Science.gov

Sample records for 3h-cyclic amp accumulation

  1. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  2. Second Messenger Signaling in Bacillus subtilis: Accumulation of Cyclic di-AMP Inhibits Biofilm Formation

    PubMed Central

    Gundlach, Jan; Rath, Hermann; Herzberg, Christina; Mäder, Ulrike; Stülke, Jörg

    2016-01-01

    The Gram-positive model organism Bacillus subtilis produces the essential second messenger signaling nucleotide cyclic di-AMP. In B. subtilis and other bacteria, c-di-AMP has been implicated in diverse functions such as control of metabolism, cell division and cell wall synthesis, and potassium transport. To enhance our understanding of the multiple functions of this second messenger, we have studied the consequences of c-di-AMP accumulation at a global level by a transcriptome analysis. C-di-AMP accumulation affected the expression of about 700 genes, among them the two major operons required for biofilm formation. The expression of both operons was severely reduced both in the laboratory and a non-domesticated strain upon accumulation of c-di-AMP. In excellent agreement, the corresponding strain was unable to form complex colonies. In B. subtilis, the transcription factor SinR controls the expression of biofilm genes by binding to their promoter regions resulting in transcription repression. Inactivation of the sinR gene restored biofilm formation even at high intracellular c-di-AMP concentrations suggesting that the second messenger acts upstream of SinR in the signal transduction pathway. As c-di-AMP accumulation did not affect the intracellular levels of SinR, we conclude that the nucleotide affects the activity of SinR. PMID:27252699

  3. Second Messenger Signaling in Bacillus subtilis: Accumulation of Cyclic di-AMP Inhibits Biofilm Formation.

    PubMed

    Gundlach, Jan; Rath, Hermann; Herzberg, Christina; Mäder, Ulrike; Stülke, Jörg

    2016-01-01

    The Gram-positive model organism Bacillus subtilis produces the essential second messenger signaling nucleotide cyclic di-AMP. In B. subtilis and other bacteria, c-di-AMP has been implicated in diverse functions such as control of metabolism, cell division and cell wall synthesis, and potassium transport. To enhance our understanding of the multiple functions of this second messenger, we have studied the consequences of c-di-AMP accumulation at a global level by a transcriptome analysis. C-di-AMP accumulation affected the expression of about 700 genes, among them the two major operons required for biofilm formation. The expression of both operons was severely reduced both in the laboratory and a non-domesticated strain upon accumulation of c-di-AMP. In excellent agreement, the corresponding strain was unable to form complex colonies. In B. subtilis, the transcription factor SinR controls the expression of biofilm genes by binding to their promoter regions resulting in transcription repression. Inactivation of the sinR gene restored biofilm formation even at high intracellular c-di-AMP concentrations suggesting that the second messenger acts upstream of SinR in the signal transduction pathway. As c-di-AMP accumulation did not affect the intracellular levels of SinR, we conclude that the nucleotide affects the activity of SinR. PMID:27252699

  4. cAMP-mediated regulation of cholesterol accumulation in cystic fibrosis and Niemann-Pick type C cells

    PubMed Central

    Manson, Mary E.; Corey, Deborah A.; White, Nicole M.; Kelley, Thomas J.

    2008-01-01

    The goal of this study was to identify a mechanism regulating cholesterol accumulation in cystic fibrosis (CF) cells. Both CFTR activation and expression are regulated by the cAMP pathway, and it is hypothesized that a feedback response involving this pathway may be involved in the phenotype of cholesterol accumulation. To examine the role of the cAMP pathway in cholesterol accumulation, we treated two CF model cell lines with the Rp diastereomer of adenosine 3′,5′-cyclic monophosphorothioate (Rp-cAMPS) and visualized by filipin staining. Rp-cAMPS treatment eliminated cholesterol accumulation in CF cells, whereas 8-bromo-cAMP treatment led to cholesterol accumulation in wild-type cells. To confirm these findings in an independent model system, we also examined the role of cAMP in modulating cholesterol accumulation in Niemann-Pick type C (NPC) fibroblasts. Expression of the protein related to NPC, NPC1, is also directly regulated by cAMP; therefore, it is postulated that NPC cells exhibit the same cAMP-mediated control of cholesterol accumulation. Cholesterol accumulation in NPC cells also was reduced by the presence of Rp-cAMPS. Expression of β-arrestin-2 (βarr2), a marker of cellular response to cAMP signaling, was significantly elevated in CF model cells, Cftr−/− MNE, primary tissue obtained by nasal scrapes from CF subjects, and in NPC fibroblasts compared with respective controls. PMID:18790990

  5. Stimulation of T-cells with OKT3 antibodies increases forskolin binding and cyclic AMP accumulation.

    PubMed

    Kvanta, A; Gerwins, P; Jondal, M; Fredholm, B B

    1990-01-01

    It has recently been shown that elevation of cAMP by adenosine receptor stimulation may be potentiated by stimulation of the T-cell receptor/CD3 complex on human T-cells with the monoclonal antibody OKT3, and that this is mimicked by activation of protein kinase C [Kvanta, A. et al. (1989) Naunyn-Schmeideberg's Arch. Pharmac. 340, 715-717]. In this study the diterpene forskolin, which binds to and activates the adenylate cyclase, has been used to examine further how the CD3 complex may influence the adenylate cyclase pathway. Stimulation with OKT3 alone was found to cause a small dose-dependent increase in basal cAMP accumulation. When combining OKT3 with a concentration of forskolin (10 microM), which by itself had little effect on the cyclase activity, the cAMP accumulation was markedly potentiated. This potentiation was paralleled by an increase in [3H]forskolin binding to saponine permeabilized Jurkat cells from 24 to 41 fmol/10(6) cells. The OKT3 effect on cAMP was blocked by chelating extracellular Ca2+ with EGTA or intracellular Ca2+ with BAPTA and also by W-7, an inhibitor of calmodulin, but was unaffected by H-7, an inhibitor of protein kinase C. Even though OKT3 caused an increase in inositolphosphate turnover, and activated protein kinase C, neither phorbol 12,13 dibutyrate (PDBu) nor the Ca2(+)-ionophore A23187 could mimic the OKT3 effect, whereas a combination of PDBu and A23187 at high concentrations could potentiate forskolin stimulated cyclase activity. Together, these results indicated that stimulation of the CD3 complex could influence the adenylate cyclase by two different mechanisms, one involving activation of protein kinase C and another which does not. PMID:2177619

  6. A cardiac mitochondrial cAMP signaling pathway regulates calcium accumulation, permeability transition and cell death

    PubMed Central

    Wang, Z; Liu, D; Varin, A; Nicolas, V; Courilleau, D; Mateo, P; Caubere, C; Rouet, P; Gomez, A-M; Vandecasteele, G; Fischmeister, R; Brenner, C

    2016-01-01

    Although cardiac cytosolic cyclic 3′,5′-adenosine monophosphate (cAMP) regulates multiple processes, such as beating, contractility, metabolism and apoptosis, little is known yet on the role of this second messenger within cardiac mitochondria. Using cellular and subcellular approaches, we demonstrate here the local expression of several actors of cAMP signaling within cardiac mitochondria, namely a truncated form of soluble AC (sACt) and the exchange protein directly activated by cAMP 1 (Epac1), and show a protective role for sACt against cell death, apoptosis as well as necrosis in primary cardiomyocytes. Upon stimulation with bicarbonate (HCO3−) and Ca2+, sACt produces cAMP, which in turn stimulates oxygen consumption, increases the mitochondrial membrane potential (ΔΨm) and ATP production. cAMP is rate limiting for matrix Ca2+ entry via Epac1 and the mitochondrial calcium uniporter and, as a consequence, prevents mitochondrial permeability transition (MPT). The mitochondrial cAMP effects involve neither protein kinase A, Epac2 nor the mitochondrial Na+/Ca2+ exchanger. In addition, in mitochondria isolated from failing rat hearts, stimulation of the mitochondrial cAMP pathway by HCO3− rescued the sensitization of mitochondria to Ca2+-induced MPT. Thus, our study identifies a link between mitochondrial cAMP, mitochondrial metabolism and cell death in the heart, which is independent of cytosolic cAMP signaling. Our results might have implications for therapeutic prevention of cell death in cardiac pathologies. PMID:27100892

  7. Qushi Huayu Decoction Inhibits Hepatic Lipid Accumulation by Activating AMP-Activated Protein Kinase In Vivo and In Vitro

    PubMed Central

    Feng, Qin; Gou, Xiao-jun; Meng, Sheng-xi; Huang, Cheng; Zhang, Yu-quan; Tang, Ya-jun; Wang, Wen-jing; Xu, Lin; Peng, Jing-hua; Hu, Yi-yang

    2013-01-01

    Qushi Huayu Decoction (QHD), a Chinese herbal formula, has been proven effective on alleviating nonalcoholic fatty liver disease (NAFLD) in human and rats. The present study was conducted to investigate whether QHD could inhibit hepatic lipid accumulation by activating AMP-activated protein kinase (AMPK) in vivo and in vitro. Nonalcoholic fatty liver (NAFL) model was duplicated with high-fat diet in rats and with free fatty acid (FFA) in L02 cells. In in vivo experimental condition, QHD significantly decreased the accumulation of fatty droplets in livers, lowered low-density lipoprotein cholesterol (LDL-c), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) levels in serum. Moreover, QHD supplementation reversed the HFD-induced decrease in the phosphorylation levels of AMPK and acetyl-CoA carboxylase (ACC) and decreased hepatic nuclear protein expression of sterol regulatory element-binding protein-1 (SREBP-1) and carbohydrate-responsive element-binding protein (ChREBP) in the liver. In in vitro, QHD-containing serum decreased the cellular TG content and alleviated the accumulation of fatty droplets in L02 cells. QHD supplementation reversed the FFA-induced decrease in the phosphorylation levels of AMPK and ACC and decreased the hepatic nuclear protein expression of SREBP-1 and ChREBP. Overall results suggest that QHD has significant effect on inhibiting hepatic lipid accumulation via AMPK pathway in vivo and in vitro. PMID:23573117

  8. A PKG inhibitor increases Ca(2+)-regulated exocytosis in guinea pig antral mucous cells: cAMP accumulation via PDE2A inhibition.

    PubMed

    Tanaka, Saori; Tanaka, Rina; Harada, Saeko; Kohda, Yuka; Matsumura, Hitoshi; Shimamoto, Chikao; Sawabe, Yukinori; Marunaka, Yoshinori; Kuwabara, Hiroko; Takahashi, Yuko; Ito, Shigenori; Nakahari, Takashi

    2013-05-01

    In antral mucous cells, acetylcholine (ACh, 1 μM) activates Ca(2+)-regulated exocytosis, consisting of an initial peak that declines rapidly (initial transient phase) followed by a second slower decline (late phase) lasting during ACh stimulation. The addition of 8-bromo-cGMP (8-BrcGMP) enhanced the initial phase, which was inhibited by the protein kinase G (PKG) inhibitor guanosine 3',5'-cyclic monophosphorothoiate, β-phenyl-1,N(2)-etheno-8-bromo, Rp-isomer, sodium salt (Rp-8-BrPETcGMPS, 100 nM). However, Rp-8-BrPETcGMPS produced a delayed, but transient, increase in the exocytotic frequency during the late phase that was abolished by a protein kinase A (PKA) inhibitor (PKI-amide), suggesting that Rp-8-BrPETcGMPS accumulates cAMP. The cGMP-dependent phosphodiesterase 2 (PDE2), which degrades cAMP, may exist in antral mucous cells. The PDE2 inhibitor BAY-60-7550 (250 nM) mimicked the effect of Rp-8-BrPETcGMPS on ACh-stimulated exocytosis. Measurement of the cGMP and cAMP contents in antral mucosae revealed that ACh stimulates the accumulation of cGMP and that BAY-60-7550 accumulates cAMP similarly to Rp-8-BrPETcGMPS during ACh stimulation. Analyses of Western blot and immunohistochemistry demonstrated that PDE2A exists in antral mucous cells. In conclusion, Rp-8-BrPETcGMPS accumulates cAMP by inhibiting PDE2 in ACh-stimulated antral mucous cells, leading to the delayed, but transient, increase in the frequency of Ca(2+)-regulated exocytosis. PDE2 may prevent antral mucous cells from excessive mucin secretion caused by the cAMP accumulation. PMID:23449671

  9. Caffeine attenuates lipid accumulation via activation of AMP-activated protein kinase signaling pathway in HepG2 cells.

    PubMed

    Quan, Hai Yan; Kim, Do Yeon; Chung, Sung Hyun

    2013-04-01

    The main purpose of this study is to examine the effect of caffeine on lipid accumulation in human hepatoma HepG2 cells. Significant decreases in the accumulation of hepatic lipids, such as triglyceride (TG), and cholesterol were observed when HepG2 cells were treated with caffeine as indicated. Caffeine decreased the mRNA level of lipogenesis-associated genes (SREBP1c, SREBP2, FAS, SCD1, HMGR and LDLR). In contrast, mRNA level of CD36, which is responsible for lipid uptake and catabolism, was increased. Next, the effect of caffeine on AMP-activated protein kinase (AMPK) signaling pathway was examined. Phosphorylation of AMPK and acetyl-CoA carboxylase were evidently increased when the cells were treated with caffeine as indicated for 24 h. These effects were all reversed in the presence of compound C, an AMPK inhibitor. In summary, these data indicate that caffeine effectively depleted TG and cholesterol levels by inhibition of lipogenesis and stimulation of lipolysis through modulating AMPK-SREBP signaling pathways. PMID:23615262

  10. Alkaline pH- and cAMP-induced V-ATPase membrane accumulation is mediated by protein kinase A in epididymal clear cells.

    PubMed

    Pastor-Soler, Núria M; Hallows, Kenneth R; Smolak, Christy; Gong, Fan; Brown, Dennis; Breton, Sylvie

    2008-02-01

    In the epididymis, low luminal bicarbonate and acidic pH maintain sperm quiescent during maturation and storage. The vacuolar H(+)-ATPase (V-ATPase) in epididymal clear cells plays a major role in luminal acidification. We have shown previously that cAMP, luminal alkaline pH, and activation of the bicarbonate-regulated soluble adenylyl cyclase (sAC) induce V-ATPase apical accumulation in these cells, thereby stimulating proton secretion into the epididymal lumen. Here we examined whether protein kinase A (PKA) is involved in this response. Confocal immunofluorescence labeling on rat epididymis perfused in vivo showed that at luminal acidic pH (6.5), V-ATPase was distributed between short apical microvilli and subapical endosomes. The specific PKA activator N(6)-monobutyryl-3'-5'-cyclic monophosphate (6-MB-cAMP, 1 mM) induced elongation of apical microvilli and accumulation of V-ATPase in these structures. The PKA inhibitor myristoylated-PKI (mPKI, 10 microM) inhibited the apical accumulation of V-ATPase induced by 6-MB-cAMP. Perfusion at pH 6.5 with 8-(4-chlorophenylthio)-2-O-methyl-cAMP (8CPT-2-O-Me-cAMP; 10 microM), an activator of the exchange protein activated by cAMP (Epac), did not induce V-ATPase apical accumulation. When applied at a higher concentration (100 microM), 8CPT-2-O-Me-cAMP induced V-ATPase apical accumulation, but this effect was completely inhibited by mPKI, suggesting crossover effects on the PKA pathway with this compound at high concentrations. Importantly, the physiologically relevant alkaline pH-induced apical V-ATPase accumulation was completely inhibited by pretreatment with mPKI. We conclude that direct stimulation of PKA activity by cAMP is necessary and sufficient for the alkaline pH-induced accumulation of V-ATPase in clear cell apical microvilli. PMID:18160485

  11. Rapid glucocorticoid inhibition of vasoactive intestinal peptide-induced cyclic AMP accumulation and prolactin release in rat pituitary cells in culture.

    PubMed Central

    Rotsztejn, W H; Dussaillant, M; Nobou, F; Rosselin, G

    1981-01-01

    Vasoactive intestinal peptide (VIP) stimulates both adenosine 3',5'-cyclic monophosphate (cAMP) accumulation and prolactin release in normal rat pituitary cells in culture. cAMP accumulation is significant (P less than 0.01) at VIP concentrations as low as 1 nM and reaches a maximum with 0.1 microM. Addition of dexamethasone as early as 15 min before VIP inhibits VIP stimulation of both cAMP production and PRL secretion. The rapid inhibition is dose-dependent: it appears at doses as low as 0.01 pM and is complete at 1 pM dexamethasone. Increasing concentrations of dexamethasone induce a noncompetitive type of inhibition, as shown by the decrease in Vmax with no change in the apparent Km for VIP. Cycloheximide (1 mM) counteracts the inhibitory effect of dexamethasone on VIP-induced cAMP production, which suggests the involvement of a rapid protein synthesis mechanism. Ru-26988, a specific glucocorticoid devoid of any mineralocorticoid activity and which does not bind to intracellular transcortin-like component, also produces an inhibition of VIP-induced cAMP accumulation. Corticosterone also inhibits VIP-induced cAMP production but at concentrations higher than those of dexamethasone. In contrast, aldosterone, progesterone, estradiol, and testosterone have no effect. These results demonstrate that, in normal rat pituitary cells in culture, glucocorticoids at physiological concentrations rapidly inhibit the cAMP production and prolactin release induced by VIP by acting through specific glucocorticoid receptors. PMID:6278481

  12. Intracellular accumulation of AMP as a cause for the decline in rate of ethanol production by Saccharomyces cerevisiae during batch fermentation

    SciTech Connect

    Dombek, K.M.; Ingram, L.O.

    1988-01-01

    A general hypothesis is presented for the decline in the rate of ethanol production (per unit of cell protein) during batch fermentation. Inhibition of ethanol production is proposed to result from the intracellular accumulation of AMP during the transition from growth to the stationary phase. AMP acts as a competitive inhibitor of hexokinase with respect to ATP. When assayed in vitro in the presence of ATP and AMP concentration equivalent to those within cells at different stages of fermentation, hexokinase activity declined in parallel with the in vivo decline in the rate of ethanol production. The coupling of glycolytic flux and fermentation to cell growth via degradation products of RNA may be of evolutionary advantage for Saccharomyces cerevisiae. Such a coupling would reduce the exposure of nongrowing cells to potentially harmful concentrations of waste products from metabolism and would conserve nutrients for future growth under more favorable conditions.

  13. Cyclic di-AMP homeostasis in bacillus subtilis: both lack and high level accumulation of the nucleotide are detrimental for cell growth.

    PubMed

    Mehne, Felix M P; Gunka, Katrin; Eilers, Hinnerk; Herzberg, Christina; Kaever, Volkhard; Stülke, Jörg

    2013-01-18

    The genome of the Gram-positive soil bacterium Bacillus subtilis encodes three potential diadenylate cyclases that may synthesize the signaling nucleotide cyclic di-AMP (c-di-AMP). These enzymes are expressed under different conditions in different cell compartments, and they localize to distinct positions in the cell. Here we demonstrate the diadenylate cyclase activity of the so far uncharacterized enzymes CdaA (previously known as YbbP) and CdaS (YojJ). Our work confirms that c-di-AMP is essential for the growth of B. subtilis and shows that an excess of the molecule is also harmful for the bacteria. Several lines of evidence suggest that the diadenylate cyclase CdaA is part of the conserved essential cda-glm module involved in cell wall metabolism. In contrast, the CdaS enzyme seems to provide c-di-AMP for spores. Accumulation of large amounts of c-di-AMP impairs the growth of B. subtilis and results in the formation of aberrant curly cells. This phenotype can be partially suppressed by elevated concentrations of magnesium. These observations suggest that c-di-AMP interferes with the peptidoglycan synthesis machinery. The activity of the diadenylate cyclases is controlled by distinct molecular mechanisms. CdaA is stimulated by a regulatory interaction with the CdaR (YbbR) protein. In contrast, the activity of CdaS seems to be intrinsically restricted, and a single amino acid substitution is sufficient to drastically increase the activity of the enzyme. Taken together, our results support the idea of an important role for c-di-AMP in B. subtilis and suggest that the levels of the nucleotide have to be tightly controlled. PMID:23192352

  14. Effects of intrathecal amylin on formalin-induced nociception and on cAMP accumulation in the rat embryonic spinal cells.

    PubMed

    Khoshdel, Zahra; Takhshid, Mohammad Ali; Owji, Ali Akbar

    2016-06-01

    Amylin (AMY) is a member of calcitonin family of peptides. In this study, the effects of intrathecal (i.t) injection of AMY on the inflammatory pain and on the cAMP accumulation in the rat spinal cells were investigated. By using AMY receptor antagonists, we also studied the pharmacology of AMY receptors in the spinal cells. Formalin model of inflammatory pain was induced by intraplantar injection of formalin. AMY (0.06250-2500pmol/rat) was administrated i.t 15min before the injection of formalin. Antagonists were injected i.t 10min before the injection of AMY and/or morphine. AMY reduced formalin-induced pain in a dose dependent mode. This effect was inhibited by the potent AMY antagonist, AC187 but not CGRP8-37. rAMY8-37, most commonly reported as a weak AMY antagonist, showed to be equally or more potent than AC187 in antagonizing the above effects. The opioid antagonist, naloxone, had no significant effects on AMY antinociceptive effects. Primary dissociated cell culture was used to investigate the effect of AMY on cAMP production and to characterize AMY receptors in the spinal cells. AMY moderately increases cAMP accumulation in the spinal cells with an EC50 value of 74.62nM. This effect was not affected by CGRP8-37 but was inhibited by AC187 and rAMY8-37 with pA2 values of 7.94 and 7.87 respectively. In conclusion, effects of AMY in reducing formalin induced pain and on the cAMP accumulation by spinal cells are mediated through undefined receptors. PMID:26778650

  15. 4-Phenylbutyrate Attenuates the ER Stress Response and Cyclic AMP Accumulation in DYT1 Dystonia Cell Models

    PubMed Central

    Cho, Jin A.; Zhang, Xuan; Miller, Gregory M.; Lencer, Wayne I.; Nery, Flavia C.

    2014-01-01

    Dystonia is a neurological disorder in which sustained muscle contractions induce twisting and repetitive movements or abnormal posturing. DYT1 early-onset primary dystonia is the most common form of hereditary dystonia and is caused by deletion of a glutamic acid residue (302/303) near the carboxyl-terminus of encoded torsinA. TorsinA is localized primarily within the contiguous lumen of the endoplasmic reticulum (ER) and nuclear envelope (NE), and is hypothesized to function as a molecular chaperone and an important regulator of the ER stress-signaling pathway, but how the mutation in torsinA causes disease remains unclear. Multiple lines of evidence suggest that the clinical symptoms of dystonia result from abnormalities in dopamine (DA) signaling, and possibly involving its down-stream effector adenylate cyclase that produces the second messenger cyclic adenosine-3′, 5′-monophosphate (cAMP). Here we find that mutation in torsinA induces ER stress, and inhibits the cyclic adenosine-3′, 5′-monophosphate (cAMP) response to the adenylate cyclase agonist forskolin. Both defective mechanins are corrected by the small molecule 4-phenylbutyrate (4-PBA) that alleviates ER stress. Our results link torsinA, the ER-stress-response, and cAMP-dependent signaling, and suggest 4-PBA could also be used in dystonia treatment. Other pharmacological agents known to modulate the cAMP cascade, and ER stress may also be therapeutic in dystonia patients and can be tested in the models described here, thus supplementing current efforts centered on the dopamine pathway. PMID:25379658

  16. Insulin inhibits human erythrocyte cAMP accumulation and ATP release: role of PDE3 and PI3K

    PubMed Central

    Hanson, Madelyn S.; Stephenson, Alan H.; Bowles, Elizabeth A.; Sprague, Randy S.

    2010-01-01

    In non – erythroid cells, insulin stimulates a signal transduction pathway that results in the activation of phosphoinositide 3 – kinase (PI3K) and phosphorylation of phosphodiesterase 3 (PDE3). Erythrocytes possess insulin receptors, PI3K, and PDE3B. These cells release ATP via a signaling pathway that requires activation of the G protein, Gi, as well as increases in cAMP. Although insulin inhibits ATP release from human erythrocytes in response to Gi activation with mastoparan 7 (Mas 7), no effect on cAMP was described. Here, we investigated the hypothesis that insulin activates PDE3 in human erythrocytes via a PI3K – mediated mechanism resulting in cAMP hydrolysis and inhibition of ATP release. We show that insulin attenuates Mas 7 – induced increases in cAMP and that selective inhibitors of PDE3 (cilostazol) or PI3K (LY294002) rescue this effect of insulin. In addition, we demonstrated that both cilostazol and LY294002 prevent insulin – induced attenuation of Mas 7 – induced ATP release. These results provide support for the hypothesis that insulin activates PDE3 in erythrocytes via a PI3K – dependent mechanism. Once activated, PDE3 limits Mas 7 – induced increases in intracellular cAMP. This effect of insulin leads, ultimately, to decreased ATP release in response to Mas 7. Since the activation of Gi is required for reduced O2 tension – induced ATP release from erythrocytes, and insulin has been shown to inhibit that release, these results suggest a novel mechanism by which supraphysiological levels of plasma insulin, such as those reported in humans with prediabetes, could inhibit ATP release from erythrocytes. Erythrocyte – derived ATP has been shown to participate in the matching of O2 supply with demand in skeletal muscle. Thus, pathological increases in circulating insulin could, via activation of PDE3, inhibit ATP release from erythrocytes depriving the peripheral circulation of a mechanism that regulates delivery of O2 to meet tissue

  17. AMP-activated protein kinase inhibits alkaline pH- and PKA-induced apical vacuolar H+-ATPase accumulation in epididymal clear cells.

    PubMed

    Hallows, Kenneth R; Alzamora, Rodrigo; Li, Hui; Gong, Fan; Smolak, Christy; Neumann, Dietbert; Pastor-Soler, Núria M

    2009-04-01

    Acidic luminal pH and low [HCO(3)(-)] maintain sperm quiescent during maturation in the epididymis. The vacuolar H(+)-ATPase (V-ATPase) in clear cells is a major contributor to epididymal luminal acidification. We have shown previously that protein kinase A (PKA), acting downstream of soluble adenylyl cyclase stimulation by alkaline luminal pH or HCO(3)(-), induces V-ATPase apical membrane accumulation in clear cells. Here we examined whether the metabolic sensor AMP-activated protein kinase (AMPK) regulates this PKA-induced V-ATPase apical membrane accumulation. Immunofluorescence labeling of rat and non-human primate epididymides revealed specific AMPK expression in epithelial cells. Immunofluorescence labeling of rat epididymis showed that perfusion in vivo with the AMPK activators 5-aminoimidazole-4-carboxamide-1-beta-d-ribofuranoside (AICAR) or A-769662 induced a redistribution of the V-ATPase into subapical vesicles, even in the presence of a luminal alkaline (pH 7.8) buffer compared with that of controls perfused without drug. Moreover, preperfusion with AICAR blocked the PKA-mediated V-ATPase translocation to clear cell apical membranes induced by N(6)-monobutyryl-cAMP (6-MB-cAMP). Purified PKA and AMPK both phosphorylated V-ATPase A subunit in vitro. In HEK-293 cells [(32)P]orthophosphate in vivo labeling of the A subunit increased following PKA stimulation and decreased following RNA interference-mediated knockdown of AMPK. Finally, the extent of PKA-dependent in vivo phosphorylation of the A subunit increased with AMPK knockdown. In summary, our findings suggest that AMPK inhibits PKA-mediated V-ATPase apical accumulation in epididymal clear cells, that both kinases directly phosphorylate the V-ATPase A subunit in vitro and in vivo, and that AMPK inhibits PKA-dependent phosphorylation of this subunit. V-ATPase activity may be coupled to the sensing of acid-base status via PKA and to metabolic status via AMPK. PMID:19211918

  18. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  19. Low reversibility of intracellular cAMP accumulation in mouse Leydig tumor cells (MLTC-1) stimulated by human Luteinizing Hormone (hLH) and Chorionic Gonadotropin (hCG).

    PubMed

    Klett, Danièle; Meslin, Philippine; Relav, Lauriane; Nguyen, Thi Mong Diep; Mariot, Julie; Jégot, Gwenhaël; Cahoreau, Claire; Combarnous, Yves

    2016-10-15

    In order to study the intracellular cAMP response kinetics of Leydig cells to hormones with LH activity, we used MLTC-1 cells transiently expressing a chimeric cAMP-responsive luciferase so that real-time variations of intracellular cAMP concentration could be followed using oxiluciferin luminescence produced from catalyzed luciferin oxidation. The potencies of the different LHs and CGs were evaluated using areas under the curves (AUC) of their kinetics over 60 min stimulation. All mammalian LHs and CGs tested were found to stimulate cAMP accumulation in these cells. The reversibility of this stimulation was studied by removing the hormone from the culture medium after 10 min of incubation. The ratios of kinetics AUC after removing or not the hormone were used to evaluate the stimulation reversibility of each hormone. Natural and recombinant hLHs and hCGs were found to exhibit slowly reversible activation compared to pituitary rat, ovine, porcine, camel and equine LHs, serum-derived eCG (PMSG) and recombinant eLH/CGs. Carbohydrate side chains are not involved in this phenomenon since natural and recombinant homologous hormones exhibit the same reversibility rates. It is still unknown whether only one human subunit, α or β, is responsible for this behaviour or whether it is due to a particular feature of the hLH and hCG quaternary structure. PMID:27373440

  20. Effect of Serum from Chickens Treated with Clenbuterol on Myosin Accumulation, Beta-Adrenergic Receptor Population, and Cyclic AMP Synthesis in Embryonic Chicken Skeletal Muscle Cell Cultures

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Wuethrich, Andrew J.; Hancock, Deana L.

    2002-01-01

    Broiler chickens at 35 d of age were fed 1 ppm clenbuterol for 14 d. This level of dietary clenbuterol led to 5-7% increases in the weights of leg and breast muscle tissue. At the end of the 14-d period, serum was prepared from both control and clenbuterol-treated chickens, and was then employed as a component of cell culture media at a final concentration of 20% (v/v). Muscle cell cultures were prepared from both the leg and the breast muscle groups of 12-d chick embryos. Treatment groups included control chicken serum to which 10 nM, 50 nM, and 1 uM clenbuterol had been added, as well as cells grown in media containing 10% horse serum. Cultures were subjected to each treatment for 3 d, beginning on the seventh d in culture. Neither the percent fusion nor the number of nuclei in myotubes was significantly affected by any of the treatments. The quantity of myosin heavy chains (MHCs) was not increased by serum from clenbuterol-treated chickens in either breast or leg muscle cultures; however, the MHC quantity was 50-150% higher in cultures grown in control chicken serum to which 10 and 50 nM clenbuterol had also been added. The B-adrenergic receptor (betaAR) population was 4000-7000 betaARs per cell in cultures grown in chicken serum with leg muscle cultures having approximately 25-30% more receptors than breast muscle Culture. Receptor population was not significantly affected by the presence of clenbuterol or by the presence of serum from clenbuterol-treated chickens. In contrast, the betaAR Population in leg and breast muscle cultures grown in the presence of 10% horse serum was 16,000-18,000 betaARs per cell. Basal concentration of cyclic adenosine 3':5'monophosphate (cAMP) was not significantly affected by the treatments. When cultures grown in chicken serum were stimulated for 10 min with 1 uM isoproterenol, limited increases of 12-20% in cAMP Concentration above the. basal levels were observed. However, when cultures grown in the presence of horse serum were

  1. Compartmentalized Accumulation of cAMP near Complexes of Multidrug Resistance Protein 4 (MRP4) and Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Contributes to Drug-induced Diarrhea*

    PubMed Central

    Moon, Changsuk; Zhang, Weiqiang; Ren, Aixia; Arora, Kavisha; Sinha, Chandrima; Yarlagadda, Sunitha; Woodrooffe, Koryse; Schuetz, John D.; Valasani, Koteswara Rao; de Jonge, Hugo R.; Shanmukhappa, Shiva Kumar; Shata, Mohamed Tarek M.; Buddington, Randal K.; Parthasarathi, Kaushik; Naren, Anjaparavanda P.

    2015-01-01

    Diarrhea is one of the most common adverse side effects observed in ∼7% of individuals consuming Food and Drug Administration (FDA)-approved drugs. The mechanism of how these drugs alter fluid secretion in the gut and induce diarrhea is not clearly understood. Several drugs are either substrates or inhibitors of multidrug resistance protein 4 (MRP4), such as the anti-colon cancer drug irinotecan and an anti-retroviral used to treat HIV infection, 3′-azido-3′-deoxythymidine (AZT). These drugs activate cystic fibrosis transmembrane conductance regulator (CFTR)-mediated fluid secretion by inhibiting MRP4-mediated cAMP efflux. Binding of drugs to MRP4 augments the formation of MRP4-CFTR-containing macromolecular complexes that is mediated via scaffolding protein PDZK1. Importantly, HIV patients on AZT treatment demonstrate augmented MRP4-CFTR complex formation in the colon, which defines a novel paradigm of drug-induced diarrhea. PMID:25762723

  2. Houttuynia cordata attenuates lipid accumulation via activation of AMP-activated protein kinase signaling pathway in HepG2 cells.

    PubMed

    Kang, Hyun; Koppula, Sushruta

    2014-01-01

    Houttuynia cordata (H. cordata) from the family Saururaceae is a perennial herb native to Southeast Asia. It possesses a range of medicinal properties to treat several disease symptoms including allergic inflammation and anaphylaxis. In the present investigation, we provided the molecular mechanisms underlying the role of H. cordata extract (HCE) in the prevention of high glucose-induced lipid accumulation in human HepG2 hepatocytes. HepG2 cells were pre-treated with various concentrations of HCE (0, 10, 20, 40, and 80 μg/mL) and treated with serum-free medium with normal glucose (5 mM) for 1 h, followed by exposure to high glucose (25 mM D-glucose) for 24 h. HCE significantly and dose-dependently attenuated lipid accumulation in human HepG2 hepatocytes when exposed to high glucose (25 mM D-glucose) (p < 0.05, p < 0.01 and p < 0.001 at 20, 40, and 80 μg/mL concentrations, respectively). Further, HCE attenuated the expression of fatty acid synthase (FAS), sterol regulatory element-binding protein-1 and glycerol 3-phosphate acyltransferases (GPATs). The adenosine monophosphate-activated protein kinase (AMPK) was also activated by HCE treatment when exposed to high glucose (25 mM D-glucose) in human HepG2 hepatocytes. This study suggests the hypolipidemic effects of HCE by the inhibition of lipid biosynthesis mediated through AMPK signaling, which may play an active role and can be developed as an anti-obesity agent. PMID:24871657

  3. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC

    PubMed Central

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  4. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC.

    PubMed

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  5. Inducing coproporphyria in rat hepatocyte cultures using cyclic AMP and cyclic AMP-releasing agents.

    PubMed

    De Matteis, Francesco; Harvey, Carolyn

    2005-07-01

    Cyclic AMP (c-AMP), added on its own to rat hepatocyte cultures, caused a marked accumulation of coproporphyrin III. The results obtained by comparing the effect of c-AMP to that of exogenous 5-aminolevulinate (ALA), and from adding c-AMP and ALA together, indicated that the coproporphyrinogen III metabolism was blocked, even though no inhibition of the relevant enzyme, coproporphyrinogen oxidase, could be demonstrated. Preferential accumulation of coproporphyrin could also be produced in cultures of rat hepatocytes by agents that raise the cellular levels of cyclic AMP, such as glucagon. The effect of supplementing the culture medium with triiodothyronine (T3) on the response of rat hepatocytes to c-AMP was also investigated. T3, which is known to stimulate mitochondrial respiration, uncoupling O2 consumption from ATP synthesis, produced a c-AMP-like effect when given on its own and potentiated the effect of c-AMP, with an apparent increase in the severity of the metabolic block. It is suggested that an oxidative mechanism may be activated in c-AMP and T3-induced coproporphyria, preferentially involving the mitochondrial compartment, leading to oxidation of porphyrinogen intermediates of haem biosynthesis, especially coproporphyrinogen. Coproporphyin, the fully oxidized aromatic derivative produced, cannot be metabolized and will therefore accumulate. PMID:15902420

  6. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  7. Modulators of cyclic AMP systems.

    PubMed

    Hess, S M; Chasin, M; Free, C A; Harris, D N

    1975-01-01

    On the basis of the data reported here, one may conclude that although many agents that act in the central nervous system are modulators of the action of cyclic AMP, it is difficult to establish a direct connection between the pharmacologic activity and the levels of cyclic AMP in the brain. This lack of interrelation applies to the benzodiazepines as well as to the pyrazolopyridines. The data for members of the latter group are somewhat frustrating in this regard, since an excellent correlation has been shown to exist between the potency of inhibition of PDE and activity in the antianxiety test. In measurements of steroidogenesis in the isolated adrenal cell, the correlation between activity in vito and the conflict assay is even better. The data presented here and reported elsewhere (Shimizu et al., 1974; Kelly et al., 1974; Mayer and King, 1974; King and Mayer, 1974) provide evidence that agents that act as inhibitors of PDE in cell-free systems exert their influence on cyclic AMP in tissue slices of the brain of guinea pigs by mechanisms that seem not to be related to an effect on PDE. Papaverine, and possibly chlordiazepoxide, may act by releasing agonists that, in turn, stimulate the accumulation of cyclic AMP. This activity is blocked bo other inhibitors of PDE, such as theophyline. Results obtained by the use of platelets are refreshingly clear. Inhibition of aggregation has been shown to occur when the level of cyclic AMP is raised, and a suggestive exists that the most potent inhibitors of platelet PDE are the best potentiators of the action of PGE1 in blocking aggregation. The study utilizing drugs collected from a large number of therapeutic classes makes clear that it is difficult to attribute the mechanism of action for any of the classes studied to modulation of cyclic AMP. An unexpected finding of this study, however, was the fact that pharmacologic agents include an unusually large number of inhibitors of PDE as compared with agents chosen at

  8. Accumulate repeat accumulate codes

    NASA Technical Reports Server (NTRS)

    Abbasfar, Aliazam; Divsalar, Dariush; Yao, Kung

    2004-01-01

    In this paper we propose an innovative channel coding scheme called 'Accumulate Repeat Accumulate codes' (ARA). This class of codes can be viewed as serial turbo-like codes, or as a subclass of Low Density Parity Check (LDPC) codes, thus belief propagation can be used for iterative decoding of ARA codes on a graph. The structure of encoder for this class can be viewed as precoded Repeat Accumulate (RA) code or as precoded Irregular Repeat Accumulate (IRA) code, where simply an accumulator is chosen as a precoder. Thus ARA codes have simple, and very fast encoder structure when they representing LDPC codes. Based on density evolution for LDPC codes through some examples for ARA codes, we show that for maximum variable node degree 5 a minimum bit SNR as low as 0.08 dB from channel capacity for rate 1/2 can be achieved as the block size goes to infinity. Thus based on fixed low maximum variable node degree, its threshold outperforms not only the RA and IRA codes but also the best known LDPC codes with the dame maximum node degree. Furthermore by puncturing the accumulators any desired high rate codes close to code rate 1 can be obtained with thresholds that stay close to the channel capacity thresholds uniformly. Iterative decoding simulation results are provided. The ARA codes also have projected graph or protograph representation that allows for high speed decoder implementation.

  9. AMPED Program Overview

    ScienceCinema

    Gur, Ilan

    2014-04-02

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  10. AMPED Program Overview

    SciTech Connect

    Gur, Ilan

    2014-03-04

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  11. In vitro and in vivo characterization of the Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodiesterase CpdA, required for cAMP homeostasis and virulence factor regulation.

    PubMed

    Fuchs, Erin L; Brutinel, Evan D; Klem, Erich R; Fehr, Anthony R; Yahr, Timothy L; Wolfgang, Matthew C

    2010-06-01

    Cyclic AMP (cAMP) is an important second messenger signaling molecule that controls a wide variety of eukaryotic and prokaryotic responses to extracellular cues. For cAMP-dependent signaling pathways to be effective, the intracellular cAMP concentration is tightly controlled at the level of synthesis and degradation. In the opportunistic human pathogen Pseudomonas aeruginosa, cAMP is a key regulator of virulence gene expression. To better understand the role of cAMP homeostasis in this organism, we identified and characterized the enzyme CpdA, a putative cAMP phosphodiesterase. We demonstrate that CpdA possesses 3',5'-cAMP phosphodiesterase activity in vitro and that it utilizes an iron-dependent catalytic mechanism. Deletion of cpdA results in the accumulation of intracellular cAMP and altered regulation of P. aeruginosa virulence traits. Further, we demonstrate that the cAMP-dependent transcription factor Vfr directly regulates cpdA expression in response to intracellular cAMP accumulation, thus providing a feedback mechanism for controlling cAMP levels and fine-tuning virulence factor expression. PMID:20348254

  12. Cyclic AMP phosphodiesterase in Salmonella typhimurium: characteristics and physiological function.

    PubMed

    Botsford, J L

    1984-11-01

    The physiological function of cyclic AMP (cAMP) phosphodiesterase in Salmonella typhimurium was investigated with strains which were isogenic except for the cpd locus. In crude broken-cell extracts the properties of the enzyme were found to be similar to those reported for Escherichia coli. The specific activity in the mutant was less than 1% that in the wild type. Rates of cAMP production in the mutant were as much as twice those observed in the wild type. The amount of cAMP accumulated when cells grew overnight with limiting glucose was 4.5-fold greater in the mutant than in the wild type. The intracellular concentration of cAMP in the two strains was measured directly, using four different techniques to wash the cells to remove extracellular cAMP. The cAMP level in the cpd strain was only 25% greater than in the wild type. The functional concentration of the cAMP receptor protein-cAMP complex was estimated indirectly from the specific activity of beta-galactosidase in the two strains after introducing F'lac. When cells were grown with carbon sources permitting synthesis of different levels of cAMP, the specific activity of the enzyme was at most 25% greater in the cpd strain. The cpd strain was more sensitive to the effects of exogenous cAMP. Exogenous cAMP relieved both permanent and transient catabolite repression of the lac operon at lower concentrations in the cpd strain than in the wild type. When cells grew with glucose, glycerol, or ribose, exogenous cAMP inhibited growth of the mutant strain more than the wild type. PMID:6094495

  13. Applying Mathematical Processes (AMP)

    ERIC Educational Resources Information Center

    Kathotia, Vinay

    2011-01-01

    This article provides insights into the "Applying Mathematical Processes" resources, developed by the Nuffield Foundation. It features Nuffield AMP activities--and related ones from Bowland Maths--that were designed to support the teaching and assessment of key processes in mathematics--representing a situation mathematically, analysing,…

  14. Accumulate-Repeat-Accumulate-Accumulate-Codes

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush; Dolinar, Sam; Thorpe, Jeremy

    2004-01-01

    Inspired by recently proposed Accumulate-Repeat-Accumulate (ARA) codes [15], in this paper we propose a channel coding scheme called Accumulate-Repeat-Accumulate-Accumulate (ARAA) codes. These codes can be seen as serial turbo-like codes or as a subclass of Low Density Parity Check (LDPC) codes, and they have a projected graph or protograph representation; this allows for a high-speed iterative decoder implementation using belief propagation. An ARAA code can be viewed as a precoded Repeat-and-Accumulate (RA) code with puncturing in concatenation with another accumulator, where simply an accumulator is chosen as the precoder; thus ARAA codes have a very fast encoder structure. Using density evolution on their associated protographs, we find examples of rate-lJ2 ARAA codes with maximum variable node degree 4 for which a minimum bit-SNR as low as 0.21 dB from the channel capacity limit can be achieved as the block size goes to infinity. Such a low threshold cannot be achieved by RA or Irregular RA (IRA) or unstructured irregular LDPC codes with the same constraint on the maximum variable node degree. Furthermore by puncturing the accumulators we can construct families of higher rate ARAA codes with thresholds that stay close to their respective channel capacity thresholds uniformly. Iterative decoding simulation results show comparable performance with the best-known LDPC codes but with very low error floor even at moderate block sizes.

  15. Accumulate-Repeat-Accumulate-Accumulate Codes

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush; Dolinar, Samuel; Thorpe, Jeremy

    2007-01-01

    Accumulate-repeat-accumulate-accumulate (ARAA) codes have been proposed, inspired by the recently proposed accumulate-repeat-accumulate (ARA) codes. These are error-correcting codes suitable for use in a variety of wireless data-communication systems that include noisy channels. ARAA codes can be regarded as serial turbolike codes or as a subclass of low-density parity-check (LDPC) codes, and, like ARA codes they have projected graph or protograph representations; these characteristics make it possible to design high-speed iterative decoders that utilize belief-propagation algorithms. The objective in proposing ARAA codes as a subclass of ARA codes was to enhance the error-floor performance of ARA codes while maintaining simple encoding structures and low maximum variable node degree.

  16. Activated cAMP receptors switch encystation into sporulation

    PubMed Central

    Kawabe, Yoshinori; Morio, Takahiro; James, John L.; Prescott, Alan R.; Tanaka, Yoshimasa; Schaap, Pauline

    2009-01-01

    Metazoan embryogenesis is controlled by a limited number of signaling modules that are used repetitively at successive developmental stages. The development of social amoebas shows similar reiterated use of cAMP-mediated signaling. In the model Dictyostelium discoideum, secreted cAMP acting on 4 cAMP receptors (cARs1-4) coordinates cell movement during aggregation and fruiting body formation, and induces the expression of aggregation and sporulation genes at consecutive developmental stages. To identify hierarchy in the multiple roles of cAMP, we investigated cAR heterogeneity and function across the social amoeba phylogeny. The gene duplications that yielded cARs 2-4 occurred late in evolution. Many species have only a cAR1 ortholog that duplicated independently in the Polysphondylids and Acytostelids. Disruption of both cAR genes of Polysphondylium pallidum (Ppal) did not affect aggregation, but caused complete collapse of fruiting body morphogenesis. The stunted structures contained disorganized stalk cells, which supported a mass of cysts instead of spores; cAMP triggered spore gene expression in Ppal, but not in the cAR null mutant, explaining its sporulation defect. Encystation is the survival strategy of solitary amoebas, and lower taxa, like Ppal, can still encyst as single cells. Recent findings showed that intracellular cAMP accumulation suffices to trigger encystation, whereas it is a complementary requirement for sporulation. Combined, the data suggest that cAMP signaling in social amoebas evolved from cAMP-mediated encystation in solitary amoebas; cAMP secretion in aggregates prompted the starving cells to form spores and not cysts, and additionally organized fruiting body morphogenesis. cAMP-mediated aggregation was the most recent innovation. PMID:19369200

  17. Counteracting Roles of AMP Deaminase and AMP Kinase in the Development of Fatty Liver

    PubMed Central

    Lanaspa, Miguel A.; Cicerchi, Christina; Garcia, Gabriela; Li, Nanxing; Roncal-Jimenez, Carlos A.; Rivard, Christopher J.; Hunter, Brandi; Andrés-Hernando, Ana; Ishimoto, Takuji; Sánchez-Lozada, Laura G.; Thomas, Jeffrey; Hodges, Robert S.; Mant, Colin T.; Johnson, Richard J.

    2012-01-01

    Fatty liver (hepatic steatosis) is associated with nucleotide turnover, loss of ATP and generation of adenosine monophosphate (AMP). It is well known that in fatty liver, activity of the AMP-activated kinase (AMPK) is reduced and that its stimulation can prevent hepatic steatosis by both enhancing fat oxidation and reducing lipogenesis. Here we show that another AMP dependent enzyme, AMPD2, has opposing effects on fatty acid oxidation when compared to AMPK. In human hepatocytres, AMPD2 activation –either by overexpression or by lowering intracellular phosphate levels with fructose- is associated with a significant reduction in AMPK activity. Likewise, silencing of AMPK spontaneously increases AMPD activity, demonstrating that these enzymes counter-regulate each other. Furthermore, we show that a downstream product of AMP metabolism through AMPD2, uric acid, can inhibit AMPK activity in human hepatocytes. Finally, we show that fructose-induced fat accumulation in hepatocytes is due to a dominant stimulation of AMPD2 despite stimulating AMPK. In this regard, AMPD2-deficient hepatocytes demonstrate a further activation of AMPK after fructose exposure in association with increased fatty acid oxidation, and conversely silencing AMPK enhances AMPD-dependent fat accumulation. In vivo, we show that sucrose fed rats also develop fatty liver that is blocked by metformin in association with both a reduction in AMPD activity and an increase in AMPK activity. In summary, AMPD and AMPK are both important in hepatic fat accumulation and counter-regulate each other. We present the novel finding that uric acid inhibits AMPK kinase activity in fructose-fed hepatocytes thus providing new insights into the pathogenesis of fatty liver. PMID:23152807

  18. An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis

    PubMed Central

    Gundlach, Jan; Mehne, Felix M. P.; Herzberg, Christina; Kampf, Jan; Valerius, Oliver; Kaever, Volkhard

    2015-01-01

    ABSTRACT Gram-positive bacteria synthesize the second messenger cyclic di-AMP (c-di-AMP) to control cell wall and potassium homeostasis and to secure the integrity of their DNA. In the firmicutes, c-di-AMP is essential for growth. The model organism Bacillus subtilis encodes three diadenylate cyclases and two potential phosphodiesterases to produce and degrade c-di-AMP, respectively. Among the three cyclases, CdaA is conserved in nearly all firmicutes, and this enzyme seems to be responsible for the c-di-AMP that is required for cell wall homeostasis. Here, we demonstrate that CdaA localizes to the membrane and forms a complex with the regulatory protein CdaR and the glucosamine-6-phosphate mutase GlmM. Interestingly, cdaA, cdaR, and glmM form a gene cluster that is conserved throughout the firmicutes. This conserved arrangement and the observed interaction between the three proteins suggest a functional relationship. Our data suggest that GlmM and GlmS are involved in the control of c-di-AMP synthesis. These enzymes convert glutamine and fructose-6-phosphate to glutamate and glucosamine-1-phosphate. c-di-AMP synthesis is enhanced if the cells are grown in the presence of glutamate compared to that in glutamine-grown cells. Thus, the quality of the nitrogen source is an important signal for c-di-AMP production. In the analysis of c-di-AMP-degrading phosphodiesterases, we observed that both phosphodiesterases, GdpP and PgpH (previously known as YqfF), contribute to the degradation of the second messenger. Accumulation of c-di-AMP in a gdpP pgpH double mutant is toxic for the cells, and the cells respond to this accumulation by inactivation of the diadenylate cyclase CdaA. IMPORTANCE Bacteria use second messengers for signal transduction. Cyclic di-AMP (c-di-AMP) is the only second messenger known so far that is essential for a large group of bacteria. We have studied the regulation of c-di-AMP synthesis and the role of the phosphodiesterases that degrade this second

  19. AMP-18 Targets p21 to Maintain Epithelial Homeostasis

    PubMed Central

    Chen, Peili; Li, Yan Chun; Toback, F. Gary

    2015-01-01

    Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD). We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP)-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF)-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI) mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD. PMID:25919700

  20. Pharmacological characterization of the dopamine receptor coupled to cyclic AMP formation expressed by rat mesenteric artery vascular smooth muscle cells in culture.

    PubMed Central

    Hall, A. S.; Bryson, S. E.; Vaughan, P. F.; Ball, S. G.; Balmforth, A. J.

    1993-01-01

    1. Mesenteric artery vascular smooth muscle cells derived from male Wistar rats and grown in culture were prelabelled with [3H]-adenine and exposed to a range of dopamine receptor agonists and antagonists. Resultant [3H]-cyclic AMP formation was determined and concentration-effect curves constructed, in the presence of propranolol (10-6) M) and the phosphodiesterase inhibitor IBMX (5 x 10(-4) M). 2. Ka apparent values for D1/DA1 dopamine receptor agonists SKF 38393, fenoldopam, 6,7-ADTN, and dopamine were 0.06, 0.59, 4.06 and 5.77 x 10(-6) M respectively. Although fenoldopam and SKF 38393 were more potent than dopamine, they were partial agonists with efficacies, relative to dopamine of approximately 48% and 24% respectively. 6,7-ADTN, in contrast, behaved as a full agonist. 3. Dopamine-stimulated cyclic AMP formation was inhibited in a concentration-dependent manner by the D1/DA1 dopamine receptor selective antagonists, SCH 23390 and cis-flupenthixol (Ki values 0.53 and 36.1 x 10(-1) M respectively). In contrast, the D2/DA2 dopamine receptor selective antagonists, domperidone and (-)-sulpiride, were less potent (Ki values 2.06 and 5.82 x 10(-6) M respectively). Furthermore, the stereoisomers of SCH 23390 and cis-flupenthixol, SCH 23388 and trans-flupenthixol, were at least two orders of magnitude less potent (Ki values 0.14 and 13.2 x 10(-6) M respectively) indicating the stereoselective nature of this receptor. 4. Our results indicate that rat mesenteric artery vascular smooth muscle cells in culture express a dopamine receptor coupled to cyclic AMP formation, which has the pharmacological profile, characteristic of the D1 dopamine receptor subfamily. PMID:7902178

  1. cAMP stimulates the ubiquitin/proteasome pathway in rat spinal cord neurons.

    PubMed

    Myeku, Natura; Wang, Hu; Figueiredo-Pereira, Maria E

    2012-10-11

    Proteasome impairment and accumulation of ubiquitinated proteins are implicated in neurodegeneration associated with different forms of spinal cord injury. We show herein that elevating cAMP in rat spinal cord neurons increases 26S proteasome activity in a protein kinase A-dependent manner. Treating spinal cord neurons with dibutyryl-cAMP (db-cAMP) also raised the levels of various components of the UPP including proteasome subunits Rpt6 and β5, polyubiquitin shuttling factor p62/sequestosome1, E3 ligase CHIP, AAA-ATPase p97 and the ubiquitin gene ubB. Finally, db-cAMP reduced the accumulation of ubiquitinated proteins, proteasome inhibition, and neurotoxicity triggered by the endogenous product of inflammation prostaglandin J2. We propose that optimizing the effects of cAMP/PKA-signaling on the UPP could offer an effective therapeutic approach to prevent UPP-related proteotoxicity in spinal cord neurons. PMID:22982149

  2. Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacterium smegmatis

    PubMed Central

    Tang, Qing; Luo, Yunchao; Zheng, Cao; Yin, Kang; Ali, Maria Kanwal; Li, Xinfeng; He, Jin

    2015-01-01

    Cyclic di‑AMP (c-di-AMP) is a second signaling molecule involved in the regulation of bacterial physiological processes and interaction between pathogen and host. However, the regulatory network mediated by c-di-AMP in Mycobacterium remains obscure. In M. smegmatis, a diadenylate cyclase (DAC) was reported recently, but there is still no investigation on c-di-AMP phosphodiesterase (PDE). Here, we provide a systematic study on signaling mechanism of c-di-AMP PDE in M. smegmatis. Based on our enzymatic analysis, MsPDE (MSMEG_2630), which contained a DHH-DHHA1 domain, displayed a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP. MsPDE was capable of converting c-di-AMP to pApA and AMP, and hydrolyzing pApA to AMP. Site-directed mutations in DHH and DHHA1 revealed that DHH domain was critical for the phosphodiesterase activity. To explore the regulatory role of c-di-AMP in vivo, we constructed the mspde mutant (Δmspde) and found that deficiency of MsPDE significantly enhanced intracellular C12-C20 fatty acid accumulation. Deficiency of DAC in many bacteria results in cell death. However, we acquired the M. smegmatis strain with DAC gene disrupted (ΔmsdisA) by homologous recombination approach. Deletion of msdisA reduced bacterial C12-C20 fatty acids production but scarcely affected bacterial survival. We also provided evidences that superfluous c-di-AMP in M. smegmatis could lead to abnormal colonial morphology. Collectively, our results indicate that MsPDE is a functional c-di-AMP-specific phosphodiesterase both in vitro and in vivo. Our study also expands the regulatory network mediated by c-di-AMP in M. smegmatis. PMID:26078723

  3. Experiment definition studies for AMPS Spacelab

    NASA Technical Reports Server (NTRS)

    Liemohn, H.

    1975-01-01

    The electrical charging of the space shuttle orbiter is discussed in relation to the AMPS Spacelab payload along with an operations research technique for the selection of AMPS Spacelab experiments. Experiments proposed for AMPS include: hydromagnetic wave experiments; bistatic sounder of AMPS wake; and an artificial meteor gun. Experiment objectives and instrument functions are given for all experiments.

  4. Accumulate Repeat Accumulate Coded Modulation

    NASA Technical Reports Server (NTRS)

    Abbasfar, Aliazam; Divsalar, Dariush; Yao, Kung

    2004-01-01

    In this paper we propose an innovative coded modulation scheme called 'Accumulate Repeat Accumulate Coded Modulation' (ARA coded modulation). This class of codes can be viewed as serial turbo-like codes, or as a subclass of Low Density Parity Check (LDPC) codes that are combined with high level modulation. Thus at the decoder belief propagation can be used for iterative decoding of ARA coded modulation on a graph, provided a demapper transforms the received in-phase and quadrature samples to reliability of the bits.

  5. Cross-talk between glucagon- and adenosine-mediated signalling systems in rat hepatocytes: effects on cyclic AMP-phosphodiesterase activity.

    PubMed Central

    Robles-Flores, M; Allende, G; Piña, E; García-Sáinz, J A

    1995-01-01

    The effect of adenosine analogues on glucagon-stimulated cyclic AMP accumulation in rat hepatocytes was explored. N6-Cyclopentyladenosine (CPA), 5'-N-ethylcarboxamidoadenosine and N6-(R-phenylisopropyl)adenosine inhibited in a dose-dependent manner the cyclic AMP accumulation induced by glucagon. This effect seems to be mediated through A1 adenosine receptors. Pertussis toxin completely abolished the effect of CPA on glucagon-stimulated cyclic AMP accumulation in whole cells which suggested that a pertussis-toxin-sensitive G-protein was involved. On the other hand, this action of adenosine analogues on glucagon-induced cyclic AMP accumulation was reverted by the selective low-Km cyclic AMP-phosphodiesterase inhibitor Ro 20-1724. Analysis of cyclic AMP-phosphodiesterase activity in purified hepatocyte plasma membranes showed that glucagon in the presence of GTP inhibited basal PDE activity by 45% and that CPA reverted this inhibition in dose-dependent manner. In membranes derived from pertussis-toxin-treated rats, we observed no inhibition of cyclic AMP-phosphodiesterase activity by glucagon in the absence or presence of CPA. Our results indicate that in hepatocyte plasma membranes, stimulation of adenylate cyclase activity and inhibition of a low-Km cyclic AMP phosphodiesterase activity are co-ordinately regulated by glucagon, and that A1 adenosine receptors can inhibit glucagon-stimulated cyclic AMP accumulation by blocking glucagon's effect on phosphodiesterase activity. Images Figure 2 PMID:8554517

  6. Crystal structure of the AmpR effector binding domain provides insight into the molecular regulation of inducible ampc beta-lactamase.

    PubMed

    Balcewich, Misty D; Reeve, Thomas M; Orlikow, Evan A; Donald, Lynda J; Vocadlo, David J; Mark, Brian L

    2010-07-30

    Hyperproduction of AmpC beta-lactamase (AmpC) is a formidable mechanism of resistance to penicillins and cephalosporins in Gram-negative bacteria such as Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is regulated by the LysR-type transcriptional regulator AmpR. ampR and ampC genes form a divergent operon with overlapping promoters to which AmpR binds and regulates the transcription of both genes. AmpR induces ampC by binding to one member of the family of 1,6-anhydro-N-acetylmuramyl peptides, which are cytosolic catabolites of peptidoglycan that accumulate during beta-lactam challenge. To gain structural insights into AmpR regulation, we determined the crystal structure of the effector binding domain (EBD) of AmpR from Citrobacter freundii up to 1.83 A resolution. The AmpR EBD is dimeric and each monomer comprises two subdomains that adopt alpha/beta Rossmann-like folds. Located between the monomer subdomains is a pocket that was found to bind the crystallization buffer molecule 2-(N-morpholino)ethanesulfonic acid. The pocket, together with a groove along the surface of subdomain I, forms a putative effector binding site into which a molecule of 1,6-anhydro-N-acetylmuramyl pentapeptide could be modeled. Amino acid substitutions at the base of the interdomain pocket either were found to render AmpR incapable of inducing ampC (Thr103Val, Ser221Ala and Tyr264Phe) or resulted in constitutive ampC expression (Gly102Glu). While the substitutions that prevented ampC induction did not alter the overall AmpR EBD structure, circular dichroism spectroscopy revealed that the nonconservative Gly102Glu mutation affected EBD secondary structure, confirming previous work suggesting that Gly102Glu induces a conformational change to result in constitutive AmpC production. PMID:20594961

  7. Amps particle accelerator definition study

    NASA Technical Reports Server (NTRS)

    Sellen, J. M., Jr.

