Science.gov

Sample records for 3h-cyclic amp accumulation

  1. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  2. Adenylyl cyclase activation underlies intracellular cyclic AMP accumulation, cyclic AMP transport, and extracellular adenosine accumulation evoked by beta-adrenergic receptor stimulation in mixed cultures of neurons and astrocytes derived from rat cerebral cortex.

    PubMed

    Rosenberg, P A; Li, Y

    1995-09-18

    We have previously shown that stimulation of cortical cultures containing both neurons and astrocytes with the beta-adrenergic agonist isoproterenol (ISO) results in transport of cAMP from astrocytes followed by extracellular hydrolysis to adenosine [Rosenberg et al. J. Neurosci. 14 (1994) 2953-2965]. In this study we found that the endogenous catecholamines epinephrine (EPI) and norepinephrine (NE), but not dopamine, serotonin, or histamine, all at 10 microM, significantly stimulated intracellular cAMP accumulation, cAMP transport, and extracellular adenosine accumulation in cortical cultures. Detailed dose-response experiments were performed for NE and EPI, as well as ISO. For each catecholamine, the potencies in evoking intracellular cAMP accumulation, cAMP transport, and extracellular adenosine accumulation were similar. These data provide additional evidence that a single common mechanism, namely beta-adrenergic mediated activation of adenylyl cyclase, underlies intracellular cAMP accumulation, cAMP transport, and extracellular adenosine accumulation. It appears that regulation of extracellular adenosine levels via cAMP transport and extracellular hydrolysis to adenosine may be a final common pathway of neuromodulation in cerebral cortex for catecholamines, and, indeed, any substance whose receptors are coupled to adenylyl cyclase.

  3. Modulation of norepinephrine-stimulated cyclic AMP accumulation in rat pinealocytes by n-3 fatty acids.

    PubMed

    Delton-Vandenbroucke, I; Sarda, N; Molière, P; Lagarde, M; Gharib, A

    1996-10-01

    This work showed that docosahexaenoic (22:6n-3) and eicosapentaenoic (20:5n-3) acid supplementation for 48 h have opposite effects on the norepinephrine-stimulated cyclic AMP accumulation in rat pinealocytes. We found that 22:6n-3 supplementation of pineal cells, done by increasing specifically 22:6n-3 in phospholipid and triacylglycerol pools, led to inhibition of norepinephrine-stimulated cyclic AMP production whereas 20:5n-3 supplementation, by increasing 20:5n-3, and 22:5n-3 and 22:6n-3 in the same pools, stimulated it. In contrast, direct treatment of pinealocytes with each fatty acid (50 microM) did not affect cyclic AMP production in the presence of (0.1-10 microM) norepinephrine. The results indicate that, using pharmacological agents such as forskolin or prazosin: (a) neither basal nor forskolin-stimulated cyclic AMP levels were modified in fatty acid-supplemented cells compared to control cells; (b) in the presence of 1 microM prazosin, the activation by 20:5n-3 was still effective whereas no additional inhibition of norepinephrine stimulation was observed in 22:6n-3-supplemented cells. Taken together our results suggest that 22:6n-3 or 20:5n-3 supplementation modulates specifically the alpha 1- or beta-adrenoceptors in the rat pineal gland.

  4. Stimulation of T-cells with OKT3 antibodies increases forskolin binding and cyclic AMP accumulation.

    PubMed

    Kvanta, A; Gerwins, P; Jondal, M; Fredholm, B B

    1990-01-01

    It has recently been shown that elevation of cAMP by adenosine receptor stimulation may be potentiated by stimulation of the T-cell receptor/CD3 complex on human T-cells with the monoclonal antibody OKT3, and that this is mimicked by activation of protein kinase C [Kvanta, A. et al. (1989) Naunyn-Schmeideberg's Arch. Pharmac. 340, 715-717]. In this study the diterpene forskolin, which binds to and activates the adenylate cyclase, has been used to examine further how the CD3 complex may influence the adenylate cyclase pathway. Stimulation with OKT3 alone was found to cause a small dose-dependent increase in basal cAMP accumulation. When combining OKT3 with a concentration of forskolin (10 microM), which by itself had little effect on the cyclase activity, the cAMP accumulation was markedly potentiated. This potentiation was paralleled by an increase in [3H]forskolin binding to saponine permeabilized Jurkat cells from 24 to 41 fmol/10(6) cells. The OKT3 effect on cAMP was blocked by chelating extracellular Ca2+ with EGTA or intracellular Ca2+ with BAPTA and also by W-7, an inhibitor of calmodulin, but was unaffected by H-7, an inhibitor of protein kinase C. Even though OKT3 caused an increase in inositolphosphate turnover, and activated protein kinase C, neither phorbol 12,13 dibutyrate (PDBu) nor the Ca2(+)-ionophore A23187 could mimic the OKT3 effect, whereas a combination of PDBu and A23187 at high concentrations could potentiate forskolin stimulated cyclase activity. Together, these results indicated that stimulation of the CD3 complex could influence the adenylate cyclase by two different mechanisms, one involving activation of protein kinase C and another which does not. PMID:2177619

  5. A cardiac mitochondrial cAMP signaling pathway regulates calcium accumulation, permeability transition and cell death

    PubMed Central

    Wang, Z; Liu, D; Varin, A; Nicolas, V; Courilleau, D; Mateo, P; Caubere, C; Rouet, P; Gomez, A-M; Vandecasteele, G; Fischmeister, R; Brenner, C

    2016-01-01

    Although cardiac cytosolic cyclic 3′,5′-adenosine monophosphate (cAMP) regulates multiple processes, such as beating, contractility, metabolism and apoptosis, little is known yet on the role of this second messenger within cardiac mitochondria. Using cellular and subcellular approaches, we demonstrate here the local expression of several actors of cAMP signaling within cardiac mitochondria, namely a truncated form of soluble AC (sACt) and the exchange protein directly activated by cAMP 1 (Epac1), and show a protective role for sACt against cell death, apoptosis as well as necrosis in primary cardiomyocytes. Upon stimulation with bicarbonate (HCO3−) and Ca2+, sACt produces cAMP, which in turn stimulates oxygen consumption, increases the mitochondrial membrane potential (ΔΨm) and ATP production. cAMP is rate limiting for matrix Ca2+ entry via Epac1 and the mitochondrial calcium uniporter and, as a consequence, prevents mitochondrial permeability transition (MPT). The mitochondrial cAMP effects involve neither protein kinase A, Epac2 nor the mitochondrial Na+/Ca2+ exchanger. In addition, in mitochondria isolated from failing rat hearts, stimulation of the mitochondrial cAMP pathway by HCO3− rescued the sensitization of mitochondria to Ca2+-induced MPT. Thus, our study identifies a link between mitochondrial cAMP, mitochondrial metabolism and cell death in the heart, which is independent of cytosolic cAMP signaling. Our results might have implications for therapeutic prevention of cell death in cardiac pathologies. PMID:27100892

  6. Vasopressin V2 receptor mRNA expression and cAMP accumulation in aging rat kidney.

    PubMed

    Klingler, C; Preisser, L; Barrault, M B; Lluel, P; Horgen, L; Teillet, L; Ancellin, N; Corman, B

    1997-06-01

    The ability of the kidney to regulate water balance is impaired with age, although the secretion of vasopressin is maintained in senescent animals. This suggests that the cellular response to antidiuretic hormone is reduced in aging kidney. To test this hypothesis, the relationship between the expression of the vasopressin. V2 receptor mRNA and adenosine 3',5'-cyclic monophosphate (cAMP) accumulation was investigated in the medullary thick ascending limb of Henle's loop (MTAL) of adult and aging rats. Tubular suspensions of MTAL were prepared from 10- and 30-mo-old female WAG/Rij rats. The accumulation of cAMP for maximal concentration of vasopressin was 34% larger in adult than in old animals (9.5 +/- 0.5 pmol/4 min, n = 16, and 7.1 +/- 0.6 pmol/4 min, n = 12, respectively). The concentration of vasopressin corresponding to half-maximal stimulation was similar in the two groups (0.66 +/- 0.20 and 0.52 +/- 0.09 nmol, n = 5, in adult and old animals), indicating comparable sensitivity of the renal cells with age. The age-related impaired response to vasopressin of the V2 receptor was specific for females and was not observed in males. Direct stimulation of adenylyl cyclase by forskolin induced a comparable accumulation of cAMP in adult and senescent rats. The V2 receptor mRNA level in the MTAL was constant between 10 and 30 mo whether the animals were normally hydrated or dehydrated for 2 days. These data indicate that, in MTAL, the age-related impaired cAMP accumulation by vasopressin would be linked to a change either in the translation of V2 mRNA or in posttranslational processing mechanisms or in the coupling between the V2 receptor and adenylyl cyclase. PMID:9227590

  7. Parathyroid hormone stimulates juxtaglomerular cell cAMP accumulation without stimulating renin release

    PubMed Central

    Atchison, Douglas K.; Harding, Pamela; Cecilia Ortiz-Capisano, M.; Peterson, Edward L.

    2012-01-01

    Parathyroid hormone (PTH) is positively coupled to the generation of cAMP via its actions on the PTH1R and PTH2R receptors. Renin secretion from juxtaglomerular (JG) cells is stimulated by elevated intracellular cAMP, and every stimulus that increases renin secretion is thought to do so via increasing cAMP. Thus we hypothesized that PTH increases renin release from primary cultures of mouse JG cells by elevating intracellular cAMP via the PTH1R receptor. We found PTH1R, but not PTH2R, mRNA expressed in JG cells. While PTH increased JG cell cAMP content from (log10 means ± SE) 3.27 ± 0.06 to 3.92 ± 0.12 fmol/mg protein (P < 0.001), it did not affect renin release. The PTH1R-specific agonist, parathyroid hormone-related protein (PTHrP), also increased JG cell cAMP from 3.13 ± 0.09 to 3.93 ± 0.09 fmol/mg protein (P < 0.001), again without effect on renin release. PTH2R receptor agonists had no effect on cAMP or renin release. PTHrP increased cAMP in the presence of both low and high extracellular calcium from 3.31 ± 0.17 to 3.83 ± 0.20 fmol/mg protein (P < 0.01) and from 3.29 ± 0.18 to 3.63 ± 0.22 fmol/mg protein (P < 0.05), respectively, with no effect on renin release. PTHrP increased JG cell cAMP in the presence of adenylyl cyclase-V inhibition from 2.85 ± 0.17 to 3.44 ± 0.14 fmol/mg protein (P < 0.001) without affecting renin release. As a positive control, forskolin increased JG cell cAMP from 3.39 ± 0.13 to 4.48 ± 0.07 fmol/mg protein (P < 0.01) and renin release from 2.96 ± 0.10 to 3.29 ± 0.08 ng ANG I·mg prot−1·h−1 (P < 0.01). Thus PTH increases JG cell cAMP via non-calcium-sensitive adenylate cyclases without affecting renin release. These data suggest compartmentalization of cAMP signaling in JG cells. PMID:22896038

  8. Parathyroid hormone stimulates juxtaglomerular cell cAMP accumulation without stimulating renin release.

    PubMed

    Atchison, Douglas K; Harding, Pamela; Cecilia Ortiz-Capisano, M; Peterson, Edward L; Beierwaltes, William H

    2012-10-15

    Parathyroid hormone (PTH) is positively coupled to the generation of cAMP via its actions on the PTH1R and PTH2R receptors. Renin secretion from juxtaglomerular (JG) cells is stimulated by elevated intracellular cAMP, and every stimulus that increases renin secretion is thought to do so via increasing cAMP. Thus we hypothesized that PTH increases renin release from primary cultures of mouse JG cells by elevating intracellular cAMP via the PTH1R receptor. We found PTH1R, but not PTH2R, mRNA expressed in JG cells. While PTH increased JG cell cAMP content from (log(10) means ± SE) 3.27 ± 0.06 to 3.92 ± 0.12 fmol/mg protein (P < 0.001), it did not affect renin release. The PTH1R-specific agonist, parathyroid hormone-related protein (PTHrP), also increased JG cell cAMP from 3.13 ± 0.09 to 3.93 ± 0.09 fmol/mg protein (P < 0.001), again without effect on renin release. PTH2R receptor agonists had no effect on cAMP or renin release. PTHrP increased cAMP in the presence of both low and high extracellular calcium from 3.31 ± 0.17 to 3.83 ± 0.20 fmol/mg protein (P < 0.01) and from 3.29 ± 0.18 to 3.63 ± 0.22 fmol/mg protein (P < 0.05), respectively, with no effect on renin release. PTHrP increased JG cell cAMP in the presence of adenylyl cyclase-V inhibition from 2.85 ± 0.17 to 3.44 ± 0.14 fmol/mg protein (P < 0.001) without affecting renin release. As a positive control, forskolin increased JG cell cAMP from 3.39 ± 0.13 to 4.48 ± 0.07 fmol/mg protein (P < 0.01) and renin release from 2.96 ± 0.10 to 3.29 ± 0.08 ng ANG I·mg prot(-1)·h(-1) (P < 0.01). Thus PTH increases JG cell cAMP via non-calcium-sensitive adenylate cyclases without affecting renin release. These data suggest compartmentalization of cAMP signaling in JG cells.

  9. Immunocytology on microwave-fixed cells reveals rapid and agonist-specific changes in subcellular accumulation patterns for cAMP or cGMP.

    PubMed Central

    Barsony, J; Marx, S J

    1990-01-01

    We developed a method for cAMP and cGMP immunocytology based upon fixation by microwave irradiation. Fixation by microwave irradiation prevented three problems found with other fixation methods: nucleotide loss from cells, nucleotide diffusion within cells, and chemical modification of immunologic epitopes. Six agonists (four that stimulate adenylate cyclase and two that stimulate guanylate cyclase) produced cAMP or cGMP accumulation patterns that were agonist-specific, dose-dependent, detectable at physiologic concentrations of hormone, and time-dependent within 15 sec to 30 min. cAMP accumulation after 1 mM forskolin was greatest in the nucleus. Isoproterenol, prostaglandin E2, or calcitonin caused initial accumulation of cAMP along the plasma membrane, but later accumulation was greater in the cytoplasm. With calcitonin the later accumulation of cAMP was selectively perinuclear and along the nuclear membrane. Sodium nitroprusside stimulated cGMP accumulation diffusely throughout the cytoplasm. Atrial natriuretic peptide initiated cGMP accumulation near the plasma membrane, and cGMP accumulation moved from there into the cytoplasm. In conclusion, microwave irradiation preserved cell structure and allowed visualization of expected as well as unsuspected changes in intracellular accumulation patterns of cAMP and cGMP. Images PMID:2153973

  10. Rapid glucocorticoid inhibition of vasoactive intestinal peptide-induced cyclic AMP accumulation and prolactin release in rat pituitary cells in culture.

    PubMed Central

    Rotsztejn, W H; Dussaillant, M; Nobou, F; Rosselin, G

    1981-01-01

    Vasoactive intestinal peptide (VIP) stimulates both adenosine 3',5'-cyclic monophosphate (cAMP) accumulation and prolactin release in normal rat pituitary cells in culture. cAMP accumulation is significant (P less than 0.01) at VIP concentrations as low as 1 nM and reaches a maximum with 0.1 microM. Addition of dexamethasone as early as 15 min before VIP inhibits VIP stimulation of both cAMP production and PRL secretion. The rapid inhibition is dose-dependent: it appears at doses as low as 0.01 pM and is complete at 1 pM dexamethasone. Increasing concentrations of dexamethasone induce a noncompetitive type of inhibition, as shown by the decrease in Vmax with no change in the apparent Km for VIP. Cycloheximide (1 mM) counteracts the inhibitory effect of dexamethasone on VIP-induced cAMP production, which suggests the involvement of a rapid protein synthesis mechanism. Ru-26988, a specific glucocorticoid devoid of any mineralocorticoid activity and which does not bind to intracellular transcortin-like component, also produces an inhibition of VIP-induced cAMP accumulation. Corticosterone also inhibits VIP-induced cAMP production but at concentrations higher than those of dexamethasone. In contrast, aldosterone, progesterone, estradiol, and testosterone have no effect. These results demonstrate that, in normal rat pituitary cells in culture, glucocorticoids at physiological concentrations rapidly inhibit the cAMP production and prolactin release induced by VIP by acting through specific glucocorticoid receptors. PMID:6278481

  11. Cortisol rapidly reduces prolactin release and cAMP and sup 45 Ca sup 2+ accumulation in the cichlid fish pituitary in vitro

    SciTech Connect

    Borski, R.J.; Helms, L.M.H.; Richman, N.H., III; Grau, E.G. )

    1991-04-01

    During in vitro incubation, prolactin release is inhibited in a dose-related manner by cortisol. This action is mimicked by the synthetic glucocorticoid agonist dexamethasone but not by other steroids tested. Perifusion studies indicate that the inhibition of ({sup 3}H)prolactin release by cortisol occurs within 20 min. Cortisol (50 nM) also inhibits cAMP accumulation and reduces {sup 45}Ca{sup 2+} accumulation in the tilapia rostral pars distalis within 15 min. Cortisol's action on prolactin release is blocked in the presence of either the Ca{sup 2+} ionophore A23187 or a combination of dibutyryl cAMP and 3-isobutyl-1-methylxanthine, which increase intracellular Ca{sup 2+} and cAMP, respectively. Taken together, these findings suggest that cortisol may play a physiologically relevant role in the rapid modulation of prolactin secretion in vivo. These studies also suggest that the inhibition of prolactin release by cortisol is a specific glucocorticoid action that may be mediated, in part, through cortisol's ability to inhibit intracellular cAMP and Ca{sup 2+} metabolism.

  12. Vasoactive intestinal peptide receptor regulation of cAMP accumulation and glycogen hydrolysis in the human Ewing's sarcoma cell line WE-68.

    PubMed

    Van Valen, F; Jürgens, H; Winkelmann, W; Keck, E

    1989-01-01

    This study describes functional characteristics of receptors for vasoactive intestinal peptide (VIP) on human Ewing's sarcoma WE-68 cells. These characteristics include 125I-VIP binding capacity, cellular cAMP generation, glycogen hydrolysis, and pharmacological specificity. Binding studies with 125I-VIP showed specific, saturable, binding sites for VIP in WE-68 cells. Scatchard analysis revealed the presence of a single class of high-affinity binding sites that exhibited a dissociation constant (Kd) of 90 pM and a maximal binding capacity (Bmax) of 24 fmol/mg of protein. VIP and VIP-related peptides competed for 125I-VIP binding in the following order of potency: human (h) VIP greater than human peptide with N-terminal histidine and C-terminal methionine (PHM) greater than chicken secretin much greater than porcine secretin. Glucagon and the C-terminal fragments VIP[10-28] and VIP[16-28] and the VIP analogue (D-Phe2)VIP did not inhibit 125I-VIP binding. Addition of hVIP to WE-68 cells provoked marked stimulation of cAMP accumulation, hVIP stimulated increases in cAMP content were rapid, concentration-dependent, and potentiated by 3-isobutyl-l-methylxanthine (IBMX). Half-maximal stimulation (EC50) occurred at 150 nM hVIP. The ability of hVIP and analogues to stimulate cAMP generation paralleled their potencies in displacing 125I-VIP binding. (D-Phe2)VIP, VIP[10-28], VIP[16-28], and (p-Cl-D-Phe6, Leu17)VIP, a putative VIP receptor antagonist, affected neither basal cAMP levels nor hVIP-induced cAMP accumulation. WE-68 cell responses to hVIP were desensitized by prior exposure to hVIP. Desensitization to hVIP did not modify the cAMP response to beta-adrenergic stimulation, and beta-adrenergic agonist desensitization did not modify responses to hVIP. hVIP also induced a time- and concentration-dependent hydrolysis of 3H-glycogen newly formed from 3H-glucose in WE-68 cultures. hVIP maximally decreased 3H-glycogen content by 36% with an EC50 value of about 8 nM. The

  13. meso-Dihydroguaiaretic acid inhibits hepatic lipid accumulation by activating AMP-activated protein kinase in human HepG2 cells.

    PubMed

    Lee, Myoung-Su; Kim, Kyung Jin; Kim, Daeyoung; Lee, Kyung-Eun; Hwang, Jae-Kwan

    2011-01-01

    Hepatic lipid accumulation is a major risk factor for dyslipidemia, nonalcoholic fatty liver disease, and insulin resistance. The present study was conducted to evaluate hypolipidemic effects of meso-dihydroguaiaretic acid (MDA), anti-oxidative and anti-inflammatory compound isolated from the Myristica fragrans HOUTT., by oil red O staining, reverse transcription-polymerase chain reaction (RT-PCR), and Western blot. MDA significantly inhibited insulin-induced hepatic lipid accumulation in a dose-dependent manner. The lipid-lowering effect of MDA was accompanied by increased expression of proteins involved in fatty acid oxidation and decreased expression of lipid synthetic proteins. In addition, MDA activated AMP-activated protein kinase (AMPK) as determined by phosphorylation of acetyl-CoA carboxylase (ACC), a downstream target of AMPK. The effects of MDA on lipogenic protein expression were suppressed by pretreatment with compound C, an AMPK inhibitor. Taken together, these findings show that MDA inhibits insulin-induced lipid accumulation in human HepG2 cells by suppressing expression of lipogenic proteins through AMPK signaling, suggesting a potent lipid-lowering agent. PMID:21963507

  14. Elevation of cAMP Levels Inhibits Doxorubicin-Induced Apoptosis in Pre- B ALL NALM- 6 Cells Through Induction of BAD Phosphorylation and Inhibition of P53 Accumulation.

    PubMed

    Fatemi, Ahmad; Kazemi, Ahmad; Kashiri, Meysam; Safa, Majid

    2015-01-01

    Recognition of the molecular mechanisms of cAMP action against DNA damage-induced apoptosis can be useful to improve the efficacy of DNA damaging therapeutic agents. Considering the critical role of bcl-2-associated death promoter (BAD) and p53 proteins in DNA damage -induced apoptosis, the aim of this study was to assess the effect of cAMP-elevating agents on these proteins in doxorubicin-treated pre-B acute lymphoblastic leukemia (pre-B ALL) NALM-6 cells.The pre-B ALL cell line NALM-6 was cultured and treated with doxorubicin in combination with or without cAMP-elevating agents forskolin and 3-isobutyl-1-methylxanthine (IBMX). Cell viability was measured by trypan blue staining and MTT assay. For evaluation of apoptosis, annexin-V staining by flow cytometry and caspase-3 activity assay were used. Protein expression of p53, BAD and phoshorylated BAD was detected by western blotting analysis.cAMP-increasing agents diminished the doxorubicin-mediated cytotoxicity in NALM-6 cells as indicated by the viability assays. Annexin-V apoptosis assay showed that the cAMP-elevating agents decreased doxorubicin-induced apoptosis. Moreover, doxorubicin-induced caspase-3 activity was attenuated in the presence of cAMP-increasing agents. Western blot results revealed the reduced expression of p53 protein in cells treated with combination of cAMP-elevating agents and doxorubicin in contrast to cells treated with doxorubicin alone. Expression of total BAD protein was not affected by doxorubicin and cAMP-elevating agents. However, phosphorylation of BAD protein was induced in the presence of cAMP-elevating agents. Our study suggests that elevated cAMP levels inhibit doxorubicin-induced apoptosis in pre-B ALL cells through induction of BAD phosphorylation and abrogation of p53 accumulation.

  15. Species differences in the effects of prostaglandins on inositol trisphosphate accumulation, phosphatidic acid formation, myosin light chain phosphorylation and contraction in iris sphincter of the mammalian eye: interaction with the cyclic AMP system.

    PubMed

    Yousufzai, S Y; Chen, A L; Abdel-Latif, A A

    1988-12-01

    Comparative studies on the effects of prostaglandins (PGs) on 1,2-diacylglycerol, measured as phosphatidic acid (PA), and inositol trisphosphate (IP3) production, cyclic AMP (cAMP) formation, myosin light chain (MLC) phosphorylation and contraction in the iris sphincter smooth muscle of rabbit, bovine and other mammalian species were undertaken and functional and biochemical relationships between the IP3-Ca++ and cAMP second messenger systems were demonstrated. The findings obtained from these studies can be summarized as follows: 1) all PGs investigated, including PGE2, PGF2 alpha, PGF2 alpha-ester, PGE1 and PGA2 increased IP3 accumulation and PA formation, and the extent of stimulation was dependent on the animal species. Thus, PGF2 alpha-ester (1 microM), the most potent of the PGs, increased IP3 accumulation in rabbit and bovine sphincters by 33 and 58%, respectively, and increased PA formation by 67 and 56%, respectively. The PG increased IP3 accumulation in both rabbit and bovine sphincters very rapidly (T1/2 values about 26 sec) and in a dose-dependent manner. 2) The PG had no effect on MLC phosphorylation in the rabbit sphincter, but it increased that of the bovine by 36%. 3) The PG increased cAMP formation by 75% in the rabbit sphincter but it had no effect on that of the bovine. 4) The PG induced a maximal contractile response in the bovine sphincter but it had no effect on that of the rabbit. 5) In the bovine, PGA2 induced IP3 accumulation and contraction, without an effect on cAMP formation; however, in the rabbit, cat and dog it increased cAMP formation and had no effect on IP3 accumulation and contraction.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. The combined inhibitory effect of the adenosine A1 and cannabinoid CB1 receptors on cAMP accumulation in the hippocampus is additive and independent of A1 receptor desensitization.

    PubMed

    Serpa, André; Correia, Sara; Ribeiro, Joaquim A; Sebastião, Ana M; Cascalheira, José F

    2015-01-01

    Adenosine A1 and cannabinoid CB1 receptors are highly expressed in hippocampus where they trigger similar transduction pathways. We investigated how the combined acute activation of A1 and CB1 receptors modulates cAMP accumulation in rat hippocampal slices. The CB1 agonist WIN55212-2 (0.3-30 μM) decreased forskolin-stimulated cAMP accumulation with an EC50 of 6.6±2.7 μM and an Emax of 31%±2%, whereas for the A1 agonist, N6-cyclopentyladenosine (CPA, 10-150 nM), an EC50 of 35±19 nM, and an Emax of 29%±5 were obtained. The combined inhibitory effect of WIN55212-2 (30 μM) and CPA (100 nM) on cAMP accumulation was 41%±6% (n=4), which did not differ (P>0.7) from the sum of the individual effects of each agonist (43%±8%) but was different (P<0.05) from the effects of CPA or WIN55212-2 alone. Preincubation with CPA (100 nM) for 95 min caused desensitization of adenosine A1 activity, which did not modify the effect of WIN55212-2 (30 μM) on cAMP accumulation. In conclusion, the combined effect of CB1 and A1 receptors on cAMP formation is additive and CB1 receptor activity is not affected by short-term A1 receptor desensitization.

  17. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  18. Schwann Cells Metabolize Extracellular 2',3'-cAMP to 2'-AMP.

    PubMed

    Verrier, Jonathan D; Kochanek, Patrick M; Jackson, Edwin K

    2015-08-01

    The 3',5'-cAMP-adenosine pathway (3',5'-cAMP→5'-AMP→adenosine) and the 2',3'-cAMP-adenosine pathway (2',3'-cAMP→2'-AMP/3'-AMP→adenosine) are active in the brain. Oligodendrocytes participate in the brain 2',3'-cAMP-adenosine pathway via their robust expression of 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase; converts 2',3'-cAMP to 2'-AMP). Because Schwann cells also express CNPase, it is conceivable that the 2',3'-cAMP-adenosine pathway exists in the peripheral nervous system. To test this and to compare the 2',3'-cAMP-adenosine pathway to the 3',5'-cAMP-adenosine pathway in Schwann cells, we examined the metabolism of 2',3'-cAMP, 2'-AMP, 3'-AMP, 3',5'-cAMP, and 5'-AMP in primary rat Schwann cells in culture. Addition of 2',3'-cAMP (3, 10, and 30 µM) to Schwann cells increased levels of 2'-AMP in the medium from 0.006 ± 0.002 to 21 ± 2, 70 ± 3, and 187 ± 10 nM/µg protein, respectively; in contrast, Schwann cells had little ability to convert 2',3'-cAMP to 3'-AMP or 3',5'-cAMP to either 3'-AMP or 5'-AMP. Although Schwann cells slightly converted 2',3'-cAMP and 2'-AMP to adenosine, they did so at very modest rates (e.g., 5- and 3-fold, respectively, more slowly compared with our previously reported studies in oligodendrocytes). Using transected myelinated rat sciatic nerves in culture medium, we observed a time-related increase in endogenous intracellular 2',3'-cAMP and extracellular 2'-AMP. These findings indicate that Schwann cells do not have a robust 3',5'-cAMP-adenosine pathway but do have a 2',3'-cAMP-adenosine pathway; however, because the pathway mostly involves 2'-AMP formation rather than 3'-AMP, and because the conversion of 2'-AMP to adenosine is slow, metabolism of 2',3'-cAMP mostly results in the accumulation of 2'-AMP. Accumulation of 2'-AMP in peripheral nerves postinjury could have pathophysiological consequences. PMID:25998049

  19. Effect of Serum from Chickens Treated with Clenbuterol on Myosin Accumulation, Beta-Adrenergic Receptor Population, and Cyclic AMP Synthesis in Embryonic Chicken Skeletal Muscle Cell Cultures

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Wuethrich, Andrew J.; Hancock, Deana L.

    2002-01-01

    Broiler chickens at 35 d of age were fed 1 ppm clenbuterol for 14 d. This level of dietary clenbuterol led to 5-7% increases in the weights of leg and breast muscle tissue. At the end of the 14-d period, serum was prepared from both control and clenbuterol-treated chickens, and was then employed as a component of cell culture media at a final concentration of 20% (v/v). Muscle cell cultures were prepared from both the leg and the breast muscle groups of 12-d chick embryos. Treatment groups included control chicken serum to which 10 nM, 50 nM, and 1 uM clenbuterol had been added, as well as cells grown in media containing 10% horse serum. Cultures were subjected to each treatment for 3 d, beginning on the seventh d in culture. Neither the percent fusion nor the number of nuclei in myotubes was significantly affected by any of the treatments. The quantity of myosin heavy chains (MHCs) was not increased by serum from clenbuterol-treated chickens in either breast or leg muscle cultures; however, the MHC quantity was 50-150% higher in cultures grown in control chicken serum to which 10 and 50 nM clenbuterol had also been added. The B-adrenergic receptor (betaAR) population was 4000-7000 betaARs per cell in cultures grown in chicken serum with leg muscle cultures having approximately 25-30% more receptors than breast muscle Culture. Receptor population was not significantly affected by the presence of clenbuterol or by the presence of serum from clenbuterol-treated chickens. In contrast, the betaAR Population in leg and breast muscle cultures grown in the presence of 10% horse serum was 16,000-18,000 betaARs per cell. Basal concentration of cyclic adenosine 3':5'monophosphate (cAMP) was not significantly affected by the treatments. When cultures grown in chicken serum were stimulated for 10 min with 1 uM isoproterenol, limited increases of 12-20% in cAMP Concentration above the. basal levels were observed. However, when cultures grown in the presence of horse serum were

  20. Compartmentalized accumulation of cAMP near complexes of multidrug resistance protein 4 (MRP4) and cystic fibrosis transmembrane conductance regulator (CFTR) contributes to drug-induced diarrhea.

    PubMed

    Moon, Changsuk; Zhang, Weiqiang; Ren, Aixia; Arora, Kavisha; Sinha, Chandrima; Yarlagadda, Sunitha; Woodrooffe, Koryse; Schuetz, John D; Valasani, Koteswara Rao; de Jonge, Hugo R; Shanmukhappa, Shiva Kumar; Shata, Mohamed Tarek M; Buddington, Randal K; Parthasarathi, Kaushik; Naren, Anjaparavanda P

    2015-05-01

    Diarrhea is one of the most common adverse side effects observed in ∼7% of individuals consuming Food and Drug Administration (FDA)-approved drugs. The mechanism of how these drugs alter fluid secretion in the gut and induce diarrhea is not clearly understood. Several drugs are either substrates or inhibitors of multidrug resistance protein 4 (MRP4), such as the anti-colon cancer drug irinotecan and an anti-retroviral used to treat HIV infection, 3'-azido-3'-deoxythymidine (AZT). These drugs activate cystic fibrosis transmembrane conductance regulator (CFTR)-mediated fluid secretion by inhibiting MRP4-mediated cAMP efflux. Binding of drugs to MRP4 augments the formation of MRP4-CFTR-containing macromolecular complexes that is mediated via scaffolding protein PDZK1. Importantly, HIV patients on AZT treatment demonstrate augmented MRP4-CFTR complex formation in the colon, which defines a novel paradigm of drug-induced diarrhea.

  1. Adenosine 5'-(gamma-thio) triphosphate (ATPgammaS) stimulates both P2Y receptors linked to inositol phosphates production and cAMP accumulation in bovine adrenocortical fasciculata cells.

    PubMed

    Nishi, Haruhisa; Hori, Seiji; Niitsu, Akiyoshi; Kawamura, Masahiro

    2004-01-16

    The study was aimed to investigate the existence of at least two kinds of P2Y receptors linked to steroidogenesis in bovine adrenocortical fasciculata cells (BAFCs). Extracellular nucleotides facilitated steroidogenesis in BAFCs. The potency order was UTP > adenosine 5'-(gamma-thio) triphosphate (ATPgammaS) > ATP > 2-methylthio ATP (2MeSATP) > adenosine 5'-(beta-thio) diphosphate (ADPbetaS) > alpha,beta-methylene ATP (alpha,beta-me-ATP), beta,gamma-methylene ATP (beta,gamma -me-ATP). ATPgammaS (10-100 microM) remarkably stimulated both total inositol phosphates (IPs) production and cyclic AMP (cAMP) accumulation. Competitive displacement experiments by using [35S]ATPgammaS as a radioactive ligand in BAFCs showed that the potency under these unlabelled ligands was ATPgammaS > ATP > ADPbetaS > 2MeSATP > UTP > alpha,beta-me-ATP, beta,gamma-me-ATP. These suggest that two different binding sites of [35S]ATPgammaS, namely P2Y receptors, exist in BAFCs, and that these receptors are linked to steroidogenesis via distinct second messenger systems in the cells.

  2. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC.

    PubMed

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  3. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC

    PubMed Central

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  4. Houttuynia cordata attenuates lipid accumulation via activation of AMP-activated protein kinase signaling pathway in HepG2 cells.

    PubMed

    Kang, Hyun; Koppula, Sushruta

    2014-01-01

    Houttuynia cordata (H. cordata) from the family Saururaceae is a perennial herb native to Southeast Asia. It possesses a range of medicinal properties to treat several disease symptoms including allergic inflammation and anaphylaxis. In the present investigation, we provided the molecular mechanisms underlying the role of H. cordata extract (HCE) in the prevention of high glucose-induced lipid accumulation in human HepG2 hepatocytes. HepG2 cells were pre-treated with various concentrations of HCE (0, 10, 20, 40, and 80 μg/mL) and treated with serum-free medium with normal glucose (5 mM) for 1 h, followed by exposure to high glucose (25 mM D-glucose) for 24 h. HCE significantly and dose-dependently attenuated lipid accumulation in human HepG2 hepatocytes when exposed to high glucose (25 mM D-glucose) (p < 0.05, p < 0.01 and p < 0.001 at 20, 40, and 80 μg/mL concentrations, respectively). Further, HCE attenuated the expression of fatty acid synthase (FAS), sterol regulatory element-binding protein-1 and glycerol 3-phosphate acyltransferases (GPATs). The adenosine monophosphate-activated protein kinase (AMPK) was also activated by HCE treatment when exposed to high glucose (25 mM D-glucose) in human HepG2 hepatocytes. This study suggests the hypolipidemic effects of HCE by the inhibition of lipid biosynthesis mediated through AMPK signaling, which may play an active role and can be developed as an anti-obesity agent. PMID:24871657

  5. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  6. Cyclic AMP efflux inhibitors as potential therapeutic agents for leukemia

    PubMed Central

    Perez, Dominique R.; Smagley, Yelena; Garcia, Matthew; Carter, Mark B.; Evangelisti, Annette; Matlawska-Wasowska, Ksenia; Winter, Stuart S.; Sklar, Larry A.; Chigaev, Alexandre

    2016-01-01

    Apoptotic evasion is a hallmark of cancer. We propose that some cancers may evade cell death by regulating 3′-5′-cyclic adenosine monophosphate (cAMP), which is associated with pro-apoptotic signaling. We hypothesize that leukemic cells possess mechanisms that efflux cAMP from the cytoplasm, thus protecting them from apoptosis. Accordingly, cAMP efflux inhibition should result in: cAMP accumulation, activation of cAMP-dependent downstream signaling, viability loss, and apoptosis. We developed a novel assay to assess cAMP efflux and performed screens to identify inhibitors. In an acute myeloid leukemia (AML) model, several identified compounds reduced cAMP efflux, appropriately modulated pathways that are responsive to cAMP elevation (cAMP-responsive element-binding protein phosphorylation, and deactivation of Very Late Antigen-4 integrin), and induced mitochondrial depolarization and caspase activation. Blocking adenylyl cyclase activity was sufficient to reduce effects of the most potent compounds. These compounds also decreased cAMP efflux and viability of B-lineage acute lymphoblastic leukemia (B-ALL) cell lines and primary patient samples, but not of normal primary peripheral blood mononuclear cells. Our data suggest that cAMP efflux is a functional feature that could be therapeutically targeted in leukemia. Furthermore, because some of the identified drugs are currently used for treating other illnesses, this work creates an opportunity for repurposing. PMID:27129155

  7. AMPED Program Overview

    ScienceCinema

    Gur, Ilan

    2016-07-12

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  8. AMPED Program Overview

    SciTech Connect

    Gur, Ilan

    2014-03-04

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  9. cAMP signalling meets mitochondrial compartments.

    PubMed

    Lefkimmiatis, Konstantinos

    2014-04-01

    Mitochondria are highly dynamic organelles comprising at least three distinct areas, the OMM (outer mitochondrial membrane), the IMS (intermembrane space) and the mitochondrial matrix. Physical compartmentalization allows these organelles to host different functional domains and therefore participate in a variety of important cellular actions such as ATP synthesis and programmed cell death. In a surprising homology, it is now widely accepted that the ubiquitous second messenger cAMP uses the same stratagem, compartmentalization, in order to achieve the characteristic functional pleiotropy of its pathway. Accumulating evidence suggests that all the main mitochondrial compartments contain segregated cAMP cascades; however, the regulatory properties and functional significance of such domains are not fully understood and often remain controversial issues. The present mini-review discusses our current knowledge of how the marriage between mitochondrial and cAMP compartmentalization is achieved and its effects on the biology of the cell. PMID:24646228

  10. Luteinizing hormone-releasing hormone (LHRH) attenuates morphine-induced inhibition of cyclic AMP (cAMP) in opioid-responsive SK-N-SH cells.

    PubMed

    Ratka, A; Simpkins, J W

    1997-04-01

    SK-N-SH cells were used to assess the effects of luteinizing hormone-releasing hormone (LHRH) on opioid receptor-mediated changes in cyclic AMP (cAMP). Prostaglandin E1 (PGE1, 1 microM) caused a dramatic increase in cAMP levels. Treatment with 10 microM morphine (MOR) significantly inhibited the stimulatory effect of PGE1, LHRH (0.8 microM) caused an increase in the basal level of intracellular cAMP and potentiated the stimulatory effect of PGE1 on cAMP accumulation. In cells pretreated with LHRH the inhibitory effect of MOR on cAMP accumulation was significantly attenuated. An LHRH antagonist had no effect on cAMP. The involvement of pertussis toxin (PTX)-sensitive G proteins in the actions of LHRH was studied. PTX increased the stimulatory effect of PGE1 on cAMP and attenuated the inhibitory effect of MOR. However, PTX pretreatment prevented the effects of LHRH on the intracellular actions of PGE1 but exerted an additive effect with LHRH in blocking the MOR-induced decrease in cAMP levels. We conclude that LHRH attenuates the inhibitory, opioid receptor-mediated effect of MOR on intracellular cAMP accumulation in SK-N-SH cells, and that the G protein-independent mechanism may be involved in LHRH-induced attenuation of the inhibitory effect of MOR on neuronal cAMP.

  11. Accumulate repeat accumulate codes

    NASA Technical Reports Server (NTRS)

    Abbasfar, Aliazam; Divsalar, Dariush; Yao, Kung

    2004-01-01

    In this paper we propose an innovative channel coding scheme called 'Accumulate Repeat Accumulate codes' (ARA). This class of codes can be viewed as serial turbo-like codes, or as a subclass of Low Density Parity Check (LDPC) codes, thus belief propagation can be used for iterative decoding of ARA codes on a graph. The structure of encoder for this class can be viewed as precoded Repeat Accumulate (RA) code or as precoded Irregular Repeat Accumulate (IRA) code, where simply an accumulator is chosen as a precoder. Thus ARA codes have simple, and very fast encoder structure when they representing LDPC codes. Based on density evolution for LDPC codes through some examples for ARA codes, we show that for maximum variable node degree 5 a minimum bit SNR as low as 0.08 dB from channel capacity for rate 1/2 can be achieved as the block size goes to infinity. Thus based on fixed low maximum variable node degree, its threshold outperforms not only the RA and IRA codes but also the best known LDPC codes with the dame maximum node degree. Furthermore by puncturing the accumulators any desired high rate codes close to code rate 1 can be obtained with thresholds that stay close to the channel capacity thresholds uniformly. Iterative decoding simulation results are provided. The ARA codes also have projected graph or protograph representation that allows for high speed decoder implementation.

  12. A Fluorescent Transport Assay Enables Studying AmpG Permeases Involved in Peptidoglycan Recycling and Antibiotic Resistance.

    PubMed

    Perley-Robertson, G Evan; Yadav, Anuj K; Winogrodzki, Judith L; Stubbs, Keith A; Mark, Brian L; Vocadlo, David J

    2016-09-16

    Inducible AmpC β-lactamases deactivate a broad-spectrum of β-lactam antibiotics and afford antibiotic resistance in many Gram-negative bacteria. The disturbance of peptidoglycan recycling caused by β-lactam antibiotics leads to accumulation of GlcNAc-1,6-anhydroMurNAc-peptides, which are transported by AmpG to the cytoplasm where they are processed into AmpC inducers. AmpG transporters are poorly understood; however, their loss restores susceptibility toward β-lactam antibiotics, highlighting AmpG as a potential target for resistance-attenuating therapeutics. We prepare a GlcNAc-1,6-anhydroMurNAc-fluorophore conjugate and, using live E. coli spheroplasts, quantitatively analyze its transport by AmpG and inhibition of this process by a competing substrate. Further, we use this transport assay to evaluate the function of two AmpG homologues from Pseudomonas aeruginosa and show that P. aeruginosa AmpG (Pa-AmpG) but not AmpP (Pa-AmpP) transports this probe substrate. We corroborate these results by AmpC induction assays with Pa-AmpG and Pa-AmpP. This fluorescent AmpG probe and spheroplast-based transport assay will enable improved understanding of PG recycling and of permeases from the major facilitator superfamily of transport proteins and may aid in identification of AmpG antagonists that combat AmpC-mediated resistance toward β-lactam antibiotics.

  13. Applying Mathematical Processes (AMP)

    ERIC Educational Resources Information Center

    Kathotia, Vinay

    2011-01-01

    This article provides insights into the "Applying Mathematical Processes" resources, developed by the Nuffield Foundation. It features Nuffield AMP activities--and related ones from Bowland Maths--that were designed to support the teaching and assessment of key processes in mathematics--representing a situation mathematically, analysing,…

  14. Mutants of PC12 cells with altered cyclic AMP responses

    SciTech Connect

    Block, T.; Kon, C.; Breckenridge, B.M.

    1984-10-01

    PCl2 cells, derived from a rat pheochromocytoma, were mutagenized and selected in media containing agents known to elevate intracellular concentrations of cyclic AMP (cAMP). More than 40 clones were isolated by selection with cholera toxin or 2-chloroadenosine or both. The variants that were deficient in accumulating cAMP were obtained by using a protocol in which 1 ..mu..m 8-bromo-cAMP was included in addition to the agonist. Certain of these variants were partially characterized with respect to the site of altered cAMP metabolism. The profiles of adenylate cyclase activity responsiveness of certain variants to guanosine-5'-(BETA,..gamma..-imido) triphosphate and to forskolin resembled those of UNC and cyc phenotypes of S49 lymphoma cells, which are functionally deficient in the GTP-sensitive coupling protein, N/sub s/. Other variants were characterized by increased cyclic nucleotide phosphodiesterase activity at low substrate concentration. Diverse morphological traits were observed among the variants, but it was not possible to assign them to a particular cAMP phenotype. Two revertants of a PCl2 mutant were isolated and observed to have regained a cellular cAMP response to 2-chloroadenosine and to forskolin. It is hoped that these PCl2 mutants will have utility for defining cAMP-mediated functions, including any links to the action of nerve growth factor, in cells derived from the neural crest.

  15. Accumulate-Repeat-Accumulate-Accumulate-Codes

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush; Dolinar, Sam; Thorpe, Jeremy

    2004-01-01

    Inspired by recently proposed Accumulate-Repeat-Accumulate (ARA) codes [15], in this paper we propose a channel coding scheme called Accumulate-Repeat-Accumulate-Accumulate (ARAA) codes. These codes can be seen as serial turbo-like codes or as a subclass of Low Density Parity Check (LDPC) codes, and they have a projected graph or protograph representation; this allows for a high-speed iterative decoder implementation using belief propagation. An ARAA code can be viewed as a precoded Repeat-and-Accumulate (RA) code with puncturing in concatenation with another accumulator, where simply an accumulator is chosen as the precoder; thus ARAA codes have a very fast encoder structure. Using density evolution on their associated protographs, we find examples of rate-lJ2 ARAA codes with maximum variable node degree 4 for which a minimum bit-SNR as low as 0.21 dB from the channel capacity limit can be achieved as the block size goes to infinity. Such a low threshold cannot be achieved by RA or Irregular RA (IRA) or unstructured irregular LDPC codes with the same constraint on the maximum variable node degree. Furthermore by puncturing the accumulators we can construct families of higher rate ARAA codes with thresholds that stay close to their respective channel capacity thresholds uniformly. Iterative decoding simulation results show comparable performance with the best-known LDPC codes but with very low error floor even at moderate block sizes.

  16. Accumulate-Repeat-Accumulate-Accumulate Codes

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush; Dolinar, Samuel; Thorpe, Jeremy

    2007-01-01

    Accumulate-repeat-accumulate-accumulate (ARAA) codes have been proposed, inspired by the recently proposed accumulate-repeat-accumulate (ARA) codes. These are error-correcting codes suitable for use in a variety of wireless data-communication systems that include noisy channels. ARAA codes can be regarded as serial turbolike codes or as a subclass of low-density parity-check (LDPC) codes, and, like ARA codes they have projected graph or protograph representations; these characteristics make it possible to design high-speed iterative decoders that utilize belief-propagation algorithms. The objective in proposing ARAA codes as a subclass of ARA codes was to enhance the error-floor performance of ARA codes while maintaining simple encoding structures and low maximum variable node degree.

  17. An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis

    PubMed Central

    Gundlach, Jan; Mehne, Felix M. P.; Herzberg, Christina; Kampf, Jan; Valerius, Oliver; Kaever, Volkhard

    2015-01-01

    ABSTRACT Gram-positive bacteria synthesize the second messenger cyclic di-AMP (c-di-AMP) to control cell wall and potassium homeostasis and to secure the integrity of their DNA. In the firmicutes, c-di-AMP is essential for growth. The model organism Bacillus subtilis encodes three diadenylate cyclases and two potential phosphodiesterases to produce and degrade c-di-AMP, respectively. Among the three cyclases, CdaA is conserved in nearly all firmicutes, and this enzyme seems to be responsible for the c-di-AMP that is required for cell wall homeostasis. Here, we demonstrate that CdaA localizes to the membrane and forms a complex with the regulatory protein CdaR and the glucosamine-6-phosphate mutase GlmM. Interestingly, cdaA, cdaR, and glmM form a gene cluster that is conserved throughout the firmicutes. This conserved arrangement and the observed interaction between the three proteins suggest a functional relationship. Our data suggest that GlmM and GlmS are involved in the control of c-di-AMP synthesis. These enzymes convert glutamine and fructose-6-phosphate to glutamate and glucosamine-1-phosphate. c-di-AMP synthesis is enhanced if the cells are grown in the presence of glutamate compared to that in glutamine-grown cells. Thus, the quality of the nitrogen source is an important signal for c-di-AMP production. In the analysis of c-di-AMP-degrading phosphodiesterases, we observed that both phosphodiesterases, GdpP and PgpH (previously known as YqfF), contribute to the degradation of the second messenger. Accumulation of c-di-AMP in a gdpP pgpH double mutant is toxic for the cells, and the cells respond to this accumulation by inactivation of the diadenylate cyclase CdaA. IMPORTANCE Bacteria use second messengers for signal transduction. Cyclic di-AMP (c-di-AMP) is the only second messenger known so far that is essential for a large group of bacteria. We have studied the regulation of c-di-AMP synthesis and the role of the phosphodiesterases that degrade this second

  18. AMP-18 Targets p21 to Maintain Epithelial Homeostasis.

    PubMed

    Chen, Peili; Li, Yan Chun; Toback, F Gary

    2015-01-01

    Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD). We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP)-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF)-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI) mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21 WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD.

  19. Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacterium smegmatis

    PubMed Central

    Tang, Qing; Luo, Yunchao; Zheng, Cao; Yin, Kang; Ali, Maria Kanwal; Li, Xinfeng; He, Jin

    2015-01-01

    Cyclic di‑AMP (c-di-AMP) is a second signaling molecule involved in the regulation of bacterial physiological processes and interaction between pathogen and host. However, the regulatory network mediated by c-di-AMP in Mycobacterium remains obscure. In M. smegmatis, a diadenylate cyclase (DAC) was reported recently, but there is still no investigation on c-di-AMP phosphodiesterase (PDE). Here, we provide a systematic study on signaling mechanism of c-di-AMP PDE in M. smegmatis. Based on our enzymatic analysis, MsPDE (MSMEG_2630), which contained a DHH-DHHA1 domain, displayed a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP. MsPDE was capable of converting c-di-AMP to pApA and AMP, and hydrolyzing pApA to AMP. Site-directed mutations in DHH and DHHA1 revealed that DHH domain was critical for the phosphodiesterase activity. To explore the regulatory role of c-di-AMP in vivo, we constructed the mspde mutant (Δmspde) and found that deficiency of MsPDE significantly enhanced intracellular C12-C20 fatty acid accumulation. Deficiency of DAC in many bacteria results in cell death. However, we acquired the M. smegmatis strain with DAC gene disrupted (ΔmsdisA) by homologous recombination approach. Deletion of msdisA reduced bacterial C12-C20 fatty acids production but scarcely affected bacterial survival. We also provided evidences that superfluous c-di-AMP in M. smegmatis could lead to abnormal colonial morphology. Collectively, our results indicate that MsPDE is a functional c-di-AMP-specific phosphodiesterase both in vitro and in vivo. Our study also expands the regulatory network mediated by c-di-AMP in M. smegmatis. PMID:26078723

  20. Experiment definition studies for AMPS Spacelab

    NASA Technical Reports Server (NTRS)

    Liemohn, H.

    1975-01-01

    The electrical charging of the space shuttle orbiter is discussed in relation to the AMPS Spacelab payload along with an operations research technique for the selection of AMPS Spacelab experiments. Experiments proposed for AMPS include: hydromagnetic wave experiments; bistatic sounder of AMPS wake; and an artificial meteor gun. Experiment objectives and instrument functions are given for all experiments.

  1. Cyclic Di-AMP Homeostasis in Bacillus subtilis

    PubMed Central

    Mehne, Felix M. P.; Gunka, Katrin; Eilers, Hinnerk; Herzberg, Christina; Kaever, Volkhard; Stülke, Jörg

    2013-01-01

    The genome of the Gram-positive soil bacterium Bacillus subtilis encodes three potential diadenylate cyclases that may synthesize the signaling nucleotide cyclic di-AMP (c-di-AMP). These enzymes are expressed under different conditions in different cell compartments, and they localize to distinct positions in the cell. Here we demonstrate the diadenylate cyclase activity of the so far uncharacterized enzymes CdaA (previously known as YbbP) and CdaS (YojJ). Our work confirms that c-di-AMP is essential for the growth of B. subtilis and shows that an excess of the molecule is also harmful for the bacteria. Several lines of evidence suggest that the diadenylate cyclase CdaA is part of the conserved essential cda-glm module involved in cell wall metabolism. In contrast, the CdaS enzyme seems to provide c-di-AMP for spores. Accumulation of large amounts of c-di-AMP impairs the growth of B. subtilis and results in the formation of aberrant curly cells. This phenotype can be partially suppressed by elevated concentrations of magnesium. These observations suggest that c-di-AMP interferes with the peptidoglycan synthesis machinery. The activity of the diadenylate cyclases is controlled by distinct molecular mechanisms. CdaA is stimulated by a regulatory interaction with the CdaR (YbbR) protein. In contrast, the activity of CdaS seems to be intrinsically restricted, and a single amino acid substitution is sufficient to drastically increase the activity of the enzyme. Taken together, our results support the idea of an important role for c-di-AMP in B. subtilis and suggest that the levels of the nucleotide have to be tightly controlled. PMID:23192352

  2. Increase in Endogenous and Exogenous Cyclic AMP Levels Inhibits Sclerotial Development in Sclerotinia sclerotiorum

    PubMed Central

    Rollins, Jeffrey A.; Dickman, Martin B.

    1998-01-01

    Growth and development of a wild-type Sclerotinia sclerotiorum isolate were examined in the presence of various pharmacological compounds to investigate signal transduction pathways that influence the development of sclerotia. Compounds known to increase endogenous cyclic AMP (cAMP) levels in other organisms by inhibiting phosphodiesterase activity (caffeine and 3-isobutyl-1-methyl xanthine) or by activating adenylate cyclase (NaF) reduced or eliminated sclerotial development in S. sclerotiorum. Growth in the presence of 5 mM caffeine correlated with increased levels of endogenous cAMP in mycelia. In addition, incorporation of cAMP into the growth medium decreased or eliminated the production of sclerotia in a concentration-dependent manner and increased the accumulation of oxalic acid. Inhibition of sclerotial development was cAMP specific, as exogenous cyclic GMP, AMP, and ATP did not influence sclerotial development. Transfer of developing cultures to cAMP-containing medium at successive time points demonstrated that cAMP inhibits development prior to or during sclerotial initiation. Together, these results indicate that cAMP plays a role in the early transition between mycelial growth and sclerotial development. PMID:9647827

  3. AMP-18 protects barrier function of colonic epithelial cells: role of tight junction proteins

    PubMed Central

    Walsh-Reitz, Margaret M.; Huang, Erick F.; Musch, Mark W.; Chang, Eugene B.; Martin, Terence E.; Kartha, Sreedharan; Toback, F. Gary

    2005-01-01

    AMP-18, a novel gastric antrum mucosal protein, and a synthetic peptide of amino acids 77-97, have mitogenic and motogenic properties for epithelial cells. The possibility that AMP-18 is also protective was evaluated in the colonic mucosa of mice and monolayer cultures of human colonic epithelial Caco2/bbe (C2) cells. Administration of AMP peptide to mice with dextran sulfate sodium (DSS)-induced colonic injury delayed the onset of bloody diarrhea, and reduced weight loss. Treatment of C2 cells with AMP peptide protected monolayers against decreases in transepithelial electrical resistance (TER) induced by the oxidant monochloramine, indomethacin, or DSS. A molecular mechanism for these barrier-protective effects was sought by asking if AMP peptide acted on specific tight junction (TJ) proteins. Immunoblots of detergent-insoluble fractions of C2 cells treated with AMP peptide exhibited increased accumulation of specific TJ proteins. Occludin immunoreactivity was also increased in detergent-insoluble fractions obtained from colonic mucosal cells of mice injected with AMP peptide. Laser scanning confocal microscopy (CF) supported the capacity of AMP peptide to enhance accumulation of occludin and ZO-1 in TJ domains of C2 cell monolayers, and together with immunoblot analysis showed that the peptide protected against loss of these TJ proteins following oxidant injury. AMP peptide also protected against a fall in TER during disruption of actin filaments by cytochalasin D, and stabilized perijunctional actin during oxidant injury when assessed by CF. These findings suggest that AMP-18 could protect the intestinal mucosal barrier by acting on specific TJ proteins and stabilizing perijunctional actin. PMID:15961882

  4. Cross-talk between glucagon- and adenosine-mediated signalling systems in rat hepatocytes: effects on cyclic AMP-phosphodiesterase activity.

    PubMed Central

    Robles-Flores, M; Allende, G; Piña, E; García-Sáinz, J A

    1995-01-01

    The effect of adenosine analogues on glucagon-stimulated cyclic AMP accumulation in rat hepatocytes was explored. N6-Cyclopentyladenosine (CPA), 5'-N-ethylcarboxamidoadenosine and N6-(R-phenylisopropyl)adenosine inhibited in a dose-dependent manner the cyclic AMP accumulation induced by glucagon. This effect seems to be mediated through A1 adenosine receptors. Pertussis toxin completely abolished the effect of CPA on glucagon-stimulated cyclic AMP accumulation in whole cells which suggested that a pertussis-toxin-sensitive G-protein was involved. On the other hand, this action of adenosine analogues on glucagon-induced cyclic AMP accumulation was reverted by the selective low-Km cyclic AMP-phosphodiesterase inhibitor Ro 20-1724. Analysis of cyclic AMP-phosphodiesterase activity in purified hepatocyte plasma membranes showed that glucagon in the presence of GTP inhibited basal PDE activity by 45% and that CPA reverted this inhibition in dose-dependent manner. In membranes derived from pertussis-toxin-treated rats, we observed no inhibition of cyclic AMP-phosphodiesterase activity by glucagon in the absence or presence of CPA. Our results indicate that in hepatocyte plasma membranes, stimulation of adenylate cyclase activity and inhibition of a low-Km cyclic AMP phosphodiesterase activity are co-ordinately regulated by glucagon, and that A1 adenosine receptors can inhibit glucagon-stimulated cyclic AMP accumulation by blocking glucagon's effect on phosphodiesterase activity. Images Figure 2 PMID:8554517

  5. Accumulate Repeat Accumulate Coded Modulation

    NASA Technical Reports Server (NTRS)

    Abbasfar, Aliazam; Divsalar, Dariush; Yao, Kung

    2004-01-01

    In this paper we propose an innovative coded modulation scheme called 'Accumulate Repeat Accumulate Coded Modulation' (ARA coded modulation). This class of codes can be viewed as serial turbo-like codes, or as a subclass of Low Density Parity Check (LDPC) codes that are combined with high level modulation. Thus at the decoder belief propagation can be used for iterative decoding of ARA coded modulation on a graph, provided a demapper transforms the received in-phase and quadrature samples to reliability of the bits.

  6. Serum-stimulated cyclic-AMP production in S49 lymphoma cells grown in serum-free medium.

    PubMed

    Darfler, F J; Mullen, M D; Insel, P A

    1984-03-23

    Growth of S49 lymphoma cells with horse serum leads to an increase in cellular cAMP phosphodiesterase activity and a resultant loss of hormone- and cholera-toxin-stimulated cAMP accumulation. We now show that the serum requires protein synthesis to produce these effects. Further, we show that acute addition of serum to wild-type S49 cells, grown in serum-free medium, rapidly (under 2 min) and transiently (under 30 min) stimulates cellular cAMP, 10-fold over basal levels. This 'acute' effect of serum was not observed in UNC S49 cells, suggesting that a functional Ns, the guanine nucleotide regulatory component that mediates stimulation of adenylate cyclase, is required for the serum-mediated stimulation of cellular cAMP. Serum added acutely to wild-type S49 cells also augmented cAMP accumulation in response to isoproterenol and forskolin. The half-maximally effective concentrations of horse serum that acutely stimulated or more slowly decreased the cAMP accumulation were approx. 0.2% and 2.0%, respectively. Preliminary attempts to characterize further the serum factor indicate that it has a high (250 000-300 000) molecular weight and is insensitive to boiling; chromatography on Sepharose CL-6B yields a 100-fold purification. Thus, the serum contains one or more components that activate adenylate cyclase, increase cellular cAMP levels and ultimately induce cAMP phosphodiesterase in S49 lymphoma cells. PMID:6322858

  7. Crystal structure of the AmpR effector binding domain provides insight into the molecular regulation of inducible ampc beta-lactamase.

    PubMed

    Balcewich, Misty D; Reeve, Thomas M; Orlikow, Evan A; Donald, Lynda J; Vocadlo, David J; Mark, Brian L

    2010-07-30

    Hyperproduction of AmpC beta-lactamase (AmpC) is a formidable mechanism of resistance to penicillins and cephalosporins in Gram-negative bacteria such as Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is regulated by the LysR-type transcriptional regulator AmpR. ampR and ampC genes form a divergent operon with overlapping promoters to which AmpR binds and regulates the transcription of both genes. AmpR induces ampC by binding to one member of the family of 1,6-anhydro-N-acetylmuramyl peptides, which are cytosolic catabolites of peptidoglycan that accumulate during beta-lactam challenge. To gain structural insights into AmpR regulation, we determined the crystal structure of the effector binding domain (EBD) of AmpR from Citrobacter freundii up to 1.83 A resolution. The AmpR EBD is dimeric and each monomer comprises two subdomains that adopt alpha/beta Rossmann-like folds. Located between the monomer subdomains is a pocket that was found to bind the crystallization buffer molecule 2-(N-morpholino)ethanesulfonic acid. The pocket, together with a groove along the surface of subdomain I, forms a putative effector binding site into which a molecule of 1,6-anhydro-N-acetylmuramyl pentapeptide could be modeled. Amino acid substitutions at the base of the interdomain pocket either were found to render AmpR incapable of inducing ampC (Thr103Val, Ser221Ala and Tyr264Phe) or resulted in constitutive ampC expression (Gly102Glu). While the substitutions that prevented ampC induction did not alter the overall AmpR EBD structure, circular dichroism spectroscopy revealed that the nonconservative Gly102Glu mutation affected EBD secondary structure, confirming previous work suggesting that Gly102Glu induces a conformational change to result in constitutive AmpC production. PMID:20594961

  8. Prostaglandins and muscarinic agonists induce cyclic AMP attenuation by two distinct mechanisms in the pregnant-rat myometrium. Interaction between cyclic AMP and Ca2+ signals.

    PubMed Central

    Goureau, O; Tanfin, Z; Harbon, S

    1990-01-01

    In pregnant-rat myometrium (day 21 of gestation), isoprenaline-induced cyclic AMP accumulation, resulting from receptor-mediated activation of adenylate cyclase, was negatively regulated by prostaglandins [PGE2, PGF2 alpha; EC50 (concn. giving 50% of maximal response) = 2 nM] and by the muscarinic agonist carbachol (EC50 = 2 microM). PG-induced inhibition was prevented by pertussis-toxin treatment, supporting the idea that it was mediated by the inhibitory G-protein Gi through the inhibitory pathway of the adenylate cyclase. Both isoprenaline-induced stimulation and PG-evoked inhibition of cyclic AMP were insensitive to Ca2+ depletion. By contrast, carbachol-evoked attenuation of cyclic AMP accumulation was dependent on Ca2+ and was insensitive to pertussis toxin. The inhibitory effect of carbachol was mimicked by ionomycin. Indirect evidence was thus provided for the enhancement of cyclic AMP degradation by a Ca2(+)-dependent phosphodiesterase activity in the muscarinic-mediated effect. The attenuation of cyclic AMP elicited by carbachol coincided with carbachol-stimulated inositol phosphate (InsP3, InsP2 and InsP) generation, which displayed an almost identical EC50 (3 microM) and was similarly unaffected by pertussis toxin. Both carbachol effects were reproduced by oxotremorine, whereas pilocarpine (a partial muscarinic agonist) failed to induce any decrease in cyclic AMP accumulation and concurrently was unable to stimulate the generation of inositol phosphates. These data support our proposal for a carbachol-mediated enhancement of a Ca2(+)-dependent phosphodiesterase activity, compatible with the rises in Ca2+ associated with muscarinic-induced increased generation of inositol phosphates. They further illustrate that a cross-talk between the two major transmembrane signalling systems contributed to an ultimate decrease in cyclic AMP in the pregnant-rat myometrium near term. PMID:1700899

  9. Heat accumulator

    SciTech Connect

    Bracht, A.

    1981-09-29

    A heat accumulator comprises a thermally-insulated reservoir full of paraffin wax mixture or other flowable or meltable heat storage mass, heat-exchangers immersed in the mass, a heat-trap connected to one of the heat-exchangers, and a heat user connected to the other heat-exchanger. Pumps circulate fluids through the heat-trap and the heat-using means and the respective heat-exchangers, and a stirrer agitates and circulates the mass, and the pumps and the stirrer and electric motors driving these devices are all immersed in the mass.

  10. Amps particle accelerator definition study

    NASA Technical Reports Server (NTRS)

    Sellen, J. M., Jr.

    1975-01-01

    The Particle Accelerator System of the AMPS (Atmospheric, Magnetospheric, and Plasmas in Space) payload is a series of charged particle accelerators to be flown with the Space Transportation System Shuttle on Spacelab missions. In the configuration presented, the total particle accelerator system consists of an energetic electron beam, an energetic ion accelerator, and both low voltage and high voltage plasma acceleration devices. The Orbiter is illustrated with such a particle accelerator system.

  11. Agile manufacturing prototyping system (AMPS)

    SciTech Connect

    Garcia, P.

    1998-05-09

    The Agile Manufacturing Prototyping System (AMPS) is being integrated at Sandia National Laboratories. AMPS consists of state of the industry flexible manufacturing hardware and software enhanced with Sandia advancements in sensor and model based control; automated programming, assembly and task planning; flexible fixturing; and automated reconfiguration technology. AMPS is focused on the agile production of complex electromechanical parts. It currently includes 7 robots (4 Adept One, 2 Adept 505, 1 Staubli RX90), conveyance equipment, and a collection of process equipment to form a flexible production line capable of assembling a wide range of electromechanical products. This system became operational in September 1995. Additional smart manufacturing processes will be integrated in the future. An automated spray cleaning workcell capable of handling alcohol and similar solvents was added in 1996 as well as parts cleaning and encapsulation equipment, automated deburring, and automated vision inspection stations. Plans for 1997 and out years include adding manufacturing processes for the rapid prototyping of electronic components such as soldering, paste dispensing and pick-and-place hardware.

  12. Atrazine acts as an endocrine disrupter by inhibiting cAMP-specific phosphodiesterase-4

    SciTech Connect

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2012-11-15

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. -- Highlights: ► Atrazine stimulates cAMP accumulation in pituitary and Leydig cells. ► Atrazine also stimulates PRL and androgens secretion. ► Stimulatory effects of atrazine were abolished in cells with IBMX-inhibited PDEs. ► Atrazine specificity toward cAMP

  13. Atrazine Acts as an Endocrine Disrupter by Inhibiting cAMP-specific Phosphodiesterase-4

    PubMed Central

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2014-01-01

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. PMID:23022511

  14. Cyclic AMP levels during induction and repression of cellulase biosynthesis in Thermomonospora curvata

    SciTech Connect

    Wood, W.E.; Neubauer, D.G.; Stutzenberger, F.J.

    1984-12-01

    Specific cellulase production rates (SCPR) were compared with intracellular cyclic AMP (cAMP) levels in the thermophilic actinomycete, Thermomonospora curvata, during growth on several carbon sources in a chemically defined medium. SCPR and cAMP levels were 0.03 U (endoglucanase (EG) units) and 2 pmol per mg of dry cells, respectively, during exponential growth on glucose. These values increased to about 6 and 25, respectively, during growth on cellulose. Detectable EG production ceased when cAMP levels dropped below 10. Cellobiose (usually considered to be a cellulase inducer) caused a sharp decrease in cAMP levels and repressed EG production when added to cellulose-grown cultures. 2-deoxy-D-glucose, although nometabolizable in T. curvata, depressed cAMP to levels observed with glucose, but unlike glucose, the 2DG effect persisted until cells were washed and transferred to fresh medium. SCPR values and cAMP levels in cells grown in continuous culture under conditions of cellobiose limitation were markedly influenced by dilution rate (D). The maxima for both occurred at D = 0.085 (culture generation time of 11.8 h). When D was held constant and cellobiose concentration was increased over a 14-fold range to support higher steady state population levels, SCPR values decreased about fivefold, indicating that extracellular catabolite accumulation may be a factor in EG repression. The role of cAMP in the mechanism of this repression appears to be neither simple nor direct, since large changes (up to 200-fold) in SCPR accompany relatively small changes (10-fold) in cellular cAMP levels.

  15. The AzTEC Mathematics Project (AMP).

    ERIC Educational Resources Information Center

    Johnson, Gae R.

    The AzTEC Mathematics Project (AMP) is a statewide partnership among Arizona's Regents universities and state community colleges, partner school districts, and economic communities. AzTec is committed to preparing highly qualified K-12 mathematics and science teachers. AMP targeted Native American teachers and teachers of Native American students…

  16. Opposing Activity Changes in AMP Deaminase and AMP-Activated Protein Kinase in the Hibernating Ground Squirrel

    PubMed Central

    Cicerchi, Christina; Garcia, Gabriela E.; Roncal-Jimenez, Carlos A.; Trostel, Jessica; Jain, Swati; Mant, Colin T.; Rivard, Christopher J.; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L.; Johnson, Richard J.

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  17. Opposing activity changes in AMP deaminase and AMP-activated protein kinase in the hibernating ground squirrel.

    PubMed

    Lanaspa, Miguel A; Epperson, L Elaine; Li, Nanxing; Cicerchi, Christina; Garcia, Gabriela E; Roncal-Jimenez, Carlos A; Trostel, Jessica; Jain, Swati; Mant, Colin T; Rivard, Christopher J; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L; Johnson, Richard J

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel.

  18. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens.

  19. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  20. EppA, a Putative Substrate of DdERK2, Regulates Cyclic AMP Relay and Chemotaxis in Dictyostelium discoideum

    PubMed Central

    Chen, Songyang; Segall, Jeffrey E.

