. • Positions P2 and P2' are invariant in the foamy viral cleavage sites. • The RNaseH domain is essential for protease activity. • The RNaseH domains of other retroviruses support foamy viral protease activity.

  14. Membrane-protease interactions. III: A consideration of the difference in binding potential of pancreatic proteases to erythrocytes and erythrocyte ghosts.

    PubMed

    Brecher, A S; Rosen, M; Burkholder, D E

    1999-09-01

    Trypsin and chymotrypsin readily bind to human erythrocyte ghosts and to resealed right-side-out ghosts, but not to intact erythrocytes, as followed with [3H]trypsin and [3H]chymotrypsin and with cold proteases in a caseinolytic assay. The proteases freely reacted with casein in the presence of intact cells. Trypsin activated trypsinogen over an 8-hr time course at a faster rate in the presence of erythrocytes than in the absence thereof, after a slight initial delay. Trypsinogen did not bind to intact erythrocytes, thereby behaving comparably to trypsin. These results suggest that different microenvironments exist about the erythrocyte ghosts and the intact erythrocytes, thereby permitting the proteases to bind to the former but not to the latter. Hence, in the absence of considerable ghosts in circulating blood, which may mask the binding site of the proteases, the proteases may be more readily accessible for interaction with circulating serpins, leading to inactivation of the proteases and protection from their degradative potential. The presence of the serpins in circulating blood may assist in the control of the degradative power of the pancreatic proteases in pancreatitis and may negatively modulate such processes as thrombosis, activation of the complement system, and vascular remodeling.

  15. MOLECULAR IDENTIFICATION OF CYSTEINE AND TRYPSIN PROTEASE, EFFECT OF DIFFERENT HOSTS ON PROTEASE EXPRESSION, AND RNAI MEDIATED SILENCING OF CYSTEINE PROTEASE GENE IN THE SUNN PEST.

    PubMed

    Amiri, Azam; Bandani, Ali Reza; Alizadeh, Houshang

    2016-04-01

    Sunn pest, Eurygaster integriceps, is a serious pest of cereals in the wide area of the globe from Near and Middle East to East and South Europe and North Africa. This study described for the first time, identification of E. integriceps trypsin serine protease and cathepsin-L cysteine, transcripts involved in digestion, which might serve as targets for pest control management. A total of 478 and 500 base pair long putative trypsin and cysteine gene sequences were characterized and named Tryp and Cys, respectively. In addition, the tissue-specific relative gene expression levels of these genes as well as gluten hydrolase (Gl) were determined under different host kernels feeding conditions. Result showed that mRNA expression of Cys, Tryp, and Gl was significantly affected after feeding on various host plant species. Transcript levels of these genes were most abundant in the wheat-fed E. integriceps larvae compared to other hosts. The Cys transcript was detected exclusively in the gut, whereas the Gl and Tryp transcripts were detectable in both salivary glands and gut. Also possibility of Sunn pest gene silencing was studied by topical application of cysteine double-stranded RNA (dsRNA). The results indicated that topically applied dsRNA on fifth nymphal stage can penetrate the cuticle of the insect and induce RNA interference. The Cys gene mRNA transcript in the gut was reduced to 83.8% 2 days posttreatment. Also, it was found that dsRNA of Cys gene affected fifth nymphal stage development suggesting the involvement of this protease in the insect growth, development, and molting.

  16. A multifaceted analysis of HIV-1 protease multidrug resistance phenotypes

    PubMed Central

    2011-01-01

    Background Great strides have been made in the effective treatment of HIV-1 with the development of second-generation protease inhibitors (PIs) that are effective against historically multi-PI-resistant HIV-1 variants. Nevertheless, mutation patterns that confer decreasing susceptibility to available PIs continue to arise within the population. Understanding the phenotypic and genotypic patterns responsible for multi-PI resistance is necessary for developing PIs that are active against clinically-relevant PI-resistant HIV-1 variants. Results In this work, we use globally optimal integer programming-based clustering techniques to elucidate multi-PI phenotypic resistance patterns using a data set of 398 HIV-1 protease sequences that have each been phenotyped for susceptibility toward the nine clinically-approved HIV-1 PIs. We validate the information content of the clusters by evaluating their ability to predict the level of decreased susceptibility to each of the available PIs using a cross validation procedure. We demonstrate the finding that as a result of phenotypic cross resistance, the considered clinical HIV-1 protease isolates are confined to ~6% or less of the clinically-relevant phenotypic space. Clustering and feature selection methods are used to find representative sequences and mutations for major resistance phenotypes to elucidate their genotypic signatures. We show that phenotypic similarity does not imply genotypic similarity, that different PI-resistance mutation patterns can give rise to HIV-1 isolates with similar phenotypic profiles. Conclusion Rather than characterizing HIV-1 susceptibility toward each PI individually, our study offers a unique perspective on the phenomenon of PI class resistance by uncovering major multidrug-resistant phenotypic patterns and their often diverse genotypic determinants, providing a methodology that can be applied to understand clinically-relevant phenotypic patterns to aid in the design of novel inhibitors that

  17. Serine Proteases Enhance Immunogenic Antigen Presentation on Lung Cancer Cells.

    PubMed

    Peters, Haley L; Tripathi, Satyendra C; Kerros, Celine; Katayama, Hiroyuki; Garber, Haven R; St John, Lisa S; Federico, Lorenzo; Meraz, Ismail M; Roth, Jack A; Sepesi, Boris; Majidi, Mourad; Ruisaard, Kathryn; Clise-Dwyer, Karen; Roszik, Jason; Gibbons, Don L; Heymach, John V; Swisher, Stephen G; Bernatchez, Chantale; Alatrash, Gheath; Hanash, Samir; Molldrem, Jeffrey J

    2017-03-02

    Immunotherapies targeting immune checkpoints have proven efficacious in reducing the burden of lung cancer in patients; however, the antigenic targets of these reinvigorated T cells remain poorly defined. Lung cancer tumors contain tumor-associated macrophages (TAM) and neutrophils, which release the serine proteases neutrophil elastase (NE) and proteinase 3 (P3) into the tumor microenvironment. NE and P3 shape the antitumor adaptive immune response in breast cancer and melanoma. In this report, we demonstrate that lung cancer cells cross-presented the tumor-associated antigen PR1, derived from NE and P3. Additionally, NE and P3 enhanced the expression of human leukocyte antigen (HLA) class I molecules on lung cancer cells and induced unique, endogenous peptides in the immunopeptidome, as detected with mass spectrometry sequencing. Lung cancer patient tissues with high intratumoral TAMs were enriched for MHC class I genes and T-cell markers, and patients with high TAM and cytotoxic T lymphocyte (CTL) infiltration had improved overall survival. We confirmed the immunogenicity of unique, endogenous peptides with cytotoxicity assays against lung cancer cell lines, using CTLs from healthy donors that had been expanded against select peptides. Finally, CTLs specific for serine proteases-induced endogenous peptides were detected in lung cancer patients using peptide/HLA-A2 tetramers and were elevated in tumor-infiltrating lymphocytes. Thus, serine proteases in the tumor microenvironment of lung cancers promote the presentation of HLA class I immunogenic peptides that are expressed by lung cancer cells, thereby increasing the antigen repertoire that can be targeted in lung cancer. Cancer Immunol Res; 5(4); 1-11. ©2017 AACR.

  18. Biased signaling by peptide agonists of protease activated receptor 2.

    PubMed

    Jiang, Yuhong; Yau, Mei-Kwan; Kok, W Mei; Lim, Junxian; Wu, Kai-Chen; Liu, Ligong; Hill, Timothy A; Suen, Jacky Y; Fairlie, David P

    2017-02-07

    Protease activated receptor 2 (PAR2) is associated with metabolism, obesity, inflammatory, respiratory and gastrointestinal disorders, pain, cancer and other diseases. The extracellular N-terminus of PAR2 is a common target for multiple proteases, which cleave it at different sites to generate different N-termini that activate different PAR2-mediated intracellular signaling pathways. There are no synthetic PAR2 ligands that reproduce the same signaling profiles and potencies as proteases. Structure-activity relationships here for 26 compounds spanned a signaling bias over 3 log units, culminating in three small ligands as biased agonist tools for interrogating PAR2 functions. DF253 (2f-LAAAAI-NH2) triggered PAR2-mediated calcium release (EC50 2 μM) but not ERK1/2 phosphorylation (EC50 > 100 μM) in CHO cells transfected with hPAR2. AY77 (Isox-Cha-Chg-NH2) was a more potent calcium-biased agonist (EC50 40 nM, Ca2+; EC50 2 μM, ERK1/2), while its analogue AY254 (Isox-Cha-Chg-A-R-NH2) was an ERK-biased agonist (EC50 2 nM, ERK1/2; EC50 80 nM, Ca2+). Signaling bias led to different functional responses in human colorectal carcinoma cells (HT29). AY254, but not AY77 or DF253, attenuated cytokine-induced caspase 3/8 activation, promoted scratch-wound healing and induced IL-8 secretion, all via PAR2-ERK1/2 signaling. Different ligand components were responsible for different PAR2 signaling and functions, clues that can potentially lead to drugs that modulate different pathway-selective cellular and physiological responses.

  19. Functional protease profiling for laboratory based diagnosis of invasive aspergillosis.

    PubMed

    Sabbagh, Bassel; Costina, Victor; Buchheidt, Dieter; Reinwald, Mark; Neumaier, Michael; Findeisen, Peter

    2015-07-01

    Invasive aspergillosis (IA) remains difficult to diagnose in immunocompromised patients, because diagnostic criteria according to EORTC/MSG guidelines are often not met and have low sensitivity. Hence there is an urgent need to improve diagnostic procedures by developing novel approaches. In the present study, we present a proof of concept experiment for the monitoring of Aspergillus associated protease activity in serum specimens for diagnostic purpose. Synthetic peptides that are selectively cleaved by proteases secreted from Aspergillus species were selected from our own experiments and published data. These so called reporter peptides (RP, n=5) were added to serum specimens from healthy controls (HC, n=101) and patients with proven (IA, n=9) and possible (PIA, n=144) invasive aspergillosis. Spiked samples were incubated ex vivo under strictly standardized conditions. Proteolytic fragments were analyzed using MALDI-TOF mass spectrometry. Spiked specimens of IA patients had highest concentrations of RP-fragments followed by PIA and HC. The median signal intensity was 116.546 (SD, 53.063) for IA and 5.009 (SD, 8.432) for HC. A cut-off >36.910 was chosen that performed with 100% specificity and sensitivity. Patients with PIA had either values above [53% (76/144)] or below [47% (67/144)] this chosen cut-off. The detection of respective reporter peptide fragments can easily be performed by MALDI TOF mass spectrometry. In this proof of concept study we were able to demonstrate that serum specimens of patients with IA have increased proteolytic activity towards selected reporter peptides. However, the diagnostic value of functional protease profiling has to be validated in further prospective studies. It is likely that a combination of existing and new methods will be required to achieve optimal performance for diagnosis of IA in the future.

  20. Plant Protease Inhibitors in Therapeutics-Focus on Cancer Therapy

    PubMed Central

    Srikanth, Sandhya; Chen, Zhong

    2016-01-01

    Plants are known to have many secondary metabolites and phytochemical compounds which are highly explored at biochemical and molecular genetics level and exploited enormously in the human health care sector. However, there are other less explored small molecular weight proteins, which inhibit proteases/proteinases. Plants are good sources of protease inhibitors (PIs) which protect them against diseases, insects, pests, and herbivores. In the past, proteinaceous PIs were considered primarily as protein-degrading enzymes. Nevertheless, this view has significantly changed and PIs are now treated as very important signaling molecules in many biological activities such as inflammation, apoptosis, blood clotting and hormone processing. In recent years, PIs have been examined extensively as therapeutic agents, primarily to deal with various human cancers. Interestingly, many plant-based PIs are also found to be effective against cardiovascular diseases, osteoporosis, inflammatory diseases and neurological disorders. Several plant PIs are under further evaluation in in vitro clinical trials. Among all types of PIs, Bowman-Birk inhibitors (BBI) have been studied extensively in the treatment of many diseases, especially in the field of cancer prevention. So far, crops such as beans, potatoes, barley, squash, millet, wheat, buckwheat, groundnut, chickpea, pigeonpea, corn, and pineapple have been identified as good sources of PIs. The PI content of such foods has a significant influence on human health disorders, particularly in the regions where people mostly depend on these kind of foods. These natural PIs vary in concentration, protease specificity, heat stability, and sometimes several PIs may be present in the same species or tissue. However, it is important to carry out individual studies to identify the potential effects of each PI on human health. PIs in plants make them incredible sources to determine novel PIs with specific pharmacological and therapeutic effects due

  1. The protease cathepsin L regulates Th17 cell differentiation.

    PubMed

    Hou, Lifei; Cooley, Jessica; Swanson, Richard; Ong, Poh Chee; Pike, Robert N; Bogyo, Matthew; Olson, Steven T; Remold-O'Donnell, Eileen

    2015-12-01

    Previously we reported that IL-17(+) T cells, primarily IL-17(+) γδ cells, are increased in mice lacking the protease inhibitor serpinB1 (serpinb1(-/-) mice). Here we show that serpinB1-deficient CD4 cells exhibit a cell-autonomous and selective deficiency in suppressing T helper 17 (Th17) cell differentiation. This suggested an opposing role for one or more protease in promoting Th17 differentiation. We found that several SerpinB1-inhibitable cysteine cathepsins are induced in Th17 cells, most prominently cathepsin L (catL); this was verified by peptidase assays, active site labeling and Western blots. Moreover, Th17 differentiation was suppressed by both broad cathepsin inhibitors and catL selective inhibitors. CatL is present in Th17 cells as single chain (SC)- and two-chain (TC)-forms. Inhibiting asparagine endopeptidase (AEP) blocked conversion of SC-catL to TC-catL and increased generation of serpinb1(-/-) Th17 cells, but not wild-type Th17 cells. These findings suggest that SC-catL is biologically active in promoting Th17 generation and is counter-regulated by serpinB1 and secondarily by AEP. Thus, in addition to regulation by cytokines and transcription factors, differentiation of CD4 cells to Th17 cells is actively regulated by a catL-serpinB1-AEP module. Targeting this protease regulatory module could be an approach to treating Th17 cell-driven autoimmune disorders.

  2. Plant Protease Inhibitors in Therapeutics-Focus on Cancer Therapy.

    PubMed

    Srikanth, Sandhya; Chen, Zhong

    2016-01-01

    Plants are known to have many secondary metabolites and phytochemical compounds which are highly explored at biochemical and molecular genetics level and exploited enormously in the human health care sector. However, there are other less explored small molecular weight proteins, which inhibit proteases/proteinases. Plants are good sources of protease inhibitors (PIs) which protect them against diseases, insects, pests, and herbivores. In the past, proteinaceous PIs were considered primarily as protein-degrading enzymes. Nevertheless, this view has significantly changed and PIs are now treated as very important signaling molecules in many biological activities such as inflammation, apoptosis, blood clotting and hormone processing. In recent years, PIs have been examined extensively as therapeutic agents, primarily to deal with various human cancers. Interestingly, many plant-based PIs are also found to be effective against cardiovascular diseases, osteoporosis, inflammatory diseases and neurological disorders. Several plant PIs are under further evaluation in in vitro clinical trials. Among all types of PIs, Bowman-Birk inhibitors (BBI) have been studied extensively in the treatment of many diseases, especially in the field of cancer prevention. So far, crops such as beans, potatoes, barley, squash, millet, wheat, buckwheat, groundnut, chickpea, pigeonpea, corn, and pineapple have been identified as good sources of PIs. The PI content of such foods has a significant influence on human health disorders, particularly in the regions where people mostly depend on these kind of foods. These natural PIs vary in concentration, protease specificity, heat stability, and sometimes several PIs may be present in the same species or tissue. However, it is important to carry out individual studies to identify the potential effects of each PI on human health. PIs in plants make them incredible sources to determine novel PIs with specific pharmacological and therapeutic effects due

  3. Endothelial Progenitor Cells in Sprouting Angiogenesis: Proteases Pave the Way.

    PubMed

    Laurenzana, A; Fibbi, G; Margheri, F; Biagioni, A; Luciani, C; Del Rosso, M; Chillà, A

    2015-01-01

    Sprouting angiogenesis consists of the expansion and remodelling of existing vessels, where the vascular sprouts connect each other to form new vascular loops. Endothelial Progenitor Cells (EPCs) are a subtype of stem cells, with high proliferative potential, able to differentiate into mature Endothelial Cells (ECs) during the neovascularization process. In addition to this direct structural role EPCs improve neovascularization, also secreting numerous pro-angiogenic factors able to enhance the proliferation, survival and function of mature ECs, and other surrounding progenitor cells. While sprouting angiogenesis by mature ECs involves resident ECs, the vasculogenic contribution of EPCs is a high hurdle race. Bone marrowmobilized EPCs have to detach from the stem cell niche, intravasate into bone marrow vessels, reach the hypoxic area or tumour site, extravasate and incorporate into the new vessel lumen, thus complementing the resident mature ECs in sprouting angiogenesis. The goal of this review is to highlight the role of the main protease systems able to control each of these steps. The pivotal protease systems here described, involved in vascular patterning in sprouting angiogenesis, are the matrix-metalloproteinases (MMPs), the serineproteinases urokinase-type plasminogen activator (uPA) associated with its receptor (uPAR) and receptorassociated plasminogen/plasmin, the neutrophil elastase and the cathepsins. Since angiogenesis plays a critical role not only in physiological but also in pathological processes, such as in tumours, controlling the contribution of EPCs to the angiogenic process, through the regulation of the protease systems involved, could yield new opportunities for the therapeutic prospect of efficient control of pathological angiogenesis.

  4. Conformational transition of the lid helix covering the protease active site is essential for the ATP-dependent protease activity of FtsH.

    PubMed

    Suno, Ryoji; Shimoyama, Masakazu; Abe, Akiko; Shimamura, Tatsuro; Shimodate, Natsuka; Watanabe, Yo-hei; Akiyama, Yoshinori; Yoshida, Masasuke

    2012-09-21

    When bound to ADP, ATP-dependent protease FtsH subunits adopt either an "open" or "closed" conformation. In the open state, the protease catalytic site is located in a narrow space covered by a lidlike helix. This space disappears in the closed form because the lid helix bends at Gly448. Here, we replaced Gly448 with various residues that stabilize helices. Most mutants retained low ATPase activity and bound to the substrate protein, but lost protease activity. However, a mutant proline substitution lost both activities. Our study shows that the conformational transition of the lid helix is essential for the function of FtsH.

  5. Lung vascular injury with protease infusion. Relationship to plasma fibronectin.

    PubMed Central

    Cohler, L F; Saba, T M; Lewis, E P

    1985-01-01

    Fibronectin exists in a soluble form in plasma and in an insoluble form in tissues. Plasma fibronectin can modulate phagocytic function as well as incorporate into the tissue matrix where it is believed to influence microvascular integrity and tissue repair. The temporal alterations in plasma and lung lymph fibronectin were studied in relation to increased pulmonary vascular permeability induced by protease infusion. The acute sheep lung lymph fistula model was used. A 39% decrease in plasma fibronectin (control = 421 +/- 67 micrograms/ml) was observed 2.5 hours (255 +/- 43 micrograms/ml) after protease infusion. There was an elevation of lymph fibronectin early after protease infusion, followed by a progressive decline. Concomitant with the decrease in plasma fibronectin, an increase in lymph flow (QL) of greater than 200% (from a control of 6.7 +/- 1.0 ml/hr to 13.9 +/- 1.4 ml/hr) was observed within 2.5 hours. Also, there was a sustained elevation in the total protein lymph/plasma concentration (L/P) ratio, which was maximal at 2.5 hours. The transvascular protein clearance (TVPC = QL X L/P) was 4.5 +/- 0.7 ml/hr at the control period and 13.1 +/- 2.0 ml/hr by 2.5 hours. This was indicative of increased flux of protein-rich fluid across the pulmonary endothelial barrier. Lung vascular permeability stabilized after 2.5 hours as manifested by a slowly declining L/P ratio. Thus, plasma fibronectin deficiency may contribute to the etiology of increased lung vascular permeability with protease infusion. Since the progressive decline in plasma fibronectin was not reflected in a proportional increase in lymph fibronectin, plasma fibronectin may have sequestered in tissues such as the lung, or perhaps in reticuloendothelial cells during the injury phase. Whether the progressive decrease in plasma fibronectin reflects its incorporation into the endothelial barrier matrix where it may mediate stabilization of the pulmonary microvascular barrier remains to be determined

  6. Lysosomal cysteine proteases: structure, function and inhibition of cathepsins.

    PubMed

    Roberts, Rebecca

    2005-12-01

    Lysosomal cysteine proteases, a subgroup of the cathepsin family, are critical for normal cellular functions such as general protein turnover, antigen processing and bone remodeling. In the past decade, the number of identified human cathepsins has more than doubled and their known role in several pathologies has expanded rapidly. Increased understanding of the structure and mechanism of this class of enzymes has brought on a new fervor in the design of small molecule inhibitors with the hope of producing specific, therapeutic drugs for diseases such as arthritis, allergy, multiple sclerosis, atherosclerosis, Alzheimer's disease and cancer.

  7. Functional analysis of rhomboid proteases during Toxoplasma invasion.

    PubMed

    Shen, Bang; Buguliskis, Jeffrey S; Lee, Tobie D; Sibley, L David

    2014-10-21

    Host cell invasion by Toxoplasma gondii and other apicomplexan parasites requires transmembrane adhesins that mediate binding to receptors on the substrate and host cell to facilitate motility and invasion. Rhomboid proteases (ROMs) are thought to cleave adhesins within their transmembrane segments, thus allowing the parasite to disengage from receptors and completely enter the host cell. To examine the specific roles of individual ROMs during invasion, we generated single, double, and triple knockouts for the three ROMs expressed in T. gondii tachyzoites. Analysis of these mutants demonstrated that ROM4 is the primary protease involved in adhesin processing and host cell invasion, whereas ROM1 or ROM5 plays negligible roles in these processes. Deletion of ROM4 blocked the shedding of adhesins such as MIC2 (microneme protein 2), causing them to accumulate on the surface of extracellular parasites. Increased surface adhesins led to nonproductive attachment, altered gliding motility, impaired moving junction formation, and reduced invasion efficiency. Despite the importance of ROM4 for efficient invasion, mutants lacking all three ROMs were viable and MIC2 was still efficiently removed from the surface of invaded mutant parasites, implying the existence of ROM-independent mechanisms for adhesin removal during invasion. Collectively, these results suggest that although ROM processing of adhesins is not absolutely essential, it is important for efficient host cell invasion by T. gondii. Importance: Apicomplexan parasites such as Toxoplasma gondii express surface proteins that bind host cell receptors to aid invasion. Many of these adhesins are subject to cleavage by rhomboid proteases (ROMs) within their transmembrane segments during invasion. Previous studies have demonstrated the importance of adhesin cleavage for parasite invasion and proposed that the ROMs responsible for processing would be essential for parasite survival. In T. gondii, ROM5 was thought to be the

  8. Ergotism associated with HIV antiviral protease inhibitor therapy.

    PubMed

    Baldwin, Zachary K; Ceraldi, Chris C

    2003-03-01

    Ergotism is a rare condition of acute vasospasm found classically in young and middle-aged women taking ergot alkaloid agents to treat migraine headache. We report the case of a young man with human immunodeficiency virus (HIV) positivity and describe the drug interaction between protease inhibitors and ergot alkaloid agents, which most likely predisposed to development of ergot toxicity. The HIV-positive population receiving antiviral therapy may be an under-recognized group at risk for ergotism through decreased hepatic metabolism of ergot preparations.

  9. Expression and activation of proteases in co-cultures.

    PubMed

    Paduch, Roman; Kandefer-Szerszeń, Martyna

    2011-01-01

    The present study concerned the expression and activation of metalloproteinase-2 (MMP-2), metalloproteinase-9 (MMP-9) and the urokinase plasminogen activator/urokinase plasminogen activator receptor (uPA/uPAR) system in co-cultures of human colon carcinoma cell spheroids (HT29, LS180, SW948) with human normal colon epithelium (CCD 841 CoTr), myofibroblasts (CCD-18Co) and endothelial cells (HUVEC). Additionally, the influence of monensin on the production and function of the proteases was tested. Tumor cells expressed small amounts of MMP-2, MMP-9 and uPA. Normal cells generally produced proportionally higher concentrations of these proteases (especially MMP-2, compared with significantly smaller yields of MMP-9 and significantly lower amounts of uPAR than tumors. In co-cultures of tumor spheroids with normal cell monolayers, the concentration of the proteases was equal to the sum of the enzymes produced in monocultures of both types of cells. The highest activity of uPA, measured as the reduction of the chromogenic substrate (S-2444), was detected in supernatants and lysates of endothelial cells. Interestingly, in normal cells, the higher expression of proteases, mainly uPA, measured as the level of protein concentration, was closely linked with their lower activity and inversely, in tumor cells, the low level of the expression of the enzymes correlated with their high enzymatic activity. In zymography analysis, mainly pro-MMPs were detected both in culture supernatants and cell lysates. The highest amounts of active forms of the MMPs were detected in tumor spheroids co-cultured with endothelial cells. Monensin inhibited MMPs and uPA secretion but significantly increased uPAR release, mainly from normal cells. In conclusion, during direct interactions of tumor cells with normal cells, MMPs and the uPA/uPAR system play an important role in the degradation of ECM and tumor development, but as we found, there is a reverse relationship between the concentration and the

  10. Structures of a bi-functional Kunitz-type STI family inhibitor of serine and aspartic proteases: Could the aspartic protease inhibition have evolved from a canonical serine protease-binding loop?

    PubMed

    Guerra, Yasel; Valiente, Pedro A; Pons, Tirso; Berry, Colin; Rudiño-Piñera, Enrique

    2016-08-01

    Bi-functional inhibitors from the Kunitz-type soybean trypsin inhibitor (STI) family are glycosylated proteins able to inhibit serine and aspartic proteases. Here we report six crystal structures of the wild-type and a non-glycosylated mutant of the bifunctional inhibitor E3Ad obtained at different pH values and space groups. The crystal structures show that E3Ad adopts the typical β-trefoil fold of the STI family exhibiting some conformational changes due to pH variations and crystal packing. Despite the high sequence identity with a recently reported potato cathepsin D inhibitor (PDI), three-dimensional structures obtained in this work show a significant conformational change in the protease-binding loop proposed for aspartic protease inhibition. The E3Ad binding loop for serine protease inhibition is also proposed, based on structural similarity with a novel non-canonical conformation described for the double-headed inhibitor API-A from the Kunitz-type STI family. In addition, structural and sequence analyses suggest that bifunctional inhibitors of serine and aspartic proteases from the Kunitz-type STI family are more similar to double-headed inhibitor API-A than other inhibitors with a canonical protease-binding loop.