    1975-01-01

    The Particle Accelerator System of the AMPS (Atmospheric, Magnetospheric, and Plasmas in Space) payload is a series of charged particle accelerators to be flown with the Space Transportation System Shuttle on Spacelab missions. In the configuration presented, the total particle accelerator system consists of an energetic electron beam, an energetic ion accelerator, and both low voltage and high voltage plasma acceleration devices. The Orbiter is illustrated with such a particle accelerator system.

  8. Agile manufacturing prototyping system (AMPS)

    SciTech Connect

    Garcia, P.

    1998-05-09

    The Agile Manufacturing Prototyping System (AMPS) is being integrated at Sandia National Laboratories. AMPS consists of state of the industry flexible manufacturing hardware and software enhanced with Sandia advancements in sensor and model based control; automated programming, assembly and task planning; flexible fixturing; and automated reconfiguration technology. AMPS is focused on the agile production of complex electromechanical parts. It currently includes 7 robots (4 Adept One, 2 Adept 505, 1 Staubli RX90), conveyance equipment, and a collection of process equipment to form a flexible production line capable of assembling a wide range of electromechanical products. This system became operational in September 1995. Additional smart manufacturing processes will be integrated in the future. An automated spray cleaning workcell capable of handling alcohol and similar solvents was added in 1996 as well as parts cleaning and encapsulation equipment, automated deburring, and automated vision inspection stations. Plans for 1997 and out years include adding manufacturing processes for the rapid prototyping of electronic components such as soldering, paste dispensing and pick-and-place hardware.

  9. Atrazine acts as an endocrine disrupter by inhibiting cAMP-specific phosphodiesterase-4

    SciTech Connect

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2012-11-15

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. -- Highlights: ► Atrazine stimulates cAMP accumulation in pituitary and Leydig cells. ► Atrazine also stimulates PRL and androgens secretion. ► Stimulatory effects of atrazine were abolished in cells with IBMX-inhibited PDEs. ► Atrazine specificity toward cAMP

  10. Pseudomonas aeruginosa β-lactamase induction requires two permeases, AmpG and AmpP

    PubMed Central

    2010-01-01

    Background In Enterobacteriaceae, β-lactam antibiotic resistance involves murein recycling intermediates. Murein recycling is a complex process with discrete steps taking place in the periplasm and the cytoplasm. The AmpG permease is critical to this process as it transports N-acetylglucosamine anhydrous N-acetylmuramyl peptides across the inner membrane. In Pseudomonadaceae, this intrinsic mechanism remains to be elucidated. Since the mechanism involves two cellular compartments, the characterization of transporters is crucial to establish the link. Results Pseudomonas aeruginosa PAO1 has two ampG paralogs, PA4218 (ampP) and PA4393 (ampG). Topology analysis using β-galactosidase and alkaline phosphatase fusions indicates ampP and ampG encode proteins which possess 10 and 14 transmembrane helices, respectively, that could potentially transport substrates. Both ampP and ampG are required for maximum expression of β-lactamase, but complementation and kinetic experiments suggest they act independently to play different roles. Mutation of ampG affects resistance to a subset of β-lactam antibiotics. Low-levels of β-lactamase induction occur independently of either ampP or ampG. Both ampG and ampP are the second members of two independent two-gene operons. Analysis of the ampG and ampP operon expression using β-galactosidase transcriptional fusions showed that in PAO1, ampG operon expression is β-lactam and ampR-independent, while ampP operon expression is β-lactam and ampR-dependent. β-lactam-dependent expression of the ampP operon and independent expression of the ampG operon is also dependent upon ampP. Conclusions In P. aeruginosa, β-lactamase induction occurs in at least three ways, induction at low β-lactam concentrations by an as yet uncharacterized pathway, at intermediate concentrations by an ampP and ampG dependent pathway, and at high concentrations where although both ampP and ampG play a role, ampG may be of greater importance. Both ampP and amp

  11. Atrazine Acts as an Endocrine Disrupter by Inhibiting cAMP-specific Phosphodiesterase-4

    PubMed Central

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2014-01-01

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. PMID:23022511

  12. A jack of all trades: the multiple roles of the unique essential second messenger cyclic di-AMP.

    PubMed

    Commichau, Fabian M; Dickmanns, Achim; Gundlach, Jan; Ficner, Ralf; Stülke, Jörg

    2015-07-01

    Second messengers are key components of many signal transduction pathways. In addition to cyclic AMP, ppGpp and cyclic di-GMP, many bacteria use also cyclic di-AMP as a second messenger. This molecule is synthesized by distinct classes of diadenylate cyclases and degraded by phosphodiesterases. The control of the intracellular c-di-AMP pool is very important since both a lack of this molecule and its accumulation can inhibit growth of the bacteria. In many firmicutes, c-di-AMP is essential, making it the only known essential second messenger. Cyclic di-AMP is implicated in a variety of functions in the cell, including cell wall metabolism, potassium homeostasis, DNA repair and the control of gene expression. To understand the molecular mechanisms behind these functions, targets of c-di-AMP have been identified and characterized. Interestingly, c-di-AMP can bind both proteins and RNA molecules. Several proteins that interact with c-di-AMP are required to control the intracellular potassium concentration. In Bacillus subtilis, c-di-AMP also binds a riboswitch that controls the expression of a potassium transporter. Thus, c-di-AMP is the only known second messenger that controls a biological process by interacting with both a protein and the riboswitch that regulates its expression. Moreover, in Listeria monocytogenes c-di-AMP controls the activity of pyruvate carboxylase, an enzyme that is required to replenish the citric acid cycle. Here, we review the components of the c-di-AMP signaling system. PMID:25869574

  13. Germanium accumulation-mode charge-injection-device process

    NASA Technical Reports Server (NTRS)

    Moore, T. G.

    1981-01-01

    Gallium doped germanium is suitable for applications in the detection of far infrared radiation. Measurements were made on experimental photoconductors (PCs), accumulation mode charge injection devices (AMCIDs), and the SSPC (a switched, sampled PC alternative to the AMCID). The results indicate that the SSPC, which had a responsivity near 1.5 amp/watt, is desirable for use in two dimensional detector arrays.

  14. The AzTEC Mathematics Project (AMP).

    ERIC Educational Resources Information Center

    Johnson, Gae R.

    The AzTEC Mathematics Project (AMP) is a statewide partnership among Arizona's Regents universities and state community colleges, partner school districts, and economic communities. AzTec is committed to preparing highly qualified K-12 mathematics and science teachers. AMP targeted Native American teachers and teachers of Native American students…

  15. Opposing Activity Changes in AMP Deaminase and AMP-Activated Protein Kinase in the Hibernating Ground Squirrel

    PubMed Central

    Cicerchi, Christina; Garcia, Gabriela E.; Roncal-Jimenez, Carlos A.; Trostel, Jessica; Jain, Swati; Mant, Colin T.; Rivard, Christopher J.; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L.; Johnson, Richard J.

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  16. Opposing activity changes in AMP deaminase and AMP-activated protein kinase in the hibernating ground squirrel.

    PubMed

    Lanaspa, Miguel A; Epperson, L Elaine; Li, Nanxing; Cicerchi, Christina; Garcia, Gabriela E; Roncal-Jimenez, Carlos A; Trostel, Jessica; Jain, Swati; Mant, Colin T; Rivard, Christopher J; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L; Johnson, Richard J

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  17. The dependence of Escherichia coli asparaginase II formation on cyclic AMP and cyclic AMP receptor protein.

    PubMed

    Russell, L; Yamazaki, H

    1978-05-01

    The amount of asparaginase II in an Escherichia coli wild-type strain (cya+, crp+) markedly increased upon a shift from aerobic to anaerobic growth. However, no such increase occurred in a mutant (cya) lacking cyclic AMP synthesis unless supplemented with exogenous cyclic AMP. Since a mutant (crp) deficient in cyclic AMP receptor protein also did not support the anaerobic formation of this enzyme, it is concluded that the formation of E. coli asparaginase II depends on both cyclic AMP and cyclic AMP receptor protein. PMID:207402

  18. Cyclic di-AMP mediates biofilm formation.

    PubMed

    Peng, Xian; Zhang, Yang; Bai, Guangchun; Zhou, Xuedong; Wu, Hui

    2016-03-01

    Cyclic di-AMP (c-di-AMP) is an emerging second messenger in bacteria. It has been shown to play important roles in bacterial fitness and virulence. However, transduction of c-di-AMP signaling in bacteria and the role of c-di-AMP in biofilm formation are not well understood. The level of c-di-AMP is modulated by activity of di-adenylyl cyclase that produces c-di-AMP and phosphodiesterase (PDE) that degrades c-di-AMP. In this study, we determined that increased c-di-AMP levels by deletion of the pdeA gene coding for a PDE promoted biofilm formation in Streptococcus mutans. Deletion of pdeA upregulated expression of gtfB, the gene coding for a major glucan producing enzyme. Inactivation of gtfB blocked the increased biofilm by the pdeA mutant. Two c-di-AMP binding proteins including CabPA (SMU_1562) and CabPB (SMU_1708) were identified. Interestingly, only CabPA deficiency inhibited both the increased biofilm formation and the upregulated expression of GtfB observed in the pdeA mutant. In addition, CabPA but not CabPB interacted with VicR, a known transcriptional factor that regulates expression of gtfB, suggesting that a signaling link between CabPA and GtfB through VicR. Increased biofilm by the pdeA deficiency also enhanced bacterial colonization of Drosophila in vivo. Taken together, our studies reveal a new role of c-di-AMP in mediating biofilm formation through a CabPA/VicR/GtfB signaling network in S. mutans. PMID:26564551

  19. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System

    PubMed Central

    Zahid, M. Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M.; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  20. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  1. Discovery of a cAMP Deaminase That Quenches Cyclic AMP-Dependent Regulation

    PubMed Central

    Goble, Alissa M.; Feng, Youjun; Raushel, Frank M.; Cronan, John E.

    2013-01-01

    An enzyme of unknown function within the amidohydrolase superfamily was discovered to catalyze the hydrolysis of the universal second messenger, cyclic-3’, 5’-adenosine monophosphate (cAMP). The enzyme, which we have named CadD, is encoded by the human pathogenic bacterium Leptospira interrogans. Although CadD is annotated as an adenosine deaminase, the protein specifically deaminates cAMP to cyclic-3’, 5’-inosine monophosphate (cIMP) with a kcat/Km of 2.7 ± 0.4 × 105 M−1 s−1 and has no activity on adenosine, adenine, or 5’-adenosine monophosphate (AMP). This is the first identification of a deaminase specific for cAMP. Expression of CadD in Escherichia coli mimics the loss of adenylate cyclase in that it blocks growth on carbon sources that require the cAMP-CRP transcriptional activator complex for expression of the cognate genes. The cIMP reaction product cannot replace cAMP as the ligand for CRP binding to DNA in vitro and cIMP is a very poor competitor of cAMP activation of CRP for DNA binding. Transcriptional analyses indicate that CadD expression represses expression of several cAMP-CRP dependent genes. CadD adds a new activity to the cAMP metabolic network and may be a useful tool in intracellular study of cAMP-dependent processes. PMID:24074367

  2. Vv-AMP1, a ripening induced peptide from Vitis vinifera shows strong antifungal activity

    PubMed Central

    de Beer, Abré; Vivier, Melané A

    2008-01-01

    Background Latest research shows that small antimicrobial peptides play a role in the innate defense system of plants. These peptides typically contribute to preformed defense by developing protective barriers around germinating seeds or between different tissue layers within plant organs. The encoding genes could also be upregulated by abiotic and biotic stimuli during active defense processes. The peptides display a broad spectrum of antimicrobial activities. Their potent anti-pathogenic characteristics have ensured that they are promising targets in the medical and agricultural biotechnology sectors. Results A berry specific cDNA sequence designated Vv-AMP1, Vitis vinifera antimicrobial peptide 1, was isolated from Vitis vinifera. Vv-AMP1 encodes for a 77 amino acid peptide that shows sequence homology to the family of plant defensins. Vv-AMP1 is expressed in a tissue specific, developmentally regulated manner, being only expressed in berry tissue at the onset of berry ripening and onwards. Treatment of leaf and berry tissue with biotic or abiotic factors did not lead to increased expression of Vv-AMP1 under the conditions tested. The predicted signal peptide of Vv-AMP1, fused to the green fluorescent protein (GFP), showed that the signal peptide allowed accumulation of its product in the apoplast. Vv-AMP1 peptide, produced in Escherichia coli, had a molecular mass of 5.495 kDa as determined by mass spectrometry. Recombinant Vv-AMP1 was extremely heat-stable and showed strong antifungal activity against a broad spectrum of plant pathogenic fungi, with very high levels of activity against the wilting disease causing pathogens Fusarium oxysporum and Verticillium dahliae. The Vv-AMP1 peptide did not induce morphological changes on the treated fungal hyphae, but instead strongly inhibited hyphal elongation. A propidium iodide uptake assay suggested that the inhibitory activity of Vv-AMP1 might be associated with altering the membrane permeability of the fungal

  3. C++ Coding Standards for the AMP Project

    SciTech Connect

    Evans, Thomas M; Clarno, Kevin T

    2009-09-01

    This document provides an initial starting point to define the C++ coding standards used by the AMP nuclear fuel performance integrated code project and a part of AMP's software development process. This document draws from the experiences, and documentation [1], of the developers of the Marmot Project at Los Alamos National Laboratory. Much of the software in AMP will be written in C++. The power of C++ can be abused easily, resulting in code that is difficult to understand and maintain. This document gives the practices that should be followed on the AMP project for all new code that is written. The intent is not to be onerous but to ensure that the code can be readily understood by the entire code team and serve as a basis for collectively defining a set of coding standards for use in future development efforts. At the end of the AMP development in fiscal year (FY) 2010, all developers will have experience with the benefits, restrictions, and limitations of the standards described and will collectively define a set of standards for future software development. External libraries that AMP uses do not have to meet these requirements, although we encourage external developers to follow these practices. For any code of which AMP takes ownership, the project will decide on any changes on a case-by-case basis. The practices that we are using in the AMP project have been in use in the Denovo project [2] for several years. The practices build on those given in References [3-5]; the practices given in these references should also be followed. Some of the practices given in this document can also be found in [6].

  4. AmpC β-Lactamases

    PubMed Central

    Jacoby, George A.

    2009-01-01

    Summary: AmpC β-lactamases are clinically important cephalosporinases encoded on the chromosomes of many of the Enterobacteriaceae and a few other organisms, where they mediate resistance to cephalothin, cefazolin, cefoxitin, most penicillins, and β-lactamase inhibitor-β-lactam combinations. In many bacteria, AmpC enzymes are inducible and can be expressed at high levels by mutation. Overexpression confers resistance to broad-spectrum cephalosporins including cefotaxime, ceftazidime, and ceftriaxone and is a problem especially in infections due to Enterobacter aerogenes and Enterobacter cloacae, where an isolate initially susceptible to these agents may become resistant upon therapy. Transmissible plasmids have acquired genes for AmpC enzymes, which consequently can now appear in bacteria lacking or poorly expressing a chromosomal blaAmpC gene, such as Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis. Resistance due to plasmid-mediated AmpC enzymes is less common than extended-spectrum β-lactamase production in most parts of the world but may be both harder to detect and broader in spectrum. AmpC enzymes encoded by both chromosomal and plasmid genes are also evolving to hydrolyze broad-spectrum cephalosporins more efficiently. Techniques to identify AmpC β-lactamase-producing isolates are available but are still evolving and are not yet optimized for the clinical laboratory, which probably now underestimates this resistance mechanism. Carbapenems can usually be used to treat infections due to AmpC-producing bacteria, but carbapenem resistance can arise in some organisms by mutations that reduce influx (outer membrane porin loss) or enhance efflux (efflux pump activation). PMID:19136439

  5. Increase in Cellular Cyclic AMP Concentrations Reverses the Profibrogenic Phenotype of Cardiac Myofibroblasts: A Novel Therapeutic Approach for Cardiac Fibrosis

    PubMed Central

    Lu, David; Aroonsakool, Nakon; Yokoyama, Utako; Patel, Hemal H.

    2013-01-01

    Tissue fibrosis is characterized by excessive production, deposition, and contraction of the extracellular matrix (ECM). The second messenger cAMP has antifibrotic effects in fibroblasts from several tissues, including cardiac fibroblasts (CFs). Increased cellular cAMP levels can prevent the transformation of CFs into profibrogenic myofibroblasts, a critical step that precedes increased ECM deposition and tissue fibrosis. Here we tested two hypotheses: 1) myofibroblasts have a decreased ability to accumulate cAMP in response to G protein–coupled receptor (GPCR) agonists, and 2) increasing cAMP will not only prevent, but also reverse, the myofibroblast phenotype. We found that myofibroblasts produce less cAMP in response to GPCR agonists or forskolin and have decreased expression of several adenylyl cyclase (AC) isoforms and increased expression of multiple cyclic nucleotide phosphodiesterases (PDEs). Furthermore, we found that forskolin-promoted increases in cAMP or N6-phenyladenosine-cAMP, a protein kinase A–selective analog, reverse the myofibroblast phenotype, as assessed by the expression of collagen Iα1, α–smooth muscle actin, plasminogen activator inhibitor–1, and cellular contractile abilities, all hallmarks of a fibrogenic state. These results indicate that: 1) altered expression of AC and PDE isoforms yield a decrease in cAMP concentrations of cardiac myofibroblasts (relative to CFs) that likely contributes to their profibrotic state, and 2) approaches to increase cAMP concentrations not only prevent fibroblast-to-myofibroblast transformation but also can reverse the profibrotic myofibroblastic phenotype. We conclude that therapeutic strategies designed to enhance cellular cAMP concentrations in CFs may provide a means to reverse excessive scar formation following injury and to treat cardiac fibrosis. PMID:24085841

  6. AMPK antagonizes hepatic glucagon-stimulated cyclic AMP signalling via phosphorylation-induced activation of cyclic nucleotide phosphodiesterase 4B

    PubMed Central

    Johanns, M.; Lai, Y.-C.; Hsu, M.-F.; Jacobs, R.; Vertommen, D.; Van Sande, J.; Dumont, J. E.; Woods, A.; Carling, D.; Hue, L.; Viollet, B.; Foretz, M; Rider, M H

    2016-01-01

    Biguanides such as metformin have previously been shown to antagonize hepatic glucagon-stimulated cyclic AMP (cAMP) signalling independently of AMP-activated protein kinase (AMPK) via direct inhibition of adenylate cyclase by AMP. Here we show that incubation of hepatocytes with the small-molecule AMPK activator 991 decreases glucagon-stimulated cAMP accumulation, cAMP-dependent protein kinase (PKA) activity and downstream PKA target phosphorylation. Moreover, incubation of hepatocytes with 991 increases the Vmax of cyclic nucleotide phosphodiesterase 4B (PDE4B) without affecting intracellular adenine nucleotide concentrations. The effects of 991 to decrease glucagon-stimulated cAMP concentrations and activate PDE4B are lost in hepatocytes deleted for both catalytic subunits of AMPK. PDE4B is phosphorylated by AMPK at three sites, and by site-directed mutagenesis, Ser304 phosphorylation is important for activation. In conclusion, we provide a new mechanism by which AMPK antagonizes hepatic glucagon signalling via phosphorylation-induced PDE4B activation. PMID:26952277

  7. Atmospheric, Magnetospheric and Plasmas in space (AMPS) spacelab payload definition study. Volume 4. Part 1, AMPS program specification

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    The AMPS Program Specification delineates the AMPS Program requirements consistent with the resources defined in the AMPS Project Plan. All subsidiary specifications and requirements shall conform to the requirements presented. The requirements hierarchy for the AMPS program is illustrated. A brief description of each of the requirements documents and their intended use is provided.

  8. Deletion of the cyclic di-AMP phosphodiesterase gene (cnpB) in Mycobacterium tuberculosis leads to reduced virulence in a mouse model of infection.

    PubMed

    Yang, Jun; Bai, Yinlan; Zhang, Yang; Gabrielle, Vincent D; Jin, Lei; Bai, Guangchun

    2014-07-01

    Tuberculosis (TB) remains a major cause of morbidity and mortality worldwide. The pathogenesis by the causative agent, Mycobacterium tuberculosis, is still not fully understood. We have previously reported that M. tuberculosis Rv3586 (disA) encodes a diadenylate cyclase, which converts ATP to cyclic di-AMP (c-di-AMP). In this study, we demonstrated that a protein encoded by Rv2837c (cnpB) possesses c-di-AMP phosphodiesterase activity and cleaves c-di-AMP exclusively to AMP. Our results showed that in M. tuberculosis, deletion of disA abolished bacterial c-di-AMP production, whereas deletion of cnpB significantly enhanced the bacterial c-di-AMP accumulation and secretion. The c-di-AMP levels in both mutants could be corrected by expressing the respective gene. We also found that macrophages infected with ΔcnpB secreted much higher levels of IFN-β than those infected with the wild type (WT) or the complemented mutant. Interestingly, mice infected with M. tuberculosis ΔcnpB displayed significantly reduced inflammation, less bacterial burden in the lungs and spleens, and extended survival compared with those infected with the WT or the complemented mutant. These results indicate that deletion of cnpB results in attenuated virulence, which is correlated with elevated c-di-AMP levels. PMID:24806618

  9. Deletion of the cyclic di-AMP phosphodiesterase gene (cnpB) in Mycobacterium tuberculosis leads to reduced virulence in a mouse model of infection

    PubMed Central

    Yang, Jun; Bai, Yinlan; Zhang, Yang; Gabrielle, Vincent D.; Jin, Lei; Bai, Guangchun

    2014-01-01

    Summary Tuberculosis (TB) remains a major cause of morbidity and mortality worldwide. The pathogenesis by the causative agent, Mycobacterium tuberculosis, is still not fully understood. We have previously reported that M. tuberculosis Rv3586 (disA) encodes a diadenylate cyclase, which converts ATP to cyclic di-AMP (c-di-AMP). In this study, we demonstrated that a protein encoded by Rv2837c (cnpB) possesses c-di-AMP phosphodiesterase activity and cleaves c-di-AMP exclusively to AMP. Our results showed that in M. tuberculosis, deletion of disA abolished bacterial c-di-AMP production, whereas deletion of cnpB significantly enhanced the bacterial c-di-AMP accumulation and secretion. The c-di-AMP levels in both mutants could be corrected by expressing the respective gene. We also found that macrophages infected with ΔcnpB secreted much higher levels of IFN-β than those infected with the wildtype (WT) or the complemented mutant. Interestingly, mice infected with M. tuberculosis ΔcnpB displayed significantly reduced inflammation, less bacterial burden in the lungs and spleens, and extended survival compared to those infected with the WT or the complemented mutant. These results indicate that deletion of cnpB results in attenuated virulence, which is correlated with elevated c-di-AMP levels. PMID:24806618

  10. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein.

    PubMed

    Underwood, Adam J; Zhang, Yang; Metzger, Dennis W; Bai, Guangchun

    2014-12-01

    Cyclic di-AMP (c-di-AMP) is a recently recognized bacterial signaling molecule. In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed using a novel pneumococcal c-di-AMP binding protein (CabP). With this method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. PMID:25239824

  11. Role of 2′,3′-cyclic nucleotide 3′-phosphodiesterase in the renal 2′,3′-cAMP-adenosine pathway

    PubMed Central

    Gillespie, Delbert G.; Mi, Zaichuan; Cheng, Dongmei; Bansal, Rashmi; Janesko-Feldman, Keri; Kochanek, Patrick M.

    2014-01-01

    Energy depletion increases the renal production of 2′,3′-cAMP (a positional isomer of 3′,5′-cAMP that opens mitochondrial permeability transition pores) and 2′,3′-cAMP is converted to 2′-AMP and 3′-AMP, which in turn are metabolized to adenosine. Because the enzymes involved in this “2′,3′-cAMP-adenosine pathway” are unknown, we examined whether 2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase) participates in the renal metabolism of 2′,3′-cAMP. Western blotting and real-time PCR demonstrated expression of CNPase in rat glomerular mesangial, preglomerular vascular smooth muscle and endothelial, proximal tubular, thick ascending limb and collecting duct cells. Real-time PCR established the expression of CNPase in human glomerular mesangial, proximal tubular and vascular smooth muscle cells; and the level of expression of CNPase was greater than that for phosphodiesterase 4 (major enzyme for the metabolism of 3′,5′-cAMP). Overexpression of CNPase in rat preglomerular vascular smooth muscle cells increased the metabolism of exogenous 2′,3′-cAMP to 2′-AMP. Infusions of 2′,3′-cAMP into isolated CNPase wild-type (+/+) kidneys increased renal venous 2′-AMP, and this response was diminished by 63% in CNPase knockout (−/−) kidneys, whereas the conversion of 3′,5′-cAMP to 5′-AMP was similar in CNPase +/+ vs. −/− kidneys. In CNPase +/+ kidneys, energy depletion (metabolic poisons) increased kidney tissue levels of adenosine and its metabolites (inosine, hypoxanthine, xanthine, and uric acid) without accumulation of 2′,3′-cAMP. In contrast, in CNPase −/− kidneys, energy depletion increased kidney tissue levels of 2′,3′-cAMP and abolished the increase in adenosine and its metabolites. In conclusion, kidneys express CNPase, and renal CNPase mediates in part the renal 2′,3′-cAMP-adenosine pathway. PMID:24808540

  12. Effect of beta-ADrenergic Agonist on Cyclic AMP Synthesis in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Because it seems logical that these agonists exert their action on muscle through stimulation of cAMP synthesis, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax levels were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. In addition, the EC50 values for isoproterenol, cimaterol, clenbuterol, epinephrine, and albuterol were 360 nM, 630 nM, 900 nM, 2,470 nM, and 3,650 nM, respectively. Finally, dose response curves show that the concentrations of cimaterol and clenbuterol in culture media at concentrations known to cause significant muscle hypertrophy in animals had no detectable effect on stimulation of CAMP accumulation in chicken skeletal muscle cells.

  13. Reduced expression of cytochrome oxidases largely explains cAMP inhibition of aerobic growth in Shewanella oneidensis

    PubMed Central

    Yin, Jianhua; Meng, Qiu; Fu, Huihui; Gao, Haichun

    2016-01-01

    Inhibition of bacterial growth under aerobic conditions by elevated levels of cyclic adenosine 3′,5′-monophosphate (cAMP), first revealed more than 50 years ago, was attributed to accumulation of toxic methylglyoxal (MG). Here, we report a Crp-dependent mechanism rather than MG accumulation that accounts for the phenotype in Shewanella oneidensis, an emerging research model for the bacterial physiology. We show that a similar phenotype can be obtained by removing CpdA, a cAMP phosphodiesterase that appears more effective than its Escherichia coli counterpart. Although production of heme c and cytochromes c is correlated well with cAMP levels, neither is sufficient for the retarded growth. Quantities of overall cytochromes c increased substantially in the presence of elevated cAMP, a phenomenon resembling cells respiring on non-oxygen electron acceptors. In contrast, transcription of Crp-dependent genes encoding both cytochromes bd and cbb3 oxidases is substantially repressed under the same condition. Overall, our results suggest that cAMP of elevated levels drives cells into a low-energetic status, under which aerobic respiration is inhibited. PMID:27076065

  14. AMPS/PC - AUTOMATIC MANUFACTURING PROGRAMMING SYSTEM

    NASA Technical Reports Server (NTRS)

    Schroer, B. J.

    1994-01-01

    The AMPS/PC system is a simulation tool designed to aid the user in defining the specifications of a manufacturing environment and then automatically writing code for the target simulation language, GPSS/PC. The domain of problems that AMPS/PC can simulate are manufacturing assembly lines with subassembly lines and manufacturing cells. The user defines the problem domain by responding to the questions from the interface program. Based on the responses, the interface program creates an internal problem specification file. This file includes the manufacturing process network flow and the attributes for all stations, cells, and stock points. AMPS then uses the problem specification file as input for the automatic code generator program to produce a simulation program in the target language GPSS. The output of the generator program is the source code of the corresponding GPSS/PC simulation program. The system runs entirely on an IBM PC running PC DOS Version 2.0 or higher and is written in Turbo Pascal Version 4 requiring 640K memory and one 360K disk drive. To execute the GPSS program, the PC must have resident the GPSS/PC System Version 2.0 from Minuteman Software. The AMPS/PC program was developed in 1988.

  15. Fast carry accumulator design

    NASA Technical Reports Server (NTRS)

    Mastin, W. C.

    1971-01-01

    Simple iterative accumulator combined with gated-carry, carry-completion detection, and skip-carry circuits produces three accumulators with decreased carry propagation times. Devices are used in machine control, measurement equipment, and computer applications to increase speed of binary addition. NAND gates are used in combining network.

  16. Activation of Cyclic AMP Synthesis by Full and Partial Beta-Adrenergic Receptor Agonists in Chicken Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Cureri, Peter A. (Technical Monitor)

    2002-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Accordingly, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax concentrations were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. When cimaterol and clenbuterol were added to culture media at concentrations known to cause significant muscle hypertrophy in animals, there was no detectable effect on stimulation of cAMP synthesis. Finally, these same levels of cimaterol and clenbuterol did not antagonize the stimulation of cAMP by either epinephrine or isoproterenol.

  17. Hypertonic NaCl enhances adenosine release and hormonal cAMP production in mouse thick ascending limb.

    PubMed

    Baudouin-Legros, M; Badou, A; Paulais, M; Hammet, M; Teulon, J

    1995-07-01

    Adenosine 3',5'-cyclic monophosphate (cAMP), accumulated in the presence of adenosine, was measured in medullary portions of mouse thick ascending limbs of Henle's loop, suspended either in classic extracellular buffer or in the presence of added NaCl. Under control conditions (140 mmol/l NaCl), adenosine (< 10(-5) mol/l) and N6-cyclohexyladenosine, an A1 adenosine receptor agonist, inhibit the cAMP accumulation induced by arginine vasopressin (AVP). On the other hand, high concentrations of adenosine and CGS-21680, an A2 adenosine receptor agonist, stimulate cAMP formation. Addition of NaCl (+300 mmol/l) to extracellular buffer stimulates the release of endogenous adenosine. It also enhances A2 receptor-induced cAMP accumulation but suppresses A1 receptor-mediated inhibition of adenylyl cyclase. This hypertonic NaCl medium also potentiates the stimulatory action of AVP on adenylyl cyclase. The modifications of tubular responses to both AVP and A1 and A2 agonists, brought about by hypertonic NaCl, were all inhibited by adenosine deaminase, thereby demonstrating the involvement of endogenous adenosine. Adenosine, the release and the effects of which are modulated by hypertonic NaCl, thus appears to act as an endogenous physiological modulator of kidney medulla function. PMID:7631823

  18. Whole body and brain distribution of [3H]cyclic [D-Pen2,D-Pen5] enkephalin after intraperitoneal, intravenous, oral and subcutaneous administration.

    PubMed

    Weber, S J; Greene, D L; Hruby, V J; Yamamura, H I; Porreca, F; Davis, T P

    1992-12-01

    The route of administration of a given drug can have a significant influence upon whole body distribution. The present study examined whole body distribution of the delta opioid receptor-selective peptide [3H]DPDPE in male CD1 mice after administration by several routes. Additionally, we describe regional brain distribution of [3H]DPDPE after i.v. administration with and without pretreatment with naloxone or the selective delta receptor antagonist naltrindole. Finally, characterization of the inherent enzymatic stability of DPDPE was also examined. Intravenous administration results in a significantly large amount of [3H]DPDPE in the small intestine and flush at 15 and 30 min postadministration, suggesting rapid biliary excretion. The highest level in the brain after i.v. administration occurred at 60 min (0.08%). After i.p. and s.c. administration, large amounts of [3H]DPDPE were found in the small intestine and flush, but not until 60 min postadministration, suggesting a slower rate of absorption from the site of administration. The i.p. and s.c. groups' brain levels peaked at 120 min (0.07 and 0.09%, respectively). The highest levels in the brain after p.o. administration were seen at 240 min (0.03%). Examination of regional brain distribution data showed no significant difference in the levels of [3H]DPDPE between brain regions at any time point studied. However, naloxone pretreatment resulted in significant reductions of [3H]DPDPE in all brain regions at 5 and 10 min. Naltrindole pretreatment resulted in significant reductions in the frontal cortex and striatum at 5 and/or 10 min postadministration, but had no effect on [3H]DPDPE levels in cerebellum, hippocampus or brain stem.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1469637

  19. A spontaneous change in the intracellular cyclic AMP level in Aspergillus niger is influenced by the sucrose concentration in the medium and by light.

    PubMed Central

    Gradisnik-Grapulin, M; Legisa, M

    1997-01-01

    A spontaneous rise in intracellular cyclic AMP (cAMP) levels was observed in the early stages of Aspergillus niger growth under conditions yielding large amounts of citric acid. The amount of cAMP formed was found to depend on the initial concentration of sucrose in the medium. Under higher-sucrose conditions, the cAMP peak appeared earlier and was higher, while in lower-sucrose media a flattened peak was observed later in fermentation. Since in media with higher concentrations of sucrose intracellular citric acid starts to accumulate earlier and more rapidly, cAMP synthesis may be triggered by intracellular acidification, which is caused by the dissociation of citric acid. No spontaneous increase in cAMP concentrations could be detected when the cells were grown in continuously illuminated cultures, suggesting that A. niger phosphodiesterase (PDE) is photoregulated. More evidence for the activation of PDE by light was obtained from morphological studies under light and dark conditions in the presence of cAMP or N6,O2'-dibutyryl cAMP, and this idea was additionally supported by experiments in which PDE inhibitors were tested. PMID:9212431

  20. cAMP phosphodiesterase and activator protein of mammalian cAMP phosphodiesterase from Trypanosoma cruzi.

    PubMed

    Gonçalves, M F; Zingales, B; Colli, W

    1980-04-01

    Epimastigote forms of Trypanosoma cruzi contain a soluble cAMP phosphodiesterase. Optimal activity was found at pH 8.0 and in the presence of 5 mM Mn2+. Other cations were less efficient and did not give rise to an additional stimulation when added in the presence of optimal concentrations of Mn2+. The enzyme is not Ca2+ dependent. The apparent Km of the enzyme for the substrate is 40 microM and no kinetic evidence for the existence of two enzymes has been found. Theophylline and caffein did not inhibit the T. cruzi cAMP phosphodiesterase. The enzyme activity does not change during cell growth suggesting that the fluctuation observed in the levels of cAMP are largely a response to variations in adenylyl cyclase activity. The intracellular concentrations of cAMP ranged between 0.04--0.15 microM. No evidence that the T. cruzi cAMP phosphodiesterase is regulated by an endogenous activator could be found. However, T. cruzi contains a heat-stable, low molecular weight, non-dialysable protein that activates mammalian cAMP phosphodiesterase in the presence of Ca2+. The properties so far studied of such an activator suggest that it might be equivalent to other Ca2+-dependent regulators described in vertebrate and invertebrate species. PMID:6255327

  1. Localized cyclic AMP-dependent protein kinase activity is required for myogenic cell fusion

    SciTech Connect

    Mukai, Atsushi; Hashimoto, Naohiro

    2008-01-15

    Multinucleated myotubes are formed by fusion of mononucleated myogenic progenitor cells (myoblasts) during terminal skeletal muscle differentiation. In addition, myoblasts fuse with myotubes, but terminally differentiated myotubes have not been shown to fuse with each other. We show here that an adenylate cyclase activator, forskolin, and other reagents that elevate intracellular cyclic AMP (cAMP) levels induced cell fusion between small bipolar myotubes in vitro. Then an extra-large myotube, designated a 'myosheet,' was produced by both primary and established mouse myogenic cells. Myotube-to-myotube fusion always occurred between the leading edge of lamellipodia at the polar end of one myotube and the lateral plasma membrane of the other. Forskolin enhanced the formation of lamellipodia where cAMP-dependent protein kinase (PKA) was accumulated. Blocking enzymatic activity or anchoring of PKA suppressed forskolin-enhanced lamellipodium formation and prevented fusion of multinucleated myotubes. Localized PKA activity was also required for fusion of mononucleated myoblasts. The present results suggest that localized PKA plays a pivotal role in the early steps of myogenic cell fusion, such as cell-to-cell contact/recognition through lamellipodium formation. Furthermore, the localized cAMP-PKA pathway might be involved in the specification of the fusion-competent areas of the plasma membrane in lamellipodia of myogenic cells.

  2. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917.

    PubMed

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin; Zhou, Xianxuan

    2015-11-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. (1)H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  3. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917

    PubMed Central

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin

    2015-01-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. 1H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  4. Cordycepin activates AMP-activated protein kinase (AMPK) via interaction with the γ1 subunit

    PubMed Central

    Wu, Chongming; Guo, Yanshen; Su, Yan; Zhang, Xue; Luan, Hong; Zhang, Xiaopo; Zhu, Huixin; He, Huixia; Wang, Xiaoliang; Sun, Guibo; Sun, Xiaobo; Guo, Peng; Zhu, Ping

    2014-01-01

    Cordycepin is a bioactive component of the fungus Cordyceps militaris. Previously, we showed that cordycepin can alleviate hyperlipidemia through enhancing the phosphorylation of AMP-activated protein kinase (AMPK), but the mechanism of this stimulation is unknown. Here, we investigated the potential mechanisms of cordycepin-induced AMPK activation in HepG2 cells. Treatment with cordycepin largely reduced oleic acid (OA)-elicited intracellular lipid accumulation and increased AMPK activity in a dose-dependent manner. Cordycepin-induced AMPK activation was not accompanied by changes in either the intracellular levels of AMP or the AMP/ATP ratio, nor was it influenced by calmodulin-dependent protein kinase kinase (CaMKK) inhibition; however, this activation was significantly suppressed by liver kinase B1 (LKB1) knockdown. Molecular docking, fluorescent and circular dichroism measurements showed that cordycepin interacted with the γ1 subunit of AMPK. Knockdown of AMPKγ1 by siRNA substantially abolished the effects of cordycepin on AMPK activation and lipid regulation. The modulating effects of cordycepin on the mRNA levels of key lipid regulatory genes were also largely reversed when AMPKγ1 expression was inhibited. Together, these data suggest that cordycepin may inhibit intracellular lipid accumulation through activation of AMPK via interaction with the γ1 subunit. PMID:24286368

  5. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  6. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 7 2011-01-01 2011-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  7. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  8. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 7 2012-01-01 2012-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  9. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 7 2013-01-01 2013-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  10. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein

    PubMed Central

    Underwood, Adam J.; Zhang, Yang; Metzger, Dennis W.; Bai, Guangchun

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a signaling molecule that has been shown to play important roles in bacterial physiology and infections. Currently, c-di-AMP detection and quantification relies mostly on the use of high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS). In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed, which utilizes a novel pneumococcal c-di-AMP binding protein (CabP) and a newly commercialized c-di-AMP derivative. With this new method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. Furthermore, this assay is much more efficient than current methods as it requires less overall cost and training while processing many samples at once. Therefore, this assay can be extensively used in research into c-di-AMP signaling. PMID:25239824

  11. AMPS Supporting Research and Technology (SR and T) report. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) definition study

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A listing of candidate technology areas that require additional study is presented. These candidate tasks, identified during the AMPS Phase B studies, are requisites to the design, development, and operation of the AMPS concept selected for preliminary design.

  12. Cyclic AMP Receptor Protein-Aequorin Molecular Switch for Cyclic AMP

    PubMed Central

    Scott, Daniel; Hamorsky, Krystal Teasley; Ensor, C. Mark; Anderson, Kimberly W.; Daunert, Sylvia

    2011-01-01

    Molecular switches are designer molecules that combine the functionality of two individual proteins into one, capable of manifesting an “on/off” signal in response to a stimulus. These switches have unique properties and functionalities and thus, can be employed as nanosensors in a variety of applications. To that end, we have developed a bioluminescent molecular switch for cyclic AMP. Bioluminescence offers many advantages over fluorescence and other detection methods including the fact that there is essentially zero background signal in physiological fluids, allowing for more sensitive detection and monitoring. The switch was created by combining the properties of the cyclic AMP receptor protein (CRP), a transcriptional regulatory protein from E. coli that binds selectively to cAMP with those of aequorin, a bioluminescent photoprotein native of the jellyfish Aequorea victoria. Genetic manipulation to split the genetic coding sequence of aequorin in two and genetically attach the fragments to the N and C termini of CRP, resulted in a hybrid protein molecular switch. The conformational change experienced by CRP upon the binding of cyclic AMP is suspected to result in the observed loss of bioluminescent signal from aequorin. The “on/off” bioluminescence can be modulated by cyclic AMP over a range of several orders of magnitude in a linear fashion in addition to the capacity to detect changes in cellular cyclic AMP of intact cells exposed to different external stimuli without the need to lyse the cells. We envision that the molecular switch could find applications in vitro as well as in vivo cyclic AMP detection and/or imaging. PMID:21329338

  13. Fiscal Year 2011 Infrastructure Refactorizations in AMP

    SciTech Connect

    Berrill, Mark A.; Philip, Bobby; Sampath, Rahul S.; Allu, Srikanth; Barai, Pallab; Cochran, Bill; Clarno, Kevin T.; Dilts, Gary A.

    2011-09-01

    In Fiscal Year 2011 (FY11), the AMP (Advanced MultiPhysics) Nuclear Fuel Performance code [1] went through a thorough review and refactorization based on the lessons-learned from the previous year, in which the version 0.9 of the software was released as a prototype. This report describes the refactorization work that has occurred or is in progress during FY11.

  14. Transcriptional regulation of 2',3'-cyclic nucleotide 3'-phosphodiesterase gene expression by cyclic AMP in C6 cells.

    PubMed

    Gravel, M; Gao, E; Hervouet-Zeiber, C; Parsons, V; Braun, P E

    2000-11-01

    -2) binding site. It is interesting that mutagenesis of this region resulted in a significant reduction in transcriptional responses to cAMP, implying a possible role for the AP-2 factor in the expression of CNP1. In addition, we have shown that putative binding sites for activator protein-4 and nuclear factor-1 adjacent to the AP-2 site are required for efficient induction of CNP1 expression by cAMP. Taken together, our results show that the cAMP-dependent accumulation of CNP1 mRNA appears to depend on the synergistic interaction of several regulatory elements. PMID:11032883

  15. The Applied Mathematics for Power Systems (AMPS)

    SciTech Connect

    Chertkov, Michael

    2012-07-24

    Increased deployment of new technologies, e.g., renewable generation and electric vehicles, is rapidly transforming electrical power networks by crossing previously distinct spatiotemporal scales and invalidating many traditional approaches for designing, analyzing, and operating power grids. This trend is expected to accelerate over the coming years, bringing the disruptive challenge of complexity, but also opportunities to deliver unprecedented efficiency and reliability. Our Applied Mathematics for Power Systems (AMPS) Center will discover, enable, and solve emerging mathematics challenges arising in power systems and, more generally, in complex engineered networks. We will develop foundational applied mathematics resulting in rigorous algorithms and simulation toolboxes for modern and future engineered networks. The AMPS Center deconstruction/reconstruction approach 'deconstructs' complex networks into sub-problems within non-separable spatiotemporal scales, a missing step in 20th century modeling of engineered networks. These sub-problems are addressed within the appropriate AMPS foundational pillar - complex systems, control theory, and optimization theory - and merged or 'reconstructed' at their boundaries into more general mathematical descriptions of complex engineered networks where important new questions are formulated and attacked. These two steps, iterated multiple times, will bridge the growing chasm between the legacy power grid and its future as a complex engineered network.

  16. Copper regulates cyclic-AMP-dependent lipolysis.

    PubMed

    Krishnamoorthy, Lakshmi; Cotruvo, Joseph A; Chan, Jefferson; Kaluarachchi, Harini; Muchenditsi, Abigael; Pendyala, Venkata S; Jia, Shang; Aron, Allegra T; Ackerman, Cheri M; Wal, Mark N Vander; Guan, Timothy; Smaga, Lukas P; Farhi, Samouil L; New, Elizabeth J; Lutsenko, Svetlana; Chang, Christopher J

    2016-08-01

    Cell signaling relies extensively on dynamic pools of redox-inactive metal ions such as sodium, potassium, calcium and zinc, but their redox-active transition metal counterparts such as copper and iron have been studied primarily as static enzyme cofactors. Here we report that copper is an endogenous regulator of lipolysis, the breakdown of fat, which is an essential process in maintaining body weight and energy stores. Using a mouse model of genetic copper misregulation, in combination with pharmacological alterations in copper status and imaging studies in a 3T3-L1 white adipocyte model, we found that copper regulates lipolysis at the level of the second messenger, cyclic AMP (cAMP), by altering the activity of the cAMP-degrading phosphodiesterase PDE3B. Biochemical studies of the copper-PDE3B interaction establish copper-dependent inhibition of enzyme activity and identify a key conserved cysteine residue in a PDE3-specific loop that is essential for the observed copper-dependent lipolytic phenotype. PMID:27272565

  17. The Cyclic AMP Phenotype of Fragile X and Autism

    PubMed Central

    Kelley, Daniel J; Bhattacharyya, Anita; Lahvis, Garet P; Yin, Jerry CP; Malter, Jim; Davidson, Richard J

    2008-01-01

    Cyclic AMP (cAMP) is a second messenger involved in many processes including mnemonic processing and anxiety. Memory deficits and anxiety are noted in the phenotype of fragile X (FX), the most common heritable cause of mental retardation and autism. Here we review reported observations of altered cAMP cascade function in FX and autism. Cyclic AMP is a potentially useful biochemical marker to distinguish autism comorbid with FX from autism per se and the cAMP cascade may be a viable therapeutic target for both FX and autism. PMID:18601949

  18. Regulation of cyclic AMP synthesis in Escherichia coli K-12: effects of the rpoD800 sigma mutation, glucose, and chloramphenicol.

    PubMed Central

    Grossman, A D; Ullmann, A; Burgess, R R; Gross, C A

    1984-01-01

    An immediate 12-fold inhibition in the rate of beta-galactosidase synthesis occurs in Escherichia coli cells containing the mutant sigma allele rpoD800 after a shift to 42 degrees C. In the present study we characterize the nature of the inhibition. The severe inhibition of beta-galactosidase synthesis was partly relieved by cyclic AMP (cAMP). We inferred that the inhibition might be mediated by a decreased intracellular concentration of cAMP. Consistent with this inference, the rate of cAMP accumulation in mutant cells after a temperature upshift was depressed relative to that in wild-type cells. Glucose and chloramphenicol, two agents known to inhibit differentially beta-galactosidase mRNA synthesis, caused a similar inhibition in the rate of cAMP accumulation. Thus, three diverse stimuli, glucose, chloramphenicol, and a temperature-sensitive sigma mutation, appear to affect beta-galactosidase synthesis by regulating the synthesis of cAMP. PMID:6325382

  19. Neurodegeneration with Brain Iron Accumulation

    MedlinePlus

    ... Diversity Find People About NINDS NINDS Neurodegeneration with Brain Iron Accumulation Information Page Synonym(s): Hallervorden-Spatz Disease, ... done? Clinical Trials Organizations What is Neurodegeneration with Brain Iron Accumulation? Neurodegeneration with brain iron accumulation (NBIA) ...

  20. Plastids and Carotenoid Accumulation.

    PubMed

    Li, Li; Yuan, Hui; Zeng, Yunliu; Xu, Qiang

    2016-01-01

    Plastids are ubiquitously present in plants and are the organelles for carotenoid biosynthesis and storage. Based on their morphology and function, plastids are classified into various types, i.e. proplastids, etioplasts, chloroplasts, amyloplasts, and chromoplasts. All plastids, except proplastids, can synthesize carotenoids. However, plastid types have a profound effect on carotenoid accumulation and stability. In this chapter, we discuss carotenoid biosynthesis and regulation in various plastids with a focus on carotenoids in chromoplasts. Plastid transition related to carotenoid biosynthesis and the different capacity of various plastids to sequester carotenoids and the associated effect on carotenoid stability are described in light of carotenoid accumulation in plants. PMID:27485226

  1. Directed evolution of the Escherichia coli cAMP receptor protein at the cAMP pocket.

    PubMed

    Gunasekara, Sanjiva M; Hicks, Matt N; Park, Jin; Brooks, Cory L; Serate, Jose; Saunders, Cameron V; Grover, Simranjeet K; Goto, Joy J; Lee, Jin-Won; Youn, Hwan

    2015-10-30

    The Escherichia coli cAMP receptor protein (CRP) requires cAMP binding to undergo a conformational change for DNA binding and transcriptional regulation. Two CRP residues, Thr(127) and Ser(128), are known to play important roles in cAMP binding through hydrogen bonding and in the cAMP-induced conformational change, but the connection between the two is not completely clear. Here, we simultaneously randomized the codons for these two residues and selected CRP mutants displaying high CRP activity in a cAMP-producing E. coli. Many different CRP mutants satisfied the screening condition for high CRP activity, including those that cannot form any hydrogen bonds with the incoming cAMP at the two positions. In vitro DNA-binding analysis confirmed that these selected CRP mutants indeed display high CRP activity in response to cAMP. These results indicate that the hydrogen bonding ability of the Thr(127) and Ser(128) residues is not critical for the cAMP-induced CRP activation. However, the hydrogen bonding ability of Thr(127) and Ser(128) was found to be important in attaining high cAMP affinity. Computational analysis revealed that most natural cAMP-sensing CRP homologs have Thr/Ser, Thr/Thr, or Thr/Asn at positions 127 and 128. All of these pairs are excellent hydrogen bonding partners and they do not elevate CRP activity in the absence of cAMP. Taken together, our analyses suggest that CRP evolved to have hydrogen bonding residues at the cAMP pocket residues 127 and 128 for performing dual functions: preserving high cAMP affinity and keeping CRP inactive in the absence of cAMP. PMID:26378231

  2. Basal and adenosine receptor-stimulated levels of cAMP are reduced in lymphocytes from alcoholic patients

    SciTech Connect

    Diamond, I.; Wrubel, B.; Estrin, W.; Gordon, A.

    1987-03-01

    Alcoholism causes serious neurologic disease that may be due, in part, to the ability of ethanol to interact with neural cell membranes and change neuronal function. Adenosine receptors are membrane-bound proteins that appear to mediate some of the effects of ethanol in the brain. Human lymphocytes also have adenosine receptors, and their activation causes increases in cAMP levels. To test the hypothesis that basal and adenosine receptor-stimulated cAMP levels in lymphocytes might be abnormal in alcoholism, the authors studied lymphocytes from 10 alcoholic subjects, 10 age- and sex-matched normal individuals, and 10 patients with nonalcoholic liver disease. Basal and adenosine receptor-stimulated cAMP levels were reduced 75% in lymphocytes from alcoholic subjects. Also, there was a 76% reduction in ethanol stimulation of cAMP accumulation in lymphocytes from alcoholics. Similar results were demonstrable in isolated T cells. Unlike other laboratory tests examined, these measurements appeared to distinguish alcoholics from normal subjects and from patients with nonalcoholic liver disease. Reduced basal and adenosine receptor-stimulated levels of cAMP in lymphocytes from alcoholics may reflect a change in cell membranes due either to chronic alcohol abuse or to a genetic predisposition unique to alcoholic subjects.

  3. Chimpanzee accumulative stone throwing.

    PubMed

    Kühl, Hjalmar S; Kalan, Ammie K; Arandjelovic, Mimi; Aubert, Floris; D'Auvergne, Lucy; Goedmakers, Annemarie; Jones, Sorrel; Kehoe, Laura; Regnaut, Sebastien; Tickle, Alexander; Ton, Els; van Schijndel, Joost; Abwe, Ekwoge E; Angedakin, Samuel; Agbor, Anthony; Ayimisin, Emmanuel Ayuk; Bailey, Emma; Bessone, Mattia; Bonnet, Matthieu; Brazolla, Gregory; Buh, Valentine Ebua; Chancellor, Rebecca; Cipoletta, Chloe; Cohen, Heather; Corogenes, Katherine; Coupland, Charlotte; Curran, Bryan; Deschner, Tobias; Dierks, Karsten; Dieguez, Paula; Dilambaka, Emmanuel; Diotoh, Orume; Dowd, Dervla; Dunn, Andrew; Eshuis, Henk; Fernandez, Rumen; Ginath, Yisa; Hart, John; Hedwig, Daniela; Ter Heegde, Martijn; Hicks, Thurston Cleveland; Imong, Inaoyom; Jeffery, Kathryn J; Junker, Jessica; Kadam, Parag; Kambi, Mohamed; Kienast, Ivonne; Kujirakwinja, Deo; Langergraber, Kevin; Lapeyre, Vincent; Lapuente, Juan; Lee, Kevin; Leinert, Vera; Meier, Amelia; Maretti, Giovanna; Marrocoli, Sergio; Mbi, Tanyi Julius; Mihindou, Vianet; Moebius, Yasmin; Morgan, David; Morgan, Bethan; Mulindahabi, Felix; Murai, Mizuki; Niyigabae, Protais; Normand, Emma; Ntare, Nicolas; Ormsby, Lucy Jayne; Piel, Alex; Pruetz, Jill; Rundus, Aaron; Sanz, Crickette; Sommer, Volker; Stewart, Fiona; Tagg, Nikki; Vanleeuwe, Hilde; Vergnes, Virginie; Willie, Jacob; Wittig, Roman M; Zuberbuehler, Klaus; Boesch, Christophe

    2016-01-01

    The study of the archaeological remains of fossil hominins must rely on reconstructions to elucidate the behaviour that may have resulted in particular stone tools and their accumulation. Comparatively, stone tool use among living primates has illuminated behaviours that are also amenable to archaeological examination, permitting direct observations of the behaviour leading to artefacts and their assemblages to be incorporated. Here, we describe newly discovered stone tool-use behaviour and stone accumulation sites in wild chimpanzees reminiscent of human cairns. In addition to data from 17 mid- to long-term chimpanzee research sites, we sampled a further 34 Pan troglodytes communities. We found four populations in West Africa where chimpanzees habitually bang and throw rocks against trees, or toss them into tree cavities, resulting in conspicuous stone accumulations at these sites. This represents the first record of repeated observations of individual chimpanzees exhibiting stone tool use for a purpose other than extractive foraging at what appear to be targeted trees. The ritualized behavioural display and collection of artefacts at particular locations observed in chimpanzee accumulative stone throwing may have implications for the inferences that can be drawn from archaeological stone assemblages and the origins of ritual sites. PMID:26923684

  4. Chimpanzee accumulative stone throwing

    PubMed Central

    Kühl, Hjalmar S.; Kalan, Ammie K.; Arandjelovic, Mimi; Aubert, Floris; D’Auvergne, Lucy; Goedmakers, Annemarie; Jones, Sorrel; Kehoe, Laura; Regnaut, Sebastien; Tickle, Alexander; Ton, Els; van Schijndel, Joost; Abwe, Ekwoge E.; Angedakin, Samuel; Agbor, Anthony; Ayimisin, Emmanuel Ayuk; Bailey, Emma; Bessone, Mattia; Bonnet, Matthieu; Brazolla, Gregory; Buh, Valentine Ebua; Chancellor, Rebecca; Cipoletta, Chloe; Cohen, Heather; Corogenes, Katherine; Coupland, Charlotte; Curran, Bryan; Deschner, Tobias; Dierks, Karsten; Dieguez, Paula; Dilambaka, Emmanuel; Diotoh, Orume; Dowd, Dervla; Dunn, Andrew; Eshuis, Henk; Fernandez, Rumen; Ginath, Yisa; Hart, John; Hedwig, Daniela; Ter Heegde, Martijn; Hicks, Thurston Cleveland; Imong, Inaoyom; Jeffery, Kathryn J.; Junker, Jessica; Kadam, Parag; Kambi, Mohamed; Kienast, Ivonne; Kujirakwinja, Deo; Langergraber, Kevin; Lapeyre, Vincent; Lapuente, Juan; Lee, Kevin; Leinert, Vera; Meier, Amelia; Maretti, Giovanna; Marrocoli, Sergio; Mbi, Tanyi Julius; Mihindou, Vianet; Moebius, Yasmin; Morgan, David; Morgan, Bethan; Mulindahabi, Felix; Murai, Mizuki; Niyigabae, Protais; Normand, Emma; Ntare, Nicolas; Ormsby, Lucy Jayne; Piel, Alex; Pruetz, Jill; Rundus, Aaron; Sanz, Crickette; Sommer, Volker; Stewart, Fiona; Tagg, Nikki; Vanleeuwe, Hilde; Vergnes, Virginie; Willie, Jacob; Wittig, Roman M.; Zuberbuehler, Klaus; Boesch, Christophe

    2016-01-01

    The study of the archaeological remains of fossil hominins must rely on reconstructions to elucidate the behaviour that may have resulted in particular stone tools and their accumulation. Comparatively, stone tool use among living primates has illuminated behaviours that are also amenable to archaeological examination, permitting direct observations of the behaviour leading to artefacts and their assemblages to be incorporated. Here, we describe newly discovered stone tool-use behaviour and stone accumulation sites in wild chimpanzees reminiscent of human cairns. In addition to data from 17 mid- to long-term chimpanzee research sites, we sampled a further 34 Pan troglodytes communities. We found four populations in West Africa where chimpanzees habitually bang and throw rocks against trees, or toss them into tree cavities, resulting in conspicuous stone accumulations at these sites. This represents the first record of repeated observations of individual chimpanzees exhibiting stone tool use for a purpose other than extractive foraging at what appear to be targeted trees. The ritualized behavioural display and collection of artefacts at particular locations observed in chimpanzee accumulative stone throwing may have implications for the inferences that can be drawn from archaeological stone assemblages and the origins of ritual sites. PMID:26923684

  5. Accumulation of the planets

    NASA Technical Reports Server (NTRS)

    Wetherill, G. W.

    1987-01-01

    In modeling the accumulation of planetesimals into planets, it is appropriate to distinguish between two stages: an early stage, during which approximately 10 km diameter planetesimals accumulate locally to form bodies approximate 10 to the 25th g in mass; and a later stage in which the approximately 10 to the 25th g planetesimals accumulate into the final planets. In the terrestrial planet region, an initial planetesimal swarm corresponding to the critical mass of dust layer gravitational instabilities is considered. In order to better understand the accumulation history of Mercury-sized bodies, 19 Monte-Carlo simulations of terrestrial planet growth were calculated. A Monte Carlo technique was used to investigate the orbital evolution of asteroidal collision debris produced interior to 2.6 AU. It was found that there are two regions primarily responsible for production of Earth-crossing meteoritic material and Apollo objects. The same techniques were extended to include the origin of Earth-approaching asteroidal bodies. It is found that these same two resonant mechanisms predict a steady-state number of Apollo-Amor about 1/2 that estimated based on astronomical observations.