    2006-01-01

    The mitogen-activated protein kinase DdERK2 is critical for cyclic AMP (cAMP) relay and chemotaxis to cAMP and folate, but the details downstream of DdERK2 are unclear. To search for targets of DdERK2 in Dictyostelium discoideum,32PO43−-labeled protein samples from wild-type and Dderk2− cells were resolved by 2-dimensional electrophoresis. Mass spectrometry was used to identify a novel 45-kDa protein, named EppA (ERK2-dependent phosphoprotein A), as a substrate of DdERK2 in Dictyostelium. Mutation of potential DdERK2 phosphorylation sites demonstrated that phosphorylation on serine 250 of EppA is DdERK2 dependent. Changing serine 250 to alanine delayed development of Dictyostelium and reduced Dictyostelium chemotaxis to cAMP. Although overexpression of EppA had no significant effect on the development or chemotaxis of Dictyostelium, disruption of the eppA gene led to delayed development and reduced chemotactic responses to both cAMP and folate. Both eppA gene disruption and overexpression of EppA carrying the serine 250-to-alanine mutation led to inhibition of intracellular cAMP accumulation in response to chemoattractant cAMP, a pivotal process in Dictyostelium chemotaxis and development. Our studies indicate that EppA regulates extracellular cAMP-induced signal relay and chemotaxis of Dictyostelium. PMID:16835457

  1. Positive Effect of Carbon Sources on Natural Transformation in Escherichia coli: Role of Low-Level Cyclic AMP (cAMP)-cAMP Receptor Protein in the Derepression of rpoS

    PubMed Central

    Guo, Mengyue; Wang, Huanyu; Xie, Nengbin

    2015-01-01

    ABSTRACT Natural plasmid transformation of Escherichia coli is a complex process that occurs strictly on agar plates and requires the global stress response factor σS. Here, we showed that additional carbon sources could significantly enhance the transformability of E. coli. Inactivation of phosphotransferase system genes (ptsH, ptsG, and crr) caused an increase in the transformation frequency, and the addition of cyclic AMP (cAMP) neutralized the promotional effect of carbon sources. This implies a negative role of cAMP in natural transformation. Further study showed that crp and cyaA mutations conferred a higher transformation frequency, suggesting that the cAMP-cAMP receptor protein (CRP) complex has an inhibitory effect on transformation. Moreover, we observed that rpoS is negatively regulated by cAMP-CRP in early log phase and that both crp and cyaA mutants show no transformation superiority when rpoS is knocked out. Therefore, it can be concluded that both the crp and cyaA mutations derepress rpoS expression in early log phase, whereby they aid in the promotion of natural transformation ability. We also showed that the accumulation of RpoS during early log phase can account for the enhanced transformation aroused by additional carbon sources. Our results thus demonstrated that the presence of additional carbon sources promotes competence development and natural transformation by reducing cAMP-CRP and, thus, derepressing rpoS expression during log phase. This finding could contribute to a better understanding of the relationship between nutrition state and competence, as well as the mechanism of natural plasmid transformation in E. coli. IMPORTANCE Escherichia coli, which is not usually considered to be naturally transformable, was found to spontaneously take up plasmid DNA on agar plates. Researching the mechanism of natural transformation is important for understanding the role of transformation in evolution, as well as in the transfer of pathogenicity and

  2. Vv-AMP1, a ripening induced peptide from Vitis vinifera shows strong antifungal activity

    PubMed Central

    de Beer, Abré; Vivier, Melané A

    2008-01-01

    Background Latest research shows that small antimicrobial peptides play a role in the innate defense system of plants. These peptides typically contribute to preformed defense by developing protective barriers around germinating seeds or between different tissue layers within plant organs. The encoding genes could also be upregulated by abiotic and biotic stimuli during active defense processes. The peptides display a broad spectrum of antimicrobial activities. Their potent anti-pathogenic characteristics have ensured that they are promising targets in the medical and agricultural biotechnology sectors. Results A berry specific cDNA sequence designated Vv-AMP1, Vitis vinifera antimicrobial peptide 1, was isolated from Vitis vinifera. Vv-AMP1 encodes for a 77 amino acid peptide that shows sequence homology to the family of plant defensins. Vv-AMP1 is expressed in a tissue specific, developmentally regulated manner, being only expressed in berry tissue at the onset of berry ripening and onwards. Treatment of leaf and berry tissue with biotic or abiotic factors did not lead to increased expression of Vv-AMP1 under the conditions tested. The predicted signal peptide of Vv-AMP1, fused to the green fluorescent protein (GFP), showed that the signal peptide allowed accumulation of its product in the apoplast. Vv-AMP1 peptide, produced in Escherichia coli, had a molecular mass of 5.495 kDa as determined by mass spectrometry. Recombinant Vv-AMP1 was extremely heat-stable and showed strong antifungal activity against a broad spectrum of plant pathogenic fungi, with very high levels of activity against the wilting disease causing pathogens Fusarium oxysporum and Verticillium dahliae. The Vv-AMP1 peptide did not induce morphological changes on the treated fungal hyphae, but instead strongly inhibited hyphal elongation. A propidium iodide uptake assay suggested that the inhibitory activity of Vv-AMP1 might be associated with altering the membrane permeability of the fungal

  3. C++ Coding Standards for the AMP Project

    SciTech Connect

    Evans, Thomas M; Clarno, Kevin T

    2009-09-01

    This document provides an initial starting point to define the C++ coding standards used by the AMP nuclear fuel performance integrated code project and a part of AMP's software development process. This document draws from the experiences, and documentation [1], of the developers of the Marmot Project at Los Alamos National Laboratory. Much of the software in AMP will be written in C++. The power of C++ can be abused easily, resulting in code that is difficult to understand and maintain. This document gives the practices that should be followed on the AMP project for all new code that is written. The intent is not to be onerous but to ensure that the code can be readily understood by the entire code team and serve as a basis for collectively defining a set of coding standards for use in future development efforts. At the end of the AMP development in fiscal year (FY) 2010, all developers will have experience with the benefits, restrictions, and limitations of the standards described and will collectively define a set of standards for future software development. External libraries that AMP uses do not have to meet these requirements, although we encourage external developers to follow these practices. For any code of which AMP takes ownership, the project will decide on any changes on a case-by-case basis. The practices that we are using in the AMP project have been in use in the Denovo project [2] for several years. The practices build on those given in References [3-5]; the practices given in these references should also be followed. Some of the practices given in this document can also be found in [6].

  4. Changes in nephrogenous cyclic AMP excretion and plasma cyclic AMP following treatment of hyperthyroidism.

    PubMed

    Naafs, M A; van der Velden, P C; Fischer, H R; Koorevaar, G; van Duin, S; Hackeng, W H; Schopman, W; Silberbusch, J

    1984-08-01

    Plasma cyclic AMP (PcAMP) concentration and the excretion of cyclic AMP/dl GF were estimated in 11 thyrotoxic patients before and after medical treatment. PcAMP concentrations were significantly higher during hyperthyroidism (2.30 +/- 0.69 vs 1.88 +/- 0.71 nmol/dl; P less than 0.05), and total urinary cyclic AMP (TcAMP) excretion showed no significant changes (3.24 +/- 0.64 vs 3.44 +/- 1.77 nmol/dl GF). Nephrogenous (NcAMP) excretion rose significantly (1.00 +/- 0.82 vs 1.68 +/- 1.31 mmol/dl GF; P less than 0.025). The increase in NcAMP excretion correlated significantly with the decrease in serum T3 levels (r = -0.46; P less than 0.05). Serum iPTH levels showed no significant change. Both the serum Ca, corrected for serum total protein and TmPO4/GFR declined after treatment (respectively 2.44 +/- 0.13 vs 2.33 +/- 0.08 mmol/l; P less than 0.05 and 1.18 +/- 0.29 vs 1.05 +/- 0.22 mmol/l; P less than 0.05). It is concluded that the rise in NcAMP excretion corroborates the concept of increasing parathyroid activity following the treatment of hyperthyroidism. PMID:6206676

  5. AMPK antagonizes hepatic glucagon-stimulated cyclic AMP signalling via phosphorylation-induced activation of cyclic nucleotide phosphodiesterase 4B

    PubMed Central

    Johanns, M.; Lai, Y.-C.; Hsu, M.-F.; Jacobs, R.; Vertommen, D.; Van Sande, J.; Dumont, J. E.; Woods, A.; Carling, D.; Hue, L.; Viollet, B.; Foretz, M; Rider, M H

    2016-01-01

    Biguanides such as metformin have previously been shown to antagonize hepatic glucagon-stimulated cyclic AMP (cAMP) signalling independently of AMP-activated protein kinase (AMPK) via direct inhibition of adenylate cyclase by AMP. Here we show that incubation of hepatocytes with the small-molecule AMPK activator 991 decreases glucagon-stimulated cAMP accumulation, cAMP-dependent protein kinase (PKA) activity and downstream PKA target phosphorylation. Moreover, incubation of hepatocytes with 991 increases the Vmax of cyclic nucleotide phosphodiesterase 4B (PDE4B) without affecting intracellular adenine nucleotide concentrations. The effects of 991 to decrease glucagon-stimulated cAMP concentrations and activate PDE4B are lost in hepatocytes deleted for both catalytic subunits of AMPK. PDE4B is phosphorylated by AMPK at three sites, and by site-directed mutagenesis, Ser304 phosphorylation is important for activation. In conclusion, we provide a new mechanism by which AMPK antagonizes hepatic glucagon signalling via phosphorylation-induced PDE4B activation. PMID:26952277

  6. Recent Advances in the Discovery of Small Molecules Targeting Exchange Proteins Directly Activated by cAMP (EPAC)

    PubMed Central

    Chen, Haijun; Wild, Christopher; Zhou, Xiaobin; Ye, Na; Cheng, Xiaodong; Zhou, Jia

    2014-01-01

    cAMP is a pivotal second messenger that regulates numerous biological processes under physiological and pathological conditions, including cancer, diabetes, heart failure, inflammation and neurological disorders. In the past, all effects of cAMP were initially believed to be mediated by PKA and cyclic nucleotide-regulated ion channels. Since the discovery of EPAC proteins in 1998, accumulating evidence has demonstrated that the net cellular effects of cAMP are also regulated by EPAC. The pursuit of the biological functions of EPAC has benefited from the development and applications of a growing number of pharmacological probes targeting EPAC proteins. In this Perspective, we seek to provide a concise update on recent advances in the development of chemical entities including various membrane-permeable analogues of cAMP and newly discovered EPAC-specific ligands from high throughput assays and hit-to-lead optimizations. PMID:24256330

  7. Atmospheric, Magnetospheric and Plasmas in space (AMPS) spacelab payload definition study. Volume 4. Part 1, AMPS program specification

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    The AMPS Program Specification delineates the AMPS Program requirements consistent with the resources defined in the AMPS Project Plan. All subsidiary specifications and requirements shall conform to the requirements presented. The requirements hierarchy for the AMPS program is illustrated. A brief description of each of the requirements documents and their intended use is provided.

  8. Regulation of vascular smooth muscle cell calcification by extracellular pyrophosphate homeostasis: synergistic modulation by cyclic AMP and hyperphosphatemia

    PubMed Central

    Prosdocimo, Domenick A.; Wyler, Steven C.; Romani, Andrea M.; O'Neill, W. Charles

    2010-01-01

    Vascular calcification is a multifaceted process involving gain of calcification inducers and loss of calcification inhibitors. One such inhibitor is inorganic pyrophosphate (PPi), and regulated generation and homeostasis of extracellular PPi is a critical determinant of soft-tissue mineralization. We recently described an autocrine mechanism of extracellular PPi generation in cultured rat aortic vascular smooth muscle cells (VSMC) that involves both ATP release coupled to the ectophosphodiesterase/pyrophosphatase ENPP1 and efflux of intracellular PPi mediated or regulated by the plasma membrane protein ANK. We now report that increased cAMP signaling and elevated extracellular inorganic phosphate (Pi) act synergistically to induce calcification of these VSMC that is correlated with progressive reduction in ability to accumulate extracellular PPi. Attenuated PPi accumulation was mediated in part by cAMP-dependent decrease in ANK expression coordinated with cAMP-dependent increase in expression of TNAP, the tissue nonselective alkaline phosphatase that degrades PPi. Stimulation of cAMP signaling did not alter ATP release or ENPP1 expression, and the cAMP-induced changes in ANK and TNAP expression were not sufficient to induce calcification. Elevated extracellular Pi alone elicited only minor calcification and no significant changes in ANK, TNAP, or ENPP1. In contrast, combined with a cAMP stimulus, elevated Pi induced decreases in the ATP release pathway(s) that supports ENPP1 activity; this resulted in markedly reduced rates of PPi accumulation that facilitated robust calcification. Calcified VSMC were characterized by maintained expression of multiple SMC differentiation marker proteins including smooth muscle (SM) α-actin, SM22α, and calponin. Notably, addition of exogenous ATP (or PPi per se) rescued cAMP + phosphate-treated VSMC cultures from progression to the calcified state. These observations support a model in which extracellular PPi generation mediated

  9. AMP decreases the efficiency of skeletal-muscle mitochondria.

    PubMed

    Cadenas, S; Buckingham, J A; St-Pierre, J; Dickinson, K; Jones, R B; Brand, M D

    2000-10-15

    Mitochondrial proton leak in rat muscle is responsible for approx. 15% of the standard metabolic rate, so its modulation could be important in regulating metabolic efficiency. We report in the present paper that physiological concentrations of AMP (K(0.5)=80 microM) increase the resting respiration rate and double the proton conductance of rat skeletal-muscle mitochondria. This effect is specific for AMP. AMP also doubles proton conductance in skeletal-muscle mitochondria from an ectotherm (the frog Rana temporaria), suggesting that AMP activation is not primarily for thermogenesis. AMP activation in rat muscle mitochondria is unchanged when uncoupling protein-3 is doubled by starvation, indicating that this protein is not involved in the AMP effect. AMP activation is, however, abolished by inhibitors and substrates of the adenine nucleotide translocase (ANT), suggesting that this carrier (possibly the ANT1 isoform) mediates AMP activation. AMP activation of ANT could be important for physiological regulation of metabolic rate.

  10. AMP decreases the efficiency of skeletal-muscle mitochondria.

    PubMed Central

    Cadenas, S; Buckingham, J A; St-Pierre, J; Dickinson, K; Jones, R B; Brand, M D

    2000-01-01

    Mitochondrial proton leak in rat muscle is responsible for approx. 15% of the standard metabolic rate, so its modulation could be important in regulating metabolic efficiency. We report in the present paper that physiological concentrations of AMP (K(0.5)=80 microM) increase the resting respiration rate and double the proton conductance of rat skeletal-muscle mitochondria. This effect is specific for AMP. AMP also doubles proton conductance in skeletal-muscle mitochondria from an ectotherm (the frog Rana temporaria), suggesting that AMP activation is not primarily for thermogenesis. AMP activation in rat muscle mitochondria is unchanged when uncoupling protein-3 is doubled by starvation, indicating that this protein is not involved in the AMP effect. AMP activation is, however, abolished by inhibitors and substrates of the adenine nucleotide translocase (ANT), suggesting that this carrier (possibly the ANT1 isoform) mediates AMP activation. AMP activation of ANT could be important for physiological regulation of metabolic rate. PMID:11023814

  11. Neuropeptide Y inhibits 3[H]noradrenaline release in the rat vas deferens independently of cAMP levels.

    PubMed

    Bitran, M; Torres, G; Tapia, W; Huidobro-Toro, J P

    1996-03-01

    The purpose of the present investigation was to ascertain the functional significance of the reduction in cyclic AMP (cAMP) levels in the inhibitory action of neuropeptide Y (NPY) on [3H]noradrenaline ([3H]NA) release, as well as to further characterize the subtype(s) of NPY receptors involved in the peptide's actions in the rat vas deferens. We studied the effects of NPY, carboxyterminal fragments of this peptide and the NPY analog (Leu31,Pro34)-NPY on three functional responses, namely, the release of [3H]NA and the associated muscle contractions evoked by electrical stimulation, and the accumulation of cAMP stimulated by forskolin. NPY, a known inhibitor of the electrically-evoked [3H]NA release and neurogenic contractions is also a potent inhibitor of the forskolin-stimulated cAMP synthesis in the prostatic portion of the rat vas deferens. However, the ability of NPY to inhibit cAMP accumulation is lost upon tissue denervation, suggesting that this is likely to be a prejunctional effect. Elevation of cAMP levels by the use of the cell permeant analog of cAMP, 8-(p-chlorophenylthio)-cAMP (8pCPTcAMP) increases the electrically-evoked release of [3H]NA. However, the inhibition of [3H]NA release by NPY is not prevented by 8pCPTcAMP. Structure-activity relationship studies reveal that NPY and related peptides inhibit the release of [3H]NA, the muscle contractions and the synthesis of cAMP with a similar pharmacological profile. NPY is the most potent inhibitory agent, whereas [Leu31,Pro34]-NPY and NPY13-36, the respective Y1 and Y2 selective agonists, display similar potencies to inhibit the three responses. It is concluded that NPY inhibits neurotransmission in the rat vas deferens through the activation of a peptide receptor different from the known NPY-Y1 or NPY-Y2 receptor subtypes. NPY receptor activation in the vas deferens is negatively coupled to adenylyl cyclase activity. This intracellular signalling pathway is, however, not likely to mediate the peptide

  12. NO-Evoked macrophage apoptosis is attenuated by cAMP-induced gene expression.

    PubMed Central

    von Knethen, A.; Brockhaus, F.; Kleiter, I.; Brüne, B.

    1999-01-01

    BACKGROUND: Previous work has suggested that an increase in expression of cyclooxygenase-2, concomitant formation of E-type prostanoids, and in turn intracellular cAMP conveys macrophage resistance against apoptosis. MATERIALS AND METHODS: We analyzed the effects of lipophilic cAMP analogs on nitric oxide (NO)-induced apoptosis in RAW 264.7 macrophages and human primary monocyte-derived macrophages. Parameters comprised DNA fragmentation (diphenylamine assay), annexin V staining of phosphatidylserine, caspase activity (quantitated by the cleavage of a fluorogenic caspase-3-like substrate Ac-DEVD-AMC), and mitochondrial membrane depolarization (DeltaPsi), analyzed using DiOC(6)(3). Western blots detected accumulation of the tumor suppressor protein p53, relocation of cytochrome c, and expression of the antiapoptotic protein Bcl-X(L). A cAMP response-element decoy approach confirmed cAMP-dependent gene induction. RESULTS: We verified resistance of murine and human macrophages against NO donors such as S-nitrosoglutathione or spermine-NO by pre-exposing cells to lipophilic cAMP analogs or by pretreatment with lipopolysaccaride, interferon-gamma, and N(G)-nitroarginine-methylester for 15 hr. Cellular prestimulation decreased NO-evoked apoptosis, as apoptotic parameters were basically absent. Macrophage protection was not achieved during a short period of preexposure, i.e., 1 hr. To verify gene induction as the underlying protective principle, we treated RAW cells with oligonucleotides containing a cAMP-responsive element in order to scavenge cAMP response element-binding protein prior to its promoter-activating ability. Decoy oligonucleotides, but not an unrelated control oligonucleotide, weakened cAMP-evoked protection and re-established a p53 response following NO addition. CONCLUSION: Gene induction by cAMP protects macrophages against apoptosis that occurs as a result of excessive NO formation. Decreasing programmed cell death of macrophages may perpetuate

  13. -Adrenergic receptors on rat ventricular myocytes: characteristics and linkage to cAMP metabolism

    SciTech Connect

    Buxton, I.L.O.; Brunton, L.L.

    1986-08-01

    When incubated with purified cardiomyocytes from adult rat ventricle, the 1-antagonist (TH)prazosin binds to a single class of sites with high affinity. Competition for (TH)prazosin binding by the 2-selective antagonist yohimbine and the nonselective -antagonist phentolamine demonstrates that these receptors are of the 1-subtype. In addition, incubation of myocyte membranes with (TH)yohimbine results in no measurable specific binding. Agonist competition for (TH)prazosin binding to membranes prepared from purified myocytes demonstrates the presence of two components of binding: 28% of 1-receptors interact with norepinephrine with high affinity (K/sub D/ = 36 nM), whereas the majority of receptors (72%) have a low affinity for agonist (K/sub D/ = 2.2 M). After addition of 10 M GTP, norepinephrine competes for (TH)prazosin binding to a single class of sites with lower affinity (K/sub D/ = 2.2 M). Incubation of intact myocytes for 2 min with 1 M norepinephrine leads to significantly less cyclic AMP (cAMP) accumulation than stimulation with either norepinephrine plus prazosin or isoproterenol. Likewise, incubation of intact myocytes with 10 W M norepinephrine leads to significantly less activation of cAMP-dependent protein kinase than when myocytes are stimulated by both norepinephrine and the 1-adrenergic antagonist, prazosin or the US -adrenergic agonist, isoproterenol. They conclude that the cardiomyocyte 1 receptor is coupled to a guanine nucleotide-binding protein, that 1-receptors are functionally linked to decreased intracellular cAMP content, and that this change in cellular cAMP is expressed as described activation of cAMP-dependent protein kinase.

  14. Reduced expression of cytochrome oxidases largely explains cAMP inhibition of aerobic growth in Shewanella oneidensis

    PubMed Central

    Yin, Jianhua; Meng, Qiu; Fu, Huihui; Gao, Haichun

    2016-01-01

    Inhibition of bacterial growth under aerobic conditions by elevated levels of cyclic adenosine 3′,5′-monophosphate (cAMP), first revealed more than 50 years ago, was attributed to accumulation of toxic methylglyoxal (MG). Here, we report a Crp-dependent mechanism rather than MG accumulation that accounts for the phenotype in Shewanella oneidensis, an emerging research model for the bacterial physiology. We show that a similar phenotype can be obtained by removing CpdA, a cAMP phosphodiesterase that appears more effective than its Escherichia coli counterpart. Although production of heme c and cytochromes c is correlated well with cAMP levels, neither is sufficient for the retarded growth. Quantities of overall cytochromes c increased substantially in the presence of elevated cAMP, a phenomenon resembling cells respiring on non-oxygen electron acceptors. In contrast, transcription of Crp-dependent genes encoding both cytochromes bd and cbb3 oxidases is substantially repressed under the same condition. Overall, our results suggest that cAMP of elevated levels drives cells into a low-energetic status, under which aerobic respiration is inhibited. PMID:27076065

  15. Reduced expression of cytochrome oxidases largely explains cAMP inhibition of aerobic growth in Shewanella oneidensis.

    PubMed

    Yin, Jianhua; Meng, Qiu; Fu, Huihui; Gao, Haichun

    2016-01-01

    Inhibition of bacterial growth under aerobic conditions by elevated levels of cyclic adenosine 3',5'-monophosphate (cAMP), first revealed more than 50 years ago, was attributed to accumulation of toxic methylglyoxal (MG). Here, we report a Crp-dependent mechanism rather than MG accumulation that accounts for the phenotype in Shewanella oneidensis, an emerging research model for the bacterial physiology. We show that a similar phenotype can be obtained by removing CpdA, a cAMP phosphodiesterase that appears more effective than its Escherichia coli counterpart. Although production of heme c and cytochromes c is correlated well with cAMP levels, neither is sufficient for the retarded growth. Quantities of overall cytochromes c increased substantially in the presence of elevated cAMP, a phenomenon resembling cells respiring on non-oxygen electron acceptors. In contrast, transcription of Crp-dependent genes encoding both cytochromes bd and cbb3 oxidases is substantially repressed under the same condition. Overall, our results suggest that cAMP of elevated levels drives cells into a low-energetic status, under which aerobic respiration is inhibited. PMID:27076065

  16. Effect of beta-ADrenergic Agonist on Cyclic AMP Synthesis in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Because it seems logical that these agonists exert their action on muscle through stimulation of cAMP synthesis, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax levels were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. In addition, the EC50 values for isoproterenol, cimaterol, clenbuterol, epinephrine, and albuterol were 360 nM, 630 nM, 900 nM, 2,470 nM, and 3,650 nM, respectively. Finally, dose response curves show that the concentrations of cimaterol and clenbuterol in culture media at concentrations known to cause significant muscle hypertrophy in animals had no detectable effect on stimulation of CAMP accumulation in chicken skeletal muscle cells.

  17. Activation of Cyclic AMP Synthesis by Full and Partial Beta-Adrenergic Receptor Agonists in Chicken Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Cureri, Peter A. (Technical Monitor)

    2002-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Accordingly, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax concentrations were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. When cimaterol and clenbuterol were added to culture media at concentrations known to cause significant muscle hypertrophy in animals, there was no detectable effect on stimulation of cAMP synthesis. Finally, these same levels of cimaterol and clenbuterol did not antagonize the stimulation of cAMP by either epinephrine or isoproterenol.

  18. Localized cyclic AMP-dependent protein kinase activity is required for myogenic cell fusion

    SciTech Connect

    Mukai, Atsushi; Hashimoto, Naohiro

    2008-01-15

    Multinucleated myotubes are formed by fusion of mononucleated myogenic progenitor cells (myoblasts) during terminal skeletal muscle differentiation. In addition, myoblasts fuse with myotubes, but terminally differentiated myotubes have not been shown to fuse with each other. We show here that an adenylate cyclase activator, forskolin, and other reagents that elevate intracellular cyclic AMP (cAMP) levels induced cell fusion between small bipolar myotubes in vitro. Then an extra-large myotube, designated a 'myosheet,' was produced by both primary and established mouse myogenic cells. Myotube-to-myotube fusion always occurred between the leading edge of lamellipodia at the polar end of one myotube and the lateral plasma membrane of the other. Forskolin enhanced the formation of lamellipodia where cAMP-dependent protein kinase (PKA) was accumulated. Blocking enzymatic activity or anchoring of PKA suppressed forskolin-enhanced lamellipodium formation and prevented fusion of multinucleated myotubes. Localized PKA activity was also required for fusion of mononucleated myoblasts. The present results suggest that localized PKA plays a pivotal role in the early steps of myogenic cell fusion, such as cell-to-cell contact/recognition through lamellipodium formation. Furthermore, the localized cAMP-PKA pathway might be involved in the specification of the fusion-competent areas of the plasma membrane in lamellipodia of myogenic cells.

  19. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917.

    PubMed

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin; Zhou, Xianxuan

    2015-11-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. (1)H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  20. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917

    PubMed Central

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin

    2015-01-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. 1H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  1. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230...) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended...

  2. AMPS Supporting Research and Technology (SR and T) report. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) definition study

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A listing of candidate technology areas that require additional study is presented. These candidate tasks, identified during the AMPS Phase B studies, are requisites to the design, development, and operation of the AMPS concept selected for preliminary design.

  3. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein

    PubMed Central

    Underwood, Adam J.; Zhang, Yang; Metzger, Dennis W.; Bai, Guangchun

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a signaling molecule that has been shown to play important roles in bacterial physiology and infections. Currently, c-di-AMP detection and quantification relies mostly on the use of high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS). In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed, which utilizes a novel pneumococcal c-di-AMP binding protein (CabP) and a newly commercialized c-di-AMP derivative. With this new method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. Furthermore, this assay is much more efficient than current methods as it requires less overall cost and training while processing many samples at once. Therefore, this assay can be extensively used in research into c-di-AMP signaling. PMID:25239824

  4. Fiscal Year 2011 Infrastructure Refactorizations in AMP

    SciTech Connect

    Berrill, Mark A.; Philip, Bobby; Sampath, Rahul S.; Allu, Srikanth; Barai, Pallab; Cochran, Bill; Clarno, Kevin T.; Dilts, Gary A.

    2011-09-01

    In Fiscal Year 2011 (FY11), the AMP (Advanced MultiPhysics) Nuclear Fuel Performance code [1] went through a thorough review and refactorization based on the lessons-learned from the previous year, in which the version 0.9 of the software was released as a prototype. This report describes the refactorization work that has occurred or is in progress during FY11.

  5. The Applied Mathematics for Power Systems (AMPS)

    SciTech Connect

    Chertkov, Michael

    2012-07-24

    Increased deployment of new technologies, e.g., renewable generation and electric vehicles, is rapidly transforming electrical power networks by crossing previously distinct spatiotemporal scales and invalidating many traditional approaches for designing, analyzing, and operating power grids. This trend is expected to accelerate over the coming years, bringing the disruptive challenge of complexity, but also opportunities to deliver unprecedented efficiency and reliability. Our Applied Mathematics for Power Systems (AMPS) Center will discover, enable, and solve emerging mathematics challenges arising in power systems and, more generally, in complex engineered networks. We will develop foundational applied mathematics resulting in rigorous algorithms and simulation toolboxes for modern and future engineered networks. The AMPS Center deconstruction/reconstruction approach 'deconstructs' complex networks into sub-problems within non-separable spatiotemporal scales, a missing step in 20th century modeling of engineered networks. These sub-problems are addressed within the appropriate AMPS foundational pillar - complex systems, control theory, and optimization theory - and merged or 'reconstructed' at their boundaries into more general mathematical descriptions of complex engineered networks where important new questions are formulated and attacked. These two steps, iterated multiple times, will bridge the growing chasm between the legacy power grid and its future as a complex engineered network.

  6. Regulation of Cl- transport in T84 cell clones expressing a mutant regulatory subunit of cAMP-dependent protein kinase.

    PubMed Central

    Rogers, K V; Goldman, P S; Frizzell, R A; McKnight, G S

    1990-01-01

    Cl- channels in the apical membranes of salt-secreting epithelia are activated by both cAMP and Ca2+ second-messenger systems, and dysfunctions in their hormonal regulation have been demonstrated in patients with cystic fibrosis. We have transfected the epithelial cell line T84 with an expression vector containing a mutant form of the regulatory subunit of the cAMP-dependent protein kinase. Stable transformants that express this construct have reduced basal cAMP-dependent protein kinase activity and do not increase kinase activity beyond the basal level of control cells in response to cAMP. Forskolin, vasoactive intestinal peptide, and prostaglandin E2 each stimulate intracellular cAMP accumulation in both mutant and control clones; however, the activation of Cl- channels in response to elevated cAMP is blocked in mutant clones, indicating direct involvement of the cAMP-dependent protein kinase. In contrast, Ca2+ ionophores retain their ability to activate the Cl- channel in T84 cells expressing the mutant regulatory subunit, suggesting that activation of the channel by means of Ca2+ does not require the participation of cAMP-dependent protein kinase activity. These clones will be useful for further studies of the interactions between the cAMP- and Ca2(+)-dependent regulatory pathways in salt-secreting epithelial cells. They can also be used to identify the mediators of Ca2(+)-dependent Cl- channel activation in isolation from interactions with the cAMP second-messenger pathway. Images PMID:2174170

  7. p85 regulatory subunit of PI3K mediates cAMP-PKA and estrogens biological effects on growth and survival.

    PubMed

    Cosentino, C; Di Domenico, M; Porcellini, A; Cuozzo, C; De Gregorio, G; Santillo, M R; Agnese, S; Di Stasio, R; Feliciello, A; Migliaccio, A; Avvedimento, E V

    2007-03-29

    Cyclic adenosine 3'5' monophosphate (cAMP) and protein kinase A (PKA) cooperate with phosphatidylinositol 3' kinase (PI3K) signals in the control of growth and survival. To determine the molecular mechanism(s) involved, we identified and mutagenized a specific serine (residue 83) in p85alpha(PI3K), which is phosphorylated in vivo and in vitro by PKA. Expression of p85alpha(PI3K) mutants (alanine or aspartic substitutions) significantly altered the biological responses of the cells to cAMP. cAMP protection from anoikis was reduced in cells expressing the alanine version p85alpha(PI3K). These cells did not arrest in G1 in the presence of cAMP, whereas cells expressing the aspartic mutant p85D accumulated in G1 even in the absence of cAMP. S phase was still efficiently inhibited by cAMP in cells expressing both mutants. The binding of PI3K to Ras p21 was greatly reduced in cells expressing p85A in the presence or absence of cAMP. Conversely, expression of the aspartic mutant stimulated robustly the binding of PI3K to p21 Ras in the presence of cAMP. Mutation in the Ser 83 inhibited cAMP, but not PDGF stimulation of PI3K. Conversely, the p85D aspartic mutant amplified cAMP stimulation of PI3K activity. Phosphorylation of Ser 83 by cAMP-PKA in p85alpha(PI3K) was also necessary for estrogen signaling as expression of p85A or p85D mutants inhibited or amplified, respectively, the binding of estrogen receptor to p85alpha and AKT phosphorylation induced by estrogens. The data presented indicate that: (1) phosphorylation of Ser 83 in p85alpha(PI3K) is critical for cAMP-PKA induced G1 arrest and survival in mouse 3T3 fibroblasts; (2) this site is necessary for amplification of estrogen signals by cAMP-PKA and related receptors. Finally, these data suggest a general mechanism of PI3K regulation by cAMP, operating in various cell types and under different conditions. PMID:17016431

  8. Directed evolution of the Escherichia coli cAMP receptor protein at the cAMP pocket.

    PubMed

    Gunasekara, Sanjiva M; Hicks, Matt N; Park, Jin; Brooks, Cory L; Serate, Jose; Saunders, Cameron V; Grover, Simranjeet K; Goto, Joy J; Lee, Jin-Won; Youn, Hwan

    2015-10-30

    The Escherichia coli cAMP receptor protein (CRP) requires cAMP binding to undergo a conformational change for DNA binding and transcriptional regulation. Two CRP residues, Thr(127) and Ser(128), are known to play important roles in cAMP binding through hydrogen bonding and in the cAMP-induced conformational change, but the connection between the two is not completely clear. Here, we simultaneously randomized the codons for these two residues and selected CRP mutants displaying high CRP activity in a cAMP-producing E. coli. Many different CRP mutants satisfied the screening condition for high CRP activity, including those that cannot form any hydrogen bonds with the incoming cAMP at the two positions. In vitro DNA-binding analysis confirmed that these selected CRP mutants indeed display high CRP activity in response to cAMP. These results indicate that the hydrogen bonding ability of the Thr(127) and Ser(128) residues is not critical for the cAMP-induced CRP activation. However, the hydrogen bonding ability of Thr(127) and Ser(128) was found to be important in attaining high cAMP affinity. Computational analysis revealed that most natural cAMP-sensing CRP homologs have Thr/Ser, Thr/Thr, or Thr/Asn at positions 127 and 128. All of these pairs are excellent hydrogen bonding partners and they do not elevate CRP activity in the absence of cAMP. Taken together, our analyses suggest that CRP evolved to have hydrogen bonding residues at the cAMP pocket residues 127 and 128 for performing dual functions: preserving high cAMP affinity and keeping CRP inactive in the absence of cAMP.

  9. Basal and adenosine receptor-stimulated levels of cAMP are reduced in lymphocytes from alcoholic patients

    SciTech Connect

    Diamond, I.; Wrubel, B.; Estrin, W.; Gordon, A.

    1987-03-01

    Alcoholism causes serious neurologic disease that may be due, in part, to the ability of ethanol to interact with neural cell membranes and change neuronal function. Adenosine receptors are membrane-bound proteins that appear to mediate some of the effects of ethanol in the brain. Human lymphocytes also have adenosine receptors, and their activation causes increases in cAMP levels. To test the hypothesis that basal and adenosine receptor-stimulated cAMP levels in lymphocytes might be abnormal in alcoholism, the authors studied lymphocytes from 10 alcoholic subjects, 10 age- and sex-matched normal individuals, and 10 patients with nonalcoholic liver disease. Basal and adenosine receptor-stimulated cAMP levels were reduced 75% in lymphocytes from alcoholic subjects. Also, there was a 76% reduction in ethanol stimulation of cAMP accumulation in lymphocytes from alcoholics. Similar results were demonstrable in isolated T cells. Unlike other laboratory tests examined, these measurements appeared to distinguish alcoholics from normal subjects and from patients with nonalcoholic liver disease. Reduced basal and adenosine receptor-stimulated levels of cAMP in lymphocytes from alcoholics may reflect a change in cell membranes due either to chronic alcohol abuse or to a genetic predisposition unique to alcoholic subjects.

  10. A novel functional link between MAP kinase cascades and the Ras/cAMP pathway that regulates survival.

    PubMed

    Cherkasova, Vera A; McCully, Ryan; Wang, Yunmei; Hinnebusch, Alan; Elion, Elaine A

    2003-07-15

    In mammalian cells, Ras regulates multiple effectors, including activators of mitogen-activated protein kinase (MAPK) cascades, phosphatidylinositol-3-kinase, and guanine nucleotide exchange factors (GEFs) for RalGTPases. In S. cerevisiae, Ras regulates the Kss1 MAPK cascade that promotes filamentous growth and cell integrity, but its major function is to activate adenylyl cyclase and control proliferation and survival ([; see Figure S1 in the Supplemental Data available with this article online). Previous work hints that the mating Fus3/Kss1 MAPK cascade cross-regulates the Ras/cAMP pathway during growth and mating, but direct evidence is lacking. Here, we report that Kss1 and Fus3 act upstream of the Ras/cAMP pathway to regulate survival. Loss of Fus3 increases cAMP and causes poor long-term survival and resistance to stress. These effects are dependent on Kss1 and Ras2. Activation of Kss1 by a hyperactive Ste11 MAPKKK also increases cAMP, but mating receptor/scaffold activation has little effect and may therefore insulate the MAPKs from cross-regulation. Catalytically inactive Fus3 represses cAMP by blocking accumulation of active Kss1 and by another function also shared by Kss1. The conserved RasGEF Cdc25 is a likely control point, because Kss1 and Fus3 complexes associate with and phosphorylate Cdc25. Cross-regulation of Cdc25 may be a general way that MAPKs control Ras signaling networks. PMID:12867033

  11. Interaction of alpha-melanocyte-stimulating hormone, melatonin, cyclic AMP and cyclic GMP in the control of melanogenesis in hair follicle melanocytes in vitro.

    PubMed

    Weatherhead, B; Logan, A

    1981-07-01

    In short-term (48 h) cultures of hair follicles alpha-melanocyte-stimulating hormone (alpha-MSH) and cyclic AMP stimulated melanogenesis through an increase in tyrosinase activity. In contrast cyclic GMP mimicked the effects of melatonin by inhibiting melanin production without causing a concomitant decrease in tyrosinase activity. Both cyclic GMP and melatonin blocked the stimulatory effects of cyclic AMP and alpha-MSH on melanin production but they left the increased levels of tyrosinase activity unaffected. Phosphodiesterase inhibitors (3-isobutyl-1--methylxanthine and papaverine) simultaneously stimulated tyrosinase activity and inhibited melanin production, presumably by allowing endogenous cyclic AMP and cyclic GMP to accumulate intracellularly. It is suggested that whereas MSH stimulates melanogenesis through a cyclic AMP-dependent mechanism there must also be an inhibitory cyclic GMP-dependent mechanism, perhaps activated by melatonin, which operates at some post-tyrosinase step in the melanin biosynthetic pathway. PMID:6267154

  12. The Regulatory Repertoire of Pseudomonas aeruginosa AmpC ß-Lactamase Regulator AmpR Includes Virulence Genes

    PubMed Central

    Balasubramanian, Deepak; Schneper, Lisa; Merighi, Massimo; Smith, Roger; Narasimhan, Giri; Lory, Stephen; Mathee, Kalai

    2012-01-01

    In Enterobacteriaceae, the transcriptional regulator AmpR, a member of the LysR family, regulates the expression of a chromosomal β-lactamase AmpC. The regulatory repertoire of AmpR is broader in Pseudomonas aeruginosa, an opportunistic pathogen responsible for numerous acute and chronic infections including cystic fibrosis. In addition to regulating ampC, P. aeruginosa AmpR regulates the sigma factor AlgT/U and production of some quorum sensing (QS)-regulated virulence factors. In order to better understand the ampR regulon, we compared the transcriptional profile generated using DNA microarrays of the prototypic P. aeruginosa PAO1 strain with its isogenic ampR deletion mutant, PAOΔampR. Transcriptome analysis demonstrates that the AmpR regulon is much more extensive than previously thought, with the deletion of ampR influencing the differential expression of over 500 genes. In addition to regulating resistance to β-lactam antibiotics via AmpC, AmpR also regulates non-β-lactam antibiotic resistance by modulating the MexEF-OprN efflux pump. Other virulence mechanisms including biofilm formation and QS-regulated acute virulence factors are AmpR-regulated. Real-time PCR and phenotypic assays confirmed the microarray data. Further, using a Caenorhabditis elegans model, we demonstrate that a functional AmpR is required for P. aeruginosa pathogenicity. AmpR, a member of the core genome, also regulates genes in the regions of genome plasticity that are acquired by horizontal gene transfer. Further, we show differential regulation of other transcriptional regulators and sigma factors by AmpR, accounting for the extensive AmpR regulon. The data demonstrates that AmpR functions as a global regulator in P. aeruginosa and is a positive regulator of acute virulence while negatively regulating biofilm formation, a chronic infection phenotype. Unraveling this complex regulatory circuit will provide a better understanding of the bacterial response to antibiotics and how the

  13. Parallel Allostery by cAMP and PDE Coordinates Activation and Termination Phases in cAMP Signaling.

    PubMed

    Krishnamurthy, Srinath; Tulsian, Nikhil Kumar; Chandramohan, Arun; Anand, Ganesh S

    2015-09-15

    The second messenger molecule cAMP regulates the activation phase of the cAMP signaling pathway through high-affinity interactions with the cytosolic cAMP receptor, the protein kinase A regulatory subunit (PKAR). Phosphodiesterases (PDEs) are enzymes responsible for catalyzing hydrolysis of cAMP to 5' AMP. It was recently shown that PDEs interact with PKAR to initiate the termination phase of the cAMP signaling pathway. While the steps in the activation phase are well understood, steps in the termination pathway are unknown. Specifically, the binding and allosteric networks that regulate the dynamic interplay between PKAR, PDE, and cAMP are unclear. In this study, PKAR and PDE from Dictyostelium discoideum (RD and RegA, respectively) were used as a model system to monitor complex formation in the presence and absence of cAMP. Amide hydrogen/deuterium exchange mass spectrometry was used to monitor slow conformational transitions in RD, using disordered regions as conformational probes. Our results reveal that RD regulates its interactions with cAMP and RegA at distinct loci by undergoing slow conformational transitions between two metastable states. In the presence of cAMP, RD and RegA form a stable ternary complex, while in the absence of cAMP they maintain transient interactions. RegA and cAMP each bind at orthogonal sites on RD with resultant contrasting effects on its dynamics through parallel allosteric relays at multiple important loci. RD thus serves as an integrative node in cAMP termination by coordinating multiple allosteric relays and governing the output signal response.

  14. Didactical formulation of the Ampère law

    NASA Astrophysics Data System (ADS)

    Barchiesi, Dominique

    2014-05-01

    The Ampère law is useful to calculate the magnetostatic field in the cases of distributions of current with high degree of symmetry. Nevertheless the magnetic field produced by a thin straight wire carrying a current I requires the Biot-Savart law and the use of the Ampère law leads to a mistake. A didactical formulation of the Ampère law is proposed to prevent misinterpretations.

  15. Cardiac cAMP: production, hydrolysis, modulation and detection

    PubMed Central

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  16. Involvement of the CDC25 gene product in the signal transmission pathway of the glucose-induced RAS-mediated cAMP signal in the yeast Saccharomyces cerevisiae.

    PubMed

    van Aelst, L; Jans, A W; Thevelein, J M

    1991-02-01

    Addition of glucose or related fermentable sugars to derepressed cells of the yeast Saccharomyces cerevisiae triggers a RAS-protein-mediated cAMP signal, which induces a protein phosphorylation cascade. Yeast strains without a functional CDC25 gene were deficient in basal cAMP synthesis and in the glucose-induced cAMP signal. Addition of dinitrophenol, which in wild-type strains strongly stimulates in vivo cAMP synthesis by lowering intracellular pH, did not enhance the cAMP level. cdc25 disruption mutants, in which the basal cAMP level was restored by the RAS2val19 oncogene or by disruption of the gene (PDE2) coding for the high-affinity phosphodiesterase, were still deficient in the glucose- and acidification-induced cAMP responses. These results indicate that the CDC25 gene product is required not only for basal cAMP synthesis in yeast but also for specific activation of cAMP synthesis by the signal transmission pathway leading from glucose to adenyl cyclase. They also show that intracellular acidification stimulates the pathway at or upstream of the CDC25 protein. When shifted to the restrictive temperature, cells with the temperature sensitive cdc25-5 mutation lost their cAMP content within a few minutes. After prolonged incubation at the restrictive temperature, cells with this mutation, and also those with the temperature sensitive cdc25-1 mutation, arrested at the 'start' point (in G1) of the cell cycle, and subsequently accumulated in the resting state G0. In contrast with cdc25-5 cells, however, the cAMP level did not decrease and normal glucose- and acidification-induced cAMP responses were observed when cdc25-1 cells were shifted to the restrictive temperature.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Analysis of a novel cyclic Amp inducible prespore gene in Dictyostelium discoideum: evidence for different patterns of cAMP regulation.

    PubMed

    Agarwal, A; Sloger, M S; Oyama, M; Blumberg, D D

    1994-09-01

    The D7 cDNA clone hybridizes to a 2.8 kb mRNA which first appears at the mound stage of development in the cellular slime mold Dictyostelium discoideum. This gene which is cyclic AMP (cAMP) inducible and is expressed specifically in the prespore cells contains an open reading frame interrupted by only one intron. The predicted amino acid sequence indicates a novel prespore protein which differs from all of the previously described prespore proteins in that it contains no internal repeats and does not share any homology with any of the other prespore genes. The amino acid sequence predicts a protein of 850 amino acids with a molecular weight of 95,343 daltons and an isoelectric point of 4.25. The protein is very rich in glutamine (13.8%), asparagine (10.6%) and glutamic acid (10.4%) with one potential glycosylation site and 28 possible sites for phosphorylation. The amino terminus is hydrophobic with characteristics of a signal sequence while the entire carboxyl half of the protein is notable for its hydrophilicity. Comparison of cAMP regulation of the D7 gene with the regulation of two other cAMP regulated prespore genes, the PL3(SP87) gene and the Psa(D19), reveals some striking differences. Disaggregation in the presence of cAMP results in transient degradation of mRNA for all three genes. The transcription rate for the D7 and PsA(D19) genes remains relatively unaffected by disaggregation but there is a rapid although transient decline in the transcription rate of the PL3(SP87) gene. Although the accumulation of all three mRNAs is first detectable at mound stage, transcription of the D7 and PsA(D19) genes is detected earlier in development, at rippling aggregate stage several hours prior to the earliest time when transcription of the PL3(SP87) gene is detected. Analysis of the promoter region of the D7 gene reveals three CA like boxes flanked by direct repeats as well as four G rich regions that may serve as regulatory elements. PMID:7988791

  18. Biguanides suppress hepatic glucagon signalling by decreasing production of cyclic AMP.

    PubMed

    Miller, Russell A; Chu, Qingwei; Xie, Jianxin; Foretz, Marc; Viollet, Benoit; Birnbaum, Morris J

    2013-02-14

    Glucose production by the liver is essential for providing a substrate for the brain during fasting. The inability of insulin to suppress hepatic glucose output is a major aetiological factor in the hyperglycaemia of type-2 diabetes mellitus and other diseases of insulin resistance. For fifty years, one of the few classes of therapeutics effective in reducing glucose production has been the biguanides, which include phenformin and metformin, the latter the most frequently prescribed drug for type-2 diabetes. Nonetheless, the mechanism of action of biguanides remains imperfectly understood. The suggestion a decade ago that metformin reduces glucose synthesis through activation of the enzyme AMP-activated protein kinase (AMPK) has recently been challenged by genetic loss-of-function experiments. Here we provide a novel mechanism by which metformin antagonizes the action of glucagon, thus reducing fasting glucose levels. In mouse hepatocytes, metformin leads to the accumulation of AMP and related nucleotides, which inhibit adenylate cyclase, reduce levels of cyclic AMP and protein kinase A (PKA) activity, abrogate phosphorylation of critical protein targets of PKA, and block glucagon-dependent glucose output from hepatocytes. These data support a mechanism of action for metformin involving antagonism of glucagon, and suggest an approach for the development of antidiabetic drugs.

  19. Prostaglandin A1 metabolism and inhibition of cyclic AMP extrusion by avian erythrocytes

    SciTech Connect

    Heasley, L.E.; Brunton, L.L.

    1985-09-25

    Prostaglandins (PG) inhibit active cyclic AMP export from pigeon red cells, PGA1 and PGA2 most potently. To probe the mechanism of this action of PGA1, the authors have studied the interaction of (TH)PGA1 with suspensions of pigeon red cells. The interaction of PGA1 with pigeon red cells is a multistep process of uptake, metabolism, and secretion. (TH) PGA1 rapidly enters red cells and is promptly metabolized to a compound(s) that remains in the aqueous layer after ethylacetate extraction. The glutathione-depleting agent, diamide, inhibits formation of the PGA1 metabolite. The red cells secrete the polar metabolite of PGA1 by a saturable mechanism that lowered temperatures inhibit. Because uptake and metabolism progress with much greater rates than metabolite secretion, red cells transiently concentrate the polar compound intracellularly. Onset and reversal of inhibition of cyclic AMP export by PGA1 coincide with accumulation and secretion of PGA1 metabolite, suggesting that the polar metabolite acts at an intracellular site to inhibit cyclic AMP efflux.

  20. Neurodegeneration with Brain Iron Accumulation

    MedlinePlus

    ... Diversity Find People About NINDS NINDS Neurodegeneration with Brain Iron Accumulation Information Page Synonym(s): Hallervorden-Spatz Disease, ... done? Clinical Trials Organizations What is Neurodegeneration with Brain Iron Accumulation? Neurodegeneration with brain iron accumulation (NBIA) ...

  1. Plastids and Carotenoid Accumulation.

    PubMed

    Li, Li; Yuan, Hui; Zeng, Yunliu; Xu, Qiang

    2016-01-01

    Plastids are ubiquitously present in plants and are the organelles for carotenoid biosynthesis and storage. Based on their morphology and function, plastids are classified into various types, i.e. proplastids, etioplasts, chloroplasts, amyloplasts, and chromoplasts. All plastids, except proplastids, can synthesize carotenoids. However, plastid types have a profound effect on carotenoid accumulation and stability. In this chapter, we discuss carotenoid biosynthesis and regulation in various plastids with a focus on carotenoids in chromoplasts. Plastid transition related to carotenoid biosynthesis and the different capacity of various plastids to sequester carotenoids and the associated effect on carotenoid stability are described in light of carotenoid accumulation in plants. PMID:27485226

  2. Plastids and Carotenoid Accumulation.

    PubMed

    Li, Li; Yuan, Hui; Zeng, Yunliu; Xu, Qiang

    2016-01-01

    Plastids are ubiquitously present in plants and are the organelles for carotenoid biosynthesis and storage. Based on their morphology and function, plastids are classified into various types, i.e. proplastids, etioplasts, chloroplasts, amyloplasts, and chromoplasts. All plastids, except proplastids, can synthesize carotenoids. However, plastid types have a profound effect on carotenoid accumulation and stability. In this chapter, we discuss carotenoid biosynthesis and regulation in various plastids with a focus on carotenoids in chromoplasts. Plastid transition related to carotenoid biosynthesis and the different capacity of various plastids to sequester carotenoids and the associated effect on carotenoid stability are described in light of carotenoid accumulation in plants.

  3. Revisiting cAMP signaling in the carotid body

    PubMed Central

    Nunes, Ana R.; Holmes, Andrew P.; Conde, Sílvia V.; Gauda, Estelle B.; Monteiro, Emília C.

    2014-01-01

    Chronic carotid body (CB) activation is now recognized as being essential in the development of hypertension and promoting insulin resistance; thus, it is imperative to characterize the chemotransduction mechanisms of this organ in order to modulate its activity and improve patient outcomes. For several years, and although controversial, cyclic adenosine monophosphate (cAMP) was considered an important player in initiating the activation of the CB. However, its relevance was partially displaced in the 90s by the emerging role of the mitochondria and molecules such as AMP-activated protein kinase and O2-sensitive K+ channels. Neurotransmitters/neuromodulators binding to metabotropic receptors are essential to chemotransmission in the CB, and cAMP is central to this process. cAMP also contributes to raise intracellular Ca2+ levels, and is intimately related to the cellular energetic status (AMP/ATP ratio). Furthermore, cAMP signaling is a target of multiple current pharmacological agents used in clinical practice. This review (1) provides an outline on the classical view of the cAMP-signaling pathway in the CB that originally supported its role in the O2/CO2 sensing mechanism, (2) presents recent evidence on CB cAMP neuromodulation and (3) discusses how CB activity is affected by current clinical therapies that modify cAMP-signaling, namely dopaminergic drugs, caffeine (modulation of A2A/A2B receptors) and roflumilast (PDE4 inhibitors). cAMP is key to any process that involves metabotropic receptors and the intracellular pathways involved in CB disease states are likely to involve this classical second messenger. Research examining the potential modification of cAMP levels and/or interactions with molecules associated with CB hyperactivity is currently in its beginning and this review will open doors for future explorations. PMID:25389406

  4. Pre-Amp Box Platform Analysis

    SciTech Connect

    Kirby, K.; Kurita, C.; /Fermilab

    1989-01-17

    A platform to be used for the installation and repair of the high voltage pre-amp boxes on the CC cryostat has been designed to support a uniform load of 30 Ibs./sq. ft. However, according to the standards set by both the American National Standard and the Uniform Building Code, the minimum uniformly distributed design load for a structure used as an 'elevated platform or walkway' is 60 lbs./sq. ft. The existing platform was tested with a uniform load of 40 lbs./sq. ft. with no major problems occurring during the testing. Considering a 40 lbs./sq. ft. load to be the minimum acceptable value for 'residential' use, and the platform in hand to be better categorized as an 'elevated platform or walkway', the platform is carefully re-analyzed for a 60 lbs./sq. ft. uniformly distributed load.

  5. Anti-microbial peptide (AMP): nucleotide variation, gene expression, and host resistance in the white pine blister rust (WPBR) pathosystem.

    PubMed

    Liu, Jun-Jun; Zamany, Arezoo; Sniezko, Richard A

    2013-01-01

    Pinus monticola antimicrobial peptide (PmAMP1) inhibits growth of Cronartium ribicola and other fungal pathogens. C. ribicola causes white pine blister rust and has resulted in a dramatic reduction of native white pines across North America. Quantitative disease resistance (QDR) is a highly desirable trait screened in breeding programs for durable resistance against C. ribicola. Along with phenotyping on a collection of germplasms, we analyzed PmAMP1 transcript and protein expression and re-sequenced the full-length gene including its promoter region. A mixed linear model was used to identify the association of single nucleotide polymorphisms (SNPs) with accumulated protein and stem QDR levels. Among 16 PmAMP1 SNPs identified in the present study, we found an association of protein levels with 6 SNPs (P < 0.05), including 2 in the 5'-untranslated region (UTR), 3 in the open reading frame (ORF) region with 2 nonsynonymous SNPs, and 1 SNP in the 3'-UTR. Another set of six SNPs was associated with stem QDR levels (P < 0.05), with one localized in the promoter region and the other five in the ORF region with four nonsynonymous changes, suggesting that multiple isoforms may have antifungal activity to differing degrees. Of three common PmAMP1 haplotypes, the trees with haplotype 2 showed high QDR levels with moderate protein abundance while those trees with haplotype 3 exhibited low QDR levels in the susceptible range and the lowest level of protein accumulation. Thus, an association of gene variations with protein abundance and resistance-related traits may facilitate elucidation of physiological contribution of PmAMP1 to host resistance.

  6. Compartmentalization of Distinct cAMP Signaling Pathways in Mammalian Sperm*♦

    PubMed Central

    Wertheimer, Eva; Krapf, Dario; de la Vega-Beltran, José L.; Sánchez-Cárdenas, Claudia; Navarrete, Felipe; Haddad, Douglas; Escoffier, Jessica; Salicioni, Ana M.; Levin, Lonny R.; Buck, Jochen; Mager, Jesse; Darszon, Alberto; Visconti, Pablo E.

    2013-01-01

    Fertilization competence is acquired in the female tract in a process known as capacitation. Capacitation is needed for the activation of motility (e.g. hyperactivation) and to prepare the sperm for an exocytotic process known as acrosome reaction. Although the HCO3−-dependent soluble adenylyl cyclase Adcy10 plays a role in motility, less is known about the source of cAMP in the sperm head. Transmembrane adenylyl cyclases (tmACs) are another possible source of cAMP. These enzymes are regulated by stimulatory heterotrimeric Gs proteins; however, the presence of Gs or tmACs in mammalian sperm has been controversial. In this study, we used Western blotting and cholera toxin-dependent ADP-ribosylation to show the Gs presence in the sperm head. Also, we showed that forskolin, a tmAC-specific activator, induces cAMP accumulation in sperm from both WT and Adcy10-null mice. This increase is blocked by the tmAC inhibitor SQ22536 but not by the Adcy10 inhibitor KH7. Although Gs immunoreactivity and tmAC activity are detected in the sperm head, PKA is only found in the tail, where Adcy10 was previously shown to reside. Consistent with an acrosomal localization, Gs reactivity is lost in acrosome-reacted sperm, and forskolin is able to increase intracellular Ca2+ and induce the acrosome reaction. Altogether, these data suggest that cAMP pathways are compartmentalized in sperm, with Gs and tmAC in the head and Adcy10 and PKA in the flagellum. PMID:24129574

  7. Chimpanzee accumulative stone throwing.

    PubMed

    Kühl, Hjalmar S; Kalan, Ammie K; Arandjelovic, Mimi; Aubert, Floris; D'Auvergne, Lucy; Goedmakers, Annemarie; Jones, Sorrel; Kehoe, Laura; Regnaut, Sebastien; Tickle, Alexander; Ton, Els; van Schijndel, Joost; Abwe, Ekwoge E; Angedakin, Samuel; Agbor, Anthony; Ayimisin, Emmanuel Ayuk; Bailey, Emma; Bessone, Mattia; Bonnet, Matthieu; Brazolla, Gregory; Buh, Valentine Ebua; Chancellor, Rebecca; Cipoletta, Chloe; Cohen, Heather; Corogenes, Katherine; Coupland, Charlotte; Curran, Bryan; Deschner, Tobias; Dierks, Karsten; Dieguez, Paula; Dilambaka, Emmanuel; Diotoh, Orume; Dowd, Dervla; Dunn, Andrew; Eshuis, Henk; Fernandez, Rumen; Ginath, Yisa; Hart, John; Hedwig, Daniela; Ter Heegde, Martijn; Hicks, Thurston Cleveland; Imong, Inaoyom; Jeffery, Kathryn J; Junker, Jessica; Kadam, Parag; Kambi, Mohamed; Kienast, Ivonne; Kujirakwinja, Deo; Langergraber, Kevin; Lapeyre, Vincent; Lapuente, Juan; Lee, Kevin; Leinert, Vera; Meier, Amelia; Maretti, Giovanna; Marrocoli, Sergio; Mbi, Tanyi Julius; Mihindou, Vianet; Moebius, Yasmin; Morgan, David; Morgan, Bethan; Mulindahabi, Felix; Murai, Mizuki; Niyigabae, Protais; Normand, Emma; Ntare, Nicolas; Ormsby, Lucy Jayne; Piel, Alex; Pruetz, Jill; Rundus, Aaron; Sanz, Crickette; Sommer, Volker; Stewart, Fiona; Tagg, Nikki; Vanleeuwe, Hilde; Vergnes, Virginie; Willie, Jacob; Wittig, Roman M; Zuberbuehler, Klaus; Boesch, Christophe

    2016-01-01

    The study of the archaeological remains of fossil hominins must rely on reconstructions to elucidate the behaviour that may have resulted in particular stone tools and their accumulation. Comparatively, stone tool use among living primates has illuminated behaviours that are also amenable to archaeological examination, permitting direct observations of the behaviour leading to artefacts and their assemblages to be incorporated. Here, we describe newly discovered stone tool-use behaviour and stone accumulation sites in wild chimpanzees reminiscent of human cairns. In addition to data from 17 mid- to long-term chimpanzee research sites, we sampled a further 34 Pan troglodytes communities. We found four populations in West Africa where chimpanzees habitually bang and throw rocks against trees, or toss them into tree cavities, resulting in conspicuous stone accumulations at these sites. This represents the first record of repeated observations of individual chimpanzees exhibiting stone tool use for a purpose other than extractive foraging at what appear to be targeted trees. The ritualized behavioural display and collection of artefacts at particular locations observed in chimpanzee accumulative stone throwing may have implications for the inferences that can be drawn from archaeological stone assemblages and the origins of ritual sites.

  8. Chimpanzee accumulative stone throwing

    PubMed Central

    Kühl, Hjalmar S.; Kalan, Ammie K.; Arandjelovic, Mimi; Aubert, Floris; D’Auvergne, Lucy; Goedmakers, Annemarie; Jones, Sorrel; Kehoe, Laura; Regnaut, Sebastien; Tickle, Alexander; Ton, Els; van Schijndel, Joost; Abwe, Ekwoge E.; Angedakin, Samuel; Agbor, Anthony; Ayimisin, Emmanuel Ayuk; Bailey, Emma; Bessone, Mattia; Bonnet, Matthieu; Brazolla, Gregory; Buh, Valentine Ebua; Chancellor, Rebecca; Cipoletta, Chloe; Cohen, Heather; Corogenes, Katherine; Coupland, Charlotte; Curran, Bryan; Deschner, Tobias; Dierks, Karsten; Dieguez, Paula; Dilambaka, Emmanuel; Diotoh, Orume; Dowd, Dervla; Dunn, Andrew; Eshuis, Henk; Fernandez, Rumen; Ginath, Yisa; Hart, John; Hedwig, Daniela; Ter Heegde, Martijn; Hicks, Thurston Cleveland; Imong, Inaoyom; Jeffery, Kathryn J.; Junker, Jessica; Kadam, Parag; Kambi, Mohamed; Kienast, Ivonne; Kujirakwinja, Deo; Langergraber, Kevin; Lapeyre, Vincent; Lapuente, Juan; Lee, Kevin; Leinert, Vera; Meier, Amelia; Maretti, Giovanna; Marrocoli, Sergio; Mbi, Tanyi Julius; Mihindou, Vianet; Moebius, Yasmin; Morgan, David; Morgan, Bethan; Mulindahabi, Felix; Murai, Mizuki; Niyigabae, Protais; Normand, Emma; Ntare, Nicolas; Ormsby, Lucy Jayne; Piel, Alex; Pruetz, Jill; Rundus, Aaron; Sanz, Crickette; Sommer, Volker; Stewart, Fiona; Tagg, Nikki; Vanleeuwe, Hilde; Vergnes, Virginie; Willie, Jacob; Wittig, Roman M.; Zuberbuehler, Klaus; Boesch, Christophe

    2016-01-01

    The study of the archaeological remains of fossil hominins must rely on reconstructions to elucidate the behaviour that may have resulted in particular stone tools and their accumulation. Comparatively, stone tool use among living primates has illuminated behaviours that are also amenable to archaeological examination, permitting direct observations of the behaviour leading to artefacts and their assemblages to be incorporated. Here, we describe newly discovered stone tool-use behaviour and stone accumulation sites in wild chimpanzees reminiscent of human cairns. In addition to data from 17 mid- to long-term chimpanzee research sites, we sampled a further 34 Pan troglodytes communities. We found four populations in West Africa where chimpanzees habitually bang and throw rocks against trees, or toss them into tree cavities, resulting in conspicuous stone accumulations at these sites. This represents the first record of repeated observations of individual chimpanzees exhibiting stone tool use for a purpose other than extractive foraging at what appear to be targeted trees. The ritualized behavioural display and collection of artefacts at particular locations observed in chimpanzee accumulative stone throwing may have implications for the inferences that can be drawn from archaeological stone assemblages and the origins of ritual sites. PMID:26923684

  9. Chimpanzee accumulative stone throwing.

    PubMed

    Kühl, Hjalmar S; Kalan, Ammie K; Arandjelovic, Mimi; Aubert, Floris; D'Auvergne, Lucy; Goedmakers, Annemarie; Jones, Sorrel; Kehoe, Laura; Regnaut, Sebastien; Tickle, Alexander; Ton, Els; van Schijndel, Joost; Abwe, Ekwoge E; Angedakin, Samuel; Agbor, Anthony; Ayimisin, Emmanuel Ayuk; Bailey, Emma; Bessone, Mattia; Bonnet, Matthieu; Brazolla, Gregory; Buh, Valentine Ebua; Chancellor, Rebecca; Cipoletta, Chloe; Cohen, Heather; Corogenes, Katherine; Coupland, Charlotte; Curran, Bryan; Deschner, Tobias; Dierks, Karsten; Dieguez, Paula; Dilambaka, Emmanuel; Diotoh, Orume; Dowd, Dervla; Dunn, Andrew; Eshuis, Henk; Fernandez, Rumen; Ginath, Yisa; Hart, John; Hedwig, Daniela; Ter Heegde, Martijn; Hicks, Thurston Cleveland; Imong, Inaoyom; Jeffery, Kathryn J; Junker, Jessica; Kadam, Parag; Kambi, Mohamed; Kienast, Ivonne; Kujirakwinja, Deo; Langergraber, Kevin; Lapeyre, Vincent; Lapuente, Juan; Lee, Kevin; Leinert, Vera; Meier, Amelia; Maretti, Giovanna; Marrocoli, Sergio; Mbi, Tanyi Julius; Mihindou, Vianet; Moebius, Yasmin; Morgan, David; Morgan, Bethan; Mulindahabi, Felix; Murai, Mizuki; Niyigabae, Protais; Normand, Emma; Ntare, Nicolas; Ormsby, Lucy Jayne; Piel, Alex; Pruetz, Jill; Rundus, Aaron; Sanz, Crickette; Sommer, Volker; Stewart, Fiona; Tagg, Nikki; Vanleeuwe, Hilde; Vergnes, Virginie; Willie, Jacob; Wittig, Roman M; Zuberbuehler, Klaus; Boesch, Christophe

    2016-01-01

    The study of the archaeological remains of fossil hominins must rely on reconstructions to elucidate the behaviour that may have resulted in particular stone tools and their accumulation. Comparatively, stone tool use among living primates has illuminated behaviours that are also amenable to archaeological examination, permitting direct observations of the behaviour leading to artefacts and their assemblages to be incorporated. Here, we describe newly discovered stone tool-use behaviour and stone accumulation sites in wild chimpanzees reminiscent of human cairns. In addition to data from 17 mid- to long-term chimpanzee research sites, we sampled a further 34 Pan troglodytes communities. We found four populations in West Africa where chimpanzees habitually bang and throw rocks against trees, or toss them into tree cavities, resulting in conspicuous stone accumulations at these sites. This represents the first record of repeated observations of individual chimpanzees exhibiting stone tool use for a purpose other than extractive foraging at what appear to be targeted trees. The ritualized behavioural display and collection of artefacts at particular locations observed in chimpanzee accumulative stone throwing may have implications for the inferences that can be drawn from archaeological stone assemblages and the origins of ritual sites. PMID:26923684

  10. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion

    PubMed Central

    Schwede, Frank; Chepurny, Oleg G.; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A.; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E.; MacDonald, Patrick E.; Genieser, Hans-G.; Herberg, Friedrich W.

    2015-01-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  11. Cyclic AMP regulation of early gene expression in Dictyostelium discoideum: mediation via the cell surface cyclic AMP receptor.

    PubMed Central

    Mann, S K; Firtel, R A

    1987-01-01

    We examined two sets of genes expressed early in the developmental cycle of Dictyostelium discoideum that appear to be regulated by cyclic AMP (cAMP). The transcripts of both sets of genes were not detectable in vegetative cells. During normal development on filter pads, RNA complementary to these genes could be detected at about 2 h, peaked around 6 to 8 h, and decreased gradually thereafter. Expression of these genes upon starvation in shaking culture was stimulated by pulsing the cells with nanomolar levels of cAMP, a condition that mimics the in vivo pulsing during normal aggregation. Expression was inhibited by caffeine or by continuous levels of cAMP, a condition found later in development when in vivo expression of these genes decreased. The inhibition of caffeine could be overcome by pulsing cells with cAMP. These results suggest that the expression is mediated via the cell surface cAMP receptor, but does not require a rise in intracellular cAMP. mRNA from a gene of the second class was induced upon starvation, peaked by 2.5 h of development, and then declined. In contrast to the other genes, its expression was maintained by continuous levels of cAMP and repressed by cAMP pulses. These and other results on a number of classes of developmentally regulated genes indicates that changing levels of cAMP, acting via the cell surface cAMP receptor, are involved in controlling these groups of genes. We also examined the structure and partial sequence of the cAMP pulse-induced genes. The two tandemly duplicated M3 genes were almost continuously homologous over the sequenced portion of the protein-coding region except for a region near the N-terminal end. The two M3 genes had regions of homology in the 5' flanking sequence and showed slight homology to the same regions in gene D2, another cAMP pulse-induced gene. D2 showed extremely significant homology over its entire sequenced length to an acetylcholinesterase. The results presented here and by others suggest that

  12. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion.

    PubMed

    Schwede, Frank; Chepurny, Oleg G; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E; MacDonald, Patrick E; Genieser, Hans-G; Herberg, Friedrich W; Holz, George G

    2015-07-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3',5'-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  13. Enzymatic characterization of AMP phosphorylase and ribose-1,5-bisphosphate isomerase functioning in an archaeal AMP metabolic pathway.

    PubMed

    Aono, Riku; Sato, Takaaki; Yano, Ayumu; Yoshida, Shosuke; Nishitani, Yuichi; Miki, Kunio; Imanaka, Tadayuki; Atomi, Haruyuki

    2012-12-01

    AMP phosphorylase (AMPpase), ribose-1,5-bisphosphate (R15P) isomerase, and type III ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) have been proposed to constitute a novel pathway involved in AMP metabolism in the Archaea. Here we performed a biochemical examination of AMPpase and R15P isomerase from Thermococcus kodakarensis. R15P isomerase was specific for the α-anomer of R15P and did not recognize other sugar compounds. We observed that activity was extremely low with the substrate R15P alone but was dramatically activated in the presence of AMP. Using AMP-activated R15P isomerase, we reevaluated the substrate specificity of AMPpase. AMPpase exhibited phosphorylase activity toward CMP and UMP in addition to AMP. The [S]-v plot (plot of velocity versus substrate concentration) of the enzyme toward AMP was sigmoidal, with an increase in activity observed at concentrations higher than approximately 3 mM. The behavior of the two enzymes toward AMP indicates that the pathway is intrinsically designed to prevent excess degradation of intracellular AMP. We further examined the formation of 3-phosphoglycerate from AMP, CMP, and UMP in T. kodakarensis cell extracts. 3-Phosphoglycerate generation was observed from AMP alone, and from CMP or UMP in the presence of dAMP, which also activates R15P isomerase. 3-Phosphoglycerate was not formed when 2-carboxyarabinitol 1,5-bisphosphate, a Rubisco inhibitor, was added. The results strongly suggest that these enzymes are actually involved in the conversion of nucleoside monophosphates to 3-phosphoglycerate in T. kodakarensis.

  14. Control of bacterial exoelectrogenesis by c-AMP-GMP

    PubMed Central

    Nelson, James W.; Sudarsan, Narasimhan; Phillips, Grace E.; Stav, Shira; Lünse, Christina E.; McCown, Phillip J.; Breaker, Ronald R.

    2015-01-01

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes. PMID:25848023

  15. Synergistic Antipseudomonal Effects of Synthetic Peptide AMP38 and Carbapenems.

    PubMed

    Rudilla, Héctor; Fusté, Ester; Cajal, Yolanda; Rabanal, Francesc; Vinuesa, Teresa; Viñas, Miguel

    2016-01-01

    The aim was to explore the antimicrobial activity of a synthetic peptide (AMP38) and its synergy with imipenem against imipenem-resistant Pseudomonas aeruginosa. The main mechanism of imipenem resistance is the loss or alteration of protein OprD. Time-kill and minimal biofilm eradication concentration (MBEC) determinations were carried out by using clinical imipenem-resistant strains. AMP38 was markedly synergistic with imipenem when determined in imipenem-resistant P. aeruginosa. MBEC obtained for the combination of AMP38 and imipenem was of 62.5 μg/mL, whereas the MBEC of each antimicrobial separately was 500 μg/mL. AMP38 should be regarded as a promising antimicrobial to fight MDR P. aeruginosa infections. Moreover, killing effect and antibiofilm activity of AMP38 plus imipenem was much higher than that of colistin plus imipenem. PMID:27626405

  16. 8-Chloro-cAMP-related changes on mice uteri.