  11. Optimisation of the detection of bacterial proteases using adsorbed immunoglobulins as universal substrates.

    PubMed

    Abuknesha, Ram A; Jeganathan, Fiona; Wildeboer, Dirk; Price, Robert G

    2010-06-15

    Bacterial proteases, Type XXIV from Bacillus licheniformens and Type XIV from Streptomyces griseus, were used to investigate the utility and optimisation of a solid phase assay for proteases, using immunoglobulin proteins as substrates. Immunoglobulins IgA and IgG were adsorbed on to surfaces of ELISA plates and exposed to various levels of the bacterial proteases which led to digestion and desorption of proportional amounts of the immunoglobulins. The assay signal was developed by measuring the remaining proteins on the polystyrene surface with appropriate enzyme-labelled anti-immunoglobulin reagents. The assay was fully optimised in terms of substrate levels employing ELISA techniques to titrate levels of adsorbed substrates and protease analytes. The critical factor which influences assay sensitivity was found to be the substrate concentration, the levels of adsorbed immunoglobulins. The estimated detection limits for protease XXIV and XIV were 10micro units/test and 9micro units/test using IgA as a substrate. EC(50) values were calculated as 213 and 48micro units/test for each protease respectively. Using IgG as a substrate, the estimated detection limits were 104micro units/test for protease XXIV and 9micro units/test for protease XIV. EC(50) values were calculated at 529micro units/test and 28micro units/test for protease XXIV and XIV respectively. The solid phase protease assay required no modification of the substrates and the adsorption step is merely simple addition of immunoglobulins to ELISA plates. Adsorption of the immunoglobulins to polystyrene enabled straightforward separation of reaction mixtures prior to development of assay signal. The assay exploits the advantages of the technical facilities of ELISA technology and commercially available reagents enabling the detection and measurement of a wide range of proteases. However, the key issue was found to be that in order to achieve the potential performance of the simple assay, optimisation of the

  12. Understanding the specificity of serpin-protease complexes through interface analysis.

    PubMed

    Rashid, Qudsia; Kapil, Charu; Singh, Poonam; Kumari, Vineeta; Jairajpuri, Mohamad Aman

    2015-01-01

    Serpins such as antithrombin, heparin cofactor II, plasminogen activator inhibitor, antitrypsin, antichymotrypsin, and neuroserpin are involved in important biological processes by inhibiting specific serine proteases. Initially, the protease recognizes the mobile reactive loop of the serpin eliciting conformational changes, where the cleaved loop together with the protease inserts into β-sheet A, translocating the protease to the opposite side of inhibitor leading to its inactivation. Serpin interaction with proteases is governed mainly by the reactive center loop residues (RCL). However, in some inhibitory serpins, exosite residues apart from RCL have been shown to confer protease specificity. Further, this forms the basis of multi-specificity of some serpins, but the residues and their dimension at interface in serpin-protease complexes remain elusive. Here, we present a comprehensive structural analysis of the serpin-protease interfaces using bio COmplexes COntact MAPS (COCOMAPS), PRotein Interface Conservation and Energetics (PRICE), and ProFace programs. We have carried out interface, burial, and evolutionary analysis of different serpin-protease complexes. Among the studied complexes, non-inhibitory serpins exhibit larger interface region with greater number of residue involvement as compared to the inhibitory serpins. On comparing the multi-specific serpins (antithrombin and antitrypsin), a difference in the interface area and residue number was observed, suggestive of a differential mechanism of action of these serpins in regulating their different target proteases. Further, detailed study of these multi-specific serpins listed few essential residues (common in all the complexes) and certain specificity (unique to each complex) determining residues at their interfaces. Structural mapping of interface residues suggested that individual patches with evolutionary conserved residues in specific serpins determine their specificity towards a particular protease.

  13. Kunitz-type protease inhibitors group B from Solanum palustre.

    PubMed

    Speransky, Anna S; Cimaglia, Fabio; Krinitsina, Anastasya A; Poltronieri, Palmiro; Fasano, Pasqua; Bogacheva, Anna M; Valueva, Tatiana A; Halterman, Dennis; Shevelev, Alexei B; Santino, Angelo

    2007-11-01

    Five Kunitz protease inhibitor group B genes were isolated from the genome of the diploid non-tuber-forming potato species Solanum palustre. Three of five new genes share 99% identity to the published KPI-B genes from various cultivated potato accessions, while others exhibit 96% identity. Spls-KPI-B2 and Spls-KPI-B4 proteins contain unique substitutions of the most conserved residues usually involved to trypsin and chymotrypsin-specific binding sites of Kunitz-type protease inhibitor (KPI)-B, respectively. To test the inhibition of trypsin and chymotrypsin by Spls-KPI proteins, five of them were produced in E. coli purified using a Ni-sepharose resin and ion-exchange chromatography. All recombinant Spls-KPI-B inhibited trypsin; K(i) values ranged from 84.8 (Spls-KPI-B4), 345.5 (Spls-KPI-B1), and 1310.6 nM (Spls-KPI-B2) to 3883.5 (Spls-KPI-B5) and 8370 nM (Spls-KPI-B3). In addition, Spls-KPI-B1 and Spls-KPI-B4 inhibited chymotrypsin. These data suggest that regardless of substitutions of key active-center residues both Spls-KPI-B4 and Spls-KPI-B1 are functional trypsin-chymotrypsin inhibitors.

  14. MOFzyme: Intrinsic protease-like activity of Cu-MOF

    NASA Astrophysics Data System (ADS)

    Li, Bin; Chen, Daomei; Wang, Jiaqiang; Yan, Zhiying; Jiang, Liang; Deliang Duan; He, Jiao; Luo, Zhongrui; Zhang, Jinping; Yuan, Fagui

    2014-10-01

    The construction of efficient enzyme mimetics for the hydrolysis of peptide bonds in proteins is challenging due to the high stability of peptide bonds and the importance of proteases in biology and industry. Metal-organic frameworks (MOFs) consisting of infinite crystalline lattices with metal clusters and organic linkers may provide opportunities for protease mimic which has remained unknown. Herein, we report that Cu2(C9H3O6)4/3 MOF (which is well known as HKUST-1 and denoted as Cu-MOF here), possesses an intrinsic enzyme mimicking activity similar to that found in natural trypsin to bovine serum albumin (BSA) and casein. The Michaelis constant (Km) of Cu-MOF is about 26,000-fold smaller than that of free trypsin indicating a much higher affinity of BSA for Cu-MOF surface. Cu-MOF also exhibited significantly higher catalytic efficiency than homogeneous artificial metalloprotease Cu(II) complexes and could be reused for ten times without losing in its activity. Moreover, Cu-MOF was successfully used to simulate trypsinization in cell culture since it dissociated cells in culture even without EDTA.

  15. Preliminary crystallographic analysis of avian infectious bronchitis virus main protease

    SciTech Connect

    Li, Jun; Shen, Wei; Liao, Ming; Bartlam, Mark

    2007-01-01

    The avian infectious bronchitis virus main protease has been crystallized; crystals diffract to 2.7 Å resolution. Infectious bronchitis virus (IBV) is the prototype of the genus Coronavirus. It causes a highly contagious disease which affects the respiratory, reproductive, neurological and renal systems of chickens, resulting great economic losses in the poultry industry worldwide. The coronavirus (CoV) main protease (M{sup pro}), which plays a pivotal role in viral gene expression and replication through a highly complex cascade involving the proteolytic processing of replicase polyproteins, is an attractive target for antiviral drug design. In this study, IBV M{sup pro} was overexpressed in Escherichia coli. Crystals suitable for X-ray crystallography have been obtained using microseeding techniques and belong to space group P6{sub 1}22. X-ray diffraction data were collected in-house to 2.7 Å resolution from a single crystal. The unit-cell parameters were a = b = 119.1, c = 270.7 Å, α = β = 90, γ = 120°. Three molecules were predicted to be present in the asymmetric unit from a calculated self-rotation function.

  16. Sphingosine-induced apoptosis is dependent on lysosomal proteases.

    PubMed Central

    Kågedal, K; Zhao, M; Svensson, I; Brunk, U T

    2001-01-01

    We propose a new mechanism for sphingosine-induced apoptosis, involving relocation of lysosomal hydrolases to the cytosol. Owing to its lysosomotropic properties, sphingosine, which is also a detergent, especially when protonated, accumulates by proton trapping within the acidic vacuolar apparatus, where most of its action as a detergent would be exerted. When sphingosine was added in low-to-moderate concentrations to Jurkat and J774 cells, partial lysosomal rupture occurred dose-dependently, starting within a few minutes. This phenomenon preceded caspase activation, as well as changes of mitochondrial membrane potential. High sphingosine doses rapidly caused extensive lysosomal rupture and ensuing necrosis, without antecedent apoptosis or caspase activation. The sphingosine effect was prevented by pre-treatment with another, non-toxic, lysosomotropic base, ammonium chloride, at 10 mM. The lysosomal protease inhibitors, pepstatin A and epoxysuccinyl-L-leucylamido-3-methyl-butane ethyl ester ('E-64d'), inhibited markedly sphingosine-induced caspase activity to almost the same degree as the general caspase inhibitor benzyloxycarbonyl-Val-Ala-DL-Asp-fluoromethylketone ('Z-VAD-FMK'), although they did not by themselves inhibit caspases. We conclude that cathepsin D and one or more cysteine proteases, such as cathepsins B or L, are important mediators of sphingosine-induced apoptosis, working upstream of the caspase cascade and mitochondrial membrane-potential changes. PMID:11583579

  17. Recent patents on microbial proteases for the dairy industry.

    PubMed

    Feijoo-Siota, Lucía; Blasco, Lucía; Rodríguez-Rama, José Luis; Barros-Velázquez, Jorge; Miguel, Trinidad de; Sánchez-Pérez, Angeles; Villa, Tomás G

    2014-01-01

    This paper reviews the general characteristics of exo and endopeptidases of microbial origin currently used in the milk industry. It also includes recent patents developed either to potentiate the enzymatic activity or to improve the resulting milk derivatives. The main application of these proteases is in the cheese-making industry. Although this industry preferentially uses animal rennets, and in particular genetically engineered chymosins, it also utilizes milk coagulants of microbial origin. Enzymes derived from Rhizomucor miehei, Rhizomucor pusillus and Cryphonectria parasitica are currently used to replace the conventional milk-clotting enzymes. In addition, the dairy industry uses microbial endo and exoproteases for relatively new applications, such as debittering and flavor generation in cheese, accelerated cheese ripening, manufacture of protein hydrolysates with improved functional properties, and production of enzyme-modified cheeses. Lactic acid bacteria play an essential role in these processes, hence these bacteria and the proteases they produce are currently being investigated by the dairy industry and are the subject of many of their patent applications.

  18. The Early Years of Retroviral Protease Crystal Structures

    PubMed Central

    Miller, Maria

    2010-01-01

    Soon after its discovery, the attempts to develop anti-AIDS therapeutics focused on the retroviral protease (PR) — an enzyme used by lentiviruses to process the precursor polypeptide into mature viral proteins. An urgent need for the three-dimensional structure of PR to guide rational drug design prompted efforts to produce milligram quantities of this enzyme. However, only minute amounts of PR were present in the HIV-1 and HIV-2 viruses, and initial attempts to express this protein in bacteria were not successful. This review describes X-ray crystallographic studies of the retroviral proteases carried out at NCI-Frederick in the late 1980s and early 1990s and puts into perspective the crucial role that the total protein chemical synthesis played in unraveling the structure, mechanism of action, and inhibition of HIV-1 PR. Notably, the first fully correct structure of HIV-1 PR and the first cocrystal structure of its complex with an inhibitor (a substrate-derived, reduced isostere hexapeptide MVT-101) were determined using chemically synthesized protein. Most importantly, these sets of coordinates were made freely available to the research community and were used worldwide to solve X-ray structures of HIV-1 PR complexes with an array of inhibitors and set in motion a variety of theoretical studies. Publication of the structure of chemically synthesized HIV-1 PR complexed with MVT-101 preceded only by six years the approval of the first PR inhibitor as an anti-AIDS drug. PMID:20593466

  19. Design of HIV Protease Inhibitors Based on Inorganic Polyhedral Metallacarboranes

    SciTech Connect

    Rezacova, Pavlina; Pokorna, Jana; Brynda, Ji; Kozisek, Milan; Cigler, Petr; Lesik, Martin; Fanfrlik, Jindrich; Rezac, Jan; Saskova, Klara Grantz; Sieglova, Irena; Plesek, Jaromir; Sicha, Vaclav; Gruner, Bohumir; Oberwinkler, Heike; Sedlacek, Juraj; Krausslich, Hans-Georg; Hobza, Pavel; Kral, Vladimir; Konvalinka, Jan

    2010-04-19

    HIV protease (HIV PR) is a primary target for anti-HIV drug design. We have previously identified and characterized substituted metallacarboranes as a new class of HIV protease inhibitors. In a structure-guided drug design effort, we connected the two cobalt bis(dicarbollide) clusters with a linker to substituted ammonium group and obtained a set of compounds based on a lead formula [H{sub 2}N-(8-(C{sub 2}H{sub 4}O){sub 2}-1,2-C{sub 2}B{sub 9}H{sub 10})(1',2'-C{sub 2}B{sub 9}H{sub 11})-3,3'-Co){sub 2}]Na. We explored inhibition properties of these compounds with various substitutions, determined the HIV PR:inhibitor crystal structure, and computationally explored the conformational space of the linker. Our results prove the capacity of linker-substituted dual-cage cobalt bis(dicarbollides) as lead compounds for design of more potent inhibitors of HIV PR.

  20. MOFzyme: Intrinsic protease-like activity of Cu-MOF.

    PubMed

    Li, Bin; Chen, Daomei; Wang, Jiaqiang; Yan, Zhiying; Jiang, Liang; Deliang Duan; He, Jiao; Luo, Zhongrui; Zhang, Jinping; Yuan, Fagui

    2014-10-24

    The construction of efficient enzyme mimetics for the hydrolysis of peptide bonds in proteins is challenging due to the high stability of peptide bonds and the importance of proteases in biology and industry. Metal-organic frameworks (MOFs) consisting of infinite crystalline lattices with metal clusters and organic linkers may provide opportunities for protease mimic which has remained unknown. Herein, we report that Cu₂(C₉H₃O₆)₄/₃ MOF (which is well known as HKUST-1 and denoted as Cu-MOF here), possesses an intrinsic enzyme mimicking activity similar to that found in natural trypsin to bovine serum albumin (BSA) and casein. The Michaelis constant (Km) of Cu-MOF is about 26,000-fold smaller than that of free trypsin indicating a much higher affinity of BSA for Cu-MOF surface. Cu-MOF also exhibited significantly higher catalytic efficiency than homogeneous artificial metalloprotease Cu(II) complexes and could be reused for ten times without losing in its activity. Moreover, Cu-MOF was successfully used to simulate trypsinization in cell culture since it dissociated cells in culture even without EDTA.

  1. Extracellular trypsin-like proteases produced by Cordyceps militaris.

    PubMed

    Hattori, Maki; Isomura, Shigeki; Yokoyama, Eiji; Ujita, Minoru; Hara, Akira

    2005-12-01

    A trypsin-like protease, P-1-1, was purified from the culture supernatant of the fungus Cordyceps militaris by (NH(4))(2)SO(4) precipitation, chromatography on DEAE Bio-Gel Agarose, TSKgel CM-5PW, and gel-filtration with HiLoad 26/60 Superdex 75 pg, and its properties were examined. Purified P-1-1 showed a single band by SDS-PAGE and was estimated to have a molecular mass of 23,405 by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS). The optimum pH of the enzyme was between 8.5 and 12.0. It was inhibited strongly by leupeptin and diisopropyl fluorophosphate (DFP), and definitely did by N(alpha)-tosyl-L-lysine chloromethyl ketone hydrochloride (TLCK), phenylmethanesulfonyl fluoride (PMSF) and chymostatin. The carbonyl group sides of Arg and Lys were confirmed as the sites of cleavage by the enzyme toward cecropin B. These results indicate that P-1-1 is a trypsin-type serine protease. The N-terminal amino acid sequence of P-1-1 showed a high homology with those of trypsins or chymotrypsin derived from Diptera insects.

  2. Targeting the AKT pathway: Repositioning HIV protease inhibitors as radiosensitizers.

    PubMed

    Goda, Jayant S; Pachpor, Tejaswini; Basu, Trinanjan; Chopra, Supriya; Gota, Vikram

    2016-02-01

    Cellular resistance in tumour cells to different therapeutic approaches has been a limiting factor in the curative treatment of cancer. Resistance to therapeutic radiation is a common phenomenon which significantly reduces treatment options and impacts survival. One of the mechanisms of acquiring resistance to ionizing radiation is the overexpression or activation of various oncogenes like the EGFR (epidermal growth factor receptor), RAS (rat sarcoma) oncogene or loss of PTEN (phosphatase and tensin homologue) which in turn activates the phosphatidyl inositol 3-kinase/protein kinase B (PI3-K)/AKT pathway responsible for radiation resistance in various tumours. Blocking the pathway enhances the radiation response both in vitro and in vivo. Due to the differential activation of this pathway (constitutively activated in tumour cells and not in the normal host cells), it is an excellent candidate target for molecular targeted therapy to enhance radiation sensitivity. In this regard, HIV protease inhibitors (HPIs) known to interfere with PI3-K/AKT signaling in tumour cells, have been shown to sensitize various tumour cells to radiation both in vitro and in vivo. As a result, HPIs are now being investigated as possible radiosensitizers along with various chemotherapeutic drugs. This review describes the mechanisms by which PI3-K/AKT pathway causes radioresistance and the role of HIV protease inhibitors especially nelfinavir as a potential candidate drug to target the AKT pathway for overcoming radioresistance and its use in various clinical trials for different malignancies.

  3. Targeting the AKT pathway: Repositioning HIV protease inhibitors as radiosensitizers

    PubMed Central

    Goda, Jayant S.; Pachpor, Tejaswini; Basu, Trinanjan; Chopra, Supriya; Gota, Vikram

    2016-01-01

    Cellular resistance in tumour cells to different therapeutic approaches has been a limiting factor in the curative treatment of cancer. Resistance to therapeutic radiation is a common phenomenon which significantly reduces treatment options and impacts survival. One of the mechanisms of acquiring resistance to ionizing radiation is the overexpression or activation of various oncogenes like the EGFR (epidermal growth factor receptor), RAS (rat sarcoma) oncogene or loss of PTEN (phosphatase and tensin homologue) which in turn activates the phosphatidyl inositol 3-kinase/protein kinase B (PI3-K)/AKT pathway responsible for radiation resistance in various tumours. Blocking the pathway enhances the radiation response both in vitro and in vivo. Due to the differential activation of this pathway (constitutively activated in tumour cells and not in the normal host cells), it is an excellent candidate target for molecular targeted therapy to enhance radiation sensitivity. In this regard, HIV protease inhibitors (HPIs) known to interfere with PI3-K/AKT signaling in tumour cells, have been shown to sensitize various tumour cells to radiation both in vitro and in vivo. As a result, HPIs are now being investigated as possible radiosensitizers along with various chemotherapeutic drugs. This review describes the mechanisms by which PI3-K/AKT pathway causes radioresistance and the role of HIV protease inhibitors especially nelfinavir as a potential candidate drug to target the AKT pathway for overcoming radioresistance and its use in various clinical trials for different malignancies. PMID:27121513

  4. Botulinum neurotoxin devoid of receptor binding domain translocates active protease.

    PubMed

    Fischer, Audrey; Mushrush, Darren J; Lacy, D Borden; Montal, Mauricio

    2008-12-01

    Clostridium botulinum neurotoxin (BoNT) causes flaccid paralysis by disabling synaptic exocytosis. Intoxication requires the tri-modular protein to undergo conformational changes in response to pH and redox gradients across endosomes, leading to the formation of a protein-conducting channel. The approximately 50 kDa light chain (LC) protease is translocated into the cytosol by the approximately 100 kDa heavy chain (HC), which consists of two modules: the N-terminal translocation domain (TD) and the C-terminal Receptor Binding Domain (RBD). Here we exploited the BoNT modular design to identify the minimal requirements for channel activity and LC translocation in neurons. Using the combined detection of substrate proteolysis and single-channel currents, we showed that a di-modular protein consisting only of LC and TD was sufficient to translocate active protease into the cytosol of target cells. The RBD is dispensable for cell entry, channel activity, or LC translocation; however, it determined a pH threshold for channel formation. These findings indicate that, in addition to its individual functions, each module acts as a chaperone for the others, working in concert to achieve productive intoxication.

  5. Sparse Representation for Prediction of HIV-1 Protease Drug Resistance.

    PubMed

    Yu, Xiaxia; Weber, Irene T; Harrison, Robert W

    2013-01-01

    HIV rapidly evolves drug resistance in response to antiviral drugs used in AIDS therapy. Estimating the specific resistance of a given strain of HIV to individual drugs from sequence data has important benefits for both the therapy of individual patients and the development of novel drugs. We have developed an accurate classification method based on the sparse representation theory, and demonstrate that this method is highly effective with HIV-1 protease. The protease structure is represented using our newly proposed encoding method based on Delaunay triangulation, and combined with the mutated amino acid sequences of known drug-resistant strains to train a machine-learning algorithm both for classification and regression of drug-resistant mutations. An overall cross-validated classification accuracy of 97% is obtained when trained on a publically available data base of approximately 1.5×10(4) known sequences (Stanford HIV database http://hivdb.stanford.edu/cgi-bin/GenoPhenoDS.cgi). Resistance to four FDA approved drugs is computed and comparisons with other algorithms demonstrate that our method shows significant improvements in classification accuracy.

  6. Regulation of neurotoxin and protease formation in Clostridium botulinum Okra B and Hall A by arginine.

    PubMed Central

    Patterson-Curtis, S I; Johnson, E A

    1989-01-01

    Supplementation of a minimal medium with high levels of arginine (20 g/liter) markedly decreased neurotoxin titers and protease activities in cultures of Clostridium botulinum Okra B and Hall A. Nitrogenous nutrients that are known to be derived from arginine, including proline, glutamate, and ammonia, also decreased protease and toxin but less so than did arginine. Proteases synthesized during growth were rapidly inactivated after growth stopped in media containing high levels of arginine. Separation of extracellular proteins by electrophoresis and immunoblots with antibodies to toxin showed that the decrease in toxin titers in media containing high levels of arginine was caused by both reduced synthesis of protoxin and impaired proteolytic activation. In contrast, certain other nutritional conditions stimulated protease and toxin formation in C. botulinum and counteracted the repression by arginine. Supplementation of the minimal medium with casein or casein hydrolysates increased protease activities and toxin titers. Casein supplementation of a medium containing high levels of arginine prevented protease inactivation. High levels of glucose (50 g/liter) also delayed the inactivation of proteases in both the minimal medium and a medium containing high levels of arginine. These observations suggest that the availability of nitrogen and energy sources, particularly arginine, affects the production and proteolytic processing of toxins and proteases in C. botulinum. Images PMID:2669631

  7. Purification and characterization of Bacillus cereus protease suitable for detergent industry.

    PubMed

    Prakash, Monika; Banik, Rathindra Mohan; Koch-Brandt, Claudia

    2005-12-01

    An extracellular alkaline protease from an alkalophilic bacterium, Bacillus cereus, was produced in a large amount by the method of extractive fermentation. The protease is thermostable, pH tolerant, and compatible with commercial laundry detergents. The protease purified and characterized in this study was found to be superior to endogenous protease already present in commercial laundry detergents. The enzyme was purified to homogeneity by ammonium sulfate precipitation, concentration by ultrafiltration, anion-exchange chromatography, and gel filtration. The purified enzyme had a specific activity of 3256.05 U/mg and was found to be a monomeric protein with a molecular mass of 28 and 31 kDa, as estimated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and nondenaturing PAGE, respectively. Its maximum protease activity against casein was found to be at pH 10.5 and 50 degrees C. Proteolytic activity of the enzyme was detected by casein and gelatin zymography, which gave a very clear protease activity zone on gel that corresponded to the band obtained on SDS-PAGE and nondenaturing PAGE with a molecular mass of nearly 31 kDa. The purified enzyme was analyzed through matrix-assisted laser desorption ionization-time-of-flight-mass spectrometry (MALDI-TOF-MS) and identified as a subtilisin class of protease. Specific serine protease inhibitors, suggesting the presence of serine residues at the active site, inhibited the enzyme significantly.

  8. Biochemical analysis and investigation on the prospective applications of alkaline protease from a Bacillus cereus strain.

    PubMed

    Saleem, Mahjabeen; Rehman, Atiqa; Yasmin, Riffat; Munir, Bushra

    2012-06-01

    Proteases have prospective financial and environment-friendly applications; hence attention is focused currently on the finding of new protease producing microorganism so as to meet the requirements of industry. A thermophilic bacterial strain producing extracellular protease activity was isolated from soil and identified as Bacillus cereus by analysis of 16S rRNA. Protease production by the microorganism was improved by studying the impact of the type of nitrogen and carbon source, fermentation period, growth temperature and initial pH of the culture medium in cultivation optimization experiments. The enzyme was purified to homogeneity in two step procedure involving Sephadex G-75 and Q-Sepharose chromatography. The molecular weight of purified enzyme was found to be 58 kDa by SDS-PAGE. Protease exhibited a pH and temperature optima of 7.5 and 60°, respectively. The enzyme was active in the pH range of 6.0-9.0 and stable up to 70°C. Histological analysis of protease treated goat and cow skin pelts showed complete removal of non leather forming structures such as hair shaft, hair follicles and glandular structures. The protease showed the stain removing property from blood stained cotton cloth and found to be compatible with six commercially available detergents. The protease could release peptides from natural proteins after digestion of coagulated egg albumin and blood clot.

  9. Discovery of MK-8718, an HIV Protease Inhibitor Containing a Novel Morpholine Aspartate Binding Group.

    PubMed

    Bungard, Christopher J; Williams, Peter D; Ballard, Jeanine E; Bennett, David J; Beaulieu, Christian; Bahnck-Teets, Carolyn; Carroll, Steve S; Chang, Ronald K; Dubost, David C; Fay, John F; Diamond, Tracy L; Greshock, Thomas J; Hao, Li; Holloway, M Katharine; Felock, Peter J; Gesell, Jennifer J; Su, Hua-Poo; Manikowski, Jesse J; McKay, Daniel J; Miller, Mike; Min, Xu; Molinaro, Carmela; Moradei, Oscar M; Nantermet, Philippe G; Nadeau, Christian; Sanchez, Rosa I; Satyanarayana, Tummanapalli; Shipe, William D; Singh, Sanjay K; Truong, Vouy Linh; Vijayasaradhi, Sivalenka; Wiscount, Catherine M; Vacca, Joseph P; Crane, Sheldon N; McCauley, John A

    2016-07-14

    A novel HIV protease inhibitor was designed using a morpholine core as the aspartate binding group. Analysis of the crystal structure of the initial lead bound to HIV protease enabled optimization of enzyme potency and antiviral activity. This afforded a series of potent orally bioavailable inhibitors of which MK-8718 was identified as a compound with a favorable overall profile.

  10. Crystal Structure of a Novel Viral Protease with a Serine/Lysine Catalytic Dyad Mechanism

    SciTech Connect

    Feldman,A.; Lee, J.; Delmas, B.; Paetzel, M.