  6. Acute hypoxia modifies cAMP levels induced by inhibitors of phosphodiesterase-4 in rat carotid bodies, carotid arteries and superior cervical ganglia

    PubMed Central

    Nunes, Ana R; Batuca, Joana R; Monteiro, Emília C

    2010-01-01

    Background and purpose: Phosphodiesterase (PDE) inhibitors are useful to treat hypoxia-related diseases and are used in experiments studying the effects of oxygen on 3′-5′-cyclic adenosine monophosphate (cAMP) production. We studied the effects of acute hypoxia on cAMP accumulation induced by PDE inhibitors in oxygen-specific chemosensors, the carotid bodies (CBs) and in non-chemosensitive CB-related structures: carotid arteries (CAs) and superior cervical ganglia (SCG). Experimental approach: Concentration–response curves for the effects of a non-specific PDE inhibitor [isobutylmethylxanthine (IBMX) ], PDE4 selective inhibitors (rolipram, Ro 20-1724) and a PDE2 selective inhibitor (erythro-9-(2-hydroxy-3-nonyl)adenine) on cAMP levels were obtained in normoxic (20% O2/5% CO2) or hypoxic (5% O2/5% CO2) conditions. Key results: Responses to the PDE inhibitors were compatible with the presence of PDE4 in rat CBs, CAs and SCG but in the absence of PDE2 in CAs and CBs. Acute hypoxia enhanced the effects of IBMX and PDE4 inhibitors on cAMP accumulation in CAs and CBs. In SCG, acute hypoxia reduced cAMP accumulation induced by all the four PDE inhibitors tested. Differences between the effects of Ro 20-1724 and rolipram on cAMP were found in CAs and CBs during hypoxia. Conclusions and implications: The effects of PDE4 inhibitors could be potentiated or inhibited by acute hypoxia depending on the PDE isoforms of the tissue. The similarities between the characterization of PDE4 inhibitors at the CBs and CAs, under normoxia and hypoxia, did not support a specific role for cAMP in the oxygen-sensing machinery at the CB and suggested that no direct CB-mediated, hyperventilatory, adverse effects would be expected with administration of PDE4 inhibitors. PMID:20082613

  7. Cyclic Di-AMP Impairs Potassium Uptake Mediated by a Cyclic Di-AMP Binding Protein in Streptococcus pneumoniae

    PubMed Central

    Bai, Yinlan; Yang, Jun; Zarrella, Tiffany M.; Zhang, Yang; Metzger, Dennis W.

    2014-01-01

    Cyclic di-AMP (c-di-AMP) has been shown to play important roles as a second messenger in bacterial physiology and infections. However, understanding of how the signal is transduced is still limited. Previously, we have characterized a diadenylate cyclase and two c-di-AMP phosphodiesterases in Streptococcus pneumoniae, a Gram-positive pathogen. In this study, we identified a c-di-AMP binding protein (CabP) in S. pneumoniae using c-di-AMP affinity chromatography. We demonstrated that CabP specifically bound c-di-AMP and that this interaction could not be interrupted by competition with other nucleotides, including ATP, cAMP, AMP, phosphoadenylyl adenosine (pApA), and cyclic di-GMP (c-di-GMP). By using a bacterial two-hybrid system and genetic mutagenesis, we showed that CabP directly interacted with a potassium transporter (SPD_0076) and that both proteins were required for pneumococcal growth in media with low concentrations of potassium. Interestingly, the interaction between CabP and SPD_0076 and the efficiency of potassium uptake were impaired by elevated c-di-AMP in pneumococci. These results establish a direct c-di-AMP-mediated signaling pathway that regulates pneumococcal potassium uptake. PMID:24272783

  8. Cyclic di-AMP impairs potassium uptake mediated by a cyclic di-AMP binding protein in Streptococcus pneumoniae.

    PubMed

    Bai, Yinlan; Yang, Jun; Zarrella, Tiffany M; Zhang, Yang; Metzger, Dennis W; Bai, Guangchun

    2014-02-01

    Cyclic di-AMP (c-di-AMP) has been shown to play important roles as a second messenger in bacterial physiology and infections. However, understanding of how the signal is transduced is still limited. Previously, we have characterized a diadenylate cyclase and two c-di-AMP phosphodiesterases in Streptococcus pneumoniae, a Gram-positive pathogen. In this study, we identified a c-di-AMP binding protein (CabP) in S. pneumoniae using c-di-AMP affinity chromatography. We demonstrated that CabP specifically bound c-di-AMP and that this interaction could not be interrupted by competition with other nucleotides, including ATP, cAMP, AMP, phosphoadenylyl adenosine (pApA), and cyclic di-GMP (c-di-GMP). By using a bacterial two-hybrid system and genetic mutagenesis, we showed that CabP directly interacted with a potassium transporter (SPD_0076) and that both proteins were required for pneumococcal growth in media with low concentrations of potassium. Interestingly, the interaction between CabP and SPD_0076 and the efficiency of potassium uptake were impaired by elevated c-di-AMP in pneumococci. These results establish a direct c-di-AMP-mediated signaling pathway that regulates pneumococcal potassium uptake. PMID:24272783

  9. Parallel Allostery by cAMP and PDE Coordinates Activation and Termination Phases in cAMP Signaling.

    PubMed

    Krishnamurthy, Srinath; Tulsian, Nikhil Kumar; Chandramohan, Arun; Anand, Ganesh S

    2015-09-15

    The second messenger molecule cAMP regulates the activation phase of the cAMP signaling pathway through high-affinity interactions with the cytosolic cAMP receptor, the protein kinase A regulatory subunit (PKAR). Phosphodiesterases (PDEs) are enzymes responsible for catalyzing hydrolysis of cAMP to 5' AMP. It was recently shown that PDEs interact with PKAR to initiate the termination phase of the cAMP signaling pathway. While the steps in the activation phase are well understood, steps in the termination pathway are unknown. Specifically, the binding and allosteric networks that regulate the dynamic interplay between PKAR, PDE, and cAMP are unclear. In this study, PKAR and PDE from Dictyostelium discoideum (RD and RegA, respectively) were used as a model system to monitor complex formation in the presence and absence of cAMP. Amide hydrogen/deuterium exchange mass spectrometry was used to monitor slow conformational transitions in RD, using disordered regions as conformational probes. Our results reveal that RD regulates its interactions with cAMP and RegA at distinct loci by undergoing slow conformational transitions between two metastable states. In the presence of cAMP, RD and RegA form a stable ternary complex, while in the absence of cAMP they maintain transient interactions. RegA and cAMP each bind at orthogonal sites on RD with resultant contrasting effects on its dynamics through parallel allosteric relays at multiple important loci. RD thus serves as an integrative node in cAMP termination by coordinating multiple allosteric relays and governing the output signal response. PMID:26276689

  10. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish.

    PubMed

    Lundegaard, Pia R; Anastasaki, Corina; Grant, Nicola J; Sillito, Rowland R; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J Douglas; Porteous, David J; Patton, E Elizabeth

    2015-10-22

    Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  11. Internal gastargets in AmPS

    NASA Astrophysics Data System (ADS)

    Kaan, A. P.; Postma, O.; van den Brand, J. F. J.; van Leeuwen, E.; Doets, M.; Kraan, M.

    1997-05-01

    Internal gas targets in AmPS A.P. Kaan, O. Postma, J.F.J. van den Brand, E. van Leeuwen, M. Doets, M. Kra= an National Institute for Nuclear Physics and High Energy Physics; Kruislaan 409; 1098 SJ Amsterdam; Holland In the Amsterdam Puls Stretcher/storage ring AmPS(1 GeV electrons), we designed a set-up in order to accommodate a gas target with a density of 1016 mol/cm2. The storage cell needed for this purpose is a aluminium tube with a length of 40 cm, a diameter of 15 mm and a wall thickness of 25 =B5m. Three sets of conductance limiters on both sides of the target, combined with dry turbopumps are designed to be used as differential pumping stations. These limiters cause discontinuities in the beam path and must therefor be retractable and radio frequency compatible in both positions. Low =B5 materials must be used because of the depolarisation effects of changing magnetic fields. The calculations show that the flow resistance's are sufficient to reduce the load of the getter pumps to a level with which the lifetime of the pump elements remain acceptable. The design of the mechanics and the vacuum system will be explained. Recent results from the measurements after installation in combination with the influence on the lifetime on the beam will be presented

  12. Oscillations of cAMP with the cardiac cycle.

    PubMed

    Wikman-Coffelt, J; Sievers, R; Coffelt, R J; Parmley, W W

    1983-03-16

    Oscillations of cAMP with the cardiac cycle were demonstrated in the rat heart using a stimulator-triggered rapid freeze-clamp to decrease the temperature of the heart from 37 degrees C to -80 degrees C in 5 msec (20,000 degrees/sec) at a predetermined phase of the cardiac cycle. The nucleotide, cAMP, oscillated 60% with the cardiac cycle during normal working conditions, the higher cAMP value occurring during systole. PMID:6301471

  13. Didactical formulation of the Ampère law

    NASA Astrophysics Data System (ADS)

    Barchiesi, Dominique

    2014-05-01

    The Ampère law is useful to calculate the magnetostatic field in the cases of distributions of current with high degree of symmetry. Nevertheless the magnetic field produced by a thin straight wire carrying a current I requires the Biot-Savart law and the use of the Ampère law leads to a mistake. A didactical formulation of the Ampère law is proposed to prevent misinterpretations.

  14. Cardiac cAMP: production, hydrolysis, modulation and detection.

    PubMed

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3',5'-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  15. Cardiac cAMP: production, hydrolysis, modulation and detection

    PubMed Central

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  16. Detection of amp C in Enterobacter cloacae in China.

    PubMed

    Zhang, Y L; Li, J T; Zhao, M W

    2001-10-01

    PCR amplification of 55 strains of Enterobacter cloacae indicated 51 of them had amp C structural gene verified by DNA sequence and Southern blotting. All PCR products were cleaved into 666- and 328-bp fragments by Kpn1 restriction enzyme. Imipenem was the most potent inducer for mRNA expression of amp C gene and beta-lactamase activity. The beta-Lactamase inhibitor R0481220 strongly inhibited Amp C beta-lactamases; 96.4% (53/55) of Enterobacter cloacae producing Amp C enzyme were susceptible to cefepime. PMID:11691570

  17. Mechanisms Restricting Diffusion of Intracellular cAMP

    PubMed Central

    Agarwal, Shailesh R.; Clancy, Colleen E.; Harvey, Robert D.

    2016-01-01

    Although numerous receptors stimulate cAMP production in a wide array of cells, many elicit distinct, highly localized responses, implying that the subcellular distribution of cAMP is not uniform. One often used explanation is that phosphodiesterases, which breakdown cAMP, act as functional barriers limiting diffusion. However, several studies refute the notion that this is sufficient, suggesting that phosphodiesterase-independent movement of cAMP must occur at rates slower than free diffusion. But, until now this has never been demonstrated. Using Raster Image Correlation Spectroscopy (RICS), we measured the diffusion coefficient of a fluorescently-labeled cAMP derivative (φ450-cAMP) as well as other fluorescent molecules in order to investigate the role that molecular size, cell morphology, and buffering by protein kinase A (PKA) play in restricting cAMP mobility in different cell types. Our results demonstrate that cytosolic movement of cAMP is indeed much slower than the rate of free diffusion and that interactions with PKA, especially type II PKA associated with mitochondria, play a significant role. These findings have important implications with respect to cAMP signaling in all cells. PMID:26795432

  18. Cyclic AMP regulates the expression and nuclear translocation of RFC40 in MCF7 cells

    SciTech Connect

    Gupte, Rakhee S. . E-mail: rakhee_gupte@nymc.edu; Sampson, Valerie; Traganos, Frank; Darzynkiewicz, Zbigniew; Lee, Marietta Y.W.T.

    2006-04-01

    We have previously shown that the regulatory subunit of PKA, RI{alpha}, functions as a nuclear transport protein for the second subunit of the replication factor C complex, RFC40, and that this transport appears to be crucial for cell cycle progression from G1 to S phase. In this study, we found that N {sup 6}-monobutyryl cAMP significantly up-regulates the expression of RFC40 mRNA by 1.8-fold and its endogenous protein by 2.3-fold with a subsequent increase in the RI{alpha}-RFC40 complex formation by 3.2-fold. Additionally, the nuclear to cytoplasmic ratio of RFC40 increased by 26% followed by a parallel increase in the percentage of S phase cells by 33%. However, there was reduction in the percentage of G1 cells by 16% and G2/M cells by 43% with a concurrent accumulation of cells in S phase. Interestingly, the higher percentage of S phase cells did not correlate with a parallel increase in DNA replication. Moreover, although cAMP did not affect the expression of the other RFC subunits, there was a significant decrease in the RFC40-37 complex formation by 81.3%, substantiating the decrease in DNA replication rate. Taken together, these findings suggest that cAMP functions as an upstream modulator that regulates the expression and nuclear translocation of RFC40.

  19. Analysis of a novel cyclic Amp inducible prespore gene in Dictyostelium discoideum: evidence for different patterns of cAMP regulation.

    PubMed

    Agarwal, A; Sloger, M S; Oyama, M; Blumberg, D D

    1994-09-01

    The D7 cDNA clone hybridizes to a 2.8 kb mRNA which first appears at the mound stage of development in the cellular slime mold Dictyostelium discoideum. This gene which is cyclic AMP (cAMP) inducible and is expressed specifically in the prespore cells contains an open reading frame interrupted by only one intron. The predicted amino acid sequence indicates a novel prespore protein which differs from all of the previously described prespore proteins in that it contains no internal repeats and does not share any homology with any of the other prespore genes. The amino acid sequence predicts a protein of 850 amino acids with a molecular weight of 95,343 daltons and an isoelectric point of 4.25. The protein is very rich in glutamine (13.8%), asparagine (10.6%) and glutamic acid (10.4%) with one potential glycosylation site and 28 possible sites for phosphorylation. The amino terminus is hydrophobic with characteristics of a signal sequence while the entire carboxyl half of the protein is notable for its hydrophilicity. Comparison of cAMP regulation of the D7 gene with the regulation of two other cAMP regulated prespore genes, the PL3(SP87) gene and the Psa(D19), reveals some striking differences. Disaggregation in the presence of cAMP results in transient degradation of mRNA for all three genes. The transcription rate for the D7 and PsA(D19) genes remains relatively unaffected by disaggregation but there is a rapid although transient decline in the transcription rate of the PL3(SP87) gene. Although the accumulation of all three mRNAs is first detectable at mound stage, transcription of the D7 and PsA(D19) genes is detected earlier in development, at rippling aggregate stage several hours prior to the earliest time when transcription of the PL3(SP87) gene is detected. Analysis of the promoter region of the D7 gene reveals three CA like boxes flanked by direct repeats as well as four G rich regions that may serve as regulatory elements. PMID:7988791

  20. The cAMP-binding proteins of Leishmania are not the regulatory subunits of cAMP-dependent protein kinase.

    PubMed

    Banerjee, C; Sarkar, D

    2001-09-01

    The most commonly used method to determine the cAMP binding activity in cytosolic extracts of promastigotes of Leishmania spp. underestimated by approximately 11.5-fold the total amount of [(3)H]cAMP bound, when compared with results obtained by the modified Millipore filter technique. Three cAMP-binding proteins (BPI, BPII and BPIII) were partially purified and characterized. The native molecular masses of BPI, BPII and BPIII were estimated to be 105, 155 and 145 kDa, respectively. The binding of [(3)H]cAMP to these proteins was affected to different extents by several cAMP analogues. Antibodies directed against the types I and II regulatory subunits of PKA did not cross-react with the leishmanial extract. Photoaffinity labeling of the cytosolic extracts with 8-N(3)-[(32)P]cAMP specifically labeled a band of M(r) 116000 and a band of M(r) 80000 partially saturable by cAMP. From these results, it is concluded that the leishmanial cAMP-binding proteins appear to belong to a different class distinct from the regulatory subunits of cAMP-dependent protein kinases. PMID:11544092

  1. Expression of the type I regulatory subunit of cAMP-dependent protein kinase in Escherichia coli

    SciTech Connect

    Saraswat, L.D.; Filutowicz, M.

    1986-05-01

    The cDNA for the bovine type I regulatory subunit of cAMP-dependent protein kinase has been inserted into the expression vector pUC7. When E. coli JM105 was transformed with this plasmid, R-subunit was expressed in amounts that approached 2-4 mg/liter. The expressed protein was visualized in total cell extracts by photolabeling with 8-N/sub 3/-(/sup 32/P)-cAMP following transfer from SDS polyacrylamide gels to nitrocellulose. Expression of R-subunit was independent of IPTG. R-subunit accumulated in large amounts only in the stationary phase of growth. The addition of IPTG during the log phase of growth actually blocked the accumulation of R-subunit. The soluble, dimeric R-subunit was purifided to homogeneity by affinity chromatography. This R-subunit bound 2 mol cAMP/mol R monomer, reassociated with C-subunit to form cAMP-dependent holoenzyme, and migrated as a dimer on SDS polyacrylamide gels in the absence of reducing agents. The expressed protein was also susceptible to limited proteolysis yielding a monomeric cAMP-binding fragment having a molecular weight of 35,000. In all of these properties the expressed protein was indistinguishable from R/sup I/ purified from bovine tissue even though the R-subunit expressed in E. coli represents a fusion protein that contains 10 additional amino acids at the amino terminus that are provided by the lac Z gene of the vector. The NH/sub 2/-terminal sequence was confirmed by amino acid sequencing.

  2. Follicle-stimulating hormone/cAMP regulation of aromatase gene expression requires β-catenin

    PubMed Central

    Parakh, Tehnaz N.; Hernandez, Jennifer A.; Grammer, Jean C.; Weck, Jennifer; Hunzicker-Dunn, Mary; Zeleznik, Anthony J.; Nilson, John H.

    2006-01-01

    Estrogens profoundly influence the physiology and pathology of reproductive and other tissues. Consequently, emphasis has been placed on delineating the mechanisms underlying regulation of estrogen levels. Circulating levels of estradiol in women are controlled by follicle-stimulating hormone (FSH), which regulates transcription of the aromatase gene (CYP19A1) in ovarian granulosa cells. Previous studies have focused on two downstream effectors of the FSH signal, cAMP and the orphan nuclear receptor steroidogenic factor-1 (NR5A1). In this report, we present evidence for β-catenin (CTNNB1) as an essential transcriptional regulator of CYP19A1. FSH induction of select steroidogenic enzyme mRNAs, including Cyp19a1, is enhanced by β-catenin. Additionally, β-catenin is present in transcription complexes assembled on the endogenous gonad-specific CYP19A1 promoter, as evidenced by chromatin immunoprecipitation assays. Transient expression and RNAi studies demonstrate that FSH- and cAMP-dependent regulation of this promoter is sensitive to alterations in the level of β-catenin. The stimulatory effect of β-catenin is mediated through functional interactions with steroidogenic factor-1 that involve four acidic residues within its ligand-binding domain, mutation of which attenuates FSH/cAMP-induced Cyp19a1 mRNA accumulation. Together, these data demonstrate that β-catenin is essential for FSH/cAMP-regulated gene expression in the ovary, identifying a central and previously unappreciated role for β-catenin in estrogen biosynthesis, and a potential broader role in other aspects of follicular maturation. PMID:16895991

  3. Effects of tetrandrine on cAMP and cGMP levels in rabbit corpus cavernosum in vitro.

    PubMed

    Chen, Jun; Liu, Jihong; Wang, Tao; Xiao, Hengjun; Yin, Chunping

    2010-07-01

    The aim of this study was to further investigate the relaxation mechanism of tetrandrine (Tet), a bis-benzylisoquinoline alkaloid isolated from the Chinese medicinal herb-root of Stephania tetrandra S Moore, on rabbit corpus cavernosum tissue in vitro. The effects of Tet on the concentrations of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) in isolated and incubated rabbit corpus cavernosum tissue were recorded by means of (125)I radioimmunoassay. The basal concentration of cAMP in corpus cavernosum tissue was 5.67 +/- 0.97 pmol mg(-1). Tet increased the cAMP concentration in a dose-dependent manner (p < 0.05), but this effect was not inhibited by an adenylate cyclase inhibitor (cis-N-(2-phenylcyclopentyl)azacyclotridec-1-en-2-amine, MDL-12, 330A) (p > 0.05). The accumulation of cAMP induced by prostaglandin E(1) (PGE(1), a stimulator of cAMP production) was also augmented by Tet in a dose-dependent manner (p < 0.05). The basal concentration of cGMP in corpus cavernosum tissue is 0.44 +/- 0.09 pmol mg(-1). Tet did not affect this concentration of cGMP, neither in the presence nor the absence of a guanyl cyclase inhibitor (1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one, ODQ) (p > 0.05). Further, sodium nitroprusside (SNP, a stimulator of cGMP production)-induced cGMP production was not enhanced by Tet (p > 0.05). Tet, with its relaxation mechanism, can enhance the concentration of cAMP in rabbit corpus cavernosum tissue, probably by inhibiting PDEs activity. PMID:20582806

  4. Vasoactive intestinal peptide: A potent stimulator of adenosine 3′:5′-cyclic monophosphate accumulation in gut carcinoma cell lines in culture*

    PubMed Central

    Laburthe, M.; Rousset, M.; Boissard, C.; Chevalier, G.; Zweibaum, A.; Rosselin, G.

    1978-01-01

    Vasoactive intestinal peptide (VIP) is a potent and efficient stimulator of adenosine 3′:5′-cyclic monophosphate (cAMP) accumulation in a human colon carcinoma cell line, HT 29. cAMP accumulation is sensitive to a concentration of VIP as low as 3×10-12 M. Maximum VIP-induced cAMP levels were observed with 10-9 M VIP and are about 200 times above the basal levels. Half-maximum cAMP production was obtained at 3×10-10 M VIP. 125I-Labeled VIP was found to bind to HT 29 cells; this binding was competitively inhibited by concentrations of unlabeled VIP between 10-10 and 10-7 M. Half-maximum inhibition of binding was observed with 2×10-9 M VIP. Secretin also stimulated cAMP accumulation in HT 29 cells, but its effectiveness was 1/1000 that of VIP. The other peptides tested at 10-7 M, such as insulin, glucagon, bovine pancreatic polypeptide, somatostatin, octapeptide of cholecystokinin, neurotensin, and substance P, did not stimulate cAMP accumulation. Prostaglandin E1 and catecholamines stimulated cAMP production but were 1/2.3 and 1/5.5 as efficient as VIP, respectively. Another malignant cell line from the gut, the human rectal tumor cell line HRT 18, is also sensitive to VIP. In HRT 18 cells, VIP stimulated cAMP accumulation with a maximal effect at 10-8 M; half-maximum stimulation was observed at about 10-9 M. These results demonstrate the presence of VIP receptors in two malignant human intestinal cell lines (HT 29 and HRT 18) in culture and provide a model for studying the action of VIP on cell proliferation. PMID:208077

  5. Beam optics of the AmPS extraction line

    NASA Astrophysics Data System (ADS)

    Hoekstra, R.

    1991-01-01

    The beam optics of the AmPS (Amsterdam Pulse Stretcher) are described. Definitions are outlined, and the beam elements and parameters are given. Developments relating to the electrostatic septum, chicane, beam transformer and bending through 90 degrees are described. The performance of the AmPS and beam diagnostics are discussed.

  6. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion.

    PubMed

    Schwede, Frank; Chepurny, Oleg G; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E; MacDonald, Patrick E; Genieser, Hans-G; Herberg, Friedrich W; Holz, George G

    2015-07-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3',5'-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  7. Synergistic Antipseudomonal Effects of Synthetic Peptide AMP38 and Carbapenems.

    PubMed

    Rudilla, Héctor; Fusté, Ester; Cajal, Yolanda; Rabanal, Francesc; Vinuesa, Teresa; Viñas, Miguel

    2016-01-01

    The aim was to explore the antimicrobial activity of a synthetic peptide (AMP38) and its synergy with imipenem against imipenem-resistant Pseudomonas aeruginosa. The main mechanism of imipenem resistance is the loss or alteration of protein OprD. Time-kill and minimal biofilm eradication concentration (MBEC) determinations were carried out by using clinical imipenem-resistant strains. AMP38 was markedly synergistic with imipenem when determined in imipenem-resistant P. aeruginosa. MBEC obtained for the combination of AMP38 and imipenem was of 62.5 μg/mL, whereas the MBEC of each antimicrobial separately was 500 μg/mL. AMP38 should be regarded as a promising antimicrobial to fight MDR P. aeruginosa infections. Moreover, killing effect and antibiofilm activity of AMP38 plus imipenem was much higher than that of colistin plus imipenem. PMID:27626405

  8. Control of bacterial exoelectrogenesis by c-AMP-GMP

    PubMed Central

    Nelson, James W.; Sudarsan, Narasimhan; Phillips, Grace E.; Stav, Shira; Lünse, Christina E.; McCown, Phillip J.; Breaker, Ronald R.

    2015-01-01

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes. PMID:25848023

  9. Heat exchanger-accumulator

    DOEpatents

    Ecker, Amir L.

    1980-01-01

    What is disclosed is a heat exchanger-accumulator for vaporizing a refrigerant or the like, characterized by an upright pressure vessel having a top, bottom and side walls; an inlet conduit eccentrically and sealingly penetrating through the top; a tubular overflow chamber disposed within the vessel and sealingly connected with the bottom so as to define an annular outer volumetric chamber for receiving refrigerant; a heat transfer coil disposed in the outer volumetric chamber for vaporizing the liquid refrigerant that accumulates there; the heat transfer coil defining a passageway for circulating an externally supplied heat exchange fluid; transferring heat efficiently from the fluid; and freely allowing vaporized refrigerant to escape upwardly from the liquid refrigerant; and a refrigerant discharge conduit penetrating sealingly through the top and traversing substantially the length of the pressurized vessel downwardly and upwardly such that its inlet is near the top of the pressurized vessel so as to provide a means for transporting refrigerant vapor from the vessel. The refrigerant discharge conduit has metering orifices, or passageways, penetrating laterally through its walls near the bottom, communicating respectively interiorly and exteriorly of the overflow chamber for controllably carrying small amounts of liquid refrigerant and oil to the effluent stream of refrigerant gas.

  10. The β-Lactamase Gene Regulator AmpR Is a Tetramer That Recognizes and Binds the d-Ala-d-Ala Motif of Its Repressor UDP-N-acetylmuramic Acid (MurNAc)-pentapeptide*

    PubMed Central

    Vadlamani, Grishma; Thomas, Misty D.; Patel, Trushar R.; Donald, Lynda J.; Reeve, Thomas M.; Stetefeld, Jörg; Standing, Kenneth G.; Vocadlo, David J.; Mark, Brian L.

    2015-01-01

    Inducible expression of chromosomal AmpC β-lactamase is a major cause of β-lactam antibiotic resistance in the Gram-negative bacteria Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is induced by the LysR-type transcriptional regulator (LTTR) AmpR, which activates ampC expression in response to changes in peptidoglycan (PG) metabolite levels that occur during exposure to β-lactams. Under normal conditions, AmpR represses ampC transcription by binding the PG precursor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide. When exposed to β-lactams, however, PG catabolites (1,6-anhydroMurNAc-peptides) accumulate in the cytosol, which have been proposed to competitively displace UDP-MurNAc-pentapeptide from AmpR and convert it into an activator of ampC transcription. Here we describe the molecular interactions between AmpR (from Citrobacter freundii), its DNA operator, and repressor UDP-MurNAc-pentapeptide. Non-denaturing mass spectrometry revealed AmpR to be a homotetramer that is stabilized by DNA containing the T-N11-A LTTR binding motif and revealed that it can bind four repressor molecules in an apparently stepwise manner. A crystal structure of the AmpR effector-binding domain bound to UDP-MurNAc-pentapeptide revealed that the terminal d-Ala-d-Ala motif of the repressor forms the primary contacts with the protein. This observation suggests that 1,6-anhydroMurNAc-pentapeptide may convert AmpR into an activator of ampC transcription more effectively than 1,6-anhydroMurNAc-tripeptide (which lacks the d-Ala-d-Ala motif). Finally, small angle x-ray scattering demonstrates that the AmpR·DNA complex adopts a flat conformation similar to the LTTR protein AphB and undergoes only a slight conformational change when binding UDP-MurNAc-pentapeptide. Modeling the AmpR·DNA tetramer bound to UDP-MurNAc-pentapeptide predicts that the UDP-MurNAc moiety of the repressor participates in modulating AmpR function. PMID:25480792

  11. The β-lactamase gene regulator AmpR is a tetramer that recognizes and binds the D-Ala-D-Ala motif of its repressor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide.

    PubMed

    Vadlamani, Grishma; Thomas, Misty D; Patel, Trushar R; Donald, Lynda J; Reeve, Thomas M; Stetefeld, Jörg; Standing, Kenneth G; Vocadlo, David J; Mark, Brian L

    2015-01-30

    Inducible expression of chromosomal AmpC β-lactamase is a major cause of β-lactam antibiotic resistance in the Gram-negative bacteria Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is induced by the LysR-type transcriptional regulator (LTTR) AmpR, which activates ampC expression in response to changes in peptidoglycan (PG) metabolite levels that occur during exposure to β-lactams. Under normal conditions, AmpR represses ampC transcription by binding the PG precursor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide. When exposed to β-lactams, however, PG catabolites (1,6-anhydroMurNAc-peptides) accumulate in the cytosol, which have been proposed to competitively displace UDP-MurNAc-pentapeptide from AmpR and convert it into an activator of ampC transcription. Here we describe the molecular interactions between AmpR (from Citrobacter freundii), its DNA operator, and repressor UDP-MurNAc-pentapeptide. Non-denaturing mass spectrometry revealed AmpR to be a homotetramer that is stabilized by DNA containing the T-N11-A LTTR binding motif and revealed that it can bind four repressor molecules in an apparently stepwise manner. A crystal structure of the AmpR effector-binding domain bound to UDP-MurNAc-pentapeptide revealed that the terminal D-Ala-D-Ala motif of the repressor forms the primary contacts with the protein. This observation suggests that 1,6-anhydroMurNAc-pentapeptide may convert AmpR into an activator of ampC transcription more effectively than 1,6-anhydroMurNAc-tripeptide (which lacks the D-Ala-D-Ala motif). Finally, small angle x-ray scattering demonstrates that the AmpR·DNA complex adopts a flat conformation similar to the LTTR protein AphB and undergoes only a slight conformational change when binding UDP-MurNAc-pentapeptide. Modeling the AmpR·DNA tetramer bound to UDP-MurNAc-pentapeptide predicts that the UDP-MurNAc moiety of the repressor participates in modulating AmpR function. PMID:25480792

  12. Atmosphere, Magnetosphere and Plasmas in Space (AMPS). Spacelab payload definition study. Volume 3, book 2: AMPS equipment to Spacelab ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The interfaces between AMPS Payload No.(TBD) and Spacelab are described. The interfaces specified cover the AMPS physical, electrical, and thermal interfaces that are established to prescribe the standard Spacelab configuration required to perform the mission. If the configuration definition changes due to change of Spacelab equipment model, or serial numbers, then reidentification of the Labcraft payload may be required.

  13. Group B Streptococcus Degrades Cyclic-di-AMP to Modulate STING-Dependent Type I Interferon Production.

    PubMed

    Andrade, Warrison A; Firon, Arnaud; Schmidt, Tobias; Hornung, Veit; Fitzgerald, Katherine A; Kurt-Jones, Evelyn A; Trieu-Cuot, Patrick; Golenbock, Douglas T; Kaminski, Pierre-Alexandre

    2016-07-13

    Induction of type I interferon (IFN) in response to microbial pathogens depends on a conserved cGAS-STING signaling pathway. The presence of DNA in the cytoplasm activates cGAS, while STING is activated by cyclic dinucleotides (cdNs) produced by cGAS or from bacterial origins. Here, we show that Group B Streptococcus (GBS) induces IFN-β production almost exclusively through cGAS-STING-dependent recognition of bacterial DNA. However, we find that GBS expresses an ectonucleotidase, CdnP, which hydrolyzes extracellular bacterial cyclic-di-AMP. Inactivation of CdnP leads to c-di-AMP accumulation outside the bacteria and increased IFN-β production. Higher IFN-β levels in vivo increase GBS killing by the host. The IFN-β overproduction observed in the absence of CdnP is due to the cumulative effect of DNA sensing by cGAS and STING-dependent sensing of c-di-AMP. These findings describe the importance of a bacterial c-di-AMP ectonucleotidase and suggest a direct bacterial mechanism that dampens activation of the cGAS-STING axis. PMID:27414497

  14. cAMP-Inhibits Cytoplasmic Phospholipase A2 and Protects Neurons against Amyloid-β-Induced Synapse Damage

    PubMed Central

    Bate, Clive; Williams, Alun

    2015-01-01

    A key event in Alzheimer’s disease (AD) is the production of amyloid-β (Aβ) peptides and the loss of synapses. In cultured neurons Aβ triggered synapse damage as measured by the loss of synaptic proteins. α-synuclein (αSN), aggregates of which accumulate in Parkinson’s disease, also caused synapse damage. Synapse damage was associated with activation of cytoplasmic phospholipase A2 (cPLA2), an enzyme that regulates synapse function and structure, and the production of prostaglandin (PG) E2. In synaptosomes PGE2 increased concentrations of cyclic adenosine monophosphate (cAMP) which suppressed the activation of cPLA2 demonstrating an inhibitory feedback system. Thus, Aβ/αSN-induced activated cPLA2 produces PGE2 which increases cAMP which in turn suppresses cPLA2 and, hence, its own production. Neurons pre-treated with pentoxifylline and caffeine (broad spectrum phosphodiesterase (PDE) inhibitors) or the PDE4 specific inhibitor rolipram significantly increased the Aβ/αSN-induced increase in cAMP and consequently protected neurons against synapse damage. The addition of cAMP analogues also inhibited cPLA2 and protected neurons against synapse damage. These results suggest that drugs that inhibit Aβ-induced activation of cPLA2 and cross the blood–brain barrier may reduce synapse damage in AD. PMID:26389963

  15. cAMP-Inhibits Cytoplasmic Phospholipase A₂ and Protects Neurons against Amyloid-β-Induced Synapse Damage.

    PubMed

    Bate, Clive; Williams, Alun

    2015-01-01

    A key event in Alzheimer's disease (AD) is the production of amyloid-β (Aβ) peptides and the loss of synapses. In cultured neurons Aβ triggered synapse damage as measured by the loss of synaptic proteins. α-synuclein (αSN), aggregates of which accumulate in Parkinson's disease, also caused synapse damage. Synapse damage was associated with activation of cytoplasmic phospholipase A₂ (cPLA₂), an enzyme that regulates synapse function and structure, and the production of prostaglandin (PG) E₂. In synaptosomes PGE₂ increased concentrations of cyclic adenosine monophosphate (cAMP) which suppressed the activation of cPLA₂ demonstrating an inhibitory feedback system. Thus, Aβ/αSN-induced activated cPLA₂ produces PGE₂ which increases cAMP which in turn suppresses cPLA₂ and, hence, its own production. Neurons pre-treated with pentoxifylline and caffeine (broad spectrum phosphodiesterase (PDE) inhibitors) or the PDE4 specific inhibitor rolipram significantly increased the Aβ/αSN-induced increase in cAMP and consequently protected neurons against synapse damage. The addition of cAMP analogues also inhibited cPLA₂ and protected neurons against synapse damage. These results suggest that drugs that inhibit Aβ-induced activation of cPLA₂ and cross the blood-brain barrier may reduce synapse damage in AD. PMID:26389963

  16. Ras protein/cAMP-dependent protein kinase signaling is negatively regulated by a deubiquitinating enzyme, Ubp3, in yeast.

    PubMed

    Li, Yang; Wang, Yuqi

    2013-04-19

    Ras proteins and cAMP-dependent protein kinase (protein kinase A, PKA) are important components of a nutrient signaling pathway that mediates cellular responses to glucose in yeast. The molecular mechanisms that regulate Ras/PKA-mediated signaling remain to be fully understood. Here, we provide evidence that Ras/PKA signaling is negatively regulated by a deubiquitinating enzyme, Ubp3. Disrupting the activity of Ubp3 leads to hyperactivation of PKA, as evidenced by much enhanced phosphorylation of PKA substrates, decreased accumulation of glycogen, larger cell size, and increased sensitivity to heat shock. Levels of intracellular cAMP and the active forms of Ras proteins are also elevated in the ubp3Δ mutant. Consistent with a possibility that the increased cAMP is responsible for the abnormal signaling behavior of the ubp3Δ mutant, overexpressing PDE2, which encodes a phosphodiesterase that hydrolyzes cAMP, significantly relieves the cell size increase and heat shock sensitivity of the mutant. Further analysis reveals that Ubp3 interacts with a Ras GTPase-accelerating protein, Ira2, and regulates its level of ubiquitination. Together, our data indicate that Ubp3 is a new regulator of the Ras/PKA signaling pathway and suggest that Ubp3 regulates this pathway by controlling the ubiquitination of Ras GTPase-accelerating protein Ira2. PMID:23476013

  17. Mass Spectrometry Imaging Reveals Elevated Glomerular ATP/AMP in Diabetes/obesity and Identifies Sphingomyelin as a Possible Mediator.

    PubMed

    Miyamoto, Satoshi; Hsu, Cheng-Chih; Hamm, Gregory; Darshi, Manjula; Diamond-Stanic, Maggie; Declèves, Anne-Emilie; Slater, Larkin; Pennathur, Subramaniam; Stauber, Jonathan; Dorrestein, Pieter C; Sharma, Kumar

    2016-05-01

    AMP-activated protein kinase (AMPK) is suppressed in diabetes and may be due to a high ATP/AMP ratio, however the quantitation of nucleotides in vivo has been extremely difficult. Via matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI) to localize renal nucleotides we found that the diabetic kidney had a significant increase in glomerular ATP/AMP ratio. Untargeted MALDI-MSI analysis revealed that a specific sphingomyelin species (SM(d18:1/16:0)) accumulated in the glomeruli of diabetic and high-fat diet-fed mice compared with wild-type controls. In vitro studies in mesangial cells revealed that exogenous addition of SM(d18:1/16:0) significantly elevated ATP via increased glucose consumption and lactate production with a consequent reduction of AMPK and PGC1α. Furthermore, inhibition of sphingomyelin synthases reversed these effects. Our findings suggest that AMPK is reduced in the diabetic kidney due to an increase in the ATP/AMP ratio and that SM(d18:1/16:0) could be responsible for the enhanced ATP production via activation of the glycolytic pathway. PMID:27322466

  18. CFTR regulation in human airway epithelial cells requires integrity of the actin cytoskeleton and compartmentalized cAMP and PKA activity

    PubMed Central

    Monterisi, Stefania; Favia, Maria; Guerra, Lorenzo; Cardone, Rosa A.; Marzulli, Domenico; Reshkin, Stephan J.; Casavola, Valeria; Zaccolo, Manuela

    2012-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) mutation ΔF508CFTR still causes regulatory defects when rescued to the apical membrane, suggesting that the intracellular milieu might affect its ability to respond to cAMP regulation. We recently reported that overexpression of the Na+/H+ exchanger regulatory factor NHERF1 in the cystic fibrosis (CF) airway cell line CFBE41o-rescues the functional expression of ΔF508CFTR by promoting F-actin organization and formation of the NHERF1–ezrin–actin complex. Here, using real-time FRET reporters of both PKA activity and cAMP levels, we find that lack of an organized subcortical cytoskeleton in CFBE41o-cells causes both defective accumulation of cAMP in the subcortical compartment and excessive cytosolic accumulation of cAMP. This results in reduced subcortical levels and increased cytosolic levels of PKA activity. NHERF1 overexpression in CFBE41o-cells restores chloride secretion, subcortical cAMP compartmentalization and local PKA activity, indicating that regulation of ΔF508CFTR function requires not only stable expression of the mutant CFTR at the cell surface but also depends on both generation of local cAMP signals of adequate amplitude and activation of PKA in proximity of its target. Moreover, we found that the knockdown of wild-type CFTR in the non-CF 16HBE14o-cells results in both altered cytoskeletal organization and loss of cAMP compartmentalization, whereas stable overexpression of wt CFTR in CF cells restores cytoskeleton organization and re-establishes the compartmentalization of cAMP at the plasma membrane. This suggests that the presence of CFTR on the plasma membrane influences the cytoskeletal organizational state and, consequently, cAMP distribution. Our data show that a sufficiently high concentration of cAMP in the subcortical compartment is required to achieve PKA-mediated regulation of CFTR activity. PMID:22302988

  19. Solids Accumulation Scouting Studies

    SciTech Connect

    Duignan, M. R.; Steeper, T. J.; Steimke, J. L.

    2012-09-26

    The objective of Solids Accumulation activities was to perform scaled testing to understand the behavior of remaining solids in a Double Shell Tank (DST), specifically AW-105, at Hanford during multiple fill, mix, and transfer operations. It is important to know if fissionable materials can concentrate when waste is transferred from staging tanks prior to feeding waste treatment plants. Specifically, there is a concern that large, dense particles containing plutonium could accumulate in poorly mixed regions of a blend tank heel for tanks that employ mixing jet pumps. At the request of the DOE Hanford Tank Operations Contractor, Washington River Protection Solutions, the Engineering Development Laboratory of the Savannah River National Laboratory performed a scouting study in a 1/22-scale model of a waste staging tank to investigate this concern and to develop measurement techniques that could be applied in a more extensive study at a larger scale. Simulated waste tank solids: Gibbsite, Zirconia, Sand, and Stainless Steel, with stainless steel particles representing the heavier particles, e.g., plutonium, and supernatant were charged to the test tank and rotating liquid jets were used to mix most of the solids while the simulant was pumped out. Subsequently, the volume and shape of the mounds of residual solids and the spatial concentration profiles for the surrogate for heavier particles were measured. Several techniques were developed and equipment designed to accomplish the measurements needed and they included: 1. Magnetic particle separator to remove simulant stainless steel solids. A device was designed and built to capture these solids, which represent the heavier solids during a waste transfer from a staging tank. 2. Photographic equipment to determine the volume of the solids mounds. The mounds were photographed as they were exposed at different tank waste levels to develop a composite of topographical areas. 3. Laser rangefinders to determine the volume of

  20. cAMP-dependent activation of mammalian target of rapamycin (mTOR) in thyroid cells. Implication in mitogenesis and activation of CDK4.

    PubMed

    Blancquaert, Sara; Wang, Lifu; Paternot, Sabine; Coulonval, Katia; Dumont, Jacques E; Harris, Thurl E; Roger, Pierre P

    2010-07-01

    How cAMP-dependent protein kinases [protein kinase A (PKA)] transduce the mitogenic stimulus elicited by TSH in thyroid cells to late activation of cyclin D3-cyclin-dependent kinase 4 (CDK4) remains enigmatic. Here we show in PC Cl3 rat thyroid cells that TSH/cAMP, like insulin, activates the mammalian target of rapamycin (mTOR)-raptor complex (mTORC1) leading to phosphorylation of S6K1 and 4E-BP1. mTORC1-dependent S6K1 phosphorylation in response to both insulin and cAMP required amino acids, whereas inhibition of AMP-activated protein kinase and glycogen synthase kinase 3 enhanced insulin but not cAMP effects. Unlike insulin, TSH/cAMP did not activate protein kinase B or induce tuberous sclerosis complex 2 phosphorylation at T1462 and Y1571. However, like insulin, TSH/cAMP produced a stable increase in mTORC1 kinase activity that was associated with augmented 4E-BP1 binding to raptor. This could be caused in part by T246 phosphorylation of PRAS40, which was found as an in vitro substrate of PKA. Both in PC Cl3 cells and primary dog thyrocytes, rapamycin inhibited DNA synthesis and retinoblastoma protein phosphorylation induced by TSH and insulin. Although rapamycin reduced cyclin D3 accumulation, the abundance of cyclin D3-CDK4 complexes was not affected. However, rapamycin inhibited the activity of these complexes by decreasing the TSH and insulin-mediated stimulation of activating T172 phosphorylation of CDK4. We propose that mTORC1 activation by TSH, at least in part through PKA-dependent phosphorylation of PRAS40, crucially contributes to mediate cAMP-dependent mitogenesis by regulating CDK4 T172-phosphorylation. PMID:20484410

  1. The Popeye Domain Containing Genes and cAMP Signaling

    PubMed Central

    Brand, Thomas; Poon, Kar Lai; Simrick, Subreena; Schindler, Roland F.R.

    2016-01-01

    3'-5'-cyclic adenosine monophosphate (cAMP) is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs). Initially, it was thought that protein kinase A (PKA) exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC) and hyperpolarizing cyclic nucleotide-gated (HCN) channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc) genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins. PMID:27500161

  2. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  3. cAMP-induced Mitochondrial Compartment Biogenesis

    PubMed Central

    Yoboue, Edgar D.; Augier, Eric; Galinier, Anne; Blancard, Corinne; Pinson, Benoît; Casteilla, Louis; Rigoulet, Michel; Devin, Anne

    2012-01-01

    Cell fate and proliferation are tightly linked to the regulation of the mitochondrial energy metabolism. Hence, mitochondrial biogenesis regulation, a complex process that requires a tight coordination in the expression of the nuclear and mitochondrial genomes, has a major impact on cell fate and is of high importance. Here, we studied the molecular mechanisms involved in the regulation of mitochondrial biogenesis through a nutrient-sensing pathway, the Ras-cAMP pathway. Activation of this pathway induces a decrease in the cellular phosphate potential that alleviates the redox pressure on the mitochondrial respiratory chain. One of the cellular consequences of this modulation of cellular phosphate potential is an increase in the cellular glutathione redox state. The redox state of the glutathione disulfide-glutathione couple is a well known important indicator of the cellular redox environment, which is itself tightly linked to mitochondrial activity, mitochondria being the main cellular producer of reactive oxygen species. The master regulator of mitochondrial biogenesis in yeast (i.e. the transcriptional co-activator Hap4p) is positively regulated by the cellular glutathione redox state. Using a strain that is unable to modulate its glutathione redox state (Δglr1), we pinpoint a positive feedback loop between this redox state and the control of mitochondrial biogenesis. This is the first time that control of mitochondrial biogenesis through glutathione redox state has been shown. PMID:22396541

  4. Imaging cytoplasmic cAMP in mouse brainstem neurons

    PubMed Central

    Mironov, SL; Skorova, E; Taschenberger, G; Hartelt, N; Nikolaev, VO; Lohse, MJ; Kügler, S

    2009-01-01

    Background cAMP is an ubiquitous second messenger mediating various neuronal functions, often as a consequence of increased intracellular Ca2+ levels. While imaging of calcium is commonly used in neuroscience applications, probing for cAMP levels has not yet been performed in living vertebrate neuronal tissue before. Results Using a strictly neuron-restricted promoter we virally transduced neurons in the organotypic brainstem slices which contained pre-Bötzinger complex, constituting the rhythm-generating part of the respiratory network. Fluorescent cAMP sensor Epac1-camps was expressed both in neuronal cell bodies and neurites, allowing us to measure intracellular distribution of cAMP, its absolute levels and time-dependent changes in response to physiological stimuli. We recorded [cAMP]i changes in the micromolar range after modulation of adenylate cyclase, inhibition of phosphodiesterase and activation of G-protein-coupled metabotropic receptors. [cAMP]i levels increased after membrane depolarisation and release of Ca2+ from internal stores. The effects developed slowly and reached their maximum after transient [Ca2+]i elevations subsided. Ca2+-dependent [cAMP]i transients were suppressed after blockade of adenylate cyclase with 0.1 mM adenylate cyclase inhibitor 2'5'-dideoxyadenosine and potentiated after inhibiting phosphodiesterase with isobutylmethylxanthine and rolipram. During paired stimulations, the second depolarisation and Ca2+ release evoked bigger cAMP responses. These effects were abolished after inhibition of protein kinase A with H-89 pointing to the important role of phosphorylation of calcium channels in the potentiation of [cAMP]i transients. Conclusion We constructed and characterized a neuron-specific cAMP probe based on Epac1-camps. Using viral gene transfer we showed its efficient expression in organotypic brainstem preparations. Strong fluorescence, resistance to photobleaching and possibility of direct estimation of [cAMP] levels using

  5. Regulation of cyclic AMP metabolism by prostaglandins in rabbit cortical collecting tubule cells

    SciTech Connect

    Sonnenburg, W.K.

    1987-01-01

    In the rabbit cortical collecting tubule (RCCT), prostaglandin E/sub 1/ (PGE/sub 1/) and prostaglandin E/sub 2/ (PGE/sub 2/) at 1 nM inhibit arginine-vasopressin (AVP)-induced water reabsorption, while 100 nM PGE/sub 1/ and PGE/sub 2/ alone stimulate water reabsorption. Reported here are studies designed to investigate the molecular basis for the biphasic physiological action of PGE/sub 1/ and PGE/sub 2/ in the collecting duct. In freshly isolated RCCT cells, PGE/sub 1/, PGE/sub 2/, and 16,16-dimethyl-PGE/sub 2/ (DM-PGE/sub 2/) stimulated cAMP synthesis at concentrations ranging from 0.1 to 10 M. Other prostaglandins including the synthetic PGE/sub 2/ analogue, sulprostone, failed to stimulate cAMP synthesis. Moreover, sulprostone did not antagonize PGE/sub 2/-stimulated cAMP formation. In contrast, PGE/sub 2/ and sulprostone at concentrations ranging from 1 to 100 nM, inhibited AVP-induced cAMP accumulation in freshly isolated RCCT cells. PGE/sub 2/, PGE/sub 1/, DM-PGE/sub 2/ and sulprostone at 100 nM were equally effective in inhibiting AVP-induced cAMP formation. Moreover sulprostone inhibited AVP-stimulated adenylate cyclase activity. These results suggest that PGE derivatives mediate either inhibition or activation of adenylate cyclase by stimulating different PGE receptors. To further test this concept, PGE/sub 2/ binding to freshly isolated RCCT cell membranes was characterized. Two different classes of PGE/sub 2/ binding were detected. //sup 3/H/PGE/sub 2/ binding to the high affinity class of sites was increased by the GTP-analogue, GTP S, while pertussis toxin pretreatment blocked the stimulatory action. In contrast, //sup 3/H/ PGE/sub 2/ binding to the low affinity class of sites was decreased by GTP S; this inhibitory effect was not blocked by pertussis toxin pretreatment.

  6. FRET measurements of intracellular cAMP concentrations and cAMP analog permeability in intact cells.

    PubMed

    Börner, Sebastian; Schwede, Frank; Schlipp, Angela; Berisha, Filip; Calebiro, Davide; Lohse, Martin J; Nikolaev, Viacheslav O

    2011-04-01

    Real-time measurements of second messengers in living cells, such as cAMP, are usually performed by ratiometric fluorescence resonance energy transfer (FRET) imaging. However, correct calibration of FRET ratios, accurate calculations of absolute cAMP levels and actual permeabilities of different cAMP analogs have been challenging. Here we present a protocol that allows precise measurements of cAMP concentrations and kinetics by expressing FRET-based cAMP sensors in cells and modulating them with an inhibitor of adenylyl cyclase activity and a cell-permeable cAMP analog that fully inhibits and activates the sensors, respectively. Using this protocol, we observed different basal cAMP levels in primary mouse cardiomyocytes, thyroid cells and in 293A cells. The protocol can be generally applied for calibration of second messenger or metabolite concentrations measured by FRET, and for studying kinetics and pharmacological properties of their membrane-permeable analogs. The complete procedure, including cell preparation and FRET measurements, takes 3-6 d. PMID:21412271

  7. ITER helium ash accumulation

    SciTech Connect

    Hogan, J.T.; Hillis, D.L.; Galambos, J.; Uckan, N.A. ); Dippel, K.H.; Finken, K.H. . Inst. fuer Plasmaphysik); Hulse, R.A.; Budny, R.V. . Plasma Physics Lab.)

    1990-01-01

    Many studies have shown the importance of the ratio {upsilon}{sub He}/{upsilon}{sub E} in determining the level of He ash accumulation in future reactor systems. Results of the first tokamak He removal experiments have been analysed, and a first estimate of the ratio {upsilon}{sub He}/{upsilon}{sub E} to be expected for future reactor systems has been made. The experiments were carried out for neutral beam heated plasmas in the TEXTOR tokamak, at KFA/Julich. Helium was injected both as a short puff and continuously, and subsequently extracted with the Advanced Limiter Test-II pump limiter. The rate at which the He density decays has been determined with absolutely calibrated charge exchange spectroscopy, and compared with theoretical models, using the Multiple Impurity Species Transport (MIST) code. An analysis of energy confinement has been made with PPPL TRANSP code, to distinguish beam from thermal confinement, especially for low density cases. The ALT-II pump limiter system is found to exhaust the He with maximum exhaust efficiency (8 pumps) of {approximately}8%. We find 1<{upsilon}{sub He}/{upsilon}{sub E}<3.3 for the database of cases analysed to date. Analysis with the ITER TETRA systems code shows that these values would be adequate to achieve the required He concentration with the present ITER divertor He extraction system.

  8. cAMP signaling in neurons: patterns of neuronal expression and intracellular localization for a novel protein, AKAP 150, that anchors the regulatory subunit of cAMP-dependent protein kinase II beta.

    PubMed Central

    Glantz, S B; Amat, J A; Rubin, C S

    1992-01-01

    In mammalian brain, physiological signals carried by cyclic AMP (cAMP) seem to be targeted to effector sites via the tethering of cAMP-dependent protein kinase II beta (PKAII beta) to intracellular structures. Recently characterized A kinase anchor proteins (AKAPs) are probable mediators of the sequestration of PKAII beta because they contain a high-affinity binding site for the regulatory subunit (RII beta) of the kinase and a distinct intracellular targeting domain. To establish a cellular basis for this targeting mechanism, we have employed immunocytochemistry to 1) identify the types of neurons that are enriched in AKAPs, 2) determine the primary intracellular location of the anchor protein, and 3) demonstrate that an AKAP and RII beta are coenriched and colocalized in neurons that utilize the adenylate cyclase-cyclic AMP-dependent protein kinase (PKA) signaling pathway. Antibodies directed against rat brain AKAP 150 were used to elucidate the regional, cellular and intracellular distribution of a prototypic anchor protein in the CNS. AKAP 150 is abundant in Purkinje cells and in neurons of the olfactory bulb, basal ganglia, cerebral cortex, and other forebrain regions. In contrast, little AKAP 150 is detected in neurons of the thalamus, hypothalamus, midbrain, and hindbrain. A high proportion of total AKAP 150 is concentrated in primary branches of dendrites, where it is associated with microtubules. We also discovered that the patterns of accumulation and localization of RII beta (and PKAII beta) in brain are similar to those of AKAP 150. The results suggest that bifunctional AKAP 150 tethers PKAII beta to the dendritic cytoskeleton, thereby creating a discrete target site for the reception and propagation of signals carried by cAMP. Images PMID:1333841

  9. cAMP Regulation of the lactose operon.

    PubMed

    Szeberenyi, Jozsef

    2004-05-01

    Terms to be familiar with before you start to solve the test: lactose operon, adenylate cyclase, cAMP, catabolite activator protein (CAP), expression plasmid, lac operator, lac repressor, lactose, glucose, promoter, cis- and trans-acting factors. PMID:21706723

  10. Cyclic di-AMP: another second messenger enters the fray.

    PubMed

    Corrigan, Rebecca M; Gründling, Angelika

    2013-08-01

    Nucleotide signalling molecules contribute to the regulation of cellular pathways in all forms of life. In recent years, the discovery of new signalling molecules in bacteria and archaea, as well as the elucidation of the pathways they regulate, has brought insights into signalling mechanisms not only in bacterial and archaeal cells but also in eukaryotic host cells. Here, we provide an overview of the synthesis and regulation of cyclic di-AMP (c-di-AMP), one of the latest cyclic nucleotide second messengers to be discovered in bacteria. We also discuss the currently known receptor proteins and pathways that are directly or indirectly controlled by c-di-AMP, the domain structure of the enzymes involved in its production and degradation, and the recognition of c-di-AMP by the eukaryotic host. PMID:23812326

  11. Amped Up! - Volume 1, No. 3, May/June 2015

    SciTech Connect

    2015-05-01

    Welcome to the latest issue of our bimonthly newsletter, Amped Up!, highlighting the initiatives, events and technologies in the Office of Energy Efficiency and Renewable Energy that influence change.

  12. Why Ampère did not discover electromagnetic induction

    NASA Astrophysics Data System (ADS)

    Williams, L. Pearce

    1986-04-01

    In 1832, after Michael Faraday had announced his discovery of electromagnetic induction, Andre-Marie Ampère claimed that he had actually discovered the induction of one current by another in 1822. In fact, he had, but did not really publish the fact at that time. This article explores the reasons for Ampère's failure to lay claim to a discovery that would have guaranteed him scientific immortality.

  13. Airborne Multisensor Pod System (AMPS) data management overview

    SciTech Connect

    Wiberg, J.D.; Blough, D.K.; Daugherty, W.R.; Hucks, J.A.; Gerhardstein, L.H.; Meitzler, W.D.; Melton, R.B.; Shoemaker, S.V.

    1994-09-01

    An overview of the Data Management Plan for the Airborne Multisensor Pod System (AMPS) pro-grain is provided in this document. The Pacific Northwest Laboratory (PNL) has been assigned the responsibility of data management for the program, which includes defining procedures for data management and data quality assessment. Data management is defined as the process of planning, acquiring, organizing, qualifying and disseminating data. The AMPS program was established by the U.S. Department of Energy (DOE), Office of Arms Control and Non-Proliferation (DOE/AN) and is integrated into the overall DOE AN-10.1 technology development program. Sensors used for collecting the data were developed under the on-site inspection, effluence analysis, and standoff sensor program, the AMPS program interacts with other technology programs of DOE/NN-20. This research will be conducted by both government and private industry. AMPS is a research and development program, and it is not intended for operational deployment, although the sensors and techniques developed could be used in follow-on operational systems. For a complete description of the AMPS program, see {open_quotes}Airborne Multisensor Pod System (AMPS) Program Plan{close_quotes}. The primary purpose of the AMPS is to collect high-quality multisensor data to be used in data fusion research to reduce interpretation problems associated with data overload and to derive better information than can be derived from any single sensor. To collect the data for the program, three wing-mounted pods containing instruments with sensors for collecting data will be flight certified on a U.S. Navy RP-3A aircraft. Secondary objectives of the AMPS program are sensor development and technology demonstration. Pod system integrators and instrument developers will be interested in the performance of their deployed sensors and their supporting data acquisition equipment.

  14. Allostery and conformational dynamics in cAMP-binding acyltransferases.

    PubMed

    Podobnik, Marjetka; Siddiqui, Nida; Rebolj, Katja; Nambi, Subhalaxmi; Merzel, Franci; Visweswariah, Sandhya S

    2014-06-01

    Mycobacteria harbor unique proteins that regulate protein lysine acylation in a cAMP-regulated manner. These lysine acyltransferases from Mycobacterium smegmatis (KATms) and Mycobacterium tuberculosis (KATmt) show distinctive biochemical properties in terms of cAMP binding affinity to the N-terminal cyclic nucleotide binding domain and allosteric activation of the C-terminal acyltransferase domain. Here we provide evidence for structural features in KATms that account for high affinity cAMP binding and elevated acyltransferase activity in the absence of cAMP. Structure-guided mutational analysis converted KATms from a cAMP-regulated to a cAMP-dependent acyltransferase and identified a unique asparagine residue in the acyltransferase domain of KATms that assists in the enzymatic reaction in the absence of a highly conserved glutamate residue seen in Gcn5-related N-acetyltransferase-like acyltransferases. Thus, we have identified mechanisms by which properties of similar proteins have diverged in two species of mycobacteria by modifications in amino acid sequence, which can dramatically alter the abundance of conformational states adopted by a protein. PMID:24748621

  15. Regulation of cAMP by Phosphodiesterases in Erythrocytes

    PubMed Central

    Adderley, Shaquria P.; Sprague, Randy S.; Stephenson, Alan H.; Hanson, Madelyn S.