    PubMed

    Actis, Andrea; Croci, Máximo; Levin, Emanuel; Bergoc, Rosa

    2002-05-22

    Histopathological effects of cAMP analog (8-Chloro-cAMP), tamoxifen, and medroxyprogesterone, alone or combined, upon BALB/c mice uteri are reported. 8-Chloro-cAMP diminished uterine weight, but did not modify its histopathology or estral cycle significantly. Tamoxifen diminished uterine weight showing cystic hyperplasia and an estral cycle arrested at diestrus. Medroxyprogesterone increased uterine weight, caused a swelling of the endometrium and a pseudopregnancy estrus. When combined with 8-Chloro-cAMP, tamoxifen or medroxyprogesterone always had a predominant effect. We concluded that the effects of 8-Chloro-cAMP on mice uteri did not cause significant changes on its histopathology, but diminished its weight.

  17. Control of bacterial exoelectrogenesis by c-AMP-GMP.

    PubMed

    Nelson, James W; Sudarsan, Narasimhan; Phillips, Grace E; Stav, Shira; Lünse, Christina E; McCown, Phillip J; Breaker, Ronald R

    2015-04-28

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes.

  18. The effects of E and F prostaglandins on ovarian cAMP production and follicular contraction in the brook trout (Salvelinus fontinalis).

    PubMed

    Hsu, S Y; Goetz, F W

    1992-12-01

    cAMP release from denuded oocytes. In addition, follicle walls appeared to be more sensitive to forskolin and PG stimulations than denuded oocytes. The stimulation of cAMP accumulation in the medium by PGEs may be significant since both forskolin and PGEs have been shown to inhibit brook trout ovulation in vitro (F. W. Goetz, D. C. Smith, and S. P. Krickle (1982). Gen. Comp. Endocrinol. 48, 154-160) and follicle contraction in the present study. PMID:1337050

  19. The β-lactamase gene regulator AmpR is a tetramer that recognizes and binds the D-Ala-D-Ala motif of its repressor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide.

    PubMed

    Vadlamani, Grishma; Thomas, Misty D; Patel, Trushar R; Donald, Lynda J; Reeve, Thomas M; Stetefeld, Jörg; Standing, Kenneth G; Vocadlo, David J; Mark, Brian L

    2015-01-30

    Inducible expression of chromosomal AmpC β-lactamase is a major cause of β-lactam antibiotic resistance in the Gram-negative bacteria Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is induced by the LysR-type transcriptional regulator (LTTR) AmpR, which activates ampC expression in response to changes in peptidoglycan (PG) metabolite levels that occur during exposure to β-lactams. Under normal conditions, AmpR represses ampC transcription by binding the PG precursor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide. When exposed to β-lactams, however, PG catabolites (1,6-anhydroMurNAc-peptides) accumulate in the cytosol, which have been proposed to competitively displace UDP-MurNAc-pentapeptide from AmpR and convert it into an activator of ampC transcription. Here we describe the molecular interactions between AmpR (from Citrobacter freundii), its DNA operator, and repressor UDP-MurNAc-pentapeptide. Non-denaturing mass spectrometry revealed AmpR to be a homotetramer that is stabilized by DNA containing the T-N11-A LTTR binding motif and revealed that it can bind four repressor molecules in an apparently stepwise manner. A crystal structure of the AmpR effector-binding domain bound to UDP-MurNAc-pentapeptide revealed that the terminal D-Ala-D-Ala motif of the repressor forms the primary contacts with the protein. This observation suggests that 1,6-anhydroMurNAc-pentapeptide may convert AmpR into an activator of ampC transcription more effectively than 1,6-anhydroMurNAc-tripeptide (which lacks the D-Ala-D-Ala motif). Finally, small angle x-ray scattering demonstrates that the AmpR·DNA complex adopts a flat conformation similar to the LTTR protein AphB and undergoes only a slight conformational change when binding UDP-MurNAc-pentapeptide. Modeling the AmpR·DNA tetramer bound to UDP-MurNAc-pentapeptide predicts that the UDP-MurNAc moiety of the repressor participates in modulating AmpR function. PMID:25480792

  20. The β-Lactamase Gene Regulator AmpR Is a Tetramer That Recognizes and Binds the d-Ala-d-Ala Motif of Its Repressor UDP-N-acetylmuramic Acid (MurNAc)-pentapeptide*

    PubMed Central

    Vadlamani, Grishma; Thomas, Misty D.; Patel, Trushar R.; Donald, Lynda J.; Reeve, Thomas M.; Stetefeld, Jörg; Standing, Kenneth G.; Vocadlo, David J.; Mark, Brian L.

    2015-01-01

    Inducible expression of chromosomal AmpC β-lactamase is a major cause of β-lactam antibiotic resistance in the Gram-negative bacteria Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is induced by the LysR-type transcriptional regulator (LTTR) AmpR, which activates ampC expression in response to changes in peptidoglycan (PG) metabolite levels that occur during exposure to β-lactams. Under normal conditions, AmpR represses ampC transcription by binding the PG precursor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide. When exposed to β-lactams, however, PG catabolites (1,6-anhydroMurNAc-peptides) accumulate in the cytosol, which have been proposed to competitively displace UDP-MurNAc-pentapeptide from AmpR and convert it into an activator of ampC transcription. Here we describe the molecular interactions between AmpR (from Citrobacter freundii), its DNA operator, and repressor UDP-MurNAc-pentapeptide. Non-denaturing mass spectrometry revealed AmpR to be a homotetramer that is stabilized by DNA containing the T-N11-A LTTR binding motif and revealed that it can bind four repressor molecules in an apparently stepwise manner. A crystal structure of the AmpR effector-binding domain bound to UDP-MurNAc-pentapeptide revealed that the terminal d-Ala-d-Ala motif of the repressor forms the primary contacts with the protein. This observation suggests that 1,6-anhydroMurNAc-pentapeptide may convert AmpR into an activator of ampC transcription more effectively than 1,6-anhydroMurNAc-tripeptide (which lacks the d-Ala-d-Ala motif). Finally, small angle x-ray scattering demonstrates that the AmpR·DNA complex adopts a flat conformation similar to the LTTR protein AphB and undergoes only a slight conformational change when binding UDP-MurNAc-pentapeptide. Modeling the AmpR·DNA tetramer bound to UDP-MurNAc-pentapeptide predicts that the UDP-MurNAc moiety of the repressor participates in modulating AmpR function. PMID:25480792

  1. Vasoactive intestinal peptide: A potent stimulator of adenosine 3′:5′-cyclic monophosphate accumulation in gut carcinoma cell lines in culture*

    PubMed Central

    Laburthe, M.; Rousset, M.; Boissard, C.; Chevalier, G.; Zweibaum, A.; Rosselin, G.

    1978-01-01

    Vasoactive intestinal peptide (VIP) is a potent and efficient stimulator of adenosine 3′:5′-cyclic monophosphate (cAMP) accumulation in a human colon carcinoma cell line, HT 29. cAMP accumulation is sensitive to a concentration of VIP as low as 3×10-12 M. Maximum VIP-induced cAMP levels were observed with 10-9 M VIP and are about 200 times above the basal levels. Half-maximum cAMP production was obtained at 3×10-10 M VIP. 125I-Labeled VIP was found to bind to HT 29 cells; this binding was competitively inhibited by concentrations of unlabeled VIP between 10-10 and 10-7 M. Half-maximum inhibition of binding was observed with 2×10-9 M VIP. Secretin also stimulated cAMP accumulation in HT 29 cells, but its effectiveness was 1/1000 that of VIP. The other peptides tested at 10-7 M, such as insulin, glucagon, bovine pancreatic polypeptide, somatostatin, octapeptide of cholecystokinin, neurotensin, and substance P, did not stimulate cAMP accumulation. Prostaglandin E1 and catecholamines stimulated cAMP production but were 1/2.3 and 1/5.5 as efficient as VIP, respectively. Another malignant cell line from the gut, the human rectal tumor cell line HRT 18, is also sensitive to VIP. In HRT 18 cells, VIP stimulated cAMP accumulation with a maximal effect at 10-8 M; half-maximum stimulation was observed at about 10-9 M. These results demonstrate the presence of VIP receptors in two malignant human intestinal cell lines (HT 29 and HRT 18) in culture and provide a model for studying the action of VIP on cell proliferation. PMID:208077

  2. Accumulator with preclosing preventer

    SciTech Connect

    Murthy, R.R.; Rice, B.J.

    1981-11-24

    A guided-float accumulator suitable for use with a hydraulic system for an oil well blowout preventer is provided with a wing shut-off valve. Radially inwardly directed outlet parts are aimed at the bottom of the valve wing to generate unbalanced reaction forces which oppose the bernoulli effect forces caused by rapid movement of fluid through the chamber of the shut-off valve, thus preventing premature closing of the valve.

  3. cAMP-Inhibits Cytoplasmic Phospholipase A₂ and Protects Neurons against Amyloid-β-Induced Synapse Damage.

    PubMed

    Bate, Clive; Williams, Alun

    2015-01-01

    A key event in Alzheimer's disease (AD) is the production of amyloid-β (Aβ) peptides and the loss of synapses. In cultured neurons Aβ triggered synapse damage as measured by the loss of synaptic proteins. α-synuclein (αSN), aggregates of which accumulate in Parkinson's disease, also caused synapse damage. Synapse damage was associated with activation of cytoplasmic phospholipase A₂ (cPLA₂), an enzyme that regulates synapse function and structure, and the production of prostaglandin (PG) E₂. In synaptosomes PGE₂ increased concentrations of cyclic adenosine monophosphate (cAMP) which suppressed the activation of cPLA₂ demonstrating an inhibitory feedback system. Thus, Aβ/αSN-induced activated cPLA₂ produces PGE₂ which increases cAMP which in turn suppresses cPLA₂ and, hence, its own production. Neurons pre-treated with pentoxifylline and caffeine (broad spectrum phosphodiesterase (PDE) inhibitors) or the PDE4 specific inhibitor rolipram significantly increased the Aβ/αSN-induced increase in cAMP and consequently protected neurons against synapse damage. The addition of cAMP analogues also inhibited cPLA₂ and protected neurons against synapse damage. These results suggest that drugs that inhibit Aβ-induced activation of cPLA₂ and cross the blood-brain barrier may reduce synapse damage in AD. PMID:26389963

  4. cAMP-Inhibits Cytoplasmic Phospholipase A2 and Protects Neurons against Amyloid-β-Induced Synapse Damage

    PubMed Central

    Bate, Clive; Williams, Alun

    2015-01-01

    A key event in Alzheimer’s disease (AD) is the production of amyloid-β (Aβ) peptides and the loss of synapses. In cultured neurons Aβ triggered synapse damage as measured by the loss of synaptic proteins. α-synuclein (αSN), aggregates of which accumulate in Parkinson’s disease, also caused synapse damage. Synapse damage was associated with activation of cytoplasmic phospholipase A2 (cPLA2), an enzyme that regulates synapse function and structure, and the production of prostaglandin (PG) E2. In synaptosomes PGE2 increased concentrations of cyclic adenosine monophosphate (cAMP) which suppressed the activation of cPLA2 demonstrating an inhibitory feedback system. Thus, Aβ/αSN-induced activated cPLA2 produces PGE2 which increases cAMP which in turn suppresses cPLA2 and, hence, its own production. Neurons pre-treated with pentoxifylline and caffeine (broad spectrum phosphodiesterase (PDE) inhibitors) or the PDE4 specific inhibitor rolipram significantly increased the Aβ/αSN-induced increase in cAMP and consequently protected neurons against synapse damage. The addition of cAMP analogues also inhibited cPLA2 and protected neurons against synapse damage. These results suggest that drugs that inhibit Aβ-induced activation of cPLA2 and cross the blood–brain barrier may reduce synapse damage in AD. PMID:26389963

  5. Slow mitochondrial repair of 5'-AMP renders mtDNA susceptible to damage in APTX deficient cells.

    PubMed

    Akbari, Mansour; Sykora, Peter; Bohr, Vilhelm A

    2015-08-10

    Aborted DNA ligation events in eukaryotic cells can generate 5'-adenylated (5'-AMP) DNA termini that can be removed from DNA by aprataxin (APTX). Mutations in APTX cause an inherited human disease syndrome characterized by early-onset progressive ataxia with ocular motor apraxia (AOA1). APTX is found in the nuclei and mitochondria of eukaryotic cells. Depletion of APTX causes mitochondrial dysfunction and renders the mitochondrial genome, but not the nuclear genome susceptible to damage. The biochemical processes that link APTX deficiency to mitochondrial dysfunction have not been well elucidated. Here, we monitored the repair of 5'-AMP DNA damage in nuclear and mitochondrial extracts from human APTX(+/+) and APTX(-/-) cells. The efficiency of repair of 5'-AMP DNA was much lower in mitochondrial than in nuclear protein extracts, and resulted in persistent DNA repair intermediates in APTX deficient cells. Moreover, the removal of 5'-AMP from DNA was significantly slower in the mitochondrial extracts from human cell lines and mouse tissues compared with their corresponding nuclear extracts. These results suggest that, contrary to nuclear DNA repair, mitochondrial DNA repair is not able to compensate for APTX deficiency resulting in the accumulation of mitochondrial DNA damage.

  6. Slow mitochondrial repair of 5'-AMP renders mtDNA susceptible to damage in APTX deficient cells.

    PubMed

    Akbari, Mansour; Sykora, Peter; Bohr, Vilhelm A

    2015-01-01

    Aborted DNA ligation events in eukaryotic cells can generate 5'-adenylated (5'-AMP) DNA termini that can be removed from DNA by aprataxin (APTX). Mutations in APTX cause an inherited human disease syndrome characterized by early-onset progressive ataxia with ocular motor apraxia (AOA1). APTX is found in the nuclei and mitochondria of eukaryotic cells. Depletion of APTX causes mitochondrial dysfunction and renders the mitochondrial genome, but not the nuclear genome susceptible to damage. The biochemical processes that link APTX deficiency to mitochondrial dysfunction have not been well elucidated. Here, we monitored the repair of 5'-AMP DNA damage in nuclear and mitochondrial extracts from human APTX(+/+) and APTX(-/-) cells. The efficiency of repair of 5'-AMP DNA was much lower in mitochondrial than in nuclear protein extracts, and resulted in persistent DNA repair intermediates in APTX deficient cells. Moreover, the removal of 5'-AMP from DNA was significantly slower in the mitochondrial extracts from human cell lines and mouse tissues compared with their corresponding nuclear extracts. These results suggest that, contrary to nuclear DNA repair, mitochondrial DNA repair is not able to compensate for APTX deficiency resulting in the accumulation of mitochondrial DNA damage. PMID:26256098

  7. Involvement of the cyclic-AMP-dependent protein kinase A pathway in thyroxine effects on calcitonin secretion from TT cells.

    PubMed

    Lu, C-C; Tsai, S-C

    2011-01-01

    Previous studies have demonstrated that plasma calcitonin is lower in hypothyroid patients and that thyroxine stimulates the human thyroid to release calcitonin. Therefore, thyroid hormones may regulate the secretion of calcitonin, but further work is needed to address this possibility in more detail. TT cells, a model of human thyroid C cells, were incubated in a medium containing vehicle, thyroxine, or thyroxine methyl-hemisuccinate-bovine serum albumin (BSA-L-T(4), thyroxine was immobilized and linked to BSA); then, the levels of secreted calcitonin (hCT), calcitonin mRNA, and cAMP were measured. To study links that connect the cAMP-dependent protein kinase A (PKA) pathway to the observed thyroxine effects, cells were treated with either vehicle or thyroxine plus SQ22536 [an adenylyl cyclase (AC) inhibitor], KT5720 (a PKA inhibitor), or 3-isobutyl-1-methylxanthine (IBMX, a phosphodiesterase inhibitor). The activity levels of AC and PKA, and secreted calcitonin were then measured. The results indicate that thyroxine increases calcitonin secretion, cellular cAMP accumulation, and the activities of AC and PKA, but does not increase hCT mRNA levels in TT cells. BSA-L-T(4) also increases calcitonin secretion. These effects are inhibited by SQ22536, and KT5720 and suggest that the nongenomic thyroxine effects that stimulate calcitonin secretion from TT cells involve the cAMP-dependent PKA pathway.

  8. Group B Streptococcus Degrades Cyclic-di-AMP to Modulate STING-Dependent Type I Interferon Production.

    PubMed

    Andrade, Warrison A; Firon, Arnaud; Schmidt, Tobias; Hornung, Veit; Fitzgerald, Katherine A; Kurt-Jones, Evelyn A; Trieu-Cuot, Patrick; Golenbock, Douglas T; Kaminski, Pierre-Alexandre

    2016-07-13

    Induction of type I interferon (IFN) in response to microbial pathogens depends on a conserved cGAS-STING signaling pathway. The presence of DNA in the cytoplasm activates cGAS, while STING is activated by cyclic dinucleotides (cdNs) produced by cGAS or from bacterial origins. Here, we show that Group B Streptococcus (GBS) induces IFN-β production almost exclusively through cGAS-STING-dependent recognition of bacterial DNA. However, we find that GBS expresses an ectonucleotidase, CdnP, which hydrolyzes extracellular bacterial cyclic-di-AMP. Inactivation of CdnP leads to c-di-AMP accumulation outside the bacteria and increased IFN-β production. Higher IFN-β levels in vivo increase GBS killing by the host. The IFN-β overproduction observed in the absence of CdnP is due to the cumulative effect of DNA sensing by cGAS and STING-dependent sensing of c-di-AMP. These findings describe the importance of a bacterial c-di-AMP ectonucleotidase and suggest a direct bacterial mechanism that dampens activation of the cGAS-STING axis. PMID:27414497

  9. cAMP-dependent activation of mammalian target of rapamycin (mTOR) in thyroid cells. Implication in mitogenesis and activation of CDK4.

    PubMed

    Blancquaert, Sara; Wang, Lifu; Paternot, Sabine; Coulonval, Katia; Dumont, Jacques E; Harris, Thurl E; Roger, Pierre P

    2010-07-01

    How cAMP-dependent protein kinases [protein kinase A (PKA)] transduce the mitogenic stimulus elicited by TSH in thyroid cells to late activation of cyclin D3-cyclin-dependent kinase 4 (CDK4) remains enigmatic. Here we show in PC Cl3 rat thyroid cells that TSH/cAMP, like insulin, activates the mammalian target of rapamycin (mTOR)-raptor complex (mTORC1) leading to phosphorylation of S6K1 and 4E-BP1. mTORC1-dependent S6K1 phosphorylation in response to both insulin and cAMP required amino acids, whereas inhibition of AMP-activated protein kinase and glycogen synthase kinase 3 enhanced insulin but not cAMP effects. Unlike insulin, TSH/cAMP did not activate protein kinase B or induce tuberous sclerosis complex 2 phosphorylation at T1462 and Y1571. However, like insulin, TSH/cAMP produced a stable increase in mTORC1 kinase activity that was associated with augmented 4E-BP1 binding to raptor. This could be caused in part by T246 phosphorylation of PRAS40, which was found as an in vitro substrate of PKA. Both in PC Cl3 cells and primary dog thyrocytes, rapamycin inhibited DNA synthesis and retinoblastoma protein phosphorylation induced by TSH and insulin. Although rapamycin reduced cyclin D3 accumulation, the abundance of cyclin D3-CDK4 complexes was not affected. However, rapamycin inhibited the activity of these complexes by decreasing the TSH and insulin-mediated stimulation of activating T172 phosphorylation of CDK4. We propose that mTORC1 activation by TSH, at least in part through PKA-dependent phosphorylation of PRAS40, crucially contributes to mediate cAMP-dependent mitogenesis by regulating CDK4 T172-phosphorylation. PMID:20484410

  10. Direct activation of cardiac pacemaker channels by intracellular cyclic AMP.

    PubMed

    DiFrancesco, D; Tortora, P

    1991-05-01

    Cyclic AMP acts as a second messenger in the modulation of several ion channels that are typically controlled by a phosphorylation process. In cardiac pacemaker cells, adrenaline and acetylcholine regulate the hyperpolarization-activated current (if), but in opposite ways; this current is involved in the generation and modulation of pacemaker activity. These actions are mediated by cAMP and underlie control of spontaneous rate by neurotransmitters. Whether the cAMP modulation of if is mediated by channel phosphorylation is, however, still unknown. Here we investigate the action of cAMP on if in excised patches of cardiac pacemaker cells and find that cAMP activates if by a mechanism independent of phosphorylation, involving a direct interaction with the channels at their cytoplasmic side. Cyclic AMP activates if by shifting its activation curve to more positive voltages, in agreement with whole-cell results. This is the first evidence of an ion channel whose gating is dually regulated by voltage and direct cAMP binding.

  11. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  12. [cAMP as a regulator of the phototransduction cascade].

    PubMed

    Astakhova, L A; Kapitskiĭ, S V; Govardovskiĭ, V I; Firsov, M L

    2012-11-01

    Until recently, it has generally been believed that cyclic AMP plays an important role in supporting circadian cycles in the vertebrate retina, but does not directly control the photoreceptors' phototransduction cascade. However, the cAMP levels in photoreceptors oscillate during the day/night cycle, and the cAMP turnover in photoreceptors may be light-dependent. Thus it is natural to suggest that the cAMP-dependent protein phosphorylation may be a mechanism of tuning phototransduction to lighting conditions. In the present review, we summarize available information on the structure and operation of the retinal pacemaker, role(s) of cAMP in its functioning, and identified intracellular targets that could be controlled by cAMP. We discuss our recent results that show that cAMP changes do regulate the phototransduction cascade. This regulation may substantially extend the range of photoreceptor's adaptation by increasing its sensitivity at night, and reducing the sensitivity in bright light. PMID:23431758

  13. The Popeye Domain Containing Genes and cAMP Signaling

    PubMed Central

    Brand, Thomas; Poon, Kar Lai; Simrick, Subreena; Schindler, Roland F.R.

    2016-01-01

    3'-5'-cyclic adenosine monophosphate (cAMP) is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs). Initially, it was thought that protein kinase A (PKA) exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC) and hyperpolarizing cyclic nucleotide-gated (HCN) channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc) genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins. PMID:27500161

  14. Cyclic AMP negatively regulates prodigiosin production by Serratia marcescens.

    PubMed

    Kalivoda, Eric J; Stella, Nicholas A; Aston, Marissa A; Fender, James E; Thompson, Paul P; Kowalski, Regis P; Shanks, Robert M Q

    2010-03-01

    Many Serratia marcescens strains produce the red pigment prodigiosin, which has antimicrobial and anti-tumor properties. Previous reports suggest that cyclic AMP (cAMP) is a positive regulator of prodigiosin production. Supporting this model, the addition of glucose to growth medium inhibited pigment production in rich and minimal media. Unexpectedly, we observed highly elevated levels of prodigiosin production in isogenic strains with mutations in genes involved in cAMP production (cyaA and crr) and in cAMP-dependent transcriptional signaling (crp). Multicopy expression of the Escherichia coli cAMP-phosphodiesterase gene, cpdA, also conferred a striking increase in prodigiosin production. Exogenous cAMP decreased both pigment production and pigA-lacZ transcription in the wild-type (WT) strain, and pigA-lacZ transcription was significantly increased in a crp mutant relative to WT. Suppressor and epistasis analysis indicate that the hyperpigment phenotype was dependent upon pigment biosynthetic genes (pigA, pigB, pigC, pigD and pigM). These experiments establish cAMP as a negative regulator of prodigiosin production in S. marcescens.

  15. Cyclic AMP inhibits secretion from electroporated human neutrophils.

    PubMed

    Smolen, J E; Stoehr, S J; Kuczynski, B

    1991-02-01

    It has long been known that intracellular cAMP inhibits and cGMP enhances intact neutrophil function. However, these effects are modest and require relatively high concentrations of the cyclic nucleotides. We decided to re-examine the effects of cyclic nucleotides on Ca2(+)-induced secretion by electroporated cells. This system allowed us to bypass normal cell surface receptor-ligand interactions as well as to directly expose the intracellular space to native cyclic nucleotides. We found that concentrations of cAMP as low as 3 microM inhibited Ca2(+)-induced secretion; 30-300 microM cAMP was maximally inhibitory. cAMP was actually slightly more potent than dibutyryl cAMP, a membrane-permeant derivative. In contrast, cGMP was only slightly stimulatory at 3 microM and modestly inhibitory at 300 microM; dibutyryl cGMP was ineffective. A more detailed investigation of the effects of cAMP showed that inhibition was only obtained in the presence of Mg2+. Half-maximal inhibition by cAMP occurred at 10-30 microM. Inhibition by cAMP was achieved by shifting the Ca2+ dose-response curve for secretion to the right; this was observed for the release of both specific granules (vitamin B12 binding protein) and azurophil granules (B-glucuronidase). We previously showed that ATP could enhance Ca2(+)-induced secretion in the presence of Mg2+, apparently by interacting with a cell surface purine receptor. However, increasing concentrations of ATP could not overcome inhibition by cAMP; this suggested that cAMP acted at some site other than the purine receptor. Inhibition by cAMP was also less apparent in the presence of the protein kinase C agonist phorbol myristate acetate (PMA), suggesting that the cyclic nucleotide did not produce systemic desensitization of the neutrophils. In summary, these results demonstrate that low, physiologically relevant concentrations of cAMP can modulate neutrophil responsiveness. PMID:1846904

  16. PdeH, a High-Affinity cAMP Phosphodiesterase, Is a Key Regulator of Asexual and Pathogenic Differentiation in Magnaporthe oryzae

    PubMed Central

    Ramanujam, Ravikrishna; Naqvi, Naweed I.

    2010-01-01

    Cyclic AMP-dependent pathways mediate the communication between external stimuli and the intracellular signaling machinery, thereby influencing important aspects of cellular growth, morphogenesis and differentiation. Crucial to proper function and robustness of these signaling cascades is the strict regulation and maintenance of intracellular levels of cAMP through a fine balance between biosynthesis (by adenylate cyclases) and hydrolysis (by cAMP phosphodiesterases). We functionally characterized gene-deletion mutants of a high-affinity (PdeH) and a low-affinity (PdeL) cAMP phosphodiesterase in order to gain insights into the spatial and temporal regulation of cAMP signaling in the rice-blast fungus Magnaporthe oryzae. In contrast to the expendable PdeL function, the PdeH activity was found to be a key regulator of asexual and pathogenic development in M. oryzae. Loss of PdeH led to increased accumulation of intracellular cAMP during vegetative and infectious growth. Furthermore, the pdeHΔ showed enhanced conidiation (2–3 fold), precocious appressorial development, loss of surface dependency during pathogenesis, and highly reduced in planta growth and host colonization. A pdeHΔ pdeLΔ mutant showed reduced conidiation, exhibited dramatically increased (∼10 fold) cAMP levels relative to the wild type, and was completely defective in virulence. Exogenous addition of 8-Br-cAMP to the wild type simulated the pdeHΔ defects in conidiation as well as in planta growth and development. While a fully functional GFP-PdeH was cytosolic but associated dynamically with the plasma membrane and vesicular compartments, the GFP-PdeL localized predominantly to the nucleus. Based on data from cAMP measurements and Real-Time RTPCR, we uncover a PdeH-dependent biphasic regulation of cAMP levels during early and late stages of appressorial development in M. oryzae. We propose that PdeH-mediated sustenance and dynamic regulation of cAMP signaling during M. oryzae development is

  17. Multiple Facets of cAMP Signalling and Physiological Impact: cAMP Compartmentalization in the Lung

    PubMed Central

    Oldenburger, Anouk; Maarsingh, Harm; Schmidt, Martina

    2012-01-01

    Therapies involving elevation of the endogenous suppressor cyclic AMP (cAMP) are currently used in the treatment of several chronic inflammatory disorders, including chronic obstructive pulmonary disease (COPD). Characteristics of COPD are airway obstruction, airway inflammation and airway remodelling, processes encompassed by increased airway smooth muscle mass, epithelial changes, goblet cell and submucosal gland hyperplasia. In addition to inflammatory cells, airway smooth muscle cells and (myo)fibroblasts, epithelial cells underpin a variety of key responses in the airways such as inflammatory cytokine release, airway remodelling, mucus hypersecretion and airway barrier function. Cigarette smoke, being next to environmental pollution the main cause of COPD, is believed to cause epithelial hyperpermeability by disrupting the barrier function. Here we will focus on the most recent progress on compartmentalized signalling by cAMP. In addition to G protein-coupled receptors, adenylyl cyclases, cAMP-specific phospho-diesterases (PDEs) maintain compartmentalized cAMP signalling. Intriguingly, spatially discrete cAMP-sensing signalling complexes seem also to involve distinct members of the A-kinase anchoring (AKAP) superfamily and IQ motif containing GTPase activating protein (IQGAPs). In this review, we will highlight the interaction between cAMP and the epithelial barrier to retain proper lung function and to alleviate COPD symptoms and focus on the possible molecular mechanisms involved in this process. Future studies should include the development of cAMP-sensing multiprotein complex specific disruptors and/or stabilizers to orchestrate cellular functions. Compartmentalized cAMP signalling regulates important cellular processes in the lung and may serve as a therapeutic target. PMID:24281338

  18. Heat exchanger-accumulator

    DOEpatents

    Ecker, Amir L.

    1980-01-01

    What is disclosed is a heat exchanger-accumulator for vaporizing a refrigerant or the like, characterized by an upright pressure vessel having a top, bottom and side walls; an inlet conduit eccentrically and sealingly penetrating through the top; a tubular overflow chamber disposed within the vessel and sealingly connected with the bottom so as to define an annular outer volumetric chamber for receiving refrigerant; a heat transfer coil disposed in the outer volumetric chamber for vaporizing the liquid refrigerant that accumulates there; the heat transfer coil defining a passageway for circulating an externally supplied heat exchange fluid; transferring heat efficiently from the fluid; and freely allowing vaporized refrigerant to escape upwardly from the liquid refrigerant; and a refrigerant discharge conduit penetrating sealingly through the top and traversing substantially the length of the pressurized vessel downwardly and upwardly such that its inlet is near the top of the pressurized vessel so as to provide a means for transporting refrigerant vapor from the vessel. The refrigerant discharge conduit has metering orifices, or passageways, penetrating laterally through its walls near the bottom, communicating respectively interiorly and exteriorly of the overflow chamber for controllably carrying small amounts of liquid refrigerant and oil to the effluent stream of refrigerant gas.

  19. cAMP Regulation of the lactose operon.

    PubMed

    Szeberenyi, Jozsef

    2004-05-01

    Terms to be familiar with before you start to solve the test: lactose operon, adenylate cyclase, cAMP, catabolite activator protein (CAP), expression plasmid, lac operator, lac repressor, lactose, glucose, promoter, cis- and trans-acting factors. PMID:21706723

  20. Amped Up! - Volume 1, No. 3, May/June 2015

    SciTech Connect

    2015-05-01

    Welcome to the latest issue of our bimonthly newsletter, Amped Up!, highlighting the initiatives, events and technologies in the Office of Energy Efficiency and Renewable Energy that influence change.

  1. ^amp;+^amp;-p Electroproduction Cross Sections off Protons in the Second Resonance Region

    NASA Astrophysics Data System (ADS)

    Fedotov, Gleb; Gothe, Ralf; Mokeev, Victor

    2013-04-01

    In this talk we present preliminary ^amp;+^amp;-p electroproduction cross sections off protons in the kinematical area of W from 1.4 to 1.8 GeV and Q^2 from 0.4 to 1.1 GeV^2. Our kinematical coverage in part overlap with previous CLAS measurements, but offers more than a factor six finer binning in Q^2. The physics analysis of these data within the framework of the JM model will allow us to determine the electrocouplings and the partial πδ, ρp decay widths of several high lying nucleon resonances S31(1620), S11(1650), F15(1685), D33(1700), P13(1720) and to further explore the evidence for the 3/2^+(1720) candidate-state. Analysis of the single pion electroproduction data measured with CLAS in the aforementioned kinematic region is in progress. Single and charged double pion exclusive channels are major contributors to the meson electroproduction in the N* excitation region with different non-resonant mechanisms. A successful description of all observables in these exclusive channels with consistent N* electrocouplings will offer evidence for the reliable evaluation of these fundamental quantities.

  2. Airborne Multisensor Pod System (AMPS) data management overview

    SciTech Connect

    Wiberg, J.D.; Blough, D.K.; Daugherty, W.R.; Hucks, J.A.; Gerhardstein, L.H.; Meitzler, W.D.; Melton, R.B.; Shoemaker, S.V.

    1994-09-01

    An overview of the Data Management Plan for the Airborne Multisensor Pod System (AMPS) pro-grain is provided in this document. The Pacific Northwest Laboratory (PNL) has been assigned the responsibility of data management for the program, which includes defining procedures for data management and data quality assessment. Data management is defined as the process of planning, acquiring, organizing, qualifying and disseminating data. The AMPS program was established by the U.S. Department of Energy (DOE), Office of Arms Control and Non-Proliferation (DOE/AN) and is integrated into the overall DOE AN-10.1 technology development program. Sensors used for collecting the data were developed under the on-site inspection, effluence analysis, and standoff sensor program, the AMPS program interacts with other technology programs of DOE/NN-20. This research will be conducted by both government and private industry. AMPS is a research and development program, and it is not intended for operational deployment, although the sensors and techniques developed could be used in follow-on operational systems. For a complete description of the AMPS program, see {open_quotes}Airborne Multisensor Pod System (AMPS) Program Plan{close_quotes}. The primary purpose of the AMPS is to collect high-quality multisensor data to be used in data fusion research to reduce interpretation problems associated with data overload and to derive better information than can be derived from any single sensor. To collect the data for the program, three wing-mounted pods containing instruments with sensors for collecting data will be flight certified on a U.S. Navy RP-3A aircraft. Secondary objectives of the AMPS program are sensor development and technology demonstration. Pod system integrators and instrument developers will be interested in the performance of their deployed sensors and their supporting data acquisition equipment.

  3. Amp Synthesis in Aqueous Solution of Adenosine and Phosphorus Pentoxide

    NASA Astrophysics Data System (ADS)

    Yamagata, Y.; Kojima, H.; Ejiri, K.; Inomata, K.

    1982-12-01

    Possible formation of a P4O10 molecule in magma, the stability of the molecule in hydrous volcanic gas at high temperatures and a possible prebiotic phosphate cycle were discussed in relation to chemical evolution. To demonstrate the utility of phosphorus pentoxide as a phosphorylating agent, aqueous solutions of adenosine (0.02M) and phosphorus pentoxide (0.2M) were incubated at 37°C for 5 months. The pH of the solutions was adjusted every day or every few days to each fixed value (9.0, 10.5, 11.5, 12.5) with 10 N NaOH. The HPLC analysis showed the formation of 2'-AMP, 3'-AMP, 5'-AMP, cyclic (2' 3')-AMP and cyclic (3' 5')-AMP. The main components of the products were 2'- and 3'-AMP, though cyclic (2' 3')-AMP was the main component in the early period of the incubation at pH 9.0. The yields (conversion rate of adenosine to AMPs) were increased almost linearly with the incubation time for 5 months in the case of pH 9.0. The final yields were about 3% (pH 9.0), 6% (pH 9.0, 1 M NaCl), 5% (pH 9.0, 0.01 M CaCl2, 0.01 M MgCl2), 7% (pH 9.0, 0.5 M NaCl, 0.01 M CaCl2, 0.01 M MgCl2), 9% (pH 9.0, 1 M NaCl, 0.01 M CaCl2, 0.01 M MgCl2), 32% (pH 10.5), 43% (pH 11.5), 35% (pH 12.5).

  4. Why Ampère did not discover electromagnetic induction

    NASA Astrophysics Data System (ADS)

    Williams, L. Pearce

    1986-04-01

    In 1832, after Michael Faraday had announced his discovery of electromagnetic induction, Andre-Marie Ampère claimed that he had actually discovered the induction of one current by another in 1822. In fact, he had, but did not really publish the fact at that time. This article explores the reasons for Ampère's failure to lay claim to a discovery that would have guaranteed him scientific immortality.

  5. Histamine receptors on adult rat cardiomyocytes: antagonism of alpha/sub 1/-receptor stimulation of cAMP degradation

    SciTech Connect

    Buxton, I.L.O.; Bowen, S.M.

    1986-03-01

    Incubation of intact cardiomyocytes with the histamine antagonist (/sup 3/H)mepyramine results in rapid reversible binding to a single class of high affinity sites (K/sub D/ = 1.2nM; 50,000 sites/myocyte). In membranes from purified myocytes histamine competition of (/sup 3/H)mepyramine binding (K/sub D/ = 300nM) is not altered by GTP (10..mu..M). Competition of (/sup 3/H)mepyramine binding by H-receptor subtype-selective antagonists suggests the presence of a single class of H/sub 1/-receptors. Incubation of intact myocytes with histamine (luM, H/sub 1/ receptor activation) plus norepinephrine (NE 1uM, alpha/sub 1/ + beta/sub 1/ receptor activation) for 3 min leads to significantly more cAMP accumulation (36.5 pmol/10/sup 6/ myocytes) than NE alone (30 pmol/10/sup 6/ myocytes). Histamine alone does not alter basal cAMP = 10.4 pmol/10/sup 6/ myocytes, or beta/sub 1/ stimulation (isoproternol, 1uM) = 39.6 pmol/10/sup 6/ myocytes. Cyclic AMP accumulation with NE plus prazosin 10nM, (alpha/sub 1/ + beta/sub 1/ + alpha/sub 1/ blockade) is indistinguishable from NE + histamine, (alpha/sub 1/ + beta/sub 1/ + H/sub 1/) stimulation. Histamine competition for (/sup 3/H)prazosin binding suggests that histamine does not block alpha/sub 1/ receptors on the myocyte. These data suggest that H/sub 1/ receptor activation leads to antagonism of the alpha/sub 1/ receptor mediated activation of cAMP phosphodiesterase the authors have recently described.

  6. Bacterial Cyclic AMP-Phosphodiesterase Activity Coordinates Biofilm Formation

    PubMed Central

    Kalivoda, Eric J.; Brothers, Kimberly M.; Stella, Nicholas A.; Schmitt, Matthew J.; Shanks, Robert M. Q.

    2013-01-01

    Biofilm-related infections are a major contributor to human disease, and the capacity for surface attachment and biofilm formation are key attributes for the pathogenesis of microbes. Serratia marcescens type I fimbriae-dependent biofilms are coordinated by the adenylate cyclase, CyaA, and the cyclic 3′,5′-adenosine monophosphate (cAMP)-cAMP receptor protein (CRP) complex. This study uses S. marcescens as a model system to test the role of cAMP-phosphodiesterase activity in controlling biofilm formation. Herein we describe the characterization of a putative S. marcescens cAMP-phosphodiesterase gene (SMA3506), designated as cpdS, and demonstrated to be a functional cAMP-phosphodiesterase both in vitro and in vivo. Deletion of cpdS resulted in defective biofilm formation and reduced type I fimbriae production, whereas multicopy expression of cpdS conferred a type I fimbriae-dependent hyper-biofilm. Together, these results support a model in which bacterial cAMP-phosphodiesterase activity modulates biofilm formation. PMID:23923059

  7. Activation of AMP-kinase by Policosanol Requires Peroxisomal Metabolism

    PubMed Central

    Banerjee, Subhashis; Ghoshal, Sarbani

    2011-01-01

    Policosanol, a well-defined mixture of very long chain primary alcohols that is available as a nutraceutical product, has been reported to lower blood cholesterol levels. The present studies demonstrate that policosanol promotes the phosphorylation of AMP-kinase and HMG-CoA reductase in hepatoma cells and in mouse liver after intragastric administration, providing a possible means by which policosanol might lower blood cholesterol levels. Treatment of hepatoma cells with policosanol produced a 2.5-fold or greater increase in the phosphorylation of AMP-kinase and HMG-CoA reductase, and increased the phosphorylation of Ca++/calmodulin-dependent kinase kinase (CaMKK), an upstream AMP-kinase kinase. Intra-gastric administration of policosanol to mice similarly increased the phosphorylation of hepatic HMG-CoA reductase and AMP-kinase by greater than 2-fold. siRNA-mediated suppression of fatty aldehyde dehydrogenase, fatty acyl-CoA synthetase 4, and acyl-CoA acetyltransferase expression in hepatoma cells prevented the phosphorylation of AMP-kinase and HMG-CoA reductase by policosanol, indicating that metabolism of these very long chain alcohols to activated fatty acids is necessary for the suppression of cholesterol synthesis, presumably by increasing cellular AMP levels. Subsequent peroxisomal β-oxidation probably augments this effect. PMID:21359855

  8. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    PubMed Central

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.; Sillito, Rowland R.; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J. Douglas; Porteous, David J.; Patton, E. Elizabeth

    2015-01-01

    Summary Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  9. Solids Accumulation Scouting Studies

    SciTech Connect

    Duignan, M. R.; Steeper, T. J.; Steimke, J. L.

    2012-09-26

    The objective of Solids Accumulation activities was to perform scaled testing to understand the behavior of remaining solids in a Double Shell Tank (DST), specifically AW-105, at Hanford during multiple fill, mix, and transfer operations. It is important to know if fissionable materials can concentrate when waste is transferred from staging tanks prior to feeding waste treatment plants. Specifically, there is a concern that large, dense particles containing plutonium could accumulate in poorly mixed regions of a blend tank heel for tanks that employ mixing jet pumps. At the request of the DOE Hanford Tank Operations Contractor, Washington River Protection Solutions, the Engineering Development Laboratory of the Savannah River National Laboratory performed a scouting study in a 1/22-scale model of a waste staging tank to investigate this concern and to develop measurement techniques that could be applied in a more extensive study at a larger scale. Simulated waste tank solids: Gibbsite, Zirconia, Sand, and Stainless Steel, with stainless steel particles representing the heavier particles, e.g., plutonium, and supernatant were charged to the test tank and rotating liquid jets were used to mix most of the solids while the simulant was pumped out. Subsequently, the volume and shape of the mounds of residual solids and the spatial concentration profiles for the surrogate for heavier particles were measured. Several techniques were developed and equipment designed to accomplish the measurements needed and they included: 1. Magnetic particle separator to remove simulant stainless steel solids. A device was designed and built to capture these solids, which represent the heavier solids during a waste transfer from a staging tank. 2. Photographic equipment to determine the volume of the solids mounds. The mounds were photographed as they were exposed at different tank waste levels to develop a composite of topographical areas. 3. Laser rangefinders to determine the volume of

  10. Functional repression of cAMP response element in 6-hydroxydopamine-treated neuronal cells.

    PubMed

    Chalovich, Elisabeth M; Zhu, Jian-hui; Caltagarone, John; Bowser, Robert; Chu, Charleen T

    2006-06-30

    Impaired survival signaling may represent a central mechanism in neurodegeneration. 6-Hydroxydopamine (6-OHDA) is an oxidative neurotoxin used to injure catecholaminergic cells of the central and peripheral nervous systems. Although 6-OHDA elicits phosphorylation of several kinases, downstream transcriptional effects that influence neuronal cell death are less defined. The cAMP response element (CRE) is present in the promoter sequences of several important neuronal survival factors. Treatment of catecholaminergic neuronal cell lines (B65 and SH-SY5Y) with 6-OHDA resulted in repression of basal CRE transactivation. Message levels of CRE-driven genes such as brain-derived neurotrophic factor and the survival factor Bcl-2 were decreased in 6-OHDA-treated cells, but message levels of genes lacking CRE sequences were not affected. Repression of CRE could be reversed by delayed treatment with cAMP several hours after initiation of 6-OHDA injury. Furthermore, restoration of CRE-driven transcription was associated with significant neuroprotection. In contrast to observations in other model systems, the mechanism of CRE repression did not involve decreased phosphorylation of its binding protein CREB. Instead, total CREB and phospho-CREB (pCREB) were increased in the cytoplasm and decreased in the nucleus of 6-OHDA-treated cells. 6-OHDA also decreased nuclear pCREB in dopaminergic neurons of primary mouse midbrain cultures. Co-treatment with cAMP promoted/restored nuclear localization of pCREB in both immortalized and primary culture systems. Increased cytoplasmic pCREB was observed in degenerating human Parkinson/Lewy body disease substantia nigra neurons but not in age-matched controls. Notably, cytoplasmic accumulation of activated upstream CREB kinases has been observed previously in both 6-OHDA-treated cells and degenerating human neurons, supporting a potential role for impaired nuclear import of phosphorylated signaling proteins.

  11. The Search for a π1(1400) Exotic Meson in the γp->^amp;++η^amp;- System

    NASA Astrophysics Data System (ADS)

    Schott, Diane

    2013-04-01

    Over twenty years ago QCD-inspired models of hadronic states suggested the existence of mesons beyond the Naive Quark Model (NQM), which motivated a rigorous search for exotic mesons. The lightest of these states is the π1(1400) decaying to η^amp;- observed by experiment E852 at Brookhaven and the VES collaboration at IHEP. Photoproduction is predicted to favor production of a J^PC=1^-+ gluonic excitation resulting in the increase of the ratio of π1 to a2 mesons. A Partial Wave Analysis was conducted on the reaction γp->^amp;++X->p^amp;+^amp;-(η), using the ^amp;++ to select the pion exchange. The analysis has shown the final spectra of the resonance decaying to η^amp;- to be dominated by the quantum state of J^PC=2^++ corresponding to the presence of the a2(1320). The J^PC=1^-+ state, shows no structure in the intensity distribution. The phase difference between the J^PC=1^-+ and J^PC=2^++ amplitudes show the interference between the two states. This is the first spin-parity analysis of the ηπ final state in photoproduction.

  12. Pseudohypoparathyroidism and Gsα-cAMP-linked disorders: current view and open issues.

    PubMed

    Mantovani, Giovanna; Spada, Anna; Elli, Francesca Marta

    2016-06-01

    Pseudohypoparathyroidism exemplifies an unusual form of hormone resistance as the underlying molecular defect is a partial deficiency of the α subunit of the stimulatory G protein (Gsα), a key regulator of the cAMP signalling pathway, rather than of the parathyroid hormone (PTH) receptor itself. Despite the first description of this disorder dating back to 1942, later findings have unveiled complex epigenetic alterations in addition to classic mutations in GNAS underpining the molecular basis of the main subtypes of pseudohypoparathyroidism. Moreover, mutations in PRKAR1A and PDE4D, which encode proteins crucial for Gsα-cAMP-mediated signalling, have been found in patients with acrodysostosis. As acrodysostosis, a disease characterized by skeletal malformations and endocrine disturbances, shares clinical and molecular characteristics with pseudohypoparathyroidism, making a differential diagnosis and providing genetic counselling to patients and families is a challenge for endocrinologists. Accumulating data on the genetic and clinical aspects of this group of diseases highlight the limitation of the current classification system and prompt the need for a new definition as well as for new diagnostic and/or therapeutic algorithms. This Review discusses both the current understanding and future challenges for the clinical and molecular diagnosis, classification and treatment of pseudohypoparathyroidism. PMID:27109785

  13. Intraoperative urinary cyclic AMP monitoring in primary hyperparathyroidism.

    PubMed Central

    Schenk, W G; Wills, M; MacLeod, M S; Hanks, J B

    1993-01-01

    OBJECTIVE: This study examined the utility of intraoperative urinary cyclic 3'5' adenosine monophosphate (UcAMP), an indicator of parathyroid (PTH) hormone end-organ activity, as a "biochemical frozen section," signaling the real-time resolution of PTH hyperactivity during surgery for primary hyperparathyroidism. SUMMARY BACKGROUND DATA: The unsuccessful initial neck exploration for primary hyperparathyroidism, leaving the patient with persistent hyperfunctioning parathyroid tissue, results in part from the surgeon's inability intraoperatively to correlate a gland's gross appearance and size estimation with physiologic function. Preoperative imaging, intraoperative imaging, and intraoperative histologic/cytologic surveillance have not resolved this dilemma. METHODS: Twenty-seven patients underwent a prospective intraoperative UcAMP monitoring protocol. The patients all had a clinical diagnosis of primary hyperparathyroidism and an average preoperative serum calcium of 12.0 +/- 0.3 mg/dl. UcAMP was assayed intraoperatively using 20-minute nonequilibrium radioimmunoassay providing real-time feedback to the operating team. RESULTS: All patients had an elevated UcAMP confirming PTh hyperactivity at the beginning of the procedure. One patient, subsequently found to have an supernumerary ectopic adenoma, had four normal glands identified intraoperatively, and his intraoperative UcAMP values corroborated persistent hyperparathyroidism, the UcAMP of the remaining 26 patients decreased from 7.0 +/- 1.1 to 2.7 +/- 0.7 nm.dl GF (p < .00005) after complete adenoma excision, and they remain normocalcemic. The protocol provided useful and relevant information to the operating team, and aided in surgical decision-making, in 10 of the 27 cases (37%). CONCLUSION: Intraoperative biochemical surveillance with ucAMP monitoring reliably signals resolution of PTH hyperfunction. It is a useful adjunct to the surgeon's skill, judgment, and experience in parathyroid surgery. PMID:8387765

  14. Sugar Accumulation in Sugarcane

    PubMed Central

    Gayler, K. R.; Glasziou, K. T.

    1972-01-01

    The rate-limiting reaction for glucose uptake in storage tissue of sugarcane, Saccharum officinarum L., appears to be the movement of glucose across the boundary between the free space and the metabolic compartments. The mechanism for uptake of glucose across this boundary has been studied using 3-O-methyl glucose, an analogue of glucose which is not metabolized by sugar-cane tissue. This analogue is taken up by sugarcane storage tissue at a similar rate to glucose. Its rate of uptake follows Michaelis-Menten kinetics, Km = 1.9 mm, and it is competitively inhibited by glucose, Ki = 2 to 3 mm. Glucose uptake is similarly inhibited by 3-O-methyl glucose. Uptake of 3-O-methyl glucose is energy-dependent and does not appear to be the result of counterflow of glucose. It is concluded that glucose and 3-O-methyl glucose uptake across the boundary between the free space and the metabolic compartment in this tissue is mediated by an energy-dependent carrier system capable of accumulating the sugars against a concentration gradient. PMID:16658002

  15. TTX accumulation in pufferfish.

    PubMed

    Noguchi, Tamao; Arakawa, Osamu; Takatani, Tomohiro

    2006-03-01

    Tetrodotoxin (TTX) has been detected in a variety of animals. The finding of TTX in the trumpet shell Charonia sauliae strongly suggested that its origin was its food, a TTX-bearing starfish Astropecten polyacanthus. Since then, the food chain has been consistently implicated as the principal means of TTX intoxication. To identify the primary producer of TTX, intestinal bacteria isolated from several TTX-bearers were investigated for their TTX production. The results demonstrated that some of them could produce TTX. Thus the primary TTX producers in the sea are concluded to be marine bacteria. Subsequently, detritus feeders and zooplankton can be intoxicated with TTX through the food chain, or in conjunction with parasitism or symbiosis. The process followed by small carnivores, omnivores or scavengers, and by organisms higher up the food chain would result in the accumulation of higher concentrations of TTX. Finally, pufferfish at the top of the food chain are intoxicated with TTX. This hypothesis is supported by the fact that net cage and land cultures produce non-toxic pufferfish that can be made toxic by feeding with a TTX-containing diet.

  16. Profound Asymmetry in the Structure of the cAMP-free cAMP Receptor Protein (CRP) from Mycobacterium tuberculosis

    SciTech Connect

    Gallagher, D.; Smith, N; Kim, S; Robinson, H; Reddy, P

    2009-01-01

    The cyclic AMP receptor protein (CRP, also called catabolite gene activator protein or CAP) plays a key role in metabolic regulation in bacteria and has become a widely studied model allosteric transcription factor. On binding its effector cAMP in the N-terminal domain, CRP undergoes a structural transition to a conformation capable of specific DNA binding in the C-terminal domain and transcription initiation. The crystal structures of Escherichia coli CRP (EcCRP) in the cAMP-bound state, both with and without DNA, are known, although its structure in the off state (cAMP-free, apoCRP) remains unknown. We describe the crystal structure at 2.0A resolution of the cAMP-free CRP homodimer from Mycobacterium tuberculosis H37Rv (MtbCRP), whose sequence is 30% identical with EcCRP, as the first reported structure of an off-state CRP. The overall structure is similar to that seen for the cAMP-bound EcCRP, but the apo MtbCRP homodimer displays a unique level of asymmetry, with a root mean square deviation of 3.5A between all C? positions in the two subunits. Unlike structures of on-state EcCRP and other homologs in which the C-domains are asymmetrically positioned but possess the same internal conformation, the two C-domains of apo MtbCRP differ both in hinge structure and in internal arrangement, with numerous residues that have completely different local environments and hydrogen bond interactions, especially in the hinge and DNA-binding regions. Comparison of the structures of apo MtbCRP and DNA-bound EcCRP shows how DNA binding would be inhibited in the absence of cAMP and supports a mechanism involving functional asymmetry in apoCRP.

  17. Intracellular tortuosity underlies slow cAMP diffusion in adult ventricular myocytes

    PubMed Central

    Richards, Mark; Lomas, Oliver; Jalink, Kees; Ford, Kerrie L.; Vaughan-Jones, Richard D.; Lefkimmiatis, Konstantinos; Swietach, Pawel

    2016-01-01

    Aims 3′,5′-Cyclic adenosine monophosphate (cAMP) signals in the heart are often confined to concentration microdomains shaped by cAMP diffusion and enzymatic degradation. While the importance of phosphodiesterases (degradative enzymes) in sculpting cAMP microdomains is well established in cardiomyocytes, less is known about cAMP diffusivity (DcAMP) and factors affecting it. Many earlier studies have reported fast diffusivity, which argues against sharply defined microdomains. Methods and results [cAMP] dynamics in the cytoplasm of adult rat ventricular myocytes were imaged using a fourth generation genetically encoded FRET-based sensor. The [cAMP]-response to the addition and removal of isoproterenol (β-adrenoceptor agonist) quantified the rates of cAMP synthesis and degradation. To obtain a read out of DcAMP, a stable [cAMP] gradient was generated using a microfluidic device which delivered agonist to one half of the myocyte only. After accounting for phosphodiesterase activity, DcAMP was calculated to be 32 µm2/s; an order of magnitude lower than in water. Diffusivity was independent of the amount of cAMP produced. Saturating cAMP-binding sites with the analogue 6-Bnz-cAMP did not accelerate DcAMP, arguing against a role of buffering in restricting cAMP mobility. cAMP diffused at a comparable rate to chemically unrelated but similar sized molecules, arguing for a common physical cause of restricted diffusivity. Lower mitochondrial density and order in neonatal cardiac myocytes allowed for faster diffusion, demonstrating the importance of mitochondria as physical barriers to cAMP mobility. Conclusion In adult cardiac myocytes, tortuosity due to physical barriers, notably mitochondria, restricts cAMP diffusion to levels that are more compatible with microdomain signalling. PMID:27089919

  18. Role of Exchange Protein Activated by cAMP 1 in Regulating Rates of Microtubule Formation in Cystic Fibrosis Epithelial Cells.

    PubMed

    Rymut, Sharon M; Ivy, Tracy; Corey, Deborah A; Cotton, Calvin U; Burgess, James D; Kelley, Thomas J

    2015-12-01

    The regulation of microtubule dynamics in cystic fibrosis (CF) epithelial cells and the consequences of reduced rates of microtubule polymerization on downstream CF cellular events, such as cholesterol accumulation, a marker of impaired intracellular transport, are explored here. It is identified that microtubules in both CF cell models and in primary CF nasal epithelial cells repolymerize at a slower rate compared with respective controls. Previous studies suggest a role for cAMP in modulating organelle transport in CF cells, implicating a role for exchange protein activated by cAMP (EPAC) 1, a regulator of microtubule elongation, as a potential mechanism. EPAC1 activity is reduced in CF cell models and in Cftr(-/-) mouse lung compared with respective non-CF controls. Stimulation of EPAC1 activity with the selective EPAC1 agonist, 8-cpt-2-O-Me-cAMP, stimulates microtubule repolymerization to wild-type rates in CF cells. EPAC1 activation also alleviates cholesterol accumulation in CF cells, suggesting a direct link between microtubule regulation and intracellular transport. To verify the relationship between transport and microtubule regulation, expression of the protein, tubulin polymerization-promoting protein, was knocked down in non-CF human tracheal (9/HTEo(-)) cells to mimic the microtubule dysregulation in CF cells. Transduced cells with short hairpin RNA targeting tubulin polymerization-promoting protein exhibit CF-like perinuclear cholesterol accumulation and other cellular manifestations of CF cells, thus supporting a role for microtubule regulation as a mechanism linking CFTR function to downstream cellular manifestation.

  19. Cyclic AMP, a nonessential regulator of the cell cycle.

    PubMed Central

    Coffino, P; Gray, J W; Tomkins, G M

    1975-01-01

    Flow-microfluorimetric analysis has been carried out on populations of exponentially growing S49 mouse lymphoma cells treated with dibutyryl cyclic AMP. The drug produces a specific concentration-dependent block in the G-1 phase of the cell cycle while other phases of the cycle are not perceptibly altered. The cell cycle of a line of mutant cells lacking the cyclic AMP-dependent protein kinase is not affected by the drug. Since these mutant cells have been shown to maintain a normal cell cycle, even in the presence of high levels of cyclic AMP, periodic fluctuations in the levels of the cyclic nucleotide cannot be required for or determine progression through the cell cycle. PMID:165491

  20. cAMP Sensor EPAC Proteins and Energy Homeostasis

    PubMed Central

    Almahariq, Muayad; Mei, Fang C.; Cheng, Xiaodong

    2013-01-01

    The pleotropic second messenger cAMP plays a critical role in mediating the effects of various hormones on metabolism. The major intracellular functions of cAMP are transduced by protein kinase A (PKA) and exchange proteins directly activated by cAMP (EPACs). The latter act as guanine nucleotide exchange factors for the RAS-like small G-proteins Rap1 and Rap2. While the role of PKA in regulating energy balance has been extensively studied, EPACs’ impact remains relatively enigmatic. This review summarizes recent genetic and pharmacological studies concerning EPACs’ involvement in glucose homeostasis and energy balance, through regulation of leptin and insulin signaling pathways. Additionally, the development of small molecule EPAC-specific modulators and their therapeutic potential for the treatment of diabetes and obesity are discussed. PMID:24231725

  1. Cyclic AMP system in muscle tissue during prolonged hypokinesia

    NASA Technical Reports Server (NTRS)

    Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

    1980-01-01

    Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

  2. cAMP increases mitochondrial cholesterol transport through the induction of arachidonic acid release inside this organelle in Leydig cells.

    PubMed

    Castillo, Ana Fernanda; Cornejo Maciel, Fabiana; Castilla, Rocío; Duarte, Alejandra; Maloberti, Paula; Paz, Cristina; Podestá, Ernesto J

    2006-11-01

    We have investigated the direct effect of arachidonic acid on cholesterol transport in intact cells or isolated mitochondria from steroidogenic cells and the effect of cyclic-AMP on the specific release of this fatty acid inside the mitochondria. We show for the first time that cyclic-AMP can regulate the release of arachidonic acid in a specialized compartment of MA-10 Leydig cells, e.g. the mitochondria, and that the fatty acid induces cholesterol transport through a mechanism different from the classical pathway. Arachidonic acid and arachidonoyl-CoA can stimulate cholesterol transport in isolated mitochondria from nonstimulated cells. The effect of arachidonoyl-CoA is inhibited by the reduction in the expression or in the activity of a mitochondrial thioesterase that uses arachidonoyl-CoA as a substrate to release arachidonic acid. cAMP-induced arachidonic acid accumulation into the mitochondria is also reduced when the mitochondrial thioesterase activity or expression is blocked. This new feature in the regulation of cholesterol transport by arachidonic acid and the release of arachidonic acid in specialized compartment of the cells could offer novel means for understanding the regulation of steroid synthesis but also would be important in other situations such as neuropathological disorders or oncology disorders, where cholesterol transport plays an important role.

  3. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells.

    PubMed

    Khan, D R; Guillemette, C; Sirard, M A; Richard, F J

    2015-09-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3'5'-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca(2+)) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence.

  4. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells

    PubMed Central

    Khan, D. R.; Guillemette, C.; Sirard, M. A.

    2015-01-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3′5′-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca2+) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence. PMID:26082143

  5. AKAPs: The Architectural Underpinnings of Local cAMP signaling

    PubMed Central

    Kritzer, Michael D.; Li, Jinliang; Dodge-Kafka, Kimberly; Kapiloff, Michael S.

    2011-01-01

    The cAMP-dependent protein kinase A (PKA) is targeted to specific compartments in the cardiac myocyte by A-kinase anchoring proteins (AKAPs), a diverse set of scaffold proteins that have been implicated in the regulation of excitation-contraction coupling and cardiac remodeling. AKAPs bind not only PKA, but also a large variety of structural and signaling molecules. In this review, we discuss the basic concepts underlying compartmentation of cAMP and PKA signaling, as well as a few of the individual AKAPs that have been shown to be functionally relevant in the heart. PMID:21600214

  6. The field concept in Ampère's magnetostatics

    NASA Astrophysics Data System (ADS)

    Davis, Artice M.

    2009-08-01

    We update Ampère's theory using vector notation and derive his expression for the force between two current elements. We assume that the two elements are in different current loops and integrate over one to obtain the force on a differential element in the second. This procedure allows us to define the magnetic field in a natural manner and to derive the Lorentz force for a current segment. We equate the magnetic moments of current and permanent magnet dipoles and show that Biot and Savart could have performed their experiment using a small current loop, thus establishing the Biot-Savart law as a consequence of Ampère's theory.

  7. Regulation and organization of adenylyl cyclases and cAMP.

    PubMed Central

    Cooper, Dermot M F

    2003-01-01

    Adenylyl cyclases are a critically important family of multiply regulated signalling molecules. Their susceptibility to many modes of regulation allows them to integrate the activities of a variety of signalling pathways. However, this property brings with it the problem of imparting specificity and discrimination. Recent studies are revealing the range of strategies utilized by the cyclases to solve this problem. Microdomains are a consequence of these solutions, in which cAMP dynamics may differ from the broad cytosol. Currently evolving methodologies are beginning to reveal cAMP fluctuations in these various compartments. PMID:12940771

  8. Noise Reduction by Signal Accumulation

    ERIC Educational Resources Information Center

    Kraftmakher, Yaakov

    2006-01-01

    The aim of this paper is to show how the noise reduction by signal accumulation can be accomplished with a data acquisition system. This topic can be used for student projects. In many cases, the noise reduction is an unavoidable part of experimentation. Several techniques are known for this purpose, and among them the signal accumulation is the…

  9. Adiponectin and AMP kinase activator stimulate proliferation, differentiation, and mineralization of osteoblastic MC3T3-E1 cells

    PubMed Central

    Kanazawa, Ippei; Yamaguchi, Toru; Yano, Shozo; Yamauchi, Mika; Yamamoto, Masahiro; Sugimoto, Toshitsugu

    2007-01-01

    Background Adiponectin is a key mediator of the metabolic syndrome that is caused by visceral fat accumulation. Adiponectin and its receptors are known to be expressed in osteoblasts, but their actions with regard to bone metabolism are still unclear. In this study, we investigated the effects of adiponectin on the proliferation, differentiation, and mineralization of osteoblastic MC3T3-E1 cells. Results Adiponectin receptor type 1 (AdipoR1) mRNA was detected in the cells by RT-PCR. The adenosine monophosphate-activated protein kinase (AMP kinase) was phosphorylated by both adiponectin and a pharmacological AMP kinase activator, 5-amino-imidazole-4-carboxamide-riboside (AICAR), in the cells. AdipoR1 small interfering RNA (siRNA) transfection potently knocked down the receptor mRNA, and the effect of this knockdown persisted for as long as 10 days after the transfection. The transfected cells showed decreased expressions of type I collagen and osteocalcin mRNA, as determined by real-time PCR, and reduced ALP activity and mineralization, as determined by von Kossa and Alizarin red stainings. In contrast, AMP kinase activation by AICAR (0.01–0.5 mM) in wild-type MC3T3-E1 cells augmented their proliferation, differentiation, and mineralization. BrdU assay showed that the addition of adiponectin (0.01–1.0 μg/ml) also promoted their proliferation. Osterix, but not Runx-2, appeared to be involved in these processes because AdipoR1 siRNA transfection and AICAR treatments suppressed and enhanced osterix mRNA expression, respectively. Conclusion Taken together, this study suggests that adiponectin stimulates the proliferation, differentiation, and mineralization of osteoblasts via the AdipoR1 and AMP kinase signaling pathways in autocrine and/or paracrine fashions. PMID:18047638

  10. Protein kinase C-mediated phosphorylation and activation of PDE3A regulate cAMP levels in human platelets.

    PubMed

    Hunter, Roger W; Mackintosh, Carol; Hers, Ingeborg

    2009-05-01

    The elevation of [cAMP](i) is an important mechanism of platelet inhibition and is regulated by the opposing activity of adenylyl cyclase and phosphodiesterase (PDE). In this study, we demonstrate that a variety of platelet agonists, including thrombin, significantly enhance the activity of PDE3A in a phosphorylation-dependent manner. Stimulation of platelets with the PAR-1 agonist SFLLRN resulted in rapid and transient phosphorylation of PDE3A on Ser(312), Ser(428), Ser(438), Ser(465), and Ser(492), in parallel with the PKC (protein kinase C) substrate, pleckstrin. Furthermore, phosphorylation and activation of PDE3A required the activation of PKC, but not of PI3K/PKB, mTOR/p70S6K, or ERK/RSK. Activation of PKC by phorbol esters also resulted in phosphorylation of the same PDE3A sites in a PKC-dependent, PKB-independent manner. This was further supported by the finding that IGF-1, which strongly activates PI3K/PKB, but not PKC, did not regulate PDE3A. Platelet activation also led to a PKC-dependent association between PDE3A and 14-3-3 proteins. In contrast, cAMP-elevating agents such as PGE(1) and forskolin-induced phosphorylation of Ser(312) and increased PDE3A activity, but did not stimulate 14-3-3 binding. Finally, complete antagonism of PGE(1)-evoked cAMP accumulation by thrombin required both G(i) and PKC activation. Together, these results demonstrate that platelet activation stimulates PKC-dependent phosphorylation of PDE3A on Ser(312), Ser(428), Ser(438), Ser(465), and Ser(492) leading to a subsequent increase in cAMP hydrolysis and 14-3-3 binding. PMID:19261611

  11. Field measurements and interpretation of TMI-2 instrumentation: YM-AMP-7023 and YM-AMP-7025

    SciTech Connect

    Jones, J E; Smith, J T; Mathis, M V

    1982-01-01

    This report describes the measurement and results of the Loose Part Monitor Channels YM-AMP-7023 and YM-AMP-7025. These instruments consist of an Endevco Model 2276 accelerometer and a model 2652M4 charge amplifier connected to the Loose Parts Monitorng System terminals by approximately 400 feet (500 feet for 7025) of cable. The instruments were being incorporated into a B and W supplied system when the measurements were taken; therefore, the equipment was not expected to be fully operational.

  12. Glucose-induced hyperaccumulation of cyclic AMP and defective glucose repression in yeast strains with reduced activity of cyclic AMP-dependent protein kinase.

    PubMed

    Mbonyi, K; van Aelst, L; Argüelles, J C; Jans, A W; Thevelein, J M

    1990-09-01

    Addition of glucose or related fermentable sugars to derepressed cells of the yeast Saccharomyces cerevisiae triggers a RAS-mediated cyclic AMP (cAMP) signal that induces a protein phosphorylation cascade. In yeast mutants (tpk1w1, tpk2w1, and tpk3w1) containing reduced activity of cAMP-dependent protein kinase, fermentable sugars, as opposed to nonfermentable carbon sources, induced a permanent hyperaccumulation of cAMP. This finding confirms previous conclusions that fermentable sugars are specific stimulators of cAMP synthesis in yeast cells. Despite the huge cAMP levels present in these mutants, deletion of the gene (BCY1) coding for the regulatory subunit of cAMP-dependent protein kinase severely reduced hyperaccumulation of cAMP. Glucose-induced hyperaccumulation of cAMP was also observed in exponential-phase glucose-grown cells of the tpklw1 and tpk2w1 strains but not the tpk3w1 strain even though addition of glucose to glucose-repressed wild-type cells did not induce a cAMP signal. Investigation of mitochondrial respiration by in vivo 31P nuclear magnetic resonance spectroscopy showed the tpk1w1 and tpk2w1 strains, to be defective in glucose repression. These results are consistent with the idea that the signal transmission pathway from glucose to adenyl cyclase contains a glucose-repressible protein. They also show that a certain level of cAMP-dependent protein phosphorylation is required for glucose repression. Investigation of the glucose-induced cAMP signal and glucose-induced activation of trehalase in derepressed cells of strains containing only one of the wild-type TPK genes indicates that the transient nature of the cAMP signal is due to feedback inhibition by cAMP-dependent protein kinase.

  13. Cyclic AMP modulates electrical signaling in a weakly electric fish.

    PubMed

    McAnelly, L; Silva, A; Zakon, H H

    2003-04-01

    Many species of electric fish show diurnal or socially elicited variation in electric organ discharge amplitude. In Sternopygus macrurus, activation of protein kinase A by 8-bromo-cAMP increases electrocyte sodium current magnitude. To determine whether the behavioral plasticity in electric organ discharge amplitude is controlled by electrocyte biophysical properties, we examined whether the effects of phosphorylation on ion currents in the electric organ translate directly into electric organ discharge changes. We injected the electric organ of restrained fish with 8-bromo-cAMP and monitored the electric organ discharge. The effect of protein kinase A activation on electrocyte action potentials was examined in isolated electric organ using two-electrode current clamp. Electric organ discharge and action potential amplitude and pulse duration increased in response to 8-bromo-cAMP. Pulse and action potential duration both increased by about 25%. However, the increase in electric organ discharge amplitude (approximately 400%) was several-fold greater than the action potential amplitude increase (approximately 40%). Resting membrane resistance decreased in electrocytes exposed to 8-bromo-cAMP. We propose that in the Thevenin equivalent circuit of the electric organ a moderate increase in action potential amplitude combined with a decrease in internal resistance produces a greater voltage drop across the external resistance (the water around the fish), accounting for the large increase in the externally recorded electric organ discharge.