    2006-01-01

    The blotched snakehead virus (BSNV), an aquatic birnavirus, encodes a polyprotein (NH2-pVP2-X-VP4-VP3-COOH) that is processed through the proteolytic activity of its own protease (VP4) to liberate itself and the viral proteins pVP2, X and VP3. The protein pVP2 is further processed by VP4 to give rise to the capsid protein VP2 and four structural peptides. We report here the crystal structure of a VP4 protease from BSNV, which displays a catalytic serine/lysine dyad in its active site. This is the first crystal structure of a birnavirus protease and the first crystal structure of a viral protease that utilizes a lysine general base in its catalytic mechanism. The topology of the VP4 substrate binding site is consistent with the enzymes substrate specificity and a nucleophilic attack from the si-face of the substrates scissile bond. Despite low levels of sequence identity, VP4 shows similarities in its active site to other characterized Ser/Lys proteases such as signal peptidase, LexA protease and Lon protease. Together, the structure of VP4 provides insights into the mechanism of a recently characterized clan of serine proteases that utilize a lysine general base and reveals the structure of potential targets for antiviral therapy, especially for other related and economically important viruses, such as infectious bursal disease virus in poultry and infectious pancreatic necrosis virus in aquaculture.

  11. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Mixed carbohydrase and protease enzyme product... enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes... current good manufacturing practice conditions of use: (1) The ingredient is used as an enzyme, as...

  12. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Mixed carbohydrase and protease enzyme product... enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes... current good manufacturing practice conditions of use: (1) The ingredient is used as an enzyme, as...

  13. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Mixed carbohydrase and protease enzyme product... enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes... current good manufacturing practice conditions of use: (1) The ingredient is used as an enzyme, as...

  14. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Mixed carbohydrase and protease enzyme product. 184... enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes... current good manufacturing practice conditions of use: (1) The ingredient is used as an enzyme, as...

  15. Full quantum mechanical study of binding of HIV-1 protease drugs

    NASA Astrophysics Data System (ADS)

    Zhang, Da W.; Zhang, John Z. H.

    Fully quantum mechanical studies of detailed binding interactions between HIV-1 protease and six FDA (Food and Drug Administration)-approved drugs (saquinavir, indinavir, ritonavir, nelfinavir, amprenavir, and lopinavir) are carried out using a recently developed MFCC (molecular fractionation with conjugate caps) method. The MFCC calculation produces a quantum mechanical interaction spectrum for any protease drug binding complex. Detailed quantitative analysis on binding of lopinavir to specific residues of the protease is given from the current study. The present calculation shows that the dominant binding of lopinavir to the protease is through the formation of a strong hydrogen bond between the central hydroxyl group of the drug to the aspartate oxygen of Asp25 in one of the two chains of the protease (A chain). This is closely followed by hydrogen binding of the drug to Asp29 in the B chain and somewhat weak hydrogen bonding to Asp30, Gly27, Gly48, and Ile50 in both chains. By partitioning all six drugs into four building blocks besides the central component containing the hydroxyl group, MFCC calculation finds that block III has essentially no binding interaction with the protease and the major binding interactions of these drugs are from blocks II and IV, in addition to the dominant central hydroxyl group. This detailed quantitative information on drug binding to the protease is very useful in rational design of new and improved inhibitors of HIV-1 protease and its mutants.

  16. Protease inhibition by Heterodera glycines cyst content: evidence for effects on the Meloidogyne incognita proteasome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteases from Heterodera glycines and Meloidogyne incognita juveniles were inhibited by heat-stable content of H. glycines female cysts (HglCE), and by the plant polyphenol epigallocatechin gallate (EGCG). General protease activities detected using the nematode peptide KSAYMRFa were inhibited by EG...

  17. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes.

    PubMed

    Liu, Zhigang; Wang, Yong; Yedidi, Ravikiran S; Dewdney, Tamaria G; Reiter, Samuel J; Brunzelle, Joseph S; Kovari, Iulia A; Kovari, Ladislau C

    2013-01-18

    The success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. In addition, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  18. Protease inhibitor in scorpion (Mesobuthus eupeus) venom prolongs the biological activities of the crude venom.

    PubMed

    Ma, Hakim; Xiao-Peng, Tang; Yang, Shi-Long; Lu, Qiu-Min; Lai, Ren

    2016-08-01

    It is hypothesized that protease inhibitors play an essential role in survival of venomous animals through protecting peptide/protein toxins from degradation by proteases in their prey or predators. However, the biological function of protease inhibitors in scorpion venoms remains unknown. In the present study, a trypsin inhibitor was purified and characterized from the venom of scorpion Mesobuthus eupeus, which enhanced the biological activities of crude venom components in mice when injected in combination with crude venom. This protease inhibitor, named MeKTT-1, belonged to Kunitz-type toxins subfamily. Native MeKTT-1 selectively inhibited trypsin with a Kivalue of 130 nmol·L(-1). Furthermore, MeKTT-1 was shown to be a thermo-stable peptide. In animal behavioral tests, MeKTT-1 prolonged the pain behavior induced by scorpion crude venom, suggesting that protease inhibitors in scorpion venom inhibited proteases and protect the functionally important peptide/protein toxins from degradation, consequently keeping them active longer. In conclusion, this was the first experimental evidence about the natural existence of serine protease inhibitor in the venom of scorpion Mesobuthus eupeus, which preserved the activity of venom components, suggests that scorpions may use protease inhibitors for survival.

  19. Activation of influenza viruses by proteases from host cells and bacteria in the human airway epithelium.

    PubMed

    Böttcher-Friebertshäuser, Eva; Klenk, Hans-Dieter; Garten, Wolfgang

    2013-11-01

    Influenza is an acute infection of the respiratory tract, which affects each year millions of people. Influenza virus infection is initiated by the surface glycoprotein hemagglutinin (HA) through receptor binding and fusion of viral and endosomal membranes. HA is synthesized as a precursor protein and requires cleavage by host cell proteases to gain its fusion capacity. Although cleavage of HA is crucial for virus infectivity, little was known about relevant proteases in the human airways for a long time. Recent progress in the identification and characterization of HA-activating host cell proteases has been considerable however and supports the idea of targeting HA cleavage as a novel approach for influenza treatment. Interestingly, certain bacteria have been demonstrated to support HA activation either by secreting proteases that cleave HA or due to activation of cellular proteases and thereby may contribute to virus spread and enhanced pathogenicity. In this review, we give an overview on activation of influenza viruses by proteases from host cells and bacteria with the main focus on recent progress on HA cleavage by proteases HAT and TMPRSS2 in the human airway epithelium. In addition, we outline investigations of HA-activating proteases as potential drug targets for influenza treatment.

  20. Proteases, cystic fibrosis and the epithelial sodium channel (ENaC).

    PubMed

    Thibodeau, P H; Butterworth, M B

    2013-02-01

    Proteases perform a diverse array of biological functions. From simple peptide digestion for nutrient absorption to complex signaling cascades, proteases are found in organisms from prokaryotes to humans. In the human airway, proteases are associated with the regulation of the airway surface liquid layer, tissue remodeling, host defense and pathogenic infection and inflammation. A number of proteases are released in the airways under both physiological and pathophysiological states by both the host and invading pathogens. In airway diseases such as cystic fibrosis, proteases have been shown to be associated with increased morbidity and airway disease progression. In this review, we focus on the regulation of proteases and discuss specifically those proteases found in human airways. Attention then shifts to the epithelial sodium channel (ENaC), which is regulated by proteolytic cleavage and that is considered to be an important component of cystic fibrosis disease. Finally, we discuss bacterial proteases, in particular, those of the most prevalent bacterial pathogen found in cystic fibrosis, Pseudomonas aeruginosa.

  1. Prevalence of genes encoding extracellular proteases in Staphylococcus aureus - important targets triggering immune response in vivo.

    PubMed

    Zdzalik, Michal; Karim, Abdulkarim Y; Wolski, Krzysztof; Buda, Pawel; Wojcik, Kinga; Brueggemann, Sarah; Wojciechowski, Piotr; Eick, Sigrun; Calander, Ann-Marie; Jonsson, Ing-Marie; Kubica, Malgorzata; Polakowska, Klaudia; Miedzobrodzki, Jacek; Wladyka, Benedykt; Potempa, Jan; Dubin, Grzegorz

    2012-11-01

    Proteases of Staphylococcus aureus have long been considered to function as important virulence factors, although direct evidence of the role of particular enzymes remains incomplete and elusive. Here, we sought to provide a collective view of the prevalence of extracellular protease genes in genomes of commensal and pathogenic strains of S. aureus and their expression in the course of human and mouse infection. Data on V8 protease, staphopains A and B, aureolysin, and the recently described and poorly characterized group of six Spl proteases are provided. A phylogenetically diverse collection of 167 clinical isolates was analyzed, resulting in the comprehensive genetic survey of the prevalence of protease-encoding genes. No correlation between identified gene patterns with specific infections was established. Humoral response against the proteases of interest was examined in the sera derived from human patients and from a model mouse infection. The analysis suggests that at least some, if not all, tested proteases are expressed and secreted during the course of infection. Overall, the results presented in this study support the hypothesis that the secretory proteases as a group may contribute to the virulence of S. aureus.

  2. Dose-dependent induction of IL-6 by plant-derived proteases in vitro

    PubMed Central

    Rose, B; Herder, C; Löffler, H; Meierhoff, G; Schloot, N C; Walz, M; Martin, S

    2006-01-01

    Oral administration of proteases such as bromelain and papain is commonly used in patients with a wide range of inflammatory conditions, but their molecular and cellular mechanisms of action are still poorly understood. The aim of our study was to investigate the impact of these proteases on the release of interleukin-6 (IL-6) and other cytokines in the recently described modified mixed lymphocyte culture (MMLC) test system which is based on the mutual interaction of cells of the innate and adaptive immunity. Bromelain and papain enhanced IL-6 production dose-dependently up to 400-fold in MMLC before and up to 30-fold after neutralization of LPS content of proteases using polymyxin B, indicating that IL-6 induction by protease treatment was attributable to both protease action and LPS content of enzyme preparations. The production of IFNγ and IL-10 was not altered by bromelain or papain, indicating a selective and differential immune activation. Both proteases impaired cytokine stability, cell proliferation and expression of cell surface molecules like CD14 only marginally, suggesting no impact of these mechanisms on protease-mediated cytokine release. These findings might provide the mechanistic rationale for the current use of proteases in wound healing and tissue regeneration since these processes depend on IL-6 induction. PMID:16367938

  3. Identification and characterization of alkaline serine protease from goat skin surface metagenome

    PubMed Central

    2011-01-01

    Metagenomic DNA isolated from goat skin surface was used to construct plasmid DNA library in Escherichia coli DH10B. Recombinant clones were screened for functional protease activity on skim milk agar plates. Upon screening 70,000 clones, a clone carrying recombinant plasmid pSP1 exhibited protease activity. In vitro transposon mutagenesis and sequencing of the insert DNA in this clone revealed an ORF of 1890 bp encoding a protein with 630 amino acids which showed significant sequence homology to the peptidase S8 and S53 subtilisin kexin sedolisin of Shewanella sp. This ORF was cloned in pET30b and expressed in E. coli BL21 (DE3). Although the cloned Alkaline Serine protease (AS-protease) was overexpressed, it was inactive as a result of forming inclusion bodies. After solubilisation, the protease was purified using Ni-NTA chromatography and then refolded properly to retain protease activity. The purified AS-protease with a molecular mass of ~63 kDa required a divalent cation (Co2+ or Mn2+) for its improved activity. The pH and temperature optima for this protease were 10.5 and 42°C respectively. PMID:21906326

  4. Amelioration of immune complex-mediated glomerulonephritis by synthetic protease inhibitors.

    PubMed

    Jennette, J C; Tidwell, R R; Geratz, J D; Bing, D H; Falk, R J

    1987-06-01

    Proteases are involved in the pathogenesis of inflammatory diseases by participating in the activation of mediator systems and by producing proteolytic tissue injury. Homeostatic control of inflammation is accomplished in part by physiologic protease inhibitors. The authors investigated the effectiveness of a number of synthetic protease inhibitors in ameliorating the glomerular injury induced by immune complex-mediated glomerulonephritis in mice. Two amidine-type protease inhibitors, bis (5-amidino-2-benzimidazolyl)methane and 1,2-bis (5-amidino-2-benzimidazolyl)ethane, had the greatest effects. They caused a marked reduction in glomerular necrosis (P less than 0.001) but did not affect the amount or site of immune complex localization or leukocyte influx. The inhibition constants of the protease inhibitors against nine purified physiologic proteases were determined. These results were discussed in relation to the effectiveness of the protease inhibitors in reducing glomerular injury. This investigation indicates that the administration of synthetic protease inhibitors can have a beneficial effect on immune-mediated inflammatory injury.

  5. Interdomain Contacts and the Stability of Serralysin Protease from Serratia marcescens.

    PubMed

    Zhang, Liang; Morrison, Anneliese J; Thibodeau, Patrick H

    2015-01-01

    The serralysin family of bacterial metalloproteases is associated with virulence in multiple modes of infection. These extracellular proteases are members of the Repeats-in-ToXin (RTX) family of toxins and virulence factors, which mediated virulence in E. coli, B. pertussis, and P. aeruginosa, as well as other animal and plant pathogens. The serralysin proteases are structurally dynamic and their folding is regulated by calcium binding to a C-terminal domain that defines the RTX family of proteins. Previous studies have suggested that interactions between N-terminal sequences and this C-terminal domain are important for the high thermal and chemical stabilities of the RTX proteases. Extending from this, stabilization of these interactions in the native structure may lead to hyperstabilization of the folded protein. To test this hypothesis, cysteine pairs were introduced into the N-terminal helix and the RTX domain and protease folding and activity were assessed. Under stringent pH and temperature conditions, the disulfide-bonded mutant showed increased protease activity and stability. This activity was dependent on the redox environment of the refolding reaction and could be blocked by selective modification of the cysteine residues before protease refolding. These data demonstrate that the thermal and chemical stability of these proteases is, in part, mediated by binding between the RTX domain and the N-terminal helix and demonstrate that stabilization of this interaction can further stabilize the active protease, leading to additional pH and thermal tolerance.

  6. Interdomain Contacts and the Stability of Serralysin Protease from Serratia marcescens

    PubMed Central

    Zhang, Liang; Morrison, Anneliese J.; Thibodeau, Patrick H.

    2015-01-01

    The serralysin family of bacterial metalloproteases is associated with virulence in multiple modes of infection. These extracellular proteases are members of the Repeats-in-ToXin (RTX) family of toxins and virulence factors, which mediated virulence in E. coli, B. pertussis, and P. aeruginosa, as well as other animal and plant pathogens. The serralysin proteases are structurally dynamic and their folding is regulated by calcium binding to a C-terminal domain that defines the RTX family of proteins. Previous studies have suggested that interactions between N-terminal sequences and this C-terminal domain are important for the high thermal and chemical stabilities of the RTX proteases. Extending from this, stabilization of these interactions in the native structure may lead to hyperstabilization of the folded protein. To test this hypothesis, cysteine pairs were introduced into the N-terminal helix and the RTX domain and protease folding and activity were assessed. Under stringent pH and temperature conditions, the disulfide-bonded mutant showed increased protease activity and stability. This activity was dependent on the redox environment of the refolding reaction and could be blocked by selective modification of the cysteine residues before protease refolding. These data demonstrate that the thermal and chemical stability of these proteases is, in part, mediated by binding between the RTX domain and the N-terminal helix and demonstrate that stabilization of this interaction can further stabilize the active protease, leading to additional pH and thermal tolerance. PMID:26378460

  7. A novel serine protease with caspase- and legumain-like activities from edible basidiomycete Flammulina velutipes.

    PubMed

    Iketani, Aya; Nakamura, Mayumi; Suzuki, Yuya; Awai, Koichiro; Shioi, Yuzo

    2013-03-01

    A serine protease with caspase- and legumain-like activities from basidiocarps of the edible basidiomycete Flammulina velutipes was characterized. The protease was purified to near homogeneity by three steps of chromatography using acetyl-Tyr-Val-Ala-Asp-4-methylcoumaryl-7-amide (Ac-YVAD-MCA) as a substrate. The enzyme was termed FvSerP (F. velutipes serine protease). This enzyme activity was completely inhibited by the caspase-specific inhibitor, Ac-YVAD-CHO, as well as moderately inhibited by serine protease inhibitors. Based on the N-terminal sequence, the cDNA of FvSerP was identified. The deduced protease sequence was a peptide composed of 325 amino acids with a molecular mass of 34.5 kDa. The amino acid sequence of FvSerP showed similarity to neither caspases nor to the plant subtilisin-like serine protease with caspase-like activity called saspase. FvSerP shared identity to the functionally unknown genes from class of Agaricomycetes, with similarity to the peptidase S41 domain of a serine protease. It was thus concluded that this enzyme is likely a novel serine protease with caspase- and legumain-like activities belonging to the peptidase S41 family and distributed in the class Agaricomycetes. This enzyme possibly functions in autolysis, a type of programmed cell death that occurs in the later stages of development of basidiocarps with reference to their enzymatic functions.

  8. A novel extracellular protease from Pseudomonas aeruginosa MCM B-327: enzyme production and its partial characterization.

    PubMed

    Zambare, Vasudeo; Nilegaonkar, Smita; Kanekar, Pradnya

    2011-02-28

    The focus of this study was on production, purification and characterization of dehairing protease from Pseudomonas aeruginosa MCM B-327, isolated from vermicompost pit soil. Optimum protease activity, 395 U mL(-1), was observed in the medium containing soybean meal and tryptone, at pH 7 and 30 °C. The crude enzyme exhibited dehairing activity. As compared to chemical method, enzymatic method of dehairing showed reduction in COD, TDS and TSS by 34.28%, 37.32% and 51.58%, respectively. Zymogram of crude enzyme on native-PAGE presented two bands with protease activity of molecular weights of 56 and 67 kDa. Both proteases showed dehairing activity. Out of these, 56kDa protease (PA02) was purified 3.05-folds with 2.71% recovery. The enzyme was active in pH range 7-9 and temperature 20-50 °C with optimum pH of 8 and temperature 35°C. Moreover, the enzyme activity of PA02 protease was not strongly inhibited by specific inhibitor showing the novel nature of enzyme compared to serine, cysteine, aspartyl and metalloproteases. Kinetic studies indicated that substrate specificity of PA02 protease was towards various natural and synthetic proteolytic substrates but inactive against collagen and keratin. These findings suggest protease secreted by P. aeruginosa MCM B-327 may have application in dehairing for environment-friendly leather processing.

  9. The higher barrier of darunavir and tipranavir resistance for HIV-1 protease

    SciTech Connect

    Wang, Yong; Liu, Zhigang; Brunzelle, Joseph S.; Kovari, Iulia A.; Dewdney, Tamaria G.; Reiter, Samuel J.; Kovari, Ladislau C.

    2011-11-17

    Darunavir and tipranavir are two inhibitors that are active against multi-drug resistant (MDR) HIV-1 protease variants. In this study, the invitro inhibitory efficacy was tested against a MDR HIV-1 protease variant, MDR 769 82T, containing the drug resistance mutations of 46L/54V/82T/84V/90M. Crystallographic and enzymatic studies were performed to examine the mechanism of resistance and the relative maintenance of potency. The key findings are as follows: (i) The MDR protease exhibits decreased susceptibility to all nine HIV-1 protease inhibitors approved by the US Food and Drug Administration (FDA), among which darunavir and tipranavir are the most potent; (ii) the threonine 82 mutation on the protease greatly enhances drug resistance by altering the hydrophobicity of the binding pocket; (iii) darunavir or tipranavir binding facilitates closure of the wide-open flaps of the MDR protease; and (iv) the remaining potency of tipranavir may be preserved by stabilizing the flaps in the inhibitor-protease complex while darunavir maintains its potency by preserving protein main chain hydrogen bonds with the flexible P2 group. These results could provide new insights into drug design strategies to overcome multi-drug resistance of HIV-1 protease variants.

  10. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    SciTech Connect

    Liu, Zhigang; Wang, Yong; Yedidi, Ravikiran S.; Dewdney, Tamaria G.; Reiter, Samuel J.; Brunzelle, Joseph S.; Kovari, Iulia A.; Kovari, Ladislau C.

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  11. Differential Response of Extracellular Proteases of Trichoderma Harzianum Against Fungal Phytopathogens.

    PubMed

    Sharma, Vivek; Salwan, Richa; Sharma, Prem N

    2016-09-01

    In the present study, production of extracellular proteases by Trichoderma harzianum was evaluated based on the relative gene expression and spectrophotometric assay. The fungal isolates were grown in Czapek Dox Broth medium supplemented with deactivated mycelium of plant fungal pathogens such as Fusarium oxysporum, Colletotrichum capsici, Gloeocercospora sorghi, and Colletotrichum truncatum. The maximum protease activity was detected after 48 h of incubation against Colletotrichum spp. Similarly in qRT-PCR, the relative gene expression of four proteases varied from 48 to 96 h against host pathogens in a time-independent manner. Among proteases, statistically significant upregulation of asp, asp, and srp was observed against Colletotrichum spp., followed by F. oxysporum. But in the case of pepM22, maximum upregulation was observed against F. oxysporum. The variation in enzyme assay and qRT-PCR of proteases at different time intervals against various fungal phytopathogens could be due to the limitation of using casein as a substrate for all types of proteases or protease-encoding transcripts selected for qRT-PCR, which may not be true representative of total protease activity.

  12. Barrier dysfunction caused by environmental proteases in the pathogenesis of allergic diseases.

    PubMed

    Takai, Toshiro; Ikeda, Shigaku

    2011-03-01

    Skin barrier dysfunction has emerged as a critical driving force in the initiation and exacerbation of atopic dermatitis and the "atopic march" in allergic diseases. The genetically determined barrier deficiency and barrier disruption by environmental and endogenous proteases in skin and epithelium are considered to increase the risk of sensitization to allergens and contribute to the exacerbation of allergic diseases. Sources of allergens such as mites, cockroaches, fungi, and pollen, produce or contain proteases, which are frequently themselves allergens. Staphylococcus aureus, which heavily colonizes the lesions of atopic dermatitis patients and is known to trigger a worsening of the disease, also produces extracellular proteases. Environmental proteases can cause barrier breakdown in the skin, not only in the epithelium, and stimulate various types of cells through IgE-independent mechanisms. Endogenous protease inhibitors control the functions of environmental and endogenous proteases. In this review, we focus on the barrier dysfunction caused by environmental proteases and roles of endogenous protease inhibitors in the pathogenesis of allergic diseases. Additionally, we examine the subsequent innate response to Th2-skewed adaptive immune reactions.

  13. Structural basis for substrate specificity of alphavirus nsP2 proteases.

    PubMed

    Russo, Andrew T; Malmstrom, Robert D; White, Mark A; Watowich, Stanley J

    2010-08-24

    The alphavirus nsP2 protease is essential for correct processing of the alphavirus nonstructural polyprotein (nsP1234) and replication of the viral genome. We have combined molecular dynamics simulations with our structural studies to reveal features of the nsP2 protease catalytic site and S1'-S4 subsites that regulate the specificity of the protease. The catalytic mechanism of the nsP2 protease appears similar to the papain-like cysteine proteases, with the conserved catalytic dyad forming a thiolate-imidazolium ion pair in the nsP2-activated state. Substrate binding likely stabilizes this ion pair. Analysis of bimolecular complexes of Venezuelan equine encephalitis virus (VEEV) nsP2 protease with each of the nsP1234 cleavage sites identified protease residues His(510), Ser(511), His(546) and Lys(706) as critical for cleavage site recognition. Homology modelling and molecular dynamics simulations of diverse alphaviruses and their cognate cleavage site sequences revealed general features of substrate recognition that operate across alphavirus strains as well as strain specific covariance between binding site and cleavage site residues. For instance, compensatory changes occurred in the P3 and S3 subsite residues to maintain energetically favourable complementary binding surfaces. These results help explain how alphavirus nsP2 proteases recognize different cleavage sites within the nonstructural polyprotein and discriminate between closely related cleavage targets.

  14. A computational module assembled from different protease family motifs identifies PI PLC from Bacillus cereus as a putative prolyl peptidase with a serine protease scaffold.

    PubMed

    Rendón-Ramírez, Adela; Shukla, Manish; Oda, Masataka; Chakraborty, Sandeep; Minda, Renu; Dandekar, Abhaya M; Ásgeirsson, Bjarni; Goñi, Félix M; Rao, Basuthkar J

    2013-01-01

    Proteolytic enzymes have evolved several mechanisms to cleave peptide bonds. These distinct types have been systematically categorized in the MEROPS database. While a BLAST search on these proteases identifies homologous proteins, sequence alignment methods often fail to identify relationships arising from convergent evolution, exon shuffling, and modular reuse of catalytic units. We have previously established a computational method to detect functions in proteins based on the spatial and electrostatic properties of the catalytic residues (CLASP). CLASP identified a promiscuous serine protease scaffold in alkaline phosphatases (AP) and a scaffold recognizing a β-lactam (imipenem) in a cold-active Vibrio AP. Subsequently, we defined a methodology to quantify promiscuous activities in a wide range of proteins. Here, we assemble a module which encapsulates the multifarious motifs used by protease families listed in the MEROPS database. Since APs and proteases are an integral component of outer membrane vesicles (OMV), we sought to query other OMV proteins, like phospholipase C (PLC), using this search module. Our analysis indicated that phosphoinositide-specific PLC from Bacillus cereus is a serine protease. This was validated by protease assays, mass spectrometry and by inhibition of the native phospholipase activity of PI-PLC by the well-known serine protease inhibitor AEBSF (IC50 = 0.018 mM). Edman degradation analysis linked the specificity of the protease activity to a proline in the amino terminal, suggesting that the PI-PLC is a prolyl peptidase. Thus, we propose a computational method of extending protein families based on the spatial and electrostatic congruence of active site residues.

  15. Improving production of extracellular proteases by random mutagenesis and biochemical characterization of a serine protease in Bacillus subtilis S1-4.

    PubMed

    Wang, X C; Zhao, H Y; Liu, G; Cheng, X J; Feng, H

    2016-06-17

    The feather is a valuable by-product with a huge annual yield produced by the poultry industry. Degradation of feathers by microorganisms is a prerequisite to utilize this insoluble protein resource. To improve the degrading efficiency of feathers, mutagenesis of the bacterium Bacillus subtilis S1-4 was performed. By combining ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine treatment for mutagenesis, a high protease-producing mutant (UMU4) of B. subtilis S1-4 was selected, which exhibited 2.5-fold higher extracellular caseinolytic activity than did the wild-type strain. UMU4 degraded chicken feathers more efficiently, particularly for the release of soluble proteins from the feathers, compared to the wild-type strain. Furthermore, an extracellular protease with a molecular weight of 45 kDa, as determined by SDS-PAGE, was purified from UMU4. Biochemical characterization indicated that the caseinolytic activity of the protease was largely inhibited by phenylmethanesulfonyl fluoride, suggesting that the purified enzyme is a serine protease. This protease was highly active over a wide range of pHs (6.0 to 12.0) and temperatures (50° to 75°C) with an optimal pH and temperature of 8.0 and 65°C, respectively. The purified enzyme exhibited good thermostability with a 72.2 min half-life of thermal denaturation at 60°C. In addition, this protease was not sensitive to heavy metal ions, surfactants, or oxidative reagents. In conclusion, strain improvement for protease production can serve as an alternative strategy to promote feather degradation. The UMU4 mutant of B. subtilis and its serine protease could be potentially used in various industries.

  16. Developmentally linked changes in proteases and protease inhibitors suggest a role for potato multicystatin in regulating protein content of potato tubers.