    2010-01-01

    The erythrocyte, a cell responsible for carrying and delivering oxygen in the body, has often been regarded as simply a vehicle for the circulation of hemoglobin. However, it has become evident that this cell also participates in the regulation of vascular caliber in the microcirculation via release of the potent vasodilator, adenosine triphosphate (ATP). The regulated release of ATP from erythrocytes occurs via a defined signaling pathway and requires increases in cyclic 3’ 5’ adenosine monophosphate (cAMP). It is well recognized that cAMP is a critical second messenger in diverse signaling pathways. In all cells increases in cAMP are localized and regulated by the activity of phosphodiesterases (PDEs). In erythrocytes activation of either β adrenergic receptors (β 2AR) or the prostacyclin receptor (IPR) results in increases in cAMP and ATP release. Receptor-mediated increases in cAMP are tightly regulated by distinct PDEs associated with each signaling pathway as shown by the finding that selective inhibitors of the PDEs localized to each pathway potentiate both increases in cAMP and ATP release. Here we review the profile of PDEs identified in erythrocytes, their association with specific signaling pathways and their role in the regulation of ATP release from these cells. Understanding the contribution of PDEs to the control of ATP release from erythrocytes identifies this cell as a potential target for the development of drugs for the treatment of vascular disease. PMID:20631411

  16. Dibutyryl cyclic AMP reduces the radiosensitivity of cultured endothelial cells

    SciTech Connect

    Ward, W.; Molteni, A.; Ts'ao, C.; Hinz, J. )

    1991-03-11

    The purpose of this study was to determine whether dibutyryl cyclic AMP modifies the radiosensitivity of confluent monolayers of bovine aortic endothelial cells (BAEC). Three indices of BAEC function were monitored from 4-24 hrs after exposure to 1-10 Gy of {sup 60}Co gamma rays: the release of {sup 51}Cr from prelabeled cells, and release of lactate dehydrogenase (LDH) and plasminogen activator (PLA) into the culture medium. There was a time- and radiation dose-dependent increase in {sup 51}Cr, LDH and PLA release from the BAEC, detectable within 12 hrs after 5 Gy or higher, and by 24 hrs after 1 Gy or higher. This increased release was accompanied by a radiation dose-dependent decrease in {sup 51}Cr and LDH, and an increase in PLA activity in the lysate of cells adherent to the monolayer at 24 hrs. The continuous presence of cAMP from 1 hr before to 24 hrs after irradiation reduced all of these radiation reactions, although mM concentrations of cAMP were required for significant sparing. The presence of cAMP from 1 hr before to 10 min after irradiation had no effect on BAEC sensitivity, whereas cAMP added 10 min after irradiation was fully as effective as continuously administered drug. Thus, cultured BAEC exhibit membrane dysfunction within 24 hrs after clinically relevant radiation doses, and this dysfunction is ameliorated by cAMP present after irradiation.

  17. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    PubMed Central

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.; Sillito, Rowland R.; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J. Douglas; Porteous, David J.; Patton, E. Elizabeth

    2015-01-01

    Summary Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  18. Activation of AMP-kinase by Policosanol Requires Peroxisomal Metabolism

    PubMed Central

    Banerjee, Subhashis; Ghoshal, Sarbani

    2011-01-01

    Policosanol, a well-defined mixture of very long chain primary alcohols that is available as a nutraceutical product, has been reported to lower blood cholesterol levels. The present studies demonstrate that policosanol promotes the phosphorylation of AMP-kinase and HMG-CoA reductase in hepatoma cells and in mouse liver after intragastric administration, providing a possible means by which policosanol might lower blood cholesterol levels. Treatment of hepatoma cells with policosanol produced a 2.5-fold or greater increase in the phosphorylation of AMP-kinase and HMG-CoA reductase, and increased the phosphorylation of Ca++/calmodulin-dependent kinase kinase (CaMKK), an upstream AMP-kinase kinase. Intra-gastric administration of policosanol to mice similarly increased the phosphorylation of hepatic HMG-CoA reductase and AMP-kinase by greater than 2-fold. siRNA-mediated suppression of fatty aldehyde dehydrogenase, fatty acyl-CoA synthetase 4, and acyl-CoA acetyltransferase expression in hepatoma cells prevented the phosphorylation of AMP-kinase and HMG-CoA reductase by policosanol, indicating that metabolism of these very long chain alcohols to activated fatty acids is necessary for the suppression of cholesterol synthesis, presumably by increasing cellular AMP levels. Subsequent peroxisomal β-oxidation probably augments this effect. PMID:21359855

  19. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 2: AMPS payload to spacelab ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The AMPS to Spacelab Interface Control Document which is to be used as a guide for format and information content in generating specific AMPS Mission ICDs is presented. This document is meant to supplement the Spacelab Payload Accommodations Handbook in that it only defines interfaces which are not discussed in the handbook to the level required for design purposes. The AMPS Top Level Requirements Tree, illustrates this ICD by a shaded area and its relationship to the other AMPS technical documents. Other interface documents shown are the Level II, AMPS to Space Shuttle Vehicle ICD and the Level III, AMPS to Instruments ICD.

  20. Osthole enhances glucose uptake through activation of AMP-activated protein kinase in skeletal muscle cells.

    PubMed

    Lee, Wei-Hwa; Lin, Ren-Jye; Lin, Shyr-Yi; Chen, Yu-Chien; Lin, Hsiu-Ming; Liang, Yu-Chih

    2011-12-28

    AMP-activated protein kinase (AMPK) is an energy sensor that regulates cellular metabolism. Activation of AMPK in skeletal muscles, the liver, and adipose tissues results in a favorable metabolic milieu for preventing and treating type 2 diabetes, i.e., decreased levels of circulating glucose, plasma lipids, and ectopic fat accumulation and enhanced insulin sensitivity. Osthole was extracted from a Chinese herbal medicine, and we found that it had glucose lowering activity in our previous study. However, the detailed glucose lowering mechanisms of osthole are still unclear. In this study, we used skeletal muscle cells to examine the underlying molecular mechanisms of osthole's glucose lowering activity. A Western blot analysis revealed that osthole significantly induced phosphorylation of AMPK and acetyl-CoA carboxylase (ACC). Next, we found that osthole significantly increased the level of translocation of glucose transporter 4 (GLUT4) to plasma membranes and glucose uptake in a dose-dependent manner. Osthole-induced glucose uptake was reversed by treatment with Compound C, an AMPK inhibitor, suggesting that osthole-induced glucose uptake was mediated in an AMPK-dependent manner. The increase in the AMP:ATP ratio was involved in osthole's activation of AMPK. Finally, we found that osthole counteracted hyperglycemia in mice with streptozotocin-induced diabetes. These results suggest that the increase in the AMP:ATP ratio by osthole triggered activation of the AMPK signaling pathway and led to increases in plasma membrane GLUT4 content and glucose uptake level. Therefore, osthole might have potential as an antidiabetic agent for treating diabetes. PMID:22098542

  1. Aclidinium bromide combined with formoterol inhibits remodeling parameters in lung epithelial cells through cAMP.

    PubMed

    Lambers, Christopher; Costa, Luigi; Ying, Qi; Zhong, Jun; Lardinois, Didier; Dekan, Gerhard; Schuller, Elisabeth; Roth, Michael

    2015-12-01

    Combined muscarinic receptor antagonists and long acting β2-agonists improve symptom control in chronic obstructive pulmonary disease (COPD) significantly. In clinical studies aclidinium bromide achieved better beneficial effects than other bronchodilators; however, the underlying molecular mechanisms are unknown. This study assessed the effect of aclidinium bromide combined with formoterol on COPD lung (n=20) and non-COPD lung (n=10) derived epithelial cells stimulated with TGF-β1+carbachol on: (i) the generation of mesenchymal cells in relation to epithelial cells, (II) extracellular matrix (ECM) deposition, and (iii) the interaction of ECM on the generation of epithelial and mesenchymal cells. TGF-β1+carbachol enhanced the generation of mesenchymal cells, which was significantly reduced by aclidinium bromide or formoterol. The effect of combined drugs was additive. Inhibition of p38 MAP kinase and Smad by specific inhibitors or aclidinium bromide reduced the generation of mesenchymal cells. In mesenchymal cells, TGF-β1+carbachol induced the deposition of collagen-I and fibronectin which was prevented by both drugs dose-dependently. Formoterol alone reduced collagen-I deposition via cAMP, this however, was overruled by TGF-β1+carbachol and rescued by aclidinium bromide. Inhibition of fibronectin was cAMP independent, but involved p38 MAP kinase and Smad. Seeding epithelial cells on ECM collagen-I and fibronectin induced mesenchymal cell generation, which was reduced by aclidinium bromide and formoterol. Our results suggest that the beneficial effect of aclidinium bromide and formoterol involves cAMP affecting both, the accumulation of mesenchymal cells and ECM remodeling, which may explain the beneficial effect of the drugs on lung function in COPD. PMID:26546746

  2. Insulin alters cAMP-activated lipolysis but not cAMP-inhibited glycogen synthase in permeabilized adipocytes

    SciTech Connect

    Mooney, R.A.; Wisniewski, J.L.

    1986-05-01

    Lipolysis and, to a lesser extent, glycogen synthase activity are regulated in adipocytes by cellular cAMP and counter-regulated by insulin. These activities were measured in situ in digitonin (20 ..mu..g/ml) permeabilized rat adipocytes. Incorporation of /sup 3/H UDP-glucose into endogenous glycogen in the presence of KF, EDTA and 10mM glucose-6-phosphate was the basis of the G.S. assay. Cellular GS activity determined by this technique was 1.4 +/- 0.2 fold greater than that of matched homogenates. Insulin treatment of intact cells prior to permeabilization increased GS activity ratio (-/+ G-6-P) 2.5 fold when subsequently measured by the in situ assay. Following digitonin permeabilization, addition of cAMP to the suspension medium increased lipolysis 7 fold and decreased GS activity ratio to 0.38 +/- 0.01 from a basal value of 0.44 +/- 0.06. ATP had a negligible effect on lipolysis but decreased GS to 0.16 +/- 0.04. ATP plus cAMP was only slightly more effective on GS than ATP alone. Insulin at 10/sup -9/M inhibited cAMP-dependent lipolysis by 27% but had no effect on the cAMP- or ATP-dependent decrease in GS. These results suggest that insulin's counter-regulatory mechanisms on these two cAMP-dependent processes may be different.

  3. Pseudohypoparathyroidism and Gsα-cAMP-linked disorders: current view and open issues.

    PubMed

    Mantovani, Giovanna; Spada, Anna; Elli, Francesca Marta

    2016-06-01

    Pseudohypoparathyroidism exemplifies an unusual form of hormone resistance as the underlying molecular defect is a partial deficiency of the α subunit of the stimulatory G protein (Gsα), a key regulator of the cAMP signalling pathway, rather than of the parathyroid hormone (PTH) receptor itself. Despite the first description of this disorder dating back to 1942, later findings have unveiled complex epigenetic alterations in addition to classic mutations in GNAS underpining the molecular basis of the main subtypes of pseudohypoparathyroidism. Moreover, mutations in PRKAR1A and PDE4D, which encode proteins crucial for Gsα-cAMP-mediated signalling, have been found in patients with acrodysostosis. As acrodysostosis, a disease characterized by skeletal malformations and endocrine disturbances, shares clinical and molecular characteristics with pseudohypoparathyroidism, making a differential diagnosis and providing genetic counselling to patients and families is a challenge for endocrinologists. Accumulating data on the genetic and clinical aspects of this group of diseases highlight the limitation of the current classification system and prompt the need for a new definition as well as for new diagnostic and/or therapeutic algorithms. This Review discusses both the current understanding and future challenges for the clinical and molecular diagnosis, classification and treatment of pseudohypoparathyroidism. PMID:27109785

  4. PKA and PDE4D3 anchoring to AKAP9 provides distinct regulation of cAMP signals at the centrosome

    PubMed Central

    Terrin, Anna; Monterisi, Stefania; Stangherlin, Alessandra; Zoccarato, Anna; Koschinski, Andreas; Surdo, Nicoletta C.; Mongillo, Marco; Sawa, Akira; Jordanides, Niove E.; Mountford, Joanne C.

    2012-01-01

    Previous work has shown that the protein kinase A (PKA)–regulated phosphodiesterase (PDE) 4D3 binds to A kinase–anchoring proteins (AKAPs). One such protein, AKAP9, localizes to the centrosome. In this paper, we investigate whether a PKA–PDE4D3–AKAP9 complex can generate spatial compartmentalization of cyclic adenosine monophosphate (cAMP) signaling at the centrosome. Real-time imaging of fluorescence resonance energy transfer reporters shows that centrosomal PDE4D3 modulated a dynamic microdomain within which cAMP concentration selectively changed over the cell cycle. AKAP9-anchored, centrosomal PKA showed a reduced activation threshold as a consequence of increased autophosphorylation of its regulatory subunit at S114. Finally, disruption of the centrosomal cAMP microdomain by local displacement of PDE4D3 impaired cell cycle progression as a result of accumulation of cells in prophase. Our findings describe a novel mechanism of PKA activity regulation that relies on binding to AKAPs and consequent modulation of the enzyme activation threshold rather than on overall changes in cAMP levels. Further, we provide for the first time direct evidence that control of cell cycle progression relies on unique regulation of centrosomal cAMP/PKA signals. PMID:22908311

  5. Noise Reduction by Signal Accumulation

    ERIC Educational Resources Information Center

    Kraftmakher, Yaakov

    2006-01-01

    The aim of this paper is to show how the noise reduction by signal accumulation can be accomplished with a data acquisition system. This topic can be used for student projects. In many cases, the noise reduction is an unavoidable part of experimentation. Several techniques are known for this purpose, and among them the signal accumulation is the…

  6. Regulation of proximal tubule vacuolar H+-ATPase by PKA and AMP-activated protein kinase

    PubMed Central

    Al-bataineh, Mohammad M.; Gong, Fan; Marciszyn, Allison L.; Myerburg, Michael M.

    2014-01-01

    The vacuolar H+-ATPase (V-ATPase) mediates ATP-driven H+ transport across membranes. This pump is present at the apical membrane of kidney proximal tubule cells and intercalated cells. Defects in the V-ATPase and in proximal tubule function can cause renal tubular acidosis. We examined the role of protein kinase A (PKA) and AMP-activated protein kinase (AMPK) in the regulation of the V-ATPase in the proximal tubule as these two kinases coregulate the V-ATPase in the collecting duct. As the proximal tubule V-ATPases have different subunit compositions from other nephron segments, we postulated that V-ATPase regulation in the proximal tubule could differ from other kidney tubule segments. Immunofluorescence labeling of rat ex vivo kidney slices revealed that the V-ATPase was present in the proximal tubule both at the apical pole, colocalizing with the brush-border marker wheat germ agglutinin, and in the cytosol when slices were incubated in buffer alone. When slices were incubated with a cAMP analog and a phosphodiesterase inhibitor, the V-ATPase accumulated at the apical pole of S3 segment cells. These PKA activators also increased V-ATPase apical membrane expression as well as the rate of V-ATPase-dependent extracellular acidification in S3 cell monolayers relative to untreated cells. However, the AMPK activator AICAR decreased PKA-induced V-ATPase apical accumulation in proximal tubules of kidney slices and decreased V-ATPase activity in S3 cell monolayers. Our results suggest that in proximal tubule the V-ATPase subcellular localization and activity are acutely coregulated via PKA downstream of hormonal signals and via AMPK downstream of metabolic stress. PMID:24553431

  7. [cAMP cascade in regulation of protein glycosylation].

    PubMed

    Surman, Magdalena; Janik, Marcelina

    2014-01-01

    O- and N-glycosylation are the most common and complex of the post-translational modifications. Both are enzymatic processes and it was suggested that both could be regulated by cAMP cascade at the early stages. N-glycosylation starts with the formation of lipid-linked oligosaccharides and this process is catalysed by crucial glycosyltransferase - dolichol phosphate mannose synthase. The results of several studies strongly suggest that the cAMP acting through a cAMP-dependent protein kinase A-mediated protein phosphorylation/dephosphorylation cycle may modulate activation of this enzyme. It was shown that cAMP can also up regulate another enzyme involved in phosphodolichole synthesis - cis-prenyltransferase. The mechanism acting here is the alteration of the rate of its gene expression. cAMP cascade is also involved in regulation of O-glycosylation since phosphorylation of human glutamine:fructose-6-phosphate amidotransferase results in depletion of O-GlcNAc structure formation. These observation suggested an important role of GPCRs and their ligand in regulation of N- and O-glycan synthesis. PMID:26263760

  8. Cyclic AMP Regulates Social Behavior in African Trypanosomes

    PubMed Central

    Oberholzer, Michael; Saada, Edwin A.

    2015-01-01

    ABSTRACT The protozoan parasite Trypanosoma brucei engages in surface-induced social behavior, termed social motility, characterized by single cells assembling into multicellular groups that coordinate their movements in response to extracellular signals. Social motility requires sensing and responding to extracellular signals, but the underlying mechanisms are unknown. Here we report that T. brucei social motility depends on cyclic AMP (cAMP) signaling systems in the parasite’s flagellum (synonymous with cilium). Pharmacological inhibition of cAMP-specific phosphodiesterase (PDE) completely blocks social motility without impacting the viability or motility of individual cells. Using a fluorescence resonance energy transfer (FRET)-based sensor to monitor cAMP dynamics in live cells, we demonstrate that this block in social motility correlates with an increase in intracellular cAMP levels. RNA interference (RNAi) knockdown of the flagellar PDEB1 phenocopies pharmacological PDE inhibition, demonstrating that PDEB1 is required for social motility. Using parasites expressing distinct fluorescent proteins to monitor individuals in a genetically heterogeneous community, we found that the social motility defect of PDEB1 knockdowns is complemented by wild-type parasites in trans. Therefore, PDEB1 knockdown cells are competent for social motility but appear to lack a necessary factor that can be provided by wild-type cells. The combined data demonstrate that the role of cyclic nucleotides in regulating microbial social behavior extends to African trypanosomes and provide an example of transcomplementation in parasitic protozoa. PMID:25922395

  9. Profound Asymmetry in the Structure of the cAMP-free cAMP Receptor Protein (CRP) from Mycobacterium tuberculosis

    SciTech Connect

    Gallagher, D.; Smith, N; Kim, S; Robinson, H; Reddy, P

    2009-01-01

    The cyclic AMP receptor protein (CRP, also called catabolite gene activator protein or CAP) plays a key role in metabolic regulation in bacteria and has become a widely studied model allosteric transcription factor. On binding its effector cAMP in the N-terminal domain, CRP undergoes a structural transition to a conformation capable of specific DNA binding in the C-terminal domain and transcription initiation. The crystal structures of Escherichia coli CRP (EcCRP) in the cAMP-bound state, both with and without DNA, are known, although its structure in the off state (cAMP-free, apoCRP) remains unknown. We describe the crystal structure at 2.0A resolution of the cAMP-free CRP homodimer from Mycobacterium tuberculosis H37Rv (MtbCRP), whose sequence is 30% identical with EcCRP, as the first reported structure of an off-state CRP. The overall structure is similar to that seen for the cAMP-bound EcCRP, but the apo MtbCRP homodimer displays a unique level of asymmetry, with a root mean square deviation of 3.5A between all C? positions in the two subunits. Unlike structures of on-state EcCRP and other homologs in which the C-domains are asymmetrically positioned but possess the same internal conformation, the two C-domains of apo MtbCRP differ both in hinge structure and in internal arrangement, with numerous residues that have completely different local environments and hydrogen bond interactions, especially in the hinge and DNA-binding regions. Comparison of the structures of apo MtbCRP and DNA-bound EcCRP shows how DNA binding would be inhibited in the absence of cAMP and supports a mechanism involving functional asymmetry in apoCRP.

  10. Gypsum accumulation on carbonate stone

    USGS Publications Warehouse

    McGee, E.S.; Mossotti, V.G.

    1992-01-01

    The accumulation of gypsum on carbonate stone has been investigated through exposure of fresh samples of limestone and marble at monitored sites, through examination of alteration crusts from old buildings and through laboratory experiments. Several factors contribute to gypsum accumulation on carbonate stone. Marble or limestone that is sheltered from direct washing by rain in an urban environment with elevated pollution levels is likely to accumulate a gypsum crust. Crust development may be enhanced if the stone is porous or has an irregular surface area. Gypsum crusts are a surficial alteration feature; gypsum crystals form at the pore opening-air interface, where evaporation is greatest.

  11. Intracellular tortuosity underlies slow cAMP diffusion in adult ventricular myocytes

    PubMed Central

    Richards, Mark; Lomas, Oliver; Jalink, Kees; Ford, Kerrie L.; Vaughan-Jones, Richard D.; Lefkimmiatis, Konstantinos; Swietach, Pawel

    2016-01-01

    Aims 3′,5′-Cyclic adenosine monophosphate (cAMP) signals in the heart are often confined to concentration microdomains shaped by cAMP diffusion and enzymatic degradation. While the importance of phosphodiesterases (degradative enzymes) in sculpting cAMP microdomains is well established in cardiomyocytes, less is known about cAMP diffusivity (DcAMP) and factors affecting it. Many earlier studies have reported fast diffusivity, which argues against sharply defined microdomains. Methods and results [cAMP] dynamics in the cytoplasm of adult rat ventricular myocytes were imaged using a fourth generation genetically encoded FRET-based sensor. The [cAMP]-response to the addition and removal of isoproterenol (β-adrenoceptor agonist) quantified the rates of cAMP synthesis and degradation. To obtain a read out of DcAMP, a stable [cAMP] gradient was generated using a microfluidic device which delivered agonist to one half of the myocyte only. After accounting for phosphodiesterase activity, DcAMP was calculated to be 32 µm2/s; an order of magnitude lower than in water. Diffusivity was independent of the amount of cAMP produced. Saturating cAMP-binding sites with the analogue 6-Bnz-cAMP did not accelerate DcAMP, arguing against a role of buffering in restricting cAMP mobility. cAMP diffused at a comparable rate to chemically unrelated but similar sized molecules, arguing for a common physical cause of restricted diffusivity. Lower mitochondrial density and order in neonatal cardiac myocytes allowed for faster diffusion, demonstrating the importance of mitochondria as physical barriers to cAMP mobility. Conclusion In adult cardiac myocytes, tortuosity due to physical barriers, notably mitochondria, restricts cAMP diffusion to levels that are more compatible with microdomain signalling. PMID:27089919

  12. Serotonin induces the migration of PC12 cells via the serotonin receptor 6/cAMP/ERK pathway

    PubMed Central

    KOIZUMI, KEITA; NAKAJIMA, HIDEO

    2014-01-01

    Serotonin (5-HT) functions as a chemoattractant that modulates neural migration during prenatal and early postnatal development. However, its molecular mechanism remains to be elucidated. The effect of 5-HT on neural cell migration was examined using PC12 neuron-like cell line. Transwell migration assay was used to determine the effect of 5-HT on PC12 cell migration. The results demonstrated that 5-HT and nerve growth factor (NGF) induced PC12 cell migration in a dose-dependent manner. Additionally, 5-HT receptor antagonists suggest that 5-HT-induced migration was mediated by serotonin receptor 6 (5-HT6), a Gs-protein coupled receptor that elevates the intercellular cAMP level. By contrast, antagonists of serotonin receptor 3 (5-HT3) did not show any effects on PC12 cell migration. Clozapine, an inhibitor of cAMP accumulation mediated by 5-HT6, significantly reduced the effect of 5-HT on the PC12 cell migration. An inhibitor of extracellular signal-regulated kinase (ERK) also suppressed migration. These results suggest that 5-HT induces PC12 cell migration by activating cAMP/ERK signaling pathways, which is mediated by 5-HT6 receptor. PMID:24649064

  13. Cranberry Product Decreases Fat Accumulation in Caenorhabditis elegans.

    PubMed

    Sun, Quancai; Yue, Yiren; Shen, Peiyi; Yang, Jeremy J; Park, Yeonhwa

    2016-04-01

    Cranberry phenolic compounds have been linked to many health benefits. A recent report suggested that cranberry bioactives inhibit adipogenesis in 3T3-L1 adipocytes. Thus, we investigated the effects and mechanisms of the cranberry product (CP) on lipid metabolism using the Caenorhabditis elegans (C. elegans) model. CP (0.016% and 0.08%) dose-dependently reduced overall fat accumulation in C. elegans (N2, wild type) by 43% and 74%, respectively, without affecting its pumping rates or locomotive activities. CP decreased fat accumulation in aak-2 (an ortholog of AMP-activated kinase α) and tub-1 (an ortholog of TUBBY) mutants significantly, but only minimal effects were observed in sbp-1 (an ortholog of sterol response element-binding protein-1) and nhr-49 (an ortholog of peroxisome proliferator-activated receptor-α) mutant strains. We further confirmed that CP downregulated sbp-1, cebp, and hosl-1 (an ortholog of hormone-sensitive lipase homolog) expression, while increasing the expression of nhr-49 in wild-type C. elegans. These results suggest that CP could effectively reduce fat accumulation in C. elegans dependent on sbp-1, cebp, and nhr-49, but not aak-2 and tub-1. PMID:26991055

  14. cAMP Sensor EPAC Proteins and Energy Homeostasis

    PubMed Central

    Almahariq, Muayad; Mei, Fang C.; Cheng, Xiaodong

    2013-01-01

    The pleotropic second messenger cAMP plays a critical role in mediating the effects of various hormones on metabolism. The major intracellular functions of cAMP are transduced by protein kinase A (PKA) and exchange proteins directly activated by cAMP (EPACs). The latter act as guanine nucleotide exchange factors for the RAS-like small G-proteins Rap1 and Rap2. While the role of PKA in regulating energy balance has been extensively studied, EPACs’ impact remains relatively enigmatic. This review summarizes recent genetic and pharmacological studies concerning EPACs’ involvement in glucose homeostasis and energy balance, through regulation of leptin and insulin signaling pathways. Additionally, the development of small molecule EPAC-specific modulators and their therapeutic potential for the treatment of diabetes and obesity are discussed. PMID:24231725

  15. Cyclic AMP system in muscle tissue during prolonged hypokinesia

    NASA Technical Reports Server (NTRS)

    Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

    1980-01-01

    Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

  16. Manganese As a Metal Accumulator

    EPA Science Inventory

    Manganese deposits in water distribution systems accumulate metals, radionuclides and oxyanions by a combination of surface complexation, adsorption and solid substitution, as well as a combination of oxidation followed by manganese reduction and sorption of the oxidized constitu...

  17. Evidence accumulation for spatial reasoning

    NASA Technical Reports Server (NTRS)

    Matsuyama, T.; Hwang, V. S. S.; Davis, L. S.

    1984-01-01

    The evidence accumulation proces of an image understanding system is described enabling the system to perform top-down(goal-oriented) picture processing as well as bottom-up verification of consistent spatial relations among objects.

  18. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells.

    PubMed

    Khan, D R; Guillemette, C; Sirard, M A; Richard, F J

    2015-09-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3'5'-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca(2+)) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence. PMID:26082143

  19. AKAPs: The Architectural Underpinnings of Local cAMP signaling

    PubMed Central

    Kritzer, Michael D.; Li, Jinliang; Dodge-Kafka, Kimberly; Kapiloff, Michael S.

    2011-01-01

    The cAMP-dependent protein kinase A (PKA) is targeted to specific compartments in the cardiac myocyte by A-kinase anchoring proteins (AKAPs), a diverse set of scaffold proteins that have been implicated in the regulation of excitation-contraction coupling and cardiac remodeling. AKAPs bind not only PKA, but also a large variety of structural and signaling molecules. In this review, we discuss the basic concepts underlying compartmentation of cAMP and PKA signaling, as well as a few of the individual AKAPs that have been shown to be functionally relevant in the heart. PMID:21600214

  20. Regulation and organization of adenylyl cyclases and cAMP.

    PubMed Central

    Cooper, Dermot M F

    2003-01-01

    Adenylyl cyclases are a critically important family of multiply regulated signalling molecules. Their susceptibility to many modes of regulation allows them to integrate the activities of a variety of signalling pathways. However, this property brings with it the problem of imparting specificity and discrimination. Recent studies are revealing the range of strategies utilized by the cyclases to solve this problem. Microdomains are a consequence of these solutions, in which cAMP dynamics may differ from the broad cytosol. Currently evolving methodologies are beginning to reveal cAMP fluctuations in these various compartments. PMID:12940771

  1. Formation of dAMP-glycerol and dAMP-Tris Derivatives by Thermococcus kodakaraensis DNA Primase*

    PubMed Central

    Chemnitz Galal, Wiebke; Pan, Miao; Giulian, Gary; Yuan, Wei; Li, Shuwei; Edwards, James L.; Marino, John P.; Kelman, Zvi; Hurwitz, Jerard

    2012-01-01

    In the presence of dATP, glycerol, and Tris buffer, the DNA primase isolated from Thermococcus kodakaraensis catalyzed the formation of dAMP and two products that were identified as dAMP-glycerol and dAMP-Tris. These products were formed by the T. kodakaraensis p41 catalytic subunit alone and the T. kodakaraensis p41-p46 complex in the absence of a DNA template. They were not formed with preparations containing the catalytically inactive p41 subunit. Similar glycerol and Tris derivatives as well as dNMPs were also formed with dGTP, dCTP, or dTTP. The mechanism contributing to the formation of these products and its implications in the initiation reaction catalyzed by the T. kodakaraensis primase are discussed. PMID:22427647

  2. Direct regulation of the natural competence regulator gene tfoX by cyclic AMP (cAMP) and cAMP receptor protein (CRP) in Vibrios

    PubMed Central

    Wu, Rui; Zhao, Meng; Li, Jing; Gao, He; Kan, Biao; Liang, Weili

    2015-01-01

    TfoX (Sxy) and CRP are two important competence activators. The link between tfoX and CRP has been shown in H. influenza but lacking evidence of direct interaction. Recently a Sxy-dependent CRP (CRP-S) site autoregulating Sxy was reported in E. coli. Here, we show that the cAMP-CRP complex transcriptionally regulates tfoX expression through multiple canonical CRP (CRP-N) sites in Vibrios. This conclusion is supported by an analysis of the tfoX mRNA levels and tfoX transcriptional reporter fusions. The reduced expression of tfoXVC was restored by trans-complementation of crp in ∆crp and by exogenous cAMP in ∆cya. A promoter deletion analysis and the site-directed mutagenesis of the putative CRP-N sites revealed the presence of two functional CRP-N sites. The direct binding of cAMP-CRP to the tfoXVCpromoter was demonstrated by EMSA assays. Additionally, the transcriptional start site (TSS) of tfoXVF in V. fluvialis was determined, and −10/−35 regions were predicted. Further comparison of the tfoX promoter in Vibrios revealed the existence of similar −10 motifs and putative CRP-N sites, indicating the conserved mechanism of CRP regulation on tfoX. Our study demonstrates the direct binding of the cAMP-CRP complex to tfoX promoter, and broadens the understanding of the molecular mechanism regulating tfoX in Vibrios. PMID:26442598

  3. Effects of isoproterenol on IL-2 and cAMP production in peripheral T cells from asthmatic and non-asthmatic subjects sensitive to Candida.

    PubMed

    Aihara, M; Dobashi, K; Horie, T; Iizuka, K; Nakazawa, T; Mori, M

    1999-09-01

    Immunity to Candida albicans (Candida) is characterized by a Th-1 type pattern of reactivity. Candida is rarely a cause antigen for bronchial asthma. Beta agonists have been found to inhibit secretion of IL-2 from T cells through intracellular cAMP elevation. We examined effects of isoproterenol (ISO) on Candida-stimulated T cells. Peripheral T cells obtained from six Candida-sensitive asthmatics, six Candida-sensitive non-asthmatic subjects, and six normal donors by Ficoll-Hypaque gradient centrifugation and nylon-wool column chromatography were incubated with Candida antigen or concanavalin A (Con A) in the absence or presence of ISO. Secretion of IL-2 and intracellular accumulation of cAMP were assayed by ELISA. Con A induced secretion of IL-2 in each of the three groups. Candida antigen induced IL-2 secretion in the normal and the non-asthmatic subjects, but not in the asthmatics. ISO, which reduced Con A-induced secretion of IL-2 in a dose-dependent manner, had no effect on Candida-induced secretion of IL-2. Although ISO increased the intracellular concentration of cAMP in untreated and Con A-treated T cells from all donors, cells from the normal and the non-asthmatic subjects, but not from the asthmatics, that were co-incubated with ISO and Candida had lower levels of cAMP than those treated with ISO alone. It is suggested that Candida antigen induces secretion of IL-2 and reduces ISO-inducible accumulation of cAMP in Candida-responsive IL-2 secreting cells, which may make Candida-induced secretion of IL-2 insensitive to ISO. PMID:10572628

  4. Effect of shear stress and of transmural pressure on cAMP-dependent responses of cells adhering to a biomaterial

    NASA Astrophysics Data System (ADS)

    Chotard-Ghodsnia, R.; Drochon, A.; Faucheux, N.; Nagel, M.-D.; Grebe, R.

    2002-02-01

    Biomaterials used in some bioreactors are porous and exposed to normal and tangential flow of physiological fluid. Flow-induced forces may influence the morphological and biochemical responses of cells adhering to these materials. The objective of this work is to examine the capacity of mechanical stress to cause changes in cell morphology via the cAMP pathway (cyclic adenosine monophosphate). This second messenger is known to modulate cell morphology in static conditions. In classical flow devices, cells are submitted to only tangential stresses. We designed a new flow system, a Hele-Shaw cell with a porous bottom wall, in order to take into account the influence of a transmural pressure. This flow chamber allows to follow up continuously the shape changes of cells that are adherent to a porous biomaterial (polyacrylonitrile) and are exposed to controlled levels of shear stress or transmural pressure. Mouse Swiss 3T3 fibroblasts exposed to a 1.1-Pa shear stress, as well as those exposed to a 84-mm Hg transmural pressure, round up (up to 50%) in a few minutes. If the cAMP pathway is inhibited when a mechanical stress is applied, cell rounding is significantly prevented. These observations suggest that flow-induced cell shape changes are cAMP-dependent. This conclusion is supported by an increased cAMP accumulation measured in cells under mechanical stress when compared to static experiments. Our in vitro flow system is thus useful to study the influence of transmural pressure or shear stress on the early morphological and biochemical responses of cells in contact with a biomaterial.

  5. Field measurements and interpretation of TMI-2 instrumentation: YM-AMP-7023 and YM-AMP-7025

    SciTech Connect

    Jones, J E; Smith, J T; Mathis, M V

    1982-01-01

    This report describes the measurement and results of the Loose Part Monitor Channels YM-AMP-7023 and YM-AMP-7025. These instruments consist of an Endevco Model 2276 accelerometer and a model 2652M4 charge amplifier connected to the Loose Parts Monitorng System terminals by approximately 400 feet (500 feet for 7025) of cable. The instruments were being incorporated into a B and W supplied system when the measurements were taken; therefore, the equipment was not expected to be fully operational.

  6. Developmental regulation of expression of the regulatory subunit of the cAMP-dependent protein kinase of Blastocladiella emersonii.

    PubMed

    Marques, M do V; Juliani, M H; Maia, J C; Gomes, S L

    1989-01-01

    A monospecific polyclonal antiserum to the regulatory subunit (R) of the cAMP-dependent protein kinase of Blastocladiella emersonii has been developed by immunization with purified regulatory subunit. In Western blots, the antiserum displays high affinity and specificity for the intact R monomer of Mr = 58,000, as well as for its proteolytic products of Mr = 43,000 and Mr = 36,000, even though the antiserum has been raised against the Mr = 43,000 fragment. Western blots of cell extracts prepared at different times during the life cycle of the fungus indicate that the increase in cAMP-binding activity occurring during sporulation, as well as its decrease during germination, are associated with the accumulation of the regulatory subunit during sporulation and its disappearance during germination, respectively. Pulse labeling with [35S]methionine and immunoprecipitation indicate that the accumulation of R is due to its increased synthesis during sporulation. Two-dimensional gel electrophoresis of affinity purified cell extracts obtained after [35S]methionine pulse labeling during sporulation confirms de novo synthesis of R during this stage and furthermore shows that the protein is rapidly phosphorylated after its synthesis. In vitro translation studies using RNA isolated from different stages of the life cycle followed by immunoprecipitation have shown that the time course of expression of the mRNA coding for the regulatory subunit parallels the rate of its synthesis in vivo. PMID:2912735

  7. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  8. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  9. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  10. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  11. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  12. cAMP signaling in cortisol-producing adrenal adenoma.

    PubMed

    Calebiro, Davide; Di Dalmazi, Guido; Bathon, Kerstin; Ronchi, Cristina L; Beuschlein, Felix

    2015-10-01

    The cAMP signaling pathway is one of the major players in the regulation of growth and hormonal secretion in adrenocortical cells. Although its role in the pathogenesis of adrenocortical hyperplasia associated with Cushing's syndrome has been clarified, a clear involvement of the cAMP signaling pathway and of one of its major downstream effectors, the protein kinase A (PKA), in sporadic adrenocortical adenomas remained elusive until recently. During the last year, a report by our group and three additional independent groups showed that somatic mutations of PRKACA, the gene coding for the catalytic subunit α of PKA, are a common genetic alteration in patients with Cushing's syndrome due to adrenal adenomas, occurring in 35-65% of the patients. In vitro studies revealed that those mutations are able to disrupt the association between catalytic and regulatory subunits of PKA, leading to a cAMP-independent activity of the enzyme. Despite somatic PRKACA mutations being a common finding in patients with clinically manifest Cushing's syndrome, the pathogenesis of adrenocortical adenomas associated with subclinical hypercortisolism seems to rely on a different molecular background. In this review, the role of cAMP/PKA signaling in the regulation of adrenocortical cell function and its alterations in cortisol-producing adrenocortical adenomas will be summarized, with particular focus on recent developments. PMID:26139209

  13. Characteristics of cyclic AMP transport by marine bacteria

    SciTech Connect

    Ammerman, J.W.; Azam, F.

    1987-12-01

    Uptake and autoradiography experiments with natural populations of marine bacteria, sea water cultures, and cultured isolates showed that the high-affinity cyclic AMP transport system in marine bacteria has stringent structural requirements, is found in a minority of cells in mixed bacterial assemblages, and appears to be related to the culture growth state.

  14. Metabolic benefits of inhibiting cAMP-PDEs with resveratrol.

    PubMed

    Chung, Jay H

    2012-10-01

    Calorie restriction (CR) extends lifespan in species ranging from yeast to mammals. There is evidence that CR also protects against aging-related diseases in non-human primates. This has led to an intense interest in the development of CR-mimetics to harness the beneficial effects of CR to treat aging-related diseases. One CR-mimetic that has received a great deal of attention is resveratrol. Resveratrol extends the lifespan of obese mice and protects against obesity-related diseases such as type 2 diabetes. The specific mechanism of resveratrol action has been difficult to elucidate because resveratrol has a promiscuous target profile. A recent finding indicates that the metabolic effects of resveratrol may result from competitive inhibition of cAMP-degrading phosphodiesterases (PDEs), which increases cAMP levels. The cAMP-dependent pathways activate AMP-activated protein kinase (AMPK), which is essential for the metabolic effects of resveratrol. Inhibiting PDE4 with rolipram reproduces all of the metabolic benefits of resveratrol, including protection against diet-induced obesity and an increase in mitochondrial function, physical stamina and glucose tolerance in mice. This discovery suggests that PDE inhibitors may be useful for treating metabolic diseases associated with aging. PMID:23700542

  15. Maximum likelihood decoding analysis of Accumulate-Repeat-Accumulate Codes

    NASA Technical Reports Server (NTRS)

    Abbasfar, Aliazam; Divsalar, Dariush; Yao, Kung

    2004-01-01

    Repeat-Accumulate (RA) codes are the simplest turbo-like codes that achieve good performance. However, they cannot compete with Turbo codes or low-density parity check codes (LDPC) as far as performance is concerned. The Accumulate Repeat Accumulate (ARA) codes, as a subclass of LDPC codes, are obtained by adding a pre-coder in front of RA codes with puncturing where an accumulator is chosen as a precoder. These codes not only are very simple, but also achieve excellent performance with iterative decoding. In this paper, the performance of these codes with (ML) decoding are analyzed and compared to random codes by very tight bounds. The weight distribution of some simple ARA codes is obtained, and through existing tightest bounds we have shown the ML SNR threshold of ARA codes approaches very closely to the performance of random codes. We have shown that the use of precoder improves the SNR threshold but interleaving gain remains unchanged with respect to RA code with puncturing.

  16. Ecology: accumulating threats to life

    SciTech Connect

    Peterson, R.W.

    1980-04-01

    The accumulating impacts of toxic materials like polychloridnated bephenyls (PCBs), acid rain, deforestation in the Amazon River Basin, and nuclear energy are examined as life-threatening actions that the public must recognize. Immediate action is needed to abandon destructive human activities and search out those life-supporting choices which will replace immediate gratification with long-range benefits. (DCK)

  17. Pensions and Household Wealth Accumulation

    ERIC Educational Resources Information Center

    Engelhardt, Gary V.; Kumar, Anil

    2011-01-01

    Economists have long suggested that higher private pension benefits "crowd out" other sources of household wealth accumulation. We exploit detailed information on pensions and lifetime earnings for older workers in the 1992 wave of the Health and Retirement Study and employ an instrumental-variable (IV) identification strategy to estimate…

  18. Wnt Signaling Inhibits Osteoclast Differentiation by Activating Canonical and Noncanonical cAMP/PKA Pathways

    PubMed Central

    Weivoda, Megan M; Ruan, Ming; Hachfeld, Christine M; Pederson, Larry; Howe, Alan; Davey, Rachel A; Zajac, Jeffrey D; Kobayashi, Yasuhiro; Williams, Bart O; Westendorf, Jennifer J; Khosla, Sundeep; Oursler, Merry Jo

    2016-01-01

    Although there has been extensive characterization of the Wnt signaling pathway in the osteoblast lineage, the effects of Wnt proteins on the osteoclast lineage are less well studied. We found that osteoclast lineage cells express canonical Wnt receptors. Wnt3a reduced osteoclast formation when applied to early bone-marrow macrophage (BMM) osteoclast differentiation cultures, whereas late addition did not suppress osteoclast formation. Early Wnt3a treatment inactivated the crucial transcription factor NFATc1 in osteoclast progenitors. Wnt3a led to the accumulation of nuclear β-catenin, confirming activation of canonical Wnt signaling. Reducing low-density lipoprotein receptor-related proteins (Lrp) 5 and Lrp6 protein expression prevented Wnt3a-induced inactivation of NFATc1; however, deletion of β-catenin did not block Wnt3a inactivation of NFATc1, suggesting that this effect was mediated by a noncanonical pathway. Wnt3a rapidly activated the cyclic adenosine monophosphate (cAMP)/protein kinase A (PKA) pathway and pharmacological stimulation of cAMP/PKA signaling suppressed osteoclast differentiation; Wnt3a-induced NFATc1 phosphorylation was blocked by inhibiting interactions between PKA and A-kinase anchoring proteins (AKAPs). These data indicate that Wnt3a directly suppresses osteoclast differentiation through both canonical (β-catenin) and noncanonical (cAMP/PKA) pathways in osteoclast precursors. In vivo reduction of Lrp5 and Lrp6 expressions in the early osteoclast lineage via Rank promoter Cre recombination reduced trabecular bone mass, whereas disruption of Lrp5/6 expression in late osteoclast precursors via cathepsin K (Ctsk) promoter Cre recombination did not alter the skeletal phenotype. Surprisingly, reduction of Lrp5/6 in the early osteoclast lineage decreased osteoclast numbers, as well as osteoblast numbers. Published studies have previously noted that β-catenin signaling is required for osteoclast progenitor proliferation. Our in vivo data

  19. Heterozygous mutations in cyclic AMP phosphodiesterase-4D (PDE4D) and protein kinase A (PKA) provide new insights into the molecular pathology of acrodysostosis.

    PubMed

    Kaname, Tadashi; Ki, Chang-Seok; Niikawa, Norio; Baillie, George S; Day, Jonathan P; Yamamura, Ken-Ichi; Ohta, Tohru; Nishimura, Gen; Mastuura, Nobuo; Kim, Ok-Hwa; Sohn, Young Bae; Kim, Hyun Woo; Cho, Sung Yoon; Ko, Ah-Ra; Lee, Jin Young; Kim, Hyun Wook; Ryu, Sung Ho; Rhee, Hwanseok; Yang, Kap-Seok; Joo, Keehyoung; Lee, Jooyoung; Kim, Chi Hwa; Cho, Kwang-Hyun; Kim, Dongsan; Yanagi, Kumiko; Naritomi, Kenji; Yoshiura, Ko-Ichiro; Kondoh, Tatsuro; Nii, Eiji; Tonoki, Hidefumi; Houslay, Miles D; Jin, Dong-Kyu

    2014-11-01

    Acrodysostosis without hormone resistance is a rare skeletal disorder characterized by brachydactyly, nasal hypoplasia, mental retardation and occasionally developmental delay. Recently, loss-of-function mutations in the gene encoding cAMP-hydrolyzing phosphodiesterase-4D (PDE4D) have been reported to cause this rare condition but the pathomechanism has not been fully elucidated. To understand the pathogenetic mechanism of PDE4D mutations, we conducted 3D modeling studies to predict changes in the binding efficacy of cAMP to the catalytic pocket in PDE4D mutants. Our results indicated diminished enzyme activity in the two mutants we analyzed (Gly673Asp and Ile678Thr; based on PDE4D4 residue numbering). Ectopic expression of PDE4D mutants in HEK293 cells demonstrated this reduction in activity, which was identified by increased cAMP levels. However, the cells from an acrodysostosis patient showed low cAMP accumulation, which resulted in a decrease in the phosphorylated cAMP Response Element-Binding Protein (pCREB)/CREB ratio. The reason for this discrepancy was due to a compensatory increase in expression levels of PDE4A and PDE4B isoforms, which accounted for the paradoxical decrease in cAMP levels in the patient cells expressing mutant isoforms with a lowered PDE4D activity. Skeletal radiographs of 10-week-old knockout (KO) rats showed that the distal part of the forelimb was shorter than in wild-type (WT) rats and that all the metacarpals and phalanges were also shorter in KO, as the name acrodysostosis implies. Like the G-protein α-stimulatory subunit and PRKAR1A, PDE4D critically regulates the cAMP signal transduction pathway and influences bone formation in a way that activity-compromising PDE4D mutations can result in skeletal dysplasia. We propose that specific inhibitory PDE4D mutations can lead to the molecular pathology of acrodysostosis without hormone resistance but that the pathological phenotype may well be dependent on an over-compensatory induction

  20. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 7 2012-01-01 2012-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  1. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  2. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 7 2011-01-01 2011-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  3. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 7 2013-01-01 2013-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  4. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  5. Stimulators of AMP-activated kinase (AMPK) inhibit seawater- but not cAMP-induced oocyte maturation in a marine worm: Implications for interactions between cAMP and AMPK signaling.

    PubMed

    Stricker, Stephen A; Swiderek, Lee; Nguyen, Thanh

    2010-06-01

    Previous studies have shown that elevations in intraoocytic cAMP prevent mammalian oocytes from maturing, whereas cAMP degradation allows these oocytes to begin maturation, as evidenced by the onset of oocyte nuclear disassembly (="germinal vesicle breakdown", GVBD). Moreover, such cAMP degradation not only reduces cAMP levels but also generates AMP, which in turn can stimulate AMP-activated kinase (AMPK), a well-documented inducer of GVBD in mice. Alternatively, in some marine invertebrates, intraoocytic cAMP triggers, rather than blocks, GVBD, and whether AMPK up- or downregulates maturation in these species has not been tested. Thus, AMPK was monitored in the nemertean worm Cerebratulus during GVBD stimulated by seawater (SW) or cAMP elevators. In oocytes lacking surrounding follicle cells, AMPK activity was initially elevated in immature oocytes but subsequently reduced during SW- or cAMP-induced GVBD, given that the catalytic alpha-subunit of AMPK in maturing oocytes displayed a decreased stimulatory phosphorylation at T172 and an increased inhibitory phosphorylation at S485/491. Accordingly, AMPK-mediated phosphorylation of acetyl-CoA carboxylase, a known target of active AMPK, also declined during maturation. Moreover, treatments with either ice-cold calcium-free seawater (CaFSW) or AMPK agonists dissolved in SW maintained AMPK activity and inhibited GVBD. Conversely, adding cAMP elevators to CaFSW- or SW-solutions of AMPK activators restored GVBD while promoting S485/491 phosphorylation and AMPK deactivation. Collectively, such findings not only demonstrate for the first time that intraoocytic AMPK can block GVBD in the absence of surrounding follicle cells, but these results also provide evidence for a novel GVBD-regulating mechanism involving AMPK deactivation by cAMP-mediated S485/491 phosphorylation. PMID:20336704

  6. Molecular characterisation of acquired and overproduced chromosomal blaAmpC in Escherichia coli clinical isolates.

    PubMed

    Alonso, Noemí; Miró, Elisenda; Pascual, Vanesa; Rivera, Alba; Simó, Maria; Garcia, Maria Consol; Xercavins, Mariona; Morera, Maria Antonia; Espejo, Elena; Gurguí, Mercè; Pérez, Josefa; Rodríguez-Carballeira, Mònica; Garau, Javier; Calbo, Esther; Navarro, Ferran; Mirelis, Beatriz; Coll, Pere

    2016-01-01

    Escherichia coli recovered from three hospitals in Barcelona (Spain) were studied to determine the prevalence of isolates with acquired AmpC (ac-AmpC) and/or overproduced chromosomal AmpC (c-AmpC). Mechanisms involved in blac-AmpC overexpression, blaac-AmpC and the plasmids associated with their distribution as well as the prevalence of plasmid-mediated quinolone resistance (PMQR) in AmpC-producing isolates were also determined. Isolates were selected according to their resistance phenotype. blaac-AmpC, alterations in the blac-AmpC promoter/attenuator, and PMQR genes [qnrA, qnrB, qnrS, aac(6')-Ib-cr and qepA] were characterised by PCR and sequencing. blac-AmpC expression was determined by qRT-PCR. Population structure analysis was performed using PFGE, MLST and phylogenetic group PCR. Plasmids carrying blaac-AmpC were characterised by PCR-based replicon typing and S1-PFGE. IncI1 and IncF plasmids were also analysed by plasmid MLST and replicon sequence typing, respectively. Among 21563 E. coli isolates, 240 (1.1%) overproduced AmpC β-lactamases, including 180 (75.0%) harbouring ac-AmpC (132 CMY-2 variants and 48 DHA-1) and 60 (25.0%) c-AmpC enzymes. Three mutation profiles in the blac-AmpC promoter/attenuator were associated with a 72.5-, 19.9- and 5.8-fold increased expression, respectively. Moreover, 63.3% of ac-AmpC and 43.3% of c-AmpC isolates belonged to B2, D, E or F phylogenetic groups. PMQR was found in 31% of ac-AmpC isolates [38 qnrB4, 8 aac(6')-Ib-cr, 6 qnrS1 and 3 qnrB19] and in 10% of c-AmpC isolates [5 aac(6')-Ib-cr and 1 qnrS1]. IncI1-ST12 and IncF were associated with blaCMY-2 and blaDHA-1, respectively. These results suggest that ac-AmpC β-lactamases were the main mechanism of AmpC production. Isolates and plasmids both showed high genetic diversity. PMID:26607336

  7. Acid sphingomyelinase regulates glucose and lipid metabolism in hepatocytes through AKT activation and AMP-activated protein kinase suppression

    PubMed Central

    Osawa, Yosuke; Seki, Ekihiro; Kodama, Yuzo; Suetsugu, Atsushi; Miura, Kouichi; Adachi, Masayuki; Ito, Hiroyasu; Shiratori, Yoshimune; Banno, Yoshiko; Olefsky, Jerrold M.; Nagaki, Masahito; Moriwaki, Hisataka; Brenner, David A.; Seishima, Mitsuru

    2011-01-01

    Acid sphingomyelinase (ASM) regulates the homeostasis of sphingolipids, including ceramides and sphingosine-1-phosphate (S1P). Because sphingolipids regulate AKT activation, we investigated the role of ASM in hepatic glucose and lipid metabolism. Initially, we overexpressed ASM in the livers of wild-type and diabetic db/db mice by adenovirus vector (Ad5ASM). In these mice, glucose tolerance was improved, and glycogen and lipid accumulation in the liver were increased. Using primary cultured hepatocytes, we confirmed that ASM increased glucose uptake, glycogen deposition, and lipid accumulation through activation of AKT and glycogen synthase kinase-3β. In addition, ASM induced up-regulation of glucose transporter 2 accompanied by suppression of AMP-activated protein kinase (AMPK) phosphorylation. Loss of sphingosine kinase-1 (SphK1) diminished ASM-mediated AKT phosphorylation, but exogenous S1P induced AKT activation in hepatocytes. In contrast, SphK1 deficiency did not affect AMPK activation. These results suggest that the SphK/S1P pathway is required for ASM-mediated AKT activation but not for AMPK inactivation. Finally, we found that treatment with high-dose glucose increased glycogen deposition and lipid accumulation in wild-type hepatocytes but not in ASM−/− cells. This result is consistent with glucose intolerance in ASM−/− mice. In conclusion, ASM modulates AKT activation and AMPK inactivation, thus regulating glucose and lipid metabolism in the liver.—Osawa, Y., Seki, E., Kodama, Y., Suetsugu, A., Miura, K., Adachi, M., Ito, H., Shiratori, Y., Banno, Y., Olefsky, J. M., Nagaki, M., Moriwaki, H., Brenner, D. A., Seishima, M. Acid sphingomyelinase regulates glucose and lipid metabolism in hepatocytes through AKT activation and AMP-activated protein kinase suppression. PMID:21163859

  8. Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution.

    PubMed

    Passner, J M; Schultz, S C; Steitz, T A

    2000-12-15

    After an allosteric transition produced by the binding of cyclic AMP (cAMP), the Escherichia coli catabolite gene activator protein (CAP) binds DNA specifically and activates transcription. The three-dimensional crystal structure of the CAP-cAMP complex has been refined at 2.1 A resolution, thus enabling a better evaluation of the structural basis for CAP phenotypes, the interactions of cAMP with CAP and the roles played by water structure. A review of mutational analysis of CAP together with the additional structural information presented here suggests a possible mechanism for the cAMP-induced allostery required for DNA binding and transcriptional activation. We hypothesize that cAMP binding may reorient the coiled-coil C-helices, which provide most of the dimer interface, thereby altering the relative positions of the DNA-binding domains of the CAP dimer. Additionally, cAMP binding may cause a further rearrangement of the DNA-binding and cAMP-binding domains of CAP via a flap consisting of beta-strands 4 and 5 which lies over the cAMP. PMID:11124031

  9. 46 CFR 58.30-25 - Accumulators.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... RELATED SYSTEMS Fluid Power and Control Systems § 58.30-25 Accumulators. (a) An accumulator is an unfired... fluid. Accumulators must meet the applicable requirements in § 54.01-5 (c)(3), (c)(4), and (d) of this chapter or the remaining requirements in part 54. (b) If the accumulator is of the gas and fluid...

  10. 46 CFR 58.30-25 - Accumulators.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... RELATED SYSTEMS Fluid Power and Control Systems § 58.30-25 Accumulators. (a) An accumulator is an unfired... fluid. Accumulators must meet the applicable requirements in § 54.01-5 (c)(3), (c)(4), and (d) of this chapter or the remaining requirements in part 54. (b) If the accumulator is of the gas and fluid...

  11. 46 CFR 58.30-25 - Accumulators.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... RELATED SYSTEMS Fluid Power and Control Systems § 58.30-25 Accumulators. (a) An accumulator is an unfired... fluid. Accumulators must meet the applicable requirements in § 54.01-5 (c)(3), (c)(4), and (d) of this chapter or the remaining requirements in part 54. (b) If the accumulator is of the gas and fluid...

  12. 46 CFR 58.30-25 - Accumulators.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... RELATED SYSTEMS Fluid Power and Control Systems § 58.30-25 Accumulators. (a) An accumulator is an unfired... fluid. Accumulators must meet the applicable requirements in § 54.01-5 (c)(3), (c)(4), and (d) of this chapter or the remaining requirements in part 54. (b) If the accumulator is of the gas and fluid...

  13. Purification of the surface cAMP receptor in Dictyostelium

    SciTech Connect

    Klein, P.; Knox, B.; Borleis, J.; Devreotes, P.

    1987-01-05

    We have previously identified and demonstrated reversible ligand-induced modification of the major cell surface cAMP receptor in Dictyostelium discoideum. The receptor, or a subunit of it, has been purified to homogeneity by hydroxylapatite chromatography followed by two-dimensional preparative sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The purification was monitored by following /sup 32/Pi incorporated by photoaffinity labeling with 8-azido-(/sup 32/P)cAMP or by in vivo labeling with /sup 32/Pi. Two interconvertible forms of the receptor, designated R (Mr 40,000) and D (Mr 43,000), co-purified. Two-dimensional peptide maps of independently purified and /sup 125/I-iodinated R and D forms of the receptor were nearly identical but did have several distinct peptides. The estimated 6000-fold purification required is consistent with the number of cell surface binding sites assuming there are not multiple binding sites/polypeptide. In the accompanying article we report the generation of a monospecific polyclonal antiserum which has helped to further elucidate the physical properties and developmental regulation of the cAMP receptor.

  14. Software Design Document for the AMP Nuclear Fuel Performance Code

    SciTech Connect

    Philip, Bobby; Clarno, Kevin T; Cochran, Bill

    2010-03-01

    The purpose of this document is to describe the design of the AMP nuclear fuel performance code. It provides an overview of the decomposition into separable components, an overview of what those components will do, and the strategic basis for the design. The primary components of a computational physics code include a user interface, physics packages, material properties, mathematics solvers, and computational infrastructure. Some capability from established off-the-shelf (OTS) packages will be leveraged in the development of AMP, but the primary physics components will be entirely new. The material properties required by these physics operators include many highly non-linear properties, which will be replicated from FRAPCON and LIFE where applicable, as well as some computationally-intensive operations, such as gap conductance, which depends upon the plenum pressure. Because there is extensive capability in off-the-shelf leadership class computational solvers, AMP will leverage the Trilinos, PETSc, and SUNDIALS packages. The computational infrastructure includes a build system, mesh database, and other building blocks of a computational physics package. The user interface will be developed through a collaborative effort with the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Capability Transfer program element as much as possible and will be discussed in detail in a future document.

  15. Sustained cyclic AMP production by parathyroid hormone receptor endocytosis

    PubMed Central

    Ferrandon, Sébastien; Feinstein, Timothy N; Castro, Marian; Wang, Bin; Bouley, Richard; Potts, John T; Gardella, Thomas J; Vilardaga, Jean-Pierre

    2011-01-01

    Cell signaling mediated by the G protein-coupled parathyroid hormone receptor type 1 (PTHR) is fundamental to bone and kidney physiology. It has been unclear how the two ligand systems—PTH, endocrine and homeostatic, and PTH-related peptide (PTHrP), paracrine—can effectively operate with only one receptor and trigger different durations of the cAMP responses. Here we analyze the ligand response by measuring the kinetics of activation and deactivation for each individual reaction step along the PTHR signaling cascade. We found that during the time frame of G protein coupling and cAMP production, PTHrP1–36 action was restricted to the cell surface, whereas PTH1–34 had moved to internalized compartments where it remained associated with the PTHR and Gαs, potentially as a persistent and active ternary complex. Such marked differences suggest a mechanism by which PTH and PTHrP induce differential responses, and these results indicate that the central tenet that cAMP production originates exclusively at the cell membrane must be revised. PMID:19701185

  16. Metal accumulating plants: Medium's role

    NASA Astrophysics Data System (ADS)

    Rabier, J.; Prudent, P.; Szymanska, B.; Mevy, J.-P.

    2003-05-01

    To evaluate phytoremediation potentialities by metal accumulation in tolerant plants, trials are carried out using in vitro cultures. Organie compounds influence on metal accumulation is studied with metals supplemented media. The tested compounds on zinc and lead absorption by Brassica juncea, are chelating agents (EDTA, citric acid) and soluble organic fractions of compost. EDTA seems to enhance the transfer of lead in plant but it is the opposite in the case of zinc. Citric acid stimulates root absorption for both zinc and lead. For the aqueous extracts of compost, variable effects are obtained according to the origin of compost (green wastes and food wastes). In'all tested conditions of cultures, zinc is mainly exported towards shoot while lead is stored in root.

  17. Vasoactive intestinal peptide synergistically stimulates DNA synthesis in mouse 3T3 cells: Role of cAMP, Ca sup 2+ , and protein kinase C

    SciTech Connect

    Zurier, B.B.; Kozma, M.; Sinnett-Smith, J.; Rozengurt, E. )

    1988-05-01

    Vasoactive intestinal peptide synergistically stimulated initiation of DNA synthesis in Swiss 3T3 cells. The peptide stimulated ({sup 3}H)thymidine incorporation in the presence of insulin and either forskolin or an inhibitor of cAMP phosphodiesterase in a concentration-dependent manner. Half-maximal effect was obtained at 1 nM. At mitogenic concentrations, VIP stimulated a marked accumulation (eightfold) of cAMP. In contrast to other growth-promoting neuropeptides, VIP did not induce an increase in cytosolic free Ca{sup 2+} or the activation of protein kinase C. The authors conclude that neuropeptides can modulate long-term cell proliferation through multiple signaling pathways.