  14. Cyclic AMP signalling pathways in the regulation of uterine relaxation

    PubMed Central

    Yuan, Wei; López Bernal, Andrés

    2007-01-01

    Studying the mechanism(s) of uterine relaxation is important and will be helpful in the prevention of obstetric difficulties such as preterm labour, which remains a major cause of perinatal mortality and morbidity. Multiple signalling pathways regulate the balance between maintaining relative uterine quiescence during gestation, and the transition to the contractile state at the onset of parturition. Elevation of intracellular cyclic AMP promotes myometrial relaxation, and thus quiescence, via effects on multiple intracellular targets including calcium channels, potassium channels and myosin light chain kinase. A complete understanding of cAMP regulatory pathways (synthesis and hydrolysis) would assist in the development of better tocolytics to delay or inhibit preterm labour. Here we review the enzymes involved in cAMP homoeostasis (adenylyl cyclases and phosphodiesterases) and possible myometrial substrates for the cAMP dependent protein kinase. We must emphasise the need to identify novel pharmacological targets in human pregnant myometrium to achieve safe and selective uterine relaxation when this is indicated in preterm labour or other obstetric complications. PMID:17570154

  15. Fluorescence study of Escherichia coli cyclic AMP receptor protein.

    PubMed

    Wasylewski, M; Małecki, J; Wasylewski, Z

    1995-07-01

    Time-resolved, steady-state fluorescence and fluorescence-detected circular dichroism (FDCD) have been used to resolve the fluorescence contributions of the two tryptophan residues, Trp-13 and Trp-85, in the cyclic AMP receptor protein (CRP). The iodide and acrylamide quenching data show that in CRP one tryptophan residue, Trp-85, is buried within the protein matrix and the other, Trp-13, is moderately exposed on the surface of the protein. Fluorescence-quenching-resolved spectra show that Trp-13 has emission at about 350 nm and contributes 76-83% to the total fluorescence emission. The Trp-85, unquenchable by iodide and acrylamide, has the fluorescence emission at about 337 nm. The time-resolved fluorescence measurements show that Trp-13 has a longer fluorescence decay time. The Trp-85 exhibits a shorter fluorescence decay time. In the CRP-cAMP complex the Trp-85, previously buried in the apoprotein becomes totally exposed to the iodide and acrylamide quenchers. The FDCD spectra indicate that in the CRP-cAMP complex Trp-85 remains in the same environment as in the protein alone. It has been proposed that the binding of cAMP to CRP is accompanied by a hinge reorientation of two protein domains. This allows for penetration of the quencher molecules into the Trp-85 residue previously buried in the protein matrix. PMID:8590598

  16. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  17. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  18. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  19. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  20. Membrane physical properties do not explain increased cyclic AMP production in hepatocytes from rats fed menhaden oil.

    PubMed

    Bizeau, M E; Hazel, J R

    2000-06-01

    To study the effect of altering plasma membrane fatty acid composition on the glucagon signal transduction pathway, cAMP accumulation was measured in hepatocytes from rats fed diets containing either menhaden oil (MO) or coconut oil (CO). Hepatocytes from MO-fed animals produced significantly more cAMP in response to glucagon and forskolin compared to CO-fed animals. Glucagon receptor number and affinity were similar in MO- and CO-fed rats. Liver plasma membranes from MO-fed animals were enriched in long-chain n-3 fatty acids and contained significantly lower amounts of saturated C10-C16 and 18:1n-9 than CO-fed animals. Membrane physical properties were examined using both Fourier transform infrared spectroscopy (FTIR) and the fluorescent probe 1,6-diphenyl-1,3,5-hexatriene (DPH). FTIR analysis revealed that below 34 degrees C, CO membranes were more ordered than MO membranes. However, as assay temperature approached 37 degrees C, MO and CO membranes became similarly ordered. DPH polarization values indicated no differences in membrane order at 37 degrees C, whereas membrane order was decreased in CO-fed animals at 25 degrees C. These data indicate the importance of assay temperature in assessing the influence of membrane physical properties on the activity of signal transduction pathways. Whereas increased signal transduction activity has been correlated to reduced membrane order in MO-fed animals, these data indicate that at physiological temperatures membrane order did not vary between groups. Enhanced cAMP accumulation in response to forskolin indicates that adenylate cyclase activity or content may be elevated in MO- vs. CO-fed rats. Enhanced adenylate cyclase activity may result, in part, from changes in specific fatty acids in hepatocyte plasma membranes without demonstrable changes in membrane physical properties.

  1. DNA-Mediated Cyclic GMP-AMP Synthase-Dependent and -Independent Regulation of Innate Immune Responses.

    PubMed

    Motani, Kou; Ito, Shinji; Nagata, Shigekazu

    2015-05-15

    Cytoplasmic DNA activates cyclic GMP-AMP synthase (cGAS) to produce cyclic 2'-5'3'-5'GMP-AMP dinucleotide (2'5 'cGAMP). The binding of 2'5'cGAMP to an adaptor protein, stimulator of IFN genes (STING), activates a transcription factor, IFN regulatory factor 3, leading to the induction of IFN and chemokine gene expression. In this study, we found that the 2'5'cGAMP-dependent STING activation induced highly upregulated CXCL10 gene expression. Formation of a distinct STING dimer, which was detected by native PAGE, was induced by 2'5'cGAMP, but not 3'-5'3'-5'cGAMP. Analysis of DNase II(-/-) mice, which constitutively produce IFN-β and CXCL10, showed the accumulation of 2'5'cGAMP in their fetal livers and spleens, suggesting that the undigested DNA accumulating in DNase II(-/-) cells may have leaked from the lysosomes into the cytoplasm. The DNase II(-/-) mouse embryonic fibroblasts produced 2'5'cGAMP in a cGAS-dependent manner during apoptotic cell engulfment. However, cGAS deficiency did not impair the STING-dependent upregulation of CXCL10 in DNase II(-/-) mouse embryonic fibroblasts that was induced by apoptotic cell engulfment or DNA lipofection. These results suggest the involvement of a cGAS-independent additional DNA sensor(s) that induces the STING-dependent activation of innate immunity.

  2. Role of CNPase in the oligodendrocytic extracellular 2',3'-cAMP-adenosine pathway.

    PubMed

    Verrier, Jonathan D; Jackson, Travis C; Gillespie, Delbert G; Janesko-Feldman, Keri; Bansal, Rashmi; Goebbels, Sandra; Nave, Klaus-Armin; Kochanek, Patrick M; Jackson, Edwin K

    2013-10-01

    Extracellular adenosine 3',5'-cyclic monophosphate (3',5'-cAMP) is an endogenous source of localized adenosine production in many organs. Recent studies suggest that extracellular 2',3'-cAMP (positional isomer of 3',5'-cAMP) is also a source of adenosine, particularly in the brain in vivo post-injury. Moreover, in vitro studies show that both microglia and astrocytes can convert extracellular 2',3'-cAMP to adenosine. Here, we examined the ability of primary mouse oligodendrocytes and neurons to metabolize extracellular 2',3'-cAMP and their respective adenosine monophosphates (2'-AMP and 3'-AMP). Cells were also isolated from mice deficient in 2',3'-cyclic nucleotide-3'-phosphodiesterase (CNPase). Oligodendrocytes metabolized 2',3'-cAMP to 2'-AMP with 10-fold greater efficiency than did neurons (and also more than previously examined microglia and astrocytes); whereas, the production of 3'-AMP was minimal in both oligodendrocytes and neurons. The production of 2'-AMP from 2',3'-cAMP was reduced by 65% in CNPase -/- versus CNPase +/+ oligodendrocytes. Oligodendrocytes also converted 2'-AMP to adenosine, and this was also attenuated in CNPase -/- oligodendrocytes. Inhibition of classic 3',5'-cAMP-3'-phosphodiesterases with 3-isobutyl-1-methylxanthine did not block metabolism of 2',3'-cAMP to 2'-AMP and inhibition of classic ecto-5'-nucleotidase (CD73) with α,β-methylene-adenosine-5'-diphosphate did not attenuate the conversion of 2'-AMP to adenosine. These studies demonstrate that oligodendrocytes express the extracellular 2',3'-cAMP-adenosine pathway (2',3'-cAMP → 2'-AMP → adenosine). This pathway is more robustly expressed in oligodendrocytes than in all other CNS cell types because CNPase is the predominant enzyme that metabolizes 2',3'-cAMP to 2-AMP in CNS cells. By reducing levels of 2',3'-cAMP (a mitochondrial toxin) and increasing levels of adenosine (a neuroprotectant), oligodendrocytes may protect axons from injury. PMID:23922219

  3. Gypsum accumulation on carbonate stone

    USGS Publications Warehouse

    McGee, E.S.; Mossotti, V.G.

    1992-01-01

    The accumulation of gypsum on carbonate stone has been investigated through exposure of fresh samples of limestone and marble at monitored sites, through examination of alteration crusts from old buildings and through laboratory experiments. Several factors contribute to gypsum accumulation on carbonate stone. Marble or limestone that is sheltered from direct washing by rain in an urban environment with elevated pollution levels is likely to accumulate a gypsum crust. Crust development may be enhanced if the stone is porous or has an irregular surface area. Gypsum crusts are a surficial alteration feature; gypsum crystals form at the pore opening-air interface, where evaporation is greatest.

  4. Presence of free cyclic AMP receptor protein and regulation of its level by cyclic AMP in neuroblastoma-glioma hybrid cells.

    PubMed Central

    Walter, U; Costa, M R; Breakefield, X O; Greengard, P

    1979-01-01

    Neuroblastoma-glioma hybrid cells of line 108CC-5 were found to contain high levels of soluble adenosine 3',5'-cyclic monophosphate (cAMP)-dependent protein kinase activity and high levels of two specific cAMP receptor proteins, RI and RII. Treatment of the hybrid cells with dibutyryl cAMP increased the level of RI but did not significantly affect the level either of RII or of cAMP-dependent protein kinase activity. The effect of dibutyryl cAMP could be mimicked by prostaglandin E1 and 3-isobutyl-1-methylxanthine, both of which are known to raise cAMP levels in neuroblastoma-glioma hybrid cells. Both in control as well as in dibutyryl cAMP-treated cells, RII but not RI was associated with cAMP-dependent protein kinase. Several lines of evidence suggest that RI represents the free regulatory subunit of type I cAMP-dependent protein kinase. The presence of this regulatory subunit as free cAMP receptor protein in neuroblastoma-glioma hybrid cells may be of significance with respect to the regulation of growth and differentiation in tumor cells. Images PMID:226964

  5. Purification, characterization, and sequencing of novel antimicrobial peptides, Tu-AMP 1 and Tu-AMP 2, from bulbs of tulip (Tulipa gesneriana L.).

    PubMed

    Fujimura, Masatoshi; Ideguchi, Mineo; Minami, Yuji; Watanabe, Keiichi; Tadera, Kenjiro

    2004-03-01

    Novel antimicrobial peptides (AMP), designated Tu-AMP 1 and Tu-AMP 2, were purified from the bulbs of tulip (Tulipa gesneriana L.) by chitin affinity chromatography and reverse-phase high-performance liquid chromatography (HPLC). They bind to chitin in a reversible way. They were basic peptides having isoelectric points of over 12. Tu-AMP 1 and Tu-AMP 2 had molecular masses of 4,988 Da and 5,006 Da on MALDI-TOF MS analysis, and their extinction coefficients of 1% aqueous solutions at 280 nm were 3.3 and 3.4, respectively. Half of all amino acid residues of Tu-AMP 1 and Tu-AMP 2 were occupied by cysteine, arginine, lysine, and proline. The concentrations of peptides required for 50% inhibition (IC(50)) of the growth of plant pathogenic bacteria and fungi were 2 to 20 microg/ml. The structural characteristics of Tu-AMP 1 and Tu-AMP 2 indicated that they were novel thionin-like antimicrobial peptides, though Tu-AMP 2 was a heterodimer composes of two short peptides joined with disulfide bonds.

  6. Manganese As a Metal Accumulator

    EPA Science Inventory

    Manganese deposits in water distribution systems accumulate metals, radionuclides and oxyanions by a combination of surface complexation, adsorption and solid substitution, as well as a combination of oxidation followed by manganese reduction and sorption of the oxidized constitu...

  7. Trehalase activity and cyclic AMP content during early development of Mucor rouxii spores.

    PubMed Central

    Dewerchin, M A; Van Laere, A J

    1984-01-01

    Incubation of Mucor rouxii sporangiospores in complex medium under aerobic conditions resulted in a transient 20-fold increase in trehalase activity. Maximum activity was reached after 15 min. Simultaneously, the cyclic AMP (cAMP) content increased approximately eightfold, reaching a maximum within 10 min. Increases in trehalase activity and cAMP content were also observed under anaerobic conditions (CO2). The extent of trehalase activation and the changes in cAMP content, during both aerobic and anaerobic incubation, varied with the medium used. Trehalase was activated in vitro by a cAMP- and ATP-dependent process. An even faster activation was obtained when cAMP was replaced by the catalytic subunit of beef heart protein kinase. The coincidence of, and the correlation between, increased cAMP contents and trehalase activities support the involvement of a cAMP-dependent phosphorylation in the in vivo regulation of trehalase activity. PMID:6327611

  8. Heterozygous mutations in cyclic AMP phosphodiesterase-4D (PDE4D) and protein kinase A (PKA) provide new insights into the molecular pathology of acrodysostosis.

    PubMed

    Kaname, Tadashi; Ki, Chang-Seok; Niikawa, Norio; Baillie, George S; Day, Jonathan P; Yamamura, Ken-Ichi; Ohta, Tohru; Nishimura, Gen; Mastuura, Nobuo; Kim, Ok-Hwa; Sohn, Young Bae; Kim, Hyun Woo; Cho, Sung Yoon; Ko, Ah-Ra; Lee, Jin Young; Kim, Hyun Wook; Ryu, Sung Ho; Rhee, Hwanseok; Yang, Kap-Seok; Joo, Keehyoung; Lee, Jooyoung; Kim, Chi Hwa; Cho, Kwang-Hyun; Kim, Dongsan; Yanagi, Kumiko; Naritomi, Kenji; Yoshiura, Ko-Ichiro; Kondoh, Tatsuro; Nii, Eiji; Tonoki, Hidefumi; Houslay, Miles D; Jin, Dong-Kyu

    2014-11-01

    Acrodysostosis without hormone resistance is a rare skeletal disorder characterized by brachydactyly, nasal hypoplasia, mental retardation and occasionally developmental delay. Recently, loss-of-function mutations in the gene encoding cAMP-hydrolyzing phosphodiesterase-4D (PDE4D) have been reported to cause this rare condition but the pathomechanism has not been fully elucidated. To understand the pathogenetic mechanism of PDE4D mutations, we conducted 3D modeling studies to predict changes in the binding efficacy of cAMP to the catalytic pocket in PDE4D mutants. Our results indicated diminished enzyme activity in the two mutants we analyzed (Gly673Asp and Ile678Thr; based on PDE4D4 residue numbering). Ectopic expression of PDE4D mutants in HEK293 cells demonstrated this reduction in activity, which was identified by increased cAMP levels. However, the cells from an acrodysostosis patient showed low cAMP accumulation, which resulted in a decrease in the phosphorylated cAMP Response Element-Binding Protein (pCREB)/CREB ratio. The reason for this discrepancy was due to a compensatory increase in expression levels of PDE4A and PDE4B isoforms, which accounted for the paradoxical decrease in cAMP levels in the patient cells expressing mutant isoforms with a lowered PDE4D activity. Skeletal radiographs of 10-week-old knockout (KO) rats showed that the distal part of the forelimb was shorter than in wild-type (WT) rats and that all the metacarpals and phalanges were also shorter in KO, as the name acrodysostosis implies. Like the G-protein α-stimulatory subunit and PRKAR1A, PDE4D critically regulates the cAMP signal transduction pathway and influences bone formation in a way that activity-compromising PDE4D mutations can result in skeletal dysplasia. We propose that specific inhibitory PDE4D mutations can lead to the molecular pathology of acrodysostosis without hormone resistance but that the pathological phenotype may well be dependent on an over-compensatory induction

  9. Wnt Signaling Inhibits Osteoclast Differentiation by Activating Canonical and Noncanonical cAMP/PKA Pathways

    PubMed Central

    Weivoda, Megan M; Ruan, Ming; Hachfeld, Christine M; Pederson, Larry; Howe, Alan; Davey, Rachel A; Zajac, Jeffrey D; Kobayashi, Yasuhiro; Williams, Bart O; Westendorf, Jennifer J; Khosla, Sundeep; Oursler, Merry Jo

    2016-01-01

    Although there has been extensive characterization of the Wnt signaling pathway in the osteoblast lineage, the effects of Wnt proteins on the osteoclast lineage are less well studied. We found that osteoclast lineage cells express canonical Wnt receptors. Wnt3a reduced osteoclast formation when applied to early bone-marrow macrophage (BMM) osteoclast differentiation cultures, whereas late addition did not suppress osteoclast formation. Early Wnt3a treatment inactivated the crucial transcription factor NFATc1 in osteoclast progenitors. Wnt3a led to the accumulation of nuclear β-catenin, confirming activation of canonical Wnt signaling. Reducing low-density lipoprotein receptor-related proteins (Lrp) 5 and Lrp6 protein expression prevented Wnt3a-induced inactivation of NFATc1; however, deletion of β-catenin did not block Wnt3a inactivation of NFATc1, suggesting that this effect was mediated by a noncanonical pathway. Wnt3a rapidly activated the cyclic adenosine monophosphate (cAMP)/protein kinase A (PKA) pathway and pharmacological stimulation of cAMP/PKA signaling suppressed osteoclast differentiation; Wnt3a-induced NFATc1 phosphorylation was blocked by inhibiting interactions between PKA and A-kinase anchoring proteins (AKAPs). These data indicate that Wnt3a directly suppresses osteoclast differentiation through both canonical (β-catenin) and noncanonical (cAMP/PKA) pathways in osteoclast precursors. In vivo reduction of Lrp5 and Lrp6 expressions in the early osteoclast lineage via Rank promoter Cre recombination reduced trabecular bone mass, whereas disruption of Lrp5/6 expression in late osteoclast precursors via cathepsin K (Ctsk) promoter Cre recombination did not alter the skeletal phenotype. Surprisingly, reduction of Lrp5/6 in the early osteoclast lineage decreased osteoclast numbers, as well as osteoblast numbers. Published studies have previously noted that β-catenin signaling is required for osteoclast progenitor proliferation. Our in vivo data

  10. Molecular characterisation of acquired and overproduced chromosomal blaAmpC in Escherichia coli clinical isolates.

    PubMed

    Alonso, Noemí; Miró, Elisenda; Pascual, Vanesa; Rivera, Alba; Simó, Maria; Garcia, Maria Consol; Xercavins, Mariona; Morera, Maria Antonia; Espejo, Elena; Gurguí, Mercè; Pérez, Josefa; Rodríguez-Carballeira, Mònica; Garau, Javier; Calbo, Esther; Navarro, Ferran; Mirelis, Beatriz; Coll, Pere

    2016-01-01

    Escherichia coli recovered from three hospitals in Barcelona (Spain) were studied to determine the prevalence of isolates with acquired AmpC (ac-AmpC) and/or overproduced chromosomal AmpC (c-AmpC). Mechanisms involved in blac-AmpC overexpression, blaac-AmpC and the plasmids associated with their distribution as well as the prevalence of plasmid-mediated quinolone resistance (PMQR) in AmpC-producing isolates were also determined. Isolates were selected according to their resistance phenotype. blaac-AmpC, alterations in the blac-AmpC promoter/attenuator, and PMQR genes [qnrA, qnrB, qnrS, aac(6')-Ib-cr and qepA] were characterised by PCR and sequencing. blac-AmpC expression was determined by qRT-PCR. Population structure analysis was performed using PFGE, MLST and phylogenetic group PCR. Plasmids carrying blaac-AmpC were characterised by PCR-based replicon typing and S1-PFGE. IncI1 and IncF plasmids were also analysed by plasmid MLST and replicon sequence typing, respectively. Among 21563 E. coli isolates, 240 (1.1%) overproduced AmpC β-lactamases, including 180 (75.0%) harbouring ac-AmpC (132 CMY-2 variants and 48 DHA-1) and 60 (25.0%) c-AmpC enzymes. Three mutation profiles in the blac-AmpC promoter/attenuator were associated with a 72.5-, 19.9- and 5.8-fold increased expression, respectively. Moreover, 63.3% of ac-AmpC and 43.3% of c-AmpC isolates belonged to B2, D, E or F phylogenetic groups. PMQR was found in 31% of ac-AmpC isolates [38 qnrB4, 8 aac(6')-Ib-cr, 6 qnrS1 and 3 qnrB19] and in 10% of c-AmpC isolates [5 aac(6')-Ib-cr and 1 qnrS1]. IncI1-ST12 and IncF were associated with blaCMY-2 and blaDHA-1, respectively. These results suggest that ac-AmpC β-lactamases were the main mechanism of AmpC production. Isolates and plasmids both showed high genetic diversity.

  11. Role of nitric oxide/cyclic GMP and cyclic AMP in beta3 adrenoceptor-chronotropic response.

    PubMed

    Sterin-Borda, Leonor; Bernabeo, Gustavo; Ganzinelli, Sabrina; Joensen, Lilian; Borda, Enri

    2006-04-01

    In this study we determine different signaling pathways involved in beta(3) adrenoceptor (beta(3)-AR) dependent frequency stimulation in isolated rodent atria. Promiscuous coupling between different G-proteins and beta(3)-AR could explain the multiple functional effects of beta(3)-AR stimulation. We examine the mechanisms and functional consequences of dual adenylate cyclase and guanylate cyclase pathways coupling to beta(3)-AR in isolated rodent atria. The beta(3)-AR selective agonists ZD 7114 and ICI 215001 stimulated in a dose-dependent manner the contraction frequency that significantly correlated with cyclic AMP (cAMP) accumulation. Inhibition of adenylate cyclase shifted the chronotropic effect to the right. On the other hand, the ZD 7114 activity on frequency was enhanced by the inhibition of nitric oxide synthase (NOS) and soluble guanylate cyclase. This countervailing negative chronotropic nitric oxide-cyclic GMP (NO-cGMP) significantly correlated with the increase on NOS activity and cGMP accumulation. Current analysis showed a negative cross talk between cAMP chronotropic and NO-cGMP effects by inhibition of phospholipase C (PLC), calcium/calmodulin (CaM), protein kinase C (PKC), NOS isoforms and Gi-protein on the effects of beta(3)-AR stimulation. RT-PCR detected both eNOS and nNOS in isolated rat atria. NOS isoforms performed independently. Only nNOS participated in limiting the effect of beta(3)-AR stimulation. In eNOS-KO (eNOS-/-) mice the chronotropic effect of beta(3)-AR agonists did not differ from wild type (WT) mice atria, but it was increased by the inhibition of nNOS activity. Our results suggest that the increase in frequency by beta(3)-AR activation on isolated rodent atria is associated to a parallel increases in cAMP. The nNOS-cGMP pathway negatively modulates beta(3)-AR activation. Multiple signal transduction pathways between G-protein and beta(3)-AR may protect myocardium from catecholamine-induced cardiotoxic effects. PMID:16510153

  12. Regulatory components in Citrobacter freundii ampC beta-lactamase induction.

    PubMed

    Lindberg, F; Westman, L; Normark, S

    1985-07-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase similar to the constitutively expressed ampC beta-lactamase of Escherichia coli. In the latter species the ampC gene is located next to the fumarate reductase (frd) operon, whereas in C. freundii the ampC gene is known to be separated from frd by 1100 base pairs. This intervening DNA segment carries a gene, ampR, coding for a 31-kilodalton polypeptide. The cloned C. freundii OS60 ampC gene is inducible by beta-lactam antibiotics in E. coli, but only in the presence of an intact ampR gene. In the absence of inducer the AmpR protein represses C. freundii ampC synthesis 2.5-fold. Addition of beta-lactams induced expression from the cloned ampC beta-lactamase gene 11-fold. Thus, the AmpR protein has a positive effect on ampC expression in the presence of inducing beta-lactams. Two spontaneous mutants of C. freundii were isolated that constitutively overproduce the ampC beta-lactamase. The mutations in both these strains occurred outside the frd-amp region, suggesting that there is at least one additional component in the regulatory system. With the cloned C. freundii ampC gene in E. coli, mutants with the same phenotype could be obtained. These mutations were located on the E. coli chromosome. The constitutive beta-lactamase overproduction in these mutants requires the presence of an intact ampR gene.

  13. Protein Kinase A-Dependent and -Independent Signaling Pathways Contribute to Cyclic AMP-Stimulated Proliferation

    PubMed Central

    Cass, Lisa A.; Summers, Scott A.; Prendergast, Gregory V.; Backer, Jonathan M.; Birnbaum, Morris J.; Meinkoth, Judy L.

    1999-01-01

    The effects of cyclic AMP (cAMP) on cell proliferation are cell type specific. Although the growth-inhibitory effects of cAMP have been well studied, much less is known regarding how cAMP stimulates proliferation. We report that cAMP stimulates proliferation through both protein kinase A (PKA)-dependent and PKA-independent signaling pathways and that phosphatidylinositol 3-kinase (PI3K) is required for cAMP-stimulated mitogenesis. In cells where cAMP is a mitogen, cAMP-elevating agents stimulate membrane ruffling, Akt phosphorylation, and p70 ribosomal S6 protein kinase (p70s6k) activity. cAMP effects on ruffle formation and Akt were PKA independent but sensitive to wortmannin. In contrast, cAMP-stimulated p70s6k activity was repressed by PKA inhibitors but not by wortmannin or microinjection of the N-terminal SH2 domain of the p85 regulatory subunit of PI3K, indicating that p70s6k and Akt can be regulated independently. Microinjection of highly specific inhibitors of PI3K or Rac1, or treatment with the p70s6k inhibitor rapamycin, impaired cAMP-stimulated DNA synthesis, demonstrating that PKA-dependent and -independent pathways contribute to cAMP-mediated mitogenesis. Direct elevation of PI3K activity through microinjection of an antibody that stimulates PI3K activity or stable expression of membrane-localized p110 was sufficient to confer hormone-independent DNA synthesis when accompanied by elevations in p70s6k activity. These findings indicate that multiple pathways contribute to cAMP-stimulated mitogenesis, only some of which are PKA dependent. Furthermore, they demonstrate that the ability of cAMP to stimulate both p70s6k- and PI3K-dependent pathways is an important facet of cAMP-regulated cell cycle progression. PMID:10454535

  14. Epidermal chalone and cyclic AMP: an in vivo study.

    PubMed

    Elgjo, K

    1975-01-01

    Water extracts of skin contain two factors that inhibit epidermal cell proliferation: one substance inhibits epidermal cells in the G2 phase (the epidermal G2 inhibitor), and another inhibits the transit of cells from the G1 phase into the S phase (the epidermal G1 inhibitor). Pretreatment of mice with a beta-receptor antagonist (propranolol) abolished the activity of the G2 inhibitor but not that of the G1 inhibitor. After pretreatment with both propranolol and a phosphodiesterase inhibitor (caffine)the G2 inhibitor had full effect. Cafine alone had a moderately inhibitory effect on epidermal G2 cells and enhanced the depressing effect of the G1 inhibitor on epidermal DNA synthesis. AMP level in epidermis to be active. Cyclic AMP is probably also involved in the regulation of the rate of transit of epidermal G1 cells into the S phase but the epidermal cyclic AMP level seems not to be so critical for the efficacy of the epidermal G2 inhibitor in epidermal cell differentiation. PMID:162919

  15. Software Design Document for the AMP Nuclear Fuel Performance Code

    SciTech Connect

    Philip, Bobby; Clarno, Kevin T; Cochran, Bill

    2010-03-01

    The purpose of this document is to describe the design of the AMP nuclear fuel performance code. It provides an overview of the decomposition into separable components, an overview of what those components will do, and the strategic basis for the design. The primary components of a computational physics code include a user interface, physics packages, material properties, mathematics solvers, and computational infrastructure. Some capability from established off-the-shelf (OTS) packages will be leveraged in the development of AMP, but the primary physics components will be entirely new. The material properties required by these physics operators include many highly non-linear properties, which will be replicated from FRAPCON and LIFE where applicable, as well as some computationally-intensive operations, such as gap conductance, which depends upon the plenum pressure. Because there is extensive capability in off-the-shelf leadership class computational solvers, AMP will leverage the Trilinos, PETSc, and SUNDIALS packages. The computational infrastructure includes a build system, mesh database, and other building blocks of a computational physics package. The user interface will be developed through a collaborative effort with the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Capability Transfer program element as much as possible and will be discussed in detail in a future document.

  16. Cyclic AMP and its functional relationship in Tetrahymena: a comparison between phagocytosis and glucose uptake.

    PubMed

    Csaba, G; Nagy, S U; Lantos, T

    1978-01-01

    In Tetrahymena, an increase in the level of cAMP is accompanied by an increased phagocytotic rate, whereas increased sugar uptake is parallelled by a decreased cAMP level. The increase in cAMP level seems to be decisive with respect to phagocytosis as a basic phenomenon of life. In the action of epinephrine, however, some mechanism other than cAMP mediation may be involved. Depending on concentration, one hormone may provoke either an increase or a decrease in cAMP level, and this in turn triggers the corresponding function.

  17. Maximum likelihood decoding analysis of Accumulate-Repeat-Accumulate Codes

    NASA Technical Reports Server (NTRS)

    Abbasfar, Aliazam; Divsalar, Dariush; Yao, Kung

    2004-01-01

    Repeat-Accumulate (RA) codes are the simplest turbo-like codes that achieve good performance. However, they cannot compete with Turbo codes or low-density parity check codes (LDPC) as far as performance is concerned. The Accumulate Repeat Accumulate (ARA) codes, as a subclass of LDPC codes, are obtained by adding a pre-coder in front of RA codes with puncturing where an accumulator is chosen as a precoder. These codes not only are very simple, but also achieve excellent performance with iterative decoding. In this paper, the performance of these codes with (ML) decoding are analyzed and compared to random codes by very tight bounds. The weight distribution of some simple ARA codes is obtained, and through existing tightest bounds we have shown the ML SNR threshold of ARA codes approaches very closely to the performance of random codes. We have shown that the use of precoder improves the SNR threshold but interleaving gain remains unchanged with respect to RA code with puncturing.

  18. Vasoactive intestinal peptide synergistically stimulates DNA synthesis in mouse 3T3 cells: Role of cAMP, Ca sup 2+ , and protein kinase C

    SciTech Connect

    Zurier, B.B.; Kozma, M.; Sinnett-Smith, J.; Rozengurt, E. )

    1988-05-01

    Vasoactive intestinal peptide synergistically stimulated initiation of DNA synthesis in Swiss 3T3 cells. The peptide stimulated ({sup 3}H)thymidine incorporation in the presence of insulin and either forskolin or an inhibitor of cAMP phosphodiesterase in a concentration-dependent manner. Half-maximal effect was obtained at 1 nM. At mitogenic concentrations, VIP stimulated a marked accumulation (eightfold) of cAMP. In contrast to other growth-promoting neuropeptides, VIP did not induce an increase in cytosolic free Ca{sup 2+} or the activation of protein kinase C. The authors conclude that neuropeptides can modulate long-term cell proliferation through multiple signaling pathways.

  19. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  20. 3':5'-cyclic AMP and hormonal control of puparium formation in the fleshfly Sarcophaga bullata.

    PubMed

    Fraenkel, G; Blechl, A; Blechl, J; Herman, P; Seligman, M I

    1977-05-01

    Injection of 3':5'-cyclic AMP (cAMP) into larvae of the fly Sarcophaga bullata 3-4 hr before the beginning of puparium formation (red-spiracle stage) greatly accelerates the onset of tanning without affecting initiation of puparium formation (anterior retraction). Accelerated tanning resembles real tanning in two important respects: the solubility of cuticular proteins becomes reduced and [U-14C]tyrosine is incorporated into the cuticle. Of a number of cAMP analogues tested, 3':5'- cyclic GMP, 2':3'-cyclic AMP, and 5'-AMP were inactive, dibutyryl-3':5'-cAMP had only slight activity, and cyclic IMP and deoxy-3':5'-cAMP showed some activity. Theophylline enhanced the effect of small doses of cAMP or of blood, diluted 1:8, active in the puparium tanning factor. Injection of dopa, dopamine, acetyldopamine, or epinephrine, but not of tyrosine, had an accelerating effect similar to that of cAMP. The tanning-inhibiting effect of DL-alpha-methyl-alpha-hydrazino-beta-(3,4-dihydroxyphenyl)propionic acid monohydrate is reversed by dopamine or epinephrine, but not by tyrosine, dopa, or cAMP. Evidence is presented to indicate that the responses to cAMP are not artifacts but reflect actual biochemical events during tanning.

  1. Orthologous and Paralogous AmpD Peptidoglycan Amidases from Gram-Negative Bacteria

    PubMed Central

    Rivera, Ivanna; Molina, Rafael; Lee, Mijoon; Mobashery, Shahriar

    2016-01-01

    Cell wall recycling and β-lactam antibiotic resistance are linked in Enterobacteriaceae and in Pseudomonas aeruginosa. This process involves a large number of murolytic enzymes, among them a cytoplasmic peptidoglycan amidase AmpD, which plays an essential role by cleaving the peptide stem from key intermediates en route to the β-lactamase production (a resistance mechanism) and cell wall recycling. Uniquely, P. aeruginosa has two additional paralogues of AmpD, designated AmpDh2 and AmpDh3, which are periplasmic enzymes. Despite the fact that AmpDh2 and AmpDh3 share a common motif for their respective catalytic domains, they are each comprised of multidomain architectures and exhibit distinct oligomerization properties. We review herein the structural and biochemical properties of orthologous and paralogous AmpD proteins and discuss their implication in cell wall recycling and antibiotic resistance processes. PMID:27326855

  2. Role of LRP1 and ERK and cAMP Signaling Pathways in Lactoferrin-Induced Lipolysis in Mature Rat Adipocytes

    PubMed Central

    Ikoma-Seki, Keiko; Nakamura, Kanae; Morishita, Satoru; Ono, Tomoji; Sugiyama, Keikichi; Nishino, Hoyoku; Hirano, Hisashi; Murakoshi, Michiaki

    2015-01-01

    Lactoferrin (LF) is a multifunctional glycoprotein present in milk. A clinical study showed that enteric-coated bovine LF tablets decrease visceral fat accumulation. Furthermore, animal studies revealed that ingested LF is partially delivered to mesenteric fat, and in vitro studies showed that LF promotes lipolysis in mature adipocytes. The aim of the present study was to determine the mechanism underlying the induction of lipolysis in mature adipocytes that is induced by LF. To address this question, we used proteomics techniques to analyze protein expression profiles. Mature adipocytes from primary cultures of rat mesenteric fat were collected at various times after exposure to LF. Proteomic analysis revealed that the expression levels of hormone-sensitive lipase (HSL), which catalyzes the rate-limiting step of lipolysis, were upregulated and that HSL was activated by protein kinase A within 15 min after the cells were treated with LF. We previously reported that LF increases the intracellular concentration of cyclic adenosine monophosphate (cAMP), suggesting that LF activates the cAMP signaling pathway. In this study, we show that the expression level and the activity of the components of the extracellular signal-regulated kinase (ERK) signaling pathway were upregulated. Moreover, LF increased the activity of the transcription factor cAMP response element binding protein (CREB), which acts downstream in the cAMP and ERK signaling pathways and regulates the expression levels of adenylyl cyclase and HSL. Moreover, silencing of the putative LF receptor low-density lipoprotein receptor-related protein 1 (LRP1) attenuated lipolysis in LF-treated adipocytes. These results suggest that LF promoted lipolysis in mature adipocytes by regulating the expression levels of proteins involved in lipolysis through controlling the activity of cAMP/ERK signaling pathways via LRP1. PMID:26506094

  3. Different β-adrenoceptor subtypes coupling to cAMP or NO/cGMP pathways: implications in the relaxant response of rat conductance and resistance vessels

    PubMed Central

    Flacco, N; Segura, V; Perez-Aso, M; Estrada, S; Seller, JF; Jiménez-Altayó, F; Noguera, MA; D'Ocon, P; Vila, E; Ivorra, MD

    2013-01-01

    Background and Purpose To analyse the relative contribution of β1-, β2- and β3-adrenoceptors (Adrb) to vasodilatation in conductance and resistance vessels, assessing the role of cAMP and/or NO/cGMP signalling pathways. Experimental Approach Rat mesenteric resistance artery (MRA) and aorta were used to analyse the Adrb expression by real-time-PCR and immunohistochemistry, and for the pharmacological characterization of Adrb-mediated activity by wire myography and tissue nucleotide accumulation. Key Results The mRNAs and protein for all Adrb were identified in endothelium and/or smooth muscle cells (SMCs) in both vessels. In MRA, Adrb1 signalled through cAMP, Adrb3 through both cAMP and cGMP, but Adrb2, did not activate nucleotide formation; isoprenaline relaxation was inhibited by propranolol (β1, β2), CGP20712A (β1), and SQ22536 (adenylyl cyclase inhibitor), but not by ICI118,551 (β2), SR59230A (β3), ODQ (soluble guanylyl cyclase inhibitor), L-NAME or endothelium removal. In aorta, Adrb1 signalled through cAMP, while β2- and β3-subtypes through cGMP; isoprenaline relaxation was inhibited by propranolol, ICI118,551, ODQ, L-NAME, and to a lesser extent, by endothelium removal. CL316243 (β3-agonist) relaxed aorta, but not MRA. Conclusion and Implication Despite all three Adrb subtypes being found in both vessels, Adrb1, located in SMCs and acting through the adenylyl cyclase/cAMP pathway, are primarily responsible for vasodilatation in MRA. However, Adrb-mediated vasodilatation in aorta is driven by endothelial Adrb2 and Adrb3, but also by the Adrb2 present in SMCs, and is coupled to the NO/cGMP pathway. These results could help to understand the different physiological roles played by Adrb signalling in regulating conductance and resistance vessels. PMID:23373597

  4. Beta-Adrenergic Receptor Population is Up-Regulated by Increased Cyclic Amp Concentration in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Vaughn, Jeffrey R.

    1999-01-01

    Skeletal muscle hypertrophy is promoted in vivo by administration of beta-drenergic receptor (bAR) agonists. Chicken skeletal muscle cells were treated with 1 (mu)M isoproterenol, a strong bAR agonist, between days 7 and 10 in culture. bAR population increased by approximately 40% during this treatment; however, the ability of the cells to synthesize cyclic AMP (cAMP) was diminished by two-fold. The quantity of myosin heavy chain (MHC) was not affected. To understand further the relationship between intracellular cAMP levels, bAR population, and muscle protein accumulation, intracellular cAMP levels were artificially elevated by treatment with 0-10 uM forskolin for up to three days. The basal concentration of CAMP in forskolin-treated cells increased up to 7-fold in a dose dependent manner. Increasing concentrations of forskolin also led to an increase in bAR population, with a maximum increase of approximately 40-60% at 10 uM forskolin. A maximum increase of 40-50% in the quantity of MHC was observed at 0.2 uM forskolin, but higher concentrations of forskolin reduced the quantity of MHC back to control levels. At 0.2 uM forskolin, intracellular levels of cAMP were higher by approximately 35%, and the (beta)AR population was higher by approximately 30%. Neither the number of muscle nuclei fused into myotubes nor the percentage of nuclei in myotubes were affected by forskolin at any of the concentrations studied.

  5. Three-dimensional measurement of cAMP gradients using hyperspectral confocal microscopy

    NASA Astrophysics Data System (ADS)

    Rich, Thomas C.; Annamdevula, Naga; Britain, Andrea L.; Mayes, Samuel; Favreau, Peter F.; Leavesley, Silas J.

    2016-03-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions over a wide range of timescales. Several lines of evidence have suggested that the distribution of cAMP within cells is not uniform, and that cAMP compartmentalization is largely responsible for signaling specificity within the cAMP signaling pathway. However, to date, no studies have experimentally measured three dimensional (3D) cAMP distributions within cells. Here we use both 2D and 3D hyperspectral microscopy to visualize cAMP gradients in endothelial cells from the pulmonary microvasculature (PMVECs). cAMP levels were measured using a FRETbased cAMP sensor comprised of a cAMP binding domain from EPAC sandwiched between FRET donors and acceptors -- Turquoise and Venus fluorescent proteins. Data were acquired using either a Nikon A1R spectral confocal microscope or custom spectral microscopy system. Analysis of hyperspectral image stacks from a single confocal slice or from summed images of all slices (2D analysis) indicated little or no cAMP gradients were formed within PMVECs under basal conditions or following agonist treatment. However, analysis of hyperspectral image stacks from 3D cellular geometries (z stacks) demonstrate marked cAMP gradients from the apical to basolateral membrane of PMVECs. These results strongly suggest that 2D imaging studies of cAMP compartmentalization -- whether epifluorescence or confocal microscopy -- may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D studies are required to assess mechanisms of signaling specificity.

  6. Pensions and Household Wealth Accumulation

    ERIC Educational Resources Information Center

    Engelhardt, Gary V.; Kumar, Anil

    2011-01-01

    Economists have long suggested that higher private pension benefits "crowd out" other sources of household wealth accumulation. We exploit detailed information on pensions and lifetime earnings for older workers in the 1992 wave of the Health and Retirement Study and employ an instrumental-variable (IV) identification strategy to estimate…

  7. Dissociations in the Effects of β2-Adrenergic Receptor Agonists on cAMP Formation and Superoxide Production in Human Neutrophils: Support for the Concept of Functional Selectivity

    PubMed Central

    Brunskole Hummel, Irena; Reinartz, Michael T.; Kälble, Solveig; Burhenne, Heike; Schwede, Frank; Buschauer, Armin; Seifert, Roland

    2013-01-01

    In neutrophils, activation of the β2-adrenergic receptor (β2AR), a Gs-coupled receptor, inhibits inflammatory responses, which could be therapeutically exploited. The aim of this study was to evaluate the effects of various β2AR ligands on adenosine-3′,5′-cyclic monophosphate (cAMP) accumulation and N-formyl-L-methionyl-L-leucyl-L-phenylalanine (fMLP)-induced superoxide anion (O2•−) production in human neutrophils and to probe the concept of ligand-specific receptor conformations (also referred to as functional selectivity or biased signaling) in a native cell system. This is an important question because so far, evidence for functional selectivity has been predominantly obtained with recombinant systems, due to the inherent difficulties to genetically manipulate human native cells. cAMP concentration was determined by HPLC/tandem mass spectrometry, and O2•− formation was assessed by superoxide dismutase-inhibitable reduction of ferricytochrome c. β2AR agonists were generally more potent in inhibiting fMLP-induced O2•− production than in stimulating cAMP accumulation. (−)-Ephedrine and dichloroisoproterenol were devoid of any agonistic activity in the cAMP assay, but partially inhibited fMLP-induced O2•− production. Moreover, (−)-adrenaline was equi-efficacious in both assays whereas the efficacy of salbutamol was more than two-fold higher in the O2•− assay. Functional selectivity was visualized by deviations of ligand potencies and efficacies from linear correlations for various parameters. We obtained no evidence for involvement of protein kinase A in the inhibition of fMLP-induced O2•− production after β2AR-stimulation although cAMP-increasing substances inhibited O2•− production. Taken together, our data corroborate the concept of ligand-specific receptor conformations with unique signaling capabilities in native human cells and suggest that the β2AR inhibits O2•− production in a cAMP-independent manner. PMID

  8. CFE-1, a novel plasmid-encoded AmpC beta-lactamase with an ampR gene originating from Citrobacter freundii.

    PubMed

    Nakano, Ryuichi; Okamoto, Ryoichi; Nakano, Yumiko; Kaneko, Kenichi; Okitsu, Naohiro; Hosaka, Yoshio; Inoue, Matsuhisa

    2004-04-01

    A clinical isolate of Escherichia coli from a patient in Japan, isolate KU6400, was found to produce a plasmid-encoded beta-lactamase that conferred resistance to extended-spectrum cephalosporins and cephamycins. Resistance arising from production of a beta-lactamase could be transferred by either conjugation or transformation with plasmid pKU601 into E. coli ML4947. The substrate and inhibition profiles of this enzyme resembled those of the AmpC beta-lactamase. The resistance gene of pKU601, which was cloned and expressed in E. coli, proved to contain an open reading frame showing 99.8% DNA sequence identity with the ampC gene of Citrobacter freundii GC3. DNA sequence analysis also identified a gene upstream of ampC whose sequence was 99.0% identical to the ampR gene from C. freundii GC3. In addition, a fumarate operon (frdABCD) and an outer membrane lipoprotein (blc) surrounding the ampR-ampC genes in C. freundii were identified, and insertion sequence (IS26) elements were observed on both sides of the sequences identified (forming an IS26 composite transposon); these results confirm the evidence of the translocation of a beta-lactamase-associated gene region from the chromosome to a plasmid. Finally, we describe a novel plasmid-encoded AmpC beta-lactamase, CFE-1, with an ampR gene derived from C. freundii.

  9. Mogrol Derived from Siraitia grosvenorii Mogrosides Suppresses 3T3-L1 Adipocyte Differentiation by Reducing cAMP-Response Element-Binding Protein Phosphorylation and Increasing AMP-Activated Protein Kinase Phosphorylation.

    PubMed

    Harada, Naoki; Ishihara, Mikako; Horiuchi, Hiroko; Ito, Yuta; Tabata, Hiromitsu; Suzuki, Yasushi A; Nakano, Yoshihisa; Yamaji, Ryoichi; Inui, Hiroshi

    2016-01-01

    This study investigated the effects of mogrol, an aglycone of mogrosides from Siraitia grosvenorii, on adipogenesis in 3T3-L1 preadipocytes. Mogrol, but not mogrosides, suppressed triglyceride accumulation by affecting early (days 0-2) and late (days 4-8), but not middle (days 2-4), differentiation stages. At the late stage, mogrol increased AMP-activated protein kinase (AMPK) phosphorylation and reduced glycerol-3-phosphate dehydrogenase activity. At the early stage, mogrol promoted AMPK phosphorylation, inhibited the induction of CCAAT/enhancer-binding protein β (C/EBPβ; a master regulator of adipogenesis), and reduced 3T3-L1 cell contents (e.g., clonal expansion). In addition, mogrol, but not the AMPK activator AICAR, suppressed the phosphorylation and activity of the cAMP response element-binding protein (CREB), which regulates C/EBPβ expression. These results indicated that mogrol suppressed adipogenesis by reducing CREB activation in the initial stage of cell differentiation and by activating AMPK signaling in both the early and late stages of this process. PMID:27583359

  10. Mogrol Derived from Siraitia grosvenorii Mogrosides Suppresses 3T3-L1 Adipocyte Differentiation by Reducing cAMP-Response Element-Binding Protein Phosphorylation and Increasing AMP-Activated Protein Kinase Phosphorylation

    PubMed Central

    Harada, Naoki; Ishihara, Mikako; Horiuchi, Hiroko; Ito, Yuta; Tabata, Hiromitsu; Suzuki, Yasushi A.; Nakano, Yoshihisa; Yamaji, Ryoichi; Inui, Hiroshi

    2016-01-01

    This study investigated the effects of mogrol, an aglycone of mogrosides from Siraitia grosvenorii, on adipogenesis in 3T3-L1 preadipocytes. Mogrol, but not mogrosides, suppressed triglyceride accumulation by affecting early (days 0–2) and late (days 4–8), but not middle (days 2–4), differentiation stages. At the late stage, mogrol increased AMP-activated protein kinase (AMPK) phosphorylation and reduced glycerol-3-phosphate dehydrogenase activity. At the early stage, mogrol promoted AMPK phosphorylation, inhibited the induction of CCAAT/enhancer-binding protein β (C/EBPβ; a master regulator of adipogenesis), and reduced 3T3-L1 cell contents (e.g., clonal expansion). In addition, mogrol, but not the AMPK activator AICAR, suppressed the phosphorylation and activity of the cAMP response element-binding protein (CREB), which regulates C/EBPβ expression. These results indicated that mogrol suppressed adipogenesis by reducing CREB activation in the initial stage of cell differentiation and by activating AMPK signaling in both the early and late stages of this process. PMID:27583359

  11. Inhibition of Gαs/cAMP Signaling Decreases TCR-Stimulated IL-2 transcription in CD4+ T Helper Cells

    PubMed Central

    Hynes, Thomas R.; Yost, Evan A.; Yost, Stacy M.; Hartle, Cassandra M.; Ott, Braden J.

    2015-01-01

    Background: The role of cAMP in regulating T cell activation and function has been controversial. cAMP is generally known as an immunosuppressant, but it is also required for generating optimal immune responses. As the effect of cAMP is likely to depend on its cellular context, the current study investigated whether the mechanism of activation of Gαs and adenylyl cyclase influences their effect on T cell receptor (TCR)-stimulated interleukin-2 (IL-2) mRNA levels. Methods: The effect of blocking Gs-coupled receptor (GsPCR)-mediated Gs activation on TCR-stimulated IL-2 mRNA levels in CD4+ T cells was compared with that of knocking down Gαs expression or inhibiting adenylyl cyclase activity. The effect of knocking down Gαs expression on TCR-stimulated cAMP accumulation was compared with that of blocking GsPCR signaling. Results: ZM-241385, an antagonist to the Gs-coupled A2A adenosine receptor (A2AR), enhanced TCR-stimulated IL-2 mRNA levels in primary human CD4+ T helper cells and in Jurkat T cells. A dominant negative Gαs construct, GαsDN3, also enhanced TCR-stimulated IL-2 mRNA levels. Similar to GsPCR antagonists, GαsDN3 blocked GsPCR-dependent activation of both Gαs and Gβγ. In contrast, Gαs siRNA and 2’,5’-dideoxyadenosine (ddA), an adenylyl cyclase inhibitor, decreased TCR-stimulated IL-2 mRNA levels. Gαs siRNA, but not GαsDN3, decreased TCR-stimulated cAMP synthesis. Potentiation of IL-2 mRNA levels by ZM-241385 required at least two days of TCR stimulation, and addition of ddA after three days of TCR stimulation enhanced IL-2 mRNA levels. Conclusions: GsPCRs play an inhibitory role in the regulation of TCR-stimulated IL-2 mRNA levels whereas Gαs and cAMP can play a stimulatory one. Additionally, TCR-dependent activation of Gαs does not appear to involve GsPCRs. These results suggest that the context of Gαs/cAMP activation and the stage of T cell activation and differentiation determine the effect on TCR-stimulated IL-2 mRNA levels. PMID

  12. A novel cysteine-rich antifungal peptide ToAMP4 from Taraxacum officinale Wigg. flowers.

    PubMed

    Astafieva, A A; Rogozhin, Eugene A; Andreev, Yaroslav A; Odintsova, T I; Kozlov, S A; Grishin, Eugene V; Egorov, Tsezi A

    2013-09-01

    A novel peptide named ToAMP4 was isolated from Taraxacum officinale Wigg. flowers by a combination of acetic acid extraction and different types of chromatography: affinity, size-exclusion, and RP-HPLC. The amino acid sequence of ToAMP4 was determined by automated Edman degradation. The peptide is basic, consists of 41 amino acids, and incorporates three disulphide bonds. Due to the unusual cysteine spacing pattern, ToAMP4 does not belong to any known plant AMP family, but classifies together with two other antimicrobial peptides ToAMP1 and ToAMP2 previously isolated from the dandelion flowers. To study the biological activity of ToAMP4, it was successfully produced in a prokaryotic expression system as a fusion protein with thioredoxin. The recombinant peptide was shown to be identical to the native ToAMP4 by chromatographic behavior, molecular mass, and N-terminal amino acid sequence. The peptide displays broad-spectrum antifungal activity against important phytopathogens. Two ToAMP4-mediated inhibition strategies depending on the fungus were demonstrated. The results obtained add to our knowledge on the structural and functional diversity of AMPs in plants.

  13. Leveraging family-specific signatures for AMP discovery and high-throughput annotation

    PubMed Central

    Waghu, Faiza Hanif; Barai, Ram Shankar; Idicula-Thomas, Susan

    2016-01-01

    Antimicrobial peptides (AMPs) are diverse, biologically active, essential components of the innate immune system. As compared to conventional antibiotics, AMPs exhibit broad spectrum antimicrobial activity, reduced toxicity and reduced microbial resistance. They are widely researched for their therapeutic potential, especially against multi-drug resistant pathogens. AMPs are known to have family-specific sequence composition, which can be mined for their discovery and rational design. Here, we present a detailed family-based study on AMP families. The study involved the use of sequence signatures represented by patterns and hidden Markov models (HMMs) present in experimentally studied AMPs to identify novel AMPs. Along with AMPs, peptides hitherto lacking antimicrobial annotation were also retrieved and wet-lab studies on randomly selected sequences proved their antimicrobial activity against Escherichia coli. CAMPSign, a webserver has been created for researchers to effortlessly exploit the use of AMP family signatures for identification of AMPs. The webserver is available online at www.campsign.bicnirrh.res.in. In this work, we demonstrate an optimised and experimentally validated protocol along with a freely available webserver that uses family-based sequence signatures for accelerated discovery of novel AMPs. PMID:27089856

  14. A novel biosensor to study cAMP dynamics in cilia and flagella

    PubMed Central

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca2+, basal SACY activity is suppressed by Ca2+. Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. DOI: http://dx.doi.org/10.7554/eLife.14052.001 PMID:27003291

  15. Activation of cyclic GMP-AMP synthase by self-DNA causes autoimmune diseases.

    PubMed

    Gao, Daxing; Li, Tuo; Li, Xiao-Dong; Chen, Xiang; Li, Quan-Zhen; Wight-Carter, Mary; Chen, Zhijian J

    2015-10-20

    TREX1 is an exonuclease that digests DNA in the cytoplasm. Loss-of-function mutations of TREX1 are linked to Aicardi-Goutieres Syndrome (AGS) and systemic lupus erythematosus (SLE) in humans. Trex1(-/-) mice exhibit autoimmune and inflammatory phenotypes that are associated with elevated expression of interferon (IFN)-induced genes (ISGs). Cyclic GMP-AMP (cGAMP) synthase (cGAS) is a cytosolic DNA sensor that activates the IFN pathway. Upon binding to DNA, cGAS is activated to catalyze the synthesis of cGAMP, which functions as a second messenger that binds and activates the adaptor protein STING to induce IFNs and other cytokines. Here we show that genetic ablation of cGas in Trex1(-/-) mice eliminated all detectable pathological and molecular phenotypes, including ISG induction, autoantibody production, aberrant T-cell activation, and lethality. Even deletion of just one allele of cGas largely rescued the phenotypes of Trex1(-/-) mice. Similarly, deletion of cGas in mice lacking DNaseII, a lysosomal enzyme that digests DNA, rescued the lethal autoimmune phenotypes of the DNaseII(-/-) mice. Through quantitative mass spectrometry, we found that cGAMP accumulated in mouse tissues deficient in Trex1 or DNaseII and that this accumulation was dependent on cGAS. These results demonstrate that cGAS activation causes the autoimmune diseases in Trex1(-/-) and DNaseII(-/-) mice and suggest that inhibition of cGAS may lead to prevention and treatment of some human autoimmune diseases caused by self-DNA. PMID:26371324

  16. 2-Octynoic Acid Inhibits Hepatitis C Virus Infection through Activation of AMP-Activated Protein Kinase

    PubMed Central

    Yang, Darong; Xue, Binbin; Wang, Xiaohong; Yu, Xiaoyan; Liu, Nianli; Gao, Yimin; Liu, Chen; Zhu, Haizhen

    2013-01-01

    Many chronic hepatitis C virus (HCV)-infected patients with current therapy do not clear the virus. It is necessary to find novel treatments. The effect of 2-octynoic acid (2-OA) on HCV infection in human hepatocytes was examined. The mechanism of 2-OA antiviral activity was explored. Our data showed that 2-OA abrogated lipid accumulation in HCV replicon cells and virus-infected hepatocytes. It suppressed HCV RNA replication and infectious virus production with no cytotoxicity to the host cells. 2-OA did not affect hepatitis B virus replication in HepG2.2.15 cells derived from HepG2 cells transfected with full genome of HBV. Further study demonstrated that 2-OA activated AMP-activated protein kinase (AMPK) and inhibited acetyl-CoA carboxylase in viral-infected cells. Compound C, a specific inhibitor of AMPK, inhibited AMPK activity and reversed the reduction of intracellular lipid accumulation and the antiviral effect of 2-OA. Knockdown of AMPK expression by RNA interference abolished the activation of AMPK by 2-OA and blocked 2-OA antiviral activity. Interestingly, 2-OA induced interferon-stimulated genes (ISGs) and inhibited microRNA-122 (miR-122) expression in virus-infected hepatocytes. MiR-122 overexpression reversed the antiviral effect of 2-OA. Furthermore, knockdown of AMPK expression reversed both the induction of ISGs and suppression of miR-122 by 2-OA, implying that activated AMPK induces the intracellular innate response through the induction of ISGs and inhibiting miR-122 expression. 2-OA inhibits HCV infection through regulation of innate immune response by activated AMPK. These findings reveal a novel mechanism by which active AMPK inhibits HCV infection. 2-OA and its derivatives hold promise for novel drug development for chronic hepatitis C. PMID:23741428

  17. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation.

    PubMed

    Yang, Pei-Chi; Boras, Britton W; Jeng, Mao-Tsuen; Docken, Steffen S; Lewis, Timothy J; McCulloch, Andrew D; Harvey, Robert D; Clancy, Colleen E

    2016-07-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  18. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation

    PubMed Central

    Yang, Pei-Chi; Boras, Britton W.; Jeng, Mao-Tsuen; Lewis, Timothy J.; McCulloch, Andrew D.; Harvey, Robert D.; Clancy, Colleen E.

    2016-01-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  19. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.

    PubMed

    Sucic, J F; Selmin, O; Rutherford, C L

    1993-01-01

    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  20. Expression and organization of BP74, a cyclic AMP-regulated gene expressed during Dictyostelium discoideum development.

    PubMed Central

    Hopkinson, S B; Pollenz, R S; Drummond, I; Chisholm, R L

    1989-01-01

    We have characterized a cDNA and the corresponding gene for a cyclic AMP-inducible gene expressed during Dictyostelium development. This gene, BP74, was found to be first expressed about the time of aggregate formation, approximately 6 h after starvation. Accumulation of BP74 mRNA did not occur in Dictyostelium cells that had been starved in fast-shaken suspension cultures but was induced in similar cultures to which cyclic AMP pulses had been added. The BP74 cDNA and gene were characterized by DNA sequence analysis and transcriptional mapping. When the BP74 promoter region was fused with a chloramphenicol acetyltransferase reporter gene and reintroduced into Dictyostelium cells, the transfected chloramphenicol acetyltransferase gene displayed the same developmentally regulated pattern of expression as did the endogenous BP74 gene, suggesting that all of the cis-acting elements required for regulated expression were carried by a 2-kilobase cloned genomic fragment. On the basis of sequence analysis, the gene appeared to encode a protein containing a 20-residue hydrophobic sequence at the amino-terminal end and 26 copies of a 20-amino-acid repeat. Images PMID:2555685

  1. Differential distribution of cAMP receptors cAR2 and cAR3 during Dictyostelium development.

    PubMed

    Yu, Y; Saxe, C L

    1996-01-10

    Signal transduction via a family of cAMP receptor subtypes (cARs) is critical for proper development in the cellular slime mold Dictyostelium. Genes encoding four related subtypes have been cloned and their expression, based on RNA accumulation, has been previously reported. Here we report the differential spatial and temporal distribution of cAR2 and cAR3 proteins, based on indirect double immunofluorescence. Cells were transformed with a carB::lacZ construct, and an antibody against beta-galactosidase was used to visualize cAR2 expression. Simultaneously, a cAR3-specific antibody was used to identify cAR3-expressing cells. Results indicate that by the time of tip formation (12-14 hr) both receptors are expressed and distribute in a virtually nonoverlapping pattern, with cAR2 being expressed on anterior, prestalk cells and cAR3 present in the rest of the organism. Differential distribution of these two receptor subtypes may result in distinct cAMP signaling mechanisms in the two major regions of the organism. PMID:8575636

  2. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  3. Curcumin attenuates diet-induced hepatic steatosis by activating AMP-activated protein kinase.

    PubMed

    Um, Min Young; Hwang, Kwang Hyun; Ahn, Jiyun; Ha, Tae Youl

    2013-09-01

    Curcumin is a well-known component of traditional turmeric (Curcuma longa), which has been reported to prevent obesity and diabetes. However, the effect of curcumin on hepatic lipid metabolism remains unclear. The aim of this study was to examine the effects of curcumin on hepatic steatosis in high-fat/cholesterol diet (HFD)-induced obese mice. Male C57BL/6J mice were fed a normal diet (ND), HFD or HFD with 0.15% curcumin (HFD+C) for 11 weeks. We found that curcumin significantly lowered the body-weight and adipose tissue weight of mice in the HFD+C group compared with the findings for the HFD group (p < 0.05). The levels of total cholesterol, fasting glucose and insulin in serum were decreased, and HFD-induced impairment of insulin sensitivity was improved by curcumin supplementation (p < 0.05). Curcumin protected against the development of hepatic steatosis by reducing hepatic fat accumulation. Moreover, curcumin activated AMP-activated protein kinase (AMPK) and elevated the gene expression of peroxisome proliferator-activated receptor alpha. By contrast, curcumin suppressed the HFD-mediated increases in sterol regulatory element-binding protein-1, acetyl-CoA carboxylase 1, fatty acid synthase and cluster of differentiation 36 expression. Taken together, these findings indicate that curcumin attenuates HFD-induced hepatic steatosis by regulating hepatic lipid metabolism via AMPK activation, suggesting its use as a therapeutic for hepatic steatosis.

  4. Amp-hour counting control for PV hybrid power systems

    SciTech Connect

    Hund, T.D.; Thompson, B.

    1997-06-01

    The performance of an amp-hour (Ah) counting battery charge control algorithm has been defined and tested using the Digital Solar Technologies MPR-9400 microprocessor based PV hybrid charge controller. This work included extensive field testing of the charge algorithm on flooded lead-antimony and valve regulated lead-acid (VRLA) batteries. The test results after one-year have demonstrated that PV charge utilization, battery charge control, and battery state of charge (SOC) has been significantly improved by providing maximum charge to the batteries while limiting battery overcharge to manufacturers specifications during variable solar resource and load periods.

  5. Op. amps in power amplification: a laboratory exercise on feedback

    NASA Astrophysics Data System (ADS)

    Borcherds, P. H.

    1984-05-01

    Rapid and continuing developments in electronics make it necessary to revise constantly the teaching of electronics and to replace obsolescent laboratory exercises. The author describes a new exercise which believes helps students' (and lecturers') understanding of negative feedback. A power amplifier is constructed from an operational amplifier (op. amp.) together with a complementary pair of transistors as an output stage. To make the exercise more realistic a low impedance (8 Omega ) loudspeaker is used as the load. The amplifier is developed and tested stage by stage, and at each stage the defects apparent at the previous stage are eliminated.

  6. Chromoplast biogenesis and carotenoid accumulation.

    PubMed

    Li, Li; Yuan, Hui

    2013-11-15

    Chromoplasts are special organelles that possess superior ability to synthesize and store massive amounts of carotenoids. They are responsible for the distinctive colors found in fruits, flowers, and roots. Chromoplasts exhibit various morphologies and are derived from either pre-existing chloroplasts or other non-photosynthetic plastids such as proplastids, leucoplasts or amyloplasts. While little is known about the molecular mechanisms underlying chromoplast biogenesis, research progress along with proteomics study of chromoplast proteomes signifies various processes and factors important for chromoplast differentiation and development. Chromoplasts act as a metabolic sink that enables great biosynthesis and high storage capacity of carotenoids. The formation of chromoplasts enhances carotenoid metabolic sink strength and controls carotenoid accumulation in plants. The objective of this review is to provide an integrated view on our understanding of chromoplast biogenesis and carotenoid accumulation in plants.

  7. Mechanisms of intrahepatic triglyceride accumulation

    PubMed Central

    Ress, Claudia; Kaser, Susanne

    2016-01-01

    Hepatic steatosis defined as lipid accumulation in hepatocytes is very frequently found in adults and obese adolescents in the Western World. Etiologically, obesity and associated insulin resistance or excess alcohol intake are the most frequent causes of hepatic steatosis. However, steatosis also often occurs with chronic hepatitis C virus (HCV) infection and is also found in rare but potentially life-threatening liver diseases of pregnancy. Clinical significance and outcome of hepatic triglyceride accumulation are highly dependent on etiology and histological pattern of steatosis. This review summarizes current concepts of pathophysiology of common causes of hepatic steatosis, including non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, chronic HCV infections, drug-induced forms of hepatic steatosis, and acute fatty liver of pregnancy. Regarding the pathophysiology of NAFLD, this work focuses on the close correlation between insulin resistance and hepatic triglyceride accumulation, highlighting the potential harmful effects of systemic insulin resistance on hepatic metabolism of fatty acids on the one side and the role of lipid intermediates on insulin signalling on the other side. Current studies on lipid droplet morphogenesis have identified novel candidate proteins and enzymes in NAFLD. PMID:26819531

  8. Effect of adenosine and adenosine analogs on ( sup 14 C)aminopyrine accumulation by rabbit parietal cells

    SciTech Connect

    Ota, S.; Hiraishi, H.; Terano, A.; Mutoh, H.; Kurachi, Y.; Shimada, T.; Ivey, K.J.; Sugimoto, T. )

    1989-12-01

    Adenosine receptors that modulate adenylate cyclase activity have been identified recently in a number of tissues. Adenosine A2 receptor is stimulatory to adenylate cyclase, whereas adenosine A1 receptor is inhibitory to adenylate cyclase. We investigated the effect of adenosine and its analogs on (14C)aminopyrine accumulation by rabbit parietal cells. Rabbit gastric mucosal cells were isolated by enzyme digestion. Parietal cells were enriched by nonlinear percoll gradients. (14C)Aminopyrine accumulation was used as an indicator of acid secretion. The effect of 2-chloroadenosine on histamine-stimulated (14C)aminopyrine accumulation was studied. The effects of N-ethylcarboxamideadenosine, 2-chloroadenosine, stable analogs of adenosine, and adenosine on (14C)aminopyrine accumulation were assessed. Cyclic AMP content of parietal cells was determined by radioimmunoassay. Histamine and carbachol, known secretagogues, stimulated (14C)aminopyrine accumulation. 2-Chloroadenosine did not suppress histamine-stimulated (14C)aminopyrine accumulation. 2-Chloroadenosine, N-ethylcarboxamideadenosine, and adenosine dose dependently increased (14C)aminopyrine accumulation. The order of potency was N-ethylcarboxamideadenosine greater than 2-chloroadenosine greater than adenosine. 8-Phenyltheophylline and theophylline, adenosine-receptor antagonists, or cimetidine did not have significant effects on the increase of AP uptake induced by 2-chloroadenosine. Coadministration of dipyridamole, and adenosine uptake inhibitor, augmented the effect of adenosine on (14C)aminopyrine accumulation. 2-Chloroadenosine, N-ethylcarboxamideadenosine, and adenosine each induced a significant increase in cellular cyclic AMP. We conclude that there may be adenosine A2 receptors on rabbit parietal cells which modulate gastric acid secretion.

  9. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases.

  10. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP. PMID:27596420

  11. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP.

  12. Cyclic AMP Can Decrease Expression of Genes Subject to Catabolite Repression in Saccharomyces cerevisiae

    PubMed Central

    Zaragoza, Oscar; Lindley, Chris; Gancedo, Juana M.

    1999-01-01

    External cyclic AMP (cAMP) hindered the derepression of gluconeogenic enzymes in a pde2 mutant of Saccharomyces cerevisiae, but it did not prevent invertase derepression. cAMP reduced nearly 20-fold the transcription driven by upstream activation sequence (UAS1FBP1) from FBP1, encoding fructose-1,6-bisphosphatase; it decreased 2-fold the activation of transcription by UAS2FBP1. Nuclear extracts from cells derepressed in the presence of cAMP were impaired in the formation of specific UASFBP1-protein complexes in band shift experiments. cAMP does not appear to act through the repressing protein Mig1. Control of FBP1 transcription through cAMP is redundant with other regulatory mechanisms. PMID:10198033

  13. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases. PMID:24750474

  14. Expression of Dm-AMP1 in rice confers resistance to Magnaporthe oryzae and Rhizoctonia solani.

    PubMed

    Jha, Sanjay; Tank, Harsukh G; Prasad, Bishun Deo; Chattoo, Bharat B

    2009-02-01

    Magnaporthe oryzae and Rhizoctonia solani, are among the most important pathogens of rice, severely limiting its productivity. Dm-AMP1, an antifungal plant defensin from Dahlia merckii, was expressed in rice (Oryza sativa L. sp. indica cv. Pusa basmati 1) using Agrobacterium tumefaciens-mediated transformation. Expression levels of Dm-AMP1 ranged from 0.43% to 0.57% of total soluble protein in transgenic plants. It was observed that constitutive expression of Dm-AMP1 suppresses the growth of M. oryzae and R. solani by 84% and 72%, respectively. Transgenic expression of Dm-AMP1 was not accompanied by an induction of pathogenesis-related (PR) gene expression, indicating that the expression of DmAMP1 directly inhibits the pathogen. The results of in vitro, in planta and microscopic analyses suggest that Dm-AMP1 expression has the potential to provide broad-spectrum disease resistance in rice. PMID:18618285

  15. Targeting cAMP/PKA pathway for glycemic control and type 2 diabetes therapy.

    PubMed

    Yang, Haihua; Yang, Linghai

    2016-08-01

    In mammals, cyclic adenosine monophosphate (cAMP) is an intracellular second messenger that is usually elicited by binding of hormones and neurotransmitters to G protein-coupled receptors (GPCRs). cAMP exerts many of its physiological effects by activating cAMP-dependent protein kinase (PKA), which in turn phosphorylates and regulates the functions of downstream protein targets including ion channels, enzymes, and transcription factors. cAMP/PKA signaling pathway regulates glucose homeostasis at multiple levels including insulin and glucagon secretion, glucose uptake, glycogen synthesis and breakdown, gluconeogenesis, and neural control of glucose homeostasis. This review summarizes recent genetic and pharmacological studies concerning the regulation of glucose homeostasis by cAMP/PKA in pancreas, liver, skeletal muscle, adipose tissues, and brain. We also discuss the strategies for targeting cAMP/PKA pathway for research and potential therapeutic treatment of type 2 diabetes mellitus (T2D). PMID:27194812

  16. Functions of AMP-activated protein kinase in adipose tissue

    PubMed Central

    Daval, Marie; Foufelle, Fabienne; Ferré, Pascal

    2006-01-01

    AMP-activated protein kinase (AMPK) is involved in cellular energy homeostasis. Its functions have been extensively studied in muscles and liver. AMPK stimulates pathways which increase energy production (glucose transport, fatty acid oxidation) and switches off pathways which consume energy (lipogenesis, protein synthesis, gluconeogenesis). This has led to the concept that AMPK has an interesting pharmaceutical potential in situations of insulin resistance and it is indeed the target of existing drugs and hormones which improve insulin sensitivity. Adipose tissue is a key player in energy metabolism through the release of substrates and hormones involved in metabolism and insulin sensitivity. Activation of AMPK in adipose tissue can be achieved through situations such as fasting and exercise. Leptin and adiponectin as well as hypoglycaemic drugs are activators of adipose tissue AMPK. This activation probably involves changes in the AMP/ATP ratio and the upstream kinase LKB1. When activated, AMPK limits fatty acid efflux from adipocytes and favours local fatty acid oxidation. Since fatty acids have a key role in insulin resistance, especially in muscles, activating AMPK in adipose tissue might be found to be beneficial in insulin-resistant states, particularly as AMPK activation also reduces cytokine secretion in adipocytes. PMID:16709632

  17. Reanalyzing the Ampère-Maxwell Law

    NASA Astrophysics Data System (ADS)

    Hill, S. Eric

    2011-09-01

    In a recent TPT article, I addressed a common miscommunication about Faraday's law, namely, that introductory texts often say the law expresses a causal relationship between the magnetic fields time variation and the electric fields circulation. In that article, I demonstrated that these field behaviors share a common cause in a time-varying current density. From that, many readers may have rightly guessed at a symmetric conclusion: while the Ampère-Maxwell law is commonly said to express a causal relation between the electric fields time variation and the magnetic fields circulation, these field behaviors share a distinct, common cause. Together, Faraday's law and the Ampère-Maxwell law constitute half of Maxwell's laws that form a foundation for almost all of electricity and magnetism. By misrepresenting these two laws, introductory texts not only present students with unnecessary conceptual hurdles early in their physics educations but also leave them with enduring misunderstandings about the very foundation of electricity and magnetism. Fortunately, compared to what is commonly taught, the actual cause of these field variations is conceptually simpler and more consistent with what the students will have already learned in the introductory texts' own earlier chapters.