    PubMed

    Weeda, Sarah M; Mohan Kumar, G N; Richard Knowles, N

    2009-06-01

    The soluble protein fraction of fully developed potato (Solanum tuberosum L.) tubers is dominated by patatin, a 40 kD storage glycoprotein, and protease inhibitors. Potato multicystatin (PMC) is a multidomain Cys-type protease inhibitor. PMC effectively inhibits degradation of patatin by tuber proteases in vitro. Herein we show that changes in PMC, patatin concentration, activities of various proteases, and their gene expression are temporally linked during tuber development, providing evidence that PMC has a role in regulating tuber protein content in vivo. PMC was barely detectable in non-tuberized stolons. PMC transcript levels increased progressively during tuberization, concomitant with a 40-fold increase in PMC concentration (protein basis) as tubers developed to 10 g fresh wt. Further increases in PMC were comparatively modest (3.7-fold) as tubers developed to full maturity (250 g). Protease activity declined precipitously as PMC levels increased during tuberization. Proteolytic activity was highest in non-tuberized stolons and fell substantially through the 10-g fresh wt stage. Cys-type proteases dominated the pre-tuberization and earliest stages of tuber development. Increases in patatin transcript levels during tuberization were accompanied by a notable lag in patatin accumulation. Patatin did not begin to accumulate substantially on a protein basis until tubers had reached the 10-g stage, wherein protease activity had been inhibited by approximately 60%. These results indicate that a threshold level of PMC (ca. 3 microg tuber(-1), 144 ng mg(-1) protein) is needed to favor patatin accumulation. Collectively, these results are consistent with a role for PMC in facilitating the accumulation of proteins in developing tubers by inhibiting Cys-type proteases.

  17. Homology among acid proteases: comparison of crystal structures at 3A resolution of acid proteases from Rhizopus chinensis and Endothia parasitica.

    PubMed Central

    Subramanian, E; Swan, I D; Liu, M; Davies, D R; Jenkins, J A; Tickle, I J; Blundell, T L

    1977-01-01

    The molecular structures of two fungal acid proteases at 3 A resolution have been compared, and found to have similar secondary and tertiary folding. These enzymes are bilobal and have a pronounced cleft between the two lobes. This cleft has been identified as the active site region from inhibitor binding studies. The results of the comparison are discussed in terms of homology among the acid proteases in general. Images PMID:322132

  18. Inhibition of protease production of various bacteria by ammonium salts: its effect on toxin production and virulence.

    PubMed

    Liu, P V; Hsieh, H C

    1969-08-01

    Production of protease by many bacteria was found to be inhibited by ammonium salts, and the enzyme production was more sensitive to the salts than was growth of the organisms. Inhibition of protease production by some pathogenic bacteria may result in the recognition of an exotoxin which otherwise would have been digested by the protease. In the case of Pseudomonas aeruginosa, qualitatively different toxicities could be demonstrated in the culture fluids, depending on the presence or absence of protease in such a fluid. The toxicity of the culture in the presence of a high titer of protease may be due primarily to the protease, whereas the toxicity exhibited in the absence of protease could be due to proteinacious exotoxin. Producers of high titers of protease tended to be less virulent in vivo than producers of low titers of the enzyme, which exert their toxicities by a separate exotoxin.

  19. Selection of suitable detergents for obtaining an active dengue protease in its natural form from E. coli.

    PubMed

    Liew, Lynette Sin Yee; Lee, Michelle Yueqi; Wong, Ying Lei; Cheng, Jinting; Li, Qingxin; Kang, CongBao

    2016-05-01

    Dengue protease is a two-component enzyme and is an important drug target against dengue virus. The protease activity and protein stability of dengue nonstructural protein 3 (NS3) require a co-factor region from a four-span membrane protein NS2B. A natural form of dengue protease containing full-length NS2B and NS3 protease domain NS2BFL-NS3pro will be useful for dengue drug discovery. In current study, detergents that can be used for protease purification were tested. Using a water soluble protease construct, 39 detergents were selected for both NS2B and NS2BFL-NS3pro purification. The results showed that 18 detergents were able to sustain the activity of the natural dengue protease and 11 detergents could be used for NS2B purification. The results obtained in this study will be useful for biochemical and biophysical studies on dengue protease.

  20. Characterization of a New S8 serine Protease from Marine Sedimentary Photobacterium sp. A5–7 and the Function of Its Protease-Associated Domain

    PubMed Central

    Li, Hui-Juan; Tang, Bai-Lu; Shao, Xuan; Liu, Bai-Xue; Zheng, Xiao-Yu; Han, Xiao-Xu; Li, Ping-Yi; Zhang, Xi-Ying; Song, Xiao-Yan; Chen, Xiu-Lan

    2016-01-01

    Bacterial extracellular proteases are important for bacterial nutrition and marine sedimentary organic nitrogen degradation. However, only a few proteases from marine sedimentary bacteria have been characterized. Some subtilases have a protease-associated (PA) domain inserted in the catalytic domain. Although structural analysis and deletion mutation suggests that the PA domain in subtilases is involved in substrate binding, direct evidence to support this function is still absent. Here, a protease, P57, secreted by Photobacterium sp. A5-7 isolated from marine sediment was characterized. P57 could hydrolyze casein, gelatin and collagen. It showed the highest activity at 40°C and pH 8.0. P57 is a new subtilase, with 63% sequence identity to the closest characterized protease. Mature P57 contains a catalytic domain and an inserted PA domain. The recombinant PA domain from P57 was shown to have collagen-binding ability, and Phe349 and Tyr432 were revealed to be key residues for collagen binding in the PA domain. This study first shows direct evidence that the PA domain of a subtilase can bind substrate, which provides a better understanding of the function of the PA domain of subtilases and bacterial extracellular proteases from marine sediment. PMID:28066343

  1. The Lon protease from the haloalkaliphilic archaeon Natrialba magadii is transcriptionally linked to a cluster of putative membrane proteases and displays DNA-binding activity.

    PubMed

    Sastre, Diego E; Paggi, Roberto A; De Castro, Rosana E

    2011-05-20

    The ATP-dependent Lon protease is universally distributed in bacteria, eukaryotic organelles and archaea. In comparison with bacterial and eukaryal Lon proteases, the biology of the archaeal Lon has been studied to a limited extent. In this study, the gene encoding the Lon protease of the alkaliphilic haloarchaeon Natrialba magadii (Nmlon) was cloned and sequenced, and the genetic organization of Nmlon was examined at the transcriptional level. Nmlon encodes a 84 kDa polypeptide with a pI of 4.42 which contains the ATPase, protease and membrane targeting domains of the archaeal-type LonB proteases. Nmlon is part of an operon that encodes membrane proteases and it is transcribed as a polycistronic mRNA in N. magadii cells at different growth stages. Accordingly, NmLon was detected in cell membranes of N. magadii throughout growth by Western blot analysis using specific anti-NmLon antibodies. Interestingly, in electrophoretic mobility shift assays, purified NmLon bound double stranded as well as single stranded DNA in the presence of elevated salt concentrations. This finding shows that DNA-binding is conserved in the LonA and LonB subfamilies and suggests that Lon-DNA interaction may be relevant for its function in haloarchaea.

  2. Clitocypin, a fungal cysteine protease inhibitor, exerts its insecticidal effect on Colorado potato beetle larvae by inhibiting their digestive cysteine proteases.

    PubMed

    Šmid, Ida; Rotter, Ana; Gruden, Kristina; Brzin, Jože; Buh Gašparič, Meti; Kos, Janko; Žel, Jana; Sabotič, Jerica

    2015-07-01

    Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a major potato pest that adapts readily to insecticides. Several types of protease inhibitors have previously been investigated as potential control agents, but with limited success. Recently, cysteine protease inhibitors from parasol mushroom, the macrocypins, were reported to inhibit growth of CPB larvae. To further investigate the insecticidal potential and mode of action of cysteine protease inhibitors of fungal origin, clitocypin, a cysteine protease inhibitor from clouded agaric (Clitocybe nebularis), was evaluated for its lethal effects on CPB larvae. Clitocypin isolated from fruiting bodies and recombinant clitocypin produced in Escherichia coli slowed growth and reduced survival of CPB larvae in a concentration dependent manner. Clitocypin was also expressed by transgenic potato, but only at low levels. Nevertheless, it reduced larval weight gain and delayed development. We have additionally shown that younger larvae are more susceptible to the action of clitocypin. The inhibition of digestive cysteine proteases, intestains, by clitocypin was shown to be the underlying mode of action. Protease inhibitors from mushrooms are confirmed as promising candidates for biopesticides.

  3. Full length and protease domain activity of chikungunya virus nsP2 differ from other alphavirus nsP2 proteases in recognition of small peptide substrates.

    PubMed

    Saisawang, Chonticha; Sillapee, Pornpan; Sinsirimongkol, Kwanhathai; Ubol, Sukathida; Smith, Duncan R; Ketterman, Albert J

    2015-04-22

    Alphavirus nsP2 proteins are multifunctional and essential for viral replication. The protease role of nsP2 is critical for virus replication as only the virus protease activity is used for processing of the viral non-structural polypeptide. Chikungunya virus is an emerging disease problem that is becoming a world-wide health issue. We have generated purified recombinant chikungunya virus nsP2 proteins, both full length and a truncated protease domain from the C-terminus of the nsP2 protein. Enzyme characterization shows that the protease domain alone has different properties compared with the full length nsP2 protease. We also show chikungunya nsP2 protease possesses different substrate specificity to the canonical alphavirus nsP2 polyprotein cleavage specificity. Moreover, the chikungunya nsP2 also appears to differ from other alphavirus nsP2 in its distinctive ability to recognize small peptide substrates.

  4. Full length and protease domain activity of chikungunya virus nsP2 differ from other alphavirus nsP2 proteases in recognition of small peptide substrates

    PubMed Central

    Saisawang, Chonticha; Sillapee, Pornpan; Sinsirimongkol, Kwanhathai; Ubol, Sukathida; Smith, Duncan R.; Ketterman, Albert J.

    2015-01-01

    Alphavirus nsP2 proteins are multifunctional and essential for viral replication. The protease role of nsP2 is critical for virus replication as only the virus protease activity is used for processing of the viral non-structural polypeptide. Chikungunya virus is an emerging disease problem that is becoming a world-wide health issue. We have generated purified recombinant chikungunya virus nsP2 proteins, both full length and a truncated protease domain from the C-terminus of the nsP2 protein. Enzyme characterization shows that the protease domain alone has different properties compared with the full length nsP2 protease. We also show chikungunya nsP2 protease possesses different substrate specificity to the canonical alphavirus nsP2 polyprotein cleavage specificity. Moreover, the chikungunya nsP2 also appears to differ from other alphavirus nsP2 in its distinctive ability to recognize small peptide substrates. PMID:26182358

  5. Cysteine proteases as therapeutic targets: does selectivity matter? A systematic review of calpain and cathepsin inhibitors

    PubMed Central

    Siklos, Marton; BenAissa, Manel; Thatcher, Gregory R.J.

    2015-01-01

    Cysteine proteases continue to provide validated targets for treatment of human diseases. In neurodegenerative disorders, multiple cysteine proteases provide targets for enzyme inhibitors, notably caspases, calpains, and cathepsins. The reactive, active-site cysteine provides specificity for many inhibitor designs over other families of proteases, such as aspartate and serine; however, a) inhibitor strategies often use covalent enzyme modification, and b) obtaining selectivity within families of cysteine proteases and their isozymes is problematic. This review provides a general update on strategies for cysteine protease inhibitor design and a focus on cathepsin B and calpain 1 as drug targets for neurodegenerative disorders; the latter focus providing an interesting query for the contemporary assumptions that irreversible, covalent protein modification and low selectivity are anathema to therapeutic safety and efficacy. PMID:26713267

  6. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms.

    PubMed

    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M

    2014-08-01

    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding.

  7. Purification and Characterization of a Thermostable Caseinolytic Serine Protease from the Latex of Euphorbia heterophylla L.

    PubMed

    Singh, Sorokhaibam J; Singh, Laishram R; Devi, Sanjenbam K; Singh, Senjam S; Devi, Chingsubam B; Rully, Huidrom

    2015-01-01

    A new thermostable caseinolytic serine protease was purified from the latex of Euphorbia heterophylla L. to electrophoretic homogeneity by a procedure involving successive steps of pretreatment of the latex, PEG fractionation, CM-cellulose chromatography and DEAE-cellulose chromatography. The purified protease was found to be a monomeric protein of molecular weight 77.2 kDa. It exhibited caseinolytic activity with hyperbolic azocasein saturation with Vmax and Km values of 0.11 units.mL(-1) and 0.55 mg.mL(-1) respectively. Specific inhibitory studies revealed the enzyme to be a serine protease. The protease was characterized by pH optimum of 8.0 and high thermostability with T1/2 of 75°C. Based on the results of peptide mass fingerprinting analysis, the protease was shown to be a new protein not characterized earlier.

  8. Characterization of two cysteine proteases secreted by Blastocystis ST7, a human intestinal parasite.

    PubMed

    Wawrzyniak, Ivan; Texier, Catherine; Poirier, Philippe; Viscogliosi, Eric; Tan, Kevin S W; Delbac, Frédéric; El Alaoui, Hicham

    2012-09-01

    Blastocystis spp. are unicellular anaerobic intestinal parasites of both humans and animals and the most prevalent ones found in human stool samples. Their association with various gastrointestinal disorders raises the questions of its pathogenicity and of the molecular mechanisms involved. Since secreted proteases are well-known to be implicated in intestinal parasite virulence, we intended to determine whether Blastocystis spp. possess such pathogenic factors. In silico analysis of the Blastocystis subtype 7 (ST7) genome sequence highlighted 22 genes coding proteases which were predicted to be secreted. We characterized the proteolytic activities in the secretory products of Blastocystis ST7 using specific protease inhibitors. Two cysteine proteases, a cathepsin B and a legumain, were identified in the parasite culture supernatant by gelatin zymographic SDS-PAGE gel and MS/MS analysis. These proteases might act on intestinal cells and disturb gut function. This work provides serious molecular candidates to link Blastocystis spp. and intestinal disorders.

  9. PlantPIs--an interactive web resource on plant protease inhibitors.

    PubMed

    Consiglio, Arianna; Grillo, Giorgio; Licciulli, Flavio; Ceci, Luigi R; Liuni, Sabino; Losito, Nicola; Volpicella, Mariateresa; Gallerani, Raffaele; De Leo, Francesca

    2011-08-01

    PlantPIs is a web querying system for a database collection of plant protease inhibitors data. Protease inhibitors in plants are naturally occurring proteins that inhibit the function of endogenous and exogenous proteases. In this paper the design and development of a web framework providing a clear and very flexible way of querying plant protease inhibitors data is reported. The web resource is based on a relational database, containing data of plants protease inhibitors publicly accessible, and a graphical user interface providing all the necessary browsing tools, including a data exporting function. PlantPIs contains information extracted principally from MEROPS database, filtered, annotated and compared with data stored in other protein and gene public databases, using both automated techniques and domain expert evaluations. The data are organized to allow a flexible and easy way to access stored information. The database is accessible at http://www.plantpis.ba.itb.cnr.it/.

  10. The protease activity of the paracaspase MALT1 is controlled by monoubiquitination.

    PubMed

    Pelzer, Christiane; Cabalzar, Katrin; Wolf, Annette; Gonzalez, Montserrat; Lenz, Georg; Thome, Margot

    2013-04-01

    The protease activity of the paracaspase MALT1 is central to lymphocyte activation and lymphomagenesis, but how this activity is controlled remains unknown. Here we identify a monoubiquitination of MALT1 on Lys644 that activated the protease function of MALT1. Monoubiquitinated MALT1 had enhanced protease activity, whereas a ubiquitination-deficient MALT1 mutant with replacement of that lysine with arginine (MALT1(K644R)) had less protease activity, which correlated with impaired induction of interleukin 2 (IL-2) via the T cell antigen receptor in activated T cells. Expression of MALT1(K644R) diminished the survival of cells derived from diffuse large B cell lymphoma of the activated B cell-like subtype (ABC DLBCL), which require constitutive protease activity of MALT1 for survival. Thus, monoubiquitination of MALT1 is essential for its catalytic activation and is therefore a potential target for the treatment of ABC-DLBCL and for immunomodulation.

  11. Efficient proteolysis and application of an alkaline protease from halophilic Bacillus sp. EMB9.

    PubMed

    Sinha, Rajeshwari; Srivastava, A K; Khare, S K

    2014-10-03

    A salt-stable alkaline protease from moderately halophilic Bacillus sp. EMB9, isolated from the western coast of India, is described. This protease was capable of efficiently removing silver from used/waste X-Ray films, as well as hydrolyzing defatted soy flour with 31% degree of hydrolysis (DH). Production of the protease was optimized by using response surface methodology. Ca(2+) and NaCl were the most critical factors in enhancing the yield. Under optimized culture conditions, a maximum of 369 U protease/mL was obtained, which is quite comparable to the yields of commercial proteases. The elevated production level coupled with ability to efficiently hydrolyze protein-laden soy flour and complete recovery of silver from used X-Ray films makes it a prospective industrial enzyme.

  12. Role of Allergen Source-Derived Proteases in Sensitization via Airway Epithelial Cells

    PubMed Central

    Matsumura, Yasuhiro

    2012-01-01

    Protease activity is a characteristic common to many allergens. Allergen source-derived proteases interact with lung epithelial cells, which are now thought to play vital roles in both innate and adaptive immune responses. Allergen source-derived proteases act on airway epithelial cells to induce disruption of the tight junctions between epithelial cells, activation of protease-activated receptor-2, and the production of thymic stromal lymphopoietin. These facilitate allergen delivery across epithelial layers and enhance allergenicity or directly activate the immune system through a nonallergic mechanism. Furthermore, they cleave regulatory cell surface molecules involved in allergic reactions. Thus, allergen source-derived proteases are a potentially critical factor in the development of allergic sensitization and appear to be strongly associated with heightened allergenicity. PMID:22523502

  13. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms

    PubMed Central

    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M.

    2014-01-01

    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding. PMID:24878526

  14. Rationally designed fluorogenic protease reporter visualizes spatiotemporal dynamics of apoptosis in vivo

    PubMed Central

    Piggott, Beverly J.; Makhijani, Kalpana; Yu, Dan; Jan, Yuh Nung; Shu, Xiaokun

    2015-01-01

    Fluorescence resonance energy transfer-based reporters have been widely used in imaging cell signaling; however, their in vivo application has been handicapped because of poor signal. Although fluorogenic reporters overcome this problem, no such reporter of proteases has been demonstrated for in vivo imaging. Now we have redesigned an infrared fluorescent protein so that its chromophore incorporation is regulated by protease activity. Upon protease activation, the infrared fluorogenic protease reporter becomes fluorescent with no requirement of exogenous cofactor. To demonstrate biological applications, we have designed an infrared fluorogenic executioner-caspase reporter, which reveals spatiotemporal coordination between cell apoptosis and embryonic morphogenesis, as well as dynamics of apoptosis during tumorigenesis in Drosophila. The designed scaffold may be used to engineer reporters of other proteases with specific cleavage sequence. PMID:25733847

  15. The chloroplast ATP-dependent Clp protease in vascular plants - new dimensions and future challenges.

    PubMed

    Clarke, Adrian K

    2012-05-01

    The ATP-dependent Clp protease is by far the most intricate protease in chloroplasts of vascular plants. Structurally, it is particularly complex with a proteolytic core complex containing 11 distinct subunits along with three potential chaperone partners. The Clp protease is also essential for chloroplast development and overall plant viability. Over the past decade, many of the important characteristics of this crucial protease have been revealed in the model plant species Arabidopsis thaliana. Despite this, challenges still remain in fully resolving certain key features, in particular, how the assembly of this multisubunit protease is regulated, the full range of native protein substrates and how they are targeted for degradation and how this complicated enzyme might have developed from simpler bacterial forms. This article focuses upon the recent advances in revealing the details underlying these important features. It also take the opportunity to speculate upon many of these findings in the hope of stimulating further investigation.

  16. A novel class of cysteine protease inhibitors: solution structure of staphostatin A from Staphylococcus aureus.

    PubMed

    Dubin, Grzegorz; Krajewski, Marcin; Popowicz, Grzegorz; Stec-Niemczyk, Justyna; Bochtler, Matthias; Potempa, Jan; Dubin, Adam; Holak, Tad A

    2003-11-25

    A series of secreted proteases are included among the virulence factors documented for Staphylococcus aureus. In light of increasing antibiotic resistance of this dangerous human pathogen, these proteases are considered as suitable targets for the development of novel therapeutic strategies. The recent discovery of staphostatins, endogenous, highly specific, staphylococcal cysteine protease inhibitors, opened a possibility for structure-based design of low molecular weight analogues. Moreover, the crystal structure of staphostatin B revealed a distinct folding pattern and an unexpected, substrate-like binding mode. The solution structure of staphostatin A reported here confirms that staphostatins constitute a novel, distinct class of cysteine protease inhibitors. In addition, the structure knowledge-based mutagenesis studies shed light on individual structural features of staphostatin A, the inhibition mechanism, and the determinants of distinct specificity of staphostatins toward their target proteases.

  17. Design of new potent HTLV-1 protease inhibitors: in silico study.

    PubMed

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-03-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1's ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing "Lipinsk's rule of five". Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment.

  18. Diversity of Cultivable Protease-Producing Bacteria in Laizhou Bay Sediments, Bohai Sea, China

    PubMed Central

    Li, Yan; Wu, Chaoya; Zhou, Mingyang; Wang, En Tao; Zhang, Zhenpeng; Liu, Wei; Ning, Jicai; Xie, Zhihong

    2017-01-01

    Protease-producing bacteria are widespread in ocean sediments and play important roles in degrading sedimentary nitrogenous organic materials. However, the diversity of the bacteria and the proteases involved in such processes remain largely unknown especially for communities in enclosed sea bays. Here, we investigated the diversity of the extracellular protease-producing bacteria and their protease types in Laizhou Bay. A total of 121 bacterial isolates were obtained from sediment samples in 7 sites and their protease types were characterized. The abundance of cultivable protease-producing bacteria was about 104 CFU g−1 of sediment. Phylogenetic analysis based on 16S rRNA gene sequences suggest that the isolates belonged to 17 genera from 4 phyla including Firmicutes, Actinobacteria, Proteobacteria and Bacteroidetes, and mainly dominated by the genera Pseudoalteromonas (40.5%), Bacillus (36.3%), and Photobacterium (5.8%). The diversity and community structure varied among different sampling sites but no significant correlation was observed with soil sediment's characteristics. Enzyme activity and inhibition tests further revealed that all isolates secreted proteases that were inhibited by serine and/or metalloprotease inhibitors, and a smaller proportion was inhibited by inhibitors of cysteine and/or aspartic proteases. Furthermore, all isolates effectively degraded casein and/or gelatin with only a few that could hydrolyze elastin, suggesting that the bacteria were producing different kinds of serine proteases or metalloproteases. This study provided novel insights on the community structure of cultivable protease-producing bacteria near the Yellow River estuary of an enclosed sea bay. PMID:28360893

  19. Design of new potent HTLV-1 protease inhibitors: in silico study

    PubMed Central

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-01-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1’s ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing “Lipinsk’s rule of five”. Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment. PMID:27844017

  20. Structural, kinetic, and thermodynamic studies of specificity designed HIV-1 protease

    SciTech Connect

    Alvizo, Oscar; Mittal, Seema; Mayo, Stephen L.; Schiffer, Celia A.

    2012-10-23

    HIV-1 protease recognizes and cleaves more than 12 different substrates leading to viral maturation. While these substrates share no conserved motif, they are specifically selected for and cleaved by protease during viral life cycle. Drug resistant mutations evolve within the protease that compromise inhibitor binding but allow the continued recognition of all these substrates. While the substrate envelope defines a general shape for substrate recognition, successfully predicting the determinants of substrate binding specificity would provide additional insights into the mechanism of altered molecular recognition in resistant proteases. We designed a variant of HIV protease with altered specificity using positive computational design methods and validated the design using X-ray crystallography and enzyme biochemistry. The engineered variant, Pr3 (A28S/D30F/G48R), was designed to preferentially bind to one out of three of HIV protease's natural substrates; RT-RH over p2-NC and CA-p2. In kinetic assays, RT-RH binding specificity for Pr3 increased threefold compared to the wild-type (WT), which was further confirmed by isothermal titration calorimetry. Crystal structures of WT protease and the designed variant in complex with RT-RH, CA-p2, and p2-NC were determined. Structural analysis of the designed complexes revealed that one of the engineered substitutions (G48R) potentially stabilized heterogeneous flap conformations, thereby facilitating alternate modes of substrate binding. Our results demonstrate that while substrate specificity could be engineered in HIV protease, the structural pliability of protease restricted the propagation of interactions as predicted. These results offer new insights into the plasticity and structural determinants of substrate binding specificity of the HIV-1 protease.

  1. A lead discovery strategy driven by a comprehensive analysis of proteases in the peptide substrate space.

    PubMed

    Sukuru, Sai Chetan K; Nigsch, Florian; Quancard, Jean; Renatus, Martin; Chopra, Rajiv; Brooijmans, Natasja; Mikhailov, Dmitri; Deng, Zhan; Cornett, Allen; Jenkins, Jeremy L; Hommel, Ulrich; Davies, John W; Glick, Meir

    2010-11-01

    We present here a comprehensive analysis of proteases in the peptide substrate space and demonstrate its applicability for lead discovery. Aligned octapeptide substrates of 498 proteases taken from the MEROPS peptidase database were used for the in silico analysis. A multiple-category naïve Bayes model, trained on the two-dimensional chemical features of the substrates, was able to classify the substrates of 365 (73%) proteases and elucidate statistically significant chemical features for each of their specific substrate positions. The positional awareness of the method allows us to identify the most similar substrate positions between proteases. Our analysis reveals that proteases from different families, based on the traditional classification (aspartic, cysteine, serine, and metallo), could have substrates that differ at the cleavage site (P1-P1') but are similar away from it. Caspase-3 (cysteine protease) and granzyme B (serine protease) are previously known examples of cross-family neighbors identified by this method. To assess whether peptide substrate similarity between unrelated proteases could reliably translate into the discovery of low molecular weight synthetic inhibitors, a lead discovery strategy was tested on two other cross-family neighbors--namely cathepsin L2 and matrix metallo proteinase 9, and calpain 1 and pepsin A. For both these pairs, a naïve Bayes classifier model trained on inhibitors of one protease could successfully enrich those of its neighbor from a different family and vice versa, indicating that this approach could be prospectively applied to lead discovery for a novel protease target with no known synthetic inhibitors.

  2. Identification of SlpB, a Cytotoxic Protease from Serratia marcescens

    PubMed Central

    Stella, Nicholas A.; Hunt, Kristin M.; Brothers, Kimberly M.; Zhang, Liang; Thibodeau, Patrick H.

    2015-01-01

    The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens. PMID:25939509

  3. Identification of SlpB, a Cytotoxic Protease from Serratia marcescens.

    PubMed

    Shanks, Robert M Q; Stella, Nicholas A; Hunt, Kristin M; Brothers, Kimberly M; Zhang, Liang; Thibodeau, Patrick H

    2015-07-01

    The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens.