  18. Mechanisms of intrahepatic triglyceride accumulation

    PubMed Central

    Ress, Claudia; Kaser, Susanne

    2016-01-01

    Hepatic steatosis defined as lipid accumulation in hepatocytes is very frequently found in adults and obese adolescents in the Western World. Etiologically, obesity and associated insulin resistance or excess alcohol intake are the most frequent causes of hepatic steatosis. However, steatosis also often occurs with chronic hepatitis C virus (HCV) infection and is also found in rare but potentially life-threatening liver diseases of pregnancy. Clinical significance and outcome of hepatic triglyceride accumulation are highly dependent on etiology and histological pattern of steatosis. This review summarizes current concepts of pathophysiology of common causes of hepatic steatosis, including non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, chronic HCV infections, drug-induced forms of hepatic steatosis, and acute fatty liver of pregnancy. Regarding the pathophysiology of NAFLD, this work focuses on the close correlation between insulin resistance and hepatic triglyceride accumulation, highlighting the potential harmful effects of systemic insulin resistance on hepatic metabolism of fatty acids on the one side and the role of lipid intermediates on insulin signalling on the other side. Current studies on lipid droplet morphogenesis have identified novel candidate proteins and enzymes in NAFLD. PMID:26819531

  19. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  20. Temporal Analysis of the Magnaporthe Oryzae Proteome During Conidial Germination and Cyclic AMP (cAMP)-mediated Appressorium Formation*

    PubMed Central

    Franck, William L.; Gokce, Emine; Oh, Yeonyee; Muddiman, David C.; Dean, Ralph A.

    2013-01-01

    Rice blast disease caused by Magnaporthe oryzae is one of the most serious threats to global rice production. During the earliest stages of rice infection, M. oryzae conidia germinate on the leaf surface and form a specialized infection structure termed the appressorium. The development of the appressorium represents the first critical stage of infectious development. A total of 3200 unique proteins were identified by nanoLC-MS/MS in a temporal study of conidial germination and cAMP-induced appressorium formation in M. oryzae. Using spectral counting based label free quantification, observed changes in relative protein abundance during the developmental process revealed changes in the cell wall biosynthetic machinery, transport functions, and production of extracellular proteins in developing appressoria. One hundred and sixty-six up-regulated and 208 down-regulated proteins were identified in response to cAMP treatment. Proteomic analysis of a cAMP-dependent protein kinase A mutant that is compromised in the ability to form appressoria identified proteins whose developmental regulation is dependent on cAMP signaling. Selected reaction monitoring was used for absolute quantification of four regulated proteins to validate the global proteomics data and confirmed the germination or appressorium specific regulation of these proteins. Finally, a comparison of the proteome and transcriptome was performed and revealed little correlation between transcript and protein regulation. A subset of regulated proteins were identified whose transcripts show similar regulation patterns and include many of the most strongly regulated proteins indicating a central role in appressorium formation. A temporal quantitative RT-PCR analysis confirmed a strong correlation between transcript and protein abundance for some but not all genes. Collectively, the data presented here provide the first comprehensive view of the M. oryzae proteome during early infection-related development and

  1. THE ABC TRANSPORTER, AbcB3, MEDIATES cAMP EXPORT IN D. DISCOIDEUM DEVELOPMENT

    PubMed Central

    Miranda, Edward Roshan; Nam, Edward A.; Kuspa, Adam; Shaulsky, Gad

    2014-01-01

    Extracellular cAMP functions as a primary ligand for cell surface cAMP receptors throughout Dictyostelium discoideum development, controlling chemotaxis and morphogenesis. The developmental consequences of cAMP signaling and the metabolism of cAMP have been studied in great detail, but it has been unclear how cells export cAMP across the plasma membrane. Here we show pharmacologically and genetically that ABC transporters mediate cAMP export. Using an evolutionary-developmental biology approach, we identified several candidate abc genes and characterized one of them, abcB3, in more detail. Genetic and biochemical evidence suggest that AbcB3 is a component of the cAMP export mechanism in D. discoideum development. PMID:25448698

  2. Cyclic Amp phosphodiesterase activity in normal and inflamed human dental pulp.

    PubMed

    Spoto, G; Menna, V; Serra, E; Santoleri, F; Perfetti, G; Ciavarelli, L; Trentini, P

    2004-01-01

    Cyclic AMP phosphodiesterase (cAMP PDE) seems to be important in pulp tissues. High levels of cAMP PDE have been demonstrated to be in dental pulp cells. In the present study cAMP PDE activity was analyzed in normal healthy human dental pulps, in reversible pulpitis and in irreversible pulpitis. Enzymatic cAMP PDE control values for normal healthy pulps were 12.14 +/- 3.74 nmols/mg of proteins. In reversible pulpitis the cAMP PDE activity increased almost 2.5 times. In irreversible pulpitis specimens the values increased 4.5 times compared with normal healthy pulps activity. The differences between the groups (control vs. reversible pulpitis and vs. irreversible pulpitis) were statistically significant. These results could point to a role of cAMP PDE in the initial pulp response after injury. PMID:16857100

  3. Beta-Adrenergic Receptor Population is Up-Regulated by Increased Cyclic Amp Concentration in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Vaughn, Jeffrey R.

    1999-01-01

    Skeletal muscle hypertrophy is promoted in vivo by administration of beta-drenergic receptor (bAR) agonists. Chicken skeletal muscle cells were treated with 1 (mu)M isoproterenol, a strong bAR agonist, between days 7 and 10 in culture. bAR population increased by approximately 40% during this treatment; however, the ability of the cells to synthesize cyclic AMP (cAMP) was diminished by two-fold. The quantity of myosin heavy chain (MHC) was not affected. To understand further the relationship between intracellular cAMP levels, bAR population, and muscle protein accumulation, intracellular cAMP levels were artificially elevated by treatment with 0-10 uM forskolin for up to three days. The basal concentration of CAMP in forskolin-treated cells increased up to 7-fold in a dose dependent manner. Increasing concentrations of forskolin also led to an increase in bAR population, with a maximum increase of approximately 40-60% at 10 uM forskolin. A maximum increase of 40-50% in the quantity of MHC was observed at 0.2 uM forskolin, but higher concentrations of forskolin reduced the quantity of MHC back to control levels. At 0.2 uM forskolin, intracellular levels of cAMP were higher by approximately 35%, and the (beta)AR population was higher by approximately 30%. Neither the number of muscle nuclei fused into myotubes nor the percentage of nuclei in myotubes were affected by forskolin at any of the concentrations studied.

  4. Role of LRP1 and ERK and cAMP Signaling Pathways in Lactoferrin-Induced Lipolysis in Mature Rat Adipocytes

    PubMed Central

    Ikoma-Seki, Keiko; Nakamura, Kanae; Morishita, Satoru; Ono, Tomoji; Sugiyama, Keikichi; Nishino, Hoyoku; Hirano, Hisashi; Murakoshi, Michiaki

    2015-01-01

    Lactoferrin (LF) is a multifunctional glycoprotein present in milk. A clinical study showed that enteric-coated bovine LF tablets decrease visceral fat accumulation. Furthermore, animal studies revealed that ingested LF is partially delivered to mesenteric fat, and in vitro studies showed that LF promotes lipolysis in mature adipocytes. The aim of the present study was to determine the mechanism underlying the induction of lipolysis in mature adipocytes that is induced by LF. To address this question, we used proteomics techniques to analyze protein expression profiles. Mature adipocytes from primary cultures of rat mesenteric fat were collected at various times after exposure to LF. Proteomic analysis revealed that the expression levels of hormone-sensitive lipase (HSL), which catalyzes the rate-limiting step of lipolysis, were upregulated and that HSL was activated by protein kinase A within 15 min after the cells were treated with LF. We previously reported that LF increases the intracellular concentration of cyclic adenosine monophosphate (cAMP), suggesting that LF activates the cAMP signaling pathway. In this study, we show that the expression level and the activity of the components of the extracellular signal-regulated kinase (ERK) signaling pathway were upregulated. Moreover, LF increased the activity of the transcription factor cAMP response element binding protein (CREB), which acts downstream in the cAMP and ERK signaling pathways and regulates the expression levels of adenylyl cyclase and HSL. Moreover, silencing of the putative LF receptor low-density lipoprotein receptor-related protein 1 (LRP1) attenuated lipolysis in LF-treated adipocytes. These results suggest that LF promoted lipolysis in mature adipocytes by regulating the expression levels of proteins involved in lipolysis through controlling the activity of cAMP/ERK signaling pathways via LRP1. PMID:26506094

  5. Different β-adrenoceptor subtypes coupling to cAMP or NO/cGMP pathways: implications in the relaxant response of rat conductance and resistance vessels

    PubMed Central

    Flacco, N; Segura, V; Perez-Aso, M; Estrada, S; Seller, JF; Jiménez-Altayó, F; Noguera, MA; D'Ocon, P; Vila, E; Ivorra, MD

    2013-01-01

    Background and Purpose To analyse the relative contribution of β1-, β2- and β3-adrenoceptors (Adrb) to vasodilatation in conductance and resistance vessels, assessing the role of cAMP and/or NO/cGMP signalling pathways. Experimental Approach Rat mesenteric resistance artery (MRA) and aorta were used to analyse the Adrb expression by real-time-PCR and immunohistochemistry, and for the pharmacological characterization of Adrb-mediated activity by wire myography and tissue nucleotide accumulation. Key Results The mRNAs and protein for all Adrb were identified in endothelium and/or smooth muscle cells (SMCs) in both vessels. In MRA, Adrb1 signalled through cAMP, Adrb3 through both cAMP and cGMP, but Adrb2, did not activate nucleotide formation; isoprenaline relaxation was inhibited by propranolol (β1, β2), CGP20712A (β1), and SQ22536 (adenylyl cyclase inhibitor), but not by ICI118,551 (β2), SR59230A (β3), ODQ (soluble guanylyl cyclase inhibitor), L-NAME or endothelium removal. In aorta, Adrb1 signalled through cAMP, while β2- and β3-subtypes through cGMP; isoprenaline relaxation was inhibited by propranolol, ICI118,551, ODQ, L-NAME, and to a lesser extent, by endothelium removal. CL316243 (β3-agonist) relaxed aorta, but not MRA. Conclusion and Implication Despite all three Adrb subtypes being found in both vessels, Adrb1, located in SMCs and acting through the adenylyl cyclase/cAMP pathway, are primarily responsible for vasodilatation in MRA. However, Adrb-mediated vasodilatation in aorta is driven by endothelial Adrb2 and Adrb3, but also by the Adrb2 present in SMCs, and is coupled to the NO/cGMP pathway. These results could help to understand the different physiological roles played by Adrb signalling in regulating conductance and resistance vessels. PMID:23373597

  6. Three-dimensional measurement of cAMP gradients using hyperspectral confocal microscopy

    NASA Astrophysics Data System (ADS)

    Rich, Thomas C.; Annamdevula, Naga; Britain, Andrea L.; Mayes, Samuel; Favreau, Peter F.; Leavesley, Silas J.

    2016-03-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions over a wide range of timescales. Several lines of evidence have suggested that the distribution of cAMP within cells is not uniform, and that cAMP compartmentalization is largely responsible for signaling specificity within the cAMP signaling pathway. However, to date, no studies have experimentally measured three dimensional (3D) cAMP distributions within cells. Here we use both 2D and 3D hyperspectral microscopy to visualize cAMP gradients in endothelial cells from the pulmonary microvasculature (PMVECs). cAMP levels were measured using a FRETbased cAMP sensor comprised of a cAMP binding domain from EPAC sandwiched between FRET donors and acceptors -- Turquoise and Venus fluorescent proteins. Data were acquired using either a Nikon A1R spectral confocal microscope or custom spectral microscopy system. Analysis of hyperspectral image stacks from a single confocal slice or from summed images of all slices (2D analysis) indicated little or no cAMP gradients were formed within PMVECs under basal conditions or following agonist treatment. However, analysis of hyperspectral image stacks from 3D cellular geometries (z stacks) demonstrate marked cAMP gradients from the apical to basolateral membrane of PMVECs. These results strongly suggest that 2D imaging studies of cAMP compartmentalization -- whether epifluorescence or confocal microscopy -- may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D studies are required to assess mechanisms of signaling specificity.

  7. Dissociations in the Effects of β2-Adrenergic Receptor Agonists on cAMP Formation and Superoxide Production in Human Neutrophils: Support for the Concept of Functional Selectivity

    PubMed Central

    Brunskole Hummel, Irena; Reinartz, Michael T.; Kälble, Solveig; Burhenne, Heike; Schwede, Frank; Buschauer, Armin; Seifert, Roland

    2013-01-01

    In neutrophils, activation of the β2-adrenergic receptor (β2AR), a Gs-coupled receptor, inhibits inflammatory responses, which could be therapeutically exploited. The aim of this study was to evaluate the effects of various β2AR ligands on adenosine-3′,5′-cyclic monophosphate (cAMP) accumulation and N-formyl-L-methionyl-L-leucyl-L-phenylalanine (fMLP)-induced superoxide anion (O2•−) production in human neutrophils and to probe the concept of ligand-specific receptor conformations (also referred to as functional selectivity or biased signaling) in a native cell system. This is an important question because so far, evidence for functional selectivity has been predominantly obtained with recombinant systems, due to the inherent difficulties to genetically manipulate human native cells. cAMP concentration was determined by HPLC/tandem mass spectrometry, and O2•− formation was assessed by superoxide dismutase-inhibitable reduction of ferricytochrome c. β2AR agonists were generally more potent in inhibiting fMLP-induced O2•− production than in stimulating cAMP accumulation. (−)-Ephedrine and dichloroisoproterenol were devoid of any agonistic activity in the cAMP assay, but partially inhibited fMLP-induced O2•− production. Moreover, (−)-adrenaline was equi-efficacious in both assays whereas the efficacy of salbutamol was more than two-fold higher in the O2•− assay. Functional selectivity was visualized by deviations of ligand potencies and efficacies from linear correlations for various parameters. We obtained no evidence for involvement of protein kinase A in the inhibition of fMLP-induced O2•− production after β2AR-stimulation although cAMP-increasing substances inhibited O2•− production. Taken together, our data corroborate the concept of ligand-specific receptor conformations with unique signaling capabilities in native human cells and suggest that the β2AR inhibits O2•− production in a cAMP-independent manner. PMID

  8. A New Dynamic Accumulator for Batch Updates

    NASA Astrophysics Data System (ADS)

    Wang, Peishun; Wang, Huaxiong; Pieprzyk, Josef

    A dynamic accumulator is an algorithm, which gathers together a large set of elements into a constant-size value such that for a given element accumulated, there is a witness confirming that the element was indeed included into the value, with a property that accumulated elements can be dynamically added and deleted into/from the original set such that the cost of an addition or deletion operation is independent of the number of accumulated elements. Although the first accumulator was presented ten years ago, there is still no standard formal definition of accumulators. In this paper, we generalize formal definitions for accumulators, formulate a security game for dynamic accumulators so-called Chosen Element Attack (CEA), and propose a new dynamic accumulator for batch updates based on the Paillier cryptosystem. Our construction makes a batch of update operations at unit cost. We prove its security under the extended strong RSA (es-RSA) assumption.

  9. Mogrol Derived from Siraitia grosvenorii Mogrosides Suppresses 3T3-L1 Adipocyte Differentiation by Reducing cAMP-Response Element-Binding Protein Phosphorylation and Increasing AMP-Activated Protein Kinase Phosphorylation.

    PubMed

    Harada, Naoki; Ishihara, Mikako; Horiuchi, Hiroko; Ito, Yuta; Tabata, Hiromitsu; Suzuki, Yasushi A; Nakano, Yoshihisa; Yamaji, Ryoichi; Inui, Hiroshi

    2016-01-01

    This study investigated the effects of mogrol, an aglycone of mogrosides from Siraitia grosvenorii, on adipogenesis in 3T3-L1 preadipocytes. Mogrol, but not mogrosides, suppressed triglyceride accumulation by affecting early (days 0-2) and late (days 4-8), but not middle (days 2-4), differentiation stages. At the late stage, mogrol increased AMP-activated protein kinase (AMPK) phosphorylation and reduced glycerol-3-phosphate dehydrogenase activity. At the early stage, mogrol promoted AMPK phosphorylation, inhibited the induction of CCAAT/enhancer-binding protein β (C/EBPβ; a master regulator of adipogenesis), and reduced 3T3-L1 cell contents (e.g., clonal expansion). In addition, mogrol, but not the AMPK activator AICAR, suppressed the phosphorylation and activity of the cAMP response element-binding protein (CREB), which regulates C/EBPβ expression. These results indicated that mogrol suppressed adipogenesis by reducing CREB activation in the initial stage of cell differentiation and by activating AMPK signaling in both the early and late stages of this process. PMID:27583359

  10. Regulation of Mg2+ Reabsorption and Transient Receptor Potential Melastatin Type 6 Activity by cAMP Signaling.

    PubMed

    Blanchard, Maxime G; Kittikulsuth, Wararat; Nair, Anil V; de Baaij, Jeroen H F; Latta, Femke; Genzen, Jonathan R; Kohan, Donald E; Bindels, René J M; Hoenderop, Joost G J

    2016-03-01

    The transient receptor potential melastatin type 6 (TRPM6) epithelial Mg(2+) channels participate in transcellular Mg(2+) transport in the kidney and intestine. Previous reports suggested a hormonal cAMP-dependent regulation of Mg(2+) reabsorption in the kidney. The molecular details of this process are, however, unknown. Adenylate cyclase 3 (Adcy3) has been shown to colocalize with the Na(+)/Cl(-) cotransporter, a marker of the distal convoluted segment of the kidney, the principal site of TRPM6 expression. Given the critical role of TRPM6 in Mg(2+) reabsorption, an inducible kidney-specific Adcy3 deletion mouse model was characterized for blood and urinary electrolyte disturbances under a normal--and low--Mg(2+) diet. Increased urinary Mg(2+) wasting and Trpm6 mRNA levels were observed in the urine and kidney of Adcy3-deleted animals compared with wild-type controls. Serum Mg(2+) concentration was significantly lower in Adcy3-deleted animals at day 7 on the low Mg(2+) diet. Using patch clamp electrophysiology, cell surface biotinylation, and total internal reflection fluorescence live cell imaging of transfected HEK293 cells, we demonstrated that cAMP signaling rapidly potentiates TRPM6 activity by promoting TRPM6 accumulation at the plasma membrane and increasing its single-channel conductance. Comparison of electrophysiological data from cells expressing the phosphorylation-deficient S1252A or phosphomimetic S1252D TRPM6 mutants suggests that phosphorylation at this intracellular residue participates in the observed stimulation of channel activity. Altogether, these data support a physiologically relevant magnesiotropic role of cAMP signaling in the kidney by a direct stimulatory action of protein kinase A on the plasma membrane trafficking and function of TRPM6 ion channels. PMID:26150606

  11. IGF-I–induced Differentiation of L6 Myogenic Cells Requires the Activity of cAMP-Phosphodiesterase

    PubMed Central

    De Arcangelis, Vania; Coletti, Dario; Conti, Marco; Lagarde, Michel; Molinaro, Mario; Adamo, Sergio; Nemoz, Georges; Naro, Fabio

    2003-01-01

    Inhibition of type 4 cAMP-specific phosphodiesterase (PDE4) activity in L6-C5 and L6-E9 abolished myogenic differentiation induced by low-serum medium and IGF-I. L6-C5 cells cultured in low-serum medium displayed a PDE4 activity higher than cells cultured in serum-free medium, a condition not sufficient to induce differentiation. In the presence of serum, PDE4D3, the major isoform natively expressed in L6-C5 cells, translocated to a Triton-insoluble fraction, which increased the PDE specific activity of the fraction, and exhibited a Mr shift typical of phosphorylation of this isoform. Furthermore, serum promoted the localization of PDE4D3 to a vesicular subcellular compartment. In L6-C5 cells, IGF-I is a stronger inducer of myogenic differentiation in the presence than in absence of serum. Its ability to trigger differentiation in the absence of serum was restored by overexpressing wild-type PDE4D3, but not a phosphorylation-insensitive mutant. This finding was confirmed in single cells overexpressing a GFP-PDE4D3 fusion protein by assessing nuclear accumulation of myogenin in both L6-C5 and L6-E9. Overexpression of other PDE isoforms was less efficient, confirming that PDE4D3 is the physiologically relevant phosphodiesterase isoform in the control of myogenesis. These results show that downregulation of cAMP signaling through cAMP-phosphodiesterase stimulation is a prerequisite for induction of myogenesis. PMID:12686596

  12. Inhibition of Gαs/cAMP Signaling Decreases TCR-Stimulated IL-2 transcription in CD4+ T Helper Cells

    PubMed Central

    Hynes, Thomas R.; Yost, Evan A.; Yost, Stacy M.; Hartle, Cassandra M.; Ott, Braden J.

    2015-01-01

    Background: The role of cAMP in regulating T cell activation and function has been controversial. cAMP is generally known as an immunosuppressant, but it is also required for generating optimal immune responses. As the effect of cAMP is likely to depend on its cellular context, the current study investigated whether the mechanism of activation of Gαs and adenylyl cyclase influences their effect on T cell receptor (TCR)-stimulated interleukin-2 (IL-2) mRNA levels. Methods: The effect of blocking Gs-coupled receptor (GsPCR)-mediated Gs activation on TCR-stimulated IL-2 mRNA levels in CD4+ T cells was compared with that of knocking down Gαs expression or inhibiting adenylyl cyclase activity. The effect of knocking down Gαs expression on TCR-stimulated cAMP accumulation was compared with that of blocking GsPCR signaling. Results: ZM-241385, an antagonist to the Gs-coupled A2A adenosine receptor (A2AR), enhanced TCR-stimulated IL-2 mRNA levels in primary human CD4+ T helper cells and in Jurkat T cells. A dominant negative Gαs construct, GαsDN3, also enhanced TCR-stimulated IL-2 mRNA levels. Similar to GsPCR antagonists, GαsDN3 blocked GsPCR-dependent activation of both Gαs and Gβγ. In contrast, Gαs siRNA and 2’,5’-dideoxyadenosine (ddA), an adenylyl cyclase inhibitor, decreased TCR-stimulated IL-2 mRNA levels. Gαs siRNA, but not GαsDN3, decreased TCR-stimulated cAMP synthesis. Potentiation of IL-2 mRNA levels by ZM-241385 required at least two days of TCR stimulation, and addition of ddA after three days of TCR stimulation enhanced IL-2 mRNA levels. Conclusions: GsPCRs play an inhibitory role in the regulation of TCR-stimulated IL-2 mRNA levels whereas Gαs and cAMP can play a stimulatory one. Additionally, TCR-dependent activation of Gαs does not appear to involve GsPCRs. These results suggest that the context of Gαs/cAMP activation and the stage of T cell activation and differentiation determine the effect on TCR-stimulated IL-2 mRNA levels. PMID

  13. Expression and organization of BP74, a cyclic AMP-regulated gene expressed during Dictyostelium discoideum development.

    PubMed Central

    Hopkinson, S B; Pollenz, R S; Drummond, I; Chisholm, R L

    1989-01-01

    We have characterized a cDNA and the corresponding gene for a cyclic AMP-inducible gene expressed during Dictyostelium development. This gene, BP74, was found to be first expressed about the time of aggregate formation, approximately 6 h after starvation. Accumulation of BP74 mRNA did not occur in Dictyostelium cells that had been starved in fast-shaken suspension cultures but was induced in similar cultures to which cyclic AMP pulses had been added. The BP74 cDNA and gene were characterized by DNA sequence analysis and transcriptional mapping. When the BP74 promoter region was fused with a chloramphenicol acetyltransferase reporter gene and reintroduced into Dictyostelium cells, the transfected chloramphenicol acetyltransferase gene displayed the same developmentally regulated pattern of expression as did the endogenous BP74 gene, suggesting that all of the cis-acting elements required for regulated expression were carried by a 2-kilobase cloned genomic fragment. On the basis of sequence analysis, the gene appeared to encode a protein containing a 20-residue hydrophobic sequence at the amino-terminal end and 26 copies of a 20-amino-acid repeat. Images PMID:2555685

  14. Early methyl donor deficiency alters cAMP signaling pathway and neurosteroidogenesis in the cerebellum of female rat pups.

    PubMed

    El Hajj Chehadeh, Sarah; Dreumont, Natacha; Willekens, Jérèmy; Canabady-Rochelle, Laetitia; Jeannesson, Elise; Alberto, Jean-Marc; Daval, Jean-Luc; Guéant, Jean-Louis; Leininger-Muller, Brigitte

    2014-12-01

    Early deficiency of the methyl donors folate and vitamin B12 produces hyperhomocysteinemia and cognitive and motor disorders in 21-day-old rat pups from dams fed a diet deficient in methyl donors during gestation and lactation. These disorders are associated with impaired neurogenesis and altered synaptic plasticity in cerebellum. We aimed to investigate whether these disorders could be related to impaired expression of neurosteroidogenesis-associated proteins, key regulator receptors, and some steroid content in the cerebellum. The methyl donor deficiency produced a decreased concentration of folate and vitamin B12, along with accumulation of homocysteine in Purkinje cells in both sexes, whereas the S-adenosylmethionine/S-adenosylhomocysteine ratio was reduced only in females. The transcription level and protein expression of StAR, aromatase, ERα, ERβ, and LH receptors were decreased only in females, with a marked effect in Purkinje cells, as shown by immunohistochemistry. Consistently, reduced levels of estradiol and pregnenolone were measured in cerebellar extracts of females only. The decreased expression levels of the transcriptional factors CREB, phospho-CREB, and SF-1, the lesser increase of cAMP concentration, and the lower level of phospho-PKC in the cerebellum of deficient females suggest that the activation of neurosteroidogenesis via cAMP-mediated signaling pathways associated with LHR activation would be altered. In conclusion, a gestational methyl donor deficiency impairs neurosteroidogenesis in cerebellum in a sex-dependent manner. PMID:25294213

  15. Differential distribution of cAMP receptors cAR2 and cAR3 during Dictyostelium development.

    PubMed

    Yu, Y; Saxe, C L

    1996-01-10

    Signal transduction via a family of cAMP receptor subtypes (cARs) is critical for proper development in the cellular slime mold Dictyostelium. Genes encoding four related subtypes have been cloned and their expression, based on RNA accumulation, has been previously reported. Here we report the differential spatial and temporal distribution of cAR2 and cAR3 proteins, based on indirect double immunofluorescence. Cells were transformed with a carB::lacZ construct, and an antibody against beta-galactosidase was used to visualize cAR2 expression. Simultaneously, a cAR3-specific antibody was used to identify cAR3-expressing cells. Results indicate that by the time of tip formation (12-14 hr) both receptors are expressed and distribute in a virtually nonoverlapping pattern, with cAR2 being expressed on anterior, prestalk cells and cAR3 present in the rest of the organism. Differential distribution of these two receptor subtypes may result in distinct cAMP signaling mechanisms in the two major regions of the organism. PMID:8575636

  16. AMP-activated Protein Kinase Signaling Activation by Resveratrol Modulates Amyloid-β Peptide Metabolism*

    PubMed Central

    Vingtdeux, Valérie; Giliberto, Luca; Zhao, Haitian; Chandakkar, Pallavi; Wu, Qingli; Simon, James E.; Janle, Elsa M.; Lobo, Jessica; Ferruzzi, Mario G.; Davies, Peter; Marambaud, Philippe

    2010-01-01

    Alzheimer disease is an age-related neurodegenerative disorder characterized by amyloid-β (Aβ) peptide deposition into cerebral amyloid plaques. The natural polyphenol resveratrol promotes anti-aging pathways via the activation of several metabolic sensors, including the AMP-activated protein kinase (AMPK). Resveratrol also lowers Aβ levels in cell lines; however, the underlying mechanism responsible for this effect is largely unknown. Moreover, the bioavailability of resveratrol in the brain remains uncertain. Here we show that AMPK signaling controls Aβ metabolism and mediates the anti-amyloidogenic effect of resveratrol in non-neuronal and neuronal cells, including in mouse primary neurons. Resveratrol increased cytosolic calcium levels and promoted AMPK activation by the calcium/calmodulin-dependent protein kinase kinase-β. Direct pharmacological and genetic activation of AMPK lowered extracellular Aβ accumulation, whereas AMPK inhibition reduced the effect of resveratrol on Aβ levels. Furthermore, resveratrol inhibited the AMPK target mTOR (mammalian target of rapamycin) to trigger autophagy and lysosomal degradation of Aβ. Finally, orally administered resveratrol in mice was detected in the brain where it activated AMPK and reduced cerebral Aβ levels and deposition in the cortex. These data suggest that resveratrol and pharmacological activation of AMPK have therapeutic potential against Alzheimer disease. PMID:20080969

  17. Exchange protein directly activated by cAMP (epac): a multidomain cAMP mediator in the regulation of diverse biological functions.

    PubMed

    Schmidt, Martina; Dekker, Frank J; Maarsingh, Harm

    2013-04-01

    Since the discovery nearly 60 years ago, cAMP is envisioned as one of the most universal and versatile second messengers. The tremendous feature of cAMP to tightly control highly diverse physiologic processes, including calcium homeostasis, metabolism, secretion, muscle contraction, cell fate, and gene transcription, is reflected by the award of five Nobel prizes. The discovery of Epac (exchange protein directly activated by cAMP) has ignited a new surge of cAMP-related research and has depicted novel cAMP properties independent of protein kinase A and cyclic nucleotide-gated channels. The multidomain architecture of Epac determines its activity state and allows cell-type specific protein-protein and protein-lipid interactions that control fine-tuning of pivotal biologic responses through the "old" second messenger cAMP. Compartmentalization of cAMP in space and time, maintained by A-kinase anchoring proteins, phosphodiesterases, and β-arrestins, contributes to the Epac signalosome of small GTPases, phospholipases, mitogen- and lipid-activated kinases, and transcription factors. These novel cAMP sensors seem to implement certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Agonists and antagonists selective for Epac are developed and will support further studies on the biologic net outcome of the activation of Epac. This will increase our current knowledge on the pathophysiology of devastating diseases, such as diabetes, cognitive impairment, renal and heart failure, (pulmonary) hypertension, asthma, and chronic obstructive pulmonary disease. Further insights into the cAMP dynamics executed by the Epac signalosome will help to optimize the pharmacological treatment of these diseases. PMID:23447132

  18. A novel biosensor to study cAMP dynamics in cilia and flagella

    PubMed Central

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca2+, basal SACY activity is suppressed by Ca2+. Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. DOI: http://dx.doi.org/10.7554/eLife.14052.001 PMID:27003291

  19. Cardiac myocyte–secreted cAMP exerts paracrine action via adenosine receptor activation

    PubMed Central

    Sassi, Yassine; Ahles, Andrea; Truong, Dong-Jiunn Jeffery; Baqi, Younis; Lee, Sang-Yong; Husse, Britta; Hulot, Jean-Sébastien; Foinquinos, Ariana; Thum, Thomas; Müller, Christa E.; Dendorfer, Andreas; Laggerbauer, Bernhard; Engelhardt, Stefan

    2014-01-01

    Acute stimulation of cardiac β-adrenoceptors is crucial to increasing cardiac function under stress; however, sustained β-adrenergic stimulation has been implicated in pathological myocardial remodeling and heart failure. Here, we have demonstrated that export of cAMP from cardiac myocytes is an intrinsic cardioprotective mechanism in response to cardiac stress. We report that infusion of cAMP into mice averted myocardial hypertrophy and fibrosis in a disease model of cardiac pressure overload. The protective effect of exogenous cAMP required adenosine receptor signaling. This observation led to the identification of a potent paracrine mechanism that is dependent on secreted cAMP. Specifically, FRET-based imaging of cAMP formation in primary cells and in myocardial tissue from murine hearts revealed that cardiomyocytes depend on the transporter ABCC4 to export cAMP as an extracellular signal. Extracellular cAMP, through its metabolite adenosine, reduced cardiomyocyte cAMP formation and hypertrophy by activating A1 adenosine receptors while delivering an antifibrotic signal to cardiac fibroblasts by A2 adenosine receptor activation. Together, our data reveal a paracrine role for secreted cAMP in intercellular signaling in the myocardium, and we postulate that secreted cAMP may also constitute an important signal in other tissues. PMID:25401477

  20. Leveraging family-specific signatures for AMP discovery and high-throughput annotation

    PubMed Central

    Waghu, Faiza Hanif; Barai, Ram Shankar; Idicula-Thomas, Susan

    2016-01-01

    Antimicrobial peptides (AMPs) are diverse, biologically active, essential components of the innate immune system. As compared to conventional antibiotics, AMPs exhibit broad spectrum antimicrobial activity, reduced toxicity and reduced microbial resistance. They are widely researched for their therapeutic potential, especially against multi-drug resistant pathogens. AMPs are known to have family-specific sequence composition, which can be mined for their discovery and rational design. Here, we present a detailed family-based study on AMP families. The study involved the use of sequence signatures represented by patterns and hidden Markov models (HMMs) present in experimentally studied AMPs to identify novel AMPs. Along with AMPs, peptides hitherto lacking antimicrobial annotation were also retrieved and wet-lab studies on randomly selected sequences proved their antimicrobial activity against Escherichia coli. CAMPSign, a webserver has been created for researchers to effortlessly exploit the use of AMP family signatures for identification of AMPs. The webserver is available online at www.campsign.bicnirrh.res.in. In this work, we demonstrate an optimised and experimentally validated protocol along with a freely available webserver that uses family-based sequence signatures for accelerated discovery of novel AMPs. PMID:27089856

  1. A novel biosensor to study cAMP dynamics in cilia and flagella.

    PubMed

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca(2+), basal SACY activity is suppressed by Ca(2+). Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. PMID:27003291

  2. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  3. Endogenous expression of histamine H1 receptors functionally coupled to phosphoinositide hydrolysis in C6 glioma cells: regulation by cyclic AMP.

    PubMed Central

    Peakman, M C; Hill, S J

    1994-01-01

    1. The effects of histamine receptor agonists and antagonists on phospholipid hydrolysis in rat-derived C6 glioma cells have been investigated. 2. Histamine H1 receptor-stimulation caused a concentration-dependent increase in the accumulation of total [3H]-inositol phosphates in cells prelabelled with [3H]-myo-inositol. The rank order of agonist potencies was histamine (EC50 = 24 microM) > N alpha-methylhistamine (EC50 = 31 microM) > 2-thiazolylethylamine (EC50 = 91 microM). 3. The response to 0.1 mM histamine was antagonized in a concentration-dependent manner by the H1-antagonists, mepyramine (apparent Kd = 1 nM) and (+)-chlorpheniramine (apparent Kd = 4 nM). In addition, (-)-chlorpheniramine was more than two orders of magnitude less potent than its (+)-stereoisomer. 4. Elevation of intracellular cyclic AMP accumulation with forskolin (10 microM, EC50 = 0.3 microM), isoprenaline (1 microM, EC50 = 4 nM) or rolipram (0.5 mM), significantly reduced the histamine-mediated (0.1 mM) inositol phosphate response by 37%, 43% and 26% respectively. In contrast, 1,9-dideoxyforskolin did not increase cyclic AMP accumulation and had no effect on the phosphoinositide response to histamine. 5. These data indicate the presence of functionally coupled, endogenous histamine H1 receptors in C6 glioma cells. Furthermore, the results also indicate that H1 receptor-mediated phospholipid hydrolysis is inhibited by the elevation of cyclic AMP levels in these cells. PMID:7889313

  4. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation.

    PubMed

    Yang, Pei-Chi; Boras, Britton W; Jeng, Mao-Tsuen; Docken, Steffen S; Lewis, Timothy J; McCulloch, Andrew D; Harvey, Robert D; Clancy, Colleen E

    2016-07-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  5. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation

    PubMed Central

    Yang, Pei-Chi; Boras, Britton W.; Jeng, Mao-Tsuen; Lewis, Timothy J.; McCulloch, Andrew D.; Harvey, Robert D.; Clancy, Colleen E.

    2016-01-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  6. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.

    PubMed

    Sucic, J F; Selmin, O; Rutherford, C L

    1993-01-01

    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  7. Stimulation of cyclic adenosine monophosphate accumulation causes breakdown of the blood-retinal barrier.

    PubMed

    Sen, H A; Campochiaro, P A

    1991-06-01

    Pigmented rabbits were given an intravitreous injection of 0.1 ml of various concentrations of test drug, and vitreous fluorophotometry was done 6 and 24 hr after injection. Dibutyryl cyclic adenosine monophosphate (AMP) and 8-bromo-cyclic AMP caused reversible intravitreous fluorescein leakage only at relatively high concentrations. Adrenergic agents that are effective stimulators of adenylate cyclase (epinephrine, isoproterenol, and norepinephrine) caused transient intravitreous fluorescein leakage (2.3-3.1-fold above baseline) that was significantly greater than that caused by phenylephrine (1.1-fold above baseline), an adrenergic agent that is a poor stimulator of adenylate cyclase. Prostaglandins E1 and E2, which are good stimulators of adenylate cyclase, caused striking disruption of the blood-ocular barriers, and prostaglandins that are not good stimulators of adenylate cyclase had little or no effect on these barriers. The magnitude of the prostaglandin E1 effect (9.3-fold above baseline) was similar to that of N-ethylcarboxamidoadenosine (NECA), the most potent adenosine agonist, and was greater than one would predict based on its effect on adenylate cyclase in vitro. Prostaglandin E1, like NECA, also caused retinal vasodilation and hemorrhages. These data suggest that stimulation of intracellular cyclic AMP accumulation may be a common feature of mediators that cause breakdown of the blood-retinal barrier, but there may be another as yet unexplained feature shared by PGE1 and NECA that makes them particularly effective and capable of causing retinal vasodilation and hemorrhages. PMID:1647374

  8. Racial Differences in Patterns of Wealth Accumulation

    ERIC Educational Resources Information Center

    Gittleman, Maury; Wolff, Edward N.

    2004-01-01

    The race differences in patterns of asset accumulations were examined using PSD data for 1984, 1989 and 1994. The results indicate that inheritances led to wealth accumulations among whites as compared to the African Americans.

  9. Neurodegeneration with brain iron accumulation (NBIA)

    MedlinePlus

    ... gov/ency/article/001225.htm Neurodegeneration with brain iron accumulation (NBIA) To use the sharing features on this page, please enable JavaScript. Neurodegeneration with brain iron accumulation (formerly known as Hallervorden-Spatz disease) is ...

  10. Characterization of prostanoid receptors on rat neutrophils.

    PubMed Central

    Wise, H; Jones, R L

    1994-01-01

    1. The effects of various prostanoid agonists have been compared on the increase in intracellular free calcium ([Ca2+]i) and the aggregation reaction of rat peritoneal neutrophils induced by N-formyl-L-methionyl-L-leucyl-L-phenylalanine (FMLP). 2. Prostaglandin E2 (PGE2) and the specific IP-receptor agonist, cicaprost, both inhibited the FMLP-induced increase in [Ca2+]i (IC50 33 nM and 18 nM respectively) and the FMLP-induced aggregation reaction (IC50 5.6 nM and 7.9 nM respectively). PGD2, PGF2 alpha, and the TP-receptor agonist, U 46619, were inactive at the highest concentration tested (1 microM). 3. The EP1-receptor agonist, 17-phenyl-omega-trinor PGE2, and the EP3-receptor agonists, GR 63799X and sulprostone, had no inhibitory effect on FMLP-stimulated rat neutrophils. 4. PGE1 (EP/IP-receptor agonist) and iloprost (IP-receptor agonist) inhibited the FMLP-induced increase in [Ca2+]i with IC50 values of 34 nM and 38 nM respectively. The EP2-receptor agonists, butaprost and misoprostol (1 microM), inhibited both FMLP-stimulated [Ca2+]i and aggregation. However another EP2-receptor agonist, AH 13205, was inactive in both assays. 5. Prostanoid receptors present on rat neutrophils were further characterized by measuring [3H]-adenosine 3':5'-cyclic monophosphate ([3H]-cyclic AMP) accumulation. Only those agonists capable of stimulating [3H]-cyclic AMP accumulation were able to inhibit both FMLP-stimulated [Ca2+]i and aggregation. 6. These results indicate that rat neutrophils possess inhibitory IP and EP-receptors; the relative potencies of PGE2, misoprostol and butaprost are those expected for the EP2-receptor subtype. No evidence for DP, FP, TP or EP1 and EP3-receptors was obtained. PMID:7834211

  11. 47 CFR 32.3100 - Accumulated depreciation.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Accumulated depreciation. 32.3100 Section 32... Accumulated depreciation. (a) This account shall include the accumulated depreciation associated with the... with depreciation amounts concurrently charged to Account 6561, Depreciation...

  12. 46 CFR 58.30-25 - Accumulators.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Accumulators. 58.30-25 Section 58.30-25 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING MAIN AND AUXILIARY MACHINERY AND RELATED SYSTEMS Fluid Power and Control Systems § 58.30-25 Accumulators. (a) An accumulator is an unfired pressure vessel in which energy is...

  13. Chip integrated fuel cell accumulator

    NASA Astrophysics Data System (ADS)

    Frank, M.; Erdler, G.; Frerichs, H.-P.; Müller, C.; Reinecke, H.

    A unique new design of a chip integrated fuel cell accumulator is presented. The system combines an electrolyser and a self-breathing polymer electrolyte membrane (PEM) fuel cell with integrated palladium hydrogen storage on a silicon substrate. Outstanding advantages of this assembly are the fuel cell with integrated hydrogen storage, the possibility of refuelling it by electrolysis and the opportunity of simply refilling the electrolyte by adding water. By applying an electrical current, wiring the palladium hydrogen storage as cathode and the counter-electrode as anode, the electrolyser produces hydrogen at the palladium surface and oxygen at the electrolyser cell anode. The generated hydrogen is absorbed by the palladium electrode and the hydrogen storage is refilled consequently enabling the fuel cell to function.

  14. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases. PMID:24750474

  15. cAMP and Ca2+ signaling in secretory epithelia: Crosstalk and Synergism

    PubMed Central

    Ahuja, Malini; Jha, Archana; Maléth, Jozsef; Park, Seonghee; Muallem, Shmuel

    2014-01-01

    The Ca2+ and cAMP/PKA pathways are the primary signaling systems in secretory epithelia that control virtually all secretory gland functions. Interaction and crosstalk in Ca2+ and cAMP signaling occur at multiple levels to control and tune the activity of each other. Physiologically, Ca2+ and cAMP signaling operate at 5–10% of maximal strength, but synergize to generate the maximal response. Although synergistic action of the Ca2+ and cAMP signaling is the common mode of signaling and has been known for many years, we know very little of the molecular mechanism and mediators of the synergism. In this review, we discuss crosstalk between the Ca2+ and cAMP signaling and the function of IRBIT (IP3 receptors binding protein release with IP3) as a third messenger that mediates the synergistic action of the Ca2+ and cAMP signaling. PMID:24613710

  16. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP. PMID:27596420

  17. Electrostatic steering enhances the rate of cAMP binding to phosphodiesterase: Brownian dynamics modeling.

    PubMed

    Huang, Yu-ming M; Huber, Gary; McCammon, J Andrew

    2015-11-01

    Signaling in cells often involves co-localization of the signaling molecules. Most experimental evidence has shown that intracellular compartmentalization restricts the range of action of the second messenger, 3'-5'-cyclic adenosine monophosphate (cAMP), which is degraded by phosphodiesterases (PDEs). The objective of this study is to understand the details of molecular encounter that may play a role in efficient operation of the cAMP signaling apparatus. The results from electrostatic potential calculations and Brownian dynamics simulations suggest that positive potential of the active site from PDE enhances capture of diffusing cAMP molecules. This electrostatic steering between cAMP and the active site of a PDE plays a major role in the enzyme-substrate encounter, an effect that may be of significance in sequestering cAMP released from a nearby binding site or in attracting more freely diffusing cAMP molecules. PMID:26346301

  18. Functions of AMP-activated protein kinase in adipose tissue

    PubMed Central

    Daval, Marie; Foufelle, Fabienne; Ferré, Pascal

    2006-01-01

    AMP-activated protein kinase (AMPK) is involved in cellular energy homeostasis. Its functions have been extensively studied in muscles and liver. AMPK stimulates pathways which increase energy production (glucose transport, fatty acid oxidation) and switches off pathways which consume energy (lipogenesis, protein synthesis, gluconeogenesis). This has led to the concept that AMPK has an interesting pharmaceutical potential in situations of insulin resistance and it is indeed the target of existing drugs and hormones which improve insulin sensitivity. Adipose tissue is a key player in energy metabolism through the release of substrates and hormones involved in metabolism and insulin sensitivity. Activation of AMPK in adipose tissue can be achieved through situations such as fasting and exercise. Leptin and adiponectin as well as hypoglycaemic drugs are activators of adipose tissue AMPK. This activation probably involves changes in the AMP/ATP ratio and the upstream kinase LKB1. When activated, AMPK limits fatty acid efflux from adipocytes and favours local fatty acid oxidation. Since fatty acids have a key role in insulin resistance, especially in muscles, activating AMPK in adipose tissue might be found to be beneficial in insulin-resistant states, particularly as AMPK activation also reduces cytokine secretion in adipocytes. PMID:16709632

  19. Solution structure of the cAMP-dependent protein kinase

    SciTech Connect

    Trewhella, J.; Olah, G.A.; Walsh, D.A.; Mitchell, R.D.

    1998-12-31

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project as Los Alamos National Laboratory (LANL). Protein phosphorylation is well established as one of the most important mechanisms of signal transduction and cellular regulation. Two of the key enzymes that catalyze these phosphorylation reactions are the cAMP- (PKA) and cGMP- (PKG) dependent protein kinases. PKA has served as the prototypic model of this class of enzymes that now comprises in excess of 300 phylogenetically related proteins. A large number of these protein kinases are critical for the regulation of cell function and a full analysis of their similarities and differences is essential to understand their diverse physiological roles. The cAMP-dependent protein kinase has the subunit structure R2C2, in which C and R refer to the catalytic and regulatory subunits, respectively. The cGMP-dependent protein kinase (PKG) is highly homologous to PKA but is distinguished from it by having the regulatory and catalytic domains on a contiguous polypeptide. The studies described here use small-angle scattering and Fourier Transform InfraRed (FTIR) spectroscopy to study domain movements and conformational changes in these enzymes in different functional states in order to elucidate the molecular bases for the regulation of their activities.

  20. Involvement of calyculin A inhibitable protein phosphatases in the cyclic AMP signal transduction pathway of mouse corticotroph tumour (AtT20) cells

    PubMed Central

    Antaraki, A; Ang, K L; Antoni, F A

    1997-01-01

    The role of non-calcineurin protein phosphatases in the cyclic AMP signal transduction pathway was examined in mouse pituitary corticotroph tumour (AtT20) cells. Blockers of protein phosphatases, calyculin A and okadaic acid, were applied in AtT20 cells depleted of rapidly mobilizable pools of intracellular calcium and activated by various cyclic AMP generating agonists. Inhibitors of cyclic nucleotide phosphodiesterases were present throughout. The accumulation of cyclic AMP was monitored by radioimmunoassay, phosphodiesterase activity in cell homogenates was measured by radiometric assay. Neither calyculin A nor okadaic acid altered basal cyclic AMP levels but cyclic AMP formation induced by 41 amino acid residue corticotrophin releasing-factor (CRF) was strongly inhibited (up to 80%). 1-Norokadaone was inactive. Similar data were also obtained when isoprenaline or pituitary adenylate cyclase activating peptide1–38 were used as agonists. Pertussis toxin did not modify the inhibition of CRF-induced cyclic AMP production by calyculin A. Pretreatment with calyculin A completely prevented the stimulation of cyclic AMP formation by cholera toxin even in the presence of 0.5 mM isobutylmethylxanthine (IBMX) and 0.1 mM rolipram. Cholera toxin mediated ADP-ribosylation of the 45K and 52K molecular weight Gsα isoforms in membranes from calyculin A-pretreated cells was enhanced to 150–200% when compared with controls. Cholera toxin-induced cyclic AMP was reduced by calyculin A within 10 min when calyculin A was applied after a 90 min pretreatment with cholera toxin. Under these conditions the effect of calyculin A could be blocked by the combination of 0.5 mM IBMX and 0.1 mM rolipram, but not by 0.5 mM IBMX alone. Phosphodiesterase activity in AtT20 cell homogenates showed a significant, 2.7 fold increase after treatment with calyculin A. In control cells phosphodiesterase activity was blocked by 80% in the presence of IBMX (0.5 mM), or IBMX plus

  1. Effects of Fatty Acid Treatments on the Dexamethasone-Induced Intramuscular Lipid Accumulation in Chickens

    PubMed Central

    Wang, Xiao juan; Wei, Dai lin; Song, Zhi gang; Jiao, Hong chao; Lin, Hai

    2012-01-01

    Background Glucocorticoid has an important effect on lipid metabolism in muscles, and the type of fatty acid likely affects mitochondrial utilization. Therefore, we hypothesize that the different fatty acid types treatment may affect the glucocorticoid induction of intramuscular lipid accumulation. Methodology/Principal Findings The effect of dexamethasone (DEX) on fatty acid metabolism and storage in skeletal muscle of broiler chickens (Gallus gallus domesticus) was investigated with and without fatty acid treatments. Male Arbor Acres chickens (31 d old) were treated with either palmitic acid (PA) or oleic acid (OA) for 7 days, followed by DEX administration for 3 days (35–37 d old). The DEX-induced lipid uptake and oxidation imbalance, which was estimated by increased fatty acid transport protein 1 (FATP1) expression and decreased carnitine palmitoyl transferase 1 activity, contributed to skeletal muscle lipid accumulation. More sensitive than glycolytic muscle, the oxidative muscle in DEX-treated chickens showed a decrease in the AMP to ATP ratio, a decrease in AMP-activated protein kinase (AMPK) alpha phosphorylation and its activity, as well as an increase in the phosphorylation of mammalian target of rapamycin (mTOR) and ribosomal p70S6 kinase, without Akt activation. DEX-stimulated lipid deposition was augmented by PA, but alleviated by OA, in response to pathways that were regulated differently, including AMPK, mTOR and FATP1. Conclusions DEX-induced intramuscular lipid accumulation was aggravated by SFA but alleviated by unsaturated fatty acid. The suppressed AMPK and augmented mTOR signaling pathways were involved in glucocortcoid-mediated enhanced intramuscular fat accumulation. PMID:22623960

  2. Dynamics of β-adrenergic/cAMP signaling and morphological changes in cultured astrocytes.

    PubMed

    Vardjan, Nina; Kreft, Marko; Zorec, Robert

    2014-04-01

    The morphology of astrocytes, likely regulated by cAMP, determines the structural association between astrocytes and the synapse, consequently modulating synaptic function. β-Adrenergic receptors (β-AR), which increase cytosolic cAMP concentration ([cAMP]i ), may affect cell morphology. However, the real-time dynamics of β-AR-mediated cAMP signaling in single live astrocytes and its effect on cell morphology have not been studied. We used the fluorescence resonance energy transfer (FRET)-based cAMP biosensor Epac1-camps to study time-dependent changes in [cAMP]i ; morphological changes in primary rat astrocytes were monitored by real-time confocal microscopy. Stimulation of β-AR by adrenaline, noradrenaline, and isoprenaline, a specific agonist of β-AR, rapidly increased [cAMP]i (∼15 s). The FRET signal response, mediated via β-AR, was faster than in the presence of forskolin (twofold) and dibutyryl-cAMP (>35-fold), which directly activate adenylyl cyclase and Epac1-camps, respectively, likely due to slow entry of these agents into the cytosol. Oscillations in [cAMP]i have not been recorded, indicating that cAMP-dependent processes operate in a slow time domain. Most Epac1-camps expressing astrocytes revealed a morphological change upon β-AR activation and attained a stellate morphology within 1 h. The morphological changes exhibited a bell-shaped dependency on [cAMP]i . The 5-10% decrease in cell cross-sectional area and the 30-50% increase in cell perimeter are likely due to withdrawal of the cytoplasm to the perinuclear region and the appearance of protrusions on the surface of astrocytes. Because astrocyte processes ensheath neurons, β-AR/cAMP-mediated morphological changes can modify the geometry of the extracellular space, affecting synaptic, neuronal, and astrocyte functions in health and disease. PMID:24464905

  3. Is This Op-Amp Any Good?: Lab-Built Checker Removes All Doubt!

    ERIC Educational Resources Information Center

    Harman, Charles

    2007-01-01

    Electronics instructors and students find it very helpful to be able to check an operational amplifier at the proto-board stage. Most students lack the experience or knowledge that it takes to recognize whether an op-amp is operating normally or not. This article discusses a handy op-amp checker that allows one to check and/or test op-amps at the…

  4. Mathematical model of cAMP-dependent signaling pathway in constitutive and UV-induced melanogenesis

    NASA Astrophysics Data System (ADS)

    Stolnitz, Mikhail M.; Peshkova, Anna Y.

    2002-07-01

    Cascade of reactions of cAMP-dependent signaling pathway in melanocytes is investigated by mathematical modeling. Model takes into account (alpha) -melanocyte stimulating hormone binding to melanocortin-1 receptor, adenylate cyclase activation by G-protein, increase of the intracellular cAMP concentration, PKA activation by cAMP, CREB phosphorylation by PKA, microphthalmia gene expression, microphthalmia binding to tyrosinase gene promoter, increase of tyrosinase synthesis. Positive and negative feedback loops of this system are analyzed.

  5. Guidelines for Waste Accumulation Areas (WAAs)

    SciTech Connect

    Not Available

    1991-07-01

    The purpose of this document is to set conditions for establishing and maintaining areas for the accumulation of hazardous waste at LBL. Areas designed for accumulation of these wastes in quantities greater than 100 kg (220 lb) per month of solid waste or 55 gallons per month of liquid waste are called Waste Accumulation Areas (WAAs). Areas designed for accumulation of wastes in smaller amounts are called Satellite Accumulation Areas (SAAs). This document provides guidelines for employee and organizational responsibilities for WAAs; constructing a WAA; storing waste in a WAA; operating and maintaining a WAA, and responding to spills in a WAA. 4 figs.

  6. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms

    SciTech Connect

    Ghayor, Chafik; Ehrbar, Martin; Miguel, Blanca San; Graetz, Klaus W.; Weber, Franz E.

    2009-04-03

    Recent studies suggest that the elevation of intracellular cyclic adenosine monophosphate (cAMP) and the activation of the protein kinase A regulate BMP-induced osteogenesis. However, the precise mechanisms underlying the enhancing effect of cAMP on BMP2 signaling were not completely revealed. In this study we investigated the effect of elevated cAMP level and PKA activation on the BMP2-induced osteoblastic differentiation in pluripotent C2C12 cells. Alkaline phosphatase activity and its mRNA were consistently induced by BMP2 treatment. The pretreatment of C2C12 cells with Forskolin, a cAMP generating agent, dbcAMP, an analogue of cAMP, or IBMX (3-isobutyl 1-methyl xanthine), and a nonspecific inhibitor of phosphodiesterases elicited further activation of alkaline phosphatase. Furthermore, elevated intracellular cAMP level increased BMP2-induced MKP1. On the other hand, BMP2-induced Erk phosphorylation (p44/p42) and cell proliferation were suppressed in the presence of cAMP. Thus, cAMP might enhance BMP2-induced osteoblastic differentiation by a MKP1-Erk-dependent mechanism.

  7. A-kinase anchoring proteins: cAMP compartmentalization in neurodegenerative and obstructive pulmonary diseases

    PubMed Central

    Poppinga, W J; Muñoz-Llancao, P; González-Billault, C; Schmidt, M

    2014-01-01

    The universal second messenger cAMP is generated upon stimulation of Gs protein-coupled receptors, such as the β2-adreneoceptor, and leads to the activation of PKA, the major cAMP effector protein. PKA oscillates between an on and off state and thereby regulates a plethora of distinct biological responses. The broad activation pattern of PKA and its contribution to several distinct cellular functions lead to the introduction of the concept of compartmentalization of cAMP. A-kinase anchoring proteins (AKAPs) are of central importance due to their unique ability to directly and/or indirectly interact with proteins that either determine the cellular content of cAMP, such as β2-adrenoceptors, ACs and PDEs, or are regulated by cAMP such as the exchange protein directly activated by cAMP. We report on lessons learned from neurons indicating that maintenance of cAMP compartmentalization by AKAP5 is linked to neurotransmission, learning and memory. Disturbance of cAMP compartments seem to be linked to neurodegenerative disease including Alzheimer's disease. We translate this knowledge to compartmentalized cAMP signalling in the lung. Next to AKAP5, we focus here on AKAP12 and Ezrin (AKAP78). These topics will be highlighted in the context of the development of novel pharmacological interventions to tackle AKAP-dependent compartmentalization. PMID:25132049

  8. cAMP diffusion in Dictyostelium discoideum: A Green's function method

    NASA Astrophysics Data System (ADS)

    Calovi, Daniel S.; Brunnet, Leonardo G.; de Almeida, Rita M. C.

    2010-07-01

    A Green’s function method is developed to approach the spatiotemporal equations describing the cAMP production in Dictyostelium discoideum, markedly reducing numerical calculations times: cAMP concentrations and gradients are calculated just at the amoeba locations. A single set of parameters is capable of reproducing the different observed behaviors, from cAMP synchronization, spiral waves and reaction-diffusion patterns to streaming and mound formation. After aggregation, the emergence of a circular motion of amoebas, breaking the radial cAMP field symmetry, is observed.

  9. Role of site-selective cAMP analogs in the control and reversal of malignancy.

    PubMed

    Cho-Chung, Y S; Clair, T; Tortora, G; Yokozaki, H

    1991-01-01

    Two isoforms of cAMP receptor protein, RI and RII, the regulatory subunits of cAMP-dependent protein kinase, transduce opposite signals, the RI being stimulatory and the RII being inhibitory of cell proliferation. In normal cells RI and RII exist at a specific physiological ratio whereas in cancer cells such physiological balance of these receptor proteins is disrupted. Reversal and suppression of malignancy can be achieved when the physiologic ratio of these intracellular signal transducers of cAMP is restored as shown by the use of site-selective cAMP analogs, antisense oligodeoxynucleotides or gene transfer, suggesting new approaches to cancer control. PMID:1653961

  10. Active site coupling in PDE:PKA complexes promotes resetting of mammalian cAMP signaling.

    PubMed

    Krishnamurthy, Srinath; Moorthy, Balakrishnan Shenbaga; Xin Xiang, Lim; Xin Shan, Lim; Bharatham, Kavitha; Tulsian, Nikhil Kumar; Mihalek, Ivana; Anand, Ganesh S

    2014-09-16

    Cyclic 3'5' adenosine monophosphate (cAMP)-dependent-protein kinase (PKA) signaling is a fundamental regulatory pathway for mediating cellular responses to hormonal stimuli. The pathway is activated by high-affinity association of cAMP with the regulatory subunit of PKA and signal termination is achieved upon cAMP dissociation from PKA. Although steps in the activation phase are well understood, little is known on how signal termination/resetting occurs. Due to the high affinity of cAMP to PKA (KD ∼ low nM), bound cAMP does not readily dissociate from PKA, thus begging the question of how tightly bound cAMP is released from PKA to reset its signaling state to respond to subsequent stimuli. It has been recently shown that phosphodiesterases (PDEs) can catalyze dissociation of bound cAMP and thereby play an active role in cAMP signal desensitization/termination. This is achieved through direct interactions with the regulatory subunit of PKA, thereby facilitating cAMP dissociation and hydrolysis. In this study, we have mapped direct interactions between a specific cyclic nucleotide phosphodiesterase (PDE8A) and a PKA regulatory subunit (RIα isoform) in mammalian cAMP signaling, by a combination of amide hydrogen/deuterium exchange mass spectrometry, peptide array, and computational docking. The interaction interface of the PDE8A:RIα complex, probed by peptide array and hydrogen/deuterium exchange mass spectrometry, brings together regions spanning the phosphodiesterase active site and cAMP-binding sites of RIα. Computational docking combined with amide hydrogen/deuterium exchange mass spectrometry provided a model for parallel dissociation of bound cAMP from the two tandem cAMP-binding domains of RIα. Active site coupling suggests a role for substrate channeling in the PDE-dependent dissociation and hydrolysis of cAMP bound to PKA. This is the first instance, to our knowledge, of PDEs directly interacting with a cAMP-receptor protein in a mammalian system, and

  11. cAMP signaling microdomains and their observation by optical methods

    PubMed Central

    Calebiro, Davide; Maiellaro, Isabella

    2014-01-01

    The second messenger cyclic AMP (cAMP) is a major intracellular mediator of many hormones and neurotransmitters and regulates a myriad of cell functions, including synaptic plasticity in neurons. Whereas cAMP can freely diffuse in the cytosol, a growing body of evidence suggests the formation of cAMP gradients and microdomains near the sites of cAMP production, where cAMP signals remain apparently confined. The mechanisms responsible for the formation of such microdomains are subject of intensive investigation. The development of optical methods based on fluorescence resonance energy transfer (FRET), which allow a direct observation of cAMP signaling with high temporal and spatial resolution, is playing a fundamental role in elucidating the nature of such microdomains. Here, we will review the optical methods used for monitoring cAMP and protein kinase A (PKA) signaling in living cells, providing some examples of their application in neurons, and will discuss the major hypotheses on the formation of cAMP/PKA microdomains. PMID:25389388

  12. A Universal Stress Protein (USP) in Mycobacteria Binds cAMP

    PubMed Central

    Banerjee, Arka; Adolph, Ramona S.; Gopalakrishnapai, Jayashree; Kleinboelting, Silke; Emmerich, Christiane; Steegborn, Clemens; Visweswariah, Sandhya S.