  18. Cyclic GMP-AMP Displays Mucosal Adjuvant Activity in Mice

    PubMed Central

    Škrnjug, Ivana

    2014-01-01

    The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP) after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice. A characteristic of the cGAMP-induced immune response is the slightly reduced induction of interleukin-17 as a hallmark of Th17 activity – a distinct feature that is not observed with other cyclic di-nucleotide adjuvants. We further characterize the innate immune stimulation activity in vitro on murine bone marrow-derived dendritic cells and human dendritic cells. The observed results suggest the consideration of cGAMP as a candidate mucosal adjuvant for human vaccines. PMID:25295996

  19. Regulation of cAMP-dependent Protein Kinases

    PubMed Central

    Diskar, Mandy; Zenn, Hans-Michael; Kaupisch, Alexandra; Kaufholz, Melanie; Brockmeyer, Stefanie; Sohmen, Daniel; Berrera, Marco; Zaccolo, Manuela; Boshart, Michael; Herberg, Friedrich W.; Prinz, Anke

    2010-01-01

    cAMP-dependent protein kinases are reversibly complexed with any of the four isoforms of regulatory (R) subunits, which contain either a substrate or a pseudosubstrate autoinhibitory domain. The human protein kinase X (PrKX) is an exemption as it is inhibited only by pseudosubstrate inhibitors, i.e. RIα or RIβ but not by substrate inhibitors RIIα or RIIβ. Detailed examination of the capacity of five PrKX-like kinases ranging from human to protozoa (Trypanosoma brucei) to form holoenzymes with human R subunits in living cells shows that this preference for pseudosubstrate inhibitors is evolutionarily conserved. To elucidate the molecular basis of this inhibitory pattern, we applied bioluminescence resonance energy transfer and surface plasmon resonance in combination with site-directed mutagenesis. We observed that the conserved αH-αI loop residue Arg-283 in PrKX is crucial for its RI over RII preference, as a R283L mutant was able to form a holoenzyme complex with wild type RII subunits. Changing the corresponding αH-αI loop residue in PKA Cα (L277R), significantly destabilized holoenzyme complexes in vitro, as cAMP-mediated holoenzyme activation was facilitated by a factor of 2–4, and lead to a decreased affinity of the mutant C subunit for R subunits, significantly affecting RII containing holoenzymes. PMID:20819953

  20. Solution structure of the cAMP-dependent protein kinase

    SciTech Connect

    Trewhella, J.; Olah, G.A.; Walsh, D.A.; Mitchell, R.D.

    1998-12-31

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project as Los Alamos National Laboratory (LANL). Protein phosphorylation is well established as one of the most important mechanisms of signal transduction and cellular regulation. Two of the key enzymes that catalyze these phosphorylation reactions are the cAMP- (PKA) and cGMP- (PKG) dependent protein kinases. PKA has served as the prototypic model of this class of enzymes that now comprises in excess of 300 phylogenetically related proteins. A large number of these protein kinases are critical for the regulation of cell function and a full analysis of their similarities and differences is essential to understand their diverse physiological roles. The cAMP-dependent protein kinase has the subunit structure R2C2, in which C and R refer to the catalytic and regulatory subunits, respectively. The cGMP-dependent protein kinase (PKG) is highly homologous to PKA but is distinguished from it by having the regulatory and catalytic domains on a contiguous polypeptide. The studies described here use small-angle scattering and Fourier Transform InfraRed (FTIR) spectroscopy to study domain movements and conformational changes in these enzymes in different functional states in order to elucidate the molecular bases for the regulation of their activities.

  1. Involvement of calyculin A inhibitable protein phosphatases in the cyclic AMP signal transduction pathway of mouse corticotroph tumour (AtT20) cells

    PubMed Central

    Antaraki, A; Ang, K L; Antoni, F A

    1997-01-01

    The role of non-calcineurin protein phosphatases in the cyclic AMP signal transduction pathway was examined in mouse pituitary corticotroph tumour (AtT20) cells. Blockers of protein phosphatases, calyculin A and okadaic acid, were applied in AtT20 cells depleted of rapidly mobilizable pools of intracellular calcium and activated by various cyclic AMP generating agonists. Inhibitors of cyclic nucleotide phosphodiesterases were present throughout. The accumulation of cyclic AMP was monitored by radioimmunoassay, phosphodiesterase activity in cell homogenates was measured by radiometric assay. Neither calyculin A nor okadaic acid altered basal cyclic AMP levels but cyclic AMP formation induced by 41 amino acid residue corticotrophin releasing-factor (CRF) was strongly inhibited (up to 80%). 1-Norokadaone was inactive. Similar data were also obtained when isoprenaline or pituitary adenylate cyclase activating peptide1–38 were used as agonists. Pertussis toxin did not modify the inhibition of CRF-induced cyclic AMP production by calyculin A. Pretreatment with calyculin A completely prevented the stimulation of cyclic AMP formation by cholera toxin even in the presence of 0.5 mM isobutylmethylxanthine (IBMX) and 0.1 mM rolipram. Cholera toxin mediated ADP-ribosylation of the 45K and 52K molecular weight Gsα isoforms in membranes from calyculin A-pretreated cells was enhanced to 150–200% when compared with controls. Cholera toxin-induced cyclic AMP was reduced by calyculin A within 10 min when calyculin A was applied after a 90 min pretreatment with cholera toxin. Under these conditions the effect of calyculin A could be blocked by the combination of 0.5 mM IBMX and 0.1 mM rolipram, but not by 0.5 mM IBMX alone. Phosphodiesterase activity in AtT20 cell homogenates showed a significant, 2.7 fold increase after treatment with calyculin A. In control cells phosphodiesterase activity was blocked by 80% in the presence of IBMX (0.5 mM), or IBMX plus

  2. Is This Op-Amp Any Good?: Lab-Built Checker Removes All Doubt!

    ERIC Educational Resources Information Center

    Harman, Charles

    2007-01-01

    Electronics instructors and students find it very helpful to be able to check an operational amplifier at the proto-board stage. Most students lack the experience or knowledge that it takes to recognize whether an op-amp is operating normally or not. This article discusses a handy op-amp checker that allows one to check and/or test op-amps at the…

  3. Impact of AmpC Derepression on Fitness and Virulence: the Mechanism or the Pathway?

    PubMed Central

    Pérez-Gallego, Marcelo; Torrens, Gabriel; Castillo-Vera, Jane; Moya, Bartolomé; Zamorano, Laura; Hultenby, Kjell; Albertí, Sebastián; Mellroth, Peter; Henriques-Normark, Birgitta; Normark, Staffan

    2016-01-01

    ABSTRACT Understanding the interplay between antibiotic resistance and bacterial fitness and virulence is essential to guide individual treatments and improve global antibiotic policies. A paradigmatic example of a resistance mechanism is the intrinsic inducible chromosomal β-lactamase AmpC from multiple Gram-negative bacteria, including Pseudomonas aeruginosa, a major nosocomial pathogen. The regulation of ampC expression is intimately linked to peptidoglycan recycling, and AmpC-mediated β-lactam resistance is frequently mediated by inactivating mutations in ampD, encoding an N-acetyl-anhydromuramyl-l-alanine amidase, affecting the levels of ampC-activating muropeptides. Here we dissect the impact of the multiple pathways causing AmpC hyperproduction on P. aeruginosa fitness and virulence. Through a detailed analysis, we demonstrate that the lack of all three P. aeruginosa AmpD amidases causes a dramatic effect in fitness and pathogenicity, severely compromising growth rates, motility, and cytotoxicity; the latter effect is likely achieved by repressing key virulence factors, such as protease LasA, phospholipase C, or type III secretion system components. We also show that ampC overexpression is required but not sufficient to confer the growth-motility-cytotoxicity impaired phenotype and that alternative pathways leading to similar levels of ampC hyperexpression and resistance, such as those involving PBP4, had no fitness-virulence cost. Further analysis indicated that fitness-virulence impairment is caused by overexpressing ampC in the absence of cell wall recycling, as reproduced by expressing ampC from a plasmid in an AmpG (muropeptide permease)-deficient background. Thus, our findings represent a major step in the understanding of β-lactam resistance biology and its interplay with fitness and pathogenesis. PMID:27795406

  4. Dynamics of β-adrenergic/cAMP signaling and morphological changes in cultured astrocytes.

    PubMed

    Vardjan, Nina; Kreft, Marko; Zorec, Robert

    2014-04-01

    The morphology of astrocytes, likely regulated by cAMP, determines the structural association between astrocytes and the synapse, consequently modulating synaptic function. β-Adrenergic receptors (β-AR), which increase cytosolic cAMP concentration ([cAMP]i ), may affect cell morphology. However, the real-time dynamics of β-AR-mediated cAMP signaling in single live astrocytes and its effect on cell morphology have not been studied. We used the fluorescence resonance energy transfer (FRET)-based cAMP biosensor Epac1-camps to study time-dependent changes in [cAMP]i ; morphological changes in primary rat astrocytes were monitored by real-time confocal microscopy. Stimulation of β-AR by adrenaline, noradrenaline, and isoprenaline, a specific agonist of β-AR, rapidly increased [cAMP]i (∼15 s). The FRET signal response, mediated via β-AR, was faster than in the presence of forskolin (twofold) and dibutyryl-cAMP (>35-fold), which directly activate adenylyl cyclase and Epac1-camps, respectively, likely due to slow entry of these agents into the cytosol. Oscillations in [cAMP]i have not been recorded, indicating that cAMP-dependent processes operate in a slow time domain. Most Epac1-camps expressing astrocytes revealed a morphological change upon β-AR activation and attained a stellate morphology within 1 h. The morphological changes exhibited a bell-shaped dependency on [cAMP]i . The 5-10% decrease in cell cross-sectional area and the 30-50% increase in cell perimeter are likely due to withdrawal of the cytoplasm to the perinuclear region and the appearance of protrusions on the surface of astrocytes. Because astrocyte processes ensheath neurons, β-AR/cAMP-mediated morphological changes can modify the geometry of the extracellular space, affecting synaptic, neuronal, and astrocyte functions in health and disease. PMID:24464905

  5. Cyclic AMP pathway modifies memory through neural cell adhesion molecule alterations in the rat hippocampus.

    PubMed

    Razmi, Ali; Sahebgharani, Mousa; Khani, Mohammad Hossein; Paylakhi, Seyed Hassan; Faizi, Mehrdad; Zarrindast, Mohammad-Reza

    2014-01-01

    Neural Cell Adhesion Molecules (NCAMs) are known to influence memory by affecting neural cell-cell and cell-extracellular matrix junctions. This study investigated the possible role of cAMP pathway in the expression of hippocampal NCAM and its polysialylated derivative (PSA-NCAM). The following pharmacological tools were employed for manipulation of cAMP pathway: a) forskolin; the activator of adenylyl cyclase (AC), b) 8-Br-cAMP; a protein kinase A (PKA) agonist, c) 8-pCPT-2'-O-Me-cAMP; a selective enhancer of exchange protein activated by cAMP (Epac) and d) Rp-cAMP; a PKA inhibitor. Memory acquisition was tested by passive avoidance paradigm after injecting the above compounds for three consecutive days into the CA1 region of dorsal hippocampus of rats. Forskolin and 8-Br-cAMP enhanced memory retrieval while Rp-cAMP significantly reduced memory and NCAM levels. 8-pCPT-2'-O-Me-cAMP failed to alter memory performance or NCAM levels as compared to vehicle. We observed no significant changes in PSA-NCAM, however the expression of St8sia4 and St8sia2 (the polysialyltransferase isoforms) were altered. The mRNA levels of St8sia4 was down-regulated by 8-Br-cAMP, Rp-cAMP and 8-pCPT while forskolin led to almost 3 and 5 fold increase in mRNAs of St8sia2 and St8sia4, respectively. The current insight might endorse the predominant role of PKA as compared to Epac in cAMP pathway in expression of NCAM and memory function. PMID:24901853

  6. Mathematical model of cAMP-dependent signaling pathway in constitutive and UV-induced melanogenesis

    NASA Astrophysics Data System (ADS)

    Stolnitz, Mikhail M.; Peshkova, Anna Y.

    2002-07-01

    Cascade of reactions of cAMP-dependent signaling pathway in melanocytes is investigated by mathematical modeling. Model takes into account (alpha) -melanocyte stimulating hormone binding to melanocortin-1 receptor, adenylate cyclase activation by G-protein, increase of the intracellular cAMP concentration, PKA activation by cAMP, CREB phosphorylation by PKA, microphthalmia gene expression, microphthalmia binding to tyrosinase gene promoter, increase of tyrosinase synthesis. Positive and negative feedback loops of this system are analyzed.

  7. Butyrate activates the cAMP-protein kinase A-cAMP response element-binding protein signaling pathway in Caco-2 cells.

    PubMed

    Wang, Aihua; Si, Hongwei; Liu, Dongmin; Jiang, Honglin

    2012-01-01

    Butyrate is a major SCFA produced by microbial fermentation of dietary fiber in the gastrointestinal tract. Butyrate is widely thought to mediate the benefits of fiber and resistant starch consumption to colon health in humans. Besides serving as a substrate for energy production, butyrate has many regulatory effects in animals. Little is known about the signaling mechanisms underlying the regulatory effects of butyrate and other SCFA. In this study, we determined whether butyrate can activate cAMP-protein kinase A (PKA)- cAMP response element (CRE)-binding protein (CREB) signaling in Caco-2 cells, a model of intestinal epithelial cells. Butyrate promoted luciferase expression from a CRE-reporter construct, induced phosphorylation of CREB, increased the activity of PKA, and elevated the levels of cAMP in Caco-2 cells. These data suggest that butyrate activates cAMP-PKA-CREB signaling in Caco-2 cells. Butyrate, however, had no effect on the activities of adenylyl cyclase (AC) and phosphodiesterase (PDE), two enzymes that determine the production and degradation of intracellular cAMP, respectively. Because the activities of AC and PDE are primarily regulated by G protein-coupled receptor (GPR)-mediated intracellular signaling, lack of an effect of butyrate on these two enzymes suggests that butyrate does not activate cAMP-PKA-CREB signaling through GPR. Butyrate-treated Caco-2 cells had greater concentrations of ATP than untreated cells. Because ATP is the substrate for cAMP production, this difference suggests that butyrate may activate cAMP-PKA-CREB signaling in Caco-2 cells through increased ATP production. Overall, this study raises the possibility that some of the regulatory effects of butyrate in animals, including those on the colonocytes, may be mediated by the cAMP-PKA-CREB signaling pathway at the cellular level.

  8. Characterization of prostanoid receptors on rat neutrophils.

    PubMed Central

    Wise, H; Jones, R L

    1994-01-01

    1. The effects of various prostanoid agonists have been compared on the increase in intracellular free calcium ([Ca2+]i) and the aggregation reaction of rat peritoneal neutrophils induced by N-formyl-L-methionyl-L-leucyl-L-phenylalanine (FMLP). 2. Prostaglandin E2 (PGE2) and the specific IP-receptor agonist, cicaprost, both inhibited the FMLP-induced increase in [Ca2+]i (IC50 33 nM and 18 nM respectively) and the FMLP-induced aggregation reaction (IC50 5.6 nM and 7.9 nM respectively). PGD2, PGF2 alpha, and the TP-receptor agonist, U 46619, were inactive at the highest concentration tested (1 microM). 3. The EP1-receptor agonist, 17-phenyl-omega-trinor PGE2, and the EP3-receptor agonists, GR 63799X and sulprostone, had no inhibitory effect on FMLP-stimulated rat neutrophils. 4. PGE1 (EP/IP-receptor agonist) and iloprost (IP-receptor agonist) inhibited the FMLP-induced increase in [Ca2+]i with IC50 values of 34 nM and 38 nM respectively. The EP2-receptor agonists, butaprost and misoprostol (1 microM), inhibited both FMLP-stimulated [Ca2+]i and aggregation. However another EP2-receptor agonist, AH 13205, was inactive in both assays. 5. Prostanoid receptors present on rat neutrophils were further characterized by measuring [3H]-adenosine 3':5'-cyclic monophosphate ([3H]-cyclic AMP) accumulation. Only those agonists capable of stimulating [3H]-cyclic AMP accumulation were able to inhibit both FMLP-stimulated [Ca2+]i and aggregation. 6. These results indicate that rat neutrophils possess inhibitory IP and EP-receptors; the relative potencies of PGE2, misoprostol and butaprost are those expected for the EP2-receptor subtype. No evidence for DP, FP, TP or EP1 and EP3-receptors was obtained. PMID:7834211

  9. cAMP diffusion in Dictyostelium discoideum: A Green's function method

    NASA Astrophysics Data System (ADS)

    Calovi, Daniel S.; Brunnet, Leonardo G.; de Almeida, Rita M. C.

    2010-07-01

    A Green’s function method is developed to approach the spatiotemporal equations describing the cAMP production in Dictyostelium discoideum, markedly reducing numerical calculations times: cAMP concentrations and gradients are calculated just at the amoeba locations. A single set of parameters is capable of reproducing the different observed behaviors, from cAMP synchronization, spiral waves and reaction-diffusion patterns to streaming and mound formation. After aggregation, the emergence of a circular motion of amoebas, breaking the radial cAMP field symmetry, is observed.

  10. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis

    PubMed Central

    Zhou, Zhiwen; Tanaka, Kenji F.; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  11. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms

    SciTech Connect

    Ghayor, Chafik; Ehrbar, Martin; Miguel, Blanca San; Graetz, Klaus W.; Weber, Franz E.

    2009-04-03

    Recent studies suggest that the elevation of intracellular cyclic adenosine monophosphate (cAMP) and the activation of the protein kinase A regulate BMP-induced osteogenesis. However, the precise mechanisms underlying the enhancing effect of cAMP on BMP2 signaling were not completely revealed. In this study we investigated the effect of elevated cAMP level and PKA activation on the BMP2-induced osteoblastic differentiation in pluripotent C2C12 cells. Alkaline phosphatase activity and its mRNA were consistently induced by BMP2 treatment. The pretreatment of C2C12 cells with Forskolin, a cAMP generating agent, dbcAMP, an analogue of cAMP, or IBMX (3-isobutyl 1-methyl xanthine), and a nonspecific inhibitor of phosphodiesterases elicited further activation of alkaline phosphatase. Furthermore, elevated intracellular cAMP level increased BMP2-induced MKP1. On the other hand, BMP2-induced Erk phosphorylation (p44/p42) and cell proliferation were suppressed in the presence of cAMP. Thus, cAMP might enhance BMP2-induced osteoblastic differentiation by a MKP1-Erk-dependent mechanism.

  12. A-kinase anchoring proteins: cAMP compartmentalization in neurodegenerative and obstructive pulmonary diseases

    PubMed Central

    Poppinga, W J; Muñoz-Llancao, P; González-Billault, C; Schmidt, M

    2014-01-01

    The universal second messenger cAMP is generated upon stimulation of Gs protein-coupled receptors, such as the β2-adreneoceptor, and leads to the activation of PKA, the major cAMP effector protein. PKA oscillates between an on and off state and thereby regulates a plethora of distinct biological responses. The broad activation pattern of PKA and its contribution to several distinct cellular functions lead to the introduction of the concept of compartmentalization of cAMP. A-kinase anchoring proteins (AKAPs) are of central importance due to their unique ability to directly and/or indirectly interact with proteins that either determine the cellular content of cAMP, such as β2-adrenoceptors, ACs and PDEs, or are regulated by cAMP such as the exchange protein directly activated by cAMP. We report on lessons learned from neurons indicating that maintenance of cAMP compartmentalization by AKAP5 is linked to neurotransmission, learning and memory. Disturbance of cAMP compartments seem to be linked to neurodegenerative disease including Alzheimer's disease. We translate this knowledge to compartmentalized cAMP signalling in the lung. Next to AKAP5, we focus here on AKAP12 and Ezrin (AKAP78). These topics will be highlighted in the context of the development of novel pharmacological interventions to tackle AKAP-dependent compartmentalization. PMID:25132049

  13. Identification of a cyclic-AMP-responsive element within the rat somatostatin gene.

    PubMed Central

    Montminy, M R; Sevarino, K A; Wagner, J A; Mandel, G; Goodman, R H

    1986-01-01

    We have examined the regulation of somatostatin gene expression by cAMP in PC12 rat pheochromocytoma cells transfected with the rat somatostatin gene. Forskolin at 10 microM caused a 4-fold increase in somatostatin mRNA levels within 4 hr of treatment in stably transfected cells. Chimeric genes containing the somatostatin gene promoter fused to the bacterial reporter gene encoding chloramphenicol acetyltransferase were also induced by cAMP in PC12 cells. To delineate the sequences required for response to cAMP, we constructed a series of promoter deletion mutants. Our studies defined a region between 60 and 29 base pairs upstream from the transcriptional initiation site that conferred cAMP responsiveness when placed adjacent to the simian virus 40 promoter. Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP. cAMP responsiveness was greatly reduced when the somatostatin fusion genes were transfected into the mutant PC12 line A126-1B2, which is deficient in cAMP-dependent protein kinase 2. Our studies indicate that transcriptional regulation of the somatostatin gene by cAMP requires protein kinase 2 activity and may depend upon a highly conserved promoter element. Images PMID:2875459

  14. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis.

    PubMed

    Zhou, Zhiwen; Tanaka, Kenji F; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  15. TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

    PubMed

    Fayet, G; Aouani, A; Hovsépian, S

    1986-01-01

    The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

  16. cAMP signaling microdomains and their observation by optical methods

    PubMed Central

    Calebiro, Davide; Maiellaro, Isabella

    2014-01-01

    The second messenger cyclic AMP (cAMP) is a major intracellular mediator of many hormones and neurotransmitters and regulates a myriad of cell functions, including synaptic plasticity in neurons. Whereas cAMP can freely diffuse in the cytosol, a growing body of evidence suggests the formation of cAMP gradients and microdomains near the sites of cAMP production, where cAMP signals remain apparently confined. The mechanisms responsible for the formation of such microdomains are subject of intensive investigation. The development of optical methods based on fluorescence resonance energy transfer (FRET), which allow a direct observation of cAMP signaling with high temporal and spatial resolution, is playing a fundamental role in elucidating the nature of such microdomains. Here, we will review the optical methods used for monitoring cAMP and protein kinase A (PKA) signaling in living cells, providing some examples of their application in neurons, and will discuss the major hypotheses on the formation of cAMP/PKA microdomains. PMID:25389388

  17. Fatal infantile cardiac glycogenosis with phosphorylase kinase deficiency and a mutation in the gamma2-subunit of AMP-activated protein kinase.

    PubMed

    Akman, Hasan O; Sampayo, James N; Ross, Fiona A; Scott, John W; Wilson, Gregory; Benson, Lee; Bruno, Claudio; Shanske, Sara; Hardie, D Grahame; Dimauro, Salvatore

    2007-10-01

    A 10-wk-old infant girl with severe hypertrophy of the septal and atrial walls by cardiac ultrasound, developed progressive ventricular wall thickening and died of aspiration pneumonia at 5 mo of age. Postmortem examination revealed ventricular hypertrophy and massive atrial wall thickening due to glycogen accumulation. A skeletal muscle biopsy showed increased free glycogen and decreased activity of phosphorylase b kinase (PHK). The report of a pathogenic mutation (R531Q) in the gene (PRKAG2) encoding the gamma2 subunit of AMP-activated protein kinase (AMPK) in three infants with congenital hypertrophic cardiomyopathy, glycogen storage, and "pseudo PHK deficiency" prompted us to screen this gene in our patient. We found a novel (R384T) heterozygous mutation in PRKAG2, affecting an arginine residue in the N-terminal AMP-binding domain. Like R531Q, this mutation reduces the binding of AMP and ATP to the isolated nucleotide-binding domains, and prevents activation of the heterotrimer by metabolic stress in intact cells. The mutation was not found in DNA from the patient's father, the only available parent, and is likely to have arisen de novo. Our studies confirm that mutations in PRKAG2 can cause fatal infantile cardiomyopathy, often associated with apparent PHK deficiency.

  18. Isolation and characterization of cAMP-resistant mutants of the H-4 rat hepatoma cells

    SciTech Connect

    Liu, A.Y.; Lin, Z.

    1987-05-01

    H-4 rat hepatoma cells were mutagenized with ethyl methane-sulfonate and the frequency of emergence of cAMP resistant mutant cells were evaluated by cloning the EMS-treated cells in a semi-solid agar medium that contained either 1-3 mM 8-bromo-cAMP plus 1 mM 3-isobutyl-1-methyl xanthine or 5 ..mu..g/ml cholera toxin plus 1 mM IBMX. cAMP resistant mutants emerged at a frequency of 8 x 10/sup -5/. 15 colonies were isolated, recloned, grown in mass culture, and cell extracts were prepared. Analysis of cAMP-dependent protein kinase demonstrated that: (1) the type II enzyme is the only cAMP-dependent protein kinase detected in extracts of the hepatoma cells; (2) of the 15 cAMP resistant clonal cell lines examined, only one (H/sub 4/M/sub 18/) was found to be devoid of cAMP-dependent protein kinase activity. In another cell line (H/sub 4/M/sub 10/) the activity was 30% of that of the parental H-4 cells; (3) there was an increase (130-300%) in cAMP-dependent protein kinase activity in 13/15 of the mutant cell lines over that of the parental H-4 cells. Analysis of cAMP-phosphodiesterase demonstrated significant increases (150-370%) in the enzyme activity in extracts of the mutants over that of the H-4 parental line. Their results suggest that while a deficiency in cAMP-dependent protein kinase may confer resistance to the hepatoma cells against the cytostatic effects of 8-bromo-cAMP and cholera toxin, other events such as overexpression of phosphodiesterase may contribute to this phenotype.

  19. Genetically-encoded tools for cAMP probing and modulation in living systems

    PubMed Central

    Paramonov, Valeriy M.; Mamaeva, Veronika; Sahlgren, Cecilia; Rivero-Müller, Adolfo

    2015-01-01

    Intracellular 3′-5′-cyclic adenosine monophosphate (cAMP) is one of the principal second messengers downstream of a manifold of signal transduction pathways, including the ones triggered by G protein-coupled receptors. Not surprisingly, biochemical assays for cAMP have been instrumental for basic research and drug discovery for decades, providing insights into cellular physiology and guiding pharmaceutical industry. However, despite impressive track record, the majority of conventional biochemical tools for cAMP probing share the same fundamental shortcoming—all the measurements require sample disruption for cAMP liberation. This common bottleneck, together with inherently low spatial resolution of measurements (as cAMP is typically analyzed in lysates of thousands of cells), underpin the ensuing limitations of the conventional cAMP assays: (1) genuine kinetic measurements of cAMP levels over time in a single given sample are unfeasible; (2) inability to obtain precise information on cAMP spatial distribution and transfer at subcellular levels, let alone the attempts to pinpoint dynamic interactions of cAMP and its effectors. At the same time, tremendous progress in synthetic biology over the recent years culminated in drastic refinement of our toolbox, allowing us not only to bypass the limitations of conventional assays, but to put intracellular cAMP life-span under tight control—something, that seemed scarcely attainable before. In this review article we discuss the main classes of modern genetically-encoded tools tailored for cAMP probing and modulation in living systems. We examine the capabilities and weaknesses of these different tools in the context of their operational characteristics and applicability to various experimental set-ups involving living cells, providing the guidance for rational selection of the best tools for particular needs. PMID:26441653

  20. cAMP Signaling Prevents Podocyte Apoptosis via Activation of Protein Kinase A and Mitochondrial Fusion

    PubMed Central

    Xie, Kewei; Ni, Zhaohui; Yan, Yucheng; Wei, Kai; Chuang, Peter Y.; He, John Cijiang; Gu, Leyi

    2014-01-01

    Our previous in vitro studies suggested that cyclic AMP (cAMP) signaling prevents adriamycin (ADR) and puromycin aminonucleoside (PAN)-induced apoptosis in podocytes. As cAMP is an important second messenger and plays a key role in cell proliferation, differentiation and cytoskeleton formation via protein kinase A (PKA) or exchange protein directly activated by cAMP (Epac) pathways, we sought to determine the role of PKA or Epac signaling in cAMP-mediated protection of podocytes. In the ADR nephrosis model, we found that forskolin, a selective activator of adenylate cyclase, attenuated albuminuria and improved the expression of podocyte marker WT-1. When podocytes were treated with pCPT-cAMP (a selective cAMP/PKA activator), PKA activation was increased in a time-dependent manner and prevented PAN-induced podocyte loss and caspase 3 activation, as well as a reduction in mitochondrial membrane potential. We found that PAN and ADR resulted in a decrease in Mfn1 expression and mitochondrial fission in podocytes. pCPT-cAMP restored Mfn1 expression in puromycin or ADR-treated podocytes and induced Drp1 phosphorylation, as well as mitochondrial fusion. Treating podocytes with arachidonic acid resulted in mitochondrial fission, podocyte loss and cleaved caspase 3 production. Arachidonic acid abolished the protective effects of pCPT-cAMP on PAN-treated podocytes. Mdivi, a mitochondrial division inhibitor, prevented PAN-induced cleaved caspase 3 production in podocytes. We conclude that activation of cAMP alleviated murine podocyte caused by ADR. PKA signaling resulted in mitochondrial fusion in podocytes, which at least partially mediated the effects of cAMP. PMID:24642777

  1. Dose and Chemical Modification Considerations for Continuous Cyclic AMP Analog Delivery to the Injured CNS

    PubMed Central

    Fouad, Karim; Ghosh, Mousumi; Vavrek, Romana; Tse, Arthur D.

    2009-01-01

    Abstract In this investigation, two cell-permeable synthetic analogs of cAMP, dibutyryl-cAMP (db-cAMP) and 8-bromo-cAMP, which are widely used to elevate intracellular cAMP levels under experimental conditions, were investigated for their ability to dose-dependently improve histological and functional outcomes following continuous delivery in two models of incomplete spinal cord injury (SCI). The cAMP analogs were delivered via osmotic minipumps at 1–250 mM through an indwelling cortical cannula or by intrathecal infusion for up to 4 weeks after either a T8 unilateral over-hemisection or a C2-3 dorsolateral quadrant lesion, respectively. In both SCI models, continuous db-cAMP delivery was associated with histopathological changes that included sporadic micro-hemorrhage formation and cavitation, enhanced macrophage infiltration and tissue damage at regions beyond the immediate application site; no deleterious or beneficial effect of agent delivery was observed at the spinal injury site. Furthermore, these changes were accompanied by pronounced behavioral deficits that included an absence of progressive locomotor recovery, increased extensor tone, paralysis, and sensory abnormalities. These deleterious effects were not observed in saline-treated animals, in animals in which the db-cAMP dose did not exceed 1 mM, or in those animals that received a high dose (250 mM) of the alternative cAMP analog, 8-bromo-cAMP. These results demonstrate that, for continuous intraparenchymal or intrathecal administration of cAMP analogs for the study of biological or therapeutic effects within the central nervous system (CNS), consideration of the effective concentration applied as well as the potential toxicity of chemical moieties on the parent molecule and/or their activity needs to be taken into account. PMID:19397425

  2. Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle

    PubMed Central

    Bernal-Ulloa, Sandra Milena; Heinzmann, Julia; Herrmann, Doris; Hadeler, Klaus-Gerd; Aldag, Patrick; Winkler, Sylke; Pache, Dorit; Baulain, Ulrich; Lucas-Hahn, Andrea; Niemann, Heiner

    2016-01-01

    High cAMP levels during in vitro maturation (IVM) have been related to improved blastocyst yields. Here, we employed the cAMP/cGMP modulators, forskolin, IBMX, and cilostamide, during IVM to unravel the role of high cAMP in early embryonic development produced from prepubertal and adult bovine oocytes. Oocytes were collected via transvaginal aspiration and randomly assigned to three experimental groups: TCM24 (24h IVM/control), cAMP30 (2h pre-IVM (forskolin-IBMX), 30h IVM-cilostamide), and DMSO30 (Dimethyl Sulfoxide/vehicle control). After IVM, oocytes were fertilized in vitro and zygotes were cultured in vitro to blastocysts. Meiotic progression, cAMP levels, mRNA abundance of selected genes and DNA methylation were evaluated in oocytes. Blastocysts were used for gene expression or DNA methylation analyses. Blastocysts from the cAMP30 groups were transferred to recipients. The cAMP elevation delayed meiotic progression, but developmental rates were not increased. In immature oocytes, mRNA abundance of PRKACA was higher for cAMP30 protocol and no differences were found for PDE3A, SMAD2, ZAR1, PRDX1 and SLC2A8. EGR1 gene was up-regulated in prepubertal cAMP30 immature oocytes and down-regulated in blastocysts from all in vitro treatments. A similar gene expression profile was observed for DNMT3b, BCL2L1, PRDX1 and SLC2A8 in blastocysts. Satellite DNA methylation profiles were different between prepubertal and adult oocytes and blastocysts derived from the TCM24 and DMSO30 groups. Blastocysts obtained from prepubertal and adult oocytes in the cAMP30 treatment displayed normal methylation profiles and produced offspring. These data indicate that cAMP regulates IVM in prepubertal and adult oocytes in a similar manner, with impact on the establishment of epigenetic marks and acquisition of full developmental competency. PMID:26926596

  3. Neurodegeneration with brain iron accumulation (NBIA)

    MedlinePlus

    ... gov/ency/article/001225.htm Neurodegeneration with brain iron accumulation (NBIA) To use the sharing features on this page, please enable JavaScript. Neurodegeneration with brain iron accumulation (formerly known as Hallervorden-Spatz disease) is ...

  4. Polynomial solutions of the Monge-Ampère equation

    NASA Astrophysics Data System (ADS)

    Aminov, Yu A.

    2014-11-01

    The question of the existence of polynomial solutions to the Monge-Ampère equation zxxzyy-zxy^2=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  5. Polynomial solutions of the Monge-Ampère equation

    SciTech Connect

    Aminov, Yu A

    2014-11-30

    The question of the existence of polynomial solutions to the Monge-Ampère equation z{sub xx}z{sub yy}−z{sub xy}{sup 2}=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  6. Amp: A modular approach to machine learning in atomistic simulations

    NASA Astrophysics Data System (ADS)

    Khorshidi, Alireza; Peterson, Andrew A.

    2016-10-01

    Electronic structure calculations, such as those employing Kohn-Sham density functional theory or ab initio wavefunction theories, have allowed for atomistic-level understandings of a wide variety of phenomena and properties of matter at small scales. However, the computational cost of electronic structure methods drastically increases with length and time scales, which makes these methods difficult for long time-scale molecular dynamics simulations or large-sized systems. Machine-learning techniques can provide accurate potentials that can match the quality of electronic structure calculations, provided sufficient training data. These potentials can then be used to rapidly simulate large and long time-scale phenomena at similar quality to the parent electronic structure approach. Machine-learning potentials usually take a bias-free mathematical form and can be readily developed for a wide variety of systems. Electronic structure calculations have favorable properties-namely that they are noiseless and targeted training data can be produced on-demand-that make them particularly well-suited for machine learning. This paper discusses our modular approach to atomistic machine learning through the development of the open-source Atomistic Machine-learning Package (Amp), which allows for representations of both the total and atom-centered potential energy surface, in both periodic and non-periodic systems. Potentials developed through the atom-centered approach are simultaneously applicable for systems with various sizes. Interpolation can be enhanced by introducing custom descriptors of the local environment. We demonstrate this in the current work for Gaussian-type, bispectrum, and Zernike-type descriptors. Amp has an intuitive and modular structure with an interface through the python scripting language yet has parallelizable fortran components for demanding tasks; it is designed to integrate closely with the widely used Atomic Simulation Environment (ASE), which

  7. AMP-deaminase from thymus of patients with myasthenia gravis.

    PubMed

    Rybakowska, I; Szydłowska, M; Szrok, S; Bakuła, S; Kaletha, K

    2015-01-01

    Myasthenia gravis (MG) is characterized clinically by skeletal muscle fatigue following the excessive exercise. Interestingly most of MG patients manifest parallely also some abnormalities of the thymus.AMP-deaminase (AMPD) from human thymus was not a subject of studies up to now. In this paper, mRNA expression and some physico-chemical and immunological properties of AMPD purified from the thymus of MG patients were described. Experiments performed identified the liver isozyme (AMPD2) as the main isoform of AMPD expressed in this organ. The activity of AMPD found in this organ was higher than in other human non-(skeletal) muscle tissues indicating on role the enzyme may play in supplying of guanylates required for the intensive multiplication of thymocytes.

  8. Heterogeneity of Calcium Channel/cAMP-Dependent Transcriptional Activation.

    PubMed

    Kobrinsky, Evgeny

    2015-01-01

    The major function of the voltage-gated calcium channels is to provide the Ca(2+) flux into the cell. L-type voltage-gated calcium channels (Cav1) serve as voltage sensors that couple membrane depolarization to many intracellular processes. Electrical activity in excitable cells affects gene expression through signaling pathways involved in the excitation-transcription (E-T) coupling. E-T coupling starts with activation of the Cav1 channel and results in initiation of the cAMP-response element binding protein (CREB)-dependent transcription. In this review we discuss the new quantitative approaches to measuring E-T signaling events. We describe the use of wavelet transform to detect heterogeneity of transcriptional activation in nuclei. Furthermore, we discuss the properties of discovered microdomains of nuclear signaling associated with the E-T coupling and the basis of the frequency-dependent transcriptional regulation.

  9. AMP-activated protein kinase and metabolic control

    PubMed Central

    Viollet, Benoit; Andreelli, Fabrizio

    2011-01-01

    AMP-activated protein kinase (AMPK), a phylogenetically conserved serine/threonine protein kinase, is a major regulator of cellular and whole-body energy homeostasis that coordinates metabolic pathways in order to balance nutrient supply with energy demand. It is now recognized that pharmacological activation of AMPK improves blood glucose homeostasis, lipid profile and blood pressure in insulin-resistant rodents. Indeed, AMPK activation mimics the beneficial effects of physical activity or those of calorie restriction by acting on multiple cellular targets. In addition it is now demonstrated that AMPK is one of the probable (albeit indirect) targets of major antidiabetic drugs including, the biguanides (metformin) and thiazolidinediones, as well as of insulin sensitizing adipokines (e.g., adiponectin). Taken together, such findings highlight the logic underlying the concept of targeting the AMPK pathway for the treatment of metabolic syndrome and type 2 diabetes. PMID:21484577

  10. Uric acid-dependent inhibition of AMP kinase induces hepatic glucose production in diabetes and starvation: evolutionary implications of the uricase loss in hominids.

    PubMed

    Cicerchi, Christina; Li, Nanxing; Kratzer, James; Garcia, Gabriela; Roncal-Jimenez, Carlos A; Tanabe, Katsuyuki; Hunter, Brandi; Rivard, Christopher J; Sautin, Yuri Y; Gaucher, Eric A; Johnson, Richard J; Lanaspa, Miguel A

    2014-08-01

    Reduced AMP kinase (AMPK) activity has been shown to play a key deleterious role in increased hepatic gluconeogenesis in diabetes, but the mechanism whereby this occurs remains unclear. In this article, we document that another AMP-dependent enzyme, AMP deaminase (AMPD) is activated in the liver of diabetic mice, which parallels with a significant reduction in AMPK activity and a significant increase in intracellular glucose accumulation in human HepG2 cells. AMPD activation is induced by a reduction in intracellular phosphate levels, which is characteristic of insulin resistance and diabetic states. Increased gluconeogenesis is mediated by reduced TORC2 phosphorylation at Ser171 by AMPK in these cells, as well as by the up-regulation of the rate-limiting enzymes PEPCK and G6Pc. The mechanism whereby AMPD controls AMPK activation depends on the production of a specific AMP downstream metabolite through AMPD, uric acid. In this regard, humans have higher uric acid levels than most mammals due to a mutation in uricase, the enzyme involved in uric acid degradation in most mammals, that developed during a period of famine in Europe 1.5 × 10(7) yr ago. Here, working with resurrected ancestral uricases obtained from early hominids, we show that their expression on HepG2 cells is enough to blunt gluconeogenesis in parallel with an up-regulation of AMPK activity. These studies identify a key role AMPD and uric acid in mediating hepatic gluconeogenesis in the diabetic state, via a mechanism involving AMPK down-regulation and overexpression of PEPCK and G6Pc. The uricase mutation in the Miocene likely provided a survival advantage to help maintain glucose levels under conditions of near starvation, but today likely has a role in the pathogenesis of diabetes.

  11. Pharmacological implications of the Ca2+/cAMP signaling interaction: from risk for antihypertensive therapy to potential beneficial for neurological and psychiatric disorders

    PubMed Central

    Caricati-Neto, Afonso; García, Antonio G; Bergantin, Leandro Bueno

    2015-01-01

    In this review, we discussed pharmacological implications of the Ca2+/cAMP signaling interaction in the antihypertensive and neurological/psychiatric disorders therapies. Since 1975, several clinical studies have reported that acute and chronic administration of L-type voltage-activated Ca2+ channels (VACCs) blockers, such as nifedipine, produces reduction in peripheral vascular resistance and arterial pressure associated with an increase in plasma noradrenaline levels and heart rate, typical of sympathetic hyperactivity. Despite this sympathetic hyperactivity has been initially attributed to adjust reflex of arterial pressure, the cellular and molecular mechanisms involved in this apparent sympathomimetic effect of the L-type VACCs blockers remained unclear for decades. In addition, experimental studies using isolated tissues richly innervated by sympathetic nerves (to exclude the influence of adjusting reflex) showed that neurogenic responses were completely inhibited by L-type VACCs blockers in concentrations above 1 μmol/L, but paradoxically potentiated in concentrations below 1 μmol/L. During almost four decades, these enigmatic phenomena remained unclear. In 2013, we discovered that this paradoxical increase in sympathetic activity produced by L-type VACCs blocker is due to interaction of the Ca2+/cAMP signaling pathways. Then, the pharmacological manipulation of the Ca2+/cAMP interaction produced by combination of the L-type VACCs blockers used in the antihypertensive therapy, and cAMP accumulating compounds used in the antidepressive therapy, could represent a potential cardiovascular risk for hypertensive patients due to increase in sympathetic hyperactivity. In contrast, this pharmacological manipulation could be a new therapeutic strategy for increasing neurotransmission in psychiatric disorders, and producing neuroprotection in the neurodegenerative diseases. PMID:26516591

  12. Adenylyl cyclase is required for cAMP production, growth, conidial germination, and virulence in the citrus green mold pathogen Penicillium digitatum.

    PubMed

    Wang, Weili; Wang, Mingshuang; Wang, Jiye; Zhu, Congyi; Chung, Kuang-Ren; Li, Hongye

    2016-11-01

    Penicillium digitatum is the causative agent of green mold decay on citrus fruit. The cAMP-mediated signaling pathway plays an important role in the transduction of extracellular signals and has been shown to regulate a wide range of developmental processes and pathogenicity in fungal pathogens. We cloned and characterized a Pdac1 gene of P. digitatum, which encodes a polypeptide similar to fungal adenylyl cyclases. Using a loss-of-function mutation in the Pdac1 gene we demonstrated a critical requirement for hyphal growth and conidial germination. Deletion of Pdac1 resulted in decreased accumulation of cAMP and down-regulation of genes encoding a G protein α subunit, both catalytic and regulatory subunits of PKA, and two transcriptional regulators StuA and Som1. Fungal mutants lacking Pdac1 produced abundant conidia, which failed to germinate effectively and displayed an elevated sensitivity to heat treatment. Pdac1 mutant failed to utilize carbohydrates effectively and thus displayed severe growth retardation on rich and synthetic media. Slow growth seen in the Pdac1 mutants could be due to a defect in nutrient sensing and acquisition. Quantitative RT-PCR analysis revealed that Pdac1 was primarily expressed at the early stage of infection. Fungal pathogenicity assayed on citrus fruit revealed that P. digitatum strains impaired for Pdac1 delayed lesion formation. Our results highlight important regulatory roles of adenylyl cyclase-mediated cAMP production in P. digitatum and provide insights into the critical role of cAMP in fungal growth, development and virulence.

  13. Ontogeny of catecholamine and adenosine receptor-mediated cAMP signaling of embryonic red blood cells: role of cGMP-inhibited phosphodiesterase 3 and hemoglobin.

    PubMed

    Baumann, R; Blass, C; Götz, R; Dragon, S

    1999-12-15

    We have previously shown that the cAMP signaling pathway controls major aspects of embryonic red blood cell (RBC) function in avian embryos (Glombitza et al, Am J Physiol 271:R973, 1996; and Dragon et al, Am J Physiol 271:R982, 1996) that are important for adaptation of the RBC gas transport properties to the progressive hypercapnia and hypoxia of later stages of avian embryonic development. Data about the ontogeny of receptor-mediated cAMP signaling are lacking. We have analyzed the response of primitive and definitive chick embryo RBC harvested from day 3 to 18 of development towards forskolin, beta-adrenergic, and A2 receptor agonists. The results show a strong response of immature definitive and primitive RBC to adenosine A2 and beta-adrenergic receptor agonists, which is drastically reduced in the last stage of development, coincident with the appearance of mature, transcriptionally inactive RBC. Modulation of cGMP-inhibited phosphodiesterase 3 (PDE3) has a controlling influence on cAMP accumulation in definitive RBC. Under physiological conditions, PDE3 is inhibited due to activation of soluble guanylyl cyclase (sGC). Inhibition of sGC with the specific inhibitor ODQ decreases receptor-mediated stimulation of cAMP production; this effect is reversed by the PDE3 inhibitor milrinone. sGC is acitivated by nitric oxide (NO), but we found no evidence for production of NO by erythrocyte NO-synthase. However, embryonic hemoglobin releases NO in an oxygen-linked manner that may activate guanylyl cyclase.

  14. Adenylyl cyclase is required for cAMP production, growth, conidial germination, and virulence in the citrus green mold pathogen Penicillium digitatum.

    PubMed

    Wang, Weili; Wang, Mingshuang; Wang, Jiye; Zhu, Congyi; Chung, Kuang-Ren; Li, Hongye

    2016-11-01

    Penicillium digitatum is the causative agent of green mold decay on citrus fruit. The cAMP-mediated signaling pathway plays an important role in the transduction of extracellular signals and has been shown to regulate a wide range of developmental processes and pathogenicity in fungal pathogens. We cloned and characterized a Pdac1 gene of P. digitatum, which encodes a polypeptide similar to fungal adenylyl cyclases. Using a loss-of-function mutation in the Pdac1 gene we demonstrated a critical requirement for hyphal growth and conidial germination. Deletion of Pdac1 resulted in decreased accumulation of cAMP and down-regulation of genes encoding a G protein α subunit, both catalytic and regulatory subunits of PKA, and two transcriptional regulators StuA and Som1. Fungal mutants lacking Pdac1 produced abundant conidia, which failed to germinate effectively and displayed an elevated sensitivity to heat treatment. Pdac1 mutant failed to utilize carbohydrates effectively and thus displayed severe growth retardation on rich and synthetic media. Slow growth seen in the Pdac1 mutants could be due to a defect in nutrient sensing and acquisition. Quantitative RT-PCR analysis revealed that Pdac1 was primarily expressed at the early stage of infection. Fungal pathogenicity assayed on citrus fruit revealed that P. digitatum strains impaired for Pdac1 delayed lesion formation. Our results highlight important regulatory roles of adenylyl cyclase-mediated cAMP production in P. digitatum and provide insights into the critical role of cAMP in fungal growth, development and virulence. PMID:27664719

  15. Ectoine accumulation in Brevibacterium epidermis.

    PubMed

    Onraedt, Annelies; De Muynck, Cassandra; Walcarius, Bart; Soetaert, Wim; Vandamme, Erick

    2004-10-01

    As a halotolerant bacterial species, Brevibacterium epidermis DSM 20659 can grow at relatively high salinity, tolerating up to 2 M NaCl. It synthesizes ectoine and the intracellular content increases with the medium salinity, with a maximum of 0.14 g ectoine/g CDW at 1 M NaCl. Sugar-stressed cells do not synthesize ectoine. Ectoine synthesis is also affected by the presence of external osmolytes. Added betaine is taken up and completely replaced ectoine, while L-proline is only temporarily accumulated after which ectoine is synthesized. The strain can metabolize ectoine; L-glutamate is a better carbon source for ectoine synthesis than L-aspartate.

  16. Asymptotic behavior on a kind of parabolic Monge-Ampère equation

    NASA Astrophysics Data System (ADS)

    Wang, Bo; Bao, Jiguang

    2015-07-01

    In this paper, we apply level set and nonlinear perturbation methods to obtain the asymptotic behavior of the solution to a kind of parabolic Monge-Ampère equation at infinity. The Jörgens-Calabi-Pogorelov theorem for parabolic and elliptic Monge-Ampère equation can be regarded as special cases of our result.

  17. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    PubMed Central

    Warrington, Nicole M.; Sun, Tao; Rubin, Joshua B.

    2015-01-01

    A relationship between cyclic adenosine 3′, 5′-monophosphate (cAMP) levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY) have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor) risk in individuals with Neurofibromatosis type 1 (NF1). Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well-known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex. PMID:26283963

  18. A possible signal-coupling role for cyclic AMP during endocytosis in Amoeba proteus.

    PubMed

    Prusch, R D; Roscoe, J C

    1993-01-01

    Cytoplasmic levels of cAMP in Amoeba proteus were measured utilizing radioimmunoassays under control conditions and when stimulated by inducers of either pinocytosis or phagocytosis. In control cells, cytoplasmic cAMP levels were approximately 0.39 pM/mg cells. When exposed to either chemotactic peptide or mannose which stimulate phagocytosis in the amoeba, there is a rapid doubling of the cAMP level within 45 sec of stimulation which then returns to the control level within 3-5 min. Theophylline prolongs the elevation of cytoplasmic cAMP in stimulated cells and is also capable of eliciting food vacuole formation in the amoeba. In addition isoproterenol also causes food vacuole formation in the amoeba as well as a large and prolonged increase in cytoplasmic cAMP levels. Inducers of pinocytosis (BSA and Na Cl) also elicit changes in cytoplasmic cAMP in the amoeba, but the response appears to differ from that elicited by inducers of phagocytosis in that the peak cAMP levels are broader and biphasic. It is concluded that cAMP plays a signal-coupling role during the early phases of both forms of endocytosis in Amoeba proteus.

  19. BaAMPs: the database of biofilm-active antimicrobial peptides.

    PubMed

    Di Luca, Mariagrazia; Maccari, Giuseppe; Maisetta, Giuseppantonio; Batoni, Giovanna

    2015-01-01

    Antimicrobial peptides (AMPs) are increasingly being considered as novel agents against biofilms. The development of AMP-based anti-biofilm strategies strongly relies on the design of sequences optimized to target specific features of sessile bacterial/fungal communities. Although several AMP databases have been created and successfully exploited for AMP design, all of these use data collected on peptides tested against planktonic microorganisms. Here, an open-access, manually curated database of AMPs specifically assayed against microbial biofilms (BaAMPs) is presented for the first time. In collecting relevant data from the literature an effort was made to define a minimal standard set of essential information including, for each AMP, the microbial species and biofilm conditions against which it was tested, and the specific assay and peptide concentration used. The availability of these data in an organized framework will benefit anti-biofilm research and support the design of novel molecules active against biofilm. BaAMPs is accessible at http://www.baamps.it. PMID:25760404

  20. A Temporal-Specific and Transient cAMP Increase Characterizes Odorant Classical Conditioning

    ERIC Educational Resources Information Center

    Cui, Wen; Smith, Andrew; Darby-King, Andrea; Harley, Carolyn W.; McLean, John H.

    2007-01-01

    Increases in cyclic adenosine monophosphate (cAMP) are proposed to initiate learning in a wide variety of species. Here, we measure changes in cAMP in the olfactory bulb prior to, during, and following a classically conditioned odor preference trial in rat pups. Measurements were taken up to the point of maximal CREB phosphorylation in olfactory…

  1. Phosphorylation and inhibition of. gamma. -glutamyl transferase activity by cAMP-dependent protein kinase

    SciTech Connect

    Kolesnichenko, L.S.; Chernov, N.N.

    1986-10-20

    It was shown that preparations of bovine kidney ..gamma..-glutamyl transferase of differing degrees of purity are phosphorylated by cAMP-dependent protein kinase. This is accompanied by a decrease in both the transferase and hydrolase activities of the enzyme. Consequently, ..gamma..-glutamyl transferase may serve as the substrate and target of the regulation of cAMP-dependent protein kinase.

  2. A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

    PubMed Central

    Abdou, Houssein S.; Bergeron, Francis

    2014-01-01

    Steroid hormones regulate essential physiological processes, and inadequate levels are associated with various pathological conditions. In testosterone-producing Leydig cells, steroidogenesis is strongly stimulated by luteinizing hormone (LH) via its receptor leading to increased cyclic AMP (cAMP) production and expression of the steroidogenic acute regulatory (STAR) protein, which is essential for the initiation of steroidogenesis. Steroidogenesis then passively decreases with the degradation of cAMP into AMP by phosphodiesterases. In this study, we show that AMP-activated protein kinase (AMPK) is activated following cAMP-to-AMP breakdown in MA-10 and MLTC-1 Leydig cells. Activated AMPK then actively inhibits cAMP-induced steroidogenesis by repressing the expression of key regulators of steroidogenesis, including Star and Nr4a1. Similar results were obtained in Y-1 adrenal cells and in the constitutively steroidogenic R2C cells. We have also determined that maximum AMPK activation following stimulation of steroidogenesis in MA-10 Leydig cells occurs when steroid hormone production has reached a plateau. Our data identify AMPK as a molecular rheostat that actively represses steroid hormone biosynthesis to preserve cellular energy homeostasis and prevent excess steroid production. PMID:25225331

  3. Changes in the cyclic AMP content during growth and development of Acetabularia.

    PubMed

    Minder, C; Vanden Driessche, T

    1978-05-26

    The 3',5'-adenosine monophosphate (cyclic-AMP) content of the unicellular alga Acetabularia has been examined at various developmental stages. It has been found that very young algae, less than 10mm in length, have a high cAMP content [more than 7 pmoles per 100 mg wet weight (WW)], but that with the growth of the algae, the cAMP content decreases rapidly, reaching the low level of 0.5--1.0 pmoles per 100mg WW. The cAMP content remains at this level until cap differentiation, after which an increase in cAMP content accompanies cap enlargement. It has been shown that these results are unlikely to be affected by changes in the cAMP content induced by variations in circadian rhythm. Treatment with theophylline (2.10(-3) M), a phosphodieterase inhibitor, results in an increase in the cAMP content and delays growth and cap formation. Experiments on the effects of theophylline upon the circadian rhythm of oxygen evolution have shown that the continuous presence of theophylline in the culture medium does not induce a phase shift in the rhythm. The cAMP content of anucleate Acetabularia shows development stage variations parallel to that of the whole algae.

  4. Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent.

    PubMed

    Stella, Nicholas A; Shanks, Robert M Q

    2014-05-01

    The cyclic-nucleotide 3',5'-cyclic AMP (cAMP) is an ancient and widespread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-cyclic-AMP receptor protein regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein, similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP.

  5. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    SciTech Connect

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer cAMP blocks cell death induced by TNF and actinomycin D in cultured hepatocytes. Black-Right-Pointing-Pointer cAMP blocks NF-{kappa}B activation induced by TNF and actinomycin D. Black-Right-Pointing-Pointer cAMP blocks DISC formation following TNF and actinomycin D exposure. Black-Right-Pointing-Pointer cAMP blocks TNF signaling at a proximal step. -- Abstract: Tumor necrosis factor {alpha} (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found

  6. cAMP inducibility of transcriptional repressor ICER in developing and mature human T lymphocytes.

    PubMed

    Bodor, J; Spetz, A L; Strominger, J L; Habener, J F

    1996-04-16

    Stimulation of the cAMP-dependent signaling pathway exerts an inhibitory effect on the proliferation and effector functions of T cells. The ability of T cells to form high intracellular levels of cAMP is acquired during development in the human thymus and is retained by the majority of mature peripheral T lymphocytes. Here we show that elevated cAMP levels in T cells correlate with the expression of the potent transcriptional repressor ICER (inducible cAMP early repressor) previously described in the hypothalamic-pituitary-gonadal axis. Further, in transcriptional assays in vivo, ICER inhibits calcineurin-mediated expression of the interleukin 2 promoter as well as Tax-mediated transactivation of the human T-lymphotropic virus type I (HTLV-I) promoter. Thus, the induction of ICER in T cells may play an important role in the cAMP-induced quiescence and the persistent latency of HTLV-I.

  7. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  8. Caffeine promotes autophagy in skeletal muscle cells by increasing the calcium-dependent activation of AMP-activated protein kinase.

    PubMed

    Mathew, T S; Ferris, R K; Downs, R M; Kinsey, S T; Baumgarner, B L

    2014-10-24

    Caffeine has been shown to promote calcium-dependent activation of AMP-activated protein kinase (AMPK) and AMPK-dependent glucose and fatty acid uptake in mammalian skeletal muscle. Though caffeine has been shown to promote autophagy in various mammalian cell lines it is unclear if caffeine-induced autophagy is related to the calcium-dependent activation of AMPK. The purpose of this study was to examine the role of calcium-dependent AMPK activation in regulating caffeine-induced autophagy in mammalian skeletal muscle cells. We discovered that the addition of the AMPK inhibitor Compound C could significantly reduce the expression of the autophagy marker microtubule-associated protein 1 light chain 3b-II (LC3b-II) and autophagic vesicle accumulation in caffeine treated skeletal muscle cells. Additional experiments using pharmacological inhibitors and RNA interference (RNAi) demonstrated that the calcium/calmodulin-activated protein kinases CaMKKβ and CaMKII contributed to the AMPK-dependent expression of LC3b-II and autophagic vesicle accumulation in a caffeine dose-dependent manner. Our results indicate that in skeletal muscle cells caffeine increases autophagy by promoting the calcium-dependent activation of AMPK.

  9. Rheum palmatum L. Attenuates High Fat Diet-Induced Hepatosteatosis by Activating AMP-Activated Protein Kinase.

    PubMed

    Yang, Mingxing; Li, Xiumin; Zeng, Xin; Ou, Zhimin; Xue, Mei; Gao, Dehong; Liu, Suhuan; Li, Xuejun; Yang, Shuyu

    2016-01-01

    Nonalcoholic fatty liver disease (NAFLD) is a common metabolic disorder characterized by the accumulation of excess fat in the liver. Rheum palmatumL. (RP) decoctions have been reported to ameliorate NAFLD. The aim of the present study was to investigate the effects and underlying mechanisms of RP in fatty liver disease induced by a high-fat diet (HFD) in rats. Low and high doses of aqueous RP extraction were orally administered to HFD-fed rats for six weeks. Body weight, tissue weight, glucose tolerance, insulin tolerance, hepatic morphology, and liver triglyceride (TG) content were assessed. The effects of RP on the expressions of lipogenic and lipolysis genes were measured by quantitative real-time PCR. The phosphorylation of AMP-activated protein kinase (AMPK) and acetyl-CoA carboxylase (ACC) was determined by Western blotting. Treatment with low-dose RP significantly reduced liver weight, liver TG content, and improved glucose tolerance in HFD-fed rats. Consistently, RP attenuated excess fat accumulation and downregulated the expression of lipogenic genes in the liver. Further, an increased phosphorylation of AMPK and ACC was observed. These findings suggest that low-dose RP alleviates hepatosteatosis, at least in part, by stimulating AMPK activity.

  10. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells.

    PubMed

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin.

  11. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells.

    PubMed

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin. PMID:27348124

  12. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells

    PubMed Central

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin. PMID:27348124

  13. The Pseudomonas aeruginosa Chp Chemosensory System Regulates Intracellular cAMP Levels by Modulating Adenylate Cyclase Activity

    PubMed Central

    Fulcher, Nanette B.; Holliday, Phillip M.; Klem, Erich; Cann, Martin J.; Wolfgang, Matthew C.

    2010-01-01

    Summary Multiple virulence systems in the opportunistic pathogen Pseudomonas aeruginosa are regulated by the second messenger signaling molecule adenosine 3’, 5’-cyclic monophosphate (cAMP). Production of cAMP by the putative adenylate cyclase enzyme CyaB represents a critical control point for virulence gene regulation. To identify regulators of CyaB, we screened a transposon insertion library for mutants with reduced intracellular cAMP. The majority of insertions resulting in reduced cAMP mapped to the Chp gene cluster encoding a putative chemotaxis-like chemosensory system. Further genetic analysis of the Chp system revealed that it has both positive and negative effects on intracellular cAMP and that it regulates cAMP levels by modulating CyaB activity. The Chp system was previously implicated in the production and function of type IV pili (TFP). Given that cAMP and the cAMP-dependent transcriptional regulator Vfr control TFP biogenesis gene expression, we explored the relationship between cAMP, the Chp system and TFP regulation. We discovered that the Chp system controls TFP production through modulation of cAMP while control of TFP-dependent twitching motility is cAMP-independent. Overall, our data define a novel function for a chemotaxis-like system in controlling cAMP production and establish a regulatory link between the Chp system, TFP and other cAMP-dependent virulence systems. PMID:20345659

  14. Guidelines for Waste Accumulation Areas (WAAs)

    SciTech Connect

    Not Available

    1991-07-01

    The purpose of this document is to set conditions for establishing and maintaining areas for the accumulation of hazardous waste at LBL. Areas designed for accumulation of these wastes in quantities greater than 100 kg (220 lb) per month of solid waste or 55 gallons per month of liquid waste are called Waste Accumulation Areas (WAAs). Areas designed for accumulation of wastes in smaller amounts are called Satellite Accumulation Areas (SAAs). This document provides guidelines for employee and organizational responsibilities for WAAs; constructing a WAA; storing waste in a WAA; operating and maintaining a WAA, and responding to spills in a WAA. 4 figs.

  15. Different effect of prostaglandin E2 on B-cell activation by two distinct B-cell differentiation factors, B151-TRF1/IL-5 and B151-TRF2: selective inhibition of B151-TRF2-induced antibody response through increases in intracellular cyclic AMP levels

    PubMed Central

    Ishihara, K.; Ono, S.; Takahama, Y.; Hirayama, F.; Hirano, H.; Itoh, K.; Dobashi, K.; Murakami, S.; Katoh, Y.; Yamaguchi, M.; Hamaoka, T.

    1989-01-01

    Effects of prostaglandin E2 (PGE2) on murine B-cell activation induced by two distinct B-cell differentiation factors, B151-TRF1/IL-5 and B151-TRF2, were examined. A final differentiation of unprimed B cells into IgM-producing cells induced by B151-TRF2 was markedly inhibited by PGE2 at physiological concentrations (around 10-8 M), whereas B151-TRF1/IL-5-induced antibody responses of unprimed as well as activated B cells were not affected by PGE2, even at 10-6 M. B-cell responses induced by B151-TRF2-like factors from autoimmune-prone MRL/1pr mice were also inhibited by PGE2. Biphasic increases in intracellular cyclic AMP (cAMP) levels were induced by culturing B cells with 10-6 or 10-8 M PGE2: rapid increases within 8 min and delayed increases around 16 hr. The direct addition of dibutyryl cAMP to cultures of B cells resulted in marked inhibition of antibody responses when stimulated with B151-TRF2 but not with B151-TRF1/IL-5. The B151-TRF2-induced antibody responses were also inhibited by cAMP-elevating reagents such as forskolin, cholera toxin and theophyline. Furthermore, 2′, 5′-dideoxyadenosine, which is an inhibitor of adenylate cyclase, prevented the PGE2-mediated cAMP accumulation in unprimed B cells as well as the PGE2-mediated inhibition of B151-TRF2-induced B-cell responses when added at the initiation of culture. These results suggest that PGE2 inhibits B151-TRF2-induced antibody responses through the activation of adenylate cyclase and subsequent accumulation of intracellular cAMP, whereas B151-TRF1/IL-5-responsive B cells are resistant to the inhibitory effect of PGE2 and cAMP. PMID:2553585

  16. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex.

    PubMed

    Guérin, François; Isnard, Christophe; Cattoir, Vincent; Giard, Jean Christophe

    2015-12-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-D-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  17. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex

    PubMed Central

    Guérin, François; Isnard, Christophe; Giard, Jean Christophe

    2015-01-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-d-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  18. Dibutyryl cAMP effects on thromboxane and leukotriene production in decompression-induced lung injury

    NASA Technical Reports Server (NTRS)

    Little, T. M.; Butler, B. D.

    1997-01-01

    Decompression-induced venous bubble formation has been linked to increased neutrophil counts, endothelial cell injury, release of vasoactive eicosanoids, and increased vascular membrane permeability. These actions may account for inflammatory responses and edema formation. Increasing the intracellular cAMP has been shown to decrease eicosanoid production and edema formation in various models of lung injury. Reduction of decompression-induced inflammatory responses was evaluated in decompressed rats pretreated with saline (controls) or dibutyryl cAMP (DBcAMP, an analog of cAMP). After pretreatment, rats were exposed to either 616 kPa for 120 min or 683 kPa for 60 min. The observed increases in extravascular lung water ratios (pulmonary edema), bronchoalveolar lavage, and pleural protein in the saline control group (683 kPa) were not evident with DBcAMP treatment. DBcAMP pretreatment effects were also seen with the white blood cell counts and the percent of neutrophils in the bronchoalveolar lavage. Urinary levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were significantly increased with the 683 kPa saline control decompression exposure. DBcAMP reduced the decompression-induced leukotriene E4 production in the urine. Plasma levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were increased with the 683-kPa exposure groups. DBcAMP treatment did not affect these changes. The 11-dehydrothromboxane B2 and leukotriene E4 levels in the bronchoalveolar lavage were increased with the 683 kPa exposure and were reduced with the DBcAMP treatment. Our results indicate that DBcAMP has the capability to reduce eicosanoid production and limit membrane permeability and subsequent edema formation in rats experiencing decompression sickness.

  19. cAMP-binding proteins in medullary tubules from rat kidney: effect of ADH

    SciTech Connect

    Gapstur, S.M.; Homma, S.; Dousa, T.P.

    1988-08-01

    Little is known of the regulatory steps in the cellular action of vasopressin (AVP) on the renal epithelium, subsequent to the cAMP generation. We studied cAMP-binding proteins in the medullary collecting tubule (MCT) and the thick ascending limb of Henle's loop (MTAL) microdissected from the rat kidney by use of photoaffinity labeling. Microdissected tubules were homogenized and photoaffinity labeled by incubation with 1 microM 32P-labeled 8-azido-adenosine 3',5'-cyclic monophosphate (N3-8-(32P)-cAMP); the incorporated 32P was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Both in MCT and MTAL preparations, the analyses showed incorporation of N3-8-(32P)cAMP into two bands (Mr = 49,000 and Mr = 55,000) that comigrated with standards of the cAMP-dependent protein kinase regulatory subunits RI and RII. In MCT, most of the 32P (80%) was incorporated into RI, whereas in MTAL the 32P incorporated into RI and RII was equivalent. When freshly dissected MCT segments were incubated with 10(-12)-10(-6) M AVP, the subsequent photoaffinity labeling of RI with N3-8-(32P)cAMP was markedly diminished in a dose-dependent manner compared with controls. Our results suggest that cAMP binds in MCT and MTAL to regulatory subunits RI and RII of cAMP-dependent protein kinase. However, in MCT the dominant type of cAMP-dependent protein kinase appears to be type I. The outlined procedure is suitable to indirectly measure the occupancy of RI by endogenous cAMP generated in MCT cells in response to physiological levels (10(-12) M) of AVP.

  20. Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site.

    PubMed

    Adams, Julian; Chen, Zhi-Ping; Van Denderen, Bryce J W; Morton, Craig J; Parker, Michael W; Witters, Lee A; Stapleton, David; Kemp, Bruce E

    2004-01-01

    AMP-activated protein kinase (AMPK) is a alphabetagamma heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the alpha subunit and by AMP allosteric control previously thought to be mediated by both alpha and gamma subunits. Here we present evidence that adjacent gamma subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the gamma(1) CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast gamma homolog, snf4 contains a His151Gly substitution, and when this is introduced into gamma(1), AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in gamma(1) corresponds to the site of mutation in human gamma(2) and pig gamma(3) genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the alpha and gamma subunits and that AMP functions to derepress AMPK activity.

  1. cAMP mediators of pulsatile insulin secretion from glucose-stimulated single beta-cells.

    PubMed

    Idevall-Hagren, Olof; Barg, Sebastian; Gylfe, Erik; Tengholm, Anders

    2010-07-23

    Pulsatile insulin release from glucose-stimulated beta-cells is driven by oscillations of the Ca(2+) and cAMP concentrations in the subplasma membrane space ([Ca(2+)](pm) and [cAMP](pm)). To clarify mechanisms by which cAMP regulates insulin secretion, we performed parallel evanescent wave fluorescence imaging of [cAMP](pm), [Ca(2+)](pm), and phosphatidylinositol 3,4,5-trisphosphate (PIP(3)) in the plasma membrane. This lipid is formed by autocrine insulin receptor activation and was used to monitor insulin release kinetics from single MIN6 beta-cells. Elevation of the glucose concentration from 3 to 11 mm induced, after a 2.7-min delay, coordinated oscillations of [Ca(2+)](pm), [cAMP](pm), and PIP(3). Inhibitors of protein kinase A (PKA) markedly diminished the PIP(3) response when applied before glucose stimulation, but did not affect already manifested PIP(3) oscillations. The reduced PIP(3) response could be attributed to accelerated depolarization causing early rise of [Ca(2+)](pm) that preceded the elevation of [cAMP](pm). However, the amplitude of the PIP(3) response after PKA inhibition was restored by a specific agonist to the cAMP-dependent guanine nucleotide exchange factor Epac. Suppression of cAMP formation with adenylyl cyclase inhibitors reduced already established PIP(3) oscillations in glucose-stimulated cells, and this effect was almost completely counteracted by the Epac agonist. In cells treated with small interfering RNA targeting Epac2, the amplitudes of the glucose-induced PIP(3) oscillations were reduced, and the Epac agonist was without effect. The data indicate that temporal coordination of the triggering [Ca(2+)](pm) and amplifying [cAMP](pm) signals is important for glucose-induced pulsatile insulin release. Although both PKA and Epac2 partake in initiating insulin secretion, the cAMP dependence of established pulsatility is mediated by Epac2.