  4. Purification and characterization of cloned alkaline protease gene of Geobacillus stearothermophilus.

    PubMed

    Iqbal, Irfana; Aftab, Muhammad Nauman; Afzal, Mohammed; Ur-Rehman, Asad; Aftab, Saima; Zafar, Asma; Ud-Din, Zia; Khuharo, Ateeque Rahman; Iqbal, Jawad; Ul-Haq, Ikram

    2015-02-01

    Thermostable alkaline serine protease gene of Geobacillus stearothermophilus B-1172 was cloned and expressed in Escherichia coli BL21 (DE3) using pET-22b(+), as an expression vector. The growth conditions were optimized for maximal production of the protease using variable fermentation parameters, i.e., pH, temperature, and addition of an inducer. Protease, thus produced, was purified by ammonium sulfate precipitation followed by ion exchange chromatography with 13.7-fold purification, with specific activity of 97.5 U mg(-1) , and a recovery of 23.6%. Molecular weight of the purified protease, 39 kDa, was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 90 °C at pH 9. The enzyme activity was steady in the presence of EDTA indicating that the protease was not a metalloprotease. No significant change in the activity of protease after addition of various metal ions further strengthened this fact. However, an addition of 1% Triton X-100 or SDS surfactants constrained the enzyme specific activity to 34 and 19%, respectively. Among organic solvents, an addition of 1-butanol (20%) augmented the enzyme activity by 29% of the original activity. With casein as a substrate, the enzyme activity under optimized conditions was found to be 73.8 U mg(-1) . The effect of protease expression on the host cells growth was also studied and found to negatively affect E. coli cells to certain extent. Catalytic domains of serine proteases from eight important thermostable organisms were analyzed through WebLogo and found to be conserved in all serine protease sequences suggesting that protease of G. stearothermophilus could be beneficially used as a biocontrol agent and in many industries including detergent industry.

  5. Identification of dehydration-responsive cysteine proteases during post-harvest senescence of broccoli florets.

    PubMed

    Coupe, Simon A; Sinclair, Ben K; Watson, Lyn M; Heyes, Julian A; Eason, Jocelyn R

    2003-03-01

    Harvest-induced senescence of broccoli results in tissue wilting and sepal chlorosis. As senescence progresses, chlorophyll and protein levels in floret tissues decline and endo-protease activity (measured with azo-casein) increases. Protease activity increased from 24 h after harvest for tissues held in air at 20 degrees C. Activity was lower in floret tissues from branchlets that had been held in solutions of sucrose (2% w/v) or under high carbon dioxide, low oxygen (10% CO(2), 5% O(2)) conditions. Four protease-active protein bands were identified in senescing floret tissue by zymography, and the use of chemical inhibitors of protease action suggests that some 44% of protease activity in senescing floret tissue 72 h after harvest is due to the action of cysteine and serine proteases. Four putative cysteine protease cDNAs have been isolated from broccoli floret tissue (BoCP1, BoCP2, BoCP3, BoCP4). The cDNAs are most similar (73-89% at the amino acid level) to dehydration-responsive cysteine proteases previously isolated from Arabidopsis thaliana (RD19, RD21). The mRNAs encoded by the broccoli cDNAs are expressed in floret tissue during harvest-induced senescence with mRNA accumulating within 6 h of harvest for BoCP1, 12 h of harvest for BoCP4 and within 24 h of harvest for BoCP2 and BoCP3. Induction of the cDNAs is differentially delayed when broccoli branchlets are held in solutions of water or sucrose. In addition, the expression of BoCP1 and BoCP3 is inhibited in tissue held in atmospheres of high carbon dioxide/low oxygen (10% CO(2), 5% O(2)). The putative cysteine protease mRNAs are expressed before measurable increases in endo-protease activity, loss of protein, chlorophyll or tissue chlorosis.

  6. High-throughput screening of improved protease inhibitors using a yeast cell surface display system and a yeast cell chip.

    PubMed

    Aoki, Wataru; Yoshino, Yuichi; Morisaka, Hironobu; Tsunetomo, Keiji; Koyo, Hirotaka; Kamiya, Shinji; Kawata, Noriyuki; Kuroda, Kouichi; Ueda, Mitsuyoshi

    2011-01-01

    Protease-targeted inhibitors have been promising pharmaceuticals. Here, we combined a yeast cell surface display system with a yeast cell chip for the high-throughput screening of protease inhibitors, and succeeded in improving the activity of a protease inhibitor.

  7. Expression Profile of the Schistosoma japonicum Degradome Reveals Differential Protease Expression Patterns and Potential Anti-schistosomal Intervention Targets

    PubMed Central

    Liu, Shuai; Cai, Pengfei; Piao, Xianyu; Hou, Nan; Zhou, Xiaosu; Wu, Chuang; Wang, Heng; Chen, Qijun

    2014-01-01

    Blood fluke proteases play pivotal roles in the processes of invasion, nutrition acquisition, immune evasion, and other host-parasite interactions. Hundreds of genes encoding putative proteases have been identified in the recently published schistosome genomes. However, the expression profiles of these proteases in Schistosoma species have not yet been systematically analyzed. We retrieved and culled the redundant protease sequences of Schistosoma japonicum, Schistosoma mansoni, Echinococcus multilocularis, and Clonorchis sinensis from public databases utilizing bioinformatic approaches. The degradomes of the four parasitic organisms and Homo sapiens were then comparatively analyzed. A total of 262 S. japonicum protease sequences were obtained and the expression profiles generated using whole-genome microarray. Four main clusters of protease genes with different expression patterns were identified: proteases up-regulated in hepatic schistosomula and adult worms, egg-specific or predominantly expressed proteases, cercaria-specific or predominantly expressed proteases, and constantly expressed proteases. A subset of protease genes with different expression patterns were further validated using real-time quantitative PCR. The present study represents the most comprehensive analysis of a degradome in Schistosoma species to date. These results provide a firm foundation for future research on the specific function(s) of individual proteases and may help to refine anti-proteolytic strategies in blood flukes. PMID:25275570

  8. Subtilases: the superfamily of subtilisin-like serine proteases.

    PubMed Central

    Siezen, R. J.; Leunissen, J. A.

    1997-01-01

    Subtilases are members of the clan (or superfamily) of subtilisin-like serine proteases. Over 200 subtilases are presently known, more than 170 of which with their complete amino acid sequence. In this update of our previous overview (Siezen RJ, de Vos WM, Leunissen JAM, Dijkstra BW, 1991, Protein Eng 4:719-731), details of more than 100 new subtilases discovered in the past five years are summarized, and amino acid sequences of their catalytic domains are compared in a multiple sequence alignment. Based on sequence homology, a subdivision into six families is proposed. Highly conserved residues of the catalytic domain are identified, as are large or unusual deletions and insertions. Predictions have been updated for Ca(2+)-binding sites, disulfide bonds, and substrate specificity, based on both sequence alignment and three-dimensional homology modeling. PMID:9070434

  9. Mapping protease substrates by using a biotinylated phage substrate library.

    PubMed

    Scholle, Michael D; Kriplani, Ushma; Pabon, Amanda; Sishtla, Kamakshi; Glucksman, Marc J; Kay, Brian K

    2006-05-01

    We describe a bacteriophage M13 substrate library encoding the AviTag (BirA substrate) and combinatorial heptamer peptides displayed at the N terminus of the mature form of capsid protein III. Phages are biotinylated efficiently (> or = 50%) when grown in E. coli cells coexpressing BirA, and such viral particles can be immobilized on a streptavidin-coated support and released by protease cleavage within the combinatorial peptide. We have used this library to map the specificity of human Factor Xa and a neuropeptidase, neurolysin (EC3.4.24.16). Validation by analysis of isolated peptide substrates has revealed that neurolysin recognizes the motif hydrophobic-X-Pro-Arg-hydrophobic, where Arg-hydrophobic is the scissile bond.

  10. Autoantibodies directed against the protease inhibitor calpastatin in psoriasis

    PubMed Central

    Matsushita, Y; Shimada, Y; Kawara, S; Takehara, K; Sato, S

    2005-01-01

    Psoriasis is believed to be a T cell-mediated autoimmune disease, but also exhibits autoantibody production. Calpastatin is an endogenous inhibitor of calpain, a ubiquitous protease that regulates inflammatory processes. Anti-calpastatin autoantibody was first identified as an autoantibody specific to rheumatoid arthritis, but has been also detected in other autoimmune diseases. In this study, we examined the presence and levels of anti-calpastatin antibody in 77 psoriasis patients by enzyme-linked immunosorbent assay. Compared with normal controls, psoriasis patients exhibited significantly elevated IgG anti-calpastatin antibody levels that were similar to those found in rheumatoid arthritis patients. Remarkably, IgG anti-calpastatin autoantibody in sera from psoriasis patients inhibited calpastatin activity. Calpain II expression was up-regulated in psoriasis skin lesions compared with normal skin while calpastatin expression was normal. The results of this study reveal the presence of anti-calpastatin autoantibody in psoriasis. PMID:15654835

  11. Cardiovascular considerations in patients treated with HIV protease inhibitors.

    PubMed

    Colagreco, Joseph P

    2004-01-01

    Highly active antiretroviral therapy (HAART) has dramatically reduced mortality from HIV infection, transforming it in many cases to a chronic condition. However, protease inhibitors (PIs), which are integral components of most HAART regimens, are commonly associated with a host of metabolic disturbances that may increase the risk of cardiovascular disease in patients with HIV infection, potentially counteracting some of the positive health effects of PIs. Dyslipidemia is of particular concern. The Adult AIDS Clinical Trials Group has established preliminary guidelines to evaluate and treat PI-associated dyslipidemia. A number of strategies exist for the management of PI-based dyslipidemia in HAART recipients; their advantages and disadvantages should be considered when treating patients with HIV infection.

  12. Efficient expression systems for cysteine proteases of malaria parasites

    PubMed Central

    Sarduy, Emir Salas; de los A. Chávez Planes, María

    2013-01-01

    Papain-like cysteine proteases of malaria parasites are considered important chemotherapeutic targets or valuable models for the evaluation of drug candidates. Consequently, many of these enzymes have been cloned and expressed in Escherichia coli for their biochemical characterization. However, their expression has been problematic, showing low yield and leading to the formation of insoluble aggregates. Given that highly-productive expression systems are required for the high-throughput evaluation of inhibitors, we analyzed the existing expression systems to identify the causes of such apparent issues. We found that significant divergences in codon and nucleotide composition from host genes are the most probable cause of expression failure, and propose several strategies to overcome these limitations. Finally we predict that yeast hosts Saccharomyces cerevisiae and Pichia pastoris may be better suited than E. coli for the efficient expression of plasmodial genes, presumably leading to soluble and active products reproducing structural and functional characteristics of the natural enzymes. PMID:23018863

  13. Macrophages and cathepsin proteases blunt chemotherapeutic response in breast cancer

    PubMed Central

    Shree, Tanaya; Olson, Oakley C.; Elie, Benelita T.; Kester, Jemila C.; Garfall, Alfred L.; Simpson, Kenishana; Bell-McGuinn, Katherine M.; Zabor, Emily C.; Brogi, Edi; Joyce, Johanna A.

    2011-01-01

    The microenvironment is known to critically modulate tumor progression, yet its role in regulating treatment response is poorly understood. Here we found increased macrophage infiltration and cathepsin protease levels in mammary tumors following paclitaxel (Taxol) chemotherapy. Cathepsin-expressing macrophages protected against Taxol-induced tumor cell death in coculture, an effect fully reversed by cathepsin inhibition and mediated partially by cathepsins B and S. Macrophages were also found to protect against tumor cell death induced by additional chemotherapeutics, specifically etoposide and doxorubicin. Combining Taxol with cathepsin inhibition in vivo significantly enhanced efficacy against primary and metastatic tumors, supporting the therapeutic relevance of this effect. Additionally incorporating continuous low-dose cyclophosphamide dramatically impaired tumor growth and metastasis and improved survival. This study highlights the importance of integrated targeting of the tumor and its microenvironment and implicates macrophages and cathepsins in blunting chemotherapeutic response. PMID:22156207

  14. Mapping protease substrates using a biotinylated phage substrate library.

    SciTech Connect

    Scholle, M. D.; Kriplani, U.; Pabon, A.; Sishtla, K.; Glucksman, M. J.; Kay, B. K.; Biosciences Division; Chicago Medical School

    2005-05-05

    We describe a bacteriophage M13 substrate library encoding the AviTag (BirA substrate) and combinatorial heptamer peptides displayed at the N terminus of the mature form of capsid protein III. Phages are biotinylated efficiently (> or = 50%) when grown in E. coli cells coexpressing BirA, and such viral particles can be immobilized on a streptavidin-coated support and released by protease cleavage within the combinatorial peptide. We have used this library to map the specificity of human Factor Xa and a neuropeptidase, neurolysin (EC3.4.24.16). Validation by analysis of isolated peptide substrates has revealed that neurolysin recognizes the motif hydrophobic-X-Pro-Arg-hydrophobic, where Arg-hydrophobic is the scissile bond.

  15. Calcium and SOL Protease Mediate Temperature Resetting of Circadian Clocks.

    PubMed

    Tataroglu, Ozgur; Zhao, Xiaohu; Busza, Ania; Ling, Jinli; O'Neill, John S; Emery, Patrick

    2015-11-19

    Circadian clocks integrate light and temperature input to remain synchronized with the day/night cycle. Although light input to the clock is well studied, the molecular mechanisms by which circadian clocks respond to temperature remain poorly understood. We found that temperature phase shifts Drosophila circadian clocks through degradation of the pacemaker protein TIM. This degradation is mechanistically distinct from photic CRY-dependent TIM degradation. Thermal TIM degradation is triggered by cytosolic calcium increase and CALMODULIN binding to TIM and is mediated by the atypical calpain protease SOL. This thermal input pathway and CRY-dependent light input thus converge on TIM, providing a molecular mechanism for the integration of circadian light and temperature inputs. Mammals use body temperature cycles to keep peripheral clocks synchronized with their brain pacemaker. Interestingly, downregulating the mammalian SOL homolog SOLH blocks thermal mPER2 degradation and phase shifts. Thus, we propose that circadian thermosensation in insects and mammals share common principles.

  16. [Chromatographic separation of activated proteases from human plasma].

    PubMed

    Lehmann, B; Taucher, M; Kühne, H; Scheuch, D W

    1988-01-01

    After separation of aceton and dextran sulfate activated human plasma by column chromatography on DEAE-cellulose three esterolytically and amidolytically active fractions, respectively, were obtained, which were assigned to the following species: plasma kallikrein (PK), PK.alpha-macroglobulin.HMW-Kininogen. Their percentage in the whole activity is variable. The proportion of free PK is low (0.11). For characterization of the products we studied inhibition by different polyvalent inhibitors. The Michaelis constant (Km) with p-toluene-sulfonyl-L-arginine methyl ester (TAME) were determined. For simulation of in vivo conditions dextran sulfate activated plasma was inactivated at 37 degrees C. The residual activity and the spontaneous activity in plasma from patients with shock are produced by different active protease inhibitor complexes.

  17. Production and stability of protease from Candida buinensis.

    PubMed

    de Araújo Viana, Daniela; de Albuquerque Lima, Carolina; Neves, Rejane Pereira; Mota, Cristina Souza; Moreira, Keila Aparecida; de Lima-Filho, José Luiz; Cavalcanti, Maria Taciana Holanda; Converti, Attilio; Porto, Ana Lúcia Figueiredo

    2010-10-01

    Cow raw milk from dairy cooperatives was examined for its microbial composition. Among the isolates identified, 17.6% were yeasts. The most frequent genus was Candida, although members belonging to the genera Brettanomyces, Dekkera, and Geotricum were also identified. Although qualitative and quantitative tests for extracellular proteolytic activity were positive for all the species isolated, Candida buinensis showed the highest response (23.5 U/mg); therefore, it was selected for subsequent investigation. The results of fermentations carried out at variable temperature, pH, and soybean flour concentration, according to a 2(3) full factorial design, demonstrated that this yeast ensured the highest production of extracellular proteases (573 U/mL) when cultivated at 35 degrees C, pH 6.5, and using soybean flour concentrations in the range 0.1-0.5% (w/v). The cell-free supernatants showed the highest activity at 25 degrees C and pH 7.0, and satisfactory stability in the ranges 25-30 degrees C and pH 7-9. The first-order rate constants of protease inactivation in the cell-free supernatants were calculated at different temperatures from semi-log plots of the residual activity versus time and then used in Arrhenius and Eyring plots to estimate the main thermodynamic parameters of thermoinactivation (E* = 40.0 kJ/mol; DeltaH* = 37.3 kJ/mol; DeltaS* = -197.5 J/mol K; DeltaG* = 101 kJ/mol).

  18. Bcl-2 inhibits the mitochondrial release of an apoptogenic protease

    PubMed Central

    1996-01-01

    Bcl-2 belongs to a family of apoptosis-regulatory proteins which incorporate into the outer mitochondrial as well as nuclear membranes. The mechanism by which the proto-oncogene product Bcl-2 inhibits apoptosis is thus far elusive. We and others have shown previously that the first biochemical alteration detectable in cells undergoing apoptosis, well before nuclear changes become manifest, is a collapse of the mitochondrial inner membrane potential (delta psi m), suggesting the involvement of mitochondrial products in the apoptotic cascade. Here we show that mitochondria contain a pre-formed approximately 50-kD protein which is released upon delta psi m disruption and which, in a cell-free in vitro system, causes isolated nuclei to undergo apoptotic changes such as chromatin condensation and internucleosomal DNA fragmentation. This apoptosis-inducing factor (AIF) is blocked by N- benzyloxycarbonyl-Val-Ala-Asp.fluoromethylketone (Z-VAD.fmk), an antagonist of interleukin-1 beta-converting enzyme (ICE)-like proteases that is also an efficient inhibitor of apoptosis in cells. We have tested the effect of Bcl-2 on the formation, release, and action of AIF. When preventing mitochondrial permeability transition (which accounts for the pre-apoptotic delta psi m disruption in cells), Bcl-2 hyperexpressed in the outer mitochondrial membrane also impedes the release of AIF from isolated mitochondria in vitro. In contrast, Bcl-2 does not affect the formation of AIF, which is contained in comparable quantities in control mitochondria and in mitochondria from Bcl-2- hyperexpressing cells. Furthermore, the presence of Bcl-2 in the nuclear membrane does not interfere with the action of AIF on the nucleus, nor does Bcl-2 hyperexpression protect cells against AIF. It thus appears that Bcl-2 prevents apoptosis by favoring the retention of an apoptogenic protease in mitochondria. PMID:8879205

  19. Protease-activated receptors and prostaglandins in inflammatory lung disease

    PubMed Central

    Peters, Terence; Henry, Peter J

    2009-01-01

    Protease-activated receptors (PARs) are a novel family of G protein-coupled receptors. Signalling through PARs typically involves the cleavage of an extracellular region of the receptor by endogenous or exogenous proteases, which reveals a tethered ligand sequence capable of auto-activating the receptor. A considerable body of evidence has emerged over the past 20 years supporting a prominent role for PARs in a variety of human physiological and pathophysiological processes, and thus substantial attention has been directed towards developing drug-like molecules that activate or block PARs via non-proteolytic pathways. PARs are widely expressed within the respiratory tract, and their activation appears to exert significant modulatory influences on the level of bronchomotor tone, as well as on the inflammatory processes associated with a range of respiratory tract disorders. Nevertheless, there is debate as to whether the principal response to PAR activation is an augmentation or attenuation of airways inflammation. In this context, an important action of PAR activators may be to promote the generation and release of prostanoids, such as prostglandin E2, which have well-established anti-inflammatory effects in the lung. In this review, we primarily focus on the relationship between PARs, prostaglandins and inflammatory processes in the lung, and highlight their potential role in selected respiratory tract disorders, including pulmonary fibrosis, asthma and chronic obstructive pulmonary disease. This article is part of a themed issue on Mediators and Receptors in the Resolution of Inflammation. To view this issue visit http://www3.interscience.wiley.com/journal/121548564/issueyear?year=2009 PMID:19845685

  20. Highly adaptable and sensitive protease assay based on fluorescence resonance energy transfer.

    PubMed

    Zauner, Thomas; Berger-Hoffmann, Renate; Müller, Katrin; Hoffmann, Ralf; Zuchner, Thole

    2011-10-01

    Proteases are widely used in analytical sciences and play a central role in several widespread diseases. Thus, there is an immense need for highly adaptable and sensitive assays for the detection and monitoring of various proteolytic enzymes. We established a simple protease fluorescence resonance energy transfer (pro-FRET) assay for the determination of protease activities, which could in principle be adapted for the detection of all proteases. As proof of principle, we demonstrated the potential of our method using trypsin and enteropeptidase in complex biological mixtures. Briefly, the assay is based on the cleavage of a FRET peptide substrate, which results in a dramatic increase of the donor fluorescence. The assay was highly sensitive and fast for both proteases. The detection limits for trypsin and enteropeptidase in Escherichia coli lysate were 100 and 10 amol, respectively. The improved sensitivity for enteropeptidase was due to the application of an enzyme cascade, which leads to signal amplification. The pro-FRET assay is highly specific as even high concentrations of other proteases did not result in significant background signals. In conclusion, this sensitive and simple assay can be performed in complex biological mixtures and can be easily adapted to act as a versatile tool for the sensitive detection of proteases.

  1. Extracellular serine proteases from Stenotrophomonas maltophilia: Screening, isolation and heterologous expression in E. coli.

    PubMed

    Ribitsch, D; Heumann, S; Karl, W; Gerlach, J; Leber, R; Birner-Gruenberger, R; Gruber, K; Eiteljoerg, I; Remler, P; Siegert, P; Lange, J; Maurer, K H; Berg, G; Guebitz, G M; Schwab, H

    2012-01-01

    A large strain collection comprising antagonistic bacteria was screened for novel detergent proteases. Several strains displayed protease activity on agar plates containing skim milk but were inactive in liquid media. Encapsulation of cells in alginate beads induced protease production. Stenotrophomonas maltophilia emerged as best performer under washing conditions. For identification of wash-active proteases, four extracellular serine proteases called StmPr1, StmPr2, StmPr3 and StmPr4 were cloned. StmPr2 and StmPr4 were sufficiently overexpressed in E. coli. Expression of StmPr1 and StmPr3 resulted in unprocessed, insoluble protein. Truncation of most of the C-terminal domain which has been identified by enzyme modeling succeeded in expression of soluble, active StmPr1 but failed in case of StmPr3. From laundry application tests StmPr2 turned out to be a highly wash-active protease at 45°C. Specific activity of StmPr2 determined with suc-L-Ala-L-Ala-L-Pro-l-Phe-p-nitroanilide as the substrate was 17±2U/mg. In addition we determined the kinetic parameters and cleavage preferences of protease StmPr2.

  2. Restricting detergent protease action to surface of protein fibres by chemical modification.

    PubMed

    Schroeder, M; Lenting, H B M; Kandelbauer, A; Silva, C J S M; Cavaco-Paulo, A; Gübitz, G M

    2006-10-01

    Due to their excellent properties, such as thermostability, activity over a broad range of pH and efficient stain removal, proteases from Bacillus sp. are commonly used in the textile industry including industrial processes and laundry and represent one of the most important groups of enzymes. However, due to the action of proteases, severe damage on natural protein fibres such as silk and wool result after washing with detergents containing proteases. To include the benefits of proteases in a wool fibre friendly detergent formulation, the soluble polymer polyethylene glycol (PEG) was covalently attached to a protease from Bacillus licheniformis. In contrast to activation of PEG with cyanuric chloride (50%) activation with 1,1'-carbonyldiimidazole (CDI) lead to activity recovery above 90%. With these modified enzymes, hydrolytic attack on wool fibres could be successfully prevented up to 95% compared to the native enzymes. Colour difference (DeltaE) measured in the three dimensional colour space showed good stain removal properties for the modified enzymes. Furthermore, half-life of the modified enzymes in buffers and commercial detergents solutions was nearly twice as high as those of the non-modified enzymes with values of up to 63 min. Out of the different modified proteases especially the B. licheniformis protease with the 2.0-kDa polymer attached both retained stain removal properties and did not hydrolyse/damage wool fibres.

  3. Purification and characterization of an immunoglobulin A1 protease from Bacteroides melaninogenicus.

    PubMed Central

    Mortensen, S B; Kilian, M

    1984-01-01

    Attention has recently been focused on bacterial proteases with the capacity to cleave immunoglobulin A (IgA proteases) as possible pathogenic factors in bacterial meningitis, gonorrhoea, and destructive periodontal disease. Here, we describe a method for the rapid purification of a specific IgA1 protease from Bacteroides melaninogenicus. The IgA1 protease was purified 6,172-fold with a yield of 9% by ammonium sulfate precipitation, DEAE-ion exchange chromatography, and separation on a preparative TSK-G 3000SWG high-pressure gel permeation chromatography column. The enzyme was specific for human IgA1 and cleaved a prolyl-seryl peptide bond in the hinge region of the alpha 1 chain between residues 223 and 224. The molecular weight of the enzyme was 62,000, the isoelectric point was 5.0, and the Km was 3.4 X 10(-6). The enzyme was active over a broad pH range and had maximal activity at pH 5.0. B. melaninogenicus IgA1 protease was classified as a thiol protease on the basis of its inhibition by traditional protease inhibitors and the fact that it was active only under reducing conditions. Images PMID:6147309

  4. Engineering of TEV protease variants by yeast ER sequestration screening (YESS) of combinatorial libraries

    PubMed Central

    Yi, Li; Gebhard, Mark C.; Li, Qing; Taft, Joseph M.; Georgiou, George; Iverson, Brent L.

    2013-01-01

    Myriad new applications of proteases would be enabled by an ability to fine-tune substrate specificity and activity. Herein we present a general strategy for engineering protease selectivity and activity by capitalizing on sequestration of the protease to be engineered within the yeast endoplasmic reticulum (ER). A substrate fusion protein composed of yeast adhesion receptor subunit Aga2, selection and counterselection substrate sequences, multiple intervening epitope tag sequences, and a C-terminal ER retention sequence is coexpressed with a protease library. Cleavage of the substrate fusion protein by the protease eliminates the ER retention sequence, facilitating transport to the yeast surface. Yeast cells that display Aga2 fusions in which only the selection substrate is cleaved are isolated by multicolor FACS with fluorescently labeled antiepitope tag antibodies. Using this system, the Tobacco Etch Virus protease (TEV-P), which strongly prefers Gln at P1 of its canonical ENLYFQ↓S substrate, was engineered to recognize selectively Glu or His at P1. Kinetic analysis indicated an overall 5,000-fold and 1,100-fold change in selectivity, respectively, for the Glu- and His-specific TEV variants, both of which retained high catalytic turnover. Human granzyme K and the hepatitis C virus protease were also shown to be amenable to this unique approach. Further, by adjusting the signaling strategy to identify phosphorylated as opposed to cleaved sequences, this unique system was shown to be compatible with the human Abelson tyrosine kinase. PMID:23589865

  5. Single Cell Analysis of Leukocyte Protease Activity Using Integrated Continuous-Flow Microfluidics.

    PubMed

    Jing, Tengyang; Lai, Zhangxing; Wu, Lidan; Han, Jongyoon; Lim, Chwee Teck; Chen, Chia-Hung

    2016-12-06

    Leukocytes are the essential cells of the immune system that protect the human body against bacteria, viruses, and other foreign invaders. Secretory products of individual leukocytes, such as matrix metalloproteinases (MMPs) and a disintegrin and metalloproteinase (ADAMs), are critical for regulating the inflammatory response and mediating host defense. Conventional single cell analytical methods, such as flow cytometry for cellular surface biomarker studies, are insufficient for performing functional assays of the protease activity of individual leukocytes. Here, an integrated continuous-flow microfluidic assay is developed to effectively detect secretory protease activity of individual viable leukocytes. Leukocytes in blood are first washed on-chip with defined buffer to remove background activity, followed by encapsulating individual leukocytes with protease sensors in water-in-oil droplets and incubating for 1 h to measure protease secretion. With this design, single leukocyte protease profiles under naive and phorbol 12-myristate 13-acetate (PMA)-stimulated conditions are reliably measured. It is found that PMA treatment not only elevates the average protease activity level but also reduces the cellular heterogeneity in protease secretion, which is important in understanding immune capability and the disease condition of individual patients.