    2015-01-01

    Mycobacteria are endowed with rich and diverse machinery for the synthesis, utilization, and degradation of cAMP. The actions of cyclic nucleotides are generally mediated by binding of cAMP to conserved and well characterized cyclic nucleotide binding domains or structurally distinct cGMP-specific and -regulated cyclic nucleotide phosphodiesterase, adenylyl cyclase, and E. coli transcription factor FhlA (GAF) domain-containing proteins. Proteins with cyclic nucleotide binding and GAF domains can be identified in the genome of mycobacterial species, and some of them have been characterized. Here, we show that a significant fraction of intracellular cAMP is bound to protein in mycobacterial species, and by using affinity chromatography techniques, we identify specific universal stress proteins (USP) as abundantly expressed cAMP-binding proteins in slow growing as well as fast growing mycobacteria. We have characterized the biochemical and thermodynamic parameters for binding of cAMP, and we show that these USPs bind cAMP with a higher affinity than ATP, an established ligand for other USPs. We determined the structure of the USP MSMEG_3811 bound to cAMP, and we confirmed through structure-guided mutagenesis, the residues important for cAMP binding. This family of USPs is conserved in all mycobacteria, and we suggest that they serve as “sinks” for cAMP, making this second messenger available for downstream effectors as and when ATP levels are altered in the cell. PMID:25802331

  13. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis

    PubMed Central

    Zhou, Zhiwen; Tanaka, Kenji F.; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  14. Structural and functional characterization of Pseudomonas aeruginosa global regulator AmpR.

    PubMed

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen; Mathee, Kalai

    2014-11-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5' rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ(54) and σ(70) consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  15. Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR

    PubMed Central

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen

    2014-01-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  16. TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

    PubMed

    Fayet, G; Aouani, A; Hovsépian, S

    1986-01-01

    The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

  17. Nutrient-contaminant (Pu) plant accumulation model

    SciTech Connect

    Cowan, C.E.; Jenne, E.A.; Simpson, J.C.; Cataldo, D.A.

    1981-12-01

    A model was developed which simulates the movement and daily accumulation of nutrients and contaminants in crop plants resulting from known physiological processes in the plant. In the model, the daily contaminant accumulation is governed by daily increase in plant biomass derived from photosynthesis and by the specified thermodynamic activity of the bioavailable contaminant species in soil or hydroponic solutin. Total accumulation and resulting concentration in the plant's root, stem and branch, leaf, and reproductive compartments can be simulated any time during the growing season. Parameters were estimated from data on plutonium accumulation in soybeans and the model was calibrated against this same data set. The plutonium distribution in the plant was found to be most sensitive to parameters related to leaf accumulation. Contamination at different times during the growing season resulted in a large change in predicted leaf accumulation but very little change in predicted accumulation in other plant parts except when contamination occurred very late in the growing season.

  18. Arrhythmia causes lipid accumulation and reduced glucose uptake.

    PubMed

    Lenski, Matthias; Schleider, Gregor; Kohlhaas, Michael; Adrian, Lucas; Adam, Oliver; Tian, Qinghai; Kaestner, Lars; Lipp, Peter; Lehrke, Michael; Maack, Christoph; Böhm, Michael; Laufs, Ulrich

    2015-01-01

    Atrial fibrillation (AF) is characterized by irregular contractions of atrial cardiomyocytes and increased energy demand. The aim of this study was to characterize the influence of arrhythmia on glucose and fatty acid (FA) metabolism in cardiomyocytes, mice and human left atrial myocardium. Compared to regular pacing, irregular (pseudo-random variation at the same number of contractions/min) pacing of neonatal rat cardiomyocytes induced shorter action potential durations and effective refractory periods and increased diastolic [Ca(2+)]c. This was associated with the activation of Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) and AMP-activated protein kinase (AMPK). Membrane expression of fatty acid translocase (FAT/CD36) and (14)C-palmitic acid uptake were augmented while membrane expression of glucose transporter subtype 4 (GLUT-4) as well as (3)H-glucose uptake were reduced. Inhibition of AMPK and CaMKII prevented these arrhythmia-induced metabolic changes. Similar alterations of FA metabolism were observed in a transgenic mouse model (RacET) for spontaneous AF. Consistent with these findings samples of left atrial myocardium of patients with AF compared to matched samples of patients with sinus rhythm showed up-regulation of CaMKII and AMPK and increased membrane expression of FAT/CD36, resulting in lipid accumulation. These changes of FA metabolism were accompanied by decreased membrane expression of GLUT-4, increased glycogen content and increased expression of the pro-apoptotic protein bax. Irregular pacing of cardiomyocytes increases diastolic [Ca(2+)]c and activation of CaMKII and AMPK resulting in lipid accumulation, reduced glucose uptake and increased glycogen synthesis. These metabolic changes are accompanied by an activation of pro-apoptotic signalling pathways. PMID:26018791

  19. Deficient guanine nucleotide regulatory unit activity in cultured fibroblast membranes from patients with pseudohypoparathyroidism type I. A cause of impaired synthesis of 3',5'-cyclic AMP by intact and broken cells

    PubMed Central

    Levine, Michael A.; Eil, Charles; Downs, Robert W.; Spiegel, Allen M.

    1983-01-01

    -stimulated adenylate cyclase, was not significantly different in the two groups. Intact fibroblasts derived from patients with PHP accumulated significantly (P 0.001) less cAMP (46±21 pmol cAMP/mcg DNA, n = 5) than cells from normal individuals (170±51 pmol cAMP/mcg DNA, n = 11) when stimulated with PGE1. PGE1-stimulated accumulation of cAMP by intact fibroblast monolayers correlated closely with PGE1 plus GTP-activated membrane adenylate cyclase activity in both patients and controls (r = 0.97, P < 0.001). Our data show that, in patients with PHP, (a) fibroblast membranes show a decreased complement of G units, (b) membrane catalytic activity is normal, but adenylate cyclase activity is reduced when stimulated by hormone or by effectors which activate the G unit, (c) the ability of cells to accumulate cAMP in response to hormone stimulation is reduced, and (d) reduced membrane adenylate cyclase activity correlates well with impaired cellular cAMP synthesis. These results, taken together, indicate that a deficiency of G-unit activity can impair synthesis of cAMP by both intact and broken cells, and may explain the resistance of multiple tissues to hormones that act via cAMP observed in PHP. ImagesFIGURE 2 PMID:6308048

  20. Natural radionuclide accumulation by raindrops

    NASA Astrophysics Data System (ADS)

    Gusev, Anatoly; Martin, Inacio; Shkevov, Rumen; Alves, Mauro

    2016-07-01

    The laboratory of environmental radiation of ITA (São José dos Campos, 23°11'11″S, 45°52'43″W, 650 MAMSL) performs simultaneous monitoring of a natural radiation background and meteorological parameters. A time resolution of up to 1 minute allows a detailed comparison of changes in meteorological parameters with those of a concentration of ambient radon progenies in the atmosphere. Results of a study of variation of a fallout of radon progenies ^{214}Pb and ^{214}Bi concomitanting rainfalls are present. The radionuclide fallout rate is reconstructed from the observed gamma rate through a simulation of the first kind Volterra integral equation with difference kernel, determined by ratio of precipitating rates of 214Pb and 214Bi and their decay half times. An original straightforward step-by-step procedure was used for the numerical solution of the equation. The radionuclide concentration in the rainwater is calculated as a ratio of the reconstructed fallout to the measured rainfall. It was observed that the radionuclide fallout rate increases as the rainfall one in approximately power 0.6, i.e. the same as the mean raindrop volume. The concentration thereafter decreases as the rainfall rate in power 0.4. A numerical simulation of the process of accumulation of the radionuclides during diffusion and coalescence drop growth and aerosol scavenging during a passage from a cloud to the ground was performed. The results of the simulations agree with the experimental data.

  1. Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle

    PubMed Central

    Bernal-Ulloa, Sandra Milena; Heinzmann, Julia; Herrmann, Doris; Hadeler, Klaus-Gerd; Aldag, Patrick; Winkler, Sylke; Pache, Dorit; Baulain, Ulrich; Lucas-Hahn, Andrea; Niemann, Heiner

    2016-01-01

    High cAMP levels during in vitro maturation (IVM) have been related to improved blastocyst yields. Here, we employed the cAMP/cGMP modulators, forskolin, IBMX, and cilostamide, during IVM to unravel the role of high cAMP in early embryonic development produced from prepubertal and adult bovine oocytes. Oocytes were collected via transvaginal aspiration and randomly assigned to three experimental groups: TCM24 (24h IVM/control), cAMP30 (2h pre-IVM (forskolin-IBMX), 30h IVM-cilostamide), and DMSO30 (Dimethyl Sulfoxide/vehicle control). After IVM, oocytes were fertilized in vitro and zygotes were cultured in vitro to blastocysts. Meiotic progression, cAMP levels, mRNA abundance of selected genes and DNA methylation were evaluated in oocytes. Blastocysts were used for gene expression or DNA methylation analyses. Blastocysts from the cAMP30 groups were transferred to recipients. The cAMP elevation delayed meiotic progression, but developmental rates were not increased. In immature oocytes, mRNA abundance of PRKACA was higher for cAMP30 protocol and no differences were found for PDE3A, SMAD2, ZAR1, PRDX1 and SLC2A8. EGR1 gene was up-regulated in prepubertal cAMP30 immature oocytes and down-regulated in blastocysts from all in vitro treatments. A similar gene expression profile was observed for DNMT3b, BCL2L1, PRDX1 and SLC2A8 in blastocysts. Satellite DNA methylation profiles were different between prepubertal and adult oocytes and blastocysts derived from the TCM24 and DMSO30 groups. Blastocysts obtained from prepubertal and adult oocytes in the cAMP30 treatment displayed normal methylation profiles and produced offspring. These data indicate that cAMP regulates IVM in prepubertal and adult oocytes in a similar manner, with impact on the establishment of epigenetic marks and acquisition of full developmental competency. PMID:26926596

  2. Role of Membrane Microdomains in Compartmentation of cAMP Signaling

    PubMed Central

    Agarwal, Shailesh R.; Yang, Pei-Chi; Rice, Monica; Singer, Cherie A.; Nikolaev, Viacheslav O.; Lohse, Martin J.; Clancy, Colleen E.; Harvey, Robert D.

    2014-01-01

    Spatially restricting cAMP production to discrete subcellular locations permits selective regulation of specific functional responses. But exactly where and how cAMP signaling is confined is not fully understood. Different receptors and adenylyl cyclase isoforms responsible for cAMP production are not uniformly distributed between lipid raft and non-lipid raft domains of the plasma membrane. We sought to determine the role that these membrane domains play in organizing cAMP responses in HEK293 cells. The freely diffusible FRET-based biosensor Epac2-camps was used to measure global cAMP responses, while versions of the probe targeted to lipid raft (Epac2-MyrPalm) and non-raft (Epac2-CAAX) domains were used to monitor local cAMP production near the plasma membrane. Disruption of lipid rafts by cholesterol depletion selectively altered cAMP responses produced by raft-associated receptors. The results indicate that receptors associated with lipid raft as well as non-lipid raft domains can contribute to global cAMP responses. In addition, basal cAMP activity was found to be significantly higher in non-raft domains. This was supported by the fact that pharmacologic inhibition of adenylyl cyclase activity reduced basal cAMP activity detected by Epac2-CAAX but not Epac2-MyrPalm or Epac2-camps. Responses detected by Epac2-CAAX were also more sensitive to direct stimulation of adenylyl cyclase activity, but less sensitive to inhibition of phosphodiesterase activity. Quantitative modeling was used to demonstrate that differences in adenylyl cyclase and phosphodiesterase activities are necessary but not sufficient to explain compartmentation of cAMP associated with different microdomains of the plasma membrane. PMID:24752595

  3. Dose and Chemical Modification Considerations for Continuous Cyclic AMP Analog Delivery to the Injured CNS

    PubMed Central

    Fouad, Karim; Ghosh, Mousumi; Vavrek, Romana; Tse, Arthur D.

    2009-01-01

    Abstract In this investigation, two cell-permeable synthetic analogs of cAMP, dibutyryl-cAMP (db-cAMP) and 8-bromo-cAMP, which are widely used to elevate intracellular cAMP levels under experimental conditions, were investigated for their ability to dose-dependently improve histological and functional outcomes following continuous delivery in two models of incomplete spinal cord injury (SCI). The cAMP analogs were delivered via osmotic minipumps at 1–250 mM through an indwelling cortical cannula or by intrathecal infusion for up to 4 weeks after either a T8 unilateral over-hemisection or a C2-3 dorsolateral quadrant lesion, respectively. In both SCI models, continuous db-cAMP delivery was associated with histopathological changes that included sporadic micro-hemorrhage formation and cavitation, enhanced macrophage infiltration and tissue damage at regions beyond the immediate application site; no deleterious or beneficial effect of agent delivery was observed at the spinal injury site. Furthermore, these changes were accompanied by pronounced behavioral deficits that included an absence of progressive locomotor recovery, increased extensor tone, paralysis, and sensory abnormalities. These deleterious effects were not observed in saline-treated animals, in animals in which the db-cAMP dose did not exceed 1 mM, or in those animals that received a high dose (250 mM) of the alternative cAMP analog, 8-bromo-cAMP. These results demonstrate that, for continuous intraparenchymal or intrathecal administration of cAMP analogs for the study of biological or therapeutic effects within the central nervous system (CNS), consideration of the effective concentration applied as well as the potential toxicity of chemical moieties on the parent molecule and/or their activity needs to be taken into account. PMID:19397425

  4. cAMP signaling prevents podocyte apoptosis via activation of protein kinase A and mitochondrial fusion.

    PubMed

    Li, Xiaoying; Tao, Hua; Xie, Kewei; Ni, Zhaohui; Yan, Yucheng; Wei, Kai; Chuang, Peter Y; He, John Cijiang; Gu, Leyi

    2014-01-01

    Our previous in vitro studies suggested that cyclic AMP (cAMP) signaling prevents adriamycin (ADR) and puromycin aminonucleoside (PAN)-induced apoptosis in podocytes. As cAMP is an important second messenger and plays a key role in cell proliferation, differentiation and cytoskeleton formation via protein kinase A (PKA) or exchange protein directly activated by cAMP (Epac) pathways, we sought to determine the role of PKA or Epac signaling in cAMP-mediated protection of podocytes. In the ADR nephrosis model, we found that forskolin, a selective activator of adenylate cyclase, attenuated albuminuria and improved the expression of podocyte marker WT-1. When podocytes were treated with pCPT-cAMP (a selective cAMP/PKA activator), PKA activation was increased in a time-dependent manner and prevented PAN-induced podocyte loss and caspase 3 activation, as well as a reduction in mitochondrial membrane potential. We found that PAN and ADR resulted in a decrease in Mfn1 expression and mitochondrial fission in podocytes. pCPT-cAMP restored Mfn1 expression in puromycin or ADR-treated podocytes and induced Drp1 phosphorylation, as well as mitochondrial fusion. Treating podocytes with arachidonic acid resulted in mitochondrial fission, podocyte loss and cleaved caspase 3 production. Arachidonic acid abolished the protective effects of pCPT-cAMP on PAN-treated podocytes. Mdivi, a mitochondrial division inhibitor, prevented PAN-induced cleaved caspase 3 production in podocytes. We conclude that activation of cAMP alleviated murine podocyte caused by ADR. PKA signaling resulted in mitochondrial fusion in podocytes, which at least partially mediated the effects of cAMP. PMID:24642777

  5. Genetically-encoded tools for cAMP probing and modulation in living systems

    PubMed Central

    Paramonov, Valeriy M.; Mamaeva, Veronika; Sahlgren, Cecilia; Rivero-Müller, Adolfo

    2015-01-01

    Intracellular 3′-5′-cyclic adenosine monophosphate (cAMP) is one of the principal second messengers downstream of a manifold of signal transduction pathways, including the ones triggered by G protein-coupled receptors. Not surprisingly, biochemical assays for cAMP have been instrumental for basic research and drug discovery for decades, providing insights into cellular physiology and guiding pharmaceutical industry. However, despite impressive track record, the majority of conventional biochemical tools for cAMP probing share the same fundamental shortcoming—all the measurements require sample disruption for cAMP liberation. This common bottleneck, together with inherently low spatial resolution of measurements (as cAMP is typically analyzed in lysates of thousands of cells), underpin the ensuing limitations of the conventional cAMP assays: (1) genuine kinetic measurements of cAMP levels over time in a single given sample are unfeasible; (2) inability to obtain precise information on cAMP spatial distribution and transfer at subcellular levels, let alone the attempts to pinpoint dynamic interactions of cAMP and its effectors. At the same time, tremendous progress in synthetic biology over the recent years culminated in drastic refinement of our toolbox, allowing us not only to bypass the limitations of conventional assays, but to put intracellular cAMP life-span under tight control—something, that seemed scarcely attainable before. In this review article we discuss the main classes of modern genetically-encoded tools tailored for cAMP probing and modulation in living systems. We examine the capabilities and weaknesses of these different tools in the context of their operational characteristics and applicability to various experimental set-ups involving living cells, providing the guidance for rational selection of the best tools for particular needs. PMID:26441653

  6. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 1: AMPS payload to shuttle ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    Physical, functional, and operational interfaces between the space shuttle orbiter and the AMPS payload are described for the ground handling and test phases, prelaunch, launch and ascent, operational, stowage, and reentry and landing activities.

  7. Polynomial solutions of the Monge-Ampère equation

    SciTech Connect

    Aminov, Yu A

    2014-11-30

    The question of the existence of polynomial solutions to the Monge-Ampère equation z{sub xx}z{sub yy}−z{sub xy}{sup 2}=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  8. An enhanced cAMP pathway is responsible for the colonic hyper-secretory response to 5-HT in acute stress rats.

    PubMed

    Li, Y; Li, L S; Zhang, X L; Zhang, Y; Xu, J D; Zhu, J X

    2015-01-01

    5-hydroxytryptamine (5-HT) is involved in the stress-induced alteration of colonic functions, specifically motility and secretion, but its precise mechanisms of regulation remain unclear. In the present study, we have investigated the effects of 5-HT on rat colonic mucosal secretion after acute water immersion restraint stress, as well as the underlying mechanism of this phenomenon, using short circuit current recording (I(SC)), real-time polymerase chain reaction, Western blot analysis, and enzyme-linked immunosorbance assays. After 2 h of water immersion restraint stress, the baseline I(SC) and 5-HT-induced I(SC) responses of the colonic mucosa were significantly increased. Pretreatment with selective 5-HT(4) receptor antagonist, SB204070, inhibited the 5-HT-induced colonic I(SC) response by 96 % in normal rats and 91.2 % in acute-stress rats. However, pretreatment with the selective antagonist of 5-HT(3) receptor, MDL72222 or Y-25130, had no obvious effect on 5-HT-induced I(SC) responses under either set of conditions. Total protein expression of both the mucosal 5-HT(3) receptors and the 5-HT(4) receptors underwent no significant changes following acute stress. Both colonic basal cAMP levels and foskolin-induced I(SC) responses were significantly enhanced in acute stress rats. 5-HT significantly enhanced the intracellular cAMP level via 5-HT(4) receptors in the colonic mucosa from both control and stressed animals, and 5-HT-induced cAMP increase in stressed rats was not more than that in control rats. Taken together, the present results indicate that acute water immersion restraint stress enhances colonic secretory responses to 5-HT in rats, a process in which increased cellular cAMP accumulation is involved. PMID:25536313

  9. Protein Kinase C-mediated Phosphorylation and Activation of PDE3A Regulate cAMP Levels in Human Platelets*S⃞

    PubMed Central

    Hunter, Roger W.; MacKintosh, Carol; Hers, Ingeborg

    2009-01-01

    The elevation of [cAMP]i is an important mechanism of platelet inhibition and is regulated by the opposing activity of adenylyl cyclase and phosphodiesterase (PDE). In this study, we demonstrate that a variety of platelet agonists, including thrombin, significantly enhance the activity of PDE3A in a phosphorylation-dependent manner. Stimulation of platelets with the PAR-1 agonist SFLLRN resulted in rapid and transient phosphorylation of PDE3A on Ser312, Ser428, Ser438, Ser465, and Ser492, in parallel with the PKC (protein kinase C) substrate, pleckstrin. Furthermore, phosphorylation and activation of PDE3A required the activation of PKC, but not of PI3K/PKB, mTOR/p70S6K, or ERK/RSK. Activation of PKC by phorbol esters also resulted in phosphorylation of the same PDE3A sites in a PKC-dependent, PKB-independent manner. This was further supported by the finding that IGF-1, which strongly activates PI3K/PKB, but not PKC, did not regulate PDE3A. Platelet activation also led to a PKC-dependent association between PDE3A and 14-3-3 proteins. In contrast, cAMP-elevating agents such as PGE1 and forskolin-induced phosphorylation of Ser312 and increased PDE3A activity, but did not stimulate 14-3-3 binding. Finally, complete antagonism of PGE1-evoked cAMP accumulation by thrombin required both Gi and PKC activation. Together, these results demonstrate that platelet activation stimulates PKC-dependent phosphorylation of PDE3A on Ser312, Ser428, Ser438, Ser465, and Ser492 leading to a subsequent increase in cAMP hydrolysis and 14-3-3 binding. PMID:19261611

  10. Emodin protects against high-fat diet-induced obesity via regulation of AMP-activated protein kinase pathways in white adipose tissue.

    PubMed

    Tzeng, Thing-Fong; Lu, Hung-Jen; Liou, Shorong-Shii; Chang, Chia Ju; Liu, I-Min

    2012-06-01

    Emodin is an active herbal component traditionally used in China for treating a variety of diseases. The aim of this study was to examine the effect of emodin on the reducing lipid accumulation in white adipose tissue of high-fat diet-fed rats, and on the regulation of the expression of the genes involved in lipid metabolism to elucidate the mechanisms. After being fed a high-fat diet for two weeks, rats were dosed orally with emodin (20, 40, 80 mg/kg/day) or pioglitazone (20 mg/kg/day), once daily for eight weeks. Changes in body weight, feeding pattern, serum lipids, coronary artery risk index, and atherogenic index were investigated. Subcutaneous white adipose tissues were isolated for pathology histology and Western blot analyses. Changes of triglyceride accumulation in differentiated 3 T3-L1 adipocytes were also investigated. Emodin exhibited a significant concentration-dependent decrease in the intracellular accumulation of triglyceride in 3 T3-L1 adipocytes. Emodin (80 mg/kg/day) displayed similar characteristics to pioglitazone (20 mg/kg/day) in reducing body weight gain and plasma lipid levels as well as the coronary artery risk and atherogenic indices of high-fat diet-fed rats. Emodin also caused dose related reductions in epididymal white adipose tissue sizes in high-fat diet-fed rats. Emodin and pioglitazone enhanced the phosphorylation of AMP-activated protein kinase and its primary downstream targeting enzyme, acetyl-CoA carboxylase, upregulated gene expression of carnitine palmitoyl transferase 1, and downregulated sterol regulatory element binding protein 1 and fatty acid synthase protein levels in the epididymal white adipose tissue of high-fat diet-fed rats. Our findings suggest that emodin could attenuate lipid accumulation in white adipose tissue through AMP-activated protein kinase activation. PMID:22673833

  11. Differential effects on cAMP on the MAP kinase cascade: evidence for a cAMP-insensitive step that can bypass Raf-1.

    PubMed Central

    Faure, M; Bourne, H R

    1995-01-01

    Because cAMP exerts opposite effects on cell proliferation in different cell types, we undertook to study its effect on the mitogen-activated protein kinase (MAPK) pathway in three cell lines (Rat-1, Swiss-3T3, and COS-7) chosen for their different mitogenic responses to cAMP. We measured the effect of cAMP on MAPK, MEK, and Raf-1 activities after stimulation by agonists acting through a tyrosine kinase receptor (epidermal growth factor) or a G protein-coupled receptor (lysophosphatidic acid). In Rat-1 cells we found that cAMP strongly inhibited all three activities (MAPK, MEK, and Raf-1), in good agreement with its effect on cell proliferation in these cells. In Swiss-3T3 and COS-7 cells, on the contrary, cAMP did not inhibit epidermal growth factor- and lysophosphatidic acid-induced stimulation of MAPK and MEK activities, and even stimulated MAPK activity slightly on its own. Again these results are in good agreement with the proliferative effect of cAMP in Swiss-3T3 cells. Raf-1 activity on the hand, was inhibited by cAMP in Swiss-3T3 and COS-7 as it was in Rat-1 cells. This result indicates that signaling pathways in Swiss-3T3 and COS-7 cells can activate MEK and MAPK in a Raf-1-independent and cAMP-insensitive manner. Our results add to growing evidence for the existence of Ras- and/or Raf-1-independent pathways leading to MEK and MAPK activation. Images PMID:7579705

  12. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells.

    PubMed

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin. PMID:27348124

  13. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells

    PubMed Central

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin. PMID:27348124

  14. The possible role of cyclic AMP in the neurotrophic control of skeletal muscle.

    PubMed Central

    Carlsen, R C

    1975-01-01

    1. Motoneurones provide trophic control of some of the functional characteristics of skeletal muscle fibres. This study has been designed to test whether the adenylate cyclase: cyclic AMP system may offer one potential mechanism for the mediation of neurotrophic regulation. 2. The concentration of cyclic AMP was measured at various intervals after muscle denervation. Muscle cyclic AMP concentration increases for the first 2 days after nerve section. It reaches a maximum value at 48 h and subsequently returns to the control value at 7 days. 3. Cyclic AMP concentration is unchanged by muscle disuse for the first 3 days following limb immobilization. Four days after immobilization, however, cyclic AMP increases in both the disused and contralateral control muscles. This phenomenon has been tentatively ascribed to some aspect of the inflammatory response. 4. Changing the level of nerve section, and therefore the length of the residual nerve stump, changes the temporal pattern of the increase in muscle cyclic AMP concentration. 5. Reinnervation of a denervated muscle produces a decrease in muscle cyclic AMP concentration. 6. It is concluded from the results that some aspect of nerve function provides trophic regulation of the muscle adenylate cyclase: cyclic AMP system. The mechanisms by which this regulation may be applied are considered in the Discussion. PMID:168354

  15. A Model Based on Receptor Desensitization for Cyclic AMP Signaling in Dictyostelium Cells

    PubMed Central

    Martiel, Jean-Louis; Goldbeter, Albert

    1987-01-01

    We analyze a model based on receptor modification for the cAMP signaling system that controls aggregation of the slime mold Dictyostelium discoideum after starvation. The model takes into account both the desensitization of the cAMP receptor by reversible phosphorylation and the activation of adenylate cyclase that follows binding of extracellular cAMP to the unmodified receptor. The dynamics of the signaling system is studied in terms of three variables, namely, intracellular and extracellular cAMP, and the fraction of receptor in active state. Using parameter values collected from experimental studies on cAMP signaling and receptor phosphorylation, we show that the model accounts qualitatively and, in a large measure, quantitatively for the various modes of dynamic behavior observed in the experiments: (a) autonomous oscillations of cAMP, (b) relay of suprathreshold cAMP pulses, i.e., excitability, characterized by both an absolute and a relative refractory period, and (c) adaptation to constant cAMP stimuli. A two-variable version of the model is used to demonstrate the link between excitability and oscillations by phase plane analysis. The response of the model to repetitive stimulation allows comprehension, in terms of receptor desensitization, of the role of periodic signaling in Dictyostelium and, more generally, the function of pulsatile patterns of hormone secretion. PMID:19431710

  16. A Temporal-Specific and Transient cAMP Increase Characterizes Odorant Classical Conditioning

    ERIC Educational Resources Information Center

    Cui, Wen; Smith, Andrew; Darby-King, Andrea; Harley, Carolyn W.; McLean, John H.

    2007-01-01

    Increases in cyclic adenosine monophosphate (cAMP) are proposed to initiate learning in a wide variety of species. Here, we measure changes in cAMP in the olfactory bulb prior to, during, and following a classically conditioned odor preference trial in rat pups. Measurements were taken up to the point of maximal CREB phosphorylation in olfactory…

  17. cAMP biosensors applied in molecular pharmacological studies of G protein-coupled receptors.

    PubMed

    Mathiesen, Jesper Mosolff; Vedel, Line; Bräuner-Osborne, Hans

    2013-01-01

    Cyclic adenosine monophosphate (cAMP) is a common second messenger that mediates numerous biological responses. Intracellular cAMP levels are increased by activation of G(s)-coupled G protein-coupled receptors (GPCRs) and decreased by activation of G(i)-coupled GPCRs via the adenylyl cyclase. Many end-point assays for quantifying GPCR-mediated changes in intracellular cAMP levels exist. More recently, fluorescence resonance energy transfer (FRET)-based cAMP biosensors that can quantify intracellular cAMP levels in real time have been developed. These FRET-based cAMP biosensors have been used primarily in single cell FRET microscopy to monitor and visualize changes in cAMP upon GPCR activation. Here, a similar cAMP biosensor with a more efficient mCerulean/mCitrine FRET pair is described for use in the 384-well plate format. After cloning and expression in HEK293 cells, the biosensor is characterized in the 384-well plate format and used for measuring the signaling of the G(s)-coupled β(2)-adrenergic receptor. The procedures described may be applied for other FRET-based biosensors in terms of characterization and conversion to the 384-well plate format. PMID:23374187

  18. 78 FR 1264 - CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative Determination Regarding...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... Employment and Training Administration CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative... workers of the subject firm (TA-W-80,399A; CalAmp Wireless Networks Corporation, Waseca, Minnesota... Wireless Networks Corporation, Waseca, Minnesota to apply for TAA, the Department determines that...

  19. Prostaglandin E2 inhibits apoptosis in human neutrophilic polymorphonuclear leukocytes: role of intracellular cyclic AMP levels.

    PubMed

    Ottonello, L; Gonella, R; Dapino, P; Sacchetti, C; Dallegri, F

    1998-08-01

    Human neutrophilic polymorphonuclear leukocytes (neutrophils) are terminally differentiated cells that die by undergoing apoptosis. At present, the intracellular pathways governing this process are only partially known. In particular, although the adenylate cyclase-dependent generation of cyclic AMP (cAMP) has been implicated in the triggering of apoptosis in lymphoid cells, the role of the intracellular cAMP pathway in neutrophil apoptosis remains controversial. In the present study, we found that two cAMP-elevating agents, prostaglandin E2 (PGE2) and the phosphodiesterase type IV inhibitor RO 20-1724, inhibit neutrophil apoptosis without inducing cell necrosis. When administered in combination, PGE2 and RO 20-1724 displayed additive effects. Moreover, neutrophil apoptosis was inhibited by a membrane-permeable analog of cAMP, dibutyryl-cAMP, in a dose-dependent manner. Finally, treatment of neutrophils with the protein kinase A inhibitor H-89 prevented PGE2- and RO 20-1724-induced inhibition of cell apoptosis. In conclusion, taking into account that PGE2 and other cAMP-elevating agents are well known downregulators of neutrophil functions, our results suggest that conditions favoring a state of functional rest, such as intracellular cAMP elevation, prolong the life span of neutrophils by delaying apoptosis. PMID:9694511

  20. Comparative biology of cAMP-induced germinal vesicle breakdown in marine invertebrate oocytes.

    PubMed

    Deguchi, Ryusaku; Takeda, Noriyo; Stricker, Stephen A

    2011-01-01

    During maturation, oocytes must undergo a process of nuclear disassembly, or "germinal vesicle breakdown" (GVBD), that is regulated by signaling pathways involving cyclic AMP (cAMP). In vertebrate and starfish oocytes, cAMP elevation typically prevents GVBD. Alternatively, increased concentrations of intra-oocytic cAMP trigger, rather than inhibit, GVBD in several groups of marine invertebrates. To integrate what is known about the stimulation of GVBD by intra-oocytic cAMP, this article reviews published data for ascidian, bivalve, brittle star, jellyfish, and nemertean oocytes. The bulk of the review concentrates on the three most intensively analyzed groups known to display cAMP-induced GVBD-nemerteans, ascidians, and jellyfish. In addition, this synopsis also presents some previously unpublished findings regarding the stimulatory effects of intra-oocytic cAMP on GVBD in jellyfish and the annelid worm Pseudopotamilla occelata. Finally, factors that may account for the currently known distribution of cAMP-induced GVBD across animal groups are discussed. PMID:21774023

  1. Looking downstream: the role of cyclic AMP-regulated genes in axonal regeneration

    PubMed Central

    Siddiq, Mustafa M.; Hannila, Sari S.

    2015-01-01

    Elevation of intracellular cyclic AMP (cAMP) levels has proven to be one of the most effective means of overcoming inhibition of axonal regeneration by myelin-associated inhibitors such as myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein. Pharmacological manipulation of cAMP through the administration of dibutyryl cAMP or rolipram leads to enhanced axonal growth both in vivo and in vitro, and importantly, upregulation of cAMP within dorsal root ganglion neurons is responsible for the conditioning lesion effect, which indicates that cAMP plays a significant role in the endogenous mechanisms that promote axonal regeneration. The effects of cAMP are transcription-dependent and are mediated through the activation of protein kinase A (PKA) and the transcription factor cyclic AMP response element binding protein (CREB). This leads to the induction of a variety of genes, several of which have been shown to overcome myelin-mediated inhibition in their own right. In this review, we will highlight the pro-regenerative effects of arginase I (ArgI), interleukin (IL)-6, secretory leukocyte protease inhibitor (SLPI), and metallothionein (MT)-I/II, and discuss their potential for therapeutic use in spinal cord injury. PMID:26150769

  2. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    PubMed Central

    Warrington, Nicole M.; Sun, Tao; Rubin, Joshua B.

    2015-01-01

    A relationship between cyclic adenosine 3′, 5′-monophosphate (cAMP) levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY) have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor) risk in individuals with Neurofibromatosis type 1 (NF1). Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well-known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex. PMID:26283963

  3. A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

    PubMed Central

    Abdou, Houssein S.; Bergeron, Francis

    2014-01-01

    Steroid hormones regulate essential physiological processes, and inadequate levels are associated with various pathological conditions. In testosterone-producing Leydig cells, steroidogenesis is strongly stimulated by luteinizing hormone (LH) via its receptor leading to increased cyclic AMP (cAMP) production and expression of the steroidogenic acute regulatory (STAR) protein, which is essential for the initiation of steroidogenesis. Steroidogenesis then passively decreases with the degradation of cAMP into AMP by phosphodiesterases. In this study, we show that AMP-activated protein kinase (AMPK) is activated following cAMP-to-AMP breakdown in MA-10 and MLTC-1 Leydig cells. Activated AMPK then actively inhibits cAMP-induced steroidogenesis by repressing the expression of key regulators of steroidogenesis, including Star and Nr4a1. Similar results were obtained in Y-1 adrenal cells and in the constitutively steroidogenic R2C cells. We have also determined that maximum AMPK activation following stimulation of steroidogenesis in MA-10 Leydig cells occurs when steroid hormone production has reached a plateau. Our data identify AMPK as a molecular rheostat that actively represses steroid hormone biosynthesis to preserve cellular energy homeostasis and prevent excess steroid production. PMID:25225331

  4. Looking downstream: the role of cyclic AMP-regulated genes in axonal regeneration.

    PubMed

    Siddiq, Mustafa M; Hannila, Sari S

    2015-01-01

    Elevation of intracellular cyclic AMP (cAMP) levels has proven to be one of the most effective means of overcoming inhibition of axonal regeneration by myelin-associated inhibitors such as myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein. Pharmacological manipulation of cAMP through the administration of dibutyryl cAMP or rolipram leads to enhanced axonal growth both in vivo and in vitro, and importantly, upregulation of cAMP within dorsal root ganglion neurons is responsible for the conditioning lesion effect, which indicates that cAMP plays a significant role in the endogenous mechanisms that promote axonal regeneration. The effects of cAMP are transcription-dependent and are mediated through the activation of protein kinase A (PKA) and the transcription factor cyclic AMP response element binding protein (CREB). This leads to the induction of a variety of genes, several of which have been shown to overcome myelin-mediated inhibition in their own right. In this review, we will highlight the pro-regenerative effects of arginase I (ArgI), interleukin (IL)-6, secretory leukocyte protease inhibitor (SLPI), and metallothionein (MT)-I/II, and discuss their potential for therapeutic use in spinal cord injury. PMID:26150769

  5. Subcelluar compartmentalization of cAMP-dependent protein kinase regulatory subunits during palate ontogeny

    SciTech Connect

    Linask, K.K.; Greene, R.M. )

    1989-01-01

    Mammalian palatal ontogeny involves epithelial-mesenchymal interactions, cell differentiation, and cell movement. These events occur on days 12, 13, and 14 of gestation in the C57BL/6J mouse embryo. During this period intracellular cAMP levels and cAMP-dependent protein kinase (cAMP-dPK) levels in the palate transiently elevate. Cyclic AMP activates cAMP-dPK by binding primarily to two types of regulatory subunits of this enzyme, designated as R{sub I} and R{sub II}. To assess whether differential compartmentalization of the regulatory subunits occurs during palatal ontogeny, cytosolic, nuclear, and particulate fractions were prepared from day 12, 13, and 14 embryonic maxillary and palatal tissue. After photo-affinity labeling of each fraction with 8-azido ({sup 32}P) cAMP, SDS-PAGE, and autoradiography, autoradiograms were analyzed densitometrically. The R{sub I} isoform predominated in the nuclear and particulate fractions on all three developmental days; whereas R{sub II} predominated in the cytosolic fractions. Thus, differential compartmentalization of cAMP-dPK may be a means by which cAMP dependent responses are regulated during palatogenesis.

  6. Global and local missions of cAMP signaling in neural plasticity, learning, and memory

    PubMed Central

    Lee, Daewoo

    2015-01-01

    The fruit fly Drosophila melanogaster has been a popular model to study cAMP signaling and resultant behaviors due to its powerful genetic approaches. All molecular components (AC, PDE, PKA, CREB, etc) essential for cAMP signaling have been identified in the fly. Among them, adenylyl cyclase (AC) gene rutabaga and phosphodiesterase (PDE) gene dunce have been intensively studied to understand the role of cAMP signaling. Interestingly, these two mutant genes were originally identified on the basis of associative learning deficits. This commentary summarizes findings on the role of cAMP in Drosophila neuronal excitability, synaptic plasticity and memory. It mainly focuses on two distinct mechanisms (global versus local) regulating excitatory and inhibitory synaptic plasticity related to cAMP homeostasis. This dual regulatory role of cAMP is to increase the strength of excitatory neural circuits on one hand, but to act locally on postsynaptic GABA receptors to decrease inhibitory synaptic plasticity on the other. Thus the action of cAMP could result in a global increase in the neural circuit excitability and memory. Implications of this cAMP signaling related to drug discovery for neural diseases are also described. PMID:26300775

  7. Expression of AMP-activated protein kinase subunits during chicken embryonic and post-hatch development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    AMP-activated protein kinase (AMPK) is a highly conserved serine/threonine protein kinase that senses cellular energy status (AMP/ATP ratio) and acts to maintain energy homeostasis by regulating the activities of energy-consuming and energy-generating metabolic pathways. AMPK is a heterotrimeric en...

  8. Reciprocal regulation of insulin and plasma 5'-AMP in glucose homeostasis in mice.

    PubMed

    Xia, Lin; Wang, Zhongqiu; Zhang, Ying; Yang, Xiao; Zhan, Yibei; Cheng, Rui; Wang, Shiming; Zhang, Jianfa

    2015-03-01

    A previous investigation has demonstrated that plasma 5'-AMP (pAMP) exacerbates and causes hyperglycemia in diabetic mice. However, the crosstalk between pAMP and insulin signaling to regulate glucose homeostasis has not been investigated in depth. In this study, we showed that the blood glucose level was more dependent on the ratio of insulin to pAMP than on the absolute level of these two factors. Administration of 5'-AMP significantly attenuated the insulin-stimulated insulin receptor (IR) autophosphorylation in the liver and muscle tissues, resulting in the inhibition of downstream AKT phosphorylation. A docking analysis indicated that adenosine was a potential inhibitor of IR tyrosine kinase. Moreover, the 5'-AMP treatment elevated the ATP level in the pancreas and in the isolated islets, stimulating insulin secretion and increasing the plasma level of insulin. The insulin administration decreased the 5'-AMP-induced hyper-adenosine level by the up-regulation of adenosine kinase activities. Our results indicate that blood glucose homeostasis is reciprocally regulated by pAMP and insulin. PMID:25512345

  9. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    SciTech Connect

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer cAMP blocks cell death induced by TNF and actinomycin D in cultured hepatocytes. Black-Right-Pointing-Pointer cAMP blocks NF-{kappa}B activation induced by TNF and actinomycin D. Black-Right-Pointing-Pointer cAMP blocks DISC formation following TNF and actinomycin D exposure. Black-Right-Pointing-Pointer cAMP blocks TNF signaling at a proximal step. -- Abstract: Tumor necrosis factor {alpha} (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found

  10. Regulation of ciliary motility by membrane potential in Paramecium: a role for cyclic AMP.

    PubMed

    Bonini, N M; Gustin, M C; Nelson, D L

    1986-01-01

    The membrane potential of Paramecium controls the frequency and direction of the ciliary beat, thus determining the cell's swimming behavior. Stimuli that hyperpolarize the membrane potential increase the ciliary beat frequency and therefore increase forward swimming speed. We have observed that 1) drugs that elevate intracellular cyclic AMP increased swimming speed 2-3-fold, 2) hyperpolarizing the membrane potential by manipulation of extracellular cations (e.g., K+) induced both a transient increase in, and a higher sustained level of cyclic AMP compared to the control, and 3) the swimming speed of detergent-permeabilized cells in MgATP was stimulated 2-fold by the addition of cyclic AMP. Our results suggest that the membrane potential can regulate intracellular cAMP in Paramecium and that control of swimming speed by membrane potential may in part be mediated by cAMP. PMID:2427226

  11. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  12. Occurrence of cyclic AMP and related enzymes during germination of Pinus pinea seeds.

    PubMed

    Martelli, P; Lusini, P; Bovalini, L; Bartali, R; Franchi, G G; Cinci, G

    1987-01-01

    The occurrence of cAMP, adenylate cyclase and cAMP phosphodiesterase has been tested in Pinus pinea seed during germination. The study has been carried out on dormant and imbibed seeds, seedlings, endospermic residues, roots and cotyledons. cAMP has been detected by the protein binding method and its occurrence has been verified by HPLC detections. cAMP phosphodiesterase shows a very high activity at acidic pH, while being completely inactive at pH 7.4. At this pH value, well detectable levels of adenylate cyclase have been observed. Therefore, the classical pathway of synthesis and breakdown of cAMP, already accepted for animal and bacterial cells, seems to be operating in Pinus pinea plant too. PMID:3038780

  13. AMPed Up immunity: how antimicrobial peptides have multiple roles in immune defense

    PubMed Central

    Lai, Yuping; Gallo, Richard L.

    2009-01-01

    Antimicrobial peptides (AMPs) are widely expressed and rapidly induced at epithelial surfaces to repel assault from diverse infectious agents including bacteria, viruses, fungi and parasites. Much information suggests that AMPs act by mechanisms that extend beyond their capacity to serve as gene-encoded antibiotics. For example, some AMPs alter the properties of the mammalian membrane or interact with its receptors to influence diverse cellular processes including cytokine release, chemotaxis, antigen presentation, angiogenesis and wound healing. These functions complement their antimicrobial action and favor resolution of infection and repair of damaged epithelia. Opposing this, some microbes have evolved mechanisms to inactivate or avoid AMPs and subsequently become pathogens. Thus, AMPs are multifunctional molecules that have a central role in infection and Inflammation. PMID:19217824

  14. Cell-to-cell coordination for the spontaneous cAMP oscillation in Dictyostelium

    NASA Astrophysics Data System (ADS)

    Nagano, Seido; Sakurai, Shunsuke

    2013-12-01

    We propose a new cellular dynamics scheme for the spontaneous cAMP oscillations in Dictyostelium discoideum. Our scheme seamlessly integrates both receptor dynamics and G-protein dynamics into our previously developed cellular dynamics scheme. Extensive computer simulation studies based on our new cellular dynamics scheme were conducted in mutant cells to evaluate the molecular network. The validity of our proposed molecular network as well as the controversial PKA-dependent negative feedback mechanism was supported by our simulation studies. Spontaneous cAMP oscillations were not observed in a single mutant cell. However, multicellular states of various mutant cells consistently initiated spontaneous cAMP oscillations. Therefore, cell-to-cell coordination via the cAMP receptor is essential for the robust initiation of spontaneous cAMP oscillations.

  15. Different effect of prostaglandin E2 on B-cell activation by two distinct B-cell differentiation factors, B151-TRF1/IL-5 and B151-TRF2: selective inhibition of B151-TRF2-induced antibody response through increases in intracellular cyclic AMP levels

    PubMed Central

    Ishihara, K.; Ono, S.; Takahama, Y.; Hirayama, F.; Hirano, H.; Itoh, K.; Dobashi, K.; Murakami, S.; Katoh, Y.; Yamaguchi, M.; Hamaoka, T.

    1989-01-01

    Effects of prostaglandin E2 (PGE2) on murine B-cell activation induced by two distinct B-cell differentiation factors, B151-TRF1/IL-5 and B151-TRF2, were examined. A final differentiation of unprimed B cells into IgM-producing cells induced by B151-TRF2 was markedly inhibited by PGE2 at physiological concentrations (around 10-8 M), whereas B151-TRF1/IL-5-induced antibody responses of unprimed as well as activated B cells were not affected by PGE2, even at 10-6 M. B-cell responses induced by B151-TRF2-like factors from autoimmune-prone MRL/1pr mice were also inhibited by PGE2. Biphasic increases in intracellular cyclic AMP (cAMP) levels were induced by culturing B cells with 10-6 or 10-8 M PGE2: rapid increases within 8 min and delayed increases around 16 hr. The direct addition of dibutyryl cAMP to cultures of B cells resulted in marked inhibition of antibody responses when stimulated with B151-TRF2 but not with B151-TRF1/IL-5. The B151-TRF2-induced antibody responses were also inhibited by cAMP-elevating reagents such as forskolin, cholera toxin and theophyline. Furthermore, 2′, 5′-dideoxyadenosine, which is an inhibitor of adenylate cyclase, prevented the PGE2-mediated cAMP accumulation in unprimed B cells as well as the PGE2-mediated inhibition of B151-TRF2-induced B-cell responses when added at the initiation of culture. These results suggest that PGE2 inhibits B151-TRF2-induced antibody responses through the activation of adenylate cyclase and subsequent accumulation of intracellular cAMP, whereas B151-TRF1/IL-5-responsive B cells are resistant to the inhibitory effect of PGE2 and cAMP. PMID:2553585

  16. The Pseudomonas aeruginosa Chp Chemosensory System Regulates Intracellular cAMP Levels by Modulating Adenylate Cyclase Activity

    PubMed Central

    Fulcher, Nanette B.; Holliday, Phillip M.; Klem, Erich; Cann, Martin J.; Wolfgang, Matthew C.

    2010-01-01

    Summary Multiple virulence systems in the opportunistic pathogen Pseudomonas aeruginosa are regulated by the second messenger signaling molecule adenosine 3’, 5’-cyclic monophosphate (cAMP). Production of cAMP by the putative adenylate cyclase enzyme CyaB represents a critical control point for virulence gene regulation. To identify regulators of CyaB, we screened a transposon insertion library for mutants with reduced intracellular cAMP. The majority of insertions resulting in reduced cAMP mapped to the Chp gene cluster encoding a putative chemotaxis-like chemosensory system. Further genetic analysis of the Chp system revealed that it has both positive and negative effects on intracellular cAMP and that it regulates cAMP levels by modulating CyaB activity. The Chp system was previously implicated in the production and function of type IV pili (TFP). Given that cAMP and the cAMP-dependent transcriptional regulator Vfr control TFP biogenesis gene expression, we explored the relationship between cAMP, the Chp system and TFP regulation. We discovered that the Chp system controls TFP production through modulation of cAMP while control of TFP-dependent twitching motility is cAMP-independent. Overall, our data define a novel function for a chemotaxis-like system in controlling cAMP production and establish a regulatory link between the Chp system, TFP and other cAMP-dependent virulence systems. PMID:20345659

  17. AMP-activated Protein Kinase Suppresses Biosynthesis of Glucosylceramide by Reducing Intracellular Sugar Nucleotides*

    PubMed Central

    Ishibashi, Yohei; Hirabayashi, Yoshio

    2015-01-01

    The membrane glycolipid glucosylceramide (GlcCer) plays a critical role in cellular homeostasis. Its intracellular levels are thought to be tightly regulated. How cells regulate GlcCer levels remains to be clarified. AMP-activated protein kinase (AMPK), which is a crucial cellular energy sensor, regulates glucose and lipid metabolism to maintain energy homeostasis. Here, we investigated whether AMPK affects GlcCer metabolism. AMPK activators (5-aminoimidazole-4-carboxamide 1-β-d-ribofuranoside and metformin) decreased intracellular GlcCer levels and synthase activity in mouse fibroblasts. AMPK inhibitors or AMPK siRNA reversed these effects, suggesting that GlcCer synthesis is negatively regulated by an AMPK-dependent mechanism. Although AMPK did not affect the phosphorylation or expression of GlcCer synthase, the amount of UDP-glucose, an activated form of glucose required for GlcCer synthesis, decreased under AMPK-activating conditions. Importantly, the UDP-glucose pyrophosphatase Nudt14, which degrades UDP-glucose, generating UMP and glucose 1-phosphate, was phosphorylated and activated by AMPK. On the other hand, suppression of Nudt14 by siRNA had little effect on UDP-glucose levels, indicating that mammalian cells have an alternative UDP-glucose pyrophosphatase that mainly contributes to the reduction of UDP-glucose under AMPK-activating conditions. Because AMPK activators are capable of reducing GlcCer levels in cells from Gaucher disease patients, our findings suggest that reducing GlcCer through AMPK activation may lead to a new strategy for treating diseases caused by abnormal accumulation of GlcCer. PMID:26048992

  18. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    PubMed Central

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying; Billiar, Timothy R.

    2013-01-01

    Tumor necrosis factor α (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found that cAMP exerts its affect at the proximal level of TNF signaling by inhibiting the formation of the DISC complex upon the binding of TNF to TNFR1. In conclusion, our study shows that cAMP prevents TNF + ActD-induced apoptosis in rat hepatocytes by inhibiting DISC complex formation. PMID:22634003

  19. cAMP/PKA signaling inhibits osteogenic differentiation and bone formation in rodent models.

    PubMed

    Siddappa, Ramakrishnaiah; Mulder, Winfried; Steeghs, Ilse; van de Klundert, Christine; Fernandes, Hugo; Liu, Jun; Arends, Roel; van Blitterswijk, Clemens; de Boer, Jan

    2009-08-01

    We previously demonstrated that cAMP-mediated protein kinase A (PKA) activation induces in vitro osteogenesis and in vivo bone formation by human mesenchymal stem cells (hMSCs). To analyze the species-specific response of this phenomenon and to translate our findings into a clinical trial, suitable animal models and cell lines are desirable. In this report, we assessed whether PKA plays a similar proosteogenic role played by two commonly used PKA activators-N6,2'-O-dibutyryl-cAMP (db-cAMP) and 8-bromo cAMP (8b-cAMP)-in a number of model systems. To this end, we treated MC3T3-E1 cells, mouse calvarial osteoblasts, mouse MSCs, and rat MSCs with cAMP. We demonstrate that cAMP inhibits osteogenesis in rodent cell types, evidenced by inhibition of osteogenic markers such as alkaline phosphatase (ALP), osteocalcin (BGLAP), and collagen type 1 (COL1A1). In support of this, ex vivo-cultured mouse calvaria exposed to db-cAMP showed a reduction in bone volume. Interestingly, cAMP even stimulated adipogenic differentiation in rat MSCs. Taken together, our data demonstrate that cAMP inhibits osteogenesis in vitro and bone formation ex vivo in rodent models in contrast to our earlier findings in hMSCs. The species discrepancy in response to various osteogenic signals is a critical need to be tested in clinically relevant models to translate the fundamental findings in lower species level to clinical applications. PMID:19231969

  20. Differential regulation by AMP and ADP of AMPK complexes containing different γ subunit isoforms

    PubMed Central

    Ross, Fiona A.; Jensen, Thomas E.; Hardie, D. Grahame

    2015-01-01

    The γ subunits of heterotrimeric AMPK complexes contain the binding sites for the regulatory adenine nucleotides AMP, ADP and ATP. We addressed whether complexes containing different γ isoforms display different responses to adenine nucleotides by generating cells stably expressing FLAG-tagged versions of the γ1, γ2 or γ3 isoform. When assayed at a physiological ATP concentration (5 mM), γ1- and γ2-containing complexes were allosterically activated almost 10-fold by AMP, with EC50 values one to two orders of magnitude lower than the ATP concentration. By contrast, γ3 complexes were barely activated by AMP under these conditions, although we did observe some activation at lower ATP concentrations. Despite this, all three complexes were activated, due to increased Thr172 phosphorylation, when cells were incubated with mitochondrial inhibitors that increase cellular AMP. With γ1 complexes, activation and Thr172 phosphorylation induced by the upstream kinase LKB1 [liver kinase B1; but not calmodulin-dependent kinase kinase (CaMKKβ)] in cell-free assays was markedly promoted by AMP and, to a smaller extent and less potently, by ADP. However, effects of AMP or ADP on activation and phosphorylation of the γ2 and γ3 complexes were small or insignificant. Binding of AMP or ADP protected all three γ subunit complexes against inactivation by Thr172 dephosphorylation; with γ2 complexes, ADP had similar potency to AMP, but with γ1 and γ3 complexes, ADP was less potent than AMP. Thus, AMPK complexes containing different γ subunit isoforms respond differently to changes in AMP, ADP or ATP. These differences may tune the responses of the isoforms to fit their differing physiological roles. PMID:26542978

  1. Dibutyryl cAMP effects on thromboxane and leukotriene production in decompression-induced lung injury

    NASA Technical Reports Server (NTRS)

    Little, T. M.; Butler, B. D.

    1997-01-01

    Decompression-induced venous bubble formation has been linked to increased neutrophil counts, endothelial cell injury, release of vasoactive eicosanoids, and increased vascular membrane permeability. These actions may account for inflammatory responses and edema formation. Increasing the intracellular cAMP has been shown to decrease eicosanoid production and edema formation in various models of lung injury. Reduction of decompression-induced inflammatory responses was evaluated in decompressed rats pretreated with saline (controls) or dibutyryl cAMP (DBcAMP, an analog of cAMP). After pretreatment, rats were exposed to either 616 kPa for 120 min or 683 kPa for 60 min. The observed increases in extravascular lung water ratios (pulmonary edema), bronchoalveolar lavage, and pleural protein in the saline control group (683 kPa) were not evident with DBcAMP treatment. DBcAMP pretreatment effects were also seen with the white blood cell counts and the percent of neutrophils in the bronchoalveolar lavage. Urinary levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were significantly increased with the 683 kPa saline control decompression exposure. DBcAMP reduced the decompression-induced leukotriene E4 production in the urine. Plasma levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were increased with the 683-kPa exposure groups. DBcAMP treatment did not affect these changes. The 11-dehydrothromboxane B2 and leukotriene E4 levels in the bronchoalveolar lavage were increased with the 683 kPa exposure and were reduced with the DBcAMP treatment. Our results indicate that DBcAMP has the capability to reduce eicosanoid production and limit membrane permeability and subsequent edema formation in rats experiencing decompression sickness.

  2. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex

    PubMed Central

    Guérin, François; Isnard, Christophe; Giard, Jean Christophe

    2015-01-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-d-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  3. cAMP-binding proteins in medullary tubules from rat kidney: effect of ADH

    SciTech Connect

    Gapstur, S.M.; Homma, S.; Dousa, T.P.

    1988-08-01

    Little is known of the regulatory steps in the cellular action of vasopressin (AVP) on the renal epithelium, subsequent to the cAMP generation. We studied cAMP-binding proteins in the medullary collecting tubule (MCT) and the thick ascending limb of Henle's loop (MTAL) microdissected from the rat kidney by use of photoaffinity labeling. Microdissected tubules were homogenized and photoaffinity labeled by incubation with 1 microM 32P-labeled 8-azido-adenosine 3',5'-cyclic monophosphate (N3-8-(32P)-cAMP); the incorporated 32P was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Both in MCT and MTAL preparations, the analyses showed incorporation of N3-8-(32P)cAMP into two bands (Mr = 49,000 and Mr = 55,000) that comigrated with standards of the cAMP-dependent protein kinase regulatory subunits RI and RII. In MCT, most of the 32P (80%) was incorporated into RI, whereas in MTAL the 32P incorporated into RI and RII was equivalent. When freshly dissected MCT segments were incubated with 10(-12)-10(-6) M AVP, the subsequent photoaffinity labeling of RI with N3-8-(32P)cAMP was markedly diminished in a dose-dependent manner compared with controls. Our results suggest that cAMP binds in MCT and MTAL to regulatory subunits RI and RII of cAMP-dependent protein kinase. However, in MCT the dominant type of cAMP-dependent protein kinase appears to be type I. The outlined procedure is suitable to indirectly measure the occupancy of RI by endogenous cAMP generated in MCT cells in response to physiological levels (10(-12) M) of AVP.