  2. DBcAMP stimulates vesicle transport and HRP excretion in isolated perfused rat liver.

    PubMed

    Hayakawa, T; Bruck, R; Ng, O C; Boyer, J L

    1990-11-01

    To clarify the effect of adenosine 3',5'-cyclic monophosphate (cAMP) on the transcytotic vesicle pathway, we measured the biliary excretion of bile acid, phospholipid, and horseradish peroxidase (HRP) in the isolated perfused rat liver (IPRL) with or without infusion of N6,2'-O-dibutyryl-cAMP (DBcAMP). A linear relationship between bile flow and bile acid excretion was observed in both control and DBcAMP-infused livers. DBcAMP increased the y-axis intercept from 1.10 +/- 0.16 to 1.48 +/- 0.19 microliters.min-1.g liver-1 (P less than 0.01) and the slope from 6.5 +/- 1.99 to 10.77 +/- 1.71 microliters/mumol bile acid (P less than 0.01). DBcAMP also increased the biliary excretion of bile acid and phospholipid during a 1.0 mumol/min infusion of taurocholate. When HRP was pulse loaded for 1 min, HRP appeared in bile in early (4-6 min) and late (20-25 min) peaks. DBcAMP markedly increased the late peak of HRP from 0.33 +/- 0.08 to 1.15 +/- 0.32 ng.min-1.g liver-1 (P less than 0.01), a phenomenon blocked by colchicine. An electron-microscopic morphometric analysis indicated that DBcAMP increased both the density and %area of HRP-containing vesicles in the pericanalicular area, compared with controls, 18 min after a 1-min pulse of HRP. DBcAMP had no effect on the uptake rate of HRP in 4-h primary hepatocyte cultures but stimulated biliary excretion of HRP when preloaded in the IPRL. These findings indicate that cAMP regulates excretory function in part by stimulating the microtubule-dependent transcytotic vesicle transport system.

  3. Nutrient-contaminant (Pu) plant accumulation model

    SciTech Connect

    Cowan, C.E.; Jenne, E.A.; Simpson, J.C.; Cataldo, D.A.

    1981-12-01

    A model was developed which simulates the movement and daily accumulation of nutrients and contaminants in crop plants resulting from known physiological processes in the plant. In the model, the daily contaminant accumulation is governed by daily increase in plant biomass derived from photosynthesis and by the specified thermodynamic activity of the bioavailable contaminant species in soil or hydroponic solutin. Total accumulation and resulting concentration in the plant's root, stem and branch, leaf, and reproductive compartments can be simulated any time during the growing season. Parameters were estimated from data on plutonium accumulation in soybeans and the model was calibrated against this same data set. The plutonium distribution in the plant was found to be most sensitive to parameters related to leaf accumulation. Contamination at different times during the growing season resulted in a large change in predicted leaf accumulation but very little change in predicted accumulation in other plant parts except when contamination occurred very late in the growing season.

  4. AMP-activated Protein Kinase Suppresses Biosynthesis of Glucosylceramide by Reducing Intracellular Sugar Nucleotides*

    PubMed Central

    Ishibashi, Yohei; Hirabayashi, Yoshio

    2015-01-01

    The membrane glycolipid glucosylceramide (GlcCer) plays a critical role in cellular homeostasis. Its intracellular levels are thought to be tightly regulated. How cells regulate GlcCer levels remains to be clarified. AMP-activated protein kinase (AMPK), which is a crucial cellular energy sensor, regulates glucose and lipid metabolism to maintain energy homeostasis. Here, we investigated whether AMPK affects GlcCer metabolism. AMPK activators (5-aminoimidazole-4-carboxamide 1-β-d-ribofuranoside and metformin) decreased intracellular GlcCer levels and synthase activity in mouse fibroblasts. AMPK inhibitors or AMPK siRNA reversed these effects, suggesting that GlcCer synthesis is negatively regulated by an AMPK-dependent mechanism. Although AMPK did not affect the phosphorylation or expression of GlcCer synthase, the amount of UDP-glucose, an activated form of glucose required for GlcCer synthesis, decreased under AMPK-activating conditions. Importantly, the UDP-glucose pyrophosphatase Nudt14, which degrades UDP-glucose, generating UMP and glucose 1-phosphate, was phosphorylated and activated by AMPK. On the other hand, suppression of Nudt14 by siRNA had little effect on UDP-glucose levels, indicating that mammalian cells have an alternative UDP-glucose pyrophosphatase that mainly contributes to the reduction of UDP-glucose under AMPK-activating conditions. Because AMPK activators are capable of reducing GlcCer levels in cells from Gaucher disease patients, our findings suggest that reducing GlcCer through AMPK activation may lead to a new strategy for treating diseases caused by abnormal accumulation of GlcCer. PMID:26048992

  5. Beta-endorphin 1-31 biotransformation and cAMP modulation in inflammation.

    PubMed

    Asvadi, Naghmeh Hajarol; Morgan, Michael; Herath, Herath M; Hewavitharana, Amitha K; Shaw, P Nicholas; Cabot, Peter J

    2014-01-01

    A large body of evidence now exists for the immune cell expression, production, and the release of beta-endorphin (BE 1-31) within inflamed tissue. The inflammatory milieu is characterised by increased acidity, temperature and metabolic activity. Within these harsh conditions BE 1-31 is even more susceptible to increased enzymatic degradation over that of plasma or other non-injured tissue. To elucidate the biotransformation pathways of BE 1-31 and provide an insight to the impact of inflamed tissue environments, BE 1-31 and three of its major N-terminal fragments (BE 1-11, BE 1-13 and BE 1-17) were incubated in inflamed tissue homogenates at pH 5.5 for 2 hrs. In addition, the potency of BE 1-31 and five main N--terminal fragments (BE 1-9, BE 1-11, BE 1-13, BE 1-17, BE 1-20) was assessed at mu-opioid receptors (MOR), delta-opioid receptors (DOR), and kappa-opioid receptors (KOR). Opioid receptor potency was investigated by examining the modulation of forskolin induced cAMP accumulation. The majority of the N-terminal fragment of BE 1-31 had similar efficacy to BE 1-31 at MOR. The shortest of the major N-terminal fragments (BE 1-9), had partial agonist activity at MOR but possessed the highest potency of all tested peptides at DOR. There was limited effect for BE 1-31 and the biotransformed peptides at KOR. Major N-terminal fragments produced within inflamed tissue have increased presence within inflamed tissue over that of the parent molecule BE 1-31 and may therefore contribute to BE 1-31 efficacy within disease states that involve inflammation. PMID:24618600

  6. The PAMP c-di-AMP Is Essential for Listeria monocytogenes Growth in Rich but Not Minimal Media due to a Toxic Increase in (p)ppGpp. [corrected].

    PubMed

    Whiteley, Aaron T; Pollock, Alex J; Portnoy, Daniel A

    2015-06-10

    Cyclic di-adenosine monophosphate (c-di-AMP) is a widely distributed second messenger that appears to be essential in multiple bacterial species, including the Gram-positive facultative intracellular pathogen Listeria monocytogenes. In this study, the only L. monocytogenes diadenylate cyclase gene, dacA, was deleted using a Cre-lox system activated during infection of cultured macrophages. All ΔdacA strains recovered from infected cells harbored one or more suppressor mutations that allowed growth in the absence of c-di-AMP. Suppressor mutations in the synthase domain of the bi-functional (p)ppGpp synthase/hydrolase led to reduced (p)ppGpp levels. A genetic assay confirmed that dacA was essential in wild-type but not strains lacking all three (p)ppGpp synthases. Further genetic analysis suggested that c-di-AMP was essential because accumulated (p)ppGpp altered GTP concentrations, thereby inactivating the pleiotropic transcriptional regulator CodY. We propose that c-di-AMP is conditionally essential for metabolic changes that occur in growth in rich medium and host cells but not minimal medium.

  7. Sequential biases in accumulating evidence

    PubMed Central

    Huggins, Richard; Dogo, Samson Henry

    2015-01-01

    Whilst it is common in clinical trials to use the results of tests at one phase to decide whether to continue to the next phase and to subsequently design the next phase, we show that this can lead to biased results in evidence synthesis. Two new kinds of bias associated with accumulating evidence, termed ‘sequential decision bias’ and ‘sequential design bias’, are identified. Both kinds of bias are the result of making decisions on the usefulness of a new study, or its design, based on the previous studies. Sequential decision bias is determined by the correlation between the value of the current estimated effect and the probability of conducting an additional study. Sequential design bias arises from using the estimated value instead of the clinically relevant value of an effect in sample size calculations. We considered both the fixed‐effect and the random‐effects models of meta‐analysis and demonstrated analytically and by simulations that in both settings the problems due to sequential biases are apparent. According to our simulations, the sequential biases increase with increased heterogeneity. Minimisation of sequential biases arises as a new and important research area necessary for successful evidence‐based approaches to the development of science. © 2015 The Authors. Research Synthesis Methods Published by John Wiley & Sons Ltd. PMID:26626562

  8. Natural radionuclide accumulation by raindrops

    NASA Astrophysics Data System (ADS)

    Gusev, Anatoly; Martin, Inacio; Shkevov, Rumen; Alves, Mauro

    2016-07-01

    The laboratory of environmental radiation of ITA (São José dos Campos, 23°11'11″S, 45°52'43″W, 650 MAMSL) performs simultaneous monitoring of a natural radiation background and meteorological parameters. A time resolution of up to 1 minute allows a detailed comparison of changes in meteorological parameters with those of a concentration of ambient radon progenies in the atmosphere. Results of a study of variation of a fallout of radon progenies ^{214}Pb and ^{214}Bi concomitanting rainfalls are present. The radionuclide fallout rate is reconstructed from the observed gamma rate through a simulation of the first kind Volterra integral equation with difference kernel, determined by ratio of precipitating rates of 214Pb and 214Bi and their decay half times. An original straightforward step-by-step procedure was used for the numerical solution of the equation. The radionuclide concentration in the rainwater is calculated as a ratio of the reconstructed fallout to the measured rainfall. It was observed that the radionuclide fallout rate increases as the rainfall one in approximately power 0.6, i.e. the same as the mean raindrop volume. The concentration thereafter decreases as the rainfall rate in power 0.4. A numerical simulation of the process of accumulation of the radionuclides during diffusion and coalescence drop growth and aerosol scavenging during a passage from a cloud to the ground was performed. The results of the simulations agree with the experimental data.

  9. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  10. Cyclic AMP Signaling through Epac Axis Modulates Human Hemogenic Endothelium and Enhances Hematopoietic Cell Generation.

    PubMed

    Saxena, Shobhit; Rönn, Roger E; Guibentif, Carolina; Moraghebi, Roksana; Woods, Niels-Bjarne

    2016-05-10

    Hematopoietic cells emerge from hemogenic endothelium in the developing embryo. Mechanisms behind human hematopoietic stem and progenitor cell development remain unclear. Using a human pluripotent stem cell differentiation model, we report that cyclic AMP (cAMP) induction dramatically increases HSC-like cell frequencies. We show that hematopoietic cell generation requires cAMP signaling through the Exchange proteins activated by cAMP (cAMP-Epac) axis; Epac signaling inhibition decreased both hemogenic and non-hemogenic endothelium, and abrogated hematopoietic cell generation. Furthermore, in hematopoietic progenitor and stem-like cells, cAMP induction mitigated oxidative stress, created a redox-state balance, and enhanced C-X-C chemokine receptor type 4 (CXCR4) expression, benefiting the maintenance of these primitive cells. Collectively, our study provides insights and mechanistic details on the previously unrecognized role of cAMP signaling in regulating human hematopoietic development. These findings advance the mechanistic understanding of hematopoietic development toward the development of transplantable human hematopoietic cells for therapeutic needs. PMID:27117782

  11. The role of the RAS pathway in iAMP21-ALL.

    PubMed

    Ryan, S L; Matheson, E; Grossmann, V; Sinclair, P; Bashton, M; Schwab, C; Towers, W; Partington, M; Elliott, A; Minto, L; Richardson, S; Rahman, T; Keavney, B; Skinner, R; Bown, N; Haferlach, T; Vandenberghe, P; Haferlach, C; Santibanez-Koref, M; Moorman, A V; Kohlmann, A; Irving, J A E; Harrison, C J

    2016-09-01

    Intrachromosomal amplification of chromosome 21 (iAMP21) identifies a high-risk subtype of acute lymphoblastic leukaemia (ALL), requiring intensive treatment to reduce their relapse risk. Improved understanding of the genomic landscape of iAMP21-ALL will ascertain whether these patients may benefit from targeted therapy. We performed whole-exome sequencing of eight iAMP21-ALL samples. The mutation rate was dramatically disparate between cases (average 24.9, range 5-51) and a large number of novel variants were identified, including frequent mutation of the RAS/MEK/ERK pathway. Targeted sequencing of a larger cohort revealed that 60% (25/42) of diagnostic iAMP21-ALL samples harboured 42 distinct RAS pathway mutations. High sequencing coverage demonstrated heterogeneity in the form of multiple RAS pathway mutations within the same sample and diverse variant allele frequencies (VAFs) (2-52%), similar to other subtypes of ALL. Constitutive RAS pathway activation was observed in iAMP21 samples that harboured mutations in the predominant clone (⩾35% VAF). Viable iAMP21 cells from primary xenografts showed reduced viability in response to the MEK1/2 inhibitor, selumetinib, in vitro. As clonal (⩾35% VAF) mutations were detected in 26% (11/42) of iAMP21-ALL, this evidence of response to RAS pathway inhibitors may offer the possibility to introduce targeted therapy to improve therapeutic efficacy in these high-risk patients.

  12. The role of the RAS pathway in iAMP21-ALL

    PubMed Central

    Ryan, Sarra L.; Matheson, Elizabeth; Grossmann, Vera; Sinclair, Paul; Bashton, Matthew; Schwab, Claire; Towers, Will; Partington, Matthew; Elliott, Alannah; Minto, Lynne; Richardson, Stacey; Rahman, Thahira; Keavney, Bernard; Skinner, Roderick; Bown, Nick; Haferlach, Torsten; Vandenberghe, Peter; Haferlach, Claudia; Santibanez-Koref, Mauro; Moorman, Anthony V.; Kohlmann, Alexander; Irving, Julie A. E.; Harrison, Christine J.

    2016-01-01

    Intrachromosomal amplification of chromosome 21 (iAMP21) identifies a high-risk subtype of acute lymphoblastic leukaemia (ALL), requiring intensive treatment to reduce their relapse risk. Improved understanding of the genomic landscape of iAMP21-ALL will ascertain whether these patients may benefit from targeted therapy. We performed whole-exome sequencing of eight iAMP21-ALL samples. The mutation rate was dramatically disparate between cases (average 24.9, range 5-51) and a large number of novel variants were identified, including frequent mutation of the RAS/MEK/ERK pathway. Targeted sequencing of a larger cohort revealed that 60% (25/42) of diagnostic iAMP21-ALL samples harboured 42 distinct RAS pathway mutations. High sequencing coverage demonstrated heterogeneity in the form of multiple RAS pathway mutations within the same sample and diverse variant allele frequencies (VAF) (2-52%), similar to other subtypes of ALL. Constitutive RAS pathway activation was observed in iAMP21 samples that harboured mutations in the predominant clone (≥35% VAF). Viable iAMP21 cells from primary xenografts showed reduced viability in response to the MEK1/2 inhibitor, selumetinib, in vitro. As clonal (≥35% VAF) mutations were detected in 26% (11/42) of iAMP21-ALL, this evidence of response to RAS pathway inhibitors may offer the possibility to introduce targeted therapy to improve therapeutic efficacy in these high-risk patients. PMID:27168466

  13. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.

    PubMed

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-11-18

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  14. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  15. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  16. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  17. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  18. Central role of soluble adenylyl cyclase and cAMP in sperm physiology

    PubMed Central

    Buffone, Mariano G.; Wertheimer, Eva V.; Visconti, Pablo E.; Krapf, Dario

    2014-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP), the first second messenger to be described, plays a central role in cell signaling in a wide variety of cell types. Over the last decades, a wide body of literature addressed the different roles of cAMP in cell physiology, mainly in response to neurotransmitters and hormones. cAMP is synthesized by a wide variety of adenylyl cylases that can generally be grouped in two types: transmembrane adenylyl cyclase and soluble adenylyl cyclases. In particular, several aspects of sperm physiology are regulated by cAMP produced by a single atypical adenylyl cyclase (Adcy10, aka sAC, SACY). The signature that identifies sAC among other ACs, is their direct stimulation by bicarbonate. The essential nature of cAMP in sperm function has been demonstrated using gain of function as well as loss of function approaches. This review unifies state of the art knowledge of the role of cAMP and those enzymes involved in cAMP signaling pathways required for the acquisition of fertilizing capacity of mammalian sperm. PMID:25066614

  19. From drought sensing to developmental control: evolution of cyclic AMP signaling in social amoebas.

    PubMed

    Ritchie, Allyson V; van Es, Saskia; Fouquet, Celine; Schaap, Pauline

    2008-10-01

    Amoebas and other protists commonly encyst when faced with environmental stress. Although little is known of the signaling pathways that mediate encystation, the analogous process of spore formation in dictyostelid social amoebas is better understood. In Dictyostelium discoideum, secreted cyclic AMP (cAMP) mediates the aggregation of starving amoebas and induces the differentiation of prespore cells. Intracellular cAMP acting on cAMP-dependent protein kinase (PKA) triggers the maturation of spores and prevents their germination under the prevalent conditions of high osmolality in the spore head. The osmolyte-activated adenylate cyclase, ACG, produces cAMP for prespore differentiation and inhibition of spore germination. To retrace the origin of ACG function, we investigated ACG gene conservation and function in species that span the dictyostelid phylogeny. ACG genes, osmolyte-activated ACG activity, and osmoregulation of spore germination were detected in species that represent the 4 major groups of Dictyostelia. Unlike the derived species D. discoideum, many basal Dictyostelia have retained the ancestral mechanism of encystation from solitary amoebas. In these species and in solitary amoebas, encystation is independently triggered by starvation or by high osmolality. Osmolyte-induced encystation was accompanied by an increase in cAMP and prevented by inhibition of PKA, indicating that ACG and PKA activation mediate this response. We propose that high osmolality signals drought in soil amoebas and that developmental cAMP signaling in the Dictyostelia has evolved from this stress response.

  20. The mechanisms of action of cAMP. A quantum chemical study.

    PubMed

    van Ool, P J; Buck, H M

    1982-01-01

    Quantum chemical calculations were performed on the formation of intermediates with trigonal bipyramidal (TBP) configurations in the hydrolysis of adenosine 3',5'-monophosphate (cAMP) with phosphodiesterases and the activation of protein kinases by cAMP. The results show that in the reaction sequence concerning the hydrolysis of cAMP with phosphodiesterase the TBP intermediate must possess an equatorial-apical cyclic phosphate ring with the 3'-oxygen atom in the apical position. This could be an additional reason for the sensitivity of the 3' position in cAMP towards modifications in comparison with the 5' position. According to the calculations, a mechanistic model is presented for the enzymatic hydrolysis of cAMP with the involvement of a covalently bonded enzyme-nucleotide intermediate. Also a model is offered for the activation of protein kinase by cAMP. The activation of protein kinase is assumed to proceed via diequatorial-ring-positioned TBP intermediates resulting in the formation of a covalent bond between cAMP and the protein kinase with retention of the cyclic phosphate ring. It seems likely that the enzyme-nucleotide intermediate enforces a conformational change in the enzyme, which causes the dissociation of the regulatory and catalytic subunit of the protein kinase, necessary for a physiological response.

  1. Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent

    PubMed Central

    Stella, Nicholas A.; Shanks, Robert M. Q.

    2014-01-01

    The cyclic-nucleotide 3’,5’-cyclic AMP (cAMP) is an ancient and wide spread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-CRP regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP. PMID:24619531

  2. Role of coronary endothelium in cyclic AMP formation by the heart

    SciTech Connect

    Kroll, K.; Schrader, J.

    1986-03-01

    In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 ..mu..M), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine.

  3. Perivascular fat, AMP-activated protein kinase and vascular diseases

    PubMed Central

    Almabrouk, T A M; Ewart, M A; Salt, I P; Kennedy, S

    2014-01-01

    Perivascular adipose tissue (PVAT) is an active endocrine and paracrine organ that modulates vascular function, with implications for the pathophysiology of cardiovascular disease (CVD). Adipocytes and stromal cells contained within PVAT produce mediators (adipokines, cytokines, reactive oxygen species and gaseous compounds) with a range of paracrine effects modulating vascular smooth muscle cell contraction, proliferation and migration. However, the modulatory effect of PVAT on the vascular system in diseases, such as obesity, hypertension and atherosclerosis, remains poorly characterized. AMP-activated protein kinase (AMPK) regulates adipocyte metabolism, adipose biology and vascular function, and hence may be a potential therapeutic target for metabolic disorders such as type 2 diabetes mellitus (T2DM) and the vascular complications associated with obesity and T2DM. The role of AMPK in PVAT or the actions of PVAT have yet to be established, however. Activation of AMPK by pharmacological agents, such as metformin and thiazolidinediones, may modulate the activity of PVAT surrounding blood vessels and thereby contribute to their beneficial effect in cardiometabolic diseases. This review will provide a current perspective on how PVAT may influence vascular function via AMPK. We will also attempt to demonstrate how modulating AMPK activity using pharmacological agents could be exploited therapeutically to treat cardiometabolic diseases. PMID:24490856

  4. Activating AMP-activated protein kinase (AMPK) slows renal cystogenesis.

    PubMed

    Takiar, Vinita; Nishio, Saori; Seo-Mayer, Patricia; King, J Darwin; Li, Hui; Zhang, Li; Karihaloo, Anil; Hallows, Kenneth R; Somlo, Stefan; Caplan, Michael J

    2011-02-01

    Renal cyst development and expansion in autosomal dominant polycystic kidney disease (ADPKD) involves both fluid secretion and abnormal proliferation of cyst-lining epithelial cells. The chloride channel of the cystic fibrosis transmembrane conductance regulator (CFTR) participates in secretion of cyst fluid, and the mammalian target of rapamycin (mTOR) pathway may drive proliferation of cyst epithelial cells. CFTR and mTOR are both negatively regulated by AMP-activated protein kinase (AMPK). Metformin, a drug in wide clinical use, is a pharmacological activator of AMPK. We find that metformin stimulates AMPK, resulting in inhibition of both CFTR and the mTOR pathways. Metformin induces significant arrest of cystic growth in both in vitro and ex vivo models of renal cystogenesis. In addition, metformin administration produces a significant decrease in the cystic index in two mouse models of ADPKD. Our results suggest a possible role for AMPK activation in slowing renal cystogenesis as well as the potential for therapeutic application of metformin in the context of ADPKD. PMID:21262823

  5. Modulation of a human lymphoblastoid B cell line by cyclic AMP. Ig secretion and phosphatidylcholine metabolism

    SciTech Connect

    Shearer, W.T.; Patke, C.L.; Gilliam, E.B.; Rosenblatt, H.M.; Barron, K.S.; Orson, F.M.

    1988-09-01

    A transformed human B cell line, LA350, was found to be sensitive to cAMP-elevating agents by responding with rapid (0 to 2 h) severalfold elevations of intracellular cAMP to treatment with cholera toxin, isobutylmethylxanthine (IBMX), forskolin, and dibutyryl cAMP (all p less than 0.001). These cAMP-elevating agents also produced significant inhibitions of subsequent (48 to 72 h) Ig secretion by the same B cells as measured by a reverse hemolytic plaque assay and an enzyme-linked immunoadsorbent assay for IgM (both p less than 0.001). PMA- and IBMX-treated cells were particularly responsive to the effects of cholera toxin, showing a doubling of cAMP content and profound decrease in Ig production (p less than 0.001). Because our previous studies had correlated activation of the metabolic turnover of the phosphatidylcholine (PC) fraction of membrane phospholipids with enhanced Ig secretion, we examined the sensitivity of PC metabolism to cAMP in control and PMA-stimulated cells. Formation of PC was found to be inhibited by forskolin and IBMX (both p less than 0.002) but breakdown of PC was stimulated (p less than 0.001). These findings imply that as the enzymatic products of PC, choline phosphate and diacylglycerol, are depleted due to the combined effects of cAMP upon synthesis and turnover of PC, there is a decrease in Ig secretion. Since diacylglycerol activates protein kinase C, it appears reasonable that Ig secretion is at least partially regulated by cAMP-responsive alterations in PC metabolism produced by protein kinase C-induced phosphorylation. We conclude that the early cAMP-sensitive changes in PC metabolism in this activated B cell line may signal for subsequent alterations in Ig secretion.

  6. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade

    PubMed Central

    Astakhova, Luba A.; Samoiliuk, Evgeniia V.; Govardovskii, Victor I.

    2012-01-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide–gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca2+ exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca2+]in. Analysis by a complete model of rod phototransduction suggests that an increase of [Ca2+]in might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca2+]in and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  7. Modulation of dihydropyridine-sensitive calcium channels in Drosophila by a cAMP-mediated pathway.

    PubMed

    Bhattacharya, A; Gu, G G; Singh, S

    1999-06-15

    Drosophila has proved to be a valuable system for studying the structure and function of ion channels. However, relatively little is known about the regulation of ion channels, particularly that of Ca2+ channels, in Drosophila. Physiological and pharmacological differences between invertebrate and mammalian L-type Ca2+ channels raise questions on the extent of conservation of Ca2+ channel modulatory pathways. We have examined the role of cyclic adenosine monophosphate (cAMP) cascade in modulating the dihydropyridine (DHP)-sensitive Ca2+ channels in the larval muscles of Drosophila, using mutations and drugs that disrupt specific steps in this pathway. The L-type (DHP-sensitive) Ca2+ channel current was increased in the dunce mutants, which have high cAMP concentration owing to cAMP-specific phosphodiesterase (PDE) disruption. The current was decreased in the rutabaga mutants, where adenylyl cyclase (AC) activity is altered thereby decreasing the cAMP concentration. The dunce effect was mimicked by 8-Br-cAMP, a cAMP analog, and IBMX, a PDE inhibitor. The rutabaga effect was rescued by forskolin, an AC activator. H-89, an inhibitor of protein kinase-A (PKA), reduced the current and inhibited the effect of 8-Br-cAMP. The data suggest modulation of L-type Ca2+ channels of Drosophila via a cAMP-PKA mediated pathway. While there are differences in L-type channels, as well as in components of cAMP cascade, between Drosophila and vertebrates, main features of the modulatory pathway have been conserved. The data also raise questions on the likely role of DHP-sensitive Ca2+ channel modulation in synaptic plasticity, and learning and memory, processes disrupted by the dnc and the rut mutations. PMID:10380071

  8. Influence of cAMP and protein kinase A on neurite length from spiral ganglion neurons

    PubMed Central

    Xu, Ningyong; Engbers, Jonathan; Khaja, Sobia; Xu, Linjing; Clark, J. Jason; Hansen, Marlan R.

    2011-01-01

    Regrowth of peripheral spiral ganglion neuron (SGN) fibers is a primary objective in efforts to improve cochlear implant outcomes and to potentially reinnervate regenerated hair cells. Cyclic adenosine monophosphate (cAMP) regulates neurite growth and guidance via activation of protein kinase A (PKA) and Exchange Protein directly Activated by Cylic AMP (Epac). Here we explored the effects of cAMP signaling on SGN neurite length in vitro. We find that the cAMP analog, cpt-cAMP, exerts a biphasic effect on neurite length; increasing length at lower concentrations and reducing length at higher concentrations. This biphasic response occurs in cultures plated on laminin, fibronectin, or tenascin C suggesting that it is not substrate dependent. cpt-cAMP also reduces SGN neurite branching. The Epac-specific agonist, 8-pCPT-2’-O-Me-cAMP, does not alter SGN neurite length. Constitutively active PKA isoforms strongly inhibit SGN neurite length similar to higher levels of cAMP. Chronic membrane depolarization activates PKA in SGNs and also inhibits SGN neurite length. However, inhibition of PKA fails to rescue neurite length in depolarized cultures implying that activation of PKA is not necessary for the inhibition of SGN neurite length by chronic depolarization. Expression of constitutively active phosphatidylinositol 3-kinase, but not c-Jun N-terminal kinase, isoforms partially rescues SGN neurite length in the presence of activated PKA. Taken together, these results suggest that activation of cAMP/PKA represents a potential strategy to enhance SGN fiber elongation following deafness; however such therapies will likely require careful titration so as to simultaneously promote rather than inhibit nerve fiber regeneration. PMID:22154930

  9. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  10. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade.

    PubMed

    Astakhova, Luba A; Samoiliuk, Evgeniia V; Govardovskii, Victor I; Firsov, Michael L

    2012-10-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide-gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca(2+) exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca(2+)](in). Analysis by a complete model of rod phototransduction suggests that an increase of [Ca(2+)](in) might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca(2+)](in) and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  11. Association of the cyclic AMP chemotaxis receptor with the detergent- insoluble cytoskeleton of Dictyostelium discoideum

    PubMed Central

    1984-01-01

    Treatment of 6-h differentiated Dictyostelium discoideum cells with the nonionic detergent Triton X-100 dissolves away membranes and soluble components, as judged by marker enzyme distributions, leaving intact a cytoskeletal residue that contains approximately 10% of the cell protein and 50% of the actin. Nitrobenzooxadiazo-phallacidin staining for F-actin and electron microscopy of detergent-extracted whole-mounts indicate that the cytoskeletons retain the size and shape of intact cells and contain F-actin in cortical meshworks. The cytoskeletons contain little if any remaining membrane material by morphological criteria, and the plasma membrane enzymes cyclic nucleotide phosphodiesterase and alkaline phosphatase are absent from the insoluble residue, which retains only 15% of the membrane concanavalin A-binding glycoproteins. This detergent-insoluble residue retains a specific [3H]cAMP-binding site with the nucleotide specificity, rapid kinetics and approximate affinity of the cAMP receptor on intact cells. Upon detergent extraction of cells, the number of cAMP-binding sites increases 20-70%. The binding site is attached to the insoluble residue whether or not the cAMP receptor is occupied at the time of detergent addition. The pH dependence for recovery of the insoluble cAMP-binding site is much sharper than that on intact cells or membranes with an optimum at pH 6.1. Conditions of pH and ionic composition that lead to disruption of the cytoskeleton upon detergent treatment also result in the loss of cAMP binding. During differentiation, the detergent- insoluble cAMP binding increases in parallel with cell surface cAMP receptors and chemotaxis to cAMP. PMID:6693497

  12. Role of cyclic AMP in pulmonary xenobiotic metabolism with special emphasis on benzo(a)pyrene

    SciTech Connect

    Schaeffer, V.H.

    1986-01-01

    This thesis was intended to investigate the role of the intracellular regulator, cAMP, on pulmonary xenobiotic metabolism using the well-studied carcinogen, benzo(a)pyrene (BP) as a representative xenobiotic. Lung slices from rats administered N/sup 6/, O/sup 2/', dibutyryl cAMP (DcAMP), theophylline or forskolin, all of which elevated biologically reactive cAMP levels in the lung, showed an increased ability to metabolize (/sup 3/H)-BP. This effect occurred beyond 6 hr following treatment and reached a maximum at 12 hr, at a time when cAMP content had already peaked and returned to basal levels. The perfusion of BP through the isolated lungs of animals administered DcAMP in vivo indicated that the BP metabolites primarily responsible for the cyclic nucleotide-induced increase in metabolism were the 3-hydroxy BP, 9-hydroxy BP, BP 9, 10 diol, BP-glucuronides and BP-glutathione conjugates. Kinetic analysis indicated that the Km component of these reactions was altered without a corresponding change in Vmax, suggesting that elevated pulmonary cAMP content may be affecting the detoxication enzymes, UDP-glucuronyltransferase and sulfotransferase. Studies with pulmonary microsomes from DcAMP-treated animals indicated that the cyclic nucleotide not only enhanced the hydroxylation of BP but also the cytochrome P450-dependent hydroxylation of coumarin. This is supported by the fact that DcAMP administration in vivo also enhanced phosphorylation of two classes of nuclear proteins, histones and nuclear acidic proteins, believed to play a role in the transcription of RNA and DNA.

  13. Role of phosphodiesterases in the shaping of sub-plasma-membrane cAMP oscillations and pulsatile insulin secretion.

    PubMed

    Tian, Geng; Sågetorp, Jenny; Xu, Yunjian; Shuai, Hongyan; Degerman, Eva; Tengholm, Anders

    2012-11-01

    Specificity and versatility in cyclic AMP (cAMP) signalling are governed by the spatial localisation and temporal dynamics of the signal. Phosphodiesterases (PDEs) are important for shaping cAMP signals by hydrolyzing the nucleotide. In pancreatic β-cells, glucose triggers sub-plasma-membrane cAMP oscillations, which are important for insulin secretion, but the mechanisms underlying the oscillations are poorly understood. Here, we investigated the role of different PDEs in the generation of cAMP oscillations by monitoring the concentration of cAMP in the sub-plasma-membrane space ([cAMP](pm)) with ratiometric evanescent wave microscopy in MIN6 cells or mouse pancreatic β-cells expressing a fluorescent translocation biosensor. The general PDE inhibitor IBMX increased [cAMP](pm), and whereas oscillations were frequently observed at 50 µM IBMX, 300 µM-1 mM of the inhibitor caused a stable increase in [cAMP](pm). The [cAMP](pm) was nevertheless markedly suppressed by the adenylyl cyclase inhibitor 2',5'-dideoxyadenosine, indicating IBMX-insensitive cAMP degradation. Among IBMX-sensitive PDEs, PDE3 was most important for maintaining a low basal level of [cAMP](pm) in unstimulated cells. After glucose induction of [cAMP](pm) oscillations, inhibitors of PDE1, PDE3 and PDE4 inhibitors the average cAMP level, often without disturbing the [cAMP](pm) rhythmicity. Knockdown of the IBMX-insensitive PDE8B by shRNA in MIN6 cells increased the basal level of [cAMP](pm) and prevented the [cAMP](pm)-lowering effect of 2',5'-dideoxyadenosine after exposure to IBMX. Moreover, PDE8B-knockdown cells showed reduced glucose-induced [cAMP](pm) oscillations and loss of the normal pulsatile pattern of insulin secretion. It is concluded that [cAMP](pm) oscillations in β-cells are caused by periodic variations in cAMP generation, and that several PDEs, including PDE1, PDE3 and the IBMX-insensitive PDE8B, are required for shaping the sub-membrane cAMP signals and pulsatile insulin release.

  14. Cyclic Adenosine Monophosphate Accumulation and beta-Adrenergic Binding in Unweighted and Denervated Rat Soleus Muscle

    NASA Technical Reports Server (NTRS)

    Kirby, Christopher R.; Woodman, Christopher R.; Woolridge, Dale; Tischler, Marc E.

    1992-01-01

    Unweighting, but not denervation, of muscle reportedly "spares" insulin receptors, increasing insulin sensitivity. Unweighting also increases beta-adrenergic responses of carbohydrate metabolism. These differential characteristics were studied further by comparing cyclic adenosine monophosphate (cAMP) accumulation and beta-adrenergic binding in normal and 3-day unweighted or denervated soleus muscle. Submaximal amounts of isoproterenol, a p-agonist, increased cAMP accumulation in vitro and in vivo (by intramuscular (IM) injection) to a greater degree (P less than .05) in unweighted muscles. Forskolin or maximal isoproterenol had similar in vitro effects in all muscles, suggesting increased beta-adrenergic sensitivity following unweighting. Increased sensitivity was confirmed by a greater receptor density (B(sub max)) for iodo-125(-)-pindolol in particulate preparations of unweighted (420 x 10(exp -18) mol/mg muscle) than of control or denervated muscles (285 x 10(exp-18) mol/mg muscle). The three dissociation constant (Kd) values were similar (20.3 to 25.8 pmol/L). Total binding capacity (11.4 fmol/muscle) did not change during 3 days of unweighting, but diminished by 30% with denervation. This result illustrates the "sparing" and loss of receptors, respectively, in these two atrophy models. In diabetic animals, IM injection of insulin diminished CAMP accumulation in the presence of theophylline in unweighted muscle (-66% +/- 2%) more than in controls (-42% +'- 6%, P less than .001). These results show that insulin affects CAMP formation in muscle, and support a greater in vivo insulin response following unweighting atrophy. These various data support a role for lysosomal proteolysis in denervation, but not in unweighting, atrophy.

  15. Snf1 Is a Regulator of Lipid Accumulation in Yarrowia lipolytica

    PubMed Central

    Seip, John; Jackson, Raymond; He, Hongxian; Zhu, Quinn

    2013-01-01

    In the oleaginous yeast Yarrowia lipolytica, de novo lipid synthesis and accumulation are induced under conditions of nitrogen limitation (or a high carbon-to-nitrogen ratio). The regulatory pathway responsible for this induction has not been identified. Here we report that the SNF1 pathway plays a key role in the transition from the growth phase to the oleaginous phase in Y. lipolytica. Strains with a Y. lipolytica snf1 (Ylsnf1) deletion accumulated fatty acids constitutively at levels up to 2.6-fold higher than those of the wild type. When introduced into a Y. lipolytica strain engineered to produce omega-3 eicosapentaenoic acid (EPA), Ylsnf1 deletion led to a 52% increase in EPA titers (7.6% of dry cell weight) over the control. Other components of the Y. lipolytica SNF1 pathway were also identified, and their function in limiting fatty acid accumulation is suggested by gene deletion analyses. Deletion of the gene encoding YlSnf4, YlGal83, or YlSak1 significantly increased lipid accumulation in both growth and oleaginous phases compared to the wild type. Furthermore, microarray and quantitative reverse transcription-PCR (qRT-PCR) analyses of the Ylsnf1 mutant identified significantly differentially expressed genes during de novo lipid synthesis and accumulation in Y. lipolytica. Gene ontology analysis found that these genes were highly enriched with genes involved in lipid metabolism. This work presents a new role for Snf1/AMP-activated protein kinase (AMPK) pathways in lipid accumulation in this oleaginous yeast. PMID:24056466

  16. [Adrenaline and cyclic AMP stimulation of ketopentose and sedoheptulose formation in rat liver homogenates].

    PubMed

    Kolotilova, A I; Glushankov, E P; Epifanova, Iu E

    1976-01-01

    Formation of sedoheptulose-7-phosphate and ketopentose phosphate was studied in vitro as affected by epinephrine and cAMP. No effect of epinephrine on the activity of transketolase was found with ribose-5-phosphate as a substrate of the nonoxidative reactions of the pentose phosphate ccyle. Epinephrine and cAMP enhance the formation of ketopentoses and sedoheptulose with glycogen as a main carbohydrate source, which is most pronounced in the experiments with cold preincubation. The phosphorylase system mediate influence of epinephrine and cAMP on the nonoxidative reactions products may be assumed.

  17. The cAMP Pathway as Therapeutic Target in Autoimmune and Inflammatory Diseases

    PubMed Central

    Raker, Verena Katharina; Becker, Christian; Steinbrink, Kerstin

    2016-01-01

    Nucleotide signaling molecules contribute to the regulation of cellular pathways. In the immune system, cyclic adenosine monophosphate (cAMP) is well established as a potent regulator of innate and adaptive immune cell functions. Therapeutic strategies to interrupt or enhance cAMP generation or effects have immunoregulatory potential in autoimmune and inflammatory disorders. Here, we provide an overview of the cyclic AMP axis and its role as a regulator of immune functions and discuss the clinical and translational relevance of interventions with these processes. PMID:27065076

  18. Analysis of Advanced Modular Power Systems (AMPS) for Deep Space Exploration

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard; Soeder, James F.; Beach, Ray

    2014-01-01

    The Advanced Modular Power Systems (AMPS) project is developing a modular approach to spacecraft power systems for exploration beyond Earth orbit. AMPS is intended to meet the need of reducing the cost of design development, test and integration and also reducing the operational logistics cost of supporting exploration missions. AMPS seeks to establish modular power building blocks with standardized electrical, mechanical, thermal and data interfaces that can be applied across multiple exploration vehicles. The presentation discusses the results of a cost analysis that compares the cost of the modular approach against a traditional non-modular approach.

  19. Phase A conceptual design study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The 12 month Phase A Conceptual Design Study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload performed within the Program Development Directorate of the Marshall Space Flight Center is presented. The AMPS payload makes use of the Spacelab pressurized module and pallet, is launched by the space shuttle, and will have initial flight durations of 7 days. Scientific instruments including particle accelerators, high power transmitters, optical instruments, and chemical release devices are mounted externally on the Spacelab pallet and are controlled by the experimenters from within the pressurized module. The capability of real-time scientist interaction on-orbit with the experiment is a major characteristic of AMPS.

  20. Cyclic AMP regulates the biosynthesis of cellobiohydrolase in Cellulomonas flavigena growing in sugar cane bagasse.

    PubMed

    Herrera-Herrera, Jesús Antonio; Pérez-Avalos, Odilia; Salgado, Luis M; Ponce-Noyola, Teresa

    2009-10-01

    Cellulomonas flavigena produces a battery of cellulase components that act concertedly to degrade cellulose. The addition of cAMP to repressed C. flavigena cultures released catabolic repression, while addition of cAMP to induced C. flavigena cultures led to a cellobiohydrolase hyperproduction. Exogenous cAMP showed positive regulation on cellobiohydrolase production in C. flavigena grown on sugar cane bagasse. A C. flavigena cellobiohydrolase gene was cloned (named celA), which coded for a 71- kDa enzyme. Upstream, a repressor celR1, identified as a 38 kDa protein, was monitored by use of polyclonal antibodies.

  1. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  2. Activation of f-channels by cAMP analogues in macropatches from rabbit sino-atrial node myocytes.

    PubMed Central

    Bois, P; Renaudon, B; Baruscotti, M; Lenfant, J; DiFrancesco, D

    1997-01-01

    1. The action of the two diastereometric phosphorothioate derivatives of cAMP, Rp-cAMPs and Sp-cAMPs, was investigated on hyperpolarization-activated 'pacemaker' current (i(f)) recorded in inside-out macropatches from rabbit sino-atrial (SA) node myocytes. 2. When superfused on the intracellular side of f-channels at the concentration of 10 microM, both cAMP derivatives accelerated i(f) activation; their action was moderately less pronounced than that due to the same concentration of cAMP. 3. The measurement of the i(f) conductance-voltage relation by voltage ramp protocols indicated that both cAMP analogues shift the activation curve of i(f) to more positive voltages with no change in maximal (fully activated) conductance. 4. Dose-response relationships of the shift of the i(f) activation curve showed that both Rp-cAMPs and Sp-cAMPs act as agonists in the cAMP-dependent direct f-channel activation. Fitting data to the Hill equation resulted in maximal shifts of 9.6 and 9.5 mV, apparent dissociation constants of 0.82 and 5.4 microM, and Hill coefficients of 0.82 and 1.12 for Sp-cAMPs and Rp-cAMPs, respectively. 5. The activating action of Rp-cAMPs, a known antagonist of cAMP in the activation of cAMP-dependent protein kinase, confirms previously established evidence that f-channel activation does not involve phosphorylation. These results also suggest that the cAMP binding site of f-channels may be structurally similar to the cyclic nucleotide binding site of olfactory receptor channels. PMID:9218217

  3. Release of Periplasmic Nucleotidase Induced by Human Antimicrobial Peptide in E. coli Causes Accumulation of the Immunomodulator Adenosine.

    PubMed

    Estrela, Andreia Bergamo; Türck, Patrick; Stutz, Elaine; Abraham, Wolf-Rainer

    2015-01-01

    Previous work by our group described that human β-defensin-2 induces accumulation of extracellular adenosine (Ado) in E. coli cultures through a non-lytic mechanism causing severe plasmolysis. Here, we investigate the presence of AMP as a direct precursor and the involvement of a bacterial enzyme in the generation of extracellular Ado by treated bacteria. Following hBD-2 treatment, metabolites were quantified in the supernatants using targeted HPLC-MS/MS analysis. Microbial growth was monitored by optical density and cell viability was determined by colony forming units counts. Phosphatase activity was measured using chromogenic substrate pNPP. The results demonstrate that defensin-treated E. coli strain W releases AMP in the extracellular space, where it is converted to Ado by a bacterial soluble factor. An increase in phosphatase activity in the supernatant was observed after peptide treatment, similar to the effect of sucrose-induced osmotic stress, suggesting that the periplasmic 5'nucleotidase (5'-NT) is released following the plasmolysis event triggered by the peptide. Ado accumulation was enhanced in the presence of Co2+ ion and inhibited by EDTA, further supporting the involvement of a metallo-phosphatase such as 5'-NT in extracellular AMP conversion into Ado. The comparative analysis of hBD-induced Ado accumulation in different E. coli strains and in Pseudomonas aeruginosa revealed that the response is not correlated to the peptide's effect on cell viability, but indicates it might be dependent on the subcellular distribution of the nucleotidase. Taken together, these data shed light on a yet undescribed mechanism of host-microbial interaction: a human antimicrobial peptide inducing selective release of a bacterial enzyme (E. coli 5'-NT), leading to the formation of a potent immunomodulator metabolite (Ado).

  4. Release of Periplasmic Nucleotidase Induced by Human Antimicrobial Peptide in E. coli Causes Accumulation of the Immunomodulator Adenosine.

    PubMed

    Estrela, Andreia Bergamo; Türck, Patrick; Stutz, Elaine; Abraham, Wolf-Rainer

    2015-01-01

    Previous work by our group described that human β-defensin-2 induces accumulation of extracellular adenosine (Ado) in E. coli cultures through a non-lytic mechanism causing severe plasmolysis. Here, we investigate the presence of AMP as a direct precursor and the involvement of a bacterial enzyme in the generation of extracellular Ado by treated bacteria. Following hBD-2 treatment, metabolites were quantified in the supernatants using targeted HPLC-MS/MS analysis. Microbial growth was monitored by optical density and cell viability was determined by colony forming units counts. Phosphatase activity was measured using chromogenic substrate pNPP. The results demonstrate that defensin-treated E. coli strain W releases AMP in the extracellular space, where it is converted to Ado by a bacterial soluble factor. An increase in phosphatase activity in the supernatant was observed after peptide treatment, similar to the effect of sucrose-induced osmotic stress, suggesting that the periplasmic 5'nucleotidase (5'-NT) is released following the plasmolysis event triggered by the peptide. Ado accumulation was enhanced in the presence of Co2+ ion and inhibited by EDTA, further supporting the involvement of a metallo-phosphatase such as 5'-NT in extracellular AMP conversion into Ado. The comparative analysis of hBD-induced Ado accumulation in different E. coli strains and in Pseudomonas aeruginosa revealed that the response is not correlated to the peptide's effect on cell viability, but indicates it might be dependent on the subcellular distribution of the nucleotidase. Taken together, these data shed light on a yet undescribed mechanism of host-microbial interaction: a human antimicrobial peptide inducing selective release of a bacterial enzyme (E. coli 5'-NT), leading to the formation of a potent immunomodulator metabolite (Ado). PMID:26371472

  5. Release of Periplasmic Nucleotidase Induced by Human Antimicrobial Peptide in E. coli Causes Accumulation of the Immunomodulator Adenosine

    PubMed Central

    Estrela, Andreia Bergamo; Türck, Patrick; Stutz, Elaine; Abraham, Wolf-Rainer

    2015-01-01

    Previous work by our group described that human β-defensin-2 induces accumulation of extracellular adenosine (Ado) in E. coli cultures through a non-lytic mechanism causing severe plasmolysis. Here, we investigate the presence of AMP as a direct precursor and the involvement of a bacterial enzyme in the generation of extracellular Ado by treated bacteria. Following hBD-2 treatment, metabolites were quantified in the supernatants using targeted HPLC-MS/MS analysis. Microbial growth was monitored by optical density and cell viability was determined by colony forming units counts. Phosphatase activity was measured using chromogenic substrate pNPP. The results demonstrate that defensin-treated E. coli strain W releases AMP in the extracellular space, where it is converted to Ado by a bacterial soluble factor. An increase in phosphatase activity in the supernatant was observed after peptide treatment, similar to the effect of sucrose-induced osmotic stress, suggesting that the periplasmic 5'nucleotidase (5'-NT) is released following the plasmolysis event triggered by the peptide. Ado accumulation was enhanced in the presence of Co2+ ion and inhibited by EDTA, further supporting the involvement of a metallo-phosphatase such as 5’-NT in extracellular AMP conversion into Ado. The comparative analysis of hBD-induced Ado accumulation in different E. coli strains and in Pseudomonas aeruginosa revealed that the response is not correlated to the peptide's effect on cell viability, but indicates it might be dependent on the subcellular distribution of the nucleotidase. Taken together, these data shed light on a yet undescribed mechanism of host-microbial interaction: a human antimicrobial peptide inducing selective release of a bacterial enzyme (E. coli 5'-NT), leading to the formation of a potent immunomodulator metabolite (Ado). PMID:26371472

  6. Binding of the Citrobacter freundii AmpR regulator to a single DNA site provides both autoregulation and activation of the inducible ampC beta-lactamase gene.

    PubMed Central

    Lindquist, S; Lindberg, F; Normark, S

    1989-01-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase. Induction requires the product of the ampR gene, which is transcribed in the opposite orientation from the ampC beta-lactamase gene. We show here that the AmpR protein acts as a transcriptional activator by binding to a DNA region immediately upstream of the ampC promoter. The DNase I footprint pattern was not affected by growth in the presence of beta-lactam inducer or by the use of extracts prepared from cells carrying the ampD2 allele leading to semiconstitutive production of beta-lactamase. It is suggested that activation of AmpR facilitates binding or open complex formation for RNA polymerase at the ampC promoter. The AmpR-binding site overlaps the ampR promoter, and beta-galactosidase activity was decreased from an ampR-lacZ transcriptional fusion when AmpR was expressed from a coresident plasmid, suggesting that ampR is autogenously controlled. The AmpR protein belongs to a family of highly homologous transcriptional activators that includes LysR, which regulates the E. coli lysine synthetase gene, and the NodD protein, which regulates expression of a number of genes involved in nodulation in Rhizobium. The lack of sequence homology to any known beta-lactam-binding protein suggests that AmpR does not bind directly to the beta-lactam inducer but interacts with a second messenger of unknown nature. Images PMID:2786868

  7. Gene Expression Patterns Define Key Transcriptional Events InCell-Cycle Regulation By cAMP And Protein Kinase A

    SciTech Connect

    Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon; Kanter, Joan R.; Prabhakar, Shyam; Salomonis, Nathan; Vranizan, Karen; Dubchak Inna,; Conklin, Bruce R.; Insel, Paul A.

    2005-06-01

    Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrest of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.

  8. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-11-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  9. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, appendixes

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    An equipment list, instrument baseline data, engineering drawings, mass properties computer printouts, electrical energy management, and control and display functional analysis pertinent to the AMPS (Satellite Payload) are presented.

  10. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    NASA Astrophysics Data System (ADS)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš

    2010-06-01

    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  11. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-05-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  12. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    SciTech Connect

    Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki . E-mail: yk-kim@korea.ac.kr

    2007-05-18

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway.

  13. N-Acetyl-D- and L-esters of 5'-AMP hydrolyze at different rates

    NASA Technical Reports Server (NTRS)

    Wickramasinghe, N. S.; Lacey, J. C. Jr; Lacey JC, J. r. (Principal Investigator)

    1993-01-01

    Studies of the properties of aminoacyl derivatives of 5'-AMP are aimed at understanding the origin of the process of protein synthesis. Aminoacyl (2',3') esters of 5'-AMP can serve as models of the 3'-terminus of aminoacyl tRNA. We report here on the relative rates of hydrolysis of Ac-D- and L-Phe AMP esters as a function of pH. At all pHs above 3, the rate constant of hydrolysis of the Ac-L-Phe ester is 1.7 to 2.1 times that of Ac-D-Phe ester. The D-isomer seems partially protected from hydrolysis by a stronger association with the adenine ring of the 5'-AMP.

  14. Role of the cAMP Pathway in Glucose and Lipid Metabolism.

    PubMed

    Ravnskjaer, Kim; Madiraju, Anila; Montminy, Marc

    2016-01-01

    3'-5'-Cyclic adenosine monophosphate (cyclic AMP or cAMP) was first described in 1957 as an intracellular second messenger mediating the effects of glucagon and epinephrine on hepatic glycogenolysis (Berthet et al., J Biol Chem 224(1):463-475, 1957). Since this initial characterization, cAMP has been firmly established as a versatile molecular signal involved in both central and peripheral regulation of energy homeostasis and nutrient partitioning. Many of these effects appear to be mediated at the transcriptional level, in part through the activation of the transcription factor CREB and its coactivators. Here we review current understanding of the mechanisms by which the cAMP signaling pathway triggers metabolic programs in insulin-responsive tissues.

  15. The plasma cyclic AMP response to catecholamines as potentiated by phentolamine in rats.

    PubMed

    Kunitada, S; Ui, M

    1978-05-15

    Norepinephrine failed to increase plasma cyclic AMP when injected alone into fasted rats, in contrast with sharp increases elicited by isoproterenol, epinephrine or tyramine. In rats pretreated with 6-hydroxydopamine or cocain, however, there was significant increase in plasma cyclic AMP after norepinephrine injection, suggesting that the rapid neuronal catecholamine uptake was at least partly responsible for the lack of norepinephrine action. Phentolamine was very effective in enhancing the epinephrine-, norepinephrine- or tyramine-induced increase in plasma cyclic AMP but without effect on the isoproterenol-induced increase. Blockade of postsynaptic alpha-adrenoceptors, rather than of presynaptic receptors, is likely to be involved in the phentolamine potentiation, since it was even observed in rats treated with 6-hydroxydopamine or cocaine. A discussion is presented regarding the mechanism by which cyclic AMP generation is influenced by the alpha- and beta-adrenoceptor interaction on effector cell membranes.

  16. Is a decrease in cyclic AMP a necessary and sufficient signal for maturation of amphibian oocytes

    SciTech Connect

    Gelerstein, S.; Shapira, H.; Dascal, N.; Yekuel, R.; Oron, Y.

    1988-05-01

    Acetylcholine rapidly lowered the intracellular levels of cyclic AMP in stage 5 and 6 Xenopus laevis oocytes. Acetylcholine alone did not induce oocyte maturation, though it did accelerate maturation induced by progesterone. The effect of acetylcholine on oocyte maturation was independent of extracellular calcium concentration. Adenosine increased cyclic AMP and abolished the progesterone-induced decrease in cyclic AMP levels in follicles and in denuded oocytes. This effect of adenosine was blocked by the Ra purinergic receptor antagonist, theophylline. Despite those effects, adenosine alone induced maturation in stage 6 oocytes and accelerated progesterone-induced maturation in both stage 5 and 6 cells. Adenosine also induced a significant increase in the rate of /sup 45/Ca efflux from oocytes in the presence and the absence of external calcium. We suggest that the activation of cell surface receptors involved in the release of calcium from cellular stores may induce or accelerate oocyte maturation independently of small changes in intracellular cyclic AMP concentration.

  17. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, technical summary document

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    Some 60 instrument candidates and 80 possible science investigations were evaluated. The early analysis emphasized the science aspect in terms of the functional requirements for each of the potential experiments identified by the AMPS science working group. These requirements were then used for the grouping of instruments into practical payloads which would fit the capabilities of the Shuttle/Spacelab. This analysis resulted in the definition of eleven different AMPS configurations. The data were then used to define a typical set of requirements for a flexible AMPS laboratory. The data gathered to this point showed that a planned sequential buildup of the laboratory would be necessary to meet both physical and funding limitations. This led to the definition of five strawman payloads by the science working group, which were used to establish a conceptual laboratory and to define preliminary design of a configuration which could satisfy AMPS needs during the early program period.

  18. Molecular analysis of polyphosphate accumulation in bacteria.

    PubMed

    Kuroda, A; Ohtake, H

    2000-03-01

    The dynamic behavior of inorganic polyphosphate (polyP), its accumulation and disappearance, is the most striking aspect of polyP metabolism in bacteria. Imbalance between polyP synthesis and degradation results in fluctuations of polyP by 100- to 1000-fold. We here review recent results with respect to this polyP metabolism in bacteria. PolyP accumulation in response to amino acid starvation, accompanied by increased levels of stringent factors, has been observed in Escherichia coli. Inhibition by stringent factors of polyphosphatase interrupts the dynamic balance between the synthesis and degradation of polyP, accounting for polyP accumulation. Polyphosphate kinase is required for activation of intracellular protein degradation, which is required for adaptation at the onset of amino acid starvation. The adaptation to amino acid starvation is mediated by the network of stringent response and polyP metabolism. PolyP accumulation independent of stringent response has also been observed. Novobiocin, an inhibitor for DNA gyrase, stimulated accumulation of polyP but not that of stringent factors. However, a temperature-sensitive DNA gyrase mutant did not exhibit polyP accumulation at the non-permissive temperature. Antagonistic relationship of polyP to nucleic acid synthesis, explored by Harold, appears to be more complicated. We discuss relationship of Pi regulation to polyP accumulation in E. coli and Klebsiella aerogenes. A function of polyP as an in vivo phosphagen affecting polyP accumulation is also discussed.

  19. 46 CFR 58.30-25 - Accumulators.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... RELATED SYSTEMS Fluid Power and Control Systems § 58.30-25 Accumulators. (a) An accumulator is an unfired pressure vessel in which energy is stored under high pressure in the form of a gas or a gas and hydraulic... result in contamination of the hydraulic fluid and loss of gas through absorption. (c) Each...

  20. 46 CFR 58.30-25 - Accumulators.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... RELATED SYSTEMS Fluid Power and Control Systems § 58.30-25 Accumulators. (a) An accumulator is an unfired pressure vessel in which energy is stored under high pressure in the form of a gas or a gas and hydraulic... result in contamination of the hydraulic fluid and loss of gas through absorption. (c) Each...

  1. NMR studies of the AMP-binding site and mechanism of adenylate kinase.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1987-03-24

    NMR has previously been used to determine the conformation of enzyme-bound MgATP and to locate the MgATP-binding site on adenylate kinase [Fry, D. C., Kuby, S. A., & Mildvan, A. S. (1985) Biochemistry 24, 4680-4694]. To determine the conformation and location of the other substrate, AMP, distances have been measured from Cr3+AMPPCP, a linear competitive inhibitor with respect to MgATP, to six protons and to the phosphorus atom of AMP on adenylate kinase, with the paramagnetic probe-T1 method. Time-dependent nuclear Overhauser effects (NOEs) have been used to measure five interproton distances on enzyme-bound AMP. These distances were used to determine the conformation of bound AMP in addition to its position with respect to metal-ATP. Enzyme-bound AMP exhibits a high anti-glycosyl torsional angle (chi = 110 +/- 10 degrees), a 3'-endo,2'-exo ribose pucker (delta = 105 +/- 10 degrees), and gauche-trans orientations about the C4'-C5' bond (gamma = 180 +/- 10 degrees) and the C5'-O5' bond (beta = 170 +/- 20 degrees). The distance from Cr3+ to the phosphorus of AMP is 5.9 +/- 0.3 A, indicating a reaction coordinate distance of approximately 3 A, which is consistent with an associative SN2 mechanism for the phosphoryl transfer. Ten intermolecular NOEs, from protons of the enzyme to those of AMP, were detected, indicating the proximity of at least three hydrophobic amino acids to bound AMP. These constraints, together with the conformation of AMP and the intersubstrate distances, were used to position AMP into the X-ray structure of adenylate kinase. The AMP binding site is found to be near (less than or equal to 4 A from) Leu-116, Arg-171, Val-173, Val-182, and Leu-190; all of these residues have been found to be invariant in muscle-type rabbit, calf, human, porcine [Kuby, S. A., Palmieri, R. H., Frischat, A., Fischer, A. H., Wu, L. H., Maland, L., & Manship, M. (1984) Biochemistry 23, 2393-2399], and chicken adenylate kinase [Kishi, F., Maruyama, M., Tanizawa, Y

  2. Effect of Glucagon on Net Splanchnic Cyclic AMP Production in Normal and Diabetic Men

    PubMed Central

    Liljenquist, John E.; Bomboy, James D.; Lewis, Stephen B.; Sinclair-Smith, Bruce C.; Felts, Philip W.; Lacy, William W.; Crofford, Oscar B.; Liddle, Grant W.

    1974-01-01

    Glucagon activates hepatic adenylate cyclase, thereby increasing acutely the liver content of cyclic AMP (cAMP) as well as the release of cAMP into the hepatic vein. Insulin, on the other hand, antagonizes this glucagon-mediated cAMP production, thus providing a hypothetical mechanism through which insulin might correct some of the metabolic abnormalities of diabetes. To study this hormonal interaction in man, net splanchnic cAMP production (NScAMPP) was investigated in normal and insulin-dependent diabetic men under basal conditions and in response to intravenous glucagon, 50 ng/kg/min for 2 h. In normals (n=19), basal hepatic vein cAMP concentration was 23.6±1.1 nM and NScAMPP was 1.7±0.6 nmol/min. Glucagon stimulated NScAMPP in four normal subjects to a peak of 99.6±43 nmol/min at 25 min with a subsequent fall to 12.4±5.1 nmol/min by 90 min despite continuing glucagon infusion. Endogenous insulin secretion was stimulated as indicated by rising levels of immunoreactive insulin and C-peptide (connecting peptide) immunoreactivity, raising the possibility that endogenous insulin might be responsible for the fall in NScAMPP that followed the initial spike. In the diabetics (n=8), basal hepatic vein cAMP concentration was 24.7±1.2 nM and NScAMPP was undetectable. Glucagon stimulated NScAMPP in five diabetics to a peak of 169.9±42.6 with a subsequent fall to 17.4±3.9 nmol/min by 90 min even though endogenous insulin secretion was not stimulated (no rise in C-peptide immunoreactivity). Although the mean increase in NScAMPP was greater in the diabetics, the two groups did not differ significantly. Conclusions. In normal resting man the liver is a significant source of circulating cAMP. Diabetics do not release abnormally large amounts of hepatic cAMP under basal conditions. Glucagon markedly enhances hepatic cAMP release with a spike-decline pattern in both normal and diabetic men. The decline in hepatic cAMP release despite continuing glucagon stimulation is due

  3. SCAP/SREBP pathway is required for the full steroidogenic response to cyclic AMP.

    PubMed

    Shimizu-Albergine, Masami; Van Yserloo, Brian; Golkowski, Martin G; Ong, Shao-En; Beavo, Joseph A; Bornfeldt, Karin E

    2016-09-20

    Luteinizing hormone (LH) stimulates steroidogenesis largely through a surge in cyclic AMP (cAMP). Steroidogenic rates are also critically dependent on the availability of cholesterol at mitochondrial sites of synthesis. This cholesterol is provided by cellular uptake of lipoproteins, mobilization of intracellular lipid, and de novo synthesis. Whether and how these pathways are coordinated by cAMP are poorly understood. Recent phosphoproteomic analyses of cAMP-dependent phosphorylation sites in MA10 Leydig cells suggested that cAMP regulates multiple steps in these processes, including activation of the SCAP/SREBP pathway. SCAP [sterol-regulatory element-binding protein (SREBP) cleavage-activating protein] acts as a cholesterol sensor responsible for regulating intracellular cholesterol balance. Its role in cAMP-mediated control of steroidogenesis has not been explored. We used two CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR associated protein 9) knockout approaches to test the role of SCAP in steroidogenesis. Our results demonstrate that SCAP is required for progesterone production induced by concurrent inhibition of the cAMP phosphodiesterases PDE4 and PDE8. These inhibitors increased SCAP phosphorylation, SREBP2 activation, and subsequent expression of cholesterol biosynthetic genes, whereas SCAP deficiency largely prevented these effects. Reexpression of SCAP in SCAP-deficient cells restored SREBP2 protein expression and partially restored steroidogenic responses, confirming the requirement of SCAP-SREBP2 in steroidogenesis. Inhibitors of 3-hydroxy-3-methylglutaryl-Coenzyme A reductase and isoprenylation attenuated, whereas exogenously provided cholesterol augmented, PDE inhibitor-induced steroidogenesis, suggesting that the cholesterol substrate needed for steroidogenesis is provided by both de novo synthesis and isoprenylation-dependent mechanisms. Overall, these results demonstrate a novel role for LH/cAMP in SCAP

  4. Estradiol increases cAMP in the oviductal secretory cells through a nongenomic mechanism.

    PubMed

    Oróstica, María L; Lopez, John; Rojas, Israel; Rocco, Jocelyn; Díaz, Patricia; Reuquén, Patricia; Cardenas, Hugo; Parada-Bustamante, Alexis; Orihuela, Pedro A

    2014-09-01

    In the rat oviduct, estradiol (E2) accelerates egg transport by a nongenomic action that requires previous conversion of E2 to methoxyestrogens via catechol-O-methyltranferase (COMT) and activation of estrogen receptor (ER) with subsequent production of cAMP and inositol triphosphate (IP3). However, the role of the different oviductal cellular phenotypes on this E2 nongenomic pathway remains undetermined. The aim of this study was to investigate the effect of E2 on the levels of cAMP and IP3 in primary cultures of secretory and smooth muscle cells from rat oviducts and determine the mechanism by which E2 increases cAMP in the secretory cells. In the secretory cells, E2 increased cAMP but not IP3, while in the smooth muscle cells E2 decreased cAMP and increased IP3. Suppression of protein synthesis by actinomycin D did not prevent the E2-induced cAMP increase, but this was blocked by the ER antagonist ICI 182 780 and the inhibitors of COMT OR 486, G protein-α inhibitory (Gαi) protein pertussis toxin and adenylyl cyclase (AC) SQ 22536. Expression of the mRNA for the enzymes that metabolizes estrogens, Comt, Cyp1a1, and Cyp1b1 was found in the secretory cells, but this was not affected by E2. Finally, confocal immunofluorescence analysis showed that E2 induced colocalization between ESR1 (ERα) and Gαi in extranuclear regions of the secretory cells. We conclude that E2 differentially regulates cAMP and IP3 in the secretory and smooth muscle cells of the rat oviduct. In the secretory cells, E2 increases cAMP via a nongenomic action that requires activation of COMT and ER, coupling between ESR1 and Gαi, and stimulation of AC.

  5. Studying the regulation of endosomal cAMP production in GPCR signaling

    PubMed Central

    Gidon, Alexandre; Feinstein, Timothy N.; Xiao, Kunhong; Vilardaga, Jean-Pierre

    2016-01-01

    We describe methods based on live cell fluorescent microscopy and mass spectrometry to characterize the mechanism of endosomal cAMP production and its regulation using the parathyroid hormone (PTH) type 1 receptor as a prime example. These methods permit to measure rapid changes of cAMP levels in response to PTH, kinetics of endosomal ligand–receptor interaction, pH changes associated with receptor trafficking, and to identify the endosomal receptor interactome. PMID:26928541

  6. The ever unfolding story of cAMP signaling in trypanosomatids: vive la difference!

    PubMed Central

    Tagoe, Daniel N. A.; Kalejaiye, Titilola D.; de Koning, Harry P.

    2015-01-01

    Kinetoplastids are unicellular, eukaryotic, flagellated protozoans containing the eponymous kinetoplast. Within this order, the family of trypanosomatids are responsible for some of the most serious human diseases, including Chagas disease (Trypanosoma cruzi), sleeping sickness (Trypanosoma brucei spp.), and leishmaniasis (Leishmania spp). Although cAMP is produced during the life cycle stages of these parasites, its signaling pathways are very different from those of mammals. The absence of G-protein-coupled receptors, the presence of structurally different adenylyl cyclases, the paucity of known cAMP effector proteins and the stringent need for regulation of cAMP in the small kinetoplastid cells all suggest a significantly different biochemical pathway and likely cell biology. However, each of the main kinetoplastid parasites express four class 1-type cyclic nucleotide-specific phosphodiesterases (PDEA-D), which have highly similar catalytic domains to that of human PDEs. To date, only TbrPDEB, expressed as two slightly different isoforms TbrPDEB1 and B2, has been found to be essential when ablated. Although the genomes contain reasonably well conserved genes for catalytic and regulatory domains of protein kinase A, these have been shown to have varied structural and functional roles in the different species. Recent discovery of a role of cAMP/AMP metabolism in a quorum-sensing signaling pathway in T. brucei, and the identification of downstream cAMP Response Proteins (CARPs) whose expression levels correlate with sensitivity to PDE inhibitors, suggests a complex signaling cascade. The interplay between the roles of these novel CARPs and the quorum-sensing signaling pathway on cell division and differentiation makes for intriguing cell biology and a new paradigm in cAMP signal transduction, as well as potential targets for trypanosomatid-specific cAMP pathway-based therapeutics. PMID:26441645

  7. Cyclic-AMP Mediated Regulation of ABCB mRNA Expression in Mussel Haemocytes

    PubMed Central

    Franzellitti, Silvia; Fabbri, Elena

    2013-01-01

    Background The multixenobiotic resistance system (MXR) allows aquatic organisms to cope with their habitat despite high pollution levels by over-expressing membrane and intracellular transporters, including the P-glycoprotein (Pgp). In mammals transcription of the ABCB1 gene encoding Pgp is under cAMP/PKA-mediated regulation; whether this is true in mollusks is not fully clarified. Methodology/Principal Findings cAMP/PKA regulation and ABCB mRNA expression were assessed in haemocytes from Mediterranean mussels (Mytilus galloprovincialis) exposed in vivo for 1 week to 0.3 ng/L fluoxetine (FX) alone or in combination with 0.3 ng/L propranolol (PROP). FX significantly decreased cAMP levels and PKA activity, and induced ABCB mRNA down-regulation. FX effects were abolished in the presence of PROP. In vitro experiments using haemocytes treated with physiological agonists (noradrenaline and serotonin) and pharmacological modulators (PROP, forskolin, dbcAMP, and H89) of the cAMP/PKA system were performed to obtain clear evidence about the involvement of the signaling pathway in the transcriptional regulation of ABCB. Serotonin (5-HT) decreased cAMP levels, PKA activity and ABCB mRNA expression but increased the mRNA levels for a putative 5-HT1 receptor. Interestingly, 5-HT1 was also over-expressed after in vivo exposures to FX. 5-HT effects were counteracted by PROP. Forskolin and dbcAMP increased PKA activity as well as ABCB mRNA expression; the latter effect was abolished in the presence of the PKA inhibitor H89. Conclusions This study provides the first direct evidence for the cAMP/PKA-mediated regulation of ABCB transcription in mussels. PMID:23593491

  8. Blockade of beta-adrenoceptors enhances cAMP signal transduction in vivo

    NASA Technical Reports Server (NTRS)

    Whalen, E. J.; Johnson, A. K.; Lewis, S. J.