  6. Identification of novel tumor suppressor proteases by degradome profiling of colorectal carcinomas

    PubMed Central

    Fraile, Julia M.; Ordóñez, Gonzalo R.; Quirós, Pedro M.; Astudillo, Aurora; Galván, José A.; Colomer, Dolors; López-Otín, Carlos; Freije, José M.P.; Puente, Xose S.

    2013-01-01

    Proteolytic enzymes play important roles during tumor development and progression through their ability to promote cell growth or by facilitating the invasion of surrounding tissues. The human genome contains more than 570 protease-coding genes, many of them forming functional networks, which has forced the use of global strategies for the analysis of this group of enzymes. In this study, we have designed a new quantitative PCR-based device for profiling the entire degradome in human malignancies. We have used this method to evaluate protease expression levels in colorectal carcinomas with the finding that most proteases with altered expression in these tumors exert their function in the extracellular compartment. In addition, we have found that among genes encoding repressed proteases there was a higher proportion with somatic mutations in colorectal cancer when compared to genes coding for upregulated proteases (14% vs. 4%, p<0.05). One of these genes, MASP3, is consistently repressed in colorectal carcinomas as well as in colorectal cancer cell lines when compared to normal colonic mucosa. Functional analysis of this gene revealed that ectopic expression of MASP3 reduces cell proliferation in vitro and restrains subcutaneous tumor growth, whereas its downregulation induces an increase in the tumorigenic potential of colorectal cancer cells. These results provide new insights into the diversity of proteases associated with cancer and support the utility of degradome profiling to identify novel proteases with tumor-defying functions.

  7. Protease activation of the entomocidal protoxin of Bacillus thuringiensis subsp. kurstaki.

    PubMed

    Andrews, R E; Bibilos, M M; Bulla, L A

    1985-10-01

    Two isolates of Bacillus thuringiensis subsp. kurstaki were examined which produced different levels of intracellular proteases. Although the crystals from both strains had comparable toxicity, one of the strains, LB1, had a strong polypeptide band at 68,000 molecular weight in the protein from the crystal; in the other, HD251, no such band was evident. When the intracellular proteases in both strains were measured, strain HD251 produced less than 10% of the proteolytic activity found in LB1. These proteases were primarily neutral metalloproteases, although low levels of other proteases were detected. In LB1, the synthesis of protease increased as the cells began to sporulate; however, in HD251, protease activity appeared much later in the sporulation cycle. The protease activity in strain LB1 was very high when the cells were making crystal toxin, whereas in HD251 reduced proteolytic activity was present during crystal toxin synthesis. The insecticidal toxin (molecular weight, 68,000) from both strains could be prepared by cleaving the protoxin (molecular weight, 135,000) with trypsin, followed by ion-exchange chromatography. The procedure described gave quantitative recovery of toxic activity, and approximately half of the total protein was recovered. Calculations show that these results correspond to stoichiometric conversion of protoxin to insecticidal toxin. The toxicities of whole crystals, soluble crystal protein, and purified toxin from both strains were comparable.

  8. KLIKK proteases of Tannerella forsythia: putative virulence factors with a unique domain structure.

    PubMed

    Ksiazek, Miroslaw; Mizgalska, Danuta; Eick, Sigrum; Thøgersen, Ida B; Enghild, Jan J; Potempa, Jan

    2015-01-01

    Comparative genomics of virulent Tannerella forsythia ATCC 43037 and a close health-associated relative, Tannerella BU063, revealed, in the latter, the absence of an entire array of genes encoding putative secretory proteases that possess a nearly identical C-terminal domain (CTD) that ends with a -Lys-Leu-Ile-Lys-Lys motif. This observation suggests that these proteins, referred to as KLIKK proteases, may function as virulence factors. Re-sequencing of the loci of the KLIKK proteases found only six genes grouped in two clusters. All six genes were expressed by T. forsythia in routine culture conditions, although at different levels. More importantly, a transcript of each gene was detected in gingival crevicular fluid (GCF) from periodontitis sites infected with T. forsythia indicating that the proteases are expressed in vivo. In each protein, a protease domain was flanked by a unique N-terminal profragment and a C-terminal extension ending with the CTD. Partially purified recombinant proteases showed variable levels of proteolytic activity in zymography gels and toward protein substrates, including collagen, gelatin, elastin, and casein. Taken together, these results indicate that the pathogenic strain of T. forsythia secretes active proteases capable of degrading an array of host proteins, which likely represents an important pathogenic feature of this bacterium.

  9. Protease production by Staphylococcus epidermidis and its effect on Staphylococcus aureus biofilms.

    PubMed

    Vandecandelaere, Ilse; Depuydt, Pieter; Nelis, Hans J; Coenye, Tom

    2014-04-01

    Due to the resistance of Staphylococcus aureus to several antibiotics, treatment of S. aureus infections is often difficult. As an alternative to conventional antibiotics, the field of bacterial interference is investigated. Staphylococcus epidermidis produces a serine protease (Esp) which inhibits S. aureus biofilm formation and which degrades S. aureus biofilms. In this study, we investigated the protease production of 114 S. epidermidis isolates, obtained from biofilms on endotracheal tubes (ET). Most of the S. epidermidis isolates secreted a mixture of serine, cysteine and metalloproteases. We found a link between high protease production by S. epidermidis and the absence of S. aureus in ET biofilms obtained from the same patient. Treating S. aureus biofilms with the supernatant (SN) of the most active protease producing S. epidermidis isolates resulted in a significant biomass decrease compared to untreated controls, while the number of metabolically active cells was not affected. The effect on the biofilm biomass was mainly due to serine proteases. Staphylococcus aureus biofilms treated with the SN of protease producing S. epidermidis were thinner with almost no extracellular matrix. An increased survival of Caenorhabditis elegans, infected with S. aureus Mu50, was observed when the SN of protease positive S. epidermidis was added.

  10. Inactivation of chemotactic activity of C5a by the serratial 56-kilodalton protease.

    PubMed Central

    Oda, T; Kojima, Y; Akaike, T; Ijiri, S; Molla, A; Maeda, H

    1990-01-01

    The effects of the 56-kilodalton protease (56K protease) from Serratia marcescens on complement-derived chemotactic activity were examined. Fresh human serum was incubated with zymosan to produce C5a. This activated serum was then incubated with various concentrations of 56K protease, and the chemotactic activity of mouse peritoneal exudate polymorphonuclear leukocytes (PMN) and macrophages was evaluated. A significant dose-dependent decrease of chemotactic activity was observed after protease treatment. Furthermore, treatment of human recombinant C5a with 56K protease at a dose of 1.0 microgram/ml resulted in a complete loss of chemotactic activity. When the living bacteria of the virulent strain, which produced about 10 times more protease than did the less virulent strain, were injected intraperitoneally into mice, the magnitude of infiltration of polymorphonuclear leukocytes into the peritoneal cavity was much lower than that caused by the less virulent strain. Because complement-dependent chemotactic activity is an initial response to bacterial infection, these results suggest indirect pathogenic functions of serratial proteases that suppress chemotactic activity. PMID:1691142

  11. Cysteine protease inhibitor (AcStefin) is required for complete cyst formation of Acanthamoeba.

    PubMed

    Lee, Jung-Yub; Song, Su-Min; Moon, Eun-Kyung; Lee, Yu-Ran; Jha, Bijay Kumar; Danne, Dinzouna-Boutamba Sylvatrie; Cha, Hee-Jae; Yu, Hak Sun; Kong, Hyun-Hee; Chung, Dong-Il; Hong, Yeonchul

    2013-04-01

    The encystation of Acanthamoeba leads to the formation of resilient cysts from vegetative trophozoites. This process is essential for parasite survival under unfavorable conditions, such as those associated with starvation, low temperatures, and biocides. Furthermore, cysteine proteases have been implicated in the massive turnover of intracellular components required for encystation. Thus, strict modulation of the activities of cysteine proteases is required to protect Acanthamoeba from intracellular damage. However, mechanisms underlying the control of protease activity during encystation have not been established in Acanthamoeba. In the present study, we identified and characterized Acanthamoeba cysteine protease inhibitor (AcStefin), which was found to be highly expressed during encystation and to be associated with lysosomes by fluorescence microscopy. Recombinant AcStefin inhibited various cysteine proteases, including human cathepsin B, human cathepsin L, and papain. Transfection with small interfering RNA against AcStefin increased cysteine protease activity during encystation and resulted in incomplete cyst formation, reduced excystation efficiency, and a significant reduction in cytoplasmic area. Taken together, these results indicate that AcStefin is involved in the modulation of cysteine proteases and that it plays an essential role during the encystation of Acanthamoeba.

  12. Molecular characterization of alkaline protease of Bacillus amyloliquefaciens SP1 involved in biocontrol of Fusarium oxysporum.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K

    2016-09-02

    An alkaline protease gene was amplified from genomic DNA of Bacillus amyloliquefaciens SP1 which was involved in effective biocontrol of Fusarium oxysporum. We investigated the antagonistic capacity of protease of B. amyloliquifaciens SP1, under in vitro conditions. The 5.62 fold purified enzyme with specific activity of 607.69U/mg reported 24.14% growth inhibition of F. oxysporum. However, no antagonistic activity was found after addition of protease inhibitor i.e. PMSF (15mM) to purified enzyme. An 1149bp nucleotide sequence of protease gene encoded 382 amino acids of 43kDa and calculated isoelectric point of 9.29. Analysis of deduced amino acid sequence revealed high homology (86%) with subtilisin E of Bacillus subtilis. The B. amyloliquefaciens SP1 protease gene was expressed in Escherichiax coli BL21. The expressed protease was secreted into culture medium by E. coli and exhibited optimum activity at pH8.0 and 60°C. The most reliable three dimensional structure of alkaline protease was determined using Phyre 2 server which was validated on the basis of Ramachandran plot and ERRAT value. The expression and structure prediction of the enzyme offers potential value for commercial application in agriculture and industry.

  13. Cysteine Protease Inhibitor (AcStefin) Is Required for Complete Cyst Formation of Acanthamoeba

    PubMed Central

    Lee, Jung-Yub; Song, Su-Min; Moon, Eun-Kyung; Lee, Yu-Ran; Jha, Bijay Kumar; Danne, Dinzouna-Boutamba Sylvatrie; Cha, Hee-Jae; Yu, Hak Sun; Kong, Hyun-Hee; Chung, Dong-Il

    2013-01-01

    The encystation of Acanthamoeba leads to the formation of resilient cysts from vegetative trophozoites. This process is essential for parasite survival under unfavorable conditions, such as those associated with starvation, low temperatures, and biocides. Furthermore, cysteine proteases have been implicated in the massive turnover of intracellular components required for encystation. Thus, strict modulation of the activities of cysteine proteases is required to protect Acanthamoeba from intracellular damage. However, mechanisms underlying the control of protease activity during encystation have not been established in Acanthamoeba. In the present study, we identified and characterized Acanthamoeba cysteine protease inhibitor (AcStefin), which was found to be highly expressed during encystation and to be associated with lysosomes by fluorescence microscopy. Recombinant AcStefin inhibited various cysteine proteases, including human cathepsin B, human cathepsin L, and papain. Transfection with small interfering RNA against AcStefin increased cysteine protease activity during encystation and resulted in incomplete cyst formation, reduced excystation efficiency, and a significant reduction in cytoplasmic area. Taken together, these results indicate that AcStefin is involved in the modulation of cysteine proteases and that it plays an essential role during the encystation of Acanthamoeba. PMID:23397569

  14. Antimicrobial proteins and peptides in human lung diseases: A friend and foe partnership with host proteases.

    PubMed

    Lecaille, Fabien; Lalmanach, Gilles; Andrault, Pierre-Marie

    2016-03-01

    Lung antimicrobial proteins and peptides (AMPs) are major sentinels of innate immunity by preventing microbial colonization and infection. Nevertheless bactericidal activity of AMPs against Gram-positive and Gram-negative bacteria is compromised in patients with chronic obstructive pulmonary disease (COPD), cystic fibrosis (CF) and asthma. Evidence is accumulating that expression of harmful human serine proteases, matrix metalloproteases and cysteine cathepsins is markedely increased in these chronic lung diseases. The local imbalance between proteases and protease inhibitors compromises lung tissue integrity and function, by not only degrading extracellular matrix components, but also non-matrix proteins. Despite the fact that AMPs are somewhat resistant to proteolytic degradation, some human proteases cleave them efficiently and impair their antimicrobial potency. By contrast, certain AMPs may be effective as antiproteases. Host proteases participate in concert with bacterial proteases in the degradation of key innate immunity peptides/proteins and thus may play immunomodulatory activities during chronic lung diseases. In this context, the present review highlights the current knowledge and recent discoveries on the ability of host enzymes to interact with AMPs, providing a better understanding of the role of human proteases in innate host defense.

  15. Unconventional serine proteases: Variations on the catalytic Ser/His/Asp triad configuration

    PubMed Central

    Ekici, Özlem Doğan; Paetzel, Mark; Dalbey, Ross E.

    2008-01-01

    Serine proteases comprise nearly one-third of all known proteases identified to date and play crucial roles in a wide variety of cellular as well as extracellular functions, including the process of blood clotting, protein digestion, cell signaling, inflammation, and protein processing. Their hallmark is that they contain the so-called “classical” catalytic Ser/His/Asp triad. Although the classical serine proteases are the most widespread in nature, there exist a variety of “nonclassical” serine proteases where variations to the catalytic triad are observed. Such variations include the triads Ser/His/Glu, Ser/His/His, and Ser/Glu/Asp, and include the dyads Ser/Lys and Ser/His. Other variations are seen with certain serine and threonine peptidases of the Ntn hydrolase superfamily that carry out catalysis with a single active site residue. This work discusses the structure and function of these novel serine proteases and threonine proteases and how their catalytic machinery differs from the prototypic serine protease class. PMID:18824507

  16. Expanding proteome coverage with orthogonal-specificity α-Lytic proteases

    SciTech Connect

    Meyer, Jesse G.; Kim, Sangtae; Maltby, David A.; Ghassemian, Majid; Bandeira, Nuno; Komives, Elizabeth A.

    2014-03-01

    Bottom-up proteomics studies traditionally involve proteome digestion with a single protease, trypsin. However, trypsin alone does not generate peptides that encompass the entire proteome. Alternative proteases have been explored, but most have specificity for charged amino acid side chains. Therefore, additional proteases that improve proteome coverage by cleavage at sequences complimentary to trypsin may increase proteome coverage. We demonstrate the novel application of two proteases for bottom-up proteomics: wild type alpha-lytic protease (WaLP), and an active site mutant of WaLP, M190A alpha-lytic protease (MaLP). We assess several relevant factors including MS/MS fragmentation, peptide length, peptide yield, and protease specificity. By combining data from separate digestions with trypsin, LysC, WaLP, and MaLP, proteome coverage was increased 101% compared to trypsin digestion alone. To demonstrate how the gained sequence coverage can access additional PTM information, we show identification of a number of novel phosphorylation sites in the S. pombe proteome and include an illustrative example from the protein MPD2, wherein two novel sites are identified, one in a tryptic peptide too short to identify and the other in a sequence devoid of tryptic sites. The specificity of WaLP and MaLP for aliphatic amino acid side chains was particularly valuable for coverage of membrane protein sequences, which increased 350% when the data from trypsin, LysC, WaLP, and MaLP were combined.

  17. Structure of the catalytic domain of the hepatitis C virus NS2-3 protease

    SciTech Connect

    Lorenz,I.; Marcotrigiano, J.; Dentzer, T.; Rice, C.

    2006-01-01

    Hepatitis C virus is a major global health problem affecting an estimated 170 million people worldwide. Chronic infection is common and can lead to cirrhosis and liver cancer. There is no vaccine available and current therapies have met with limited success. The viral RNA genome encodes a polyprotein that includes two proteases essential for virus replication. The NS2-3 protease mediates a single cleavage at the NS2/NS3 junction, whereas the NS3-4A protease cleaves at four downstream sites in the polyprotein. NS3-4A is characterized as a serine protease with a chymotrypsin-like fold, but the enzymatic mechanism of the NS2-3 protease remains unresolved. Here we report the crystal structure of the catalytic domain of the NS2-3 protease at 2.3 Angstroms resolution. The structure reveals a dimeric cysteine protease with two composite active sites. For each active site, the catalytic histidine and glutamate residues are contributed by one monomer, and the nucleophilic cysteine by the other. The carboxy-terminal residues remain coordinated in the two active sites, predicting an inactive post-cleavage form. Proteolysis through formation of a composite active site occurs in the context of the viral polyprotein expressed in mammalian cells. These features offer unexpected insights into polyprotein processing by hepatitis C virus and new opportunities for antiviral drug design.

  18. Optimization of protease extraction from horse mango (Mangifera foetida Lour) kernels by a response surface methodology.

    PubMed

    Ahmad, Mohammad Norazmi; Liew, Siew Ling; Yarmo, Mohd Ambar; Said, Mamot

    2012-01-01

    Protease is one of the most important industrial enzymes with a multitude of applications in both food and non-food sectors. Although most commercial proteases are microbial proteases, the potential of non-conventional protease sources, especially plants, should not be overlooked. In this study, horse mango (Mangifera foetida Lour) fruit, known to produce latex with a blistering effect upon contact with human skin, was chosen as a source of protease, and the effect of the extraction process on its protease activity evaluated. The crude enzyme was extracted from the kernels and extraction was optimized by a response surface methodology (RSM) using a central composite rotatable design (CCRD). The variables studied were pH (x(1)), CaCl(2) (x(2)), Triton X-100 (x(3)), and 1,4-dithryeitol (x(4)). The results obtained indicate that the quadratic model is significant for all the variables tested. Based on the RSM model generated, optimal extraction conditions were obtained at pH 6.0, 8.16 mM CaCl(2), 5.0% Triton X-100, and 10.0 mM DTT, and the estimated response was 95.5% (w/w). Verification test results showed that the difference between the calculated and the experimental protease activity value was only 2%. Based on the t-value, the effects of the variables arranged in ascending order of strength were CaCl(2) < pH < DTT < Triton X-100.

  19. A protease substrate profiling method that links site-specific proteolysis with antibiotic resistance.

    PubMed

    Sandersjöö, Lisa; Kostallas, George; Löfblom, John; Samuelson, Patrik

    2014-01-01

    Proteases are involved in many biological processes and have become important tools in biomedical research and industry. Technologies for engineering and characterization of, for example, proteolytic activity and specificity are essential in protease research. Here, we present a novel method for assessment of site-specific proteolysis. The assay utilizes plasmid-encoded reporters that, upon processing by a co-expressed protease, confer antibiotic resistance to bacteria in proportion to the cleavage efficiency. We have demonstrated that cells co-expressing cleavable reporters together with tobacco etch virus protease (TEVp) could be discriminated from cells with non-cleavable reporters by growth in selective media. Importantly, the resistance to antibiotics proved to correlate with the substrate processing efficiency. Thus, by applying competitive growth of a mock library in antibiotic-containing medium, we could show that the substrate preferred by TEVp was enriched relative to less-efficient substrates. We believe that this simple methodology will facilitate protease substrate identification, and hold great promise for directed evolution of proteases and protease recognition sequences towards improved or even new functionality.

  20. Modulation of the epithelial sodium channel (ENaC) by bacterial metalloproteases and protease inhibitors.

    PubMed

    Butterworth, Michael B; Zhang, Liang; Liu, Xiaoning; Shanks, Robert M; Thibodeau, Patrick H

    2014-01-01

    The serralysin family of metalloproteases is associated with the virulence of multiple gram-negative human pathogens, including Pseudomonas aeruginosa and Serratia marcescens. The serralysin proteases share highly conserved catalytic domains and show evolutionary similarity to the mammalian matrix metalloproteases. Our previous studies demonstrated that alkaline protease (AP) from Pseudomonas aeruginosa is capable of activating the epithelial sodium channel (ENaC), leading to an increase in sodium absorption in airway epithelia. The serralysin proteases are often co-expressed with endogenous, intracellular or periplasmic inhibitors, which putatively protect the bacterium from unwanted or unregulated protease activities. To evaluate the potential use of these small protein inhibitors in regulating the serralysin induced activation of ENaC, proteases from Pseudomonas aeruginosa and Serratia marcescens were purified for characterization along with a high affinity inhibitor from Pseudomonas. Both proteases showed activity against in vitro substrates and could be blocked by near stoichiometric concentrations of the inhibitor. In addition, both proteases were capable of activating ENaC when added to the apical surfaces of multiple epithelial cells with similar slow activation kinetics. The high-affinity periplasmic inhibitor from Pseudomonas effectively blocked this activation. These data suggest that multiple metalloproteases are capable of activating ENaC. Further, the endogenous, periplasmic bacterial inhibitors may be useful for modulating the downstream effects of the serralysin virulence factors under physiological conditions.

  1. Engineering of TEV protease variants by yeast ER sequestration screening (YESS) of combinatorial libraries.

    PubMed

    Yi, Li; Gebhard, Mark C; Li, Qing; Taft, Joseph M; Georgiou, George; Iverson, Brent L

    2013-04-30

    Myriad new applications of proteases would be enabled by an ability to fine-tune substrate specificity and activity. Herein we present a general strategy for engineering protease selectivity and activity by capitalizing on sequestration of the protease to be engineered within the yeast endoplasmic reticulum (ER). A substrate fusion protein composed of yeast adhesion receptor subunit Aga2, selection and counterselection substrate sequences, multiple intervening epitope tag sequences, and a C-terminal ER retention sequence is coexpressed with a protease library. Cleavage of the substrate fusion protein by the protease eliminates the ER retention sequence, facilitating transport to the yeast surface. Yeast cells that display Aga2 fusions in which only the selection substrate is cleaved are isolated by multicolor FACS with fluorescently labeled antiepitope tag antibodies. Using this system, the Tobacco Etch Virus protease (TEV-P), which strongly prefers Gln at P1 of its canonical ENLYFQ↓S substrate, was engineered to recognize selectively Glu or His at P1. Kinetic analysis indicated an overall 5,000-fold and 1,100-fold change in selectivity, respectively, for the Glu- and His-specific TEV variants, both of which retained high catalytic turnover. Human granzyme K and the hepatitis C virus protease were also shown to be amenable to this unique approach. Further, by adjusting the signaling strategy to identify phosphorylated as opposed to cleaved sequences, this unique system was shown to be compatible with the human Abelson tyrosine kinase.

  2. Enzymatic dehairing of goat skins using alkaline protease from Bacillus sp. SB12.

    PubMed

    Briki, Selmen; Hamdi, Olfa; Landoulsi, Ahmed

    2016-05-01

    The present paper reports the production, purification and biochemical characterization of an extracellular alkaline protease from Bacillus sp. SB12. The enzyme has been used as an alternative to conventional chemicals treatment for dehairing of goat skins. The protease was optimally active at 37 °C and pH 9. Starch at 2% (w/v) was used as the best carbon source and the addition of yeast extract and peptone at 1% each supported the maximum level of protease production in the presence of 5 mM Ca(2+). Protease purification was performed with ammonium sulphate precipitation at 70% saturated fraction followed by dialysis and gel filtration chromatography using Sephadex G-100. The purified enzyme was homogeneous on non-denaturing PAGE and appeared as a single band with an apparent molecular weight of 41 kDa. This enzyme was moderately thermostable and has a wide pH stability range extending from pH 7 to 11. It showed high tolerance toward surfactants agents and organic solvents while it was completely inhibited by PMSF indicating the serine protease type. Purified protease was used to remove hair from goat skin proving its potential application in leather processing industry. The results revealed that the protease has enhanced the quality and physico-chemical properties of the skins while reducing the pollution.

  3. Statistical optimization of alkaline protease production from Penicillium citrinum YL-1 under solid-state fermentation.

    PubMed

    Xiao, Yun-Zhu; Wu, Duan-Kai; Zhao, Si-Yang; Lin, Wei-Min; Gao, Xiang-Yang

    2015-01-01

    Proteases from halotolerant and halophilic microorganisms were found in traditional Chinese fish sauce. In this study, 30 fungi were isolated from fermented fish sauce in five growth media based on their morphology. However, only one strain, YL-1, which was identified as Penicillium citrinum by internal transcribed spacer (ITS) sequence analysis, can produce alkaline protease. This study is the first to report that a protease-producing fungus strain was isolated and identified in traditional Chinese fish sauce. Furthermore, the culture conditions of alkaline protease production by P. citrinum YL-1 in solid-state fermentation were optimized by response surface methodology. First, three variables including peptone, initial pH, and moisture content were selected by Plackett-Burman design as the significant variables for alkaline protease production. The Box-Behnken design was then adopted to further investigate the interaction effects between the three variables on alkaline protease production and determine the optimal values of the variables. The maximal production (94.30 U/mL) of alkaline protease by P. citrinum YL-1 took place under the optimal conditions of peptone, initial pH, and moisture content (v/w) of 35.5 g/L, 7.73, and 136%, respectively.

  4. Purification and characterization of manganese-dependent alkaline serine protease from Bacillus pumilus TMS55.

    PubMed

    Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Karutha Pandian, Shunmugiah

    2011-01-01

    The purification and characterization of a Mn2+-dependent alkaline serine protease produced by Bacillus pumilus TMS55 were investigated. The enzyme was purified in three steps: concentrating the crude enzyme using ammonium sulfate precipitation, followed by gel filtration and cation-exchange chromatography. The purified protease had a molecular mass of approximately 35 kDa, was highly active over a broad pH range of 7.0 to 12.0, and remained stable over a pH range of 7.5 to 11.5. The optimum temperature for the enzyme activity was found to be 60 degreesC. PMSF and AEBSF (1 mM) significantly inhibited the protease activity, indicating that the protease is a serine protease. Mn2+ ions enhanced the activity and stability of the enzyme. In addition, the purified protease remained stable with oxidants (H2O2, 2%) and organic solvents (25%), such as benzene, hexane, and toluene. Therefore, these characteristics of the protease and its dehairing ability indicate its potential for a wide range of commercial applications.