  4. Cyclic AMP can promote APL progression and protect myeloid leukemia cells against anthracycline-induced apoptosis

    PubMed Central

    Gausdal, G; Wergeland, A; Skavland, J; Nguyen, E; Pendino, F; Rouhee, N; McCormack, E; Herfindal, L; Kleppe, R; Havemann, U; Schwede, F; Bruserud, Ø; Gjertsen, B T; Lanotte, M; Ségal-Bendirdjian, E; Døskeland, S O

    2013-01-01

    We show that cyclic AMP (cAMP) elevating agents protect blasts from patients with acute promyelocytic leukemia (APL) against death induced by first-line anti-leukemic anthracyclines like daunorubicin (DNR). The cAMP effect was reproduced in NB4 APL cells, and shown to depend on activation of the generally cytoplasmic cAMP-kinase type I (PKA-I) rather than the perinuclear PKA-II. The protection of both NB4 cells and APL blasts was associated with (inactivating) phosphorylation of PKA site Ser118 of pro-apoptotic Bad and (activating) phosphorylation of PKA site Ser133 of the AML oncogene CREB. Either event would be expected to protect broadly against cell death, and we found cAMP elevation to protect also against 2-deoxyglucose, rotenone, proteasome inhibitor and a BH3-only mimetic. The in vitro findings were mirrored by the findings in NSG mice with orthotopic NB4 cell leukemia. The mice showed more rapid disease progression when given cAMP-increasing agents (prostaglandin E2 analog and theophylline), both with and without DNR chemotherapy. The all-trans retinoic acid (ATRA)-induced terminal APL cell differentiation is a cornerstone in current APL treatment and is enhanced by cAMP. We show also that ATRA-resistant APL cells, believed to be responsible for treatment failure with current ATRA-based treatment protocols, were protected by cAMP against death. This suggests that the beneficial pro-differentiating and non-beneficial pro-survival APL cell effects of cAMP should be weighed against each other. The results suggest also general awareness toward drugs that can affect bone marrow cAMP levels in leukemia patients. PMID:23449452

  5. Cyclic Adenosine Monophosphate Accumulation and beta-Adrenergic Binding in Unweighted and Denervated Rat Soleus Muscle

    NASA Technical Reports Server (NTRS)

    Kirby, Christopher R.; Woodman, Christopher R.; Woolridge, Dale; Tischler, Marc E.

    1992-01-01

    Unweighting, but not denervation, of muscle reportedly "spares" insulin receptors, increasing insulin sensitivity. Unweighting also increases beta-adrenergic responses of carbohydrate metabolism. These differential characteristics were studied further by comparing cyclic adenosine monophosphate (cAMP) accumulation and beta-adrenergic binding in normal and 3-day unweighted or denervated soleus muscle. Submaximal amounts of isoproterenol, a p-agonist, increased cAMP accumulation in vitro and in vivo (by intramuscular (IM) injection) to a greater degree (P less than .05) in unweighted muscles. Forskolin or maximal isoproterenol had similar in vitro effects in all muscles, suggesting increased beta-adrenergic sensitivity following unweighting. Increased sensitivity was confirmed by a greater receptor density (B(sub max)) for iodo-125(-)-pindolol in particulate preparations of unweighted (420 x 10(exp -18) mol/mg muscle) than of control or denervated muscles (285 x 10(exp-18) mol/mg muscle). The three dissociation constant (Kd) values were similar (20.3 to 25.8 pmol/L). Total binding capacity (11.4 fmol/muscle) did not change during 3 days of unweighting, but diminished by 30% with denervation. This result illustrates the "sparing" and loss of receptors, respectively, in these two atrophy models. In diabetic animals, IM injection of insulin diminished CAMP accumulation in the presence of theophylline in unweighted muscle (-66% +/- 2%) more than in controls (-42% +'- 6%, P less than .001). These results show that insulin affects CAMP formation in muscle, and support a greater in vivo insulin response following unweighting atrophy. These various data support a role for lysosomal proteolysis in denervation, but not in unweighting, atrophy.

  6. 40 CFR 262.34 - Accumulation time.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 27 2013-07-01 2013-07-01 false Accumulation time. 262.34 Section 262.34 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE Pre-Transport Requirements § 262.34 Accumulation time. (a) Except as provided in paragraphs (d),...

  7. Elevated cAMP increases aquaporin-3 plasma membrane diffusion.

    PubMed

    Marlar, Saw; Arnspang, Eva C; Koffman, Jennifer S; Løcke, Else-Merete; Christensen, Birgitte M; Nejsum, Lene N

    2014-03-15

    Regulated urine concentration takes place in the renal collecting duct upon arginine vasopressin (AVP) stimulation, where subapical vesicles containing aquaporin-2 (AQP2) are inserted into the apical membrane instantly increasing water reabsorption and urine concentration. The reabsorped water exits via basolateral AQP3 and AQP4. Upon long-term stimulation with AVP or during thirst, expression levels of both AQP2 and AQP3 are increased; however, there is so far no evidence for short-term AVP regulation of AQP3 or AQP4. To facilitate the increase in transepithelial water transport, AQP3 may be short-term regulated via changes in protein-protein interactions, incorporation into lipid rafts, and/or changes in steady-state turnover, which could result in changes in the diffusion behavior of AQP3. Thus we measured AQP3 diffusion coefficients upon stimulation with the AVP mimic forskolin to reveal if AQP3 could be short-term regulated by AVP. k-Space image correlation spectroscopy (kICS) analysis of time-lapse image sequences of basolateral enhanced green fluorescent protein-tagged AQP3 (AQP3-EGFP) revealed that the forskolin-mediated elevation of cAMP increased the diffusion coefficient by 58% from 0.0147 ± 0.0082 μm(2)/s (control) to 0.0232 ± 0.0085 μm(2)/s (forskolin, P < 0.05). Quantum dot-conjugated antibody labeling also revealed a significant increase in AQP3 diffusion upon forskolin treatment by 44% [0.0104 ± 0.0040 μm(2)/s (control) vs. 0.0150 ± 0.0016 μm(2)/s (forskolin, P < 0.05)]. Immunoelectron microscopy showed no obvious difference in AQP3-EGFP expression levels or localization in the plasma membrane upon forskolin stimulation. Thus AQP3-EGFP diffusion is altered upon increased cAMP, which may correspond to basolateral adaptations in response to the increased apical water readsorption. PMID:24452376

  8. Release of Periplasmic Nucleotidase Induced by Human Antimicrobial Peptide in E. coli Causes Accumulation of the Immunomodulator Adenosine

    PubMed Central

    Estrela, Andreia Bergamo; Türck, Patrick; Stutz, Elaine; Abraham, Wolf-Rainer

    2015-01-01

    Previous work by our group described that human β-defensin-2 induces accumulation of extracellular adenosine (Ado) in E. coli cultures through a non-lytic mechanism causing severe plasmolysis. Here, we investigate the presence of AMP as a direct precursor and the involvement of a bacterial enzyme in the generation of extracellular Ado by treated bacteria. Following hBD-2 treatment, metabolites were quantified in the supernatants using targeted HPLC-MS/MS analysis. Microbial growth was monitored by optical density and cell viability was determined by colony forming units counts. Phosphatase activity was measured using chromogenic substrate pNPP. The results demonstrate that defensin-treated E. coli strain W releases AMP in the extracellular space, where it is converted to Ado by a bacterial soluble factor. An increase in phosphatase activity in the supernatant was observed after peptide treatment, similar to the effect of sucrose-induced osmotic stress, suggesting that the periplasmic 5'nucleotidase (5'-NT) is released following the plasmolysis event triggered by the peptide. Ado accumulation was enhanced in the presence of Co2+ ion and inhibited by EDTA, further supporting the involvement of a metallo-phosphatase such as 5’-NT in extracellular AMP conversion into Ado. The comparative analysis of hBD-induced Ado accumulation in different E. coli strains and in Pseudomonas aeruginosa revealed that the response is not correlated to the peptide's effect on cell viability, but indicates it might be dependent on the subcellular distribution of the nucleotidase. Taken together, these data shed light on a yet undescribed mechanism of host-microbial interaction: a human antimicrobial peptide inducing selective release of a bacterial enzyme (E. coli 5'-NT), leading to the formation of a potent immunomodulator metabolite (Ado). PMID:26371472

  9. Release of Periplasmic Nucleotidase Induced by Human Antimicrobial Peptide in E. coli Causes Accumulation of the Immunomodulator Adenosine.

    PubMed

    Estrela, Andreia Bergamo; Türck, Patrick; Stutz, Elaine; Abraham, Wolf-Rainer

    2015-01-01

    Previous work by our group described that human β-defensin-2 induces accumulation of extracellular adenosine (Ado) in E. coli cultures through a non-lytic mechanism causing severe plasmolysis. Here, we investigate the presence of AMP as a direct precursor and the involvement of a bacterial enzyme in the generation of extracellular Ado by treated bacteria. Following hBD-2 treatment, metabolites were quantified in the supernatants using targeted HPLC-MS/MS analysis. Microbial growth was monitored by optical density and cell viability was determined by colony forming units counts. Phosphatase activity was measured using chromogenic substrate pNPP. The results demonstrate that defensin-treated E. coli strain W releases AMP in the extracellular space, where it is converted to Ado by a bacterial soluble factor. An increase in phosphatase activity in the supernatant was observed after peptide treatment, similar to the effect of sucrose-induced osmotic stress, suggesting that the periplasmic 5'nucleotidase (5'-NT) is released following the plasmolysis event triggered by the peptide. Ado accumulation was enhanced in the presence of Co2+ ion and inhibited by EDTA, further supporting the involvement of a metallo-phosphatase such as 5'-NT in extracellular AMP conversion into Ado. The comparative analysis of hBD-induced Ado accumulation in different E. coli strains and in Pseudomonas aeruginosa revealed that the response is not correlated to the peptide's effect on cell viability, but indicates it might be dependent on the subcellular distribution of the nucleotidase. Taken together, these data shed light on a yet undescribed mechanism of host-microbial interaction: a human antimicrobial peptide inducing selective release of a bacterial enzyme (E. coli 5'-NT), leading to the formation of a potent immunomodulator metabolite (Ado). PMID:26371472

  10. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  11. Central role of soluble adenylyl cyclase and cAMP in sperm physiology

    PubMed Central

    Buffone, Mariano G.; Wertheimer, Eva V.; Visconti, Pablo E.; Krapf, Dario

    2014-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP), the first second messenger to be described, plays a central role in cell signaling in a wide variety of cell types. Over the last decades, a wide body of literature addressed the different roles of cAMP in cell physiology, mainly in response to neurotransmitters and hormones. cAMP is synthesized by a wide variety of adenylyl cylases that can generally be grouped in two types: transmembrane adenylyl cyclase and soluble adenylyl cyclases. In particular, several aspects of sperm physiology are regulated by cAMP produced by a single atypical adenylyl cyclase (Adcy10, aka sAC, SACY). The signature that identifies sAC among other ACs, is their direct stimulation by bicarbonate. The essential nature of cAMP in sperm function has been demonstrated using gain of function as well as loss of function approaches. This review unifies state of the art knowledge of the role of cAMP and those enzymes involved in cAMP signaling pathways required for the acquisition of fertilizing capacity of mammalian sperm. PMID:25066614

  12. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  13. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.

    PubMed

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-11-18

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  14. Sustained exposure to catecholamines affects cAMP/PKA compartmentalised signalling in adult rat ventricular myocytes.

    PubMed

    Fields, Laura A; Koschinski, Andreas; Zaccolo, Manuela

    2016-07-01

    In the heart compartmentalisation of cAMP/protein kinase A (PKA) signalling is necessary to achieve a specific functional outcome in response to different hormonal stimuli. Chronic exposure to catecholamines is known to be detrimental to the heart and disrupted compartmentalisation of cAMP signalling has been associated to heart disease. However, in most cases it remains unclear whether altered local cAMP signalling is an adaptive response, a consequence of the disease or whether it contributes to the pathogenetic process. We have previously demonstrated that isoforms of PKA expressed in cardiac myocytes, PKA-I and PKA-II, localise to different subcellular compartments and are selectively activated by spatially confined pools of cAMP, resulting in phosphorylation of distinct downstream targets. Here we investigate cAMP signalling in an in vitro model of hypertrophy in primary adult rat ventricular myocytes. By using a real time imaging approach and targeted reporters we find that that sustained exposure to catecholamines can directly affect cAMP/PKA compartmentalisation. This appears to involve a complex mechanism including both changes in the subcellular localisation of individual phosphodiesterase (PDE) isoforms as well as the relocalisation of PKA isoforms. As a result, the preferential coupling of PKA subsets with different PDEs is altered resulting in a significant difference in the level of cAMP the kinase is exposed to, with potential impact on phosphorylation of downstream targets. PMID:26475678

  15. Cyclic AMP Signaling through Epac Axis Modulates Human Hemogenic Endothelium and Enhances Hematopoietic Cell Generation.

    PubMed

    Saxena, Shobhit; Rönn, Roger E; Guibentif, Carolina; Moraghebi, Roksana; Woods, Niels-Bjarne

    2016-05-10

    Hematopoietic cells emerge from hemogenic endothelium in the developing embryo. Mechanisms behind human hematopoietic stem and progenitor cell development remain unclear. Using a human pluripotent stem cell differentiation model, we report that cyclic AMP (cAMP) induction dramatically increases HSC-like cell frequencies. We show that hematopoietic cell generation requires cAMP signaling through the Exchange proteins activated by cAMP (cAMP-Epac) axis; Epac signaling inhibition decreased both hemogenic and non-hemogenic endothelium, and abrogated hematopoietic cell generation. Furthermore, in hematopoietic progenitor and stem-like cells, cAMP induction mitigated oxidative stress, created a redox-state balance, and enhanced C-X-C chemokine receptor type 4 (CXCR4) expression, benefiting the maintenance of these primitive cells. Collectively, our study provides insights and mechanistic details on the previously unrecognized role of cAMP signaling in regulating human hematopoietic development. These findings advance the mechanistic understanding of hematopoietic development toward the development of transplantable human hematopoietic cells for therapeutic needs. PMID:27117782

  16. Role of coronary endothelium in cyclic AMP formation by the heart

    SciTech Connect

    Kroll, K.; Schrader, J.

    1986-03-01

    In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 ..mu..M), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine.

  17. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA

    PubMed Central

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-01-01

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  18. Detection of plasmid-mediated AmpC β-lactamase in Escherichia coli

    PubMed Central

    LIU, XIANGQUN; LIU, YONGRUI

    2016-01-01

    Escherichia coli (E. coli) is a common opportunistic pathogen for nosocomial infection. The aim of the study was to examine the phenotype, genotype and epidemiology of plasmid-mediated AmpC β-lactamases in E. coli. In total, 96 clinical isolates of repeated E. coli were collected from different hospitals between August and October 2012. Using a cefoxitin disk diffusion method to identify the phenotype of AmpC β-lactamases in E. coli, the plasmid was extracted, and multiplex polymerase chain reaction (PCR) was used to determine the amp gene. The PCR products were purified and sequenced. Of the 96 isolates strains, 43 strains were cefoxitin-resistant. Twelve (12.5%) isolates were detected to produce AmpC β-lactamases with multiplex PCR, 11 strains carried DHA type ampC-resistant genes, and one strain carried ACC type ampC-resistant genes. In conclusion, the incidence of producing a plasmid-mediated AmpC enzyme of E. coli strains was relatively high. Therefore, antibiotics such as imipenem, a carbapenem, potentially serve as the treatment of choice for the infection. PMID:27284407

  19. Osteoblast differentiation is functionally associated with decreased AMP kinase activity.

    PubMed

    Kasai, Takayuki; Bandow, Kenjiro; Suzuki, Hiraku; Chiba, Norika; Kakimoto, Kyoko; Ohnishi, Tomokazu; Kawamoto, Shin-ichiro; Nagaoka, Eiichi; Matsuguchi, Tetsuya

    2009-12-01

    Osteoblasts, originating from mesenchymal stem cells, play a pivotal role in bone formation and mineralization. Several transcription factors including runt-related transcription factor 2 (Runx2) have been reported to be essential for osteoblast differentiation, whereas the cytoplasmic signal transduction pathways controlling the differentiation process have not been fully elucidated. AMP-activated protein kinase (AMPK) is a serine-threonine kinase generally regarded as a key regulator of cellular energy homeostasis, polarity, and division. Recent lines of evidence have indicated that the activity of the catalytic alpha subunit of AMPK is regulated through its phosphorylation by upstream AMPK kinases (AMPKKs) including LKB1. Here, we explored the role of AMPK in osteoblast differentiation using in vitro culture models. Phosphorylation of AMPKalpha was significantly decreased during osteoblastic differentiation in both primary osteoblasts and MC3T3-E1, a mouse osteoblastic cell line. Conversely, the terminal differentiation of primary osteoblasts and MC3T3-E1 cells, represented by matrix mineralization, was significantly inhibited by glucose restriction and stimulation with metformin, both of which are known activators of AMPK. Matrix mineralization of MC3T3-E1 cells was also inhibited by the forced expression of a constitutively active form of AMPKalpha. Metformin significantly inhibited gene expression of Runx2 along with osteoblast differentiation markers including osteocalcin (Ocn), bone sialo protein (Bsp), and osteopontin (Opn). Thus, our present data indicate that differentiation of osteoblasts is functionally associated with decreased AMPK activity. PMID:19725053

  20. Activating AMP-activated protein kinase (AMPK) slows renal cystogenesis.

    PubMed

    Takiar, Vinita; Nishio, Saori; Seo-Mayer, Patricia; King, J Darwin; Li, Hui; Zhang, Li; Karihaloo, Anil; Hallows, Kenneth R; Somlo, Stefan; Caplan, Michael J

    2011-02-01

    Renal cyst development and expansion in autosomal dominant polycystic kidney disease (ADPKD) involves both fluid secretion and abnormal proliferation of cyst-lining epithelial cells. The chloride channel of the cystic fibrosis transmembrane conductance regulator (CFTR) participates in secretion of cyst fluid, and the mammalian target of rapamycin (mTOR) pathway may drive proliferation of cyst epithelial cells. CFTR and mTOR are both negatively regulated by AMP-activated protein kinase (AMPK). Metformin, a drug in wide clinical use, is a pharmacological activator of AMPK. We find that metformin stimulates AMPK, resulting in inhibition of both CFTR and the mTOR pathways. Metformin induces significant arrest of cystic growth in both in vitro and ex vivo models of renal cystogenesis. In addition, metformin administration produces a significant decrease in the cystic index in two mouse models of ADPKD. Our results suggest a possible role for AMPK activation in slowing renal cystogenesis as well as the potential for therapeutic application of metformin in the context of ADPKD. PMID:21262823

  1. Perivascular fat, AMP-activated protein kinase and vascular diseases

    PubMed Central

    Almabrouk, T A M; Ewart, M A; Salt, I P; Kennedy, S

    2014-01-01

    Perivascular adipose tissue (PVAT) is an active endocrine and paracrine organ that modulates vascular function, with implications for the pathophysiology of cardiovascular disease (CVD). Adipocytes and stromal cells contained within PVAT produce mediators (adipokines, cytokines, reactive oxygen species and gaseous compounds) with a range of paracrine effects modulating vascular smooth muscle cell contraction, proliferation and migration. However, the modulatory effect of PVAT on the vascular system in diseases, such as obesity, hypertension and atherosclerosis, remains poorly characterized. AMP-activated protein kinase (AMPK) regulates adipocyte metabolism, adipose biology and vascular function, and hence may be a potential therapeutic target for metabolic disorders such as type 2 diabetes mellitus (T2DM) and the vascular complications associated with obesity and T2DM. The role of AMPK in PVAT or the actions of PVAT have yet to be established, however. Activation of AMPK by pharmacological agents, such as metformin and thiazolidinediones, may modulate the activity of PVAT surrounding blood vessels and thereby contribute to their beneficial effect in cardiometabolic diseases. This review will provide a current perspective on how PVAT may influence vascular function via AMPK. We will also attempt to demonstrate how modulating AMPK activity using pharmacological agents could be exploited therapeutically to treat cardiometabolic diseases. PMID:24490856

  2. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  3. Rethinking the roles of CRP, cAMP, and sugar-mediated global regulation in the Vibrionaceae.

    PubMed

    Colton, Deanna M; Stabb, Eric V

    2016-02-01

    Many proteobacteria modulate a suite of catabolic genes using the second messenger cyclic 3', 5'-AMP (cAMP) and the cAMP receptor protein (CRP). Together, the cAMP-CRP complex regulates target promoters, usually by activating transcription. In the canonical model, the phosphotransferase system (PTS), and in particular the EIIA(Glc) component for glucose uptake, provides a mechanistic link that modulates cAMP levels depending on glucose availability, resulting in more cAMP and activation of alternative catabolic pathways when glucose is unavailable. Within the Vibrionaceae, cAMP-CRP appears to play the classical role in modulating metabolic pathways; however, it also controls functions involved in natural competence, bioluminescence, pheromone signaling, and colonization of animal hosts. For this group of marine bacteria, chitin is an ecologically relevant resource, and chitin's monomeric sugar N-acetylglucosamine (NAG) supports robust growth while also triggering regulatory responses. Recent studies with Vibrio fischeri indicate that NAG and glucose uptake share EIIA(Glc), yet the responses of cAMP-CRP to these two carbon sources are starkly different. Moreover, control of cAMP levels appears to be more dominantly controlled by export and degradation. Perhaps more surprisingly, although CRP may require cAMP, its activity can be controlled in response to glucose by a mechanism independent of cAMP levels. Future studies in this area promise to shed new light on the role of cAMP and CRP. PMID:26215147

  4. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  5. Phosphodiesterase inhibition by a gastroprotective agent irsogladine: preferential blockade of cAMP hydrolysis.

    PubMed

    Kyoi, Takashi; Oka, Michiko; Noda, Kumiko; Ukai, Yojiro

    2004-08-27

    The effect of irsogladine [2,4-diamino-6-(2,5-dichlorophenyl)-s-triazine maleate], an antiulcer drug, on contents of cyclic nucleotides including cAMP and cGMP was investigated in rat stomachs. Irsogladine concentration-dependently increased cAMP content in rat glandula stomach. However, irsogladine at higher concentration (10(-5) M) was unable to further increase cAMP level in the presence of non-selective phosphodiesterase (PDE) inhibitor 3-isobutyl-1-methylxanthine, although 3-isobutyl-1-methylxanthine by itself increased cAMP level. On the other hand, irsogladine had no effect on the glandula cGMP content. Subsequently, the effect of irsogladine on the cyclic nucleotide degradation by purified bovine brain and heart PDEs was investigated. The cAMP degradation by purified bovine brain PDE was partially suppressed by PDE1 inhibitor vinpocetin, PDE2 inhibitor erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride and PDE4 inhibitor rolipram but not by PDE3 inhibitor cilostamide, and completely inhibited by 3-isobutyl-1-methylxanthine, suggesting that is attributed almost exclusively to PDE1, PDE2 and PDE4. Meanwhile, cGMP degradation by purified bovine brain PDE was partially suppressed by erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride. Irsogladine preferentially inhibited the response to cAMP degradation compared with cGMP degradation by this brain PDE. The cAMP degradation by bovine heart PDE was almost completely inhibited by the combination with vinpocetine and cilostamide, indicating that is mediated almost exclusively by PDE1 and PDE3. Irsogladine suppressed this cAMP degradation measured in the presence of vinpocetine to almost the same extent as that determined in the presence of cilostamide. These results indicate that irsogladine produces the increase of intracellular cAMP content via non-selective inhibition of PDE isozymes, which may be a key mechanism involved in its gastroprotective actions. PMID:15302227

  6. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade

    PubMed Central

    Astakhova, Luba A.; Samoiliuk, Evgeniia V.; Govardovskii, Victor I.

    2012-01-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide–gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca2+ exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca2+]in. Analysis by a complete model of rod phototransduction suggests that an increase of [Ca2+]in might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca2+]in and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  7. Autophosphorylation and rapid dephosphorylation of the cAMP-dependent protein kinase from Blastocladiella emersonii zoospores.

    PubMed

    Gomes, S L; Juliani, M H; da Costa Maia, J C; Rangel-Aldao, R

    1983-06-10

    The photoaffinity label 8-azido[32P]adenosine 3':5'-monophosphate and affinity chromatography on N6-(2-aminoethyl)-cAMP-Sepharose were used to analyze the cAMP-binding proteins present in cell-free extracts of Blastocladiella emersonii zoospores. In the presence of a mixture of protease inhibitors, 8-azido[32P]cAMP was specifically and quantitatively incorporated into a major protein band of Mr = 58,000, and three minor protein bands of Mr = 50,000, Mr = 43,000, and Mr = 36,000 respectively, after autoradiography following sodium dodecyl sulfate-polyacryl-amide gel electrophoresis. In the absence of the protease inhibitors, the Mr = 58,000 protein band was converted into the lower molecular weight cAMP-binding proteins, indicating a high sensitivity of the intact Mr = 58,000 protein band to endogenous proteases. The Mr = 58,000 protein corresponded to the regulatory subunit (R), of the cAMP-dependent protein kinase of zoospores, as shown by their identical behavior on DEAE-cellulose chromatography. The partially purified protein kinase incorporated 32P from [gamma-32P] ATP . Mg2+ into R as demonstrated by the specific adsorption of the 32P-labeled protein with N6-(2-aminoethyl)-cAMP-Sepharose. The incorporated 32P group was rapidly removed by endogenous phosphoprotein phosphatases in the presence of cAMP, as shown by pulse-chase experiments with [gamma-32P]ATP. Dephosphorylation of R-cAMP and rapid proteolysis may indicate two other mechanisms, in addition to cAMP, for the control of this protein kinase in vivo. PMID:6304069

  8. Long-range signaling in growing neurons after local elevation of cyclic AMP-dependent activity

    PubMed Central

    1994-01-01

    Cyclic AMP-dependent activity at the growth cone or the soma of cultured Xenopus spinal neurons was elevated by local extracellular perfusion of the neuron with culture medium containing 8-bromoadenosine 3',5'-cyclic monophosphate (8-br-cAMP) or forskolin. During local perfusion of one of the growth cones of multipolar neurons with these drugs, the perfused growth cone showed further extension, while the distant, unperfused growth cones were inhibited in their growth. Local perfusion of the growth cone with culture medium or local perfusion with 8-br-cAMP at a cell-free region 100 microns away from the growth cone did not produce any effect on the extension of the growth cone. Reduced extension of all growth cones was observed when the perfusion with 8-br-cAMP was restricted to the soma. The distant inhibitory effect does not depend on the growth of the perfused growth cone since local coperfusion of the growth cone with 8-br-cAMP and colchicine inhibited growth on both perfused and unperfused growth cones, while local perfusion with colchicine alone inhibited only the perfused growth cone. The distant inhibitory effect was abolished when the perfusion of 8-br-cAMP was carried out together with kinase inhibitor H- 8, suggesting the involvement of cAMP-dependent protein kinase and/or its downstream factors in the long-range inhibitory signaling. Uniform exposure of the entire neuron to bath-applied 8-br-cAMP, however, led to enhanced growth activity at all growth cones. Thus, local elevation of cAMP-dependent activity produces long-range and opposite effects on distant parts of the neuron, and a cytosolic gradient of second messengers may produce effects distinctly different from those following uniform global elevation of the messenger, leading to differential growth regulation at different regions of the same neuron. PMID:7798321

  9. Influence of cAMP and protein kinase A on neurite length from spiral ganglion neurons

    PubMed Central

    Xu, Ningyong; Engbers, Jonathan; Khaja, Sobia; Xu, Linjing; Clark, J. Jason; Hansen, Marlan R.

    2011-01-01

    Regrowth of peripheral spiral ganglion neuron (SGN) fibers is a primary objective in efforts to improve cochlear implant outcomes and to potentially reinnervate regenerated hair cells. Cyclic adenosine monophosphate (cAMP) regulates neurite growth and guidance via activation of protein kinase A (PKA) and Exchange Protein directly Activated by Cylic AMP (Epac). Here we explored the effects of cAMP signaling on SGN neurite length in vitro. We find that the cAMP analog, cpt-cAMP, exerts a biphasic effect on neurite length; increasing length at lower concentrations and reducing length at higher concentrations. This biphasic response occurs in cultures plated on laminin, fibronectin, or tenascin C suggesting that it is not substrate dependent. cpt-cAMP also reduces SGN neurite branching. The Epac-specific agonist, 8-pCPT-2’-O-Me-cAMP, does not alter SGN neurite length. Constitutively active PKA isoforms strongly inhibit SGN neurite length similar to higher levels of cAMP. Chronic membrane depolarization activates PKA in SGNs and also inhibits SGN neurite length. However, inhibition of PKA fails to rescue neurite length in depolarized cultures implying that activation of PKA is not necessary for the inhibition of SGN neurite length by chronic depolarization. Expression of constitutively active phosphatidylinositol 3-kinase, but not c-Jun N-terminal kinase, isoforms partially rescues SGN neurite length in the presence of activated PKA. Taken together, these results suggest that activation of cAMP/PKA represents a potential strategy to enhance SGN fiber elongation following deafness; however such therapies will likely require careful titration so as to simultaneously promote rather than inhibit nerve fiber regeneration. PMID:22154930

  10. Analysis of Advanced Modular Power Systems (AMPS) for Deep Space Exploration

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard; Soeder, James F.; Beach, Ray

    2014-01-01

    The Advanced Modular Power Systems (AMPS) project is developing a modular approach to spacecraft power systems for exploration beyond Earth orbit. AMPS is intended to meet the need of reducing the cost of design development, test and integration and also reducing the operational logistics cost of supporting exploration missions. AMPS seeks to establish modular power building blocks with standardized electrical, mechanical, thermal and data interfaces that can be applied across multiple exploration vehicles. The presentation discusses the results of a cost analysis that compares the cost of the modular approach against a traditional non-modular approach.

  11. Compartmentation of cAMP signalling in cardiomyocytes in health and disease.

    PubMed

    Perera, R K; Nikolaev, V O

    2013-04-01

    3',5'-cyclic adenosine monophosphate (cAMP) is a ubiquitous second messenger critically involved in the regulation of heart function. It has been shown to act in discrete subcellular signalling compartments formed by differentially localized receptors, phosphodiesterases and protein kinases. Cardiac diseases such as hypertrophy or heart failure are associated with structural and functional remodelling of these microdomains which leads to changes in cAMP compartmentation. In this review, we will discuss recent key findings which provided new insights into cAMP compartmentation in cardiomyocytes with a particular focus on its alterations in heart disease. PMID:23383621

  12. Cyclic AMP induces maturation of trout sperm axoneme to initiate motility

    NASA Astrophysics Data System (ADS)

    Morisawa, Masaaki

    1982-02-01

    Cyclic AMP has long been implicated as an activator of sperm motility1-5. From more recent experiments using demembranated mammalian and sea urchin spermatozoa6,7, it was concluded that cyclic AMP only increases the motility of the axoneme after it has been initiated by MgATP2-. We have now carried out similar experiments using spermatozoa collected from the rainbow trout and demembranated by treatment with the detergent Triton X-100. Our results suggest that in this species, cyclic AMP is required before MgATP2- to trigger maturation of the nonmotile axoneme. Subsequent addition of an energy source then induces motility.

  13. The cAMP Pathway as Therapeutic Target in Autoimmune and Inflammatory Diseases

    PubMed Central

    Raker, Verena Katharina; Becker, Christian; Steinbrink, Kerstin

    2016-01-01

    Nucleotide signaling molecules contribute to the regulation of cellular pathways. In the immune system, cyclic adenosine monophosphate (cAMP) is well established as a potent regulator of innate and adaptive immune cell functions. Therapeutic strategies to interrupt or enhance cAMP generation or effects have immunoregulatory potential in autoimmune and inflammatory disorders. Here, we provide an overview of the cyclic AMP axis and its role as a regulator of immune functions and discuss the clinical and translational relevance of interventions with these processes. PMID:27065076

  14. Phase A conceptual design study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The 12 month Phase A Conceptual Design Study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload performed within the Program Development Directorate of the Marshall Space Flight Center is presented. The AMPS payload makes use of the Spacelab pressurized module and pallet, is launched by the space shuttle, and will have initial flight durations of 7 days. Scientific instruments including particle accelerators, high power transmitters, optical instruments, and chemical release devices are mounted externally on the Spacelab pallet and are controlled by the experimenters from within the pressurized module. The capability of real-time scientist interaction on-orbit with the experiment is a major characteristic of AMPS.

  15. Virus-induced atherosclerosis. Herpesvirus infection alters aortic cholesterol metabolism and accumulation.

    PubMed Central

    Hajjar, D. P.; Fabricant, C. G.; Minick, C. R.; Fabricant, J.

    1986-01-01

    Infection of normocholesterolemic, specific-pathogen-free chickens with Marek's disease herpesvirus (MDV) has been shown histologically to lead to chronic atherosclerosis like that in humans. The development of herpesvirus-induced atherosclerosis in vivo and the presence of specific Marek's antigen within aortic cells suggested that MDV infection may modify lipid metabolism and lead to significant lipid accumulation. Experiments reported herein were designed to determine the types and quantity of lipid present in aortas from MDV-infected and uninfected chickens between 2 and 8 months of age following infection and assess one possible mechanism of lipid accumulation by evaluating the effect of MDV infection on aortic cholesterol and cholesteryl ester (CE) metabolism. Chromatographic-fluorometric analyses indicated that at 4 and 8 months of age after MDV inoculation, MDV-infected animals had a significant (P less than 0.05) two-fold to threefold increase in total aortic lipid accumulation characterized by significant increases in cholesterol, CE, triacylglycerol, and phospholipid as compared with aortas from uninfected animals. At 8 months of age, similar increases in aortic lipid accumulation were observed in MDV-infected animals as compared with those animals vaccinated with turkey herpesvirus and later challenged with MDV. CE synthetic activity was increased significantly by 50% at 4 months of age in the MDV-infected group as compared with the uninfected group, which could explain the initial increase in CE accumulation. By 8 months of age, the authors also observed a twofold increase in CE synthetic activity and a 30% and 80% reduction in lysosomal and cytoplasmic CE hydrolytic activities, respectively, in aortas of MDV-infected chickens as compared to controls. Moreover, infection with MDV blocked the activation of cytoplasmic CE hydrolytic activity by dibutyryl cyclic AMP or exogenous cyclic AMP-dependent protein kinase. Taken together, these results suggest

  16. THE KINETICS OF PENETRATION : VIII. TEMPORARY ACCUMULATION.

    PubMed

    Osterhout, W J; Kamerling, S E

    1934-03-20

    A model is described which throws light on the mechanism of accumulation. In the model used an external aqueous phase A is separated by a non-aqueous phase B (representing the protoplasm) from the artificial sap in C. A contains KOH and C contains HCl: they tend to mix by passing through the non-aqueous layer but much more KOH moves so that most of the KCl is formed in C, where the concentration of potassium becomes much greater than in A. This accumulation is only temporary for as the system approaches equilibrium the composition of A approaches identity with that of C, since all the substances present can pass through the non-aqueous layer. Such an approach to equilibrium may be compared to the death of the cell as the result of which accumulation disappears. During the earlier stages of the experiment potassium tends to go in as KOH and at the same time to go out as KCl. These opposing tendencies do not balance until the concentration of potassium inside becomes much greater than outside (hence potassium accumulates). The reason is that KCl, although its driving force be great, moves very slowly in B because its partition coefficient is low and in consequence its concentration gradient in B is small. This illustrates the importance of partition coefficients for penetration in models and in living cells. It also indicates that accumulation depends on the fact that permeability is greater for the ingoing compound of the accumulating substance than for the outgoing compound. Other things being equal, accumulation is increased by maintaining a low pH in C. Hence we may infer that anything which checks the production of acid in the living cell may be expected to check accumulation and growth. This model recalls the situation in Valonia and in most living cells where potassium accumulates as KCl, perhaps because it enters as KOH and forms KA in the sap (where A is an organic anion). In some plants potassium accumulates as KA but when HCl exists in the external

  17. Geochemistry Model Validation Report: External Accumulation Model

    SciTech Connect

    K. Zarrabi

    2001-09-27

    The purpose of this Analysis and Modeling Report (AMR) is to validate the External Accumulation Model that predicts accumulation of fissile materials in fractures and lithophysae in the rock beneath a degrading waste package (WP) in the potential monitored geologic repository at Yucca Mountain. (Lithophysae are voids in the rock having concentric shells of finely crystalline alkali feldspar, quartz, and other materials that were formed due to entrapped gas that later escaped, DOE 1998, p. A-25.) The intended use of this model is to estimate the quantities of external accumulation of fissile material for use in external criticality risk assessments for different types of degrading WPs: U.S. Department of Energy (DOE) Spent Nuclear Fuel (SNF) codisposed with High Level Waste (HLW) glass, commercial SNF, and Immobilized Plutonium Ceramic (Pu-ceramic) codisposed with HLW glass. The scope of the model validation is to (1) describe the model and the parameters used to develop the model, (2) provide rationale for selection of the parameters by comparisons with measured values, and (3) demonstrate that the parameters chosen are the most conservative selection for external criticality risk calculations. To demonstrate the applicability of the model, a Pu-ceramic WP is used as an example. The model begins with a source term from separately documented EQ6 calculations; where the source term is defined as the composition versus time of the water flowing out of a breached waste package (WP). Next, PHREEQC, is used to simulate the transport and interaction of the source term with the resident water and fractured tuff below the repository. In these simulations the primary mechanism for accumulation is mixing of the high pH, actinide-laden source term with resident water; thus lowering the pH values sufficiently for fissile minerals to become insoluble and precipitate. In the final section of the model, the outputs from PHREEQC, are processed to produce mass of accumulation

  18. Microbial accumulation of uranium, radium, and cesium

    SciTech Connect

    Strandberg, G.W.; Shumate, S.E. II; Parrott, J.R. Jr.; North, S.E.

    1981-05-01

    Diverse microbial species varied considerably in their ability to accumulate uranium, cesium, and radium. Mechanistic differences in uranium uptake by Saccharomyces cerevisiae and Pseudomonas aeruginosa were indicated. S. serevisiae exhibited a slow (hours) surface accumulation of uranium which was subject to environmental factors, while P. aeruginosa accumulated uranium rapidly (minutes) as dense intracellular deposits and did not appear to be affected by environmental parameters. Metabolism was not required for uranium uptake by either organism. Cesium and radium were concentrated to a considerably lesser extent than uranium by the several species tested.

  19. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. PMID:27137358

  20. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  1. Activation of f-channels by cAMP analogues in macropatches from rabbit sino-atrial node myocytes.

    PubMed Central

    Bois, P; Renaudon, B; Baruscotti, M; Lenfant, J; DiFrancesco, D

    1997-01-01

    1. The action of the two diastereometric phosphorothioate derivatives of cAMP, Rp-cAMPs and Sp-cAMPs, was investigated on hyperpolarization-activated 'pacemaker' current (i(f)) recorded in inside-out macropatches from rabbit sino-atrial (SA) node myocytes. 2. When superfused on the intracellular side of f-channels at the concentration of 10 microM, both cAMP derivatives accelerated i(f) activation; their action was moderately less pronounced than that due to the same concentration of cAMP. 3. The measurement of the i(f) conductance-voltage relation by voltage ramp protocols indicated that both cAMP analogues shift the activation curve of i(f) to more positive voltages with no change in maximal (fully activated) conductance. 4. Dose-response relationships of the shift of the i(f) activation curve showed that both Rp-cAMPs and Sp-cAMPs act as agonists in the cAMP-dependent direct f-channel activation. Fitting data to the Hill equation resulted in maximal shifts of 9.6 and 9.5 mV, apparent dissociation constants of 0.82 and 5.4 microM, and Hill coefficients of 0.82 and 1.12 for Sp-cAMPs and Rp-cAMPs, respectively. 5. The activating action of Rp-cAMPs, a known antagonist of cAMP in the activation of cAMP-dependent protein kinase, confirms previously established evidence that f-channel activation does not involve phosphorylation. These results also suggest that the cAMP binding site of f-channels may be structurally similar to the cyclic nucleotide binding site of olfactory receptor channels. PMID:9218217

  2. Activation of AMPKα2 Is Not Required for Mitochondrial FAT/CD36 Accumulation during Exercise.

    PubMed

    Monaco, Cynthia; Whitfield, Jamie; Jain, Swati S; Spriet, Lawrence L; Bonen, Arend; Holloway, Graham P

    2015-01-01

    Exercise has been shown to induce the translocation of fatty acid translocase (FAT/CD36), a fatty acid transport protein, to both plasma and mitochondrial membranes. While previous studies have examined signals involved in the induction of FAT/CD36 translocation to sarcolemmal membranes, to date the signaling events responsible for FAT/CD36 accumulation on mitochondrial membranes have not been investigated. In the current study muscle contraction rapidly increased FAT/CD36 on plasma membranes (7.5 minutes), while in contrast, FAT/CD36 only increased on mitochondrial membranes after 22.5 minutes of muscle contraction, a response that was exercise-intensity dependent. Considering that previous research has shown that AMP activated protein kinase (AMPK) α2 is not required for FAT/CD36 translocation to the plasma membrane, we investigated whether AMPK α2 signaling is necessary for mitochondrial FAT/CD36 accumulation. Administration of 5-Aminoimidazole-4-carboxamide ribonucleotide (AICAR) induced AMPK phosphorylation, and resulted in FAT/CD36 accumulation on SS mitochondria, suggesting AMPK signaling may mediate this response. However, SS mitochondrial FAT/CD36 increased following acute treadmill running in both wild-type (WT) and AMPKα 2 kinase dead (KD) mice. These data suggest that AMPK signaling is not required for SS mitochondrial FAT/CD36 accumulation. The current data also implicates alternative signaling pathways that are exercise-intensity dependent, as IMF mitochondrial FAT/CD36 content only occurred at a higher power output. Taken altogether the current data suggests that activation of AMPK signaling is sufficient but not required for exercise-induced accumulation in mitochondrial FAT/CD36. PMID:25965390

  3. p-Synephrine Suppresses Glucose Production but Not Lipid Accumulation in H4IIE Liver Cells

    PubMed Central

    Cui, Zhigang; Lee, Youngil; Lee, Youngki

    2015-01-01

    Abstract p-Synephrine, the primary protoalkaloid in the extract of bitter orange and other citrus species, has gained interest due to its lipolytic activity in adipose tissues. We previously found that p-synephrine stimulates glucose consumption via AMP-activated protein kinase (AMPK) in L6 skeletal muscle cells. This study investigated the effect of p-synephrine on glucose production and lipid accumulation in H4IIE rat liver cells. Glucose production was increased in H4llE cells that were incubated in glucose-free medium but decreased dose dependently (1–100 μM) with p-synephrine treatment. Protein levels of glucose-6-phosphatase (G6Pase) and phosphoenol pyruvate carboxykinase (PEPCK) were also decreased by treatment (4 h) with p-synephrine. Antagonists against α- and β-adrenergic receptors (phentolamine and propranolol) and other inhibitors against signaling molecules did not interrupt p-synephrine-induced suppression in glucose production. However, H7 (an inhibitor of serine/threonine kinases PKA, PKC, and PKG) significantly blocked p-synephrine-induced suppression of glucose production and further increased basal glucose production. Unlike the suppressive effect on glucose production, p-synephrine failed to affect palmitic acid-induced cytoplasmic lipid accumulation. Protein levels of fatty acid synthase (FAS) and phosphorylation levels of AMPK and ACC were not changed by p-synephrine. Altogether, p-synephrine can suppress glucose production but does not affect lipid accumulation in H4IIE liver cells. PMID:25379695

  4. Accumulation of nickel in transgenic tobacco

    NASA Astrophysics Data System (ADS)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TF<1) at all levels of metal treatment. Among the 4 transgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  5. The accumulation and structure of comets

    NASA Technical Reports Server (NTRS)

    Donn, Bertram

    1991-01-01

    The paper reviews evidence for the accumulation of the terrestrial planets and comets from solid grains, with emphasis on the various proposals for the formation of cometary nuclei. With three exceptions, all hypotheses conclude or imply that a single compact object forms. Several hypotheses start with Goldreich-Ward-type gravitational instabilities. The collapse for this case also occurs at low velocities in the cm/s to m/s range. Experiment and theory show that under these conditions, low-density, filamentary clusters form that are fractal aggregates with a fractal dimension approximately equal to 2. In order to form cometary nuclei, the initial temperature must be about 50 K and not undergo a significant temperature rise during the accumulation process. The calculations show that accumulation will occur at low temperatures. Models of cometary nuclei are reviewed, and a simple model of the structure that results fom the accumulation of fluffy aggregates is described.

  6. AMP-activated protein kinase regulates L-arginine mediated cellular responses

    PubMed Central

    2013-01-01

    Background Our prior study revealed the loss in short-term L-Arginine (ARG) therapeutic efficacy after continuous exposure; resulting in tolerance development, mediated by endothelial nitric oxide synthase (eNOS) down-regulation, secondary to oxidative stress and induced glucose accumulation. However, the potential factor regulating ARG cellular response is presently unknown. Method Human umbilical vein endothelial cells were incubated with 100 μM ARG for 2 h in buffer (short-term or acute), or for 7 days in culture medium and challenged for 2 h in buffer (continuous or chronic), in the presence or absence of other agents. eNOS activity was determined by analyzing cellular nitrite/nitrate (NO2–/NO3–), and AMP-activated protein kinase (AMPK) activity was assayed using SAMS peptide. 13C6 glucose was added to medium to measure glucose uptake during cellular treatments, which were determined by LC-MS/MS. Cellular glucose was identified by o-toluidine method. Superoxide (O2•–) was identified by EPR-spin-trap, and peroxynitrite (ONOO–) was measured by flow-cytometer using aminophenyl fluorescein dye. Results Short-term incubation of cells with 100 μM ARG in the presence or absence of 30 μM L-NG-Nitroarginine methyl ester (L-NAME) or 30 μM AMPK inhibitor (compound C, CMP-C) increased cellular oxidative stress and overall glucose accumulation with no variation in glucose transporter-1 (GLUT-1), or AMPK activity from control. The increase in total NO2–/NO3– after 2 h 100 μM ARG exposure, was suppressed in cells co-incubated with 30 μM CMP-C or L-NAME. Long-term exposure of ARG with or without CMP-C or L-NAME suppressed NO2–/NO3–, glucose uptake, GLUT-1, AMPK expression and activity below control, and increased overall cellular glucose, O2•– and ONOO–. Gluconeogenesis inhibition with 30 μM 5-Chloro-2-N-2,5-dichlorobenzenesulfonamido-benzoxazole (CDB) during ARG exposure for 2 h maintained overall cellular glucose to control, but increased

  7. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, technical summary document

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    Some 60 instrument candidates and 80 possible science investigations were evaluated. The early analysis emphasized the science aspect in terms of the functional requirements for each of the potential experiments identified by the AMPS science working group. These requirements were then used for the grouping of instruments into practical payloads which would fit the capabilities of the Shuttle/Spacelab. This analysis resulted in the definition of eleven different AMPS configurations. The data were then used to define a typical set of requirements for a flexible AMPS laboratory. The data gathered to this point showed that a planned sequential buildup of the laboratory would be necessary to meet both physical and funding limitations. This led to the definition of five strawman payloads by the science working group, which were used to establish a conceptual laboratory and to define preliminary design of a configuration which could satisfy AMPS needs during the early program period.

  8. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed Central

    Pinkney, M; Hoggett, J G

    1988-01-01

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  9. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed

    Pinkney, M; Hoggett, J G

    1988-03-15

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  10. DOE/NEAMS AMP CAMP I 2010 - multi species transport in metal fuels

    SciTech Connect

    Dilts, Gary A

    2011-01-21

    Essential aspects from the literature of metal nuclear fuel alloys and modeling the transport of constituents therein are discussed. The essential mathematical problem is described along with relevant issues for implementation of solution algorithms in the AMP nuclear fuel code.

  11. c-di-AMP recognition by Staphylococcus aureus PstA.

    PubMed

    Müller, Martina; Hopfner, Karl-Peter; Witte, Gregor

    2015-01-01

    Cyclic-di-AMP (c-di-AMP) is a bacterial secondary messenger involved in various processes, including sensing of DNA-integrity, cell wall metabolism and potassium transport. A number of c-di-AMP receptor proteins have recently been identified in Staphylococcus aureus. One of them - PstA - possesses a ferredoxin-like fold and is structurally related to the class of PII signal-transduction proteins. PII proteins are involved in a large number of pathways, most of them associated with nitrogen metabolism. In this study we describe the mode of c-di-AMP binding and subsequent structural changes of S. aureus PstA. An altered architecture in PstA compared to canonical PII proteins results in differences in ligand coordination. PMID:25435171

  12. Is a decrease in cyclic AMP a necessary and sufficient signal for maturation of amphibian oocytes

    SciTech Connect

    Gelerstein, S.; Shapira, H.; Dascal, N.; Yekuel, R.; Oron, Y.

    1988-05-01

    Acetylcholine rapidly lowered the intracellular levels of cyclic AMP in stage 5 and 6 Xenopus laevis oocytes. Acetylcholine alone did not induce oocyte maturation, though it did accelerate maturation induced by progesterone. The effect of acetylcholine on oocyte maturation was independent of extracellular calcium concentration. Adenosine increased cyclic AMP and abolished the progesterone-induced decrease in cyclic AMP levels in follicles and in denuded oocytes. This effect of adenosine was blocked by the Ra purinergic receptor antagonist, theophylline. Despite those effects, adenosine alone induced maturation in stage 6 oocytes and accelerated progesterone-induced maturation in both stage 5 and 6 cells. Adenosine also induced a significant increase in the rate of /sup 45/Ca efflux from oocytes in the presence and the absence of external calcium. We suggest that the activation of cell surface receptors involved in the release of calcium from cellular stores may induce or accelerate oocyte maturation independently of small changes in intracellular cyclic AMP concentration.

  13. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    NASA Astrophysics Data System (ADS)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš

    2010-06-01

    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  14. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, appendixes

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    An equipment list, instrument baseline data, engineering drawings, mass properties computer printouts, electrical energy management, and control and display functional analysis pertinent to the AMPS (Satellite Payload) are presented.

  15. AMP: a science-driven web-based application for the TeraGrid

    NASA Astrophysics Data System (ADS)

    Woitaszek, M.; Metcalfe, T.; Shorrock, I.

    The Asteroseismic Modeling Portal (AMP) provides a web-based interface for astronomers to run and view simulations that derive the properties of Sun-like stars from observations of their pulsation frequencies. In this paper, we describe the architecture and implementation of AMP, highlighting the lightweight design principles and tools used to produce a functional fully-custom web-based science application in less than a year. Targeted as a TeraGrid science gateway, AMP's architecture and implementation are intended to simplify its orchestration of TeraGrid computational resources. AMP's web-based interface was developed as a traditional standalone database-backed web application using the Python-based Django web development framework, allowing us to leverage the Django framework's capabilities while cleanly separating the user interface development from the grid interface development. We have found this combination of tools flexible and effective for rapid gateway development and deployment.

  16. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-05-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  17. A QM/MM study of the 5‧-AMP DNA hydrolysis of aprataxin

    NASA Astrophysics Data System (ADS)

    Hanaoka, Kyohei; Tanaka, Wataru; Kayanuma, Megumi; Shoji, Mitsuo

    2015-07-01

    Aprataxin is a DNA repair enzyme that hydrolyzes the abnormal 5‧-AMP termini of broken DNAs. Based on quantum mechanical/molecular mechanical (QM/MM) calculations, we found that the catalytic reaction proceeds in three steps; substrate protonation, DNA deadenylation and histidine-AMP intermediate hydrolysis. The calculated activation energies for the second and third reactions are 19.0 and 10.5 kcal mol-1, which can be attributed to a penta-coordinated AMP-phosphoryl formation and closing of a water molecule, respectively. We also found that a histidine-AMP intermediate is hydrolyzed easily in the third step when a water molecule closes within 3 Å to the phosphorus nucleus.

  18. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    SciTech Connect

    Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki . E-mail: yk-kim@korea.ac.kr

    2007-05-18

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway.

  19. I - Prostaglandin hyperalgesia, a cAMP/Ca2+ dependent process.

    PubMed

    Ferreira, S H; Nakamura, M

    1979-08-01

    Prostaglandins stimulate cAMP increase in several biological systems including CNS. The possible participation of a cAMP/Ca2+ related mechanism in prostaglandin induced hyperalgesia in the rat paw, as measured by a modification of the Randall-Selitto method was investigated. A serie of agents was administered in the paw in an attempt to change either Ca2+ or cyclic AMP concentration at the nociceptive terminations. PGE2, dibutyryl cyclic AMP, isoprenaline, noradrenaline, adrenaline, Ca2+ionophore (A23187), BaCl2 caused a dose dependent hyperalgesia. The hyperalgesic effect of these substances was enhanced by methyl-xanthines. Cyclic GMP as well as agents which interfere with Ca2+ influx (verapamil and lanthanum) were local analgesics in normal and hyperalgesic paws. PMID:230542

  20. The genetically encoded tool set for investigating cAMP: more than the sum of its parts

    PubMed Central

    Patel, Neha; Gold, Matthew G.

    2015-01-01

    Intracellular fluctuations of the second messenger cyclic AMP (cAMP) are regulated with spatial and temporal precision. This regulation is supported by the sophisticated arrangement of cyclases, phosphodiesterases, anchoring proteins, and receptors for cAMP. Discovery of these nuances to cAMP signaling has been facilitated by the development of genetically encodable tools for monitoring and manipulating cAMP and the proteins that support cAMP signaling. In this review, we discuss the state-of-the-art in development of different genetically encoded tools for sensing cAMP and the activity of its primary intracellular receptor protein kinase A (PKA). We introduce sequences for encoding adenylyl cyclases that enable cAMP levels to be artificially elevated within cells. We chart the evolution of sequences for selectively modifying protein–protein interactions that support cAMP signaling, and for driving cAMP sensors and manipulators to different subcellular locations. Importantly, these different genetically encoded tools can be applied synergistically, and we highlight notable instances that take advantage of this property. Finally, we consider prospects for extending the utility of the tool set to support further insights into the role of cAMP in health and disease. PMID:26300778

  1. Reduction of endothelial permeability in vitro by cAMP and cGMP

    SciTech Connect

    Kreienberg, P.B.; DeMichele, M.A.; Kowalczyk, P.; Minnear, F.L. )

    1990-02-26

    The cAMP enhancing-vasodilator isoproterenol has been shown previously to decrease endothelial permeability in vitro. This effect may not be unique to cAMP-enhancing agents. The authors have shown that thrombin at a concentration of 2 pM, a level which relaxes aortic vessel strips in association with increased levels of cGMP, reduces endothelial permeability. In this study, the permeability effect of cAMP and cGMP analogues were assessed by measuring the clearance of {sup 125}I-albumin across bovine pulmonary artery endothelial cell monolayers. The experiments were divided into baseline and experimental periods so that each monolayer served as its own control. The cAMP and cGMP analogues, 8-bromo-cAMP (1 mM) and 8-bromo-cGMP (1 mM), decreased clearance form a vehicle control value of 1.3{+-}0.2 (mean {+-}SD of experimental/baseline clearance, n=15 cell monolayers) to 0.7{+-}0.2 and 1.0{+-}0.2, respectively, although cGMP did not decrease clearance from its own baseline value. Coincubation of these analogues with thrombin (0.1 uM) also decreased the thrombin-induced increase in albumin clearance from 2.2{+-}0.5 to 0.8{+-}0.2 (cAMP) and 1.5{+-}0.2 (cGMP). The data indicate that in vitro both cAMP and cGMP-enhancing vasodilators would reduce endothelial permeability and that cAMP-enhancing agents would be more effective.

  2. Studying the regulation of endosomal cAMP production in GPCR signaling

    PubMed Central

    Gidon, Alexandre; Feinstein, Timothy N.; Xiao, Kunhong; Vilardaga, Jean-Pierre

    2016-01-01

    We describe methods based on live cell fluorescent microscopy and mass spectrometry to characterize the mechanism of endosomal cAMP production and its regulation using the parathyroid hormone (PTH) type 1 receptor as a prime example. These methods permit to measure rapid changes of cAMP levels in response to PTH, kinetics of endosomal ligand–receptor interaction, pH changes associated with receptor trafficking, and to identify the endosomal receptor interactome. PMID:26928541

  3. Cooperation between cAMP signalling and sulfonylurea in insulin secretion.

    PubMed

    Shibasaki, T; Takahashi, T; Takahashi, H; Seino, S

    2014-09-01

    Although glucose is physiologically the most important regulator of insulin secretion, glucose-induced insulin secretion is modulated by hormonal and neural inputs to pancreatic β-cells. Most of the hormones and neurotransmitters evoke intracellular signals such as cAMP, Ca²⁺ , and phospholipid-derived molecules by activating G protein-coupled receptors (GPCRs). In particular, cAMP is a key second messenger that amplifies insulin secretion in a glucose concentration-dependent manner. The action of cAMP on insulin secretion is mediated by both protein kinase A (PKA)-dependent and Epac2A-dependent mechanisms. Many of the proteins expressed in β-cells are phosphorylated by PKA in vitro, but only a few proteins in which PKA phosphorylation directly affects insulin secretion have been identified. On the other hand, Epac2A activates the Ras-like small G protein Rap in a cAMP-dependent manner. Epac2A is also directly activated by various sulfonylureas, except for gliclazide. 8-pCPT-2'-O-Me-cAMP, an Epac-selective cAMP analogue, and glibenclamide, a sulfonylurea, synergistically activate Epac2A and Rap1, whereas adrenaline, which suppresses cAMP production in pancreatic β-cells, blocks activation of Epac2A and Rap1 by glibenclamide. Thus, cAMP signalling and sulfonylurea cooperatively activate Epac2A and Rap1. This interaction could account, at least in part, for the synergistic effects of incretin-related drugs and sulfonylureas in insulin secretion. Accordingly, clarification of the mechanism of Epac2A activation may provide therapeutic strategies to improve insulin secretion in diabetes. PMID:25200305

  4. Cyclic AMP-modulated phosphorylation of intermediate filament proteins in cultured avian myogenic cells.

    PubMed Central

    Gard, D L; Lazarides, E

    1982-01-01

    The intermediate filament proteins desmin and vimentin and the muscle tropomyosins were the major protein phosphate acceptors in 8-day-old myotubes incubated for 4 h in medium containing radiolabeled phosphate. The addition of isoproterenol or 8-bromo-cyclic AMP (BrcAMP) resulted in a two- to threefold increase in incorporation of 32PO4 into both desmin and vimentin, whereas no changes in the incorporation of 32PO4 into tropomyosin or other cellular proteins were observed. The BrcAMP- or hormonally induced increase in 32PO4 incorporation into desmin and vimentin was independent of protein synthesis and was not caused by stimulation of protein phosphate turnover. In addition, BrcAMP did not induce significant changes in the specific activity of the cellular ATP pool. These data suggest that the observed increase in 32PO4 incorporation represented an actual increase in phosphorylation of the intermediate filament proteins desmin and vimentin. Two-dimensional tryptic analysis of desmin from 8-day-old myotubes revealed five phosphopeptides of which two showed a 7- to 10-fold increase in 32PO4 incorporation in BrcAMP-treated myotubes. Four of the phosphopeptides identified in desmin labeled in vivo were also observed in desmin phosphorylated in vitro by bovine heart cAMP-dependent protein kinase. Although phosphorylation of desmin and vimentin was apparent in myogenic cells at all stages of differentiation, BrcAMP- and isoproterenol-induced increases in phosphorylation of these proteins were restricted to mature myotubes. These data strongly suggest that in vivo phosphorylation of the intermediate filament proteins desmin and vimentin is catalyzed by the cAMP-dependent protein kinases and that such phosphorylation may be regulated during muscle differentiation. Images PMID:6294504

  5. AmpC-BETA Lactamases among Enterobacteriaceae Isolated at a Tertiary Hospital, South Western Uganda

    PubMed Central

    Nakaye, Martha; Bwanga, Freddie; Itabangi, Herbert; Stanley, Iramiot J.; Bashir, Mwambi; Bazira, Joel

    2015-01-01

    Aim To characterize AmpC-beta lactamases among Enterobacteriaceae isolates from clinical samples at Mbarara Regional Referral Hospital. Study Design Laboratory-based descriptive cross-sectional study Place and Duration of Study Microbiology Department, Mbarara Regional Referral Hospital and MBN clinical Laboratories, between May to September 2013. Methodology This study included 293 Enterobacteriaceae isolates recovered from clinical specimens that included blood, urine, stool and aspirates. AmpC Beta lactamase production was determined using disc placement method for cefoxitin at a break point of <18mm. Common AmpC plasmid mediated genes were EBC, ACC, FOX, DHA, CIT and MOX were; was determined by Multiplex PCR as described by Hanson and Perez-Perez. Results Plasmid mediated AmpC phenotype was confirmed in 107 of the 293 (36.5%) cefoxitin resistant isolates with 30 isolates having more than one gene coding for resistance. The commonest source that harbored AmpC beta lactamases was urine and E. coli was the most common AmpC producer (59.5%). The genotypes detected in this study, included EBC (n=36), FOX (n=18), ACC (n=11), CIT (n=10), DHA (n=07) and MOX (n=1). Conclusion Our findings showed that prevalence of AmpC beta-lactamase at MRRH was high (39.6), with EBC as the commonest genotype among Enterobacteriaceae Urine and E. coli were the commonest source and organism respectively that harbored AmpC beta-lactamases. There‘s rational antimicrobial therapy and antibiotic susceptibility tests should be requested by health workers especially patients presenting with urinary tract infections and bacteraemias. PMID:26078920

  6. Blockade of beta-adrenoceptors enhances cAMP signal transduction in vivo

    NASA Technical Reports Server (NTRS)

    Whalen, E. J.; Johnson, A. K.; Lewis, S. J.