    1998-01-01

    The aim of this study was to determine whether the blockade of beta-adrenoceptors would enhance cAMP-mediated signal transduction processes in vivo. The administration of the membrane permeable cAMP analogue, 8-(4-chlorophenylthiol)-cAMP (8-CPT-cAMP, 10 micromol/kg, i.v.) produced an increase in heart rate (+27 +/- 2%, P < 0.05), a fall in mean arterial blood pressure (-21 +/- 3%, P < 0.05) and falls in hindquarter (-12 +/- 3%, P < 0.05) and mesenteric (-32 +/- 3%, P < 0.05) vascular resistances in pentobarbital-anesthetized rats. The beta-adrenoceptor antagonist, propranolol (1 mg/kg, i.v.) lowered heart rate (-12 +/- 3%, P < 0.05) but did not affect mean arterial blood pressure or vascular resistances. The tachycardia, hypotension and vasodilation produced by 8-CPT-cAMP were exaggerated after administration of propranolol (P < 0.05 for all comparisons). The nitric oxide-donor, sodium nitroprusside (2 microg/kg, i.v.), produced falls in mean arterial blood pressure and vascular resistances of similar magnitude to those produced by 8-CPT-cAMP. These sodium nitroprusside-induced responses were unaffected by propranolol (P < 0.05 for all comparisons). Sodium nitroprusside also produced a minor increase in heart rate (+5 +/- 1%, P < 0.05) which was abolished by propranolol. These findings suggest that 8-CPT-cAMP directly increases heart rate and that blockade of beta-adrenoceptors enhances the potency of cAMP within the heart and vasculature.

  9. 5′-AMP impacts lymphocyte recirculation through activation of A2B receptors

    PubMed Central

    Bouma, Hjalmar R.; Mandl, Judith N.; Strijkstra, Arjen M.; Boerema, Ate S.; Kok, Jan-Willem; van Dam, Annie; IJzerman, Ad; Kroese, Frans G. M.; Henning, Robert H.

    2013-01-01

    Natural hibernation consists of torpid phases with metabolic suppression alternating with euthermic periods. Induction of torpor holds substantial promise in various medical conditions, including trauma, major surgery, and transplantation. Torpor in mice can be induced pharmacologically by 5′-AMP. Previously, we showed that during natural torpor, the reduction in body temperature results in lymphopenia via a reduction in plasma S1P. Here, we show that during torpor induced by 5′-AMP, there is a similar reduction in the number of circulating lymphocytes that is a result of their retention in secondary lymphoid organs. This lymphopenia could be mimicked by engagement of A2BRs by a selective A2BR agonist (LUF6210) in the absence of changes in temperature and prevented by A2BR antagonists during 5′-AMP-induced torpor. In addition, forced cooling of mice led to peripheral blood lymphopenia, independent of A2BR signaling. The induction of torpor using 5′-AMP impacted the migration of lymphocytes within and between secondary lymphoid organs. During torpor, the homing into LNs was impaired, and two-photon intravital microscopy revealed that cell motility was decreased significantly and rapidly upon 5′-AMP administration. Furthermore, the S1P plasma concentration was reduced by 5′-AMP but not by LUF6210. S1P plasma levels restored upon arousal. Likely, the reduced migration in LNs combined with the reduced S1P plasma level substantially reduces lymphocyte egress after injection of 5′-AMP. In conclusion, 5′-AMP induces a state of pharmacological torpor in mice, during which, lymphopenia is governed primarily by body temperature-independent suppression of lymphocyte egress from LNs. PMID:23682128

  10. Modeling mutant phenotypes and oscillatory dynamics in the Saccharomyces cerevisiae cAMP-PKA pathway

    PubMed Central

    2013-01-01

    Background The cyclic AMP-Protein Kinase A (cAMP-PKA) pathway is an evolutionarily conserved signal transduction mechanism that regulates cellular growth and differentiation in animals and fungi. We present a mathematical model that recapitulates the short-term and long-term dynamics of this pathway in the budding yeast, Saccharomyces cerevisiae. Our model is aimed at recapitulating the dynamics of cAMP signaling for wild-type cells as well as single (pde1Δ and pde2Δ) and double (pde1Δpde2Δ) phosphodiesterase mutants. Results Our model focuses on PKA-mediated negative feedback on the activity of phosphodiesterases and the Ras branch of the cAMP-PKA pathway. We show that both of these types of negative feedback are required to reproduce the wild-type signaling behavior that occurs on both short and long time scales, as well as the the observed responses of phosphodiesterase mutants. A novel feature of our model is that, for a wide range of parameters, it predicts that intracellular cAMP concentrations should exhibit decaying oscillatory dynamics in their approach to steady state following glucose stimulation. Experimental measurements of cAMP levels in two genetic backgrounds of S. cerevisiae confirmed the presence of decaying cAMP oscillations as predicted by the model. Conclusions Our model of the cAMP-PKA pathway provides new insights into how yeast respond to alterations in their nutrient environment. Because the model has both predictive and explanatory power it will serve as a foundation for future mathematical and experimental studies of this important signaling network. PMID:23680078

  11. CREB modulates calcium signaling in cAMP-induced bone marrow stromal cells (BMSCs).

    PubMed

    Zhang, Linxia; Liu, Li; Thompson, Ryan; Chan, Christina

    2014-10-01

    Calcium signaling has a versatile role in many important cellular functions. Despite its importance, regulation of calcium signaling in bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) has not been explored extensively. Our previous study revealed that cyclic adenosine monophosphate (cAMP) enabled BMSCs to generate calcium signal upon stimulation by dopamine, KCl and glutamate. Concurrently, cAMP transiently activated the transcription factor cAMP response element binding protein (CREB) in BMSCs. Activity of CREB can be modulated by the calcium/calmodulin-dependent kinase signaling pathway, however, whether the calcium signaling observed in cAMP-induced BMSCs requires CREB has not been investigated. In an effort to uncover the role of CREB in the generation of calcium signaling in response to modulators such as dopamine and KCl, we knocked down CREB activity in BMSCs. Our study indicated that BMSCs, but not its close relative fibroblasts, are responsive to dopamine and KCl after cAMP treatment. Calcium signal elicited by dopamine depends, in part, on calcium influx whereas that elicited by KCl depends completely on calcium influx. Knock-down of CREB activity significantly reduced or abolished the cAMP-induced calcium response, and reintroducing a constitutively active CREB partially restored the calcium response.

  12. Dynamic fluctuations provide the basis of a conformational switch mechanism in apo cyclic AMP receptor protein.

    PubMed

    Aykaç Fas, Burcu; Tutar, Yusuf; Haliloğlu, Türkan

    2013-01-01

    Escherichia coli cyclic AMP Receptor Protein (CRP) undergoes conformational changes with cAMP binding and allosterically promotes CRP to bind specifically to the DNA. In that, the structural and dynamic properties of apo CRP prior to cAMP binding are of interest for the comprehension of the activation mechanism. Here, the dynamics of apo CRP monomer/dimer and holo CRP dimer were studied by Molecular Dynamics (MD) simulations and Gaussian Network Model (GNM). The interplay of the inter-domain hinge with the cAMP and DNA binding domains are pre-disposed in the apo state as a conformational switch in the CRP's allosteric communication mechanism. The hinge at L134-D138 displaying intra- and inter-subunit coupled fluctuations with the cAMP and DNA binding domains leads to the emergence of stronger coupled fluctuations between the two domains and describes an on state. The flexible regions at K52-E58, P154/D155 and I175 maintain the dynamic coupling of the two domains. With a shift in the inter-domain hinge position towards the N terminus, nevertheless, the latter correlations between the domains loosen and become disordered; L134-D138 dynamically interacts only with the cAMP and DNA binding domains of its own subunit, and an off state is assumed. We present a mechanistic view on how the structural dynamic units are hierarchically built for the allosteric functional mechanism; from apo CRP monomer to apo-to-holo CRP dimers.

  13. Spatiotemporal regulation of cAMP signaling controls the human trophoblast fusion

    PubMed Central

    Gerbaud, Pascale; Taskén, Kjetil; Pidoux, Guillaume

    2015-01-01

    During human placentation, mononuclear cytotrophoblasts fuse to form multinucleated syncytia ensuring hormonal production and nutrient exchanges between the maternal and fetal circulation. Syncytial formation is essential for the maintenance of pregnancy and for fetal growth. The cAMP signaling pathway is the major route to trigger trophoblast fusion and its activation results in phosphorylation of specific intracellular target proteins, in transcription of fusogenic genes and assembly of macromolecular protein complexes constituting the fusogenic machinery at the plasma membrane. Specificity in cAMP signaling is ensured by generation of localized pools of cAMP controlled by cAMP phosphodiesterases (PDEs) and by discrete spatial and temporal activation of protein kinase A (PKA) in supramolecular signaling clusters inside the cell organized by A-kinase-anchoring proteins (AKAPs) and by organization of signal termination by protein phosphatases (PPs). Here we present original observations on the available components of the cAMP signaling pathway in the human placenta including PKA, PDE, and PP isoforms as well as AKAPs. We continue to discuss the current knowledge of the spatiotemporal regulation of cAMP signaling triggering trophoblast fusion. PMID:26441659

  14. Pharmacological elevation of cyclic AMP and transmitter release at the mouse neuromuscular junction.

    PubMed

    Dryden, W F; Singh, Y N; Gordon, T; Lazarenko, G

    1988-03-01

    Intracellular recordings of spontaneous and evoked end-plate potentials have been made at the neuromuscular junction of mouse hemidiaphragms to determine a possible role of cyclic AMP (cAMP) in the release of acetylcholine from presynaptic terminals. Spontaneous release, as determined from the frequency of miniature end-plate potentials, was increased by drugs that inhibit phosphodiesterase: isobutylmethylxanthine (IBMX), SQ 20,009, theophylline, and caffeine; drugs that stimulate adenylate cyclase: forskolin, fluoride, and cholera toxin, and the stable analogue of cAMP: 8-bromo-cAMP but not dibutyryl cAMP. Release increased with time during maintained exposure to the drugs and generally followed a simple exponential time course with time constants ranging from 8 to 17 min at 20 degrees C, except for SQ 20,009 and cholera toxin which required longer exposure times for effect. The order of potency of the phosphodiesterase inhibitors was IBMX = SQ 20,009 greater than theophylline = caffeine. This is consistent with an effect mediated by an increase in cAMP concentrations within the nerve terminal. Evoked release, determined from the quantal content of the end-plate potential, was increased to a lesser extent than spontaneous release. The results are discussed with reference to the possible involvement of second messengers in the release of vesicles from nerve terminals in vertebrate synapses.

  15. Odor-induced cAMP production in Drosophila melanogaster olfactory sensory neurons.

    PubMed

    Miazzi, Fabio; Hansson, Bill S; Wicher, Dieter

    2016-06-15

    Insect odorant receptors are seven transmembrane domain proteins that form cation channels, whose functional properties such as receptor sensitivity are subject to regulation by intracellular signaling cascades. Here, we used the cAMP fluorescent indicator Epac1-camps to investigate the occurrence of odor-induced cAMP production in olfactory sensory neurons (OSNs) of Drosophila melanogaster We show that stimulation of the receptor complex with an odor mixture or with the synthetic agonist VUAA1 induces a cAMP response. Moreover, we show that while the intracellular Ca(2+) concentration influences cAMP production, the OSN-specific receptor OrX is necessary to elicit cAMP responses in Ca(2+)-free conditions. These results provide direct evidence of a relationship between odorant receptor stimulation and cAMP production in olfactory sensory neurons in the fruit fly antenna and show that this method can be used to further investigate the role that this second messenger plays in insect olfaction. PMID:27045092

  16. The role of ventral striatal cAMP signaling in stress-induced behaviors.

    PubMed

    Plattner, Florian; Hayashi, Kanehiro; Hernández, Adan; Benavides, David R; Tassin, Tara C; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W; Yuen, Eunice Y; Yan, Zhen; Goldberg, Matthew S; Nairn, Angus C; Greengard, Paul; Nestler, Eric J; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D; Bibb, James A

    2015-08-01

    The cAMP and cAMP-dependent protein kinase A (PKA) signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitated cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targeted the regulation of PDE4 by Cdk5, produced analogous effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  17. CREB modulates calcium signaling in cAMP-induced bone marrow stromal cells (BMSCs)

    PubMed Central

    Zhang, Linxia; Liu, Li; Thompson, Ryan; Chan, Christina

    2014-01-01

    Calcium signaling has a versatile role in many important cellular functions. Despite its importance, regulation of calcium signaling in bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) has not been explored extensively. Our previous study revealed that cyclic adenosine monophosphate (cAMP) enabled BMSCs to generate calcium signal upon stimulation by dopamine, KCl and glutamate. Concurrently, cAMP transiently activated the transcription factor cAMP response element binding protein (CREB) in BMSCs. Activity of CREB can be modulated by the calcium/calmodulin-dependent kinase signaling pathway, however, whether the calcium signaling observed in cAMP-induced BMSCs requires CREB has not been investigated. In an effort to uncover the role of CREB in the generation of calcium signaling in response to modulators such as dopamine and KCl, we knocked down CREB activity in BMSCs. Our study indicated that BMSCs, but not its close relative fibroblasts, are responsive to dopamine and KCl after cAMP treatment. Calcium signal elicited by dopamine depends, in part, on calcium influx whereas that elicited by KCl depends completely on calcium influx. Knock-down of CREB activity significantly reduced or abolished the cAMP-induced calcium response, and reintroducing a constitutively active CREB partially restored the calcium response. PMID:25154887

  18. Involvement of Type 4 cAMP-Phosphodiesterase in the Myogenic Differentiation of L6 Cells

    PubMed Central

    Naro, Fabio; Sette, Claudio; Vicini, Elena; De Arcangelis, Vania; Grange, Muriel; Conti, Marco; Lagarde, Michel; Molinaro, Mario; Adamo, Sergio; Némoz, Georges

    1999-01-01

    Myogenic cell differentiation is induced by Arg8-vasopressin, whereas high cAMP levels and protein kinase A (PKA) activity inhibit myogenesis. We investigated the role of type 4 phosphodiesterase (PDE4) during L6-C5 myoblast differentiation. Selective PDE4 inhibition resulted in suppression of differentiation induced by vasopressin. PDE4 inhibition prevented vasopressin-induced nuclear translocation of the muscle-specific transcription factor myogenin without affecting its overall expression level. The effects of PDE4 inhibition could be attributed to an increase of cAMP levels and PKA activity. RNase protection, reverse transcriptase PCR, immunoprecipitation, Western blot, and enzyme activity assays demonstrated that the PDE4D3 isoform is the major PDE4 expressed in L6-C5 myoblasts and myotubes, accounting for 75% of total cAMP-hydrolyzing activity. Vasopressin cell stimulation caused a biphasic increase of PDE4 activity, which peaked at 2 and 15 min and remained elevated for 48 h. In the continuous presence of vasopressin, cAMP levels and PKA activity were lowered. PDE4D3 overexpression increased spontaneous and vasopressin-dependent differentiation of L6-C5 cells. These results show that PDE4D3 plays a key role in the control of cAMP levels and differentiation of L6-C5 cells. Through the modulation of PDE4 activity, vasopressin inhibits the cAMP signal transduction pathway, which regulates myogenesis possibly by controlling the subcellular localization of myogenin. PMID:10588663

  19. Identification of Novel Genes Responsible for Overexpression of ampC in Pseudomonas aeruginosa PAO1

    PubMed Central

    Tsutsumi, Yuko; Tomita, Haruyoshi

    2013-01-01

    The development of resistance to antipseudomonal penicillins and cephalosporins mediated by the chromosomal ampC gene in Pseudomonas aeruginosa is of clinical importance. We isolated piperacillin-resistant mutants derived from P. aeruginosa PAO1 and analyzed two mutants that had an insertion in mpl and nuoN. One mutant, YT1677, was resistant to piperacillin and ceftazidime and had an insertion in mpl, which encodes UDP-N-acetylmuramate:l-alanyl-γ-d-glutamyl-meso-diaminopimelate ligase. The other mutant, YT7988, showed increased MICs of piperacillin, ceftazidime, cefepime, and cefoperazone, and the insertion was mapped to nuoN, which encodes NADH dehydrogenase I chain N. Complementation experiments demonstrated that these mutations resulted in higher levels of resistance to β-lactams. The expression of genes reported to be involved in β-lactam resistance was examined by real-time PCR in YT1677 and YT7988 mutants. Overexpression was observed for only ampC, and other genes were expressed normally. Deletion of the ampR gene in YT1677 and YT7988 resulted in decreased expression of ampC, indicating that the mutations in YT1677 and YT7988 affected the expression of ampC through the function of AmpR. PMID:24041903

  20. The role of ventral striatal cAMP signaling in stress-induced behaviors.

    PubMed

    Plattner, Florian; Hayashi, Kanehiro; Hernández, Adan; Benavides, David R; Tassin, Tara C; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W; Yuen, Eunice Y; Yan, Zhen; Goldberg, Matthew S; Nairn, Angus C; Greengard, Paul; Nestler, Eric J; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D; Bibb, James A

    2015-08-01

    The cAMP and cAMP-dependent protein kinase A (PKA) signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitated cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targeted the regulation of PDE4 by Cdk5, produced analogous effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression.

  1. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 3: AMPS payload to instruments ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    General physical, functional, and operational interface control requirements for instruments on the first AMPS payload are presented. Interface specifications are included to satisfy ground handling, prelaunch, launch, stowage, operation, and landing activities. Applicable supporting documentation to implement the information is also given.

  2. Effects of activation of protein kinase C (PKC) on the hormonal stimulation and inhibition of cAMP formation in intact human platelets

    SciTech Connect

    Williams, K.A.; Haslam, R.J.

    1986-05-01

    Washed platelets, labelled by preincubation with (/sup 3/H)adenine and (/sup 32/P)P/sub i/, were studied in the presence of indomethacin, phosphocreatine and creatine phosphokinase to block thromboxane A/sub 2/ formation and inhibitory effects of released ADP. Addition of phorbol 12-myristate 13-acetate (PMA) or 1,2-dioctanoyl-glycerol (diC/sub 8/) decreased the initial rate of accumulation of (/sup 3/H)cAMP observed with PGE/sub 1/ and 3-isobutyl 1- methylxanthine. Maximal decreases of 31% (1 ..mu..M PMA) and 42% (100 ..mu..M diC/sub 8/) were obtained. Also, the inhibition of (/sup 3/H)cAMP formation by epinephrine (5 ..mu..M) was decreased from 68% to 16% and 31% by 1..mu..M PMA and 100 ..mu..M diC/sub 8/, respectively. The effects of increasing concentrations of PMA and diC/sub 8/ on the stimulation of (/sup 3/H)cAMp formation by PGE/sub 1/ and on the inhibitory action of epinephrine correlated with increases in /sup 32/P incorporation into the major substrate of PKC (P47) and into two other polypeptides (P41 and P20). These results suggested that activation of PKC might explain the failure of some aggregating agents (e.g. PAF and vasopressin) to inhibit adenylate cyclase in intact platelets, although they are inhibitory with isolated membranes. However, comparison of the effects of PMA and these aggregating agents on the phosphorylation of platelet polypeptides indicated that activation of PKC by aggregating agents is inadequate to block their inhibitory effects on adenylate cyclase, when PGE/sub 1/ is present.

  3. Gene limiting cadmium accumulation in rice.

    PubMed

    Ueno, Daisei; Yamaji, Naoki; Kono, Izumi; Huang, Chao Feng; Ando, Tsuyu; Yano, Masahiro; Ma, Jian Feng

    2010-09-21

    Intake of toxic cadmium (Cd) from rice caused Itai-itai disease in the past and it is still a threat for human health. Therefore, control of the accumulation of Cd from soil is an important food-safety issue, but the molecular mechanism for the control is unknown. Herein, we report a gene (OsHMA3) responsible for low Cd accumulation in rice that was isolated from a mapping population derived from a cross between a high and low Cd-accumulating cultivar. The gene encodes a transporter belonging to the P(1B)-type ATPase family, but shares low similarity with other members. Heterologous expression in yeast showed that the transporter from the low-Cd cultivar is functional, but the transporter from the high-Cd cultivar had lost its function, probably because of the single amino acid mutation. The transporter is mainly expressed in the tonoplast of root cells at a similar level in both the low and high Cd-accumulating cultivars. Overexpression of the functional gene from the low Cd-accumulating cultivar selectively decreased accumulation of Cd, but not other micronutrients in the grain. Our results indicated that OsHMA3 from the low Cd-accumulating cultivar limits translocation of Cd from the roots to the above-ground tissues by selectively sequestrating Cd into the root vacuoles.

  4. Induction of triglyceride accumulation and mitochondrial maintenance in muscle cells by lactate.

    PubMed

    Sun, Jingquan; Ye, Xin; Xie, Minhao; Ye, Jianping

    2016-01-01

    Muscle exercise induces intramuscular triglyceride (TG) accumulation and promotes mitochondrial maintenance in myotubes. However, the mechanism underlying exercise effects remains unknown. In this study, lactic acid was tested as a signaling molecule in C2C12 myotubes to understand the mechanism. Intracellular TG storage was induced in the cells by sodium lactate. The lactate activity was observed with an inhibition of the cAMP-PKA pathway as indicated by a reduction in the phosphorylation status of CREB (pCREB). Induction of pCREB signal by forskolin was blocked by pretreatment of cells with lactate. The impact of lactate on mitochondrial function was examined with a focus on the activities of two enzymes, MCAT (malonylCoA:ACP transferase) and PDH (pyruvate dehydrogenase). The enzyme activities were induced in the cells by lactate. Expression of the lactate receptor (GPR81) and lactate transporters (MCT1/4) were induced as well by lactate. The lactate activities were observed at concentrations between 4-64 mM, and were not dependent on the increase in intracellular pyruvate. Pyruvate treatment did not generate the same effects in the cells. Those results suggest that lactate may induce intramuscular TG storage and mitochondrial maintenance in myotubes through inhibition of the cAMP pathway by activation of GPR81 in a positive feedback manner. PMID:27645401

  5. Induction of triglyceride accumulation and mitochondrial maintenance in muscle cells by lactate

    PubMed Central

    Sun, Jingquan; Ye, Xin; Xie, Minhao; Ye, Jianping

    2016-01-01

    Muscle exercise induces intramuscular triglyceride (TG) accumulation and promotes mitochondrial maintenance in myotubes. However, the mechanism underlying exercise effects remains unknown. In this study, lactic acid was tested as a signaling molecule in C2C12 myotubes to understand the mechanism. Intracellular TG storage was induced in the cells by sodium lactate. The lactate activity was observed with an inhibition of the cAMP-PKA pathway as indicated by a reduction in the phosphorylation status of CREB (pCREB). Induction of pCREB signal by forskolin was blocked by pretreatment of cells with lactate. The impact of lactate on mitochondrial function was examined with a focus on the activities of two enzymes, MCAT (malonylCoA:ACP transferase) and PDH (pyruvate dehydrogenase). The enzyme activities were induced in the cells by lactate. Expression of the lactate receptor (GPR81) and lactate transporters (MCT1/4) were induced as well by lactate. The lactate activities were observed at concentrations between 4–64 mM, and were not dependent on the increase in intracellular pyruvate. Pyruvate treatment did not generate the same effects in the cells. Those results suggest that lactate may induce intramuscular TG storage and mitochondrial maintenance in myotubes through inhibition of the cAMP pathway by activation of GPR81 in a positive feedback manner. PMID:27645401

  6. Induction of triglyceride accumulation and mitochondrial maintenance in muscle cells by lactate.

    PubMed

    Sun, Jingquan; Ye, Xin; Xie, Minhao; Ye, Jianping

    2016-09-20

    Muscle exercise induces intramuscular triglyceride (TG) accumulation and promotes mitochondrial maintenance in myotubes. However, the mechanism underlying exercise effects remains unknown. In this study, lactic acid was tested as a signaling molecule in C2C12 myotubes to understand the mechanism. Intracellular TG storage was induced in the cells by sodium lactate. The lactate activity was observed with an inhibition of the cAMP-PKA pathway as indicated by a reduction in the phosphorylation status of CREB (pCREB). Induction of pCREB signal by forskolin was blocked by pretreatment of cells with lactate. The impact of lactate on mitochondrial function was examined with a focus on the activities of two enzymes, MCAT (malonylCoA:ACP transferase) and PDH (pyruvate dehydrogenase). The enzyme activities were induced in the cells by lactate. Expression of the lactate receptor (GPR81) and lactate transporters (MCT1/4) were induced as well by lactate. The lactate activities were observed at concentrations between 4-64 mM, and were not dependent on the increase in intracellular pyruvate. Pyruvate treatment did not generate the same effects in the cells. Those results suggest that lactate may induce intramuscular TG storage and mitochondrial maintenance in myotubes through inhibition of the cAMP pathway by activation of GPR81 in a positive feedback manner.

  7. Requirement of cAMP Signaling for Schwann Cell Differentiation Restricts the Onset of Myelination

    PubMed Central

    Bacallao, Ketty; Monje, Paula V.

    2015-01-01

    Isolated Schwann cells (SCs) respond to cAMP elevation by adopting a differentiated post-mitotic state that exhibits high levels of Krox-20, a transcriptional enhancer of myelination, and mature SC markers such as the myelin lipid galactocerebroside (O1). To address how cAMP controls myelination, we performed a series of cell culture experiments which compared the differentiating responses of isolated and axon-related SCs to cAMP analogs and ascorbate, a known inducer of axon ensheathment, basal lamina formation and myelination. In axon-related SCs, cAMP induced the expression of Krox-20 and O1 without a concomitant increase in the expression of myelin basic protein (MBP) and without promoting axon ensheathment, collagen synthesis or basal lamina assembly. When cAMP was provided together with ascorbate, a dramatic enhancement of MBP expression occurred, indicating that cAMP primes SCs to form myelin only under conditions supportive of basal lamina formation. Experiments using a combination of cell permeable cAMP analogs and type-selective adenylyl cyclase (AC) agonists and antagonists revealed that selective transmembrane AC (tmAC) activation with forskolin was not sufficient for full SC differentiation and that the attainment of an O1 positive state also relied on the activity of the soluble AC (sAC), a bicarbonate sensor that is insensitive to forskolin and GPCR activation. Pharmacological and immunological evidence indicated that SCs expressed sAC and that sAC activity was required for morphological differentiation and the expression of myelin markers such as O1 and protein zero. To conclude, our data indicates that cAMP did not directly drive myelination but rather the transition into an O1 positive state, which is perhaps the most critical cAMP-dependent rate limiting step for the onset of myelination. The temporally restricted role of cAMP in inducing differentiation independently of basal lamina formation provides a clear example of the uncoupling of signals

  8. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells

    PubMed Central

    Poole, Jill A.; Nordgren, Tara M.; DeVasure, Jane M.; Heires, Art J.; Bailey, Kristina L.; Romberger, Debra J.

    2014-01-01

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  9. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells.

    PubMed

    Wyatt, Todd A; Poole, Jill A; Nordgren, Tara M; DeVasure, Jane M; Heires, Art J; Bailey, Kristina L; Romberger, Debra J

    2014-10-15

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3',5'-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  10. Requirement of cAMP signaling for Schwann cell differentiation restricts the onset of myelination.

    PubMed

    Bacallao, Ketty; Monje, Paula V

    2015-01-01

    Isolated Schwann cells (SCs) respond to cAMP elevation by adopting a differentiated post-mitotic state that exhibits high levels of Krox-20, a transcriptional enhancer of myelination, and mature SC markers such as the myelin lipid galactocerebroside (O1). To address how cAMP controls myelination, we performed a series of cell culture experiments which compared the differentiating responses of isolated and axon-related SCs to cAMP analogs and ascorbate, a known inducer of axon ensheathment, basal lamina formation and myelination. In axon-related SCs, cAMP induced the expression of Krox-20 and O1 without a concomitant increase in the expression of myelin basic protein (MBP) and without promoting axon ensheathment, collagen synthesis or basal lamina assembly. When cAMP was provided together with ascorbate, a dramatic enhancement of MBP expression occurred, indicating that cAMP primes SCs to form myelin only under conditions supportive of basal lamina formation. Experiments using a combination of cell permeable cAMP analogs and type-selective adenylyl cyclase (AC) agonists and antagonists revealed that selective transmembrane AC (tmAC) activation with forskolin was not sufficient for full SC differentiation and that the attainment of an O1 positive state also relied on the activity of the soluble AC (sAC), a bicarbonate sensor that is insensitive to forskolin and GPCR activation. Pharmacological and immunological evidence indicated that SCs expressed sAC and that sAC activity was required for morphological differentiation and the expression of myelin markers such as O1 and protein zero. To conclude, our data indicates that cAMP did not directly drive myelination but rather the transition into an O1 positive state, which is perhaps the most critical cAMP-dependent rate limiting step for the onset of myelination. The temporally restricted role of cAMP in inducing differentiation independently of basal lamina formation provides a clear example of the uncoupling of signals

  11. Microbial accumulation of uranium, radium, and cesium

    SciTech Connect

    Strandberg, G.W.; Shumate, S.E. II; Parrott, J.R. Jr.; North, S.E.

    1981-05-01

    Diverse microbial species varied considerably in their ability to accumulate uranium, cesium, and radium. Mechanistic differences in uranium uptake by Saccharomyces cerevisiae and Pseudomonas aeruginosa were indicated. S. serevisiae exhibited a slow (hours) surface accumulation of uranium which was subject to environmental factors, while P. aeruginosa accumulated uranium rapidly (minutes) as dense intracellular deposits and did not appear to be affected by environmental parameters. Metabolism was not required for uranium uptake by either organism. Cesium and radium were concentrated to a considerably lesser extent than uranium by the several species tested.

  12. Studies of the cAMP mediated aggregation in Dictyostelium discoideum: receptor mediated activation of the adenylate cyclase

    SciTech Connect

    Theibert, W.E.A.B.

    1985-01-01

    Dictyostelium discoideum, a eukaryotic amoeba of the cellular slime mold family, provides an interesting paradigm in developmental biology. During development, hundreds of thousands of cells aggregate to form a multicellular aggregate. Aggregation is mediated by chemotaxis and chemical signaling. Waves of adenosine 3'-5' cyclic monophosphate (cAMP) propagate through the monolayer and provide transient gradients for chemotaxis. The author has used a reversible inhibitor of the cAMP signaling response to demonstrate that adaptation to cAMP is independent of the activation of the adenylate cyclase and therefore is not caused by the rise in intracellular cAMP. Next, it is shown that adenosine inhibits the cAMP signaling response. Inhibition is rapid, reversible, and depends on the cAMP stimulus concentration. Then the specificity of the cAMP receptors which mediates signaling is determined and compared with the receptors which mediate chemotaxis, the cGMP response, and cAMP binding antagonism. The cAMP surface receptor has been identified by photoaffinity labeling intact cells with (/sup 32/P)-8-N/sub 3/-cAMP using an ammonium sulfate binding stabilization technique. The photoactivated ligand specifically labels a polypeptide, localized to the membrane fraction, which migrates as a closely spaced doublet on SDS Page.

  13. Autocrine activation of neuronal NMDA receptors by aspartate mediates dopamine- and cAMP-induced CREB-dependent gene transcription.

    PubMed

    Almeida, Luis E F; Murray, Peter D; Zielke, H Ronald; Roby, Clinton D; Kingsbury, Tami J; Krueger, Bruce K

    2009-10-01

    cAMP can stimulate the transcription of many activity-dependent genes via activation of the transcription factor, cAMP response element-binding protein (CREB). However, in mouse cortical neuron cultures, prior to synaptogenesis, neither cAMP nor dopamine, which acts via cAMP, stimulated CREB-dependent gene transcription when NR2B-containing NMDA receptors (NMDARs) were blocked. Stimulation of transcription by cAMP was potentiated by inhibitors of excitatory amino acid uptake, suggesting a role for extracellular glutamate or aspartate in cAMP-induced transcription. Aspartate was identified as the extracellular messenger: enzymatic scavenging of l-aspartate, but not glutamate, blocked stimulation of CREB-dependent gene transcription by cAMP; moreover, cAMP induced aspartate but not glutamate release. Together, these results suggest that cAMP acts via an autocrine or paracrine pathway to release aspartate, which activates NR2B-containing NMDARs, leading to Ca(2+) entry and activation of transcription. This cAMP/aspartate/NMDAR signaling pathway may mediate the effects of transmitters such as dopamine on axon growth and synaptogenesis in developing neurons or on synaptic plasticity in mature neural networks.

  14. Folic acid supplementation during high-fat diet feeding restores AMPK activation via an AMP-LKB1-dependent mechanism.

    PubMed

    Sid, Victoria; Wu, Nan; Sarna, Lindsei K; Siow, Yaw L; House, James D; O, Karmin

    2015-11-15

    AMPK is an endogenous energy sensor that regulates lipid and carbohydrate metabolism. Nonalcoholic fatty liver disease (NAFLD) is regarded as a hepatic manifestation of metabolic syndrome with impaired lipid and glucose metabolism and increased oxidative stress. Our recent study showed that folic acid supplementation attenuated hepatic oxidative stress and lipid accumulation in high-fat diet-fed mice. The aim of the present study was to investigate the effect of folic acid on hepatic AMPK during high-fat diet feeding and the mechanisms involved. Male C57BL/6J mice were fed a control diet (10% kcal fat), a high-fat diet (60% kcal fat), or a high-fat diet supplemented with folic acid (26 mg/kg diet) for 5 wk. Mice fed a high-fat diet exhibited hyperglycemia, hepatic cholesterol accumulation, and reduced hepatic AMPK phosphorylation. Folic acid supplementation restored AMPK phosphorylation (activation) and reduced blood glucose and hepatic cholesterol levels. Activation of AMPK by folic acid was mediated through an elevation of its allosteric activator AMP and activation of its upstream kinase, namely, liver kinase B1 (LKB1) in the liver. Consistent with in vivo findings, 5-methyltetrahydrofolate (bioactive form of folate) restored phosphorylation (activation) of both AMPK and LKB1 in palmitic acid-treated HepG2 cells. Activation of AMPK by folic acid might be responsible for AMPK-dependent phosphorylation of HMG-CoA reductase, leading to reduced hepatic cholesterol synthesis during high-fat diet feeding. These results suggest that folic acid supplementation may improve cholesterol and glucose metabolism by restoration of AMPK activation in the liver.

  15. AmpG is required for BlaXc beta-lactamase expression in Xanthomonas campestris pv. campestris str. 17.

    PubMed

    Yang, Tsuey-Ching; Chen, Tzu-Fan; Tsai, Jeffrey J P; Hu, Rouh-Mei

    2013-03-01

    The chromosomal ampR(Xc) -bla(Xc) module is essential for the β-lactam resistance of Xanthomonas campestris pv. campestris. Bla(Xc) β-lactamase is expressed at a high basal level in the absence of an inducer and its expression can be further induced by β-lactam. In enterobacteria, ampG encodes an inner membrane facilitator involved in the recycling of murein degradation compounds. An isogenic ampG mutant (XcampG) of X. campestris pv. campestris str. 17 (Xc17) was constructed to investigate the link between murein recycling and bla(Xc) expression. Our data demonstrate that (1) XcampG is susceptible to β-lactam antibiotics; (2) AmpG(Xc) is essential for expression of bla(Xc) ; (3) AmpGs of Xc17, Stenotrophomonas maltophilia KJ (SmKJ) and Escherichia coli DH5α can complement the defect of XcampG; (4) overexpression of AmpG(X) (c) significantly increased bla(Xc) expression; and (5) AmpG(Xc) from Xc17 is able to restore β-lactamase induction of the ampN(Xc) -ampG(Xc) double mutant of SmKJ. In Xc17, ampG(Xc) can be expressed from the promoter residing in the intergenic region of ampN(Xc) -ampG(Xc) and the expression is independent of β-lactam induction. AmpN, which is required for β-lactamases induction in SmKJ, is not required for the β-lactam antibiotic resistance of Xc17.

  16. Bai-Hu-Jia-Ren-Shen-Tang Decoction Reduces Fatty Liver by Activating AMP-Activated Protein Kinase In Vitro and In Vivo

    PubMed Central

    Liu, Hui-Kang; Hung, Tzu-Min; Huang, Hsiu-Chen; Lee, I-Jung; Chang, Chia-Chuan; Cheng, Jing-Jy; Lin, Lie-Chwen; Huang, Cheng

    2015-01-01

    Obesity and associated conditions, such as type 2 diabetes mellitus (T2DM) and nonalcoholic fatty liver disease (NAFLD), are currently a worldwide health problem. In Asian traditional medicine, Bai-Hu-Jia-Ren-Shen-Tang (BHJRST) is widely used in diabetes patients to reduce thirst. However, whether it has a therapeutic effect on T2DM or NAFLD is not known. The aim of this study was to examine whether BHJRST had a lipid-lowering effect using a HuS-E/2 cell model of fatty liver induced by palmitate and in a db/db mouse model of dyslipidemia. Incubation of HuS-E/2 cells with palmitate markedly increased lipid accumulation and expression of adipose triglyceride lipase (ATGL), which is involved in lipolysis. BHJRST significantly decreased lipid accumulation and increased ATGL levels and phosphorylation of AMP-activated protein kinase (AMPK) and its primary downstream target, acetyl-CoA carboxylase (ACC), which are involved in fatty acid oxidation. Furthermore, after twice daily oral administration for six weeks, BHJRST significantly reduced hepatic fat accumulation in db/db mice, as demonstrated by increased hepatic AMPK and ACC phosphorylation, reduced serum triglyceride levels, and reduced hepatic total lipid content. The results show that BHJRST has a lipid-lowering effect in the liver that is mediated by activation of the AMPK signaling pathway. PMID:26508982

  17. Thyroid-stimulating hormone stimulates increases in inositol phosphates as well as cyclic AMP in the FRTL-5 rat thyroid cell line.

    PubMed Central

    Field, J B; Ealey, P A; Marshall, N J; Cockcroft, S

    1987-01-01

    Studies were conducted to determine whether thyroid-stimulating hormone (TSH; thyrotropin), a hormone known to increase cytosol concentrations of cyclic AMP, also stimulates the formation of inositol phosphates in thyroid cells. TSH and noradrenaline both stimulated [3H]inositol phosphate formation in a concentration-dependent manner in the rat thyroid cell line, FRTL-5 cells, which had been prelabelled with [3H]inositol. The threshold concentration of TSH required to stimulate inositol phosphate formation was more than 20 munits/ml, which is approx. 10(3)-fold greater than that required for cyclic AMP accumulation and growth in these cells. We also demonstrate that membranes prepared from FRTL-5 cells possess a guanine nucleotide-activatable polyphosphoinositide phosphodiesterase, which suggests that activation of inositide metabolism in these cells may be coupled to receptors by the G-protein, Gp. Our findings suggest that two second-messenger systems exist to mediate the action of TSH in the thyroid. PMID:2827631

  18. The Popeye domain containing protein family – A novel class of cAMP effectors with important functions in multiple tissues

    PubMed Central

    Schindler, Roland F.R.; Brand, Thomas

    2016-01-01

    Popeye domain containing (Popdc) proteins are a unique family, which combine several different properties and functions in a surprisingly complex fashion. They are expressed in multiple tissues and cell types, present in several subcellular compartments, interact with different classes of proteins, and are associated with a variety of physiological and pathophysiological processes. Moreover, Popdc proteins bind the second messenger cAMP with high affinity and it is thought that they act as a novel class of cAMP effector proteins. Here, we will review the most important findings about the Popdc family, which accumulated since its discovery about 15 years ago. We will be focussing on Popdc protein interaction and function in striated muscle tissue. However, as a full picture only emerges if all aspects are taken into account, we will also describe what is currently known about the role of Popdc proteins in epithelial cells and in various types of cancer, and discuss these findings with regard to their relevance for cardiac and skeletal muscle. PMID:26772438

  19. Crystallization of the glycogen-binding domain of the AMP-activated protein kinase β subunit and preliminary X-ray analysis

    SciTech Connect

    Polekhina, Galina Feil, Susanne C.; Gupta, Abhilasha; O’Donnell, Paul; Stapleton, David; Parker, Michael W.

    2005-01-01

    The glycogen-binding domain of the AMP-activated kinase β subunit has been crystallized in the presence of β-cyclodextrin. The structure has been determined by single isomorphous replacement and threefold averaging using in-house X-ray data collected from selenomethionine-substituted protein. AMP-activated protein kinase (AMPK) is an intracellular energy sensor that regulates metabolism in response to energy demand and supply by adjusting the ATP-generating and ATP-consuming pathways. AMPK potentially plays a critical role in diabetes and obesity as it is known to be activated by metforin and rosiglitazone, drugs used for the treatment of type II diabetes. AMPK is a heterotrimer composed of a catalytic α subunit and two regulatory subunits, β and γ. Mutations in the γ subunit are known to cause glycogen accumulation, leading to cardiac arrhythmias. Recently, a functional glycogen-binding domain (GBD) has been identified in the β subunit. Here, the crystallization of GBD in the presence of β-cyclodextrin is reported together with preliminary X-ray data analysis allowing the determination of the structure by single isomorphous replacement and threefold averaging using in-house X-ray data collected from a selenomethionine-substituted protein.

  20. Responses of protein phosphatases and cAMP-dependent protein kinase in a freeze-avoiding insect, Epiblema scudderiana.

    PubMed

    Pfister, Thomas D; Storey, Kenneth B

    2006-05-01

    Larvae of the goldenrod gall moth, Epiblema scudderiana, use the freeze avoidance strategy of winter cold hardiness and show multiple metabolic adaptations for subzero survival including accumulation of large amounts of glycerol as a colligative antifreeze. Induction and regulation of cold hardiness adaptations requires the intermediary action of signal transduction enzymes. Changes in the activities of several signaling enzymes including cAMP-dependent protein kinase (PKA), protein phosphatases 1 (PP1), 2A, 2C, and protein tyrosine phosphatases (PTPs) were monitored over the winter and during experimental exposures of larvae to subzero temperatures (-4 degrees C, a temperature that triggers rapid glycerol synthesis, or -20 degrees C, a common midwinter ambient temperature) or anoxia. A strong increase in the amount of active PP1 in the latter part of the winter may be responsible for shutting off glycogenolysis once glycerol levels are maximized. There appears to be a limited role for PKA in overwintering but PP2A and PP2C activities rose when larvae were exposed to -20 degrees C and PTP activities rose significantly over the winter months and also in response to laboratory subzero (-20 degrees C) and anoxia exposures. The strong responses by PTPs suggest that these may be involved in cell cycle and growth arrest during winter diapause.

  1. AMP-Activated Kinase Regulates Lipid Droplet Localization and Stability of Adipose Triglyceride Lipase in C. elegans Dauer Larvae.

    PubMed

    Xie, Meng; Roy, Richard

    2015-01-01

    Animals have developed diverse mechanisms to adapt to their changing environment. Like many organisms the free-living nematode C. elegans can alternate between a reproductive mode or a diapause-like "dauer" stage during larval development to circumvent harsh environmental conditions. The master metabolic regulator AMP-activated protein kinase (AMPK) is critical for survival during the dauer stage, where it phosphorylates adipose triglyceride lipase (ATGL-1) at multiple sites to block lipid hydrolysis and ultimately protect the cellular triglyceride-based energy depot from rapid depletion. However, how the AMPK-mediated phosphorylation affects the function of ATGL-1 has not been characterised at the molecular level. Here we show that AMPK phosphorylation leads to the generation of 14-3-3 binding sites on ATGL-1, which are recognized by the C. elegans 14-3-3 protein orthologue PAR-5. Physical interaction of ATGL-1 with PAR-5 results in sequestration of ATGL-1 away from the lipid droplets and eventual proteasome-mediated degradation. In addition, we also show that the major AMPK phosphorylation site on ATGL-1, Ser 303, is required for both modification of its lipid droplet localization and its degradation. Our data provide mechanistic insight as to how AMPK functions to enhance survival through its ability to protect the accumulated triglyceride deposits from rapid hydrolysis to preserve the energy stores during periods of extended environmental duress. PMID:26098762

  2. Viola mandshurica ethanolic extract prevents high-fat-diet-induced obesity in mice by activating AMP-activated protein kinase.

    PubMed

    Sung, Yoon-Young; Kim, Dong-Seon; Kim, Ho Kyoung

    2014-07-01

    Viola mandshurica W. Becker has been used as an expectorant, diuretic, and anti-inflammatory agent. We evaluated the effects of V. mandshurica ethanol extract (VME) on high-fat-diet (HFD)-induced obesity in mice. HPLC analysis showed that the VME contained 11.95 ± 0.37 mg/g esculetin and 0.13 ± 0.01 mg/g scopoletin. Orally administered VME decreased the body weight, adipose tissue mass, adipocyte size, and triglyceride and leptin serum concentrations. In contrast, VME increased serum adiponectin concentrations and adiponectin expression levels in epididymal adipose tissues. VME also significantly reversed the HFD-induced elevation of the mRNA and protein levels of lipogenic genes such as peroxisome proliferator-activated receptor γ, sterol regulatory element-binding protein-1c, fatty-acid synthase, and adipocyte protein 2. Moreover, VME reversed the HFD-induced inhibition of AMP-activated protein kinase (AMPK) and acetyl-coA carboxylase phosphorylation in epididymal adipose tissues. Furthermore, treatment of VME and esculetin in 3T3-L1 cells inhibited adipocyte differentiation and fat accumulation. These results suggest that VME exerts anti-obesity effects in HFD-induced obese mice by activating AMPK and suppressing PPARγ expression in adipose tissues.

  3. Dibenzoylmethane Exerts Metabolic Activity through Regulation of AMP-Activated Protein Kinase (AMPK)-Mediated Glucose Uptake and Adipogenesis Pathways

    PubMed Central

    Kim, Nami; Kim, Hong Min; Lee, Eun Soo; Lee, Jung Ok; Lee, Hye Jeong; Lee, Soo Kyung; Moon, Ji Wook; Kim, Ji Hae; Kim, Joong Kwan; Kim, Su Jin; Park, Sun Hwa; Chung, Choon Hee; Kim, Hyeon Soo

    2015-01-01

    Dibenzoylmethane (DBM) has been shown to exert a variety of beneficial effects on human health. However, the mechanism of action is poorly understood. In this study, DBM increased phosphorylation of AMP-activated protein kinase (AMPK) and stimulated glucose uptake in a skeletal muscle cell line. Both knockdown of AMPK with siRNA and inhibition with AMPK inhibitor blocked DBM-induced glucose uptake. DBM increased the concentration of intracellular calcium and glucose uptake due to DBM was abolished by STO-609 (a calcium/calmodulin-dependent protein kinase inhibitor). DBM stimulated phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK), which was blocked by pretreatment with compound C, an AMPK inhibitor. The expression of glucose transporter type 4 (GLUT4) was increased by DBM. The translocation of GLUT4 to the plasma membrane was also increased by DBM in AMPK dependently. In addition, DBM suppressed weight gain and prevented fat accumulation in the liver and abdomen in mice fed a high-fat diet. In pre-adipocyte cells, DBM decreased the activity of acetyl-CoA carboxylase (ACC), the rate-limiting enzyme of fatty acid synthesis. Expression of the adipogenic gene, fatty acid synthase (FAS), was suppressed by DBM in an AMPK-dependent manner. These results showed that the beneficial metabolic effects of DBM might be due to regulation of glucose uptake via AMPK in skeletal muscle and inhibition of adipogenesis in pre-adipocytes. PMID:25756788

  4. AMP-Activated Kinase Regulates Lipid Droplet Localization and Stability of Adipose Triglyceride Lipase in C. elegans Dauer Larvae

    PubMed Central

    Xie, Meng; Roy, Richard

    2015-01-01

    Animals have developed diverse mechanisms to adapt to their changing environment. Like many organisms the free-living nematode C. elegans can alternate between a reproductive mode or a diapause-like "dauer" stage during larval development to circumvent harsh environmental conditions. The master metabolic regulator AMP-activated protein kinase (AMPK) is critical for survival during the dauer stage, where it phosphorylates adipose triglyceride lipase (ATGL-1) at multiple sites to block lipid hydrolysis and ultimately protect the cellular triglyceride-based energy depot from rapid depletion. However, how the AMPK-mediated phosphorylation affects the function of ATGL-1 has not been characterised at the molecular level. Here we show that AMPK phosphorylation leads to the generation of 14-3-3 binding sites on ATGL-1, which are recognized by the C. elegans 14-3-3 protein orthologue PAR-5. Physical interaction of ATGL-1 with PAR-5 results in sequestration of ATGL-1 away from the lipid droplets and eventual proteasome-mediated degradation. In addition, we also show that the major AMPK phosphorylation site on ATGL-1, Ser 303, is required for both modification of its lipid droplet localization and its degradation. Our data provide mechanistic insight as to how AMPK functions to enhance survival through its ability to protect the accumulated triglyceride deposits from rapid hydrolysis to preserve the energy stores during periods of extended environmental duress. PMID:26098762

  5. Resveratrol up-regulates AMPA receptor expression via AMP-activated protein kinase-mediated protein translation.

    PubMed

    Wang, Guan; Amato, Stephen; Gilbert, James; Man, Heng-Ye

    2015-08-01

    Resveratrol is a phytoalexin that confers overall health benefits including positive regulation in brain function such as learning and cognition. However, whether and how resveratrol affects synaptic activity remains largely unknown. α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) are glutamatergic receptors that mediate the majority of fast excitatory transmission and synaptic plasticity, and thus play a critical role in higher brain functions, including learning and memory. We find that in rat primary neurons, resveratrol can rapidly increase AMPAR protein level, AMPAR synaptic accumulation and the strength of excitatory synaptic transmission. The resveratrol effect on AMPAR protein expression is independent of sirtuin 1 (SIRT1), the conventional downstream target of resveratrol, but rather is mediated by AMP-activated protein kinase (AMPK) and subsequent downstream phosphoinositide 3-kinase (PI3K)/Akt signaling. Application of the AMPK specific activator 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) mimics the effects of resveratrol on both signaling and AMPAR expression. The resveratrol-induced increase in AMPAR expression results from elevated protein synthesis via regulation of the eukaryotic initiation factor (eIF) 4E/4G complex. Disruption of the translation initiation complex completely blocks resveratrol-dependent AMPAR up-regulation. These findings indicate that resveratrol may regulate brain function through facilitation of AMPAR biogenesis and synaptic transmission.

  6. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli

    PubMed Central

    El Mahdy, Taghrid S.; Shibl, Atef M.

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried blaCTX-M-15, and two isolates carried blaCTX-M-14 gene. Two CTX-M-positive E. coli isolates carried blaCMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  7. Cholesterol ester hydrolase in pig liver is activated by cyclic AMP-dependent protein kinase

    SciTech Connect

    Chen, J.J.S.; Dubin, E.; Margolis, S.

    1986-05-01

    To examine whether hepatic neutral cholesterol ester hydrolase (CEH) is regulated by phosphorylation, the authors have assayed CEH activity from pig liver cytosol by measuring /sup 14/C-oleate release from labeled cholesteryl oleate at pH 7.4. When pig liver cytosol was incubated with 2 mM Mg and 0.5 mM ATP, CEH activity was increased (141 +/- 8% of control, mean +/- SEM). Addition of 25..mu..M cyclic AMP (cAMP) further activated CEH activity (164 +/- 4% of control) as compared to incubation with Mg and ATP (p < 0.02). In the presence of 5 mM EDTA or in the absence of either Mg or ATP, no activation of CEH was observed. The activation was completely abolished by further incubation of activated cytosol with E. coli alkaline phosphatase. Activation of CEH activity was partially prevented by the addition of protein kinase inhibitor (p < 0.02) and this effect was completely reversed in the presence of exogenous cAMP-dependent protein kinase (p < 0.05). To examine further the role of the cAMP-dependent protein kinase, CEH activity was purified 240-fold by 35% (NH/sub 4/)/sub 2/SO/sub 4/ precipitation and Sepharose 4B chromatography. Incubation of partially purified CEH fractions with Mg, ATP and cAMP did not increase CEH activity. Addition of exogenous cAMP-dependent protein kinase activated CEH activity of partially purified fractions. The authors observations indicate that pig liver CEH is activated by phosphorylation mediated by cAMP-dependent protein kinase.

  8. Effect of Elevated Intracellular cAMP Levels on Actomyosin Contraction in Bovine Trabecular Meshwork Cells

    PubMed Central

    Ramachandran, Charanya; Patil, Rajkumar V.; Sharif, Najam A.

    2011-01-01

    Purpose. Elevated cAMP in the trabecular meshwork (TM) cells increases the aqueous humor outflow facility. The authors investigated the mechanisms by which elevated cAMP opposes the RhoA-Rho kinase pathway, leading to the relaxation of the actomyosin system in bovine TM cells. Methods. Forskolin (Fsk) and rolipram were used to elevate cAMP levels. Changes in the phosphorylation of RhoA at Ser188 (a putative inhibitory site), the regulatory light chain of myosin (pMLC), and the regulatory subunit of myosin phosphatase (MYPT1) were determined by Western blot analysis. The actomyosin contraction was measured by collagen gel contraction (CGC) assay. The impact of cAMP on cell-matrix adhesion was followed by immunostaining of focal adhesion proteins and by electric cell-substrate impedance sensing. Results. Elevated cAMP led to an increase in the phosphorylation of RhoA at Ser188, to the inhibition of endothelin-1 (ET-1)–induced activation of RhoA, and to the formation of stress fibers. The loss of pMLC along the stress fibers was comparable to that induced by Y-27632 (Rho kinase inhibitor). A concomitant reduction in both MYPT1 phosphorylation and pMLC was observed. Elevated cAMP also reduced (ET-1)–induced CGC and the cell-substrate resistance by >50%. Conclusions. In TM cells, elevated cAMP leads to the phosphorylation of RhoA at Ser188. Consequent inhibition of RhoA activity reduces the phosphorylation of MYPT1 at Thr853, leading to a reduction in MLC phosphorylation and actomyosin contraction. These actions, similar to those of the Rho kinase inhibitors, possibly underlie the reported increase in outflow facility in response to Fsk perfusion ex vivo. PMID:21071747

  9. Influence of cAMP on reporter bioassays for dioxin and dioxin-like compounds

    SciTech Connect

    Kasai, Ayumi; Yao, Jian; Yamauchi, Kozue; Hiramatsu, Nobuhiko; Hayakawa, Kunihiro; Meng, Yiman; Maeda, Shuichiro; Kitamura, Masanori . E-mail: masanori@yamanashi.ac.jp

    2006-02-15

    In reporter assays for detection of dioxins, the dioxin-responsive element (DRE) is generally used as a sensor sequence. In several systems, the CYP1A1 promoter containing DREs (DRE{sup cyp}) is inserted into a part of the long terminal repeat of mouse mammary tumor virus (LTR{sup MMTV}) to improve sensitivity of assays. We found that DRE{sup cyp}-LTR{sup MMTV} responds not only to dioxins and dioxin-like compounds but also to forskolin, a cAMP-elevating agent. This effect was dose-dependent and reproduced by other cAMP-elevating agents including 8-bromo-cAMP and 3-isobutyl-methylxanthine. The cAMP response element (CRE) and CRE-like sequences were absent in DRE{sup cyp}-LTR{sup MMTV} and not involved in this process. In contrast to the effect of dioxin, the activation of DRE{sup cyp}-LTR{sup MMTV} by cAMP was independent of the aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor for DRE. Furthermore, neither DRE{sup cyp}, LTR{sup MMTV} nor the consensus sequence of DRE alone was activated in response to cAMP. These data elucidated for the first time that the combination of DRE{sup cyp} with LTR{sup MMTV} causes a peculiar response to cAMP and suggested that use of AhR antagonists is essential to exclude false-positive responses of DRE{sup cyp}-LTR{sup MMTV}-based bioassays for detection and quantification of dioxins and dioxin-like compounds.

  10. Expression of nitric oxide synthase in rat glomerular mesangial cells mediated by cyclic AMP.

    PubMed Central

    Mühl, H.; Kunz, D.; Pfeilschifter, J.

    1994-01-01

    1. Treatment of rat mesangial cells with interleukin 1 beta (IL-1 beta) or tumour necrosis factor alpha (TNF alpha) has been shown to induce a macrophage-type of nitric oxide (NO) synthase. Here we report that adenosine 3':5'-cyclic monophosphate (cyclic AMP) is another mediator that triggers induction of NO synthase in mesangial cells. 2. Incubation of mesangial cells with the beta-adrenoceptor agonist, salbutamol, forskolin or cholera toxin, which all activate adenylate cyclase and increase intracellular cyclic AMP concentration, increased nitrite formation in a dose-dependent manner. Likewise, the addition of the membrane-permeable cyclic AMP analogue, N6, 0-2'-dibutyryladenosine 3',5'-phosphate (Bt2 cyclic AMP) or the phosphodiesterase inhibitor, 3-isobutyl-1-methylxanthine enhanced NO synthase activity in a dose-dependent manner. 3. There was a lag period of about 8 h before a significantly enhanced secretion of nitrite could be detected upon exposure of cells to forskolin and for maximal stimulation, forskolin had to be present during the whole incubation period. 4. Treatment of mesangial cells with actinomycin D, cycloheximide or dexamethasone completely suppressed forskolin-stimulated NO-synthase activity, thus demonstrating that transcription and protein synthesis are necessary for nitrite formation. 5. Bt2 cyclic AMP, the most potent inducer of nitrite production, increased NO synthase mRNA levels in mesangial cells in a time- and dose-dependent fashion. Dexamethasone completely inhibited the increase of NO synthase mRNA in response to Bt2 cyclic AMP. 6. Combination of Bt2 cyclic AMP and IL-1 beta or TNF alpha revealed a strong synergy in terms of nitrite formation.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 7 Figure 8 Figure 9 PMID:7518300

  11. Nuclease-resistant c-di-AMP derivatives that differentially recognize RNA and protein receptors

    PubMed Central

    Meehan, Robert E.; Torgerson, Chad D.; Gaffney, Barbara L.; Jones, Roger A.; Strobel, Scott A.

    2016-01-01

    The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3’-5’-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activate specific pathways and mediate phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogs, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-AMP and structurally related second messengers by discriminating against an amine at the C2 position, more than a carbonyl at the C6 position. We also identified phosphate-modified analogs that bind both the ydaO RNA and GdpP protein with high affinity, while symmetrically-modified ribose analogs exhibited a substantial decrease in ydaO affinity, but retained high affinity for GdpP. These ligand modifications resulted in increased resistance to enzyme-catalyzed hydrolysis by the GdpP enzyme. Together, these data suggest that these c-di-AMP analogs could be useful as chemical tools to specifically target subsections of the second-messenger signaling pathways. PMID:26789423

  12. Carbachol and bradykinin elevate cyclic AMP and rapidly deplete ATP in cultured rat sympathetic neurons.

    PubMed Central

    Suidan, H S; Murrell, R D; Tolkovsky, A M

    1991-01-01

    The agonists carbachol (CCh) and bradykinin (BK) and 54 mM KCl (high K+) were among the most potent stimulants of cyclic AMP (cAMP) production in cultured rat sympathetic neurons, measured with the use of a high-fidelity assay developed for small samples. The rise in cAMP evoked by CCh (through muscarinic receptors), BK, and high K+ was inhibited in Ca2(+)-depleted medium (1.3 mM Ca2+ and 2 mM BAPTA or EGTA), which also prevented the sustained rise in [Ca2+]i evoked by each of these stimuli, showing that elevation of cAMP requires extracellular Ca2+ and, possibly, Ca2+ influx. Preliminary results obtained with the novel calmodulin inhibitor CGS 9343B, which blocked the elevation of cAMP, and with the cyclogenase inhibitor indomethacin, which partially blocked the actions of the agonists but not those of high K+, suggest that calmodulin and arachidonate metabolites may be two components of the signaling pathway. In addition to their effects on cAMP metabolism, CCh, muscarine, and BK, but not nicotine, caused a 30-40% decrease in ATP levels. This effect was much greater than that evoked by high K+ and was largely inhibited by CGS 9343B but slightly enhanced in the Ca(+)-depleted medium, showing that agonists are still active in the absence of [Ca2+]o. Thus, agonists that activate phosphoinositide metabolism can also increase cAMP production and substantially deplete cells of ATP. These novel actions may have to be taken into account when the mechanisms by which such agonists regulate cell function are being considered. PMID:1848792

  13. Effects of dibutyryl cyclic AMP and papaverine on intrahepatocytic bile acid transport. Role of vesicle transport.

    PubMed

    Hoshino, M; Ohiwa, T; Hayakawa, T; Kamiya, Y; Tanaka, A; Hirano, A; Kumai, T; Katagiri, K; Miyaji, M; Takeuchi, T

    1993-09-01

    The secondary messenger cyclic AMP plays an important role in regulating biliary excretory function by stimulating the transcytotic vesicle transport system, whereas papaverine exerts an inhibitory effect on this system. We therefore investigated their effects on bile acid-induced cytotoxicity and intrahepatocytic content of bile acid in primary cultured rat hepatocytes. Simultaneous addition of 1 mM dibutyryl cyclic AMP (DBcAMP), an analogue of cAMP, with 1 mM taurochenodeoxycholic acid (TCDCA) significantly decreased the release of lactate dehydrogenase (LDH) as compared with the case with 1 mM TCDCA alone (7.1 +/- 0.13% of total versus 10.7 +/- 0.3%). In contrast, 0.1 mM papaverine approximately doubled the amount of LDH (22.0 +/- 0.6% of total versus 10.7 +/- 0.3%; P < 0.01). The intracellular content of TCDCA 180 min after the administration of 1 mM TCDCA alone was 20.8 +/- 0.7 nmol/mg protein, that after simultaneous administration of 1 mM DBcAMP, 16.2 +/- 1.0 nmol/mg protein, and that after the simultaneous administration of 0.1 mM papaverine, 38.5 +/- 1.9 nmol/mg protein. A clear correlation between the release of LDH from hepatocytes and the intracellular content of TCDCA was thus observed. When given together with 1 mM taurocholic acid (TCA) or 1 mM tauroursodeoxycholic acid (TUDCA), papaverine exerted little effect on cytotoxicity or intrahepatocytic bile acid content. When cells were bathed in a medium free of bile acid after pretreatment with 1 mM TCDCA and 1 mM DBcAMP, additional exposure to DBcAMP for 30 min significantly stimulated reduction of intracellular TCDCA content (30.2 +/- 0.4% of total versus 44.0 +/- 1.4%).(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Naphazoline-induced neuroendocrine changes: increases in ANP and cGMP levels, but suppression of NE, 3H-NE, and cAMP levels in rabbit eyes.

    PubMed

    Ogidigben, Miller J; Chu, Teh-Ching; Potter, David E

    2002-07-01

    The objective of this study was to determine whether naphazoline, an alpha 2 (alpha2)/imidazoline (I1) agonist, can alter endogenous levels of atrial natriuretic peptide (ANP) and norepinephrine (NE) in aqueous humor and cyclic nucleotide (cAMP, cGMP) accumulation and NE overflow in the iris-ciliary body (ICB) of the rabbit eye. Topical naphazoline (25, 75, and 250 microg) caused a dose-dependent elevation of the ANP levels (36, 54, and 137 pg/ml, respectively) in aqueous humor. This effect was antagonized by pretreatment with efaroxan, an antagonist of I1/alpha2 receptors. Another alpha2/I1 agonist, moxonidine (75 microg topically), caused significant increases in ANP levels in aqueous humor, whereas other relatively selective alpha2-adrenergic receptor agonists, brimonidine (50 microg topically) and oxymetazoline (75 microg topically), did not. In naphazoline (75 microg) pretreated eyes, the NE levels in aqueous humor were attenuated by 36% (from 6.0 to 3.8 pg/ml). Furthermore, naphazoline (1, 10, and 100 micromol/l) caused a dose-related inhibition of NE release from ICBs: 25, 45, and 80%, respectively. The isoproterenol (1 micromol/l) stimulated cAMP accumulation was inhibited 53% by naphazoline (100 micromol/l). In contrast, naphazoline significantly increased the cGMP levels in ICBs. These data demonstrate that naphazoline acts on I1 receptors to increase ANP and to reduce NE levels in aqueous humor. The former effect could also contribute to elevation of cGMP levels and inhibition of cAMP accumulation in the ICB. Further studies will be required to determine if elevation of ANP levels is a critical component of naphazoline-induced alteration of aqueous humor dynamics.

  15. Waste tank ventilation system waste material accumulations

    SciTech Connect

    Van Vleet, R.J., Westinghouse Hanford

    1996-08-06

    This paper calculates the amount of material that accumulates in the ventilation systems of various Tank Waste Remediation System facilities and estimates the amount of material that could be released due to a rapid pressurization.

  16. 19 CFR 10.534 - Accumulation.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Singapore Free Trade Agreement Rules of Origin § 10.534 Accumulation. (a) Originating materials of Singapore or the United States...

  17. 19 CFR 10.534 - Accumulation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Singapore Free Trade Agreement Rules of Origin § 10.534 Accumulation. (a) Originating materials of Singapore or the United States...

  18. 19 CFR 10.534 - Accumulation.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Singapore Free Trade Agreement Rules of Origin § 10.534 Accumulation. (a) Originating materials of Singapore or the United States...

  19. 19 CFR 10.534 - Accumulation.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Singapore Free Trade Agreement Rules of Origin § 10.534 Accumulation. (a) Originating materials of Singapore or the United States...

  20. 19 CFR 10.534 - Accumulation.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Singapore Free Trade Agreement Rules of Origin § 10.534 Accumulation. (a) Originating materials of Singapore or the United States...

  1. Accumulation of nickel in transgenic tobacco

    NASA Astrophysics Data System (ADS)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TF<1) at all levels of metal treatment. Among the 4 transgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  2. 47 CFR 32.3100 - Accumulated depreciation.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ....3100 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES UNIFORM... investment contained in Account 2001, Telecommunications Plant in Service. (b) This account shall be credited... plant in service. (Note also Account 3300, Accumulated depreciation—nonoperating.) (c) At the time...

  3. 47 CFR 32.3100 - Accumulated depreciation.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ....3100 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES UNIFORM... investment contained in Account 2001, Telecommunications Plant in Service. (b) This account shall be credited... plant in service. (Note also Account 3300, Accumulated depreciation—nonoperating.) (c) At the time...

  4. 47 CFR 32.3100 - Accumulated depreciation.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ....3100 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES UNIFORM... investment contained in Account 2001, Telecommunications Plant in Service. (b) This account shall be credited... plant in service. (Note also Account 3300, Accumulated depreciation—nonoperating.) (c) At the time...

  5. Metal accumulation by wood-decaying fungi

    SciTech Connect

    Tyler, G.

    1982-01-01

    Metal concentrations (Na, K, Rb, Mg, Ca, Sr, Mn, Fe, Cu, Zn, Cd, Al, and Pb) in the sporophores of ten wood-decaying macromycete species were related to concentrations in the wood substrates. Manganese, Sr, Ca, and Pb were usually excluded by the fungi; K, Rb, and to a lower degree, Cd, Fe, Zn, Cu, Mg and Na were accumulated. Accumulation ratios are compared with similar ratios for soil and litter inhabiting species previously studied.

  6. Differential activation of ammonium transporters during the accumulation of ammonia by Colletotrichum gloeosporioides and its effect on appressoria formation and pathogenicity.

    PubMed

    Shnaiderman, Chen; Miyara, Itay; Kobiler, Ilana; Sherman, Amir; Prusky, Dov

    2013-03-01

    Ammonium secreted by the post-harvest pathogen Colletotrichum gloeosporioides during host colonization accumulates in the host environment due to enhanced fungal nitrogen metabolism. Two types of ammonium transporter-encoding genes, AMET and MEP, are expressed during pathogenicity. Gene disruption of AMET, a gene modulating ammonia secretion, showed twofold reduced ammonia secretion and 45% less colonization on avocado fruit, suggesting a contribution to pathogenicity. MEPB, a gene modulating ammonium transport, is expressed by C. gloeosporioides during pathogenicity and starvation conditions in culture. Gene disruption of MEPB, the most highly expressed gene of the MEP family, resulted in twofold overexpression of MEPA and MEPC but reduced colonization, suggesting MEPB expression's contribution to pathogenicity. Analysis of internal and external ammonia accumulation by ΔmepB strains in mycelia and germinated spores showed rapid uptake and accumulation, and reduced secretion of ammonia in the mutant versus wild-type (WT) strains. Ammonia uptake by the WT germinating spores but not by the ΔmepB strain with compromised ammonium transport activated cAMP and transcription of PKA subunits PKAR and PKA2. ΔmepB mutants showed 75% less appressorium formation and colonization than the WT, which was partially restored by 10 mM exogenous ammonia. Thus, whereas both AMET and MEPB genes modulate ammonia secretion, only MEPB contributes to ammonia accumulation by mycelia and germinating spores that activate the cAMP pathways, inducing the morphogenetic processes contributing to C. gloeosporioides pathogenicity. PMID:23387470

  7. Sucrose induces vesicle accumulation and autophagy.

    PubMed

    Higuchi, Takahiro; Nishikawa, Jun; Inoue, Hiroko

    2015-04-01

    It has been shown that the treatment of mammalian cells with sucrose leads to vacuole accumulation associated with lysosomes and upregulation of lysosomal enzyme expression and activity. Autophagy is an evolutionarily conserved homeostatic process by which cells deliver cytoplasmic material for degradation into lysosomes, thus it is probable that sucrose affects the autophagic activity. The role of sucrose in autophagy is unknown; however, another disaccharide, trehalose has been shown to induce autophagy. In the current study, we used mouse embryonic fibroblasts to investigate whether sucrose induces autophagy and whether vesicle formation is associated with autophagy. The results showed that sucrose induces autophagy while being accumulated within the endosomes/lysosomes. These vesicles were swollen and packed within the cytoplasm. Furthermore, trehalose and the trisaccharide raffinose, which are not hydrolyzed in mammalian cells, increased the rate of vesicles accumulation and LC3-II level (a protein marker of autophagy). However, fructose and maltose did not show the same effects. The correlation between the two processes, vesicle accumulation and autophagy induction, was confirmed by treatment of cells with sucrose plus invertase, or maltose plus acarbose-the α-glucosidase inhibitor-and by sucrose deprivation. Results also showed that vesicle accumulation was not affected by autophagy inhibition. Therefore, the data suggest that sucrose-induced autophagy through accumulation of sucrose-containing vesicles is caused by the absence of hydrolysis enzymes.

  8. Sodium accumulation in Atriplex. Final report

    SciTech Connect

    Norton, J.A.; Caldwell, M.M.; Richardson, S.G.

    1984-09-01

    This study was undertaken to determine the ecological significance and the significance to arid land reclamation of sodium accumulation and nonaccumulation in Atriplex. There was a continuum in the genetic tendency of Atriplex canescens to accumulate sodium, from populations which accumulated almost no sodium to populations which accumulated up to 7% in the leaves. There were also substantial differences in sodium uptake between populations of A. tridentata, A. falcata and A. gardneri, with some populations having less than 0.1% leaf sodium and other populations having up to 5 or 6%. In three experiments (a field study, a greenhouse pot study and a hydroponics study) there were no significant differences in salinity tolerance between sodium accumulating and nonaccumulating A. canescens: both genotypes were highly salt tolerant. There was a significant buildup of sodium in the soil beneath sodium accumulating Atriplex plants, both in natural populations and on revegetated oil shale study plots. The sodium buildup was not sufficient to be detrimental to the growth or establishment of most herbaceous species, but with older Atriplex plants or with more saline soil, the buildup could potentially be detrimental. 14 references, 42 figures, 3 tables.