  5. KLIKK proteases of Tannerella forsythia: putative virulence factors with a unique domain structure

    PubMed Central

    Ksiazek, Miroslaw; Mizgalska, Danuta; Eick, Sigrum; Thøgersen, Ida B.; Enghild, Jan J.; Potempa, Jan

    2015-01-01

    Comparative genomics of virulent Tannerella forsythia ATCC 43037 and a close health-associated relative, Tannerella BU063, revealed, in the latter, the absence of an entire array of genes encoding putative secretory proteases that possess a nearly identical C-terminal domain (CTD) that ends with a -Lys-Leu-Ile-Lys-Lys motif. This observation suggests that these proteins, referred to as KLIKK proteases, may function as virulence factors. Re-sequencing of the loci of the KLIKK proteases found only six genes grouped in two clusters. All six genes were expressed by T. forsythia in routine culture conditions, although at different levels. More importantly, a transcript of each gene was detected in gingival crevicular fluid (GCF) from periodontitis sites infected with T. forsythia indicating that the proteases are expressed in vivo. In each protein, a protease domain was flanked by a unique N-terminal profragment and a C-terminal extension ending with the CTD. Partially purified recombinant proteases showed variable levels of proteolytic activity in zymography gels and toward protein substrates, including collagen, gelatin, elastin, and casein. Taken together, these results indicate that the pathogenic strain of T. forsythia secretes active proteases capable of degrading an array of host proteins, which likely represents an important pathogenic feature of this bacterium. PMID:25954253

  6. Analyzing Protease Specificity and Detecting in Vivo Proteolytic Events Using Tandem Mass Spectrometry

    SciTech Connect

    Gupta, Nitin; Hixson, Kim K.; Culley, David E.; Smith, Richard D.; Pevzner, Pavel A.

    2010-07-01

    While trypsin remains the most commonly used protease in mass spectrometry, other proteases may be employed for increasing peptide-coverage or generating overlapping peptides. Knowledge of the accurate specifcity rules of these proteases is helpful for database search tools to detect peptides, and becomes crucial when mass spectrometry is used to discover in vivo proteolytic cleavages. In this study, we use tandem mass spectrometry to analyze the specifcity rules of selected proteases and describe MS- Proteolysis, a software tool for identifying putative sites of in vivo proteolytic cleavage. Our analysis suggests that the specifcity rules for some commonly used proteases can be improved, e.g., we find that V8 protease cuts not only after Asp and Glu, as currently expected, but also shows a smaller propensity to cleave after Gly for the conditions tested in this study. Finally, we show that comparative analysis of multiple proteases can be used to detect putative in vivo proteolytic sites on a proteome-wide scale.

  7. Conformer and pharmacophore based identification of peptidomimetic inhibitors of chikungunya virus nsP2 protease.

    PubMed

    Dhindwal, Sonali; Kesari, Pooja; Singh, Harvijay; Kumar, Pravindra; Tomar, Shailly

    2016-12-02

    Chikungunya virus nsP2 replication protein is a cysteine protease, which cleaves the nonstructural nsP1234 polyprotein into functional replication components. The cleavage and processing of nsP1234 by nsP2 protease is essential for the replication and proliferation of the virus. Thus, ChikV nsP2 protease is a promising target for antiviral drug discovery. In this study, the crystal structure of the C-terminal domain of ChikV nsP2 protease (PDB ID: 4ZTB) was used for structure based identification and rational designing of peptidomimetic inhibitors against nsP2 protease. The interactions of the junction residues of nsP3/4 polyprotein in the active site of nsP2 protease have been mimicked to identify and design potential inhibitory molecules. Molecular docking of the nsP3/4 junction peptide in the active site of ChikV nsP2 protease provided the structural insight of the probable binding mode of nsP3/4 peptide and pigeonholed the molecular interactions critical for the substrate binding. Further, the shape and pharmacophoric properties of the viral nsP3/4 substrate peptide were taken into consideration and the mimetic molecules were identified and designed. The designed mimetic compounds were then analyzed by docking and their binding affinity was assessed by molecular dynamics simulations.

  8. Molecular Modeling and Docking Study to Elucidate Novel Chikungunya Virus nsP2 Protease Inhibitors.

    PubMed

    Agarwal, T; Asthana, Somya; Bissoyi, A

    2015-01-01

    Chikungunya is one of the tropical viral infections that severely affect the Asian and African countries. Absence of any suitable drugs or vaccines against Chikungunya virus till date makes it essential to identify and develop novel leads for the same. Recently, nsP2 cysteine protease has been classified as a crucial drug target to combat infections caused by Alphaviruses including Chikungunya virus due to its involvement viral replication. Here in, we investigated the structural aspects of the nsP2 protease through homology modeling based on nsP2 protease from Venezuelan equine encephalitis virus. Further, the ligands were virtually screened based on various pharmacological, ADME/Tox filters and subjected to docking with the modeled Chikungunya nsP2 protease using AutoDock4.2. The interaction profiling of ligand with the protein was carried out using LigPlot(+). The results demonstrated that the ligand with PubChem Id (CID_5808891) possessed highest binding affinity towards Chikungunya nsP2 protease with a good interaction profile with the active site residues. We hereby propose that these compounds could inhibit the nsP2 protease by binding to its active site. Moreover, they may provide structural scaffold for the design of novel leads with better efficacy and specificity for the nsP2 protease.

  9. Resistance mechanism of human immunodeficiency virus type-1 protease to inhibitors: A molecular dynamic approach

    PubMed Central

    Dayer, Mohammad Reza; Dayer, Mohammad Saaid

    2014-01-01

    Human immunodeficiency virus type 1 (HIV-1) protease inhibitors comprise an important class of drugs used in HIV treatments. However, mutations of protease genes accelerated by low fidelity of reverse transcriptase yield drug resistant mutants of reduced affinities for the inhibitors. This problem is considered to be a serious barrier against HIV treatment for the foreseeable future. In this study, molecular dynamic simulation method was used to examine the combinational and additive effects of all known mutations involved in drug resistance against FDA approved inhibitors. Results showed that drug resistant mutations are not randomly distributed along the protease sequence; instead, they are localized on flexible or hot points of the protein chain. Substitution of more hydrophobic residues in flexible points of protease chains tends to increase the folding, lower the flexibility and decrease the active site area of the protease. The reduced affinities of HIV-1 protease for inhibitors seemed to be due to substantial decrease in the size of the active site and flap mobility. A correlation was found between the binding energy of inhibitors and their affinities for each mutant suggesting the distortion of the active site geometry in drug resistance by preventing effective fitting of inhibitors into the enzymes' active site. To overcome the problem of drug resistance of HIV-1 protease, designing inhibitors of variable functional groups and configurations is proposed. PMID:27843989

  10. Molecular Modeling and Docking Study to Elucidate Novel Chikungunya Virus nsP2 Protease Inhibitors

    PubMed Central

    Agarwal, T.; Asthana, Somya; Bissoyi, A.

    2015-01-01

    Chikungunya is one of the tropical viral infections that severely affect the Asian and African countries. Absence of any suitable drugs or vaccines against Chikungunya virus till date makes it essential to identify and develop novel leads for the same. Recently, nsP2 cysteine protease has been classified as a crucial drug target to combat infections caused by Alphaviruses including Chikungunya virus due to its involvement viral replication. Here in, we investigated the structural aspects of the nsP2 protease through homology modeling based on nsP2 protease from Venezuelan equine encephalitis virus. Further, the ligands were virtually screened based on various pharmacological, ADME/Tox filters and subjected to docking with the modeled Chikungunya nsP2 protease using AutoDock4.2. The interaction profiling of ligand with the protein was carried out using LigPlot+. The results demonstrated that the ligand with PubChem Id (CID_5808891) possessed highest binding affinity towards Chikungunya nsP2 protease with a good interaction profile with the active site residues. We hereby propose that these compounds could inhibit the nsP2 protease by binding to its active site. Moreover, they may provide structural scaffold for the design of novel leads with better efficacy and specificity for the nsP2 protease. PMID:26664062

  11. Phage-protease-peptide: a novel trifecta enabling multiplex detection of viable bacterial pathogens.

    PubMed

    Alcaine, S D; Tilton, L; Serrano, M A C; Wang, M; Vachet, R W; Nugen, S R

    2015-10-01

    Bacteriophages represent rapid, readily targeted, and easily produced molecular probes for the detection of bacterial pathogens. Molecular biology techniques have allowed researchers to make significant advances in the bioengineering of bacteriophage to further improve speed and sensitivity of detection. Despite their host specificity, bacteriophages have not been meaningfully leveraged in multiplex detection of bacterial pathogens. We propose a proof-of-principal phage-based scheme to enable multiplex detection. Our scheme involves bioengineering bacteriophage to carry a gene for a specific protease, which is expressed during infection of the target cell. Upon lysis, the protease is released to cleave a reporter peptide, and the signal detected. Here we demonstrate the successful (i) modification of T7 bacteriophage to carry tobacco etch virus (TEV) protease; (ii) expression of TEV protease by Escherichia coli following infection by our modified T7, an average of 2000 units of protease per phage are produced during infection; and (iii) proof-of-principle detection of E. coli in 3 h after a primary enrichment via TEV protease activity using a fluorescent peptide and using a designed target peptide for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis (MALDI-TOF MS) analysis. This proof-of-principle can be translated to other phage-protease-peptide combinations to enable multiplex bacterial detection and readily adopted on multiple platforms, like MALDI-TOF MS or fluorescent readers, commonly found in labs.

  12. Identification of novel tumor suppressor proteases by degradome profiling of colorectal carcinomas.

    PubMed

    Fraile, Julia M; Ordóñez, Gonzalo R; Quirós, Pedro M; Astudillo, Aurora; Galván, José A; Colomer, Dolors; López-Otín, Carlos; Freije, José M P; Puente, Xose S

    2013-11-01

    Proteolytic enzymes play important roles during tumor development and progression through their ability to promote cell growth or by facilitating the invasion of surrounding tissues. The human genome contains more than 570 protease-coding genes, many of them forming functional networks, which has forced the use of global strategies for the analysis of this group of enzymes. In this study, we have designed a new quantitative PCR-based device for profiling the entire degradome in human malignancies. We have used this method to evaluate protease expression levels in colorectal carcinomas with the finding that most proteases with altered expression in these tumors exert their function in the extracellular compartment. In addition, we have found that among genes encoding repressed proteases there was a higher proportion with somatic mutations in colorectal cancer when compared to genes coding for upregulated proteases (14% vs. 4%, p<0.05). One of these genes, MASP3, is consistently repressed in colorectal carcinomas as well as in colorectal cancer cell lines when compared to normal colonic mucosa. Functional analysis of this gene revealed that ectopic expression of MASP3 reduces cell proliferation in vitro and restrains subcutaneous tumor growth, whereas its downregulation induces an increase in the tumorigenic potential of colorectal cancer cells. These results provide new insights into the diversity of proteases associated with cancer and support the utility of degradome profiling to identify novel proteases with tumor-defying functions.

  13. Evolutionary optimization of peptide substrates for proteases that exhibit rapid hydrolysis kinetics.

    PubMed

    Boulware, Kevin T; Jabaiah, Abeer; Daugherty, Patrick S

    2010-06-15

    Protease cleavage site recognition motifs can be identified using protease substrate discovery methodologies, but typically exhibit non-optimal specificity and activity. To enable evolutionary optimization of substrate cleavage kinetics, a two-color cellular library of peptide substrates (CLiPS) methodology was developed. Two-color CLiPS was applied to identify peptide substrates for the tobacco etch virus (TEV) protease from a random pentapeptide library, which were then optimized by screening of a focused, extended substrate library. Quantitative library screening yielded seven amino acid substrates exhibiting rapid hydrolysis by TEV protease and high sequence similarity to the native seven-amino-acid substrate, with a strong consensus of EXLYPhiQG. Comparison of hydrolysis rates for a family of closely related substrates indicates that the native seven-residue TEV substrate co-evolved with TEV protease to facilitate highly efficient hydrolysis. Consensus motifs revealed by screening enabled database identification of a family of related, putative viral protease substrates. More generally, our results suggest that substrate evolution using CLiPS may be useful for optimizing substrate selectivity and activity to enable the design of more effective protease activity probes, molecular imaging agents, and prodrugs.

  14. Role of Proteases in Extra-Oral Digestion of a Predatory Bug, Andrallus spinidens

    PubMed Central

    Zibaee, Arash; Hoda, Hassan; Mahmoud, Fazeli-Dinan

    2012-01-01

    Roles of salivary proteases in the extra-oral digestion of the predatory bug, Andrallus spinidens Fabricius (Hemiptera: Pentatomidae) were studied by using 2% azocasein as a general substrate and specific protease substrates, as well as synthetic and endogenous inhibitors. It was found that salivary glands of A. spinidens have two anterior, two lateral, and two posterior lobes. Azocasein was used to measure the activity of general proteases in the salivary glands using different buffer solutions. The enzyme had the highest activity at pH 8. General protease activity was highest at 40 °C and was stable for 6–16 hours. The use of specific substrates showed that trypsin-like, chymotrypsin-like, aminopeptidase, and carboxypeptidase are the active proteases present in salivary glands, by the maximum activity of trypsin-like protease in addition to their optimal pH between 8–9. Ca2+ and Mg2+ increased proteolytic activity about 216%, while other ions decreased it. Specific inhibitors including SBTI, PMSF, TLCK, and TPCK significantly decreased enzyme activity, as well as the specific inhibitors of methalloproteases including phenanthroline, EGTA, and TTHA. Extracted endogenous trypsin inhibitors extracted from potential prey, Chilo suppressalis, Naranga aenescens, Pieris brassicae, Hyphantria cunea, and Ephestia kuhniella, had different effects on trypsin-like protease activity of A. spinidens salivary glands. With the exception of C. suppressalis, the endogenous inhibitors significantly decreased enzyme activity in A. spinidens. PMID:22954419

  15. Purification, primary structures and evolution of coagulant proteases from Deinagkistrodon actus venom.

    PubMed

    Nikandrov, Nikolai N; Deshimaru, Masanobu; Tani, Ayako; Chijiwa, Takahito; Shibata, Hiroki; Chang, Chang-Chun; Fukumaki, Yasuyuki; Ito, Tatsumi; Ohno, Motonori

    2005-12-15

    Deinagkistrodon (formerly Agkistrodon) actus (Taiwan) snake venom was found to contain at least seven closely related coagulant proteases. One of them, named actibin, was purified to homogeneity by means of four chromatographic steps. Actibin acted on fibrinogen to form fibrin clots with extremely high specific activity of 1,630 NIH units/mg and preferentially released fibrinopeptide A. Actibin was an acidic glycoprotein (pI 3.4) with molecular weight of 41,000, which was reduced to 28,800 after deglycosylation with N-glycanase. The k(cat)/K(m) values of actibin for hydrolysis of tosyl-l-arginine methyl ester and benzoyl-l-arginine p-nitroanilide were one-third to a half those for thrombin, reflecting a high potency of actibin in fibrinogen clotting. The amidase activities of actibin and its family proteases were inhibited by 3,4-dichloroisocoumarin, a serine protease inhibitor, indicating that actibin and its family proteases are serine proteases. Four cDNAs, named DaP1 and DaP7-DaP9, encoding D. actus coagulant proteases were cloned. All cDNAs contain an open reading frame of 780 bp coding for 260 amino acid residues, including a signal peptide of 24 amino acid residues. Their amino acid sequences predicted are highly homologous to one another with one to five amino acid substitutions. When four D. actus protease cDNAs were compared with the cDNAs coding for Trimeresurus flavoviridis and T. gramineus venom serine proteases, accelerated evolution was clearly observed. Similarity of the nucleotide sequences of four D. actus protease cDNAs with no synonymous and one to five nonsynonymous substitutions seems not to be in direct conformity with accelerated evolution. This possibly suggests that they have evolved to a similar direction to enhance their clotting activity rather than to produce other physiological activities.

  16. PROSPER: An Integrated Feature-Based Tool for Predicting Protease Substrate Cleavage Sites

    PubMed Central

    Perry, Andrew J.; Akutsu, Tatsuya; Webb, Geoffrey I.; Whisstock, James C.; Pike, Robert N.

    2012-01-01

    The ability to catalytically cleave protein substrates after synthesis is fundamental for all forms of life. Accordingly, site-specific proteolysis is one of the most important post-translational modifications. The key to understanding the physiological role of a protease is to identify its natural substrate(s). Knowledge of the substrate specificity of a protease can dramatically improve our ability to predict its target protein substrates, but this information must be utilized in an effective manner in order to efficiently identify protein substrates by in silico approaches. To address this problem, we present PROSPER, an integrated feature-based server for in silico identification of protease substrates and their cleavage sites for twenty-four different proteases. PROSPER utilizes established specificity information for these proteases (derived from the MEROPS database) with a machine learning approach to predict protease cleavage sites by using different, but complementary sequence and structure characteristics. Features used by PROSPER include local amino acid sequence profile, predicted secondary structure, solvent accessibility and predicted native disorder. Thus, for proteases with known amino acid specificity, PROSPER provides a convenient, pre-prepared tool for use in identifying protein substrates for the enzymes. Systematic prediction analysis for the twenty-four proteases thus far included in the database revealed that the features we have included in the tool strongly improve performance in terms of cleavage site prediction, as evidenced by their contribution to performance improvement in terms of identifying known cleavage sites in substrates for these enzymes. In comparison with two state-of-the-art prediction tools, PoPS and SitePrediction, PROSPER achieves greater accuracy and coverage. To our knowledge, PROSPER is the first comprehensive server capable of predicting cleavage sites of multiple proteases within a single substrate sequence using

  17. Approaches for Analyzing the Roles of Mast Cells and Their Proteases In Vivo

    PubMed Central

    Galli, Stephen J.; Tsai, Mindy; Marichal, Thomas; Tchougounova, Elena; Reber, Laurent L.; Pejler, Gunnar

    2016-01-01

    The roles of mast cells in health and disease remain incompletely understood. While the evidence that mast cells are critical effector cells in IgE-dependent anaphylaxis and other acute IgE-mediated allergic reactions seems unassailable, studies employing various mice deficient in mast cells or mast cell-associated proteases have yielded divergent conclusions about the roles of mast cells or their proteases in certain other immunological responses. Such “controversial” results call into question the relative utility of various older versus newer approaches to ascertain the roles of mast cells and mast cell proteases in vivo. This review discusses how both older and more recent mouse models have been used to investigate the functions of mast cells and their proteases in health and disease. We particularly focus on settings in which divergent conclusions about the importance of mast cells and their proteases have been supported by studies that employed different models of mast cell or mast cell protease deficiency. We think that two major conclusions can be drawn from such findings: (1) no matter which models of mast cell or mast cell protease deficiency one employs, the conclusions drawn from the experiments always should take into account the potential limitations of the models (particularly abnormalities affecting cell types other than mast cells) and (2) even when analyzing a biological response using a single model of mast cell or mast cell protease deficiency, details of experimental design are critical in efforts to define those conditions under which important contributions of mast cells or their proteases can be identified. PMID:25727288

  18. Protease-inhibitor interaction predictions: Lessons on the complexity of protein-protein interactions.

    PubMed

    Fortelny, Nikolaus; Butler, Georgina S; Overall, Christopher Mark; Pavlidis, Paul

    2017-04-06

    Protein interactions shape proteome function and thus biology. Identification of protein interactions is a major goal in molecular biology, but biochemical methods, although improving, remain limited in coverage and accuracy. Whereas computational predictions can guide biochemical experiments, low validation rates of predictions remain a major limitation. Here, we investigated computational methods in the prediction of a specific type of interaction, the inhibitory interactions between proteases and their inhibitors. Proteases generate thousands of proteoforms that dynamically shape the functional state of proteomes. Despite the important regulatory role of proteases, knowledge of their inhibitors remains largely incomplete with the vast majority of proteases lacking an annotated inhibitor. To link inhibitors to their target proteases on a large scale, we applied computational methods to predict inhibitory interactions between proteases and their inhibitors based on complementary data including coexpression, phylogenetic similarity, structural information, co-annotation, and colocalization, and also surveyed general protein interaction networks for potential inhibitory interactions. In testing nine predicted interactions biochemically, we validated the inhibition of kallikrein 5 by serpin B12. Despite the use of a wide array of complementary data, we found a high false positive rate of computational predictions in biochemical follow-up. Based on a protease-specific definition of true negatives derived from the biochemical classification of proteases and inhibitors, we analyzed prediction accuracy of individual features. Thereby we identified feature-specific limitations, which also affected general protein interaction prediction methods. Interestingly, proteases were often not coexpressed with most of their functional inhibitors, contrary to what is commonly assumed and extrapolated predominantly from cell culture experiments. Predictions of inhibitory interactions

  19. Development of novel robust nanobiocatalyst for detergents formulations and the other applications of alkaline protease.

    PubMed

    Ibrahim, Abdelnasser S S; El-Toni, Ahmed M; Al-Salamah, Ali A; Almaary, Khalid S; El-Tayeb, Mohamed A; Elbadawi, Yahya B; Antranikian, Garabed

    2016-05-01

    Alkaline protease from alkaliphilic Bacillus sp. NPST-AK15 was immobilized onto functionalized and non-functionalized rattle-type magnetic core@mesoporous shell silica (RT-MCMSS) nanoparticles by physical adsorption and covalent attachment. However, the covalent attachment approach was superior for NPST-AK15 protease immobilization onto the activated RT-MCMSS-NH₂nanoparticles and was used for further studies. In comparison to free protease, the immobilized enzyme exhibited a shift in the optimal temperature and pH from 60 to 65 °C and pH 10.5-11.0, respectively. While free protease was completely inactivated after treatment for 1 h at 60 °C, the immobilized enzyme maintained 66.5% of its initial activity at similar conditions. The immobilized protease showed higher k cat and K m , than the soluble enzyme by about 1.3-, and 1.2-fold, respectively. In addition, the results revealed significant improvement of NPST-AK15 protease stability in variety of organic solvents, surfactants, and commercial laundry detergents, upon immobilization onto activated RT-MCMSS-NH₂nanoparticles. Importantly, the immobilized protease maintained significant catalytic efficiency for ten consecutive reaction cycles, and was separated easily from the reaction mixture using an external magnetic field. To the best of our knowledge this is the first report about protease immobilization onto rattle-type magnetic core@mesoporous shell silica nanoparticles that also defied activity-stability tradeoff. The results clearly suggest that the developed immobilized enzyme system is a promising nanobiocatalyst for various bioprocess applications requiring a protease.

  20. A potential Kazal-type serine protease inhibitor involves in kinetics of protease inhibition and bacteriostatic activity.

    PubMed

    Kumaresan, Venkatesh; Harikrishnan, Ramaswamy; Arockiaraj, Jesu

    2015-02-01

    Kazal-type serine protease inhibitor (KSPI) is a pancreatic secretary trypsin inhibitor which involves in various cellular component regulations including development and defense process. In this study, we have characterized a KSPI cDNA sequence of freshwater striped murrel fish Channa striatus (Cs) at molecular level. Cellular location analysis predicted that the CsKSPI was an extracellular protein. The domain analysis showed that the CsKSPI contains a Kazal domain at 47-103 along with its family signature between 61 and 83. Phylogenetically, CsKSPI is closely related to KSPI from Maylandia zebra and formed a sister group with mammals. The 2D structure of CsKSPI showed three α-helical regions which are connected with random coils, one helix at signal sequence and two at the Kazal domain region. The relative gene expression showed that the CsKSPI was highly expressed in gills and its expression was induced upon fungus (Aphanomyces invadans), bacteria (Aeromonas hydrophila) and poly I:C (a viral analogue) challenge. The CsKSPI recombinant protein was produced to characterize and study the CsKSPI gene specific functions. The recombinant CsKSPI strongly inhibited trypsin compared to other tested proteases. The results of the kinetic activity of CsKSPI against trypsin was V(max)s = 1.62 nmol/min, K(M)s = 0.21 mM and K(i)s = 15.37 nM. Moreover, the recombinant CsKSPI inhibited the growth of Gram-negative bacteria A. hydrophila at 20 μM and Gram-positive bacteria Bacillus subtilis at the MIC50 of 15 μM. Overall, the study indicated that the CsKSPI was a potential trypsin inhibitor which involves in antimicrobial activity.

  1. Molecular docking and structure-based virtual screening studies of potential drug target, CAAX prenyl proteases, of Leishmania donovani.

    PubMed

    Singh, Shalini; Vijaya Prabhu, Sitrarasu; Suryanarayanan, Venkatesan; Bhardwaj, Ruchika; Singh, Sanjeev Kumar; Dubey, Vikash Kumar

    2016-11-01

    Targeting CAAX prenyl proteases of Leishmania donovani can be a good approach towards developing a drug molecule against Leishmaniasis. We have modeled the structure of CAAX prenyl protease I and II of L. donovani, using homology modeling approach. The structures were further validated using Ramachandran plot and ProSA. Active site prediction has shown difference in the amino acid residues present at the active site of CAAX prenyl protease I and CAAX prenyl protease II. The electrostatic potential surface of the CAAX prenyl protease I and II has revealed that CAAX prenyl protease I has more electropositive and electronegative potentials as compared CAAX prenyl protease II suggesting significant difference in their activity. Molecular docking with known bisubstrate analog inhibitors of protein farnesyl transferase and peptidyl (acyloxy) methyl ketones reveals significant binding of these molecules with CAAX prenyl protease I, but comparatively less binding with CAAX prenyl protease II. New and potent inhibitors were also found using structure-based virtual screening. The best docked compounds obtained from virtual screening were subjected to induced fit docking to get best docked configurations. Prediction of drug-like characteristics has revealed that the best docked compounds are in line with Lipinski's rule. Moreover, best docked protein-ligand complexes of CAAX prenyl protease I and II are found to be stable throughout 20 ns simulation. Overall, the study has identified potent drug molecules targeting CAAX prenyl protease I and II of L. donovani whose drug candidature can be verified further using biochemical and cellular studies.

  2. Simultaneous production of biopesticide and alkaline proteases by Bacillus thuringiensis using sewage sludge as a raw material.

    PubMed

    Tyagi, R D; Sikati Foko, V; Barnabe, S; Vidyarthi, A S; Valéro, J R; Surampalli, R Y

    2002-01-01

    The simultaneous production of Bacillus thuringiensis (Bt) based biopesticide and proteases was studied using synthetic medium and wastewater sludge as a raw material. The studies were conducted in shake flask and computer controlled 15-L capacity fermentors. Measuring viable cell and spore counts, entomotoxicity and protease activity monitored the progress of the biopesticide production process. A higher viable cell count and spore count was observed in synthetic Soya medium, however, higher entomotoxicity and protease activity were observed in wastewater sludge medium. Thus, the wastewater sludge is a better raw material than commercial Soya medium for the biopesticides and enzyme production. The maximum entomotoxicity and protease activity observed in the fermentor was 9,332 IU/microL and 4.58 IU/mL, respectively. The proteases produced by Bt were also characterised. Two types of proteases were detected; neutral proteases with pH optimum 7.0 and alkaline proteases with pH optimum 10-11. Further, two types of alkaline proteases were detected; one having a pH and temperature optimum at 10 and 50 degrees C while the other at 11 and 70 degrees C. The protease thermal stability was found to increase in the presence of CaCl2, indicating the proteases were metalloproteases.

  3. Characterization of senescence-associated protease activities involved in the efficient protein remobilization during leaf senescence of winter oilseed rape.

    PubMed

    Poret, Marine; Chandrasekar, Balakumaran; van der Hoorn, Renier A L; Avice, Jean-Christophe

    2016-05-01

    Oilseed rape (Brassica napus L.) is a crop plant characterized by a poor nitrogen (N) use efficiency that is mainly due to low N remobilization efficiency during the sequential leaf senescence of the vegetative stage. As a high leaf N remobilization efficiency was strongly linked to a high remobilization of proteins during leaf senescence of rapeseed, our objective was to identify senescence-associated protease activities implicated in the protein degradation. To reach this goal, leaf senescence processes and protease activities were investigated in a mature leaf becoming senescent in plants subjected to ample or low nitrate supply. The characterization of protease activities was performed by using in vitro analysis of RuBisCO degradation with or without inhibitors of specific protease classes followed by a protease activity profiling using activity-dependent probes. As expected, the mature leaf became senescent regardless of the nitrate treatment, and nitrate limitation enhanced the senescence processes associated with an enhanced degradation of soluble proteins. The characterization of protease activities revealed that: (i) aspartic proteases and the proteasome were active during senescence regardless of nitrate supply, and (ii) the activities of serine proteases and particularly cysteine proteases (Papain-like Cys proteases and vacuolar processing enzymes) increased when protein remobilization associated with senescence was accelerated by nitrate limitation. Short statement: Serine and particularly cysteine proteases (both PLCPs and VPEs) seem to play a crucial role in the efficient protein remobilization when leaf senescence of oilseed rape was accelerated by nitrate limitation.

  4. Hemisphaericin-D, a dialysable and polymerizable protease found in Bromelia hemisphaerica.

    PubMed

    Agundis, C; Reyes, M; Córdoba, F

    1977-07-15

    Proteolytic activity was detected outside dialysis bag filled with Bromelia hemisphaerica fruit juice. The dialysable protease was concentrated and purified from small molecular weight contaminants on Sephadex G-10 columns. Acrylamide gel electrophoresis of the dialysable protease, in the presence of SDS and 2-mercaptoethanol, demonstrated a single protein band of about 8000 daltons mol. wt. The same single band with identical mobility was shown with Hemisphaericin, the enzyme retained inside the dialysis bag. The small protease, named Hemisphaericin-D was antigenic in rabbits and the antibodies cross-reacted fully with Hemisphaericin. Hemisphaericin-D appears not to be a degradation product of Hemisphaericin.

  5. Degradation of Argininosuccinate Lyase by a Protease Synthesized in Soybean Cell Suspension Cultures 1

    PubMed Central

    Shargool, P. D.

    1975-01-01

    Suspension cultures of soybean (Glycine max L.) were shown to contain protease activity which could be inhibited by the addition of protease inhibitors such as p-hydroxymercuribenzoate and ethylenediaminetetraacetic acid. The use of these inhibitors, coupled with studies of the rate of degradation of argininosuccinate lyase (argininosuccinate-lyase = l-arginino-succinate arginine-lyase, EC 4.3.2.1) in extracts of cell cultures grown for 24 hours led to the hypothesis that a metal-dependent protease is synthesized by the cells after 24 hours of growth, to remove the lyase enzyme. PMID:16659138

  6. Studies of a calcium-activated neutral protease from chicken skeletal muscle. I. Purification and characterization.

    PubMed

    Ishiura, S; Murofushi, H; Suzuki, K; Imahori, K

    1978-07-01

    A calcium-activated neutral protease was purified 2,700-fold over the crude extract from chicken skeletal muscle. The purified protease migrated as a single band on polyacrylamide gel electrophoresis with or without SDS. Its molecular weight was 80,000 and pH optimum for activity was 7.7. The activity required strictly the presence of calcium (optimum concentration: 1.8 mM) or strontium (optimum concentration: 10 mM) ions. The protease was inhibited by leupeptin, which is known to be a strong inhibitor of papain, cathepsin B, trypsin, and plasmin.

  7. Mechanism-Based Inhibitors of Serine Proteases with High Selectivity Through Optimization of S’ Subsite Binding

    PubMed Central

    Li, Yi; Dou, Dengfeng; He, Guijia; Lushington, Gerald H.; Groutas, William C.

    2009-01-01

    A series of mechanism-based inhibitors designed to interact with the S’ subsites of serine proteases was synthesized and their inhibitory activity toward the closely-related serine proteases human neutrophil elastase (HNE) and proteinase 3 (PR 3) was investigated. The compounds were found to be time-dependent inhibitors of HNE and were devoid of any inhibitory activity toward PR 3. The results suggest that highly selective inhibitors of serine proteases whose primary substrate specificity and active sites are similar can be identified by exploiting differences in their S’ subsites. The best inhibitor (compound 16) had a kinact/KI value of 4580 M−1 s−1. PMID:19394830

  8. Pavlovian Conditioning of Rat Mucosal Mast Cells to Secrete Rat Mast Cell Protease II

    NASA Astrophysics Data System (ADS)

    MacQueen, Glenda; Marshall, Jean; Perdue, Mary; Siegel, Shepard; Bienenstock, John

    1989-01-01

    Antigen (egg albumin) injections, which stimulate mucosal mast cells to secrete mediators, were paired with an audiovisual cue. After reexposure to the audiovisual cue, a mediator (rat mast cell protease II) was measured with a sensitive and specific assay. Animals reexposed to only the audiovisual cue released a quantity of protease not significantly different from animals reexposed to both the cue and the antigen; these groups released significantly more protease than animals that had received the cue and antigen in a noncontingent manner. The results support a role for the central nervous system as a functional effector of mast cell function in the allergic state.

  9. Oxadiazole-Based Cell Permeable Macrocyclic Transition State Inhibitors of Norovirus 3CL Protease.

    PubMed

    Damalanka, Vishnu C; Kim, Yunjeong; Alliston, Kevin R; Weerawarna, Pathum M; Galasiti Kankanamalage, Anushka C; Lushington, Gerald H; Mehzabeen, Nurjahan; Battaile, Kevin P; Lovell, Scott; Chang, Kyeong-Ok; Groutas, William C

    2016-03-10

    Human noroviruses are the primary causative agents of acute gastroenteritis and a pressing public health burden worldwide. There are currently no vaccines or small molecule therapeutics available for the treatment or prophylaxis of norovirus infections. Norovirus 3CL protease plays a vital role in viral replication by generating structural and nonstructural proteins via the cleavage of the viral polyprotein. Thus, molecules that inhibit the viral protease may have potential therapeutic value. We describe herein the structure-based design, synthesis, and in vitro and cell-based evaluation of the first class of oxadiazole-based, permeable macrocyclic inhibitors of norovirus 3CL protease.

  10. Approaches for the generation of active papain-like cysteine proteases from inclusion bodies of Escherichia coli.

    PubMed

    Ling, Chunfang; Zhang, Junyan; Lin, Deqiu; Tao, Ailin

    2015-05-01

    Papain-like cysteine proteases are widely expressed, fulfill specific functions in extracellular matrix turnover, antigen presentation and processing events, and may represent viable drug targets for major diseases. In depth and rigorous studies of the potential for these proteins to be targets for drug development require sufficient amounts of protease protein that can be used for both experimental and therapeutic purposes. Escherichia coli was widely used to express papain-like cysteine proteases, but most of those proteases are produced in insoluble inclusion bodies that need solubilizing, refolding, purifying and activating. Refolding is the most critical step in the process of generating active cysteine proteases and the current approaches to refolding include dialysis, dilution and chromatography. Purification is mainly achieved by various column chromatography. Finally, the attained refolded proteases are examined regarding their protease structures and activities.

  11. Characterization, cloning, and heterologous expression of a subtilisin-like serine protease gene VlPr1 from Verticillium lecanii.

    PubMed

    Yu, Gang; Liu, Jin-Liang; Xie, Li-Qin; Wang, Xue-Liang; Zhang, Shi-Hong; Pan, Hong-Yu

    2012-12-01

    The entomopathogenic fungus Verticillium lecanii is a well-known biocontrol agent. V. lecanii produces subtilisin-like serine protease (Pr1), which is important in the biological control activity of some insect pests by degrading insect cuticles. In this study, a subtilisin-like serine protease gene VlPr1 was cloned from the fungus and the VlPr1 protein was expressed in Escherichia coli. The VlPr1 gene contains an open reading frame (ORF) interrupted by three short introns, and encodes a protein of 379 amino acids. Protein sequence analysis revealed high homology with subtilisin serine proteases. The molecular mass of the protease was 38 kDa, and the serine protease exhibited its maximal activity at 40°C and pH 9.0. Protease activity was also affected by Mg(2+) and Ca(2+) concentration. The protease showed inhibitory activity against several plant pathogens, especially towards Fusarium moniliforme.

  12. Contribution of the 80s loop of HIV-1 protease to the multidrug-resistance mechanism: crystallographic study of MDR769 HIV-1 protease variants

    PubMed Central

    Yedidi, Ravikiran S.; Proteasa, Georghe; Martinez, Jorge L.; Vickrey, John F.; Martin, Philip D.; Wawrzak, Zdzislaw; Liu, Zhigang; Kovari, Iulia A.; Kovari, Ladislau C.

    2011-01-01

    The flexible flaps and the 80s loops (Pro79–Ile84) of HIV-1 protease are crucial in inhibitor binding. Previously, it was reported that the crystal structure of multidrug-resistant 769 (MDR769) HIV-1 protease shows a wide-open conformation of the flaps owing to conformational rigidity acquired by the accumulation of mutations. In the current study, the effect of mutations on the conformation of the 80s loop of MDR769 HIV-1 protease variants is reported. Alternate conformations of Pro81 (proline switch) with a root-mean-square deviation of 3–4.8 Å in the Cα atoms of the I10V mutant and a side chain with a ‘flipped-out’ conformation in the A82F mutant cause distortion in the S1/S1′ binding pockets that affects inhibitor binding. The A82S and A82T mutants show local changes in the electrostatics of inhibitor binding owing to the mutation from nonpolar to polar residues. In summary, the crystallo­graphic studies of four variants of MDR769 HIV-1 protease presented in this article provide new insights towards understanding the drug-resistance mechanism as well as a basis for design of future protease inhibitors with enhanced potency. PMID:21636892

  13. Contribution of the 80s loop of HIV-1 protease to the multidrug-resistance mechanism: crystallographic study of MDR769 HIV-1 protease variants

    SciTech Connect

    Yedidi, Ravikiran S.; Proteasa, Georghe; Martinez, Jorge L.; Vickrey, John F.; Martin, Philip D.; Wawrzak, Zdzislaw; Liu, Zhigang; Kovari, Iulia A.; Kovari, Ladislau C.

    2011-09-06

    The flexible flaps and the 80s loops (Pro79-Ile84) of HIV-1 protease are crucial in inhibitor binding. Previously, it was reported that the crystal structure of multidrug-resistant 769 (MDR769) HIV-1 protease shows a wide-open conformation of the flaps owing to conformational rigidity acquired by the accumulation of mutations. In the current study, the effect of mutations on the conformation of the 80s loop of MDR769 HIV-1 protease variants is reported. Alternate conformations of Pro81 (proline switch) with a root-mean-square deviation of 3-4.8 {angstrom} in the C{alpha} atoms of the I10V mutant and a side chain with a 'flipped-out' conformation in the A82F mutant cause distortion in the S1/S1' binding pockets that affects inhibitor binding. The A82S and A82T mutants show local changes in the electrostatics of inhibitor binding owing to the mutation from nonpolar to polar residues. In summary, the crystallographic studies of four variants of MDR769 HIV-1 protease presented in this article provide new insights towards understanding the drug-resistance mechanism as well as a basis for design of future protease inhibitors with enhanced potency.

  14. Chikungunya nsP2 protease is not a papain-like cysteine protease and the catalytic dyad cysteine is interchangeable with a proximal serine.

    PubMed

    Saisawang, Chonticha; Saitornuang, Sawanan; Sillapee, Pornpan; Ubol, Sukathida; Smith, Duncan R; Ketterman, Albert J

    2015-11-24

    Chikungunya virus is the pathogenic alphavirus that causes chikungunya fever in humans. In the last decade millions of cases have been reported around the world from Africa to Asia to the Americas. The alphavirus nsP2 protein is multifunctional and is considered to be pivotal to viral replication, as the nsP2 protease activity is critical for proteolytic processing of the viral polyprotein during replication. Classically the alphavirus nsP2 protease is thought to be papain-like with the enzyme reaction proceeding through a cysteine/histidine catalytic dyad. We performed structure-function studies on the chikungunya nsP2 protease and show that the enzyme is not papain-like. Characterization of the catalytic dyad cysteine residue enabled us to identify a nearby serine that is catalytically interchangeable with the dyad cysteine residue. The enzyme retains activity upon alanine replacement of either residue but a replacement of both cysteine and serine residues results in no detectable activity. Protein dynamics appears to allow the use of either the cysteine or the serine residue in catalysis. This switchable dyad residue has not been previously reported for alphavirus nsP2 proteases and would have a major impact on the nsP2 protease as an anti-viral target.

  15. Chikungunya nsP2 protease is not a papain-like cysteine protease and the catalytic dyad cysteine is interchangeable with a proximal serine

    PubMed Central

    Saisawang, Chonticha; Saitornuang, Sawanan; Sillapee, Pornpan; Ubol, Sukathida; Smith, Duncan R.; Ketterman, Albert J.

    2015-01-01

    Chikungunya virus is the pathogenic alphavirus that causes chikungunya fever in humans. In the last decade millions of cases have been reported around the world from Africa to Asia to the Americas. The alphavirus nsP2 protein is multifunctional and is considered to be pivotal to viral replication, as the nsP2 protease activity is critical for proteolytic processing of the viral polyprotein during replication. Classically the alphavirus nsP2 protease is thought to be papain-like with the enzyme reaction proceeding through a cysteine/histidine catalytic dyad. We performed structure-function studies on the chikungunya nsP2 protease and show that the enzyme is not papain-like. Characterization of the catalytic dyad cysteine residue enabled us to identify a nearby serine that is catalytically interchangeable with the dyad cysteine residue. The enzyme retains activity upon alanine replacement of either residue but a replacement of both cysteine and serine residues results in no detectable activity. Protein dynamics appears to allow the use of either the cysteine or the serine residue in catalysis. This switchable dyad residue has not been previously reported for alphavirus nsP2 proteases and would have a major impact on the nsP2 protease as an anti-viral target. PMID:26597768

  16. Cysteine Proteases Inhibitors with immunoglobulin-like fold in protozoan parasites and their role in pathogenesis.

    PubMed

    Jimenez-Sandoval, Pedro; Lopez-Castillo, Laura Margarita; Trasviña-Arenas, Carlos H; Brieba, Luis G

    2016-08-13

    The number of protein folds in nature is limited, thus is not surprising that proteins with the same fold are able to exert different functions. The cysteine protease inhibitors that adopt an immunoglobulin-like fold (Ig-ICPs) are inhibitors encoded in bacteria and protozoan parasites. Structural studies indicate that these inhibitors resemble the structure of archetypical proteins with an Ig fold, like antibodies, cadherins or cell receptors. The structure of Ig-ICPs from four different protozoan parasites clearly shows the presence of three loops that form part of a protein-ligand interaction surface that resembles the antigen binding sites of antibodies. Thus, Ig-ICPs bind to different cysteine proteases using a tripartite mechanism in which their BC, DE and FG loops are responsible for the main interactions with the target cysteine protease. Ig-ICPs from different protozoan parasites regulate the enzymatic activity of host or parasite's proteases and thus regulate virulence and pathogenesis.

  17. Cloning of the gene encoding streptococcal immunoglobulin A protease and its expression in Escherichia coli.

    PubMed Central

    Gilbert, J V; Plaut, A G; Fishman, Y; Wright, A

    1988-01-01

    We have identified and cloned a 6-kilobase-pair segment of chromosomal DNA from Streptococcus sanguis ATCC 10556 that encodes immunoglobulin A (IgA) protease activity when cloned into Escherichia coli. The enzyme specified by the iga gene in plasmid pJG1 accumulates in the periplasm of E. coli MM294 cells and has a substrate specificity for human IgA1 identical to that of native S. sanguis protease. Hybridization experiments with probes from within the encoding DNA showed no detectable homology at the nucleotide sequence level with chromosomal DNA of gram-negative bacteria that excrete IgA protease. Moreover, the S. sanguis iga gene probes showed no detectable hybridization with chromosomal DNA of S. pneumoniae, although the IgA proteases of these two streptococcal species cleaved the identical peptide bond in the human IgA1 heavy-chain hinge region. Images PMID:3294181

  18. Stabilities and conformational transitions of various proteases in the presence of an organic solvent.

    PubMed

    Ogino, Hiroyasu; Gemba, Yuichi; Yutori, Yoshikazu; Doukyu, Noriyuki; Ishimi, Kosaku; Ishikawa, Haruo

    2007-01-01

    The half-life of the activity of the PST-01 protease that was secreted by organic solvent-tolerant Pseudomonas aeruginosa PST-01 was very long in the presence of methanol as compared to that in the absence of methanol. The conformational transitions of the PST-01 protease, alpha-chymotrypsin, thermolysin, and subtilisin in the presence and absence of methanol were monitored by measuring the CD spectra. The conformational stabilities of the PST-01 protease and subtilisin in the presence of methanol were higher than those in the absence of methanol. This resulted in high stability of these proteases in the presence of methanol. Furthermore, it was suggested that the organic solvent stabilities of enzymes were closely related to the secondary structure by monitoring the conformational transitions of polyamino acids, which form the particular conformations, in the presence and absence of methanol.

  19. Purification and characterization of aspartic protease derived from Sf9 insect cells.

    PubMed

    Gotoh, Takeshi; Ono, Hiroki; Kikuchi, Ken-Ichi; Nirasawa, Satoru; Takahashi, Saori

    2010-01-01

    An aspartic protease that is significantly produced by baculovirus-infected Spodoptera frugiperda Sf9 insect cells was purified to homogeneity from a growth medium. To monitor aspartic protease activity, an internally quenched fluoresce (IQF) substrate specific to cathepsin D was used. The purified aspartic protease showed a single protein band on SDS-PAGE with an apparent molecular mass of 40 kDa. The N-terminal amino acid sequence of the enzyme had a high homology to a Bombyx mori aspartic protease. The enzyme showed greatest affinity for the IQF substrate at pH 3.0 with a K(m) of 0.85 µM. The k(cat) and k(cat)/K(m) values were 13 s(-1) and 15 s(-1) µM(-1) respectively. Pepstatin A proved to be a potent competitive inhibitor with inhibitor constant, K(i), of 25 pM.

  20. Efficient expression and purification of a protease from the common cold virus, human rhinovirus type 14

    NASA Astrophysics Data System (ADS)

    Leong, L. E.-C.; Walker, P. A.; Porter, A. G.

    1992-08-01

    The protease (3C pro) from human rhinovirus serotype-14 (HRV-14) has been cloned and efficiently expressed in E. coli. A straightforward single-step purification of the recombinant 3C pro has been achieved by fusing the protein to the car☐y-terminus of the glutathione-S-transferase from Schistosoma japonicum. Modifications made to the 5' end of the PCR fragment coding for the 3C pro have allowed the specific cleavage of the fusion protein using thrombin to yield mature 3C pro with the correct amino-terminal amino acid. This protease has been shown to be active when assayed using synthetic peptides corresponding to the natural cleavage recognition sequences within the polyprotein. Other substrates are being developed for this protease for possible use in the screening of inhibitors of 3C pro. Sufficient protease 3C pro has been purified for initial attempts at crystallization.

  1. Identification of the recognition sequence and target proteins for DJ-1 protease.

    PubMed

    Mitsugi, Hitomi; Niki, Takeshi; Takahashi-Niki, Kazuko; Tanimura, Kyoko; Yoshizawa-Kumagaye, Kumiko; Tsunemi, Masahiko; Iguchi-Ariga, Sanae M M; Ariga, Hiroyoshi

    2013-08-19

    DJ-1, the product of familial Parkinson's disease gene and an oncogene, is a cysteine protease which plays a role in anti-oxidative stress reaction. In this study, we identified the recognition sequence for DJ-1 protease by using recombinant DJ-1 and a peptide library. Protease activity of DJ-1 lacking C-terminal α-helix (DJ-1ΔH9) was stronger than that of full-sized DJ-1, and the most susceptible sequence digested by DJ-1ΔH9 was valine-lysine-valine-alanine (VKVA) under the optimal conditions of pH 5.5 and 0 mM NaCl. Divalent ions, especially Cu²⁺, were inhibitory to DJ-1's protease activity. c-abl oncogene 1 product (ABL1) and kinesin family member 1B (KIF1B) containing VKVA were digested by DJ-1ΔH9.

  2. Activity-based probes for rhomboid proteases discovered in a mass spectrometry-based assay

    PubMed Central

    Vosyka, Oliver; Vinothkumar, Kutti R.; Wolf, Eliane V.; Brouwer, Arwin J.; Liskamp, Rob M. J.; Verhelst, Steven H. L.

    2013-01-01

    Rhomboid proteases are evolutionary conserved intramembrane serine proteases. Because of their emerging role in many important biological pathways, rhomboids are potential drug targets. Unfortunately, few chemical tools are available for their study. Here, we describe a mass spectrometry-based assay to measure rhomboid substrate cleavage and inhibition. We have identified isocoumarin inhibitors and developed activity-based probes for rhomboid proteases. The probes can distinguish between active and inactive rhomboids due to covalent, reversible binding of the active-site serine and stable modification of a histidine residue. Finally, the structure of an isocoumarin-based inhibitor with Escherichia coli rhomboid GlpG uncovers an unusual mode of binding at the active site and suggests that the interactions between the 3-substituent on the isocoumarin inhibitor and hydrophobic residues on the protease reflect S′ subsite binding. Overall, these probes represent valuable tools for rhomboid study, and the structural insights may facilitate future inhibitor design. PMID:23359682

  3. Evaluation on Potential Contributions of Protease Activated Receptors Related Mediators in Allergic Inflammation

    PubMed Central

    Zhang, Huiyun; Zeng, Xiaoning; He, Shaoheng

    2014-01-01

    Protease activated receptors (PARs) have been recognized as a distinctive four-member family of seven transmembrane G protein-coupled receptors (GPCRs) that can be cleaved by certain serine proteases. In recent years, there has been considerable interest in the role of PARs in allergic inflammation, the fundamental pathologic changes of allergy, but the potential roles of PARs in allergy remain obscure. Since many of these proteases are produced and actively involved in the pathologic process of inflammation including exudation of plasma components, inflammatory cell infiltration, and tissue damage and repair, PARs appear to make important contribution to allergy. The aim of the present review is to summarize the expression of PARs in inflammatory and structural cells, the influence of agonists or antagonists of PARs on cell behavior, and the involvement of PARs in allergic disorders, which will help us to better understand the roles of serine proteases and PARs in allergy. PMID:24876677

  4. Proteases of an early colonizer can hinder Streptococcus mutans colonization in vitro.

    PubMed

    Wang, B-Y; Deutch, A; Hong, J; Kuramitsu, H K

    2011-04-01

    Streptococcus mutans is the primary cariogen that produces several virulence factors that are modulated by a competence-stimulating peptide (CSP) signaling system. In this study, we sought to determine if proteases produced by early dental plaque colonizers such as Streptococcus gordonii interfere with the subsequent colonization of S. mutans BM71 on the existing streptococcal biofilms. We demonstrated that S. mutans BM71 colonized much less efficiently in vitro on streptococcal biofilms than on Actinomyces naeslundii biofilms. Several oral streptococci, relative to A. naeslundii, produced proteases that inactivated the S. mutans CSP. We further demonstrated that cell protein extracts from S. gordonii, but not from A. naeslundii, interfered with S. mutans BM71 colonization. In addition, S. mutans BM71 colonized more efficiently on the sgc protease knockout mutant of S. gordonii than on the parent biofilms. In conclusion, proteases of early colonizers can interfere with subsequent colonization by S. mutans in vitro.

  5. Membrane proteases in the bacterial protein secretion and quality control pathway.

    PubMed

    Dalbey, Ross E; Wang, Peng; van Dijl, Jan Maarten

    2012-06-01

    Proteolytic cleavage of proteins that are permanently or transiently associated with the cytoplasmic membrane is crucially important for a wide range of essential processes in bacteria. This applies in particular to the secretion of proteins and to membrane protein quality control. Major progress has been made in elucidating the structure-function relationships of many of the responsible membrane proteases, including signal peptidases, signal peptide hydrolases, FtsH, the rhomboid protease GlpG, and the site 1 protease DegS. These enzymes employ very different mechanisms to cleave substrates at the cytoplasmic and extracytoplasmic membrane surfaces or within the plane of the membrane. This review highlights the different ways that bacterial membrane proteases degrade their substrates, with special emphasis on catalytic mechanisms and substrate delivery to the respective active sites.

  6. Potent inhibitors of HCV-NS3 protease derived from boronic acids

    SciTech Connect

    Venkatraman, Srikanth; Wu, Wanli; Prongay, Andrew; Girijavallabhan, Viyyoor; Njoroge, F. George

    2009-07-23

    Chronic hepatitis C infection is the leading causes for cirrhosis of the liver and hepatocellular carcinoma, leading to liver failure and liver transplantation. The etiological agent, HCV virus produces a single positive strand of RNA that is processed with the help of serine protease NS3 to produce mature virus. Inhibition of NS3 protease can be potentially used to develop effective drugs for HCV infections. Numerous efforts are now underway to develop potent inhibitors of HCV protease that contain ketoamides as serine traps. Herein we report the synthesis of a series of potent inhibitors that contain a boronic acid as a serine trap. The activity of these compounds were optimized to 200 pM. X-ray structure of compound 17 bound to NS3 protease is also discussed.

  7. Fluorogenic Assay for Inhibitors of HIV-1 Protease with Sub-picomolar Affinity

    NASA Astrophysics Data System (ADS)

    Windsor, Ian W.; Raines, Ronald T.

    2015-08-01

    A fluorogenic substrate for HIV-1 protease was designed and used as the basis for a hypersensitive assay. The substrate exhibits a kcat of 7.4 s-1, KM of 15 μM, and an increase in fluorescence intensity of 104-fold upon cleavage, thus providing sensitivity that is unmatched in a continuous assay of HIV-1 protease. These properties enabled the enzyme concentration in an activity assay to be reduced to 25 pM, which is close to the Kd value of the protease dimer. By fitting inhibition data to Morrison’s equation, Ki values of amprenavir, darunavir, and tipranavir were determined to be 135, 10, and 82 pM, respectively. This assay, which is capable of measuring Ki values as low as 0.25 pM, is well-suited for characterizing the next generation of HIV-1 protease inhibitors.

  8. Expression and Purification of Haemophilus influenzae Rhomboid Intramembrane Protease GlpG for Structural Studies.

    PubMed

    Panwar, Pankaj; Lemieux, M Joanne

    2014-04-01

    Rhomboid proteases are membrane-embedded proteases that cleave peptide bonds of transmembrane proteins. They play a variety of roles in cell signaling events. The rhomboid protease GlpG from Haemophilus influenzae (hiGlpG) is a canonical form of rhomboid protease having six transmembrane segments. In this unit, detailed protocols are presented for optimization of hiGlpG expression using the araBAD promotor system in the pBAD vector. The parameters for optimization include concentration of inducing agent, induction temperature, and time. Optimization of these key factors led to the development of a protocol yielding 1.6 to 2.5 mg/liter protein purified after ion metal affinity chromatography (IMAC). Further purification can include size exclusion chromatography (SEC).

  9. Structural basis of ubiquitin recognition by the deubiquitinating protease USP2.

    PubMed