    1998-01-01

    The aim of this study was to determine whether the blockade of beta-adrenoceptors would enhance cAMP-mediated signal transduction processes in vivo. The administration of the membrane permeable cAMP analogue, 8-(4-chlorophenylthiol)-cAMP (8-CPT-cAMP, 10 micromol/kg, i.v.) produced an increase in heart rate (+27 +/- 2%, P < 0.05), a fall in mean arterial blood pressure (-21 +/- 3%, P < 0.05) and falls in hindquarter (-12 +/- 3%, P < 0.05) and mesenteric (-32 +/- 3%, P < 0.05) vascular resistances in pentobarbital-anesthetized rats. The beta-adrenoceptor antagonist, propranolol (1 mg/kg, i.v.) lowered heart rate (-12 +/- 3%, P < 0.05) but did not affect mean arterial blood pressure or vascular resistances. The tachycardia, hypotension and vasodilation produced by 8-CPT-cAMP were exaggerated after administration of propranolol (P < 0.05 for all comparisons). The nitric oxide-donor, sodium nitroprusside (2 microg/kg, i.v.), produced falls in mean arterial blood pressure and vascular resistances of similar magnitude to those produced by 8-CPT-cAMP. These sodium nitroprusside-induced responses were unaffected by propranolol (P < 0.05 for all comparisons). Sodium nitroprusside also produced a minor increase in heart rate (+5 +/- 1%, P < 0.05) which was abolished by propranolol. These findings suggest that 8-CPT-cAMP directly increases heart rate and that blockade of beta-adrenoceptors enhances the potency of cAMP within the heart and vasculature.

  7. The ever unfolding story of cAMP signaling in trypanosomatids: vive la difference!

    PubMed Central

    Tagoe, Daniel N. A.; Kalejaiye, Titilola D.; de Koning, Harry P.

    2015-01-01

    Kinetoplastids are unicellular, eukaryotic, flagellated protozoans containing the eponymous kinetoplast. Within this order, the family of trypanosomatids are responsible for some of the most serious human diseases, including Chagas disease (Trypanosoma cruzi), sleeping sickness (Trypanosoma brucei spp.), and leishmaniasis (Leishmania spp). Although cAMP is produced during the life cycle stages of these parasites, its signaling pathways are very different from those of mammals. The absence of G-protein-coupled receptors, the presence of structurally different adenylyl cyclases, the paucity of known cAMP effector proteins and the stringent need for regulation of cAMP in the small kinetoplastid cells all suggest a significantly different biochemical pathway and likely cell biology. However, each of the main kinetoplastid parasites express four class 1-type cyclic nucleotide-specific phosphodiesterases (PDEA-D), which have highly similar catalytic domains to that of human PDEs. To date, only TbrPDEB, expressed as two slightly different isoforms TbrPDEB1 and B2, has been found to be essential when ablated. Although the genomes contain reasonably well conserved genes for catalytic and regulatory domains of protein kinase A, these have been shown to have varied structural and functional roles in the different species. Recent discovery of a role of cAMP/AMP metabolism in a quorum-sensing signaling pathway in T. brucei, and the identification of downstream cAMP Response Proteins (CARPs) whose expression levels correlate with sensitivity to PDE inhibitors, suggests a complex signaling cascade. The interplay between the roles of these novel CARPs and the quorum-sensing signaling pathway on cell division and differentiation makes for intriguing cell biology and a new paradigm in cAMP signal transduction, as well as potential targets for trypanosomatid-specific cAMP pathway-based therapeutics. PMID:26441645

  8. Detection of ESBL- and AmpC-producing E. coli isolates from urinary tract infections

    PubMed Central

    Shayan, Sara; Bokaeian, Mohammad

    2015-01-01

    Background: Extended-spectrum β-lactamases (ESBLs) and AmpC enzymes have been observed in virtually all species of the family Enterobacteriaceae. The β-lactamase producing bacteria cause many serious infections, including urinary tract infections. These enzymes are predominantly plasmid mediated. There are no recommended guidelines for detection of this resistance mechanism and there is a need to address this issue as much as the detection of ESBLs. This study was undertaken to characterize ESBL and AmpC producers among Escherichia coli by polymerase chain reaction (PCR), which were initially screened by phenotypic method. Materials and Methods: A total of 90 isolates of E. coli were recovered from the urinary tract during a 7-month period, and were screened for ESBLs and AmpC production by disk diffusion test using cefoxitin (30 μg) disks and confirmed by combined disk diffusion test using phenyl boronic acid. The presence of genes encoding CIT, FOX, and TEM was detected by PCR. Results: On disk diffusion test, 59 of 90 isolates were resistant to third generation of cephalosporins; of these 37 (62.7%) and 3 (5%) were ESBL and AmpC producers, respectively. PCR showed that 29 (49.1%) and 3 (5%) were positive for blaTEM and blaCMY-2, respectively. Conclusion: ESBL- and AmpC-producing E. coli isolates cause significant resistance to cephalosporin. There is a need for a correct and reliable phenotypic test to identify AmpC β-lactamases and to discriminate between AmpC and ESBL producers. This work showed that boronic acid can differentiate ESBL enzymes from AmpC enzymes. PMID:26605249

  9. Modulation of cGMP accumulation by adenosine A1 receptors at the hippocampus: influence of cGMP levels and gender.

    PubMed

    Serpa, André; Sebastião, Ana M; Cascalheira, José F

    2014-12-01

    Adenosine A1 receptor is highly expressed in hippocampus where it inhibits neurotransmitter release and has neuroprotective activity. Similar actions are obtained by increasing cGMP concentration, but a clear link between adenosine A1 receptor and cGMP levels remains to be established. The present work aims to investigate if cGMP formation is modulated by adenosine A1 receptors at the hippocampus and if this effect is gender dependent. cGMP accumulation, induced by phosphodiesterases inhibitors Zaprinast (100 μM) and Bay 60-7550 (10 μM), and cAMP accumulation, induced by Forskolin (20 μM) and Rolipram (50 μM), were quantified in rat hippocampal slices using specific enzymatic immunoassays. N6-cyclopentyladenosine (CPA, 100 nM) alone failed to modify basal cGMP accumulation. However, the presence of adenosine deaminase (ADA, 2 U/ml) unmasked a CPA (0.03-300 nM) stimulatory effect on basal cGMP accumulation (EC50: 4.2±1.4 nM; Emax: 17±0.9%). ADA influence on CPA activity was specific for cGMP, since inhibition of cAMP accumulation by CPA was not affected by the presence of ADA, though ADA inhibited cAMP accumulation in the absence of CPA. Increasing cGMP accumulation, by about four-fold, with sodium nitroprusside (SNP, 100 μM) abolished the CPA (100 nM) effect on cGMP accumulation in males but did not modify the effect of CPA in female rats. This effect was reversed by 8-Cyclopentyl-1,3-dipropylxanthine (DPCPX, 100 nM), indicating an adenosine A1 receptor mediated effect on cGMP accumulation. In conclusion, adenosine A1 receptors increase intracellular cGMP formation at hippocampus both in males and females under basal conditions, but only in females when cGMP levels are increased by SNP. PMID:25300679

  10. Thyrotropin via cyclic AMP induces insulin receptor expression and insulin Co-stimulation of growth and amplifies insulin and insulin-like growth factor signaling pathways in dog thyroid epithelial cells.

    PubMed

    Burikhanov, R; Coulonval, K; Pirson, I; Lamy, F; Dumont, J E; Roger, P P

    1996-11-15

    Despite the similarity of their receptors and signal transduction pathways, insulin is regarded as a regulator of glucose, protein, and lipid metabolism, whereas insulin-like growth factors (IGF-I and IGF-II) mainly act as mitogenic hormones. In the dog thyroid primary culture model, the triggering of DNA synthesis by thyrotropin (TSH) through cAMP, or by cAMP-independent factors including epidermal growth factor, hepatocyte growth factor and phorbol esters, requires insulin or IGFs as comitogenic factors. In the present study, in TSH-treated cells, IGF-I receptors and insulin receptors were paradoxically equivalent in their capacity to elicit the comitogenic pathway, which, however, was mediated only by IGF-I receptors in dog thyroid cells stimulated by cAMP-independent mitogens. Moreover, prior cell exposure to TSH or forskolin increased their responsiveness to insulin, IGF-I, and IGF-II, as seen on DNA synthesis and activation of a common insulin/IGF signaling pathway. To understand these observations, binding characteristics and expression of insulin and IGF-I receptors were examined. To analyze IGF-I receptor characteristics, the unexpected interference of a huge presence of IGF-binding proteins at the cell membrane was avoided using labeled Long R3 IGF-I instead of IGF-I. Strikingly, TSH, through cAMP, time-dependently induced insulin binding and insulin receptor mRNA and protein accumulation without any effect on IGF-I receptors. These findings constitute a first example of an induction of insulin receptor gene expression by a cAMP-mediated hormone. In dog thyroid cells, this allows low physiological insulin concentrations to act as a comitogenic factor and might explain in part the enhanced responsiveness to IGFs in response to TSH. This raises the possibility that TSH-insulin interactions may play a role in the regulation of thyroid growth and function in vivo. PMID:8910605

  11. Structural insights into recognition of c-di-AMP by the ydaO riboswitch.

    PubMed

    Gao, Ang; Serganov, Alexander

    2014-09-01

    Bacterial second messenger cyclic di-AMP (c-di-AMP) is implicated in signaling DNA damage and cell wall stress through interactions with several protein receptors and a widespread ydaO-type riboswitch. We report the crystal structures of c-di-AMP riboswitches from Thermoanaerobacter pseudethanolicus and Thermovirga lienii determined at ∼3.0-Å resolution. In both species, the RNA adopts an unforeseen 'square'-shaped pseudosymmetrical architecture that features two three-way junctions, a turn and a pseudoknot, positioned in the square corners. Uncharacteristically for riboswitches, the structure is stapled by two ligand molecules that span the interior of the structure and employ similar noncanonical interactions for RNA recognition. Mutations in either ligand-binding site negatively affect c-di-AMP binding, suggesting that the riboswitch-triggered genetic response requires contribution of both ligands. Our data provide what are to our knowledge the first insights into specific sensing of c-di-AMP and a molecular mechanism underlying the common c-di-AMP-dependent control of essential cellular processes in bacteria. PMID:25086507

  12. Identification of Novel Genes Responsible for Overexpression of ampC in Pseudomonas aeruginosa PAO1

    PubMed Central

    Tsutsumi, Yuko; Tomita, Haruyoshi

    2013-01-01

    The development of resistance to antipseudomonal penicillins and cephalosporins mediated by the chromosomal ampC gene in Pseudomonas aeruginosa is of clinical importance. We isolated piperacillin-resistant mutants derived from P. aeruginosa PAO1 and analyzed two mutants that had an insertion in mpl and nuoN. One mutant, YT1677, was resistant to piperacillin and ceftazidime and had an insertion in mpl, which encodes UDP-N-acetylmuramate:l-alanyl-γ-d-glutamyl-meso-diaminopimelate ligase. The other mutant, YT7988, showed increased MICs of piperacillin, ceftazidime, cefepime, and cefoperazone, and the insertion was mapped to nuoN, which encodes NADH dehydrogenase I chain N. Complementation experiments demonstrated that these mutations resulted in higher levels of resistance to β-lactams. The expression of genes reported to be involved in β-lactam resistance was examined by real-time PCR in YT1677 and YT7988 mutants. Overexpression was observed for only ampC, and other genes were expressed normally. Deletion of the ampR gene in YT1677 and YT7988 resulted in decreased expression of ampC, indicating that the mutations in YT1677 and YT7988 affected the expression of ampC through the function of AmpR. PMID:24041903

  13. Odor-induced cAMP production in Drosophila melanogaster olfactory sensory neurons.

    PubMed

    Miazzi, Fabio; Hansson, Bill S; Wicher, Dieter

    2016-06-15

    Insect odorant receptors are seven transmembrane domain proteins that form cation channels, whose functional properties such as receptor sensitivity are subject to regulation by intracellular signaling cascades. Here, we used the cAMP fluorescent indicator Epac1-camps to investigate the occurrence of odor-induced cAMP production in olfactory sensory neurons (OSNs) of Drosophila melanogaster We show that stimulation of the receptor complex with an odor mixture or with the synthetic agonist VUAA1 induces a cAMP response. Moreover, we show that while the intracellular Ca(2+) concentration influences cAMP production, the OSN-specific receptor OrX is necessary to elicit cAMP responses in Ca(2+)-free conditions. These results provide direct evidence of a relationship between odorant receptor stimulation and cAMP production in olfactory sensory neurons in the fruit fly antenna and show that this method can be used to further investigate the role that this second messenger plays in insect olfaction. PMID:27045092

  14. cAMP and cGMP Play an Essential Role in Galvanotaxis of Cell Fragments.

    PubMed

    Zhu, Kan; Sun, Yaohui; Miu, Anh; Yen, Michael; Liu, Bowei; Zeng, Qunli; Mogilner, Alex; Zhao, Min

    2016-06-01

    Cell fragments devoid of the nucleus and major organelles are found in physiology and pathology, for example platelets derived from megakaryocytes, and cell fragments from white blood cells and glioma cells. Platelets exhibit active chemotaxis. Fragments from white blood cells display chemotaxis, phagocytosis, and bactericidal functions. Signaling mechanisms underlying migration of cell fragments are poorly understood. Here we used fish keratocyte fragments and demonstrated striking differences in signal transduction in migration of cell fragments and parental cells in a weak electric field. cAMP or cGMP agonists completely abolished directional migration of fragments, but had no effect on parental cells. The inhibition effects were prevented by pre-incubating with cAMP and cGMP antagonists. Blocking cAMP and cGMP downstream signaling by inhibition of PKA and PKG also recovered fragment galvanotaxis. Both perturbations confirmed that the inhibitory effect was mediated by cAMP or cGMP signaling. Inhibition of cathode signaling with PI3K inhibitor LY294002 also prevented the effects of cAMP or cGMP agonists. Our results suggest that cAMP and cGMP are essential for galvanotaxis of cell fragments, in contrast to the signaling mechanisms in parental cells. PMID:26517849

  15. A Novel Conditional Genetic System Reveals That Increasing Neuronal cAMP Enhances Memory and Retrieval

    PubMed Central

    Isiegas, Carolina; McDonough, Conor; Huang, Ted; Havekes, Robbert; Fabian, Sara; Wu, Long-Jun; Xu, Hui; Zhao, Ming-Gao; Kim, Jae-Ick; Lee, Yong-Seok; Lee, Hye-Ryeon; Ko, Hyoung-Gon; Lee, Nuribalhae; Choi, Sun-Lim; Lee, Jeong-Sik; Son, Hyeon; Zhuo, Min; Kaang, Bong-Kiun; Abel, Ted

    2010-01-01

    Consistent evidence from pharmacological and genetic studies shows that cAMP is a critical modulator of synaptic plasticity and memory formation. However, the potential of the cAMP signaling pathway as a target for memory enhancement remains unclear because of contradictory findings from pharmacological and genetic approaches. To address these issues, we have developed a novel conditional genetic system in mice based on the heterologous expression of an Aplysia octopamine receptor, a G-protein-coupled receptor whose activation by its natural ligand octopamine leads to rapid and transient increases in cAMP. We find that activation of this receptor transgenically expressed in mouse forebrain neurons induces a rapid elevation of hippocampal cAMP levels, facilitates hippocampus synaptic plasticity, and enhances the consolidation and retrieval of fear memory. Our findings clearly demonstrate that acute increases in cAMP levels selectively in neurons facilitate synaptic plasticity and memory, and illustrate the potential of this heterologous system to study cAMP-mediated processes in mammalian systems. PMID:18550764

  16. Spatiotemporal regulation of cAMP signaling controls the human trophoblast fusion

    PubMed Central

    Gerbaud, Pascale; Taskén, Kjetil; Pidoux, Guillaume

    2015-01-01

    During human placentation, mononuclear cytotrophoblasts fuse to form multinucleated syncytia ensuring hormonal production and nutrient exchanges between the maternal and fetal circulation. Syncytial formation is essential for the maintenance of pregnancy and for fetal growth. The cAMP signaling pathway is the major route to trigger trophoblast fusion and its activation results in phosphorylation of specific intracellular target proteins, in transcription of fusogenic genes and assembly of macromolecular protein complexes constituting the fusogenic machinery at the plasma membrane. Specificity in cAMP signaling is ensured by generation of localized pools of cAMP controlled by cAMP phosphodiesterases (PDEs) and by discrete spatial and temporal activation of protein kinase A (PKA) in supramolecular signaling clusters inside the cell organized by A-kinase-anchoring proteins (AKAPs) and by organization of signal termination by protein phosphatases (PPs). Here we present original observations on the available components of the cAMP signaling pathway in the human placenta including PKA, PDE, and PP isoforms as well as AKAPs. We continue to discuss the current knowledge of the spatiotemporal regulation of cAMP signaling triggering trophoblast fusion. PMID:26441659

  17. Multidrug resistant AmpC β-lactamase producing Escherichia coli isolated from a paediatric hospital

    PubMed Central

    Jameel, Noor-ul-Ain; Ejaz, Hasan; Zafar, Aizza; Amin, Hafsa

    2014-01-01

    Objective : The objective of the study was to observe the antimicrobial resistance of AmpC β-lactamase producing E. coli. Methods: Six hundred and seventy E. coli were isolated from 20,257 various pathological samples collected from The Children’s Hospital and Institute of Child Health, Lahore, Pakistan. The isolates showed resistance to ceftazidime which were further examined for AmpC β-lactamase activity by Disc Potentiation method. Results: There were 670 isolates of E. coli out of which 85 (12.6%) were AmpC β-lactamase producers. Risk factors like intravenous line (76.5%), endotracheal tube (22.4%), surgery (12.9%) and urinary catheters (7.1%) were found to be associated with infection caused by AmpC β-lactamase producing E. coli. Antimicrobial resistance pattern revealed that AmpC producing E. coli were highly resistant to co-amoxiclav, ceftazidime, cefotaxime, cefuroxime, cefixime, ceftriaxone and cefoxitin (100% each). Least resistance was observed against sulbactam-cefoperazone (14.1%), cefepime (7.1%), piperacillin-tazobactam (5.9%) and none of the isolates were resistant to imipenem and meropenem. Conclusion: The minimum use of invasive devices and strict antibiotic policies can reduce the spread of AmpC β-lactamase producing E. coli. PMID:24639857

  18. The role of ventral striatal cAMP signaling in stress-induced behaviors.

    PubMed

    Plattner, Florian; Hayashi, Kanehiro; Hernández, Adan; Benavides, David R; Tassin, Tara C; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W; Yuen, Eunice Y; Yan, Zhen; Goldberg, Matthew S; Nairn, Angus C; Greengard, Paul; Nestler, Eric J; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D; Bibb, James A

    2015-08-01

    The cAMP and cAMP-dependent protein kinase A (PKA) signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitated cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targeted the regulation of PDE4 by Cdk5, produced analogous effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  19. Differential activation of ammonium transporters during the accumulation of ammonia by Colletotrichum gloeosporioides and its effect on appressoria formation and pathogenicity.

    PubMed

    Shnaiderman, Chen; Miyara, Itay; Kobiler, Ilana; Sherman, Amir; Prusky, Dov

    2013-03-01

    Ammonium secreted by the post-harvest pathogen Colletotrichum gloeosporioides during host colonization accumulates in the host environment due to enhanced fungal nitrogen metabolism. Two types of ammonium transporter-encoding genes, AMET and MEP, are expressed during pathogenicity. Gene disruption of AMET, a gene modulating ammonia secretion, showed twofold reduced ammonia secretion and 45% less colonization on avocado fruit, suggesting a contribution to pathogenicity. MEPB, a gene modulating ammonium transport, is expressed by C. gloeosporioides during pathogenicity and starvation conditions in culture. Gene disruption of MEPB, the most highly expressed gene of the MEP family, resulted in twofold overexpression of MEPA and MEPC but reduced colonization, suggesting MEPB expression's contribution to pathogenicity. Analysis of internal and external ammonia accumulation by ΔmepB strains in mycelia and germinated spores showed rapid uptake and accumulation, and reduced secretion of ammonia in the mutant versus wild-type (WT) strains. Ammonia uptake by the WT germinating spores but not by the ΔmepB strain with compromised ammonium transport activated cAMP and transcription of PKA subunits PKAR and PKA2. ΔmepB mutants showed 75% less appressorium formation and colonization than the WT, which was partially restored by 10 mM exogenous ammonia. Thus, whereas both AMET and MEPB genes modulate ammonia secretion, only MEPB contributes to ammonia accumulation by mycelia and germinating spores that activate the cAMP pathways, inducing the morphogenetic processes contributing to C. gloeosporioides pathogenicity. PMID:23387470

  20. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 3: AMPS payload to instruments ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    General physical, functional, and operational interface control requirements for instruments on the first AMPS payload are presented. Interface specifications are included to satisfy ground handling, prelaunch, launch, stowage, operation, and landing activities. Applicable supporting documentation to implement the information is also given.

  1. Bai-Hu-Jia-Ren-Shen-Tang Decoction Reduces Fatty Liver by Activating AMP-Activated Protein Kinase In Vitro and In Vivo

    PubMed Central

    Liu, Hui-Kang; Hung, Tzu-Min; Huang, Hsiu-Chen; Lee, I-Jung; Chang, Chia-Chuan; Cheng, Jing-Jy; Lin, Lie-Chwen; Huang, Cheng

    2015-01-01

    Obesity and associated conditions, such as type 2 diabetes mellitus (T2DM) and nonalcoholic fatty liver disease (NAFLD), are currently a worldwide health problem. In Asian traditional medicine, Bai-Hu-Jia-Ren-Shen-Tang (BHJRST) is widely used in diabetes patients to reduce thirst. However, whether it has a therapeutic effect on T2DM or NAFLD is not known. The aim of this study was to examine whether BHJRST had a lipid-lowering effect using a HuS-E/2 cell model of fatty liver induced by palmitate and in a db/db mouse model of dyslipidemia. Incubation of HuS-E/2 cells with palmitate markedly increased lipid accumulation and expression of adipose triglyceride lipase (ATGL), which is involved in lipolysis. BHJRST significantly decreased lipid accumulation and increased ATGL levels and phosphorylation of AMP-activated protein kinase (AMPK) and its primary downstream target, acetyl-CoA carboxylase (ACC), which are involved in fatty acid oxidation. Furthermore, after twice daily oral administration for six weeks, BHJRST significantly reduced hepatic fat accumulation in db/db mice, as demonstrated by increased hepatic AMPK and ACC phosphorylation, reduced serum triglyceride levels, and reduced hepatic total lipid content. The results show that BHJRST has a lipid-lowering effect in the liver that is mediated by activation of the AMPK signaling pathway. PMID:26508982

  2. Dual bradykinin B2 receptor signalling in A431 human epidermoid carcinoma cells: activation of protein kinase C is counteracted by a GS-mediated stimulation of the cyclic AMP pathway.

    PubMed Central

    Liebmann, C; Graness, A; Ludwig, B; Adomeit, A; Boehmer, A; Boehmer, F D; Nürnberg, B; Wetzker, R

    1996-01-01

    Cell membranes of the human epidermoid cell line A431 express classical bradykinin (BK) B2 receptors, as assessed by [3H]BK binding studies. Furthermore, stimulation by BK induced a time-dependent modulation of protein kinase C (PKC) activity in A431 cells: a rapid activation (t1/2 approximately 1 min) is followed by a slow inhibition (t1/2 approximately 20 min) of PKC translocation measured by [3H]phorbol 12,13-dibutyrate binding. In addition, BK stimulated both adenylate cyclase activity in A431 membranes and accumulation of intracellular cyclic AMP (cAMP) in intact cells in a retarded manner. A possible BK-induced activation of the cAMP pathway mediated via PKC, phospholipase D, prostaglandins or Ca2+/calmodulin was excluded. A 35 kDa protein was found in A431 membranes to be specifically phosphorylated in the presence of both BK and protein kinase A (PKA). An anti-alpha s-antibody, AS 348, abolished stimulation of adenylate cyclase activity in response to BK, cholera toxin and isoprenaline, strongly suggesting the involvement of Gs proteins in the BK action. The BK-activated cAMP signalling system might be important for the observed inactivation of PKC slowly evoked by BK: the BK-induced rapid activation of PKC is decreased by dibutyryl cAMP, and the slow inhibition of PKC is prevented by an inhibitor of PKA, adenosine 3':5'-monophosphothioate (cyclic, Rp isomer). The inhibition of PKC translocation might be exerted directly at the level of PKC activation, since stimulation of phosphoinositide hydrolysis by BK was affected by neither dibutyryl cAMP nor forskolin. Thus our results provide the first evidence that A431 cells BK is able to activate two independent signal-transduction pathways via a single class of B2 receptors but two different G proteins. The lagging stimulation of the cAMP signalling pathway via Gs might serve to switch off PKC, which is rapidly activated via Gq-mediated stimulation of phosphoinositide hydrolysis. PMID:8546671

  3. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells

    PubMed Central

    Poole, Jill A.; Nordgren, Tara M.; DeVasure, Jane M.; Heires, Art J.; Bailey, Kristina L.; Romberger, Debra J.

    2014-01-01

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  4. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells.

    PubMed

    Wyatt, Todd A; Poole, Jill A; Nordgren, Tara M; DeVasure, Jane M; Heires, Art J; Bailey, Kristina L; Romberger, Debra J

    2014-10-15

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3',5'-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  5. Geomorphic control of landscape carbon accumulation

    USGS Publications Warehouse

    Rosenbloom, N.A.; Harden, J.W.; Neff, J.C.; Schimel, D.S.

    2006-01-01

    We use the CREEP process-response model to simulate soil organic carbon accumulation in an undisturbed prairie site in Iowa. Our primary objectives are to identify spatial patterns of carbon accumulation, and explore the effect of erosion on basin-scale C accumulation. Our results point to two general findings. First, redistribution of soil carbon by erosion results in a net increase in basin-wide carbon storage relative to a noneroding environment. Landscape-average mean residence times are increased in an eroding landscape owing to the burial/preservation of otherwise labile C. Second, field observations taken along a slope transect may overlook significant intraslope variations in carbon accumulation. Spatial patterns of modeled deep C accumulation are complex. While surface carbon with its relatively short equilibration time is predictable from surface properties, deep carbon is strongly influenced by the landscape's geomorphic and climatic history, resulting in wide spatial variability. Convergence and divergence associated with upland swales and interfluves result in bimodal carbon distributions in upper and mid slopes; variability in carbon storage within modeled mid slopes was as high as simulated differences between erosional shoulders and depositional valley bottoms. The bimodality of mid-slope C variability in the model suggests that a three-dimensional sampling strategy is preferable over the traditional two-dimensional analog or "catena" approach. Copyright 2006 by the American Geophysical Union.

  6. Prostaglandin E2 Reverses Aberrant Production of an Inflammatory Chemokine by Microglia from Sandhoff Disease Model Mice through the cAMP-PKA Pathway

    PubMed Central

    Kawashita, Eri; Tsuji, Daisuke; Toyoshima, Masahiro; Kanno, Yosuke; Matsuno, Hiroyuki; Itoh, Kohji

    2011-01-01

    Background Sandhoff disease (SD) is a neurodegenerative lysosomal β-hexosaminidase (Hex) deficiency involving excessive accumulation of undegraded substrates, including terminal GlcNAc-oligosaccharides and GM2 ganglioside. Microglia-mediated neuroinflammation contributes to the pathogenesis and progression of SD. Our previous study demonstrated that MIP-1α, a putative pathogenic factor for SD, is up-regulated in microglial cells derived from SD model mice (SD-Mg) through activation of Akt and JNK. Methodology/Principal Findings In this study, we first demonstrated that prostaglandin E2 (PGE2), which is one of the lipid mediators derived from arachidonic acid and is known to suppress activation of microglia, reduced the aberrant MIP-1α production by SD-Mg to the same level as by WT-Mg. PGE2 also attenuated the activation of Akt and JNK. The inhibition of MIP-1α production and the activation of Akt and JNK occurred through the EP2 and 4/cAMP/PKA signaling pathway in the murine microglia derived from SD model mice. Conclusions/Significance We propose that PGE2 plays a role as a negative regulator of MIP-1α production in the pathogenesis of SD, and that PGE2-EP2 and 4/cAMP/PKA signaling could be a target pathway for therapy for SD. PMID:21298000

  7. The Popeye domain containing protein family – A novel class of cAMP effectors with important functions in multiple tissues

    PubMed Central

    Schindler, Roland F.R.; Brand, Thomas

    2016-01-01

    Popeye domain containing (Popdc) proteins are a unique family, which combine several different properties and functions in a surprisingly complex fashion. They are expressed in multiple tissues and cell types, present in several subcellular compartments, interact with different classes of proteins, and are associated with a variety of physiological and pathophysiological processes. Moreover, Popdc proteins bind the second messenger cAMP with high affinity and it is thought that they act as a novel class of cAMP effector proteins. Here, we will review the most important findings about the Popdc family, which accumulated since its discovery about 15 years ago. We will be focussing on Popdc protein interaction and function in striated muscle tissue. However, as a full picture only emerges if all aspects are taken into account, we will also describe what is currently known about the role of Popdc proteins in epithelial cells and in various types of cancer, and discuss these findings with regard to their relevance for cardiac and skeletal muscle. PMID:26772438

  8. Prolyl isomerase Pin1 negatively regulates AMP-activated protein kinase (AMPK) by associating with the CBS domain in the γ subunit.

    PubMed

    Nakatsu, Yusuke; Iwashita, Misaki; Sakoda, Hideyuki; Ono, Hiraku; Nagata, Kengo; Matsunaga, Yasuka; Fukushima, Toshiaki; Fujishiro, Midori; Kushiyama, Akifumi; Kamata, Hideaki; Takahashi, Shin-Ichiro; Katagiri, Hideki; Honda, Hiroaki; Kiyonari, Hiroshi; Uchida, Takafumi; Asano, Tomoichiro

    2015-10-01

    AMP-activated protein kinase (AMPK) plays a critical role in metabolic regulation. In this study, first, it was revealed that Pin1 associates with any isoform of γ, but not with either the α or the β subunit, of AMPK. The association between Pin1 and the AMPK γ1 subunit is mediated by the WW domain of Pin1 and the Thr(211)-Pro-containing motif located in the CBS domain of the γ1 subunit. Importantly, overexpression of Pin1 suppressed AMPK phosphorylation in response to either 2-deoxyglucose or biguanide stimulation, whereas Pin1 knockdown by siRNAs or treatment with Pin1 inhibitors enhanced it. The experiments using recombinant Pin1, AMPK, LKB1, and PP2C proteins revealed that the protective effect of AMP against PP2C-induced AMPKα subunit dephosphorylation was markedly suppressed by the addition of Pin1. In good agreement with the in vitro data, the level of AMPK phosphorylation as well as the expressions of mitochondria-related genes, such as PGC-1α, which are known to be positively regulated by AMPK, were markedly higher with reduced triglyceride accumulation in the muscles of Pin1 KO mice as compared with controls. These findings suggest that Pin1 plays an important role in the pathogenic mechanisms underlying impaired glucose and lipid metabolism, functioning as a negative regulator of AMPK. PMID:26276391

  9. Crystallization of the glycogen-binding domain of the AMP-activated protein kinase β subunit and preliminary X-ray analysis

    SciTech Connect

    Polekhina, Galina Feil, Susanne C.; Gupta, Abhilasha; O’Donnell, Paul; Stapleton, David; Parker, Michael W.

    2005-01-01

    The glycogen-binding domain of the AMP-activated kinase β subunit has been crystallized in the presence of β-cyclodextrin. The structure has been determined by single isomorphous replacement and threefold averaging using in-house X-ray data collected from selenomethionine-substituted protein. AMP-activated protein kinase (AMPK) is an intracellular energy sensor that regulates metabolism in response to energy demand and supply by adjusting the ATP-generating and ATP-consuming pathways. AMPK potentially plays a critical role in diabetes and obesity as it is known to be activated by metforin and rosiglitazone, drugs used for the treatment of type II diabetes. AMPK is a heterotrimer composed of a catalytic α subunit and two regulatory subunits, β and γ. Mutations in the γ subunit are known to cause glycogen accumulation, leading to cardiac arrhythmias. Recently, a functional glycogen-binding domain (GBD) has been identified in the β subunit. Here, the crystallization of GBD in the presence of β-cyclodextrin is reported together with preliminary X-ray data analysis allowing the determination of the structure by single isomorphous replacement and threefold averaging using in-house X-ray data collected from a selenomethionine-substituted protein.

  10. [Effects of acute hypobaric hypoxia and exhaustive exercise on AMP-activated protein kinase phosphorylation in rat skeletal muscle].

    PubMed

    Yang, Tao; Huang, Qing-Yuan; Shan, Fa-Bo; Guan, Li-Bin; Cai, Ming-Chun

    2012-04-25

    The present study was aimed to explore the changes of phosphorylated AMP-activated protein kinase (pAMPK) level in skeletal muscle after exposure to acute hypobaric hypoxia and exhaustive exercise. Thirty-two male Sprague-Dawley (SD) rats were randomly divided into sea level and high altitude groups. The rats in high altitude group were submitted to simulated 5 000 m of high altitude in a hypobaric chamber for 24 h, and sea level group was maintained at normal conditions. All the rats were subjected to exhaustive swimming exercise. The exhaustion time was recorded. Before and after the exercise, blood lactate and glycogen content in skeletal muscle were determined; AMPK and pAMPK levels in skeletal muscle were detected by Western blot. The results showed that the exhaustion time was significantly decreased after exposure to high altitude. At the moment of exhaustion, high altitude group had lower blood lactate concentration and higher surplus glycogen content in gastrocnemius compared with sea level group. Exhaustive exercise significantly increased the pAMPK/AMPK ratio in rat skeletal muscles from both sea level and high altitude groups. However, high altitude group showed lower pAMPK/AMPK ratio after exhaustion compared to sea level group. These results suggest that, after exposure to acute hypobaric hypoxia, the decrement in exercise capacity may not be due to running out of glycogen, accumulation of lactate or disturbance in energy status in skeletal muscle. PMID:22513470

  11. Dibenzoylmethane Exerts Metabolic Activity through Regulation of AMP-Activated Protein Kinase (AMPK)-Mediated Glucose Uptake and Adipogenesis Pathways

    PubMed Central

    Kim, Nami; Kim, Hong Min; Lee, Eun Soo; Lee, Jung Ok; Lee, Hye Jeong; Lee, Soo Kyung; Moon, Ji Wook; Kim, Ji Hae; Kim, Joong Kwan; Kim, Su Jin; Park, Sun Hwa; Chung, Choon Hee; Kim, Hyeon Soo

    2015-01-01

    Dibenzoylmethane (DBM) has been shown to exert a variety of beneficial effects on human health. However, the mechanism of action is poorly understood. In this study, DBM increased phosphorylation of AMP-activated protein kinase (AMPK) and stimulated glucose uptake in a skeletal muscle cell line. Both knockdown of AMPK with siRNA and inhibition with AMPK inhibitor blocked DBM-induced glucose uptake. DBM increased the concentration of intracellular calcium and glucose uptake due to DBM was abolished by STO-609 (a calcium/calmodulin-dependent protein kinase inhibitor). DBM stimulated phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK), which was blocked by pretreatment with compound C, an AMPK inhibitor. The expression of glucose transporter type 4 (GLUT4) was increased by DBM. The translocation of GLUT4 to the plasma membrane was also increased by DBM in AMPK dependently. In addition, DBM suppressed weight gain and prevented fat accumulation in the liver and abdomen in mice fed a high-fat diet. In pre-adipocyte cells, DBM decreased the activity of acetyl-CoA carboxylase (ACC), the rate-limiting enzyme of fatty acid synthesis. Expression of the adipogenic gene, fatty acid synthase (FAS), was suppressed by DBM in an AMPK-dependent manner. These results showed that the beneficial metabolic effects of DBM might be due to regulation of glucose uptake via AMPK in skeletal muscle and inhibition of adipogenesis in pre-adipocytes. PMID:25756788

  12. Enhancement of β-catenin activity by BIG1 plus BIG2 via Arf activation and cAMP signals.

    PubMed

    Li, Chun-Chun; Le, Kang; Kato, Jiro; Moss, Joel; Vaughan, Martha

    2016-05-24

    Multifunctional β-catenin, with critical roles in both cell-cell adhesion and Wnt-signaling pathways, was among HeLa cell proteins coimmunoprecipitated by antibodies against brefeldin A-inhibited guanine nucleotide-exchange factors 1 and 2 (BIG1 or BIG2) that activate ADP-ribosylation factors (Arfs) by accelerating the replacement of bound GDP with GTP. BIG proteins also contain A-kinase anchoring protein (AKAP) sequences that can act as scaffolds for multimolecular assemblies that facilitate and limit cAMP signaling temporally and spatially. Direct interaction of BIG1 N-terminal sequence with β-catenin was confirmed using yeast two-hybrid assays and in vitro synthesized proteins. Depletion of BIG1 and/or BIG2 or overexpression of guanine nucleotide-exchange factor inactive mutant, but not wild-type, proteins interfered with β-catenin trafficking, leading to accumulation at perinuclear Golgi structures. Both phospholipase D activity and vesicular trafficking were required for effects of BIG1 and BIG2 on β-catenin activation. Levels of PKA-phosphorylated β-catenin S675 and β-catenin association with PKA, BIG1, and BIG2 were also diminished after BIG1/BIG2 depletion. Inferring a requirement for BIG1 and/or BIG2 AKAP sequence in PKA modification of β-catenin and its effect on transcription activation, we confirmed dependence of S675 phosphorylation and transcription coactivator function on BIG2 AKAP-C sequence. PMID:27162341

  13. AMP-Activated Kinase Regulates Lipid Droplet Localization and Stability of Adipose Triglyceride Lipase in C. elegans Dauer Larvae

    PubMed Central

    Xie, Meng; Roy, Richard

    2015-01-01

    Animals have developed diverse mechanisms to adapt to their changing environment. Like many organisms the free-living nematode C. elegans can alternate between a reproductive mode or a diapause-like "dauer" stage during larval development to circumvent harsh environmental conditions. The master metabolic regulator AMP-activated protein kinase (AMPK) is critical for survival during the dauer stage, where it phosphorylates adipose triglyceride lipase (ATGL-1) at multiple sites to block lipid hydrolysis and ultimately protect the cellular triglyceride-based energy depot from rapid depletion. However, how the AMPK-mediated phosphorylation affects the function of ATGL-1 has not been characterised at the molecular level. Here we show that AMPK phosphorylation leads to the generation of 14-3-3 binding sites on ATGL-1, which are recognized by the C. elegans 14-3-3 protein orthologue PAR-5. Physical interaction of ATGL-1 with PAR-5 results in sequestration of ATGL-1 away from the lipid droplets and eventual proteasome-mediated degradation. In addition, we also show that the major AMPK phosphorylation site on ATGL-1, Ser 303, is required for both modification of its lipid droplet localization and its degradation. Our data provide mechanistic insight as to how AMPK functions to enhance survival through its ability to protect the accumulated triglyceride deposits from rapid hydrolysis to preserve the energy stores during periods of extended environmental duress. PMID:26098762

  14. AMP-Activated Protein Kinase and Glycogen Synthase Kinase 3β Modulate the Severity of Sepsis-Induced Lung Injury

    PubMed Central

    Liu, Zhongyu; Bone, Nathaniel; Jiang, Shaoning; Park, Dae Won; Tadie, Jean-Marc; Deshane, Jessy; Rodriguez, Cilina Ann; Pittet, Jean-Francois; Abraham, Edward; Zmijewski, Jaroslaw W

    2015-01-01

    Alterations in metabolic and bioenergetic homeostasis contribute to sepsis-mediated organ injury. However, how AMP-activated protein kinase (AMPK), a major sensor and regulator of energy expenditure and production, affects development of organ injury and loss of innate capacity during polymicrobial sepsis remains unclear. In the present experiments, we found that cross-talk between the AMPK and GSK3β signaling pathways controls chemotaxis and the ability of neutrophils and macrophages to kill bacteria ex vivo. In mice with polymicrobial abdominal sepsis or more severe sepsis induced by the combination of hemorrhage and intraabdominal infection, administration of the AMPK activator metformin or the GSK3β inhibitor SB216763 reduced the severity of acute lung injury (ALI). Improved survival in metformin-treated septic mice was correlated with preservation of mitochondrial complex V (ATP synthase) function and increased amounts of ETC complex III and IV. Although immunosuppression is a consequence of sepsis, metformin effectively increased innate immune capacity to eradicate P. aeruginosa in the lungs of septic mice. We also found that AMPK activation diminished accumulation of the immunosuppressive transcriptional factor HIF-1α as well as the development of endotoxin tolerance in LPS-treated macrophages. Furthermore, AMPK-dependent preservation of mitochondrial membrane potential also prevented LPS-mediated dysfunction of neutrophil chemotaxis. These results indicate that AMPK activation reduces the severity of polymicrobial sepsis-induced lung injury and prevents the development of sepsis-associated immunosuppression. PMID:26650187

  15. Dibenzoylmethane exerts metabolic activity through regulation of AMP-activated protein kinase (AMPK)-mediated glucose uptake and adipogenesis pathways.

    PubMed

    Kim, Nami; Kim, Hong Min; Lee, Eun Soo; Lee, Jung Ok; Lee, Hye Jeong; Lee, Soo Kyung; Moon, Ji Wook; Kim, Ji Hae; Kim, Joong Kwan; Kim, Su Jin; Park, Sun Hwa; Chung, Choon Hee; Kim, Hyeon Soo

    2015-01-01

    Dibenzoylmethane (DBM) has been shown to exert a variety of beneficial effects on human health. However, the mechanism of action is poorly understood. In this study, DBM increased phosphorylation of AMP-activated protein kinase (AMPK) and stimulated glucose uptake in a skeletal muscle cell line. Both knockdown of AMPK with siRNA and inhibition with AMPK inhibitor blocked DBM-induced glucose uptake. DBM increased the concentration of intracellular calcium and glucose uptake due to DBM was abolished by STO-609 (a calcium/calmodulin-dependent protein kinase inhibitor). DBM stimulated phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK), which was blocked by pretreatment with compound C, an AMPK inhibitor. The expression of glucose transporter type 4 (GLUT4) was increased by DBM. The translocation of GLUT4 to the plasma membrane was also increased by DBM in AMPK dependently. In addition, DBM suppressed weight gain and prevented fat accumulation in the liver and abdomen in mice fed a high-fat diet. In pre-adipocyte cells, DBM decreased the activity of acetyl-CoA carboxylase (ACC), the rate-limiting enzyme of fatty acid synthesis. Expression of the adipogenic gene, fatty acid synthase (FAS), was suppressed by DBM in an AMPK-dependent manner. These results showed that the beneficial metabolic effects of DBM might be due to regulation of glucose uptake via AMPK in skeletal muscle and inhibition of adipogenesis in pre-adipocytes. PMID:25756788

  16. 5-aminoimidazole-4-carboxamide ribonucleoside and AMP-activated protein kinase inhibit signalling through NF-κB.

    PubMed

    Katerelos, Marina; Mudge, Stuart J; Stapleton, David; Auwardt, Russell B; Fraser, Scott A; Chen, C-G; Kemp, Bruce E; Power, David A

    2010-10-01

    Activation of nuclear factor-kappa B (NF-κB) is one of the most important pro-inflammatory mechanisms in disease. In this study, we show that 5-aminoimidazole-4-carboxamide ribonucleoside (AICAR), an intermediate in nucleoside metabolism, inhibits signalling by NF-κB in three cell types, including bovine aortic endothelial cells (BAEC). The block in the NF-κB signalling pathway occurred beyond degradation of IκB-α and movement of p65 into the nucleus of BAEC. There was, however, reduced binding of NF-κB from AICAR-treated cells to a κB-consensus oligonucleotide, suggesting that part of the mechanism was a reduction in NF-κB DNA-binding activity. Although AICAR is metabolized to ZMP and then adenosine, adenosine had no effect on activation of an NF-κB reporter. ZMP, however, activates the metabolic stress-sensing AMP-activated protein kinase (AMPK). Transfection of active AMPK into BAEC reduced NF-κB reporter activity compared with a kinase-dead mutant, suggesting that part of the ability of AICAR to inhibit NF-κB signalling is due to activation of AMPK. Inhibition of NF-κB signalling may be important in the anti-inflammatory action of drugs such as sulfasalazine and methotrexate, which led to the accumulation of AICAR within target cells. PMID:20404837

  17. Studies of the cAMP mediated aggregation in Dictyostelium discoideum: receptor mediated activation of the adenylate cyclase

    SciTech Connect

    Theibert, W.E.A.B.

    1985-01-01

    Dictyostelium discoideum, a eukaryotic amoeba of the cellular slime mold family, provides an interesting paradigm in developmental biology. During development, hundreds of thousands of cells aggregate to form a multicellular aggregate. Aggregation is mediated by chemotaxis and chemical signaling. Waves of adenosine 3'-5' cyclic monophosphate (cAMP) propagate through the monolayer and provide transient gradients for chemotaxis. The author has used a reversible inhibitor of the cAMP signaling response to demonstrate that adaptation to cAMP is independent of the activation of the adenylate cyclase and therefore is not caused by the rise in intracellular cAMP. Next, it is shown that adenosine inhibits the cAMP signaling response. Inhibition is rapid, reversible, and depends on the cAMP stimulus concentration. Then the specificity of the cAMP receptors which mediates signaling is determined and compared with the receptors which mediate chemotaxis, the cGMP response, and cAMP binding antagonism. The cAMP surface receptor has been identified by photoaffinity labeling intact cells with (/sup 32/P)-8-N/sub 3/-cAMP using an ammonium sulfate binding stabilization technique. The photoactivated ligand specifically labels a polypeptide, localized to the membrane fraction, which migrates as a closely spaced doublet on SDS Page.

  18. Interplay of Ca2+ and cAMP signaling in the insulin-secreting MIN6 beta-cell line.

    PubMed

    Landa, Luis R; Harbeck, Mark; Kaihara, Kelly; Chepurny, Oleg; Kitiphongspattana, Kajorn; Graf, Oliver; Nikolaev, Viacheslav O; Lohse, Martin J; Holz, George G; Roe, Michael W

    2005-09-01

    Ca2+ and cAMP are important second messengers that regulate multiple cellular processes. Although previous studies have suggested direct interactions between Ca2+ and cAMP signaling pathways, the underlying mechanisms remain unresolved. In particular, direct evidence for Ca2+-regulated cAMP production in living cells is incomplete. Genetically encoded fluorescence resonance energy transfer-based biosensors have made possible real-time imaging of spatial and temporal gradients of intracellular cAMP concentration in single living cells. Here, we used confocal microscopy, fluorescence resonance energy transfer, and insulin-secreting MIN6 cells expressing Epac1-camps, a biosynthetic unimolecular cAMP indicator, to better understand the role of intracellular Ca2+ in cAMP production. We report that depolarization with high external K+, tolbutamide, or glucose caused a rapid increase in cAMP that was dependent on extracellular Ca2+ and inhibited by nitrendipine, a Ca2+ channel blocker, or 2',5'-dideoxyadenosine, a P-site antagonist of transmembrane adenylate cyclases. Stimulation of MIN6 cells with glucose in the presence of tetraethylammonium chloride generated concomitant Ca2+ and cAMP oscillations that were abolished in the absence of extracellular Ca2+ and blocked by 2',5'-dideoxyadenosine or 3-isobutyl-1-methylxanthine, an inhibitor of phosphodiesterase. Simultaneous measurements of Ca2+ and cAMP concentrations with Fura-2 and Epac1-camps, respectively, revealed a close temporal and causal interrelationship between the increases in cytoplasmic Ca2+ and cAMP levels following membrane depolarization. These findings indicate highly coordinated interplay between Ca2+ and cAMP signaling in electrically excitable endocrine cells and suggest that Ca2+-dependent cAMP oscillations are derived from an increase in adenylate cyclase activity and periodic activation and inactivation of cAMP-hydrolyzing phosphodiesterase. PMID:15987680

  19. 8-Chloro-cAMP induces apoptotic cell death in a human mammary carcinoma cell (MCF-7) line.

    PubMed Central

    Bøe, R.; Gjertsen, B. T.; Døskeland, S. O.; Vintermyr, O. K.

    1995-01-01

    8-Cl-cAMP and 8-NH2-cAMP induced MCF-7 cell death. The type(s) of cell death were studied in more detail and compared with the cell death type (apoptosis) induced by okadaic acid, an inhibitor of serine/threonine phosphatases. By morphological criteria dying cells showed loss of cell-cell interactions and microvilli, condensation of nuclear chromatin and segregation of cytoplasmic organelles. By in situ nick end-labelling, using digoxigenin-conjugated dUTP as probe, a large fraction of 8-Cl-cAMP, 8-NH2-cAMP and 8-Cl-adenosine-exposed cells stained positively in the advanced stages of death. In the early phase of chromatin condensation the cells stained negatively. Specific (internucleosomal) DNA fragmentation was not observed. The MCF-7 cell death induced by 8-Cl-cAMP and 8-NH2-cAMP was not mediated by activation of the cAMP kinase since more stable cAMP analogues (8-CPT-cAMP and N6-benzoyl-cAMP) or forskolin failed to induce death. Furthermore, 8-Cl-cAMP action was counteracted by adenosine deaminase and 3-isobutyl-1-methylxanthine, and mimicked by 8-Cl-adenosine, a major metabolite of 8-Cl-cAMP. It is concluded that 8-Cl- and 8-NH2-cAMP can induce morphological and biochemical effects resembling apoptotic cell death in MCF-7 cells through their conversion into potent cytotoxic metabolite(s). Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7577461

  20. Genotoxicity assessment of the antiepileptic drug AMP397, an Ames-positive aromatic nitro compound.

    PubMed

    Suter, Willi; Hartmann, Andreas; Poetter, Franziska; Sagelsdorff, Peter; Hoffmann, Peter; Martus, Hans-Jörg

    2002-07-25

    AMP397 is a novel antiepileptic agent and the first competitive AMPA antagonist with high receptor affinity, good in vivo potency, and oral activity. AMP397 has a structural alert (aromatic nitro group) and was mutagenic in Salmonella typhimurium strains TA97a, TA98 and TA100 without S9, but negative in the nitroreductase-deficient strains TA98NR and TA100NR. The amino derivative of AMP397 was negative in wild-type strains TA98 and TA100. AMP397 was negative in a mouse lymphoma tk assay, which included a 24h treatment without S9. A weak micronucleus induction in vitro was found at the highest concentrations tested in V79 cells with S9. AMP397 was negative in the following in vivo studies, which included the maximum tolerated doses of 320mg/kg in mice and 2000mg/kg in rats: MutaMouse assay in colon and liver (5x320mg/kg) at three sampling times (3, 7 and 31 days after the last administration); DNA binding study in the liver of mice and rats after a single treatment with [14C]-AMP397; comet assay (1x2000mg/kg) in jejunum and liver of rats, sampling times 3 and 24h after administration; micronucleus test (2x320mg/kg) in the bone marrow of mice, sampling 24h after the second administration. Based on these results, it was concluded that AMP397 has no genotoxic potential in vivo. In particular, no genotoxic metabolite is formed in mammalian cells, and, if formed by intestinal bacteria, is unable to exert any genotoxic activity in the adjacent intestinal tissue. These data were considered to provide sufficient safety to initiate clinical development of the compound. PMID:12113769

  1. Ser364 of connexin43 and the upregulation of gap junction assembly by cAMP

    PubMed Central

    TenBroek, Erica M.; Lampe, Paul D.; Solan, Joell L.; Reynhout, James K.; Johnson, Ross G.

    2001-01-01

    The assembly of gap junctions (GJs) is a process coordinated by growth factors, kinases, and other signaling molecules. GJ assembly can be enhanced via the elevation of cAMP and subsequent stimulation of connexon trafficking to the plasma membrane. To study the positive regulation of GJ assembly, fibroblasts derived from connexin (Cx)43 knockout (KO) and wild-type (WT) mice were transfected with WT Cx43 (WTCx43) or mutant Cx43. GJ assembly between untransfected WT fibroblasts or stably transfected WTCx43/KO fibroblasts was increased two- to fivefold by 8Br-cAMP, and this increase could be blocked by inhibition of cAMP-dependent protein kinase (PKA) or truncation of the Cx43 COOH terminus (CT). Although serine 364 (S364) of the Cx43 CT was determined to be a major site of phosphorylation, the molar ratio of Cx43 phosphorylation was not increased by 8Br-cAMP. Importantly, GJ assembly between either S364ECx43/KO or S364ECx43/WT fibroblasts was stimulated by 8Br-cAMP, but that between S364ACx43/KO or S364PCx43/KO fibroblasts was not stimulated, indicating that phosphorylation or a negative charge at S364 is required for enhancement of GJ assembly by cAMP. Furthermore, GJ assembly between S364ACx43/WT fibroblasts could be stimulated by 8Br-cAMP, but could not be between S364PCx43/WT fibroblasts. Thus, S364PCx43 interferes with enhanced GJ assembly when coexpressed with WTCx43. PMID:11756479

  2. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli

    PubMed Central

    El Mahdy, Taghrid S.; Shibl, Atef M.

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried blaCTX-M-15, and two isolates carried blaCTX-M-14 gene. Two CTX-M-positive E. coli isolates carried blaCMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  3. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli.

    PubMed

    Al-Agamy, Mohamed H; El Mahdy, Taghrid S; Shibl, Atef M

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried bla CTX-M-15, and two isolates carried bla CTX-M-14 gene. Two CTX-M-positive E. coli isolates carried bla CMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  4. Nuclease-resistant c-di-AMP derivatives that differentially recognize RNA and protein receptors

    PubMed Central

    Meehan, Robert E.; Torgerson, Chad D.; Gaffney, Barbara L.; Jones, Roger A.; Strobel, Scott A.

    2016-01-01

    The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3’-5’-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activate specific pathways and mediate phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogs, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-AMP and structurally related second messengers by discriminating against an amine at the C2 position, more than a carbonyl at the C6 position. We also identified phosphate-modified analogs that bind both the ydaO RNA and GdpP protein with high affinity, while symmetrically-modified ribose analogs exhibited a substantial decrease in ydaO affinity, but retained high affinity for GdpP. These ligand modifications resulted in increased resistance to enzyme-catalyzed hydrolysis by the GdpP enzyme. Together, these data suggest that these c-di-AMP analogs could be useful as chemical tools to specifically target subsections of the second-messenger signaling pathways. PMID:26789423

  5. Capsaicinoids regulate airway anion transporters through Rho kinase- and cyclic AMP-dependent mechanisms.

    PubMed

    Hibino, Yoshitaka; Morise, Masahiro; Ito, Yasushi; Mizutani, Takefumi; Matsuno, Tadakatsu; Ito, Satoru; Hashimoto, Naozumi; Sato, Mitsuo; Kondo, Masashi; Imaizumi, Kazuyoshi; Hasegawa, Yoshinori

    2011-10-01

    To investigate the effects of capsaicinoids on airway anion transporters, we recorded and analyzed transepithelial currents in human airway epithelial Calu-3 cells. Application of capsaicin (100 μM) attenuated vectorial anion transport, estimated as short-circuit currents (I(SC)), before and after stimulation by forskolin (10 μM) with concomitant reduction of cytosolic cyclic AMP (cAMP) levels. The capsaicin-induced inhibition of I(SC) was also observed in the response to 8-bromo-cAMP (1 mM, a cell-permeable cAMP analog) and 3-isobutyl-1-methylxanthine (1 mM, an inhibitor of phosphodiesterases). The capsaicin-induced inhibition of I(SC) was attributed to suppression of bumetanide (an inhibitor of the basolateral Na(+)-K(+)-2 Cl(-) cotransporter 1)- and 4,4'-dinitrostilbene-2,2'-disulfonic acid (an inhibitor of basolateral HCO(3)(-)-dependent anion transporters)-sensitive components, which reflect anion uptake via basolateral cAMP-dependent anion transporters. In contrast, capsaicin potentiated apical Cl(-) conductance, which reflects conductivity through the cystic fibrosis transmembrane conductance regulator, a cAMP-regulated Cl(-) channel. All these paradoxical effects of capsaicin were mimicked by capsazepine. Forskolin application also increased phosphorylated myosin phosphatase target subunit 1, and the phosphorylation was prevented by capsaicin and capsazepine, suggesting that these capsaicinoids assume aspects of Rho kinase inhibitors. We also found that the increments in apical Cl(-) conductance were caused by conventional Rho kinase inhibitors, Y-27632 (20 μM) and HA-1077 (20 μM), with selective inhibition of basolateral Na(+)-K(+)-2 Cl(-) cotransporter 1. Collectively, capsaicinoids inhibit cAMP-mediated anion transport through down-regulation of basolateral anion uptake, paradoxically accompanied by up-regulation of apical cystic fibrosis transmembrane conductance regulator-mediated anion conductance. The latter is mediated by inhibition of Rho

  6. Cholesterol ester hydrolase in pig liver is activated by cyclic AMP-dependent protein kinase

    SciTech Connect

    Chen, J.J.S.; Dubin, E.; Margolis, S.

    1986-05-01

    To examine whether hepatic neutral cholesterol ester hydrolase (CEH) is regulated by phosphorylation, the authors have assayed CEH activity from pig liver cytosol by measuring /sup 14/C-oleate release from labeled cholesteryl oleate at pH 7.4. When pig liver cytosol was incubated with 2 mM Mg and 0.5 mM ATP, CEH activity was increased (141 +/- 8% of control, mean +/- SEM). Addition of 25..mu..M cyclic AMP (cAMP) further activated CEH activity (164 +/- 4% of control) as compared to incubation with Mg and ATP (p < 0.02). In the presence of 5 mM EDTA or in the absence of either Mg or ATP, no activation of CEH was observed. The activation was completely abolished by further incubation of activated cytosol with E. coli alkaline phosphatase. Activation of CEH activity was partially prevented by the addition of protein kinase inhibitor (p < 0.02) and this effect was completely reversed in the presence of exogenous cAMP-dependent protein kinase (p < 0.05). To examine further the role of the cAMP-dependent protein kinase, CEH activity was purified 240-fold by 35% (NH/sub 4/)/sub 2/SO/sub 4/ precipitation and Sepharose 4B chromatography. Incubation of partially purified CEH fractions with Mg, ATP and cAMP did not increase CEH activity. Addition of exogenous cAMP-dependent protein kinase activated CEH activity of partially purified fractions. The authors observations indicate that pig liver CEH is activated by phosphorylation mediated by cAMP-dependent protein kinase.

  7. Caveolin-3 regulates compartmentation of cardiomyocyte beta2-adrenergic receptor-mediated cAMP signaling.

    PubMed

    Wright, Peter T; Nikolaev, Viacheslav O; O'Hara, Thomas; Diakonov, Ivan; Bhargava, Anamika; Tokar, Sergiy; Schobesberger, Sophie; Shevchuk, Andrew I; Sikkel, Markus B; Wilkinson, Ross; Trayanova, Natalia A; Lyon, Alexander R; Harding, Sian E; Gorelik, Julia

    2014-02-01

    The purpose of this study was to investigate whether caveolin-3 (Cav3) regulates localization of β2-adrenergic receptor (β2AR) and its cAMP signaling in healthy or