  9. Sucrose induces vesicle accumulation and autophagy.

    PubMed

    Higuchi, Takahiro; Nishikawa, Jun; Inoue, Hiroko

    2015-04-01

    It has been shown that the treatment of mammalian cells with sucrose leads to vacuole accumulation associated with lysosomes and upregulation of lysosomal enzyme expression and activity. Autophagy is an evolutionarily conserved homeostatic process by which cells deliver cytoplasmic material for degradation into lysosomes, thus it is probable that sucrose affects the autophagic activity. The role of sucrose in autophagy is unknown; however, another disaccharide, trehalose has been shown to induce autophagy. In the current study, we used mouse embryonic fibroblasts to investigate whether sucrose induces autophagy and whether vesicle formation is associated with autophagy. The results showed that sucrose induces autophagy while being accumulated within the endosomes/lysosomes. These vesicles were swollen and packed within the cytoplasm. Furthermore, trehalose and the trisaccharide raffinose, which are not hydrolyzed in mammalian cells, increased the rate of vesicles accumulation and LC3-II level (a protein marker of autophagy). However, fructose and maltose did not show the same effects. The correlation between the two processes, vesicle accumulation and autophagy induction, was confirmed by treatment of cells with sucrose plus invertase, or maltose plus acarbose-the α-glucosidase inhibitor-and by sucrose deprivation. Results also showed that vesicle accumulation was not affected by autophagy inhibition. Therefore, the data suggest that sucrose-induced autophagy through accumulation of sucrose-containing vesicles is caused by the absence of hydrolysis enzymes. PMID:25389129

  10. Spilanthol from Acmella Oleracea Lowers the Intracellular Levels of cAMP Impairing NKCC2 Phosphorylation and Water Channel AQP2 Membrane Expression in Mouse Kidney

    PubMed Central

    Gerbino, Andrea; Schena, Giorgia; Milano, Serena; Milella, Luigi; Barbosa, Alan Franco; Armentano, Francesca; Procino, Giuseppe; Svelto, Maria; Carmosino, Monica

    2016-01-01

    Acmella oleracea is well recognized in Brazilian traditional medicine as diuretic, although few scientific data have been published to support this effect. Aim of this study was to determine the molecular effect of Acmella oleracea extract and its main alkylamide spilanthol on two major processes involved in the urine concentrating mechanism: Na-K-2Cl symporter (NKCC2) activity in the thick ascending limb and water channel aquaporin 2 accumulation at the apical plasma membrane of collecting duct cells. Phosphorylation of NKCC2 was evaluated as index of its activation by Western blotting. Rate of aquaporin 2 apical expression was analyzed by confocal laser microscopy. Spilanthol-induced intracellular signalling events were dissected by video-imaging experiments. Exposure to spilanthol reduced the basal phosphorylation level of NKCC2 both in freshly isolated mouse kidney slices and in NKCC2-expresing HEK293 cells. In addition, exposure to spilanthol strongly reduced both desmopressin and low Cl−-dependent increase in NKCC2 phosphorylation in mouse kidney slices and NKCC2-expressing HEK293 cells, respectively. Similarly, spilanthol reduced both desmopressin- and forskolin-stimulated aquaporin 2 accumulation at the apical plasma membrane of collecting duct in mouse kidney slice and MCD4 cells, respectively. Of note, when orally administered, spilanthol induced a significant increase in both urine output and salt urinary excretion associated with a markedly reduced urine osmolality compared with control mice. Finally, at cellular level, spilanthol rapidly reduced or reversed basal and agonist-increased cAMP levels through a mechanism involving increases in intracellular [Ca2+]. In conclusion, spilanthol-induced inhibition of cAMP production negatively modulates urine-concentrating mechanisms thus holding great promise for its use as diuretic. PMID:27213818

  11. [Cyclic AMP level in the muscle tissue of cattle and the physico-chemical properties of meat].

    PubMed

    Górna, M; Wieckowski, W

    1982-01-01

    The purpose of this study was to determine quantitative changes of cyclic adenosine mono-phosphate (c-AMP) level in meat of slaughter bulls. Meat samples were taken from the muscle longissimus dorsi (LD) of bulls overstressed by transport, which were stunned with electricity without rest. The obtained data did not show statistical correlations between c-AMP level and pI-values but showed statistical correlations between c-AMP level and some sensory properties of beef. The highest concentration of c-AMP was detected in the muscle about 90 minutes after slaughter. Individual differences in the concentration of c-AMP in the LD were observed in 30 min. after slaughter. In this time the high c-AMP level was correlated with the colour and sensory properties of meat and bouillon.

  12. The cyclic AMP phosphodiesterase RegA critically regulates encystation in social and pathogenic amoebas.

    PubMed

    Du, Qingyou; Schilde, Christina; Birgersson, Elin; Chen, Zhi-hui; McElroy, Stuart; Schaap, Pauline

    2014-02-01

    Amoebas survive environmental stress by differentiating into encapsulated cysts. As cysts, pathogenic amoebas resist antibiotics, which particularly counteracts treatment of vision-destroying Acanthamoeba keratitis. Limited genetic tractability of amoeba pathogens has left their encystation mechanisms unexplored. The social amoeba Dictyostelium discoideum forms spores in multicellular fruiting bodies to survive starvation, while other dictyostelids, such as Polysphondylium pallidum can additionally encyst as single cells. Sporulation is induced by cAMP acting on PKA, with the cAMP phosphodiesterase RegA critically regulating cAMP levels. We show here that RegA is deeply conserved in social and pathogenic amoebas and that deletion of the RegA gene in P. pallidum causes precocious encystation and prevents cyst germination. We heterologously expressed and characterized Acanthamoeba RegA and performed a compound screen to identify RegA inhibitors. Two effective inhibitors increased cAMP levels and triggered Acanthamoeba encystation. Our results show that RegA critically regulates Amoebozoan encystation and that components of the cAMP signalling pathway could be effective targets for therapeutic intervention with encystation.

  13. Actin induction during PMA and cAMP-dependent signal pathway activation in Entamoeba histolytica trophozoites.

    PubMed

    Ortiz, D; del Carmen Dominguez-Robles, M; Villegas-Sepúlveda, N; Meza, I

    2000-10-01

    Activation of PKC or cAMP-dependent signalling pathways in Entamoeba histolytica triggers the phosphorylation of proteins involved in actin rearrangements necessary for adhesion and locomotion. Analogous motifs to SRE and CRE sequences--known to respond to PMA and cAMP--were identified within the 5' regulatory region (5'RR) of one of the parasite actin genes. These sequences could be involved in the actin transcriptional upregulation reported during signalling. To test this hypothesis, a plasmid containing the 5'RR of the actin gene fused to the bacterial neomycin gene (neo) was used for stable transfection. Expression of neo and endogenous actin was measured after stimulation of transfected amoebae by PMA and dcAMP. It was found that both compounds induced neo and actin expression and showed a co-operative effect in the induction of neo. Induction by PMA or dcAMP failed if the directing amoebic 5'RR lacked SRE and CRE motifs. Transfection of amoebae with plasmid constructs, containing either progressive deletions of the actin 5'RR or site-directed mutations of the SRE and CRE-like motifs, corroborated that these sequences and a co-ordinated participation of PKC- and PKA-activated transcription factors are responsible for the increments in neo and actin mRNAs. In vivo, these PMA and cAMP-response elements could play an important role in regulating actin expression and organization in signalling processes activated during tissue invasion.

  14. Origin and evolution of the AmpC beta-lactamases of Citrobacter freundii.

    PubMed

    Barlow, Miriam; Hall, Barry G

    2002-05-01

    To determine whether the widespread clinical use of beta-lactams has been selective for Citrobacter freundii-derived alleles of plasmid ampC genes, we generated a Bayesian consensus phylogeny of the published ampC sequences and compared the MICs of 16 beta-lactam antibiotics for Escherichia coli strains containing cloned copies of the C. freundii ampC alleles. We found that for the majority of compounds investigated, there has been essentially no increase in beta-lactam resistance conferred by those alleles. We also found that ampC alleles from the chromosomes of two beta-lactam-sensitive C. freundii strains isolated in the 1920s, before the clinical use of antibiotics, were as effective at providing beta-lactam resistance in E. coli as were the plasmid-borne alleles from beta-lactam-resistant clinical isolates. These results suggest that selection for increased resistance to beta-lactam antibiotics has not been a significant force directing the evolution of the C. freundii ampC alleles found in beta-lactam-resistant clinical isolates.

  15. What is the role of antimicrobial peptides (AMP) in acne vulgaris?

    PubMed

    Harder, Jürgen; Tsuruta, Daisuke; Murakami, Masamoto; Kurokawa, Ichiro

    2013-06-01

    Acne vulgaris is the most common disorder of the pilosebaceous unit leading to inflamed skin characterized by the formation of comedones, papules, pustules and scarring. There is increasing evidence that the abundance of Propionibacterium acnes (P. acnes) in the inflamed acne lesions triggers inflammation. Therefore, in addition to treatment with retinoids, the use of antimicrobial agents has been established as a treatment option for acne. This indicates that antimicrobial mechanisms to control the growth of P. acnes may have an important influence on the severity of inflammatory acne. One import antimicrobial innate defense system comprises the production of antimicrobial peptides (AMP), small molecules with a broad spectrum of antimicrobial activity as well as immunomodulatory properties. Although the role of AMP in acne is still emerging, there is increasing evidence that AMP may be of importance in acne. The aim of this viewpoint is to provide some hypotheses about the potential function of AMP in the pathogenesis of acne and to discuss potential AMP-based therapies for the treatment of acne.

  16. Presynaptic H3 autoreceptors modulate histamine synthesis through cAMP pathway.

    PubMed

    Gomez-Ramirez, Jordi; Ortiz, Jordi; Blanco, Isaac

    2002-01-01

    Histamine H3 receptors modulate histamine synthesis, although little is known about the transduction mechanisms involved. To investigate this issue, we have used a preparation of rat brain cortical miniprisms in which histamine synthesis can be modulated by depolarization and by H3 receptor ligands. When the miniprisms were incubated in presence of forskolin, dibutyryl-cAMP, or 3-isobutyl-1-methylxanthine (IBMX), histamine synthesis was stimulated in 34, 29, and 47%, respectively. These stimulations could be prevented by the selective cAMP protein kinase blocker Rp-adenosine 3',5'-cyclic monophosphothioate triethylamine (Rp-cAMPs). Preincubation with the H3 receptor agonist imetit prevented IBMX- (100% blockade) and forskolin- (70% blockade) induced stimulation of histamine synthesis. The H3 inverse agonist thioperamide enhanced histamine synthesis in the presence of 1 mM IBMX or 30 mM potassium (+47 and +45%, respectively). Similarly, the H3 antagonist clobenpropit enhanced histamine synthesis in the presence of 30 mM potassium (+ 59%). The cAMP-dependent protein kinase blockers Rp-cAMPs and PKI14-22 could impair the effects of thioperamide and clobenpropit, respectively. These results indicate that the adenylate cyclase-protein kinase A pathway is involved in the modulation of histamine synthesis by H3 autoreceptors present in histaminergic nerve terminals.

  17. Pseudomonas aeruginosa AmpR: an acute–chronic switch regulator

    PubMed Central

    Balasubramanian, Deepak; Kumari, Hansi; Mathee, Kalai

    2015-01-01

    Pseudomonas aeruginosa is one of the most intractable human pathogens that pose serious clinical challenge due to extensive prevalence of multidrug-resistant clinical isolates. Armed with abundant virulence and antibiotic resistance mechanisms, it is a major etiologic agent in a number of acute and chronic infections. A complex and intricate network of regulators dictates the expression of pathogenicity factors in P. aeruginosa. Some proteins within the network play key roles and control multiple pathways. This review discusses the role of one such protein, AmpR, which was initially recognized for its role in antibiotic resistance by regulating AmpC β-lactamase. Recent genomic, proteomic and phenotypic analyses demonstrate that AmpR regulates expression of hundreds of genes that are involved in diverse pathways such as β-lactam and non-β-lactam resistance, quorum sensing and associated virulence phenotypes, protein phosphorylation, and physiological processes. Finally, ampR mutations in clinical isolates are reviewed to shed light on important residues required for its function in antibiotic resistance. The prevalence and evolutionary implications of AmpR in pathogenic and nonpathogenic proteobacteria are also discussed. A comprehensive understanding of proteins at nodal positions in the P. aeruginosa regulatory network is crucial in understanding, and ultimately targeting, the pathogenic stratagems of this organism. PMID:25066236

  18. Cesium absorption from acidic solutions using ammonium molybdophosphate on a polyacrylonitrile support (AMP-PAN)

    SciTech Connect

    Miller, C.J.; Olson, A.L.; Johnson, C.K.

    1995-12-01

    Recent efforts at the Idaho Chemical Processing Plant (ICPP) have included evaluation of cesium removal technologies as applied to ICPP acidic radioactive waste streams. Ammonium molybdophosphate (AMP) immobilized on a polyacrylonitrile support (AMP-PAN) has been studied as an ion exchange agent for cesium removal from acidic waste solutions. Capacities, distribution coefficients, elutability, and kinetics of cesium-extraction have been evaluated. Exchange breakthrough curves using small columns have been determined from 1M HNO{sub 3} and simulated waste solutions. The theoretical capacity of AMP is 213 g Cs/kg AMP. The average experimental capacity in batch contacts with various acidic solutions was 150 g Cs/kg AMP. The measured cesium distribution coefficients from actual waste solutions were 3287 mL/g for dissolved zirconia calcines, and 2679 mL/g for sodium-bearing waste. The cesium in the dissolved alumina calcines was analyzed for; however, the concentration was below analytical detectable limits resulting in inconclusive results. The reaction kinetics are very rapid (2-10 minutes). Cesium absorption appears to be independent of acid concentration over the range tested (0.1 M to 5 M HNO{sub 3}).

  19. Intercellular redistribution of cAMP underlies selective suppression of cancer cell growth by connexin26.

    PubMed

    Chandrasekhar, Anjana; Kalmykov, Edward A; Polusani, Srikanth R; Mathis, Sandra A; Zucker, Shoshanna N; Nicholson, Bruce J

    2013-01-01

    Connexins (Cx), which constitute gap junction intercellular channels in vertebrates, have been shown to suppress transformed cell growth and tumorigenesis, but the mechanism(s) still remain largely speculative. Here, we define the molecular basis by which Cx26, but less frequently Cx43 or Cx32, selectively confer growth suppression on cancer cells. Functional intercellular coupling is shown to be required, producing partial blocks of the cell cycle due to prolonged activation of several mitogenic kinases. PKA is both necessary and sufficient for the Cx26 induced growth inhibition in low serum and the absence of anchorage. Activation of PKA was not associated with elevated cAMP levels, but appeared to result from a redistribution of cAMP throughout the cell population, eliminating the cell cycle oscillations in cAMP required for efficient cell cycle progression. Cx43 and Cx32 fail to mediate this redistribution as, unlike Cx26, these channels are closed during the G2/M phase of the cell cycle when cAMP levels peak. Comparisons of tumor cell lines indicate that this is a general pattern, with growth suppression by connexins occurring whenever cAMP oscillates with the cell cycle, and the gap junction remain open throughout the cell cycle. Thus, gap junctional coupling, in the absence of any external signals, provides a general means to limit the mitotic rate of cell populations. PMID:24312655

  20. cAMP-Signalling Regulates Gametocyte-Infected Erythrocyte Deformability Required for Malaria Parasite Transmission

    PubMed Central

    Thompson, Eloise; Breil, Florence; Lorthiois, Audrey; Dupuy, Florian; Cummings, Ross; Duffier, Yoann; Corbett, Yolanda; Mercereau-Puijalon, Odile; Vernick, Kenneth; Taramelli, Donatella; Baker, David A.; Langsley, Gordon; Lavazec, Catherine

    2015-01-01

    Blocking Plasmodium falciparum transmission to mosquitoes has been designated a strategic objective in the global agenda of malaria elimination. Transmission is ensured by gametocyte-infected erythrocytes (GIE) that sequester in the bone marrow and at maturation are released into peripheral blood from where they are taken up during a mosquito blood meal. Release into the blood circulation is accompanied by an increase in GIE deformability that allows them to pass through the spleen. Here, we used a microsphere matrix to mimic splenic filtration and investigated the role of cAMP-signalling in regulating GIE deformability. We demonstrated that mature GIE deformability is dependent on reduced cAMP-signalling and on increased phosphodiesterase expression in stage V gametocytes, and that parasite cAMP-dependent kinase activity contributes to the stiffness of immature gametocytes. Importantly, pharmacological agents that raise cAMP levels in transmissible stage V gametocytes render them less deformable and hence less likely to circulate through the spleen. Therefore, phosphodiesterase inhibitors that raise cAMP levels in P. falciparum infected erythrocytes, such as sildenafil, represent new candidate drugs to block transmission of malaria parasites. PMID:25951195

  1. Adenylate Kinase and AMP Signaling Networks: Metabolic Monitoring, Signal Communication and Body Energy Sensing

    PubMed Central

    Dzeja, Petras; Terzic, Andre

    2009-01-01

    Adenylate kinase and downstream AMP signaling is an integrated metabolic monitoring system which reads the cellular energy state in order to tune and report signals to metabolic sensors. A network of adenylate kinase isoforms (AK1-AK7) are distributed throughout intracellular compartments, interstitial space and body fluids to regulate energetic and metabolic signaling circuits, securing efficient cell energy economy, signal communication and stress response. The dynamics of adenylate kinase-catalyzed phosphotransfer regulates multiple intracellular and extracellular energy-dependent and nucleotide signaling processes, including excitation-contraction coupling, hormone secretion, cell and ciliary motility, nuclear transport, energetics of cell cycle, DNA synthesis and repair, and developmental programming. Metabolomic analyses indicate that cellular, interstitial and blood AMP levels are potential metabolic signals associated with vital functions including body energy sensing, sleep, hibernation and food intake. Either low or excess AMP signaling has been linked to human disease such as diabetes, obesity and hypertrophic cardiomyopathy. Recent studies indicate that derangements in adenylate kinase-mediated energetic signaling due to mutations in AK1, AK2 or AK7 isoforms are associated with hemolytic anemia, reticular dysgenesis and ciliary dyskinesia. Moreover, hormonal, food and antidiabetic drug actions are frequently coupled to alterations of cellular AMP levels and associated signaling. Thus, by monitoring energy state and generating and distributing AMP metabolic signals adenylate kinase represents a unique hub within the cellular homeostatic network. PMID:19468337

  2. Opposing actions of dibutyryl cyclic AMP and GMP on temperature in conscious guinea-pigs

    NASA Technical Reports Server (NTRS)

    Kandasamy, S. B.; Williaes, B. A.

    1983-01-01

    It is shown that the intracerebroventricular administration of dibutyryl cyclic AMP (Db-cAMP) induced hyperthermia in guinea pigs which was not mediated through prostaglandins or norepinephrine since a prostaglandin synthesis inhibitor and an alpha-adrenergic receptor blocking agent did not antagonize the hyperthermia. However, the hyperthermic response to Db-cAMP was attenuated by the central administration of a beta-adrenergic receptor antagonist, which indicates that cAMP may be involved, through beta-adrenergic receptors, in the central regulation of heat production and conservation. The central administration of Db-cGMP produced hypothermia which was not mediated via histamine H1 or H2 receptors and serotonin. The antagonism of hypothermia induced by Db-cGMP and acetylcholine + physostigmine by central administration of a cholinergic muscarine receptor antagonist and not by a cholinergic nicotinic receptor antagonist suggests that cholinoceptive neurons and endogenous cGMP may regulate heat loss through cholinergic muscarine receptors. It is concluded that these results indicate a regulatory role in thermoregulation provided by a balance between opposing actions of cAMP and cGMP in guinea pigs.

  3. Retromer terminates the generation of cAMP by internalized PTH-receptors

    PubMed Central

    Feinstein, Timothy N.; Wehbi, Vanessa L.; Ardura, Juan; Wheeler, David S.; Ferrandon, Sebastien; Gardella, Thomas J.; Vilardaga, Jean-Pierre

    2011-01-01

    Generation of cAMP by G protein–coupled receptors (GPCRs) and its termination is currently thought to occur exclusively at the plasma membrane of cells. Under existing models of receptor regulation, this signal is primarily restricted by desensitizationof the receptors through their binding to β-arrestins. However, this paradigm is not consistent with recent observations that the parathyroid hormone receptor type 1 (PTHR) continues to stimulate cAMP production even after receptor internalization, as β-arrestins are known to rapidly bind and internalize activated PTHR. Here we show that β-arrestin1 binding prolongs rather than terminates cAMP generation by PTHR, and that cAMP generation correlates with the persistence of arrestin-receptor complexes on endosomes. We found that PTHR signaling is instead turned-off by the retromer complex, which regulates traffic of internalized receptor from endosomes to the Golgi apparatus. Thus, binding by the retromer complex regulates sustained cAMP generation triggered by an internalized GPCR. PMID:21445058

  4. Renal Epithelial Cyst Formation and Enlargement in vitro: Dependence on cAMP

    NASA Astrophysics Data System (ADS)

    Mangoo-Karim, Roberto; Uchic, Marie; Lechene, Claude; Grantham, Jared J.

    1989-08-01

    Cysts, a common abnormality of kidneys, are collections of urine-like fluid enclosed by a continuous layer of epithelial cells. Renal cysts derive from nephrons and collecting ducts and progressively enlarge as a consequence of epithelial proliferation and transepithelial fluid secretion. The initiation of cyst formation and the factors that control cyst enlargement are unknown. We used an in vitro model of renal cysts to explore the role of the cAMP signal transduction system in the formation and expansion of cysts. MDCK cells, cultured in hydrated-collagen gel, produced polarized monolayered epithelial cysts when intracellular cAMP was increased by prostaglandin E1, arginine vasopressin, cholera toxin, forskolin, or 8-bromoadenosine 3',5'-cyclic monophosphate. All agonists were potentiated by 3-isobutyl-1-methylxanthine, a nucleotide phosphodiesterase inhibitor. The cell proliferation component of cyst enlargement was accelerated by cAMP agonists, as shown by the increased growth of MDCK cells in subconfluent monolayers. The fluid secretion component, reflected by the transepithelial movement of fluid across polarized monolayers of MDCK cells grown on permeable supports, was stimulated by cAMP agonists in the basolateral medium. Chloride levels were higher in the cyst fluid and the secreted fluid than in the bathing medium. We conclude that the development of MDCK cysts is dependent on cAMP. This signal transduction system may be an important modulator of epithelial cell proliferation and transepithelial fluid secretion in the kidney.

  5. Senescent-induced dysregulation of cAMP/CREB signaling and correlations with cognitive decline

    PubMed Central

    Hansen, Rolf T.; Zhang, Han-Ting

    2013-01-01

    It is well known that alongside senescence there is a gradual decline in cognitive ability, most noticeably certain kinds of memory such as working, episodic, spatial, and long term memory. However, until recently, not much has been known regarding the specific mechanisms responsible for the decline in cognitive ability with age. Over the past decades, researchers have become more interested in cAMP signaling, and its downstream transcription factor cAMP response element binding protein (CREB) in the context of senescence. However, there is still a lack of understanding on what ultimately causes the cognitive deficits observed with senescence. This review will focus on the changes in intracellular signaling in the brain, more specifically, alterations in cAMP/CREB signaling in aging. In addition, the downstream effects of altered cAMP signaling on cognitive ability with age will be further discussed. Overall, understanding the senescent-related changes that occur in cAMP/CREB signaling could be important for the development of novel drug targets for both healthy aging, and pathological aging such as Alzheimer's disease. PMID:23623816

  6. Strain-dependent occurrence of functional GTP:AMP phosphotransferase (AK3) in Saccharomyces cerevisiae.

    PubMed

    Schricker, R; Magdolen, V; Strobel, G; Bogengruber, E; Breitenbach, M; Bandlow, W

    1995-12-29

    The gene for yeast GTP:AMP phosphotransferase (PAK3) was found to encode a nonfunctional protein in 10 laboratory strains and one brewers' strain. The protein product showed high similarity to vertebrate AK3 and was located exclusively in the mitochondrial matrix. The deduced amino acid sequence revealed a protein that was shorter at the carboxyl terminus than all other known adenylate kinases. Introduction of a +1 frameshift into the 3'-terminal region of the gene extended homology of the deduced amino acid sequence to other members of the adenylate kinase family including vertebrate AK3. Frameshift mutations obtained after in vitro and in vivo mutagenesis were capable of complementing the adk1 temperature-conditional deficiency in Escherichia coli, indicating that the frameshift led to the expression of a protein that could phosphorylate AMP. Some yeasts, however, including strain D273-10B, two wine yeasts, and two more distantly related yeast genera, harbored an active allele, named AKY3, which contained a +1 frameshift close to the carboxyl terminus as compared with the laboratory strains. The encoded protein exhibited GTP:AMP and ITP:AMP phosphotransferase activities but did not accept ATP as phosphate donor. Although single copy in the haploid genome, disruption of the AKY3 allele displayed no phenotype, excluding the possibility that laboratory and brewers' strains had collected second site suppressors. It must be concluded that yeast mitochondria can completely dispense with GTP:AMP phosphotransferase activity.

  7. Diatom acclimation to elevated CO2 via cAMP signalling and coordinated gene expression

    NASA Astrophysics Data System (ADS)

    Hennon, Gwenn M. M.; Ashworth, Justin; Groussman, Ryan D.; Berthiaume, Chris; Morales, Rhonda L.; Baliga, Nitin S.; Orellana, Mónica V.; Armbrust, E. V.

    2015-08-01

    Diatoms are responsible for ~40% of marine primary productivity, fuelling the oceanic carbon cycle and contributing to natural carbon sequestration in the deep ocean. Diatoms rely on energetically expensive carbon concentrating mechanisms (CCMs) to fix carbon efficiently at modern levels of CO2 (refs , , ). How diatoms may respond over the short and long term to rising atmospheric CO2 remains an open question. Here we use nitrate-limited chemostats to show that the model diatom Thalassiosira pseudonana rapidly responds to increasing CO2 by differentially expressing gene clusters that regulate transcription and chromosome folding, and subsequently reduces transcription of photosynthesis and respiration gene clusters under steady-state elevated CO2. These results suggest that exposure to elevated CO2 first causes a shift in regulation, and then a metabolic rearrangement. Genes in one CO2-responsive cluster included CCM and photorespiration genes that share a putative cAMP-responsive cis-regulatory sequence, implying these genes are co-regulated in response to CO2, with cAMP as an intermediate messenger. We verified cAMP-induced downregulation of CCM gene δ-CA3 in nutrient-replete diatom cultures by inhibiting the hydrolysis of cAMP. These results indicate an important role for cAMP in downregulating CCM and photorespiration genes under elevated CO2 and provide insights into mechanisms of diatom acclimation in response to climate change.

  8. The role of ventral striatal cAMP signaling in stress-induced behaviors

    PubMed Central

    Plattner, Florian; Hayashi, Kanehiro; Hernandez, Adan; Benavides, David R.; Tassin, Tara C.; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W.; Yuen, Eunice Y.; Yan, Zhen; Goldberg, Matthew S.; Nairn, Angus C.; Greengard, Paul; Nestler, Eric J.; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D.; Bibb, James A.

    2015-01-01

    The cAMP/PKA signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitates cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targets the regulation of PDE4 by Cdk5, all produced analogical effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  9. alpha-Tocopherol decreases the somatostatin receptor-effector system and increases the cyclic AMP/cyclic AMP response element binding protein pathway in the rat dentate gyrus.

    PubMed

    Hernández-Pinto, A M; Puebla-Jiménez, L; Arilla-Ferreiro, E

    2009-08-01

    Neuronal survival has been shown to be enhanced by alpha-tocopherol and modulated by cyclic AMP (cAMP). Somatostatin (SST) receptors couple negatively to adenylyl cyclase (AC), thus leading to decreased cAMP levels. Whether alpha-tocopherol can stimulate neuronal survival via regulation of the somatostatinergic system, however, is unknown. The aim of this study was to investigate the effects of alpha-tocopherol on the SST signaling pathway in the rat dentate gyrus. To that end, 15-week-old male Sprague-Dawley rats were treated daily for 1 week with (+)-alpha-tocopherol or vehicle and sacrificed on the day following the last administration. No changes in either SST-like immunoreactivity (SST-LI) content or SST mRNA levels were detected in the dentate gyrus as a result of alpha-tocopherol treatment. A significant decrease in the density of the SST binding sites and an increase in the dissociation constant, however, were detected. The lower SST receptor density in the alpha-tocopherol-treated rats correlated with a significant decrease in the protein levels of the SST receptor subtypes SSTR1-SSTR4, whereas the corresponding mRNA levels were unaltered. G-protein-coupled-receptor kinase 2 expression was decreased by alpha-tocopherol treatment. This vitamin induced a significant increase in both basal and forskolin-stimulated AC activity, as well as a decrease in the inhibitory effect of SST on AC. Whereas the protein levels of AC type V/VI were not modified by alpha-tocopherol administration, ACVIII expression was significantly enhanced, suggesting it might account for the increase in AC activity. In addition, this treatment led to a reduction in Gialpha1-3 protein levels and in Gi functionality. alpha-Tocopherol did not affect the expression of the regulator of G-protein signaling 6/7 (RGS6/7). Finally, alpha-tocopherol induced an increase in the levels of phosphorylated cAMP response element binding protein (p-CREB) and total CREB in the dentate gyrus. Since CREB

  10. Antidepressants Accumulate in Lipid Rafts Independent of Monoamine Transporters to Modulate Redistribution of the G Protein, Gαs.

    PubMed

    Erb, Samuel J; Schappi, Jeffrey M; Rasenick, Mark M

    2016-09-16

    Depression is a significant public health problem for which currently available medications, if effective, require weeks to months of treatment before patients respond. Previous studies have shown that the G protein responsible for increasing cAMP (Gαs) is increasingly localized to lipid rafts in depressed subjects and that chronic antidepressant treatment translocates Gαs from lipid rafts. Translocation of Gαs, which shows delayed onset after chronic antidepressant treatment of rats or of C6 glioma cells, tracks with the delayed onset of therapeutic action of antidepressants. Because antidepressants appear to specifically modify Gαs localized to lipid rafts, we sought to determine whether structurally diverse antidepressants accumulate in lipid rafts. Sustained treatment of C6 glioma cells, which lack 5-hydroxytryptamine transporters, showed marked concentration of several antidepressants in raft fractions, as revealed by increased absorbance and by mass fingerprint. Closely related molecules without antidepressant activity did not concentrate in raft fractions. Thus, at least two classes of antidepressants accumulate in lipid rafts and effect translocation of Gαs to the non-raft membrane fraction, where it activates the cAMP-signaling cascade. Analysis of the structural determinants of raft localization may both help to explain the hysteresis of antidepressant action and lead to design and development of novel substrates for depression therapeutics.

  11. Regulation of the Na,K-ATPase in MDCK cells by prostaglandin E1: a role for calcium as well as cAMP.

    PubMed

    Taub, Mary; Borsick, Maryanne; Geisel, Janet; Matlhagela, Keikantse; Rajkhowa, Trivikram; Allen, Cheryl

    2004-09-10

    Prostaglandins (PGs) play a significant role in the regulation of sodium reabsorption by the kidney, in addition to accumulating during inflammation as well as in several solid tumors. Previously, we presented evidence indicating that prostaglandin E(1) (PGE(1)), a supplement in the serum-free medium for MDCK cells, increases the activity of the Na,K-ATPase in MDCK cells, in addition to its growth stimulatory effect [J. Cell. Physiol. 151 (1992) 337]. This report defines the molecular mechanisms, and signaling pathways responsible for the increased Na,K-ATPase activity. Our results indicate that the increased activity of the Na,K-ATPase in MDCK monolayers treated with either PGE(1) or 8Bromocyclic AMP (8Br-cAMP) can be attributed to an increase in the rate of biosynthesis of the Na,K-ATPase, and an increase in the levels of Na,K-ATPase alpha and beta subunit mRNAs. As beta subunit mRNA increased to a larger extent than alpha subunit mRNA, transient transfection studies were conducted using a human beta1 promoter/luciferase construct [Nucleic Acids Res. 21 (1993) 2619]. While an 8Br-cAMP stimulation was observed (suggesting the involvement of cAMP), our results also suggest that the observed PGE(1) stimulation could be explained by the involvement of Ca(2+) as well protein kinase C (PKC). Consistent with the involvement of Ca(2+), TMB-8 (which inhibits Ca(2+) efflux from intracellular stores) inhibited the PGE(1) stimulation. Moreover, PGE(1) was observed to stimulate the translocation of PKC beta1 from the soluble to the particulate fraction. The translocation of PKC, the PGE(1) stimulation of transcription, and the PGE(1)-mediated increase in the beta subunit mRNA level were all inhibited by the PKC inhibitor Gö6989. These results can be explained by the involvement of two classes of cell surface receptors in mediating the PGE(1) stimulation, including the EP1subtype (which activates phospholipase C), as well as the EP2 subtype (which activates adenylate cyclase).

  12. The cause of hepatic accumulation of fructose 1-phosphate on fructose loading

    PubMed Central

    Woods, H. F.; Eggleston, L. V.; Krebs, H. A.

    1970-01-01

    1. The changes in the metabolite content in freeze-clamped livers of fed rats occurring on perfusion with 10mm-d-fructose have been examined. 2. The most striking effects of fructose were an accumulation of fructose 1-phosphate, as already known, up to 8.7μmol/g of liver within 10min, a loss of total adenine nucleotides (up to 35% after 40min) with a decrease in the ATP content to 23% within 10min, a sevenfold rise in the concentration of IMP to 1.1μmol/g and an eightfold rise of α-glycerophosphate to 1.1μmol/g. 3. There was a transient decrease in Pi from 4.2 to 1.7μmol/g. Within 40min the Pi content recovered to the normal value, probably because of an uptake of Pi from the perfusion medium. 4. The degradation of the adenine nucleotides beyond the stage of AMP can be accounted for by the decrease of ATP and Pi. As ATP inhibits 5-nucleotidase, and as Pi inhibits AMP deaminase any AMP arising in the tissue is liable to undergo dephosphorylation or deamination under the conditions occurring after fructose loading. 5. The content of lactate increased to 4.3μmol/g at 80min; pyruvate also increased and the [lactate]/[pyruvate] ratio remained within physiological limits. 6. The concentration of free fructose within the liver remained much below that in the perfusion medium, indicating that the rate of penetration of fructose into the tissue was lower than the rate of utilization. 7. The fission of fructose 1-phosphate by liver aldolase is inhibited by several phosphorylated intermediates, especially by IMP. This inhibition is competitive with a Ki of 0.1mm. 8. The maximal rates of the enzymes synthesizing and splitting fructose 1-phosphate are about equal. The accumulation of fructose 1-phosphate on fructose loading is due to the inhibition of the fission of fructose 1-phosphate by the IMP arising from the degradation of the adenine nucleotides. PMID:5500310

  13. Genetically-encoded yellow fluorescent cAMP indicator with an expanded dynamic range for dual-color imaging.

    PubMed

    Odaka, Haruki; Arai, Satoshi; Inoue, Takafumi; Kitaguchi, Tetsuya

    2014-01-01

    Cyclic AMP is a ubiquitous second messenger, which mediates many cellular responses mainly initiated by activation of cell surface receptors. Various Förster resonance energy transfer-based ratiometric cAMP indicators have been created for monitoring the spatial and temporal dynamics of cAMP at the single-cell level. However, single fluorescent protein-based cAMP indicators have been poorly developed, with improvement required for dynamic range and brightness. Based on our previous yellow fluorescent protein-based cAMP indicator, Flamindo, we developed an improved yellow fluorescent cAMP indicator named Flamindo2. Flamindo2 has a 2-fold expanded dynamic range and 8-fold increased brightness compared with Flamindo by optimization of linker peptides in the vicinity of the chromophore. We found that fluorescence intensity of Flamindo2 was decreased to 25% in response to cAMP. Live-cell cAMP imaging of the cytosol and nucleus in COS7 cells using Flamindo2 and nlsFlamindo2, respectively, showed that forskolin elevated cAMP levels in each compartment with different kinetics. Furthermore, dual-color imaging of cAMP and Ca2+ with Flamindo2 and a red fluorescent Ca2+ indicator, R-GECO, showed that cAMP and Ca2+ elevation were induced by noradrenaline in single HeLa cells. Our study shows that Flamindo2, which is feasible for multi-color imaging with other intracellular signaling molecules, is useful and is an alternative tool for live-cell imaging of intracellular cAMP dynamics.

  14. Inactivation of the ampD gene causes semiconstitutive overproduction of the inducible Citrobacter freundii beta-lactamase.

    PubMed Central

    Lindberg, F; Lindquist, S; Normark, S

    1987-01-01

    In Citrobacter freundii and Enterobacter cloacae, synthesis of AmpC beta-lactamase is inducible by the addition of beta-lactams to the growth medium. Spontaneous mutants that constitutively overproduce the enzyme occur at a high frequency. When the C. freundii ampC beta-lactamase gene is cloned into Escherichia coli together with the regulatory gene ampR, beta-lactamase expression from the clone is inducible. Spontaneous cefotaxime-resistant mutants were selected from an E. coli strain carrying the cloned C. freundii ampC and ampR genes on a plasmid. Virtually all isolates had chromosomal mutations leading to semiconstitutive overproduction of beta-lactamase. The mutation ampD2 in one such mutant was caused by an IS1 insertion into the hitherto unknown ampD gene, located between nadC and aroP at minute 2.4 on the E. coli chromosome. The wild-type ampD allele cloned on a plasmid could fully trans-complement beta-lactamase-overproducing mutants of both E. coli and C. freundii, restoring the wild-type phenotype of highly inducible enzyme synthesis. This indicates that these E. coli and C. freundii mutants have their lesions in ampD. We hypothesize that induction of beta-lactamase synthesis is caused by blocking of the AmpD function by the beta-lactam inducer and that this leads directly or indirectly to an AmpR-mediated stimulation of ampC expression. PMID:3032901

  15. Pyridinium-based tripodal chemosensor in visual sensing of AMP in water by indicator displacement assay (IDA).

    PubMed

    Ghosh, Kumaresh; Ali, Sk Sarfaraj; Sarkar, Avik Ranjan; Samadder, Asmita; Khuda-Bukhsh, Anisur Rahman; Petsalakis, Ioannis D; Theodorakopoulos, Giannoula

    2013-09-14

    A simple pyridinium-based tripodal chemosensor, 1, effectively recognizes AMP over ATP and ADP through indicator displacement assay (IDA) technique in water at pH 6.4. The good recognition of 1 is due to the better accommodation of AMP at the core of 1 as well as functional interaction involving hydrogen bonding and charge-charge interaction. The sensor 1 also recognizes intracellular AMP.

  16. DhhP, a Cyclic di-AMP Phosphodiesterase of Borrelia burgdorferi, Is Essential for Cell Growth and Virulence

    PubMed Central

    Ye, Meiping; Zhang, Jun-Jie; Fang, Xin; Lawlis, Gavin B.; Troxell, Bryan; Zhou, Yan; Gomelsky, Mark

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a recently discovered second messenger in bacteria. Most of work on c-di-AMP signaling has been done in Gram-positive bacteria, firmicutes, and actinobacteria, where c-di-AMP signaling pathways affect potassium transport, cell wall structure, and antibiotic resistance. Little is known about c-di-AMP signaling in other bacteria. Borrelia burgdorferi, the causative agent of Lyme disease, is a spirochete that has a Gram-negative dual membrane. In this study, we demonstrated that B. burgdorferi BB0619, a DHH-DHHA1 domain protein (herein designated DhhP), functions as c-di-AMP phosphodiesterase. Recombinant DhhP hydrolyzed c-di-AMP to pApA in a Mn2+- or Mg2+-dependent manner. In contrast to c-di-AMP phosphodiesterases reported thus far, DhhP appears to be essential for B. burgdorferi growth both in vitro and in the mammalian host. Inactivation of the chromosomal dhhP gene could be achieved only in the presence of a plasmid-encoded inducible dhhP gene. The conditional dhhP mutant had a dramatic increase in intracellular c-di-AMP level in comparison to the isogenic wild-type strain. Unlike what has been observed in Gram-positive bacteria, elevated cellular c-di-AMP in B. burgdorferi did not result in an increased resistance to β-lactamase antibiotics, suggesting that c-di-AMP's functions in spirochetes differ from those in Gram-positive bacteria. In addition, the dhhP mutant was defective in induction of the σS factor, RpoS, and the RpoS-dependent outer membrane virulence factor OspC, which uncovers an important role of c-di-AMP in B. burgdorferi virulence. PMID:24566626

  17. Cyclic AMP Control Measured in Two Compartments in HEK293 Cells: Phosphodiesterase KM Is More Important than Phosphodiesterase Localization

    PubMed Central

    Matthiesen, Karina; Nielsen, Jacob

    2011-01-01

    The intracellular second messenger cyclic AMP (cAMP) is degraded by phosphodiesterases (PDE). The knowledge of individual families and subtypes of PDEs is considerable, but how the different PDEs collaborate in the cell to control a cAMP signal is still not fully understood. In order to investigate compartmentalized cAMP signaling, we have generated a membrane-targeted variant of the cAMP Bioluminiscence Resonance Energy Transfer (BRET) sensor CAMYEL and have compared intracellular cAMP measurements with it to measurements with the cytosolic BRET sensor CAMYEL in HEK293 cells. With these sensors we observed a slightly higher cAMP response to adenylyl cyclase activation at the plasma membrane compared to the cytosol, which is in accordance with earlier results from Fluorescence Resonance Energy Transfer (FRET) sensors. We have analyzed PDE activity in fractionated lysates from HEK293 cells using selective PDE inhibitors and have identified PDE3 and PDE10A as the major membrane-bound PDEs and PDE4 as the major cytosolic PDE. Inhibition of membrane-bound or cytosolic PDEs can potentiate the cAMP response to adenylyl cyclase activation, but we see no significant difference between the potentiation of the cAMP response at the plasma membrane and in cytosol when membrane-bound and cytosolic PDEs are inhibited. When different levels of stimulation were tested, we found that PDEs 3 and 10 are mainly responsible for cAMP degradation at low intracellular cAMP concentrations, whereas PDE4 is more important for control of cAMP at higher concentrations. PMID:21931705

  18. cAMP-mediated and metabolic amplification of insulin secretion are distinct pathways sharing independence of β-cell microfilaments.

    PubMed

    Mourad, Nizar I; Nenquin, Myriam; Henquin, Jean-Claude

    2012-10-01

    Insulin secretion is triggered by an increase in the cytosolic calcium concentration ([Ca(2+)](c)) in β-cells. Ca(2+)-induced exocytosis of insulin granules can be augmented by metabolic amplification (unknown signals generated through glucose metabolism) or neurohormonal amplification (in particular cAMP mediated). Functional actin microfilaments are not required for metabolic amplification, but their possible role in cAMP-mediated amplification is unknown. It is also uncertain whether cAMP (generated in response to glucose) is implicated in metabolic amplification. These questions were addressed using isolated mouse islets. cAMP levels were increased by phosphodiesterase inhibition (with isobutylmethylxanthine) and adenylate-cyclase stimulation (with forskolin or glucagon-like peptide-1, 7-36 amide). Raising cAMP levels had no steady-state impact on actin polymerization in control islets. Neither disruption (depolymerization by latrunculin) nor stabilization (polymerization by jasplakinolide) of actin microfilaments was counteracted by cAMP. Both changes increased both phases of glucose- or tolbutamide-induced insulin secretion but did not prevent further amplification by cAMP. These large changes in secretion were not caused by changes in [Ca(2+)](c), which was only slightly increased by cAMP. Both phases of insulin secretion were larger in response to glucose than tolbutamide, although [Ca(2+)](c) was lower. This difference in secretion, which reflects metabolic amplification, was independent of microfilaments, was not attributable to differences in cAMP, and persisted in presence of dibutyryl-cAMP or when cAMP levels were variably raised by isobutylmethylxanthine + forskolin or glucagon-like peptide-1, 7-36 amide. We conclude that metabolic and cAMP-mediated amplification of insulin secretion are distinct pathways that accelerate acquisition of release competence by insulin granules that can access exocytotic sites without intervention of microfilaments.

  19. Role of Rac 1 and cAMP in endothelial barrier stabilization and thrombin-induced barrier breakdown.

    PubMed

    Baumer, Y; Spindler, V; Werthmann, R C; Bünemann, M; Waschke, J

    2009-09-01

    Barrier stabilizing effects of cAMP as well as of the small GTPase Rac 1 are well established. Moreover, it is generally believed that permeability-increasing mediators such as thrombin disrupt endothelial barrier functions primarily via activation of Rho A. In this study, we provide evidence that decrease of both cAMP levels and of Rac 1 activity contribute to thrombin-mediated barrier breakdown. Treatment of human dermal microvascular endothelial cells (HDMEC) with Rac 1-inhibitor NSC-23766 decreased transendothelial electrical resistance (TER) and caused intercellular gap formation. These effects were reversed by addition of forskolin/rolipram (F/R) to increase intracellular cAMP but not by the cAMP analogue 8-pCPT-2'-O-Methyl-cAMP (O-Me-cAMP) which primarily stimulates protein kinase A (PKA)-independent signaling via Epac/Rap 1. However, both F/R and O-Me-cAMP did not increase TER above control levels in the presence of NSC-23766 in contrast to experiments without Rac 1 inhibition. Because Rac 1 was required for maintenance of barrier functions as well as for cAMP-mediated barrier stabilization, we tested the role of Rac 1 and cAMP in thrombin-induced barrier breakdown. Thrombin-induced drop of TER and intercellular gap formation were paralleled by a rapid decrease of cAMP as revealed by fluorescence resonance energy transfer (FRET). The efficacy of F/R or O-Me-cAMP to block barrier-destabilizing effects of thrombin was comparable to Y27632-induced inhibition of Rho kinase but was blunted when Rac 1 was inactivated by NSC-23766. Taken together, these data indicate that decrease of cAMP and Rac 1 activity may be an important step in inflammatory barrier disruption.

  20. Characterization of chromosomal qnrB and ampC alleles in Citrobacter freundii isolates from different origins.

    PubMed

    Liao, Xiaoping; Fang, Liangxing; Li, Liang; Sun, Jian; Li, Xingping; Chen, Muya; Deng, Hui; Yang, Qiu'e; Li, Xue; Liu, Yahong

    2015-10-01

    The association of ESBLs (extended-spectrum beta-lactamases)/pAmpCs (plasmid-mediated AmpC β-lactamases) with PMQR (plasmid mediated quinolone resistance) in gram-negative bacteria has been of great concern. The present study was performed to characterize the diversity, gene location, genetic context, and evolution of ampC and qnrB alleles in isolates of Citrobacter freundii. Fifteen isolates of C. freundii were identified from a total of 788 isolates of Enterobacteriaceae derived from humans, animals, animal food products, and the environment between 2010 and 2012. Co-existence of qnrB/ΔqnrB with ampC was detected in all C. freundii isolates. Both ampC and qnrB genes were found to be located on the chromosome, but were distantly separated on the chromosome. Seven and six novel alleles were discovered for the 10 ampC and qnrB variants detected in this study, respectively. Phylogenetic analysis showed that the new alleles differed a little from the variants of ampC/qnrB previously described in this genus. The genetic context surrounding ampC genes was AmpR-AmpC-Blc-SugE. However, five different genetic contexts surrounding qnrB/ΔqnrB genes were observed, but they occurred in all cases between the pspF and sapA genes. Additionally, cloning experiments showed that the regions containing different qnrB alleles, even with different genetic contexts, contributed to the reduction of quinolone susceptibility. Our results showed that the chromosomal ampC and qnrB alleles are closely related to C. freundii. However, unlike ampC, qnrB alleles seemed to be related to the genetic contexts surrounding them. The evolution of these two genes in C. freundii isolates might be through different pathways.

  1. Effect of cholera toxin on cAMP levels and Na/sup +/ influx in isolated intestinal epithelial cells

    SciTech Connect

    Hyun, C.S.; Kimmich, G.A.

    1982-09-01

    Freshly isolated chicken intestinal cells contain approximately 20 pmol adenosine 3',5'-cyclic monophosphate (cAMP)/mg cellular protein. Incubation with 3 ..mu..g/ml cholera toxin (CT) at 37/sup 0/C induces an elevation of cellular cAMP beginning 10-15 min after initial exposure. The response is linear with time for 40-50 min and causes a six- to eightfold increase over control levels at steady state. Dibutyryl cAMP and agents that increase cAMP production inhibit Na/sup +/ influx into the isolated enterocytes. Chlorpromazine completely abolishes the toxin-induced elevation of cAMP in the isolated cells and also reverses the effect on Na/sup +/ entry. The data provide evidence for a cAMP-mediated control of intestinal cell Na/sup +/ uptake, which may represent the mechanistic basis for the antiabsorptive effect of CT on Na/sup +/ during induction of intestinal secretory activity. Studies on the time-dependent effects of chlorpromazine on both intracellular cAMP concentration and Na/sup +/ influx suggest that the reactivation of the Na/sup +/ transport system after cAMP-induced inhibition is slow relative to the disappearance of cAMP.

  2. The interplay between cyclic AMP, MAPK, and NF-κB pathways in response to proinflammatory signals in microglia.

    PubMed

    Ghosh, Mousumi; Aguirre, Vladimir; Wai, Khine; Felfly, Hady; Dietrich, W Dalton; Pearse, Damien D

    2015-01-01

    Cyclic AMP is an important intracellular regulator of microglial cell homeostasis and its negative perturbation through proinflammatory signaling results in microglial cell activation. Though cytokines, TNF-α and IL-1β, decrease intracellular cyclic AMP, the mechanism by which this occurs is poorly understood. The current study examined which signaling pathways are responsible for decreasing cyclic AMP in microglia following TNF-α stimulation and sought to identify the role cyclic AMP plays in regulating these pathways. In EOC2 microglia, TNF-α produced a dramatic reduction in cyclic AMP and increased cyclic AMP-dependent PDE activity that could be antagonized by Rolipram, myristoylated-PKI, PD98059, or JSH-23, implicating a role for PDE4, PKA, MEK, and NF-κB in this regulation. Following TNF-α there were significant increases in iNOS and COX-2 immunoreactivity, phosphorylated ERK1/2 and NF-κB-p65, IκB degradation, and NF-κB p65 nuclear translocation, which were reduced in the presence of high levels of cyclic AMP, indicating that reductions in cyclic AMP during cytokine stimulation are important for removing its inhibitory action on NF-κB activation and subsequent proinflammatory gene expression. Further elucidation of the signaling crosstalk involved in decreasing cyclic AMP in response to inflammatory signals may provide novel therapeutic targets for modulating microglial cell activation during neurological injury and disease. PMID:25722974

  3. Effects of ethanol on cAMP production in murine embryonic palate mesenchymal cells

    SciTech Connect

    Weston, W.M.; Greene, R.M. )

    1991-01-01

    Ethanol affected the ability of murine embryonic palate mesenchymal (MEPM) cells to produce cAMP in response to hormone treatment. Acute exposure to ethanol resulted in an increase in hormone-stimulated cAMP levels, while chronic ethanol treatment led to decreased sensitivity to hormone. Forskolin-stimulated cAMP levels were decreased by both acute and chronic ethanol treatment, while the cells' response to cholera toxin was unchanged by ethanol treatment. The lack of sensitivity of the cholera toxin response to ethanol suggests that,in contrast to what has been observed in other systems, ethanol does not affect the production or activity of G{alpha}s in MEPM cells. These results suggest a possible explanation for the molecular basis for the craniofacial abnormalities observed in the fetal alcohol syndrome.

  4. Involvement of the second messenger cAMP in gravity-signal transduction in physarum

    NASA Astrophysics Data System (ADS)

    Block, I.; Rabien, H.; Ivanova, K.

    The aim of the investigation was to clarify, whether cellular signal processing following graviperception involves second messenger pathways. The test object was a most gravisensitive free-living ameboid cell, the myxomycete (acellular slime mold) Physarum polycephalum. It was demonstrated that the motor response is related to acceleration-dependent changes in the levels of the cellular second messenger cyclic adenosine monophosphate (cAMP). Rotating Physarum plasmodia in the gravity field of the Earth about a horizontal axis increased their cAMP concentration. Depriving the cells for a few days of the acceleration stimulus (near weightlessness in a space experiment on STS-69) slightly lowered plasmodial cAMP levels. Thus, the results provide first indications that the acceleration-stimulus signal transduction chain of Physarum uses an ubiquitous second messenger pathway.

  5. Improved Synthesis of Biotinol-5′-AMP: Implications for Antibacterial Discovery

    PubMed Central

    2014-01-01

    An improved synthesis of biotinol-5′-AMP, an acyl-AMP mimic of the natural reaction intermediate of biotin protein ligase (BPL), is reported. This compound was shown to be a pan inhibitor of BPLs from a series of clinically important bacteria, particularly Staphylococcus aureus and Mycobacterium tuberculosis, and kinetic analysis revealed it to be competitive against the substrate biotin. Biotinol-5′-AMP also exhibits antibacterial activity against a panel of clinical isolates of S. aureus and M. tuberculosis with MIC values of 1–8 and 0.5–2.5 μg/mL, respectively, while being devoid of cytotoxicity to human HepG2 cells. PMID:25699152

  6. Cyclic AMP-dependent phosphorylation of neuronal nitric oxide synthase mediates penile erection

    PubMed Central

    Hurt, K. Joseph; Sezen, Sena F.; Lagoda, Gwen F.; Musicki, Biljana; Rameau, Gerald A.; Snyder, Solomon H.; Burnett, Arthur L.

    2012-01-01

    Nitric oxide (NO) generated by neuronal NO synthase (nNOS) initiates penile erection, but has not been thought to participate in the sustained erection required for normal sexual performance. We now show that cAMP-dependent phosphorylation of nNOS mediates erectile physiology, including sustained erection. nNOS is phosphorylated by cAMP-dependent protein kinase (PKA) at serine(S)1412. Electrical stimulation of the penile innervation increases S1412 phosphorylation that is blocked by PKA inhibitors but not by PI3-kinase/Akt inhibitors. Stimulation of cAMP formation by forskolin also activates nNOS phosphorylation. Sustained penile erection elicited by either intracavernous forskolin injection, or augmented by forskolin during cavernous nerve electrical stimulation, is prevented by the NOS inhibitor l-NAME or in nNOS-deleted mice. Thus, nNOS mediates both initiation and maintenance of penile erection, implying unique approaches for treating erectile dysfunction. PMID:23012472

  7. Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

    NASA Astrophysics Data System (ADS)

    Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

    1996-06-01

    cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

  8. Effect of leaving group on the oligomerization of 5'-AMP on montmorillonite. [Abstract only

    NASA Technical Reports Server (NTRS)

    Prabahar, K. Joseph; Ferris, James P.

    1994-01-01

    The oligomerization of imidazole derivative of 5'-AMP (ImpA) in the presence of montmorillonite clay yields oligomers containing up to 10 monomer units. In these reactions, the heterocyclic base, imidazole is the leaving group. In our present study, we synthesized a series of activated nucleotides of 5'AMP using other leaving groups such as pyrazole, 1,2,4-triazole, piperidine, morpholine, 4-aminopyridine, 4-methylaminopyridine, 4-dimethylaminopyridine, 2-aminobenzimidazole etc. to determine the effect of amine leaving group on the products of the oligomerization reaction. Earlier results from our laboratory showed that the presence AppA in the clay reaction of ImpA enhances the oligomerization reaction to yield higher oligomers. We also studied the effect of AppA in the clay mediated oligomerization reaction of the activated nucleotides. Oligomerization of 2-amino-benzimidazole derivative of 5'-AMP gave higher oligomers containing up to nine monomer units in the presence of AppA.

  9. Modulation of adhesion-dependent cAMP signaling by echistatin and alendronate

    NASA Technical Reports Server (NTRS)

    Fong, J. H.; Ingber, D. E.

    1996-01-01

    We measured intracellular cAMP levels in cells during attachment and spreading on different extracellular matrix (ECM) proteins. Increases in cAMP were observed within minutes when cells attached to fibronectin, vitronectin, and a synthetic RGD-containing fibronectin peptide (Petite 2000), but not when they adhered to another integrin alpha nu beta 3 ligand, echistatin. Because echistatin also inhibits bone resorption, we measured the effects of adding another osteoporosis inhibitor, alendronate, in this system. Alendronate inhibited the cAMP increase induced by ligands that primarily utilize integrin alpha nu beta 3 (vitronectin, Peptite 2000), but not by fibronectin which can also use integrin alpha 5 beta 1. These results show that cell adhesion to ECM can increase intracellular cAPM levels and raise the possibility that inhibitors of osteoporosis may act, in part, by preventing activation of this pathway by integrins.

  10. Cyclic AMP-dependent phosphorylation of neuronal nitric oxide synthase mediates penile erection.

    PubMed

    Hurt, K Joseph; Sezen, Sena F; Lagoda, Gwen F; Musicki, Biljana; Rameau, Gerald A; Snyder, Solomon H; Burnett, Arthur L

    2012-10-01

    Nitric oxide (NO) generated by neuronal NO synthase (nNOS) initiates penile erection, but has not been thought to participate in the sustained erection required for normal sexual performance. We now show that cAMP-dependent phosphorylation of nNOS mediates erectile physiology, including sustained erection. nNOS is phosphorylated by cAMP-dependent protein kinase (PKA) at serine(S)1412. Electrical stimulation of the penile innervation increases S1412 phosphorylation that is blocked by PKA inhibitors but not by PI3-kinase/Akt inhibitors. Stimulation of cAMP formation by forskolin also activates nNOS phosphorylation. Sustained penile erection elicited by either intracavernous forskolin injection, or augmented by forskolin during cavernous nerve electrical stimulation, is prevented by the NOS inhibitor L-NAME or in nNOS-deleted mice. Thus, nNOS mediates both initiation and maintenance of penile erection, implying unique approaches for treating erectile dysfunction.

  11. The cyclic AMP signaling pathway: Exploring targets for successful drug discovery (Review)

    PubMed Central

    YAN, KUO; GAO, LI-NA; CUI, YUAN-LU; ZHANG, YI; ZHOU, XIN

    2016-01-01

    During development of disease, complex intracellular signaling pathways regulate an intricate series of events, including resistance to external toxins, the secretion of cytokines and the production of pathological phenomena. Adenosine 3′,5′-cyclic monophosphate (cAMP) is a nucleotide that acts as a key second messenger in numerous signal transduction pathways. cAMP regulates various cellular functions, including cell growth and differentiation, gene transcription and protein expression. This review aimed to provide an understanding of the effects of the cAMP signaling pathway and the associated factors on disease occurrence and development by examining the information from a new perspective. These novel insights aimed to promote the development of novel therapeutic approaches and aid in the development of new drugs. PMID:27035868

  12. Effects of antimicrobial peptides (AMPs) on blood biochemical parameters, antioxidase activity, and immune function in the common carp (Cyprinus carpio).

    PubMed

    Dong, Xiao-Qing; Zhang, Dong-Ming; Chen, Yu-Ke; Wang, Qiu-Ju; Yang, Yi-Yu

    2015-11-01

    Antibiotic use in livestock feed additives has resulted in harmful residue accumulation and spread of drug-resistance. We examined the use of antimicrobial peptides (AMPs) as a safer alternative to antibiotics in feeding the common carp. AMPs were added to common carp basal diets (Control) as additives at four concentrations: 100 mg kg(-1) (B1), 200 mg kg(-1) (B2), 400 mg kg(-1) (B3), 600 mg kg(-1) (B4) by dry weight of basal diet. After a 60-day feeding experiment, the final weight, DG and SGR of carps on B1, B2 and B3 diet were significantly higher than the control (p < 0.05). The FCR of carps on B1, B2 and B3 diet were significantly lower than the control (p < 0.05). Carps on B2, B3, and B4 diets showed significantly lower (p < 0.05) levels of triglyceride than the control. B4-fed carps showed significantly lower (p < 0.05) levels of total protein, albumin, and total cholesterol than the control. However there was no remarkable difference (p > 0.05) in levels of uric ammonia, globulin, glutamic-pyruvic transaminase, glutamic-oxalacetic transaminase, lactic dehydrogenase and blood glucose in all groups. The serum superoxide dismutase and catalase activity of B1-fed carps was significantly higher (p < 0.05) than the control and B4-fed carps. The serum alkaline phosphate activity of carps on B1 diets was significantly higher (p < 0.05) than B4-fed carps. The serum acid phosphatase activity of B1-fed carps was significantly higher (p < 0.05) than the control and other antimicrobial peptide-fed groups. The serum lysozyme activity of carps on B1, B2, and B3 diets was significantly higher (p < 0.05) than the control- and B4-fed carps. Regarding immune factors in serum, the levels of immunoglobulin (Ig) and interleukin (IL)-1β in B1-fed carps were significantly higher (p < 0.05) than the control and other groups, while IL-1α levels in B1-fed carps was significantly higher (p < 0.05) than the control-, B2-, and B3-fed carps. Furthermore, there were no significant

  13. 14-Deoxyandrographolide alleviates ethanol-induced hepatosteatosis through stimulation of AMP-activated protein kinase activity in rats.

    PubMed

    Mandal, Samir; Mukhopadhyay, Sibabrata; Bandhopadhyay, Sukdeb; Sen, Gargi; Biswas, Tuli

    2014-03-01

    Andrographis paniculata (AP) is a traditional medicinal plant of Ayurveda. It grows widely in Asia and is prescribed in the treatment of liver diseases. Here we have investigated the beneficial role of 14-deoxyandrographolide (14-DAG), a bioactive diterpenoid from AP, against alcoholic steatosis in rats. 14-DAG was extracted from aerial parts (leaves and stems) of AP. Rats were fed with ethanol for 8 weeks. Animals were treated with 14-DAG during the last 4 weeks of ethanol treatment. In vitro studies were undertaken in a human hepatocellular liver carcinoma cell line culture. Hepatosteatosis was assessed from histopathological studies of liver sections. Acetyl-CoA, malonyl-CoA, and triglyceride contents were determined using commercially available kits. Fatty acid synthesis was evaluated from incorporation of 1-(14)C acetate. Regulation of fatty acid oxidation and lipogenesis were monitored with immunoblotting and immunoprecipitation studies. Ethanol exposure led to hepatotoxicity, as evident from the marked enhancement in the levels of AST and ALT. The values decreased almost to control levels in response to 14-DAG treatment. Results showed that ethanol feeding induced deactivation of AMP-activated protein kinase (AMPK) that led to enhanced lipid synthesis and decreased fatty acid oxidation, culminating in hepatic fat accumulation. Treatment with 14-DAG activated AMPK through induction of cyclic AMP-protein kinase A pathway. Activation of AMPK was followed by down-regulation of sterol regulatory element binding protein-1c, acetyl-CoA carboxylase, and fatty acid synthase, leading to suppression of lipogenesis. This was associated with up-regulation of sirtuin 1 and depletion of malonyl-CoA, in favor of increased fatty acid oxidation. 14-DAG controlled ethanol-induced hepatosteatosis by interfering with dysregulation of lipid metabolism. In conclusion, our results indicated that 14-DAG was capable of preventing the development of fatty liver through AMPK

  14. Suppression of mesangial proliferative glomerulonephritis development in rats by inhibitors of cAMP phosphodiesterase isozymes types III and IV.

    PubMed Central

    Tsuboi, Y; Shankland, S J; Grande, J P; Walker, H J; Johnson, R J; Dousa, T P

    1996-01-01

    conclude that antagonists of PDE-III and PDE-IV administered in submicromolar concentrations in vivo to ATS-injected rats can decrease the activation and proliferation of MC, inhibit the macrophage accumulation, and prevent proteinuria in the acute phase of MSGN. We propose that PDE isozyme inhibitors act to block (negative "crosstalk") the mitogen-stimulated intracellular signaling pathway which controls MC proliferation due to activating of the cAMP-PKA pathway. These results suggest that antagonists of PDE-111 and IV may have a suppressive effect in acute phases or relapses of glomerulopathies associated with MC proliferations. PMID:8755633

  15. Accumulation of swimming bacteria near an interface

    NASA Astrophysics Data System (ADS)

    Tang, Jay; Li, Guanglai

    2012-11-01

    Microbes inhabit planet earth over billions of years and have adapted to diverse physical environment of water, soil, and particularly at or near interfaces. We focused our attention on the locomotion of Caulobacter crescentus, a singly flagellated bacterium, at the interface of water/solid or water/air. We measured the distribution of a forward swimming strain of C. crescentus near a surface using a three-dimensional tracking technique based on dark field microscopy and found that the swimming bacteria accumulate heavily within a micrometer from the surface. We attribute this accumulation to frequent collisions of the swimming cells with the surface, causing them to align parallel to the surface as they continually move forward. The extent of accumulation at the steady state is accounted for by balancing alignment caused by these collisions with rotational Brownian motion of the micrometer-sized bacteria. We performed a simulation based on this model, which reproduced the measured results. Additional simulations demonstrate the dependence of accumulation on swimming speed and cell size, showing that longer and faster cells accumulate more near a surface than shorter and slower ones do. The overarching goal of our study is to describe interfacial microbial behavior through detailed analysis of their motion. We acknowledge support by NSF PHY 1058375.

  16. Geomorphic control of landscape carbon accumulation

    USGS Publications Warehouse

    Rosenbloom, N.A.; Harden, J.W.; Neff, J.C.; Schimel, D.S.

    2006-01-01

    We use the CREEP process-response model to simulate soil organic carbon accumulation in an undisturbed prairie site in Iowa. Our primary objectives are to identify spatial patterns of carbon accumulation, and explore the effect of erosion on basin-scale C accumulation. Our results point to two general findings. First, redistribution of soil carbon by erosion results in a net increase in basin-wide carbon storage relative to a noneroding environment. Landscape-average mean residence times are increased in an eroding landscape owing to the burial/preservation of otherwise labile C. Second, field observations taken along a slope transect may overlook significant intraslope variations in carbon accumulation. Spatial patterns of modeled deep C accumulation are complex. While surface carbon with its relatively short equilibration time is predictable from surface properties, deep carbon is strongly influenced by the landscape's geomorphic and climatic history, resulting in wide spatial variability. Convergence and divergence associated with upland swales and interfluves result in bimodal carbon distributions in upper and mid slopes; variability in carbon storage within modeled mid slopes was as high as simulated differences between erosional shoulders and depositional valley bottoms. The bimodality of mid-slope C variability in the model suggests that a three-dimensional sampling strategy is preferable over the traditional two-dimensional analog or "catena" approach. Copyright 2006 by the American Geophysical Union.

  17. Acetate limitation and nitrite accumulation during denitrification

    SciTech Connect

    Oh, J.; Silverstein, J.

    1999-03-01

    Nitrite accumulated in denitrifying activated sludge mixed liquor when the carbon and electron source, acetate, was limited. If acetate was added to obtain a carbon-to-nitrogen (C:N) ratio in the range of 2:1 to 3:1, nitrate was completely consumed at the same rate with no nitrite accumulation, indicating that nitrate concentration controlled the respiration rate as long as sufficient substrate was present. However, when acetate was reduced to a C:N ratio of 1:1, while nitrate continued to be consumed, > 50% of the initial nitrate-nitrogen accumulated as nitrite and 29% persisted as nitrite throughout an endogenous denitrification period of 8--9 h. While nitrite accumulated during acetate-limited denitrification, the specific nitrate reduction rate increased significantly compared with the rate when excess acetate was provided as follows: 0.034 mg-NO{sub 3}-N/mg-mixed liquid volatile suspended solids/h versus 0.023 mg-NO{sub 3}-N/mg-mixed liquid volatile suspended solids/h, respective. This may be explained by nitrate respiration out-competing nitrite respiration for limited acetate electrons. Complete restoration of balanced denitrification and elimination of nitrite accumulation during denitrification required several weeks after the C:N ratio was increased back to 2:1.

  18. Cyclic AMP synergizes with butyrate in promoting β-defensin 9 expression in chickens.

    PubMed

    Sunkara, Lakshmi T; Zeng, Xiangfang; Curtis, Amanda R; Zhang, Guolong

    2014-02-01

    Host defense peptides (HDP) have both microbicidal and immunomodulatory properties. Specific induction of endogenous HDP synthesis has emerged as a novel approach to antimicrobial therapy. Cyclic adenosine monophosphate (cAMP) and butyrate have been implicated in HDP induction in humans. However, the role of cAMP signaling and the possible interactions between cAMP and butyrate in regulating HDP expression in other species remain unknown. Here we report that activation of cAMP signaling induces HDP gene expression in chickens as exemplified by β-defensin 9 (AvBD9). We further showed that, albeit being weak inducers, cAMP agonists synergize strongly with butyrate or butyrate analogs in AvBD9 induction in macrophages and primary jejunal explants. Additionally, oral supplementation of forskolin, an adenylyl cyclase agonist in the form of a Coleus forskohlii extract, was found to induce AvBD9 expression in the crop of chickens. Furthermore, feeding with both forskolin and butyrate showed an obvious synergy in triggering AvBD9 expression in the crop and jejunum of chickens. Surprisingly, inhibition of the MEK-ERK mitogen-activated protein kinase (MAPK) pathway augmented the butyrate-FSK synergy, whereas blocking JNK or p38 MAPK pathway significantly diminished AvBD9 induction in chicken macrophages and jejunal explants in response to butyrate and FSK individually or in combination. Collectively, these results suggest the potential for concomitant use of butyrate and cAMP signaling activators in enhancing HDP expression, innate immunity, and disease resistance in both animals and humans.

  19. A CaMKII/PDE4D negative feedback regulates cAMP signaling

    PubMed Central

    Mika, Delphine; Richter, Wito; Conti, Marco

    2015-01-01

    cAMP production and protein kinase A (PKA) are the most widely studied steps in β-adrenergic receptor (βAR) signaling in the heart; however, the multifunctional Ca2+/calmodulin-dependent protein kinase II (CaMKII) is also activated in response to βAR stimulation and is involved in the regulation of cardiac excitation-contraction coupling. Its activity and expression are increased during cardiac hypertrophy, in heart failure, and under conditions that promote arrhythmias both in animal models and in the human heart, underscoring the clinical relevance of CaMKII in cardiac pathophysiology. Both CaMKII and PKA phosphorylate a number of protein targets critical for Ca2+ handling and contraction with similar, but not always identical, functional consequences. How these two pathways communicate with each other remains incompletely understood, however. To maintain homeostasis, cyclic nucleotide levels are regulated by phosphodiesterases (PDEs), with PDE4s predominantly responsible for cAMP degradation in the rodent heart. Here we have reassessed the interaction between cAMP/PKA and Ca2+/CaMKII signaling. We demonstrate that CaMKII activity constrains basal and βAR-activated cAMP levels. Moreover, we show that these effects are mediated, at least in part, by CaMKII regulation of PDE4D. This regulation establishes a negative feedback loop necessary to maintain cAMP/CaMKII homeostasis, revealing a previously unidentified function for PDE4D as a critical integrator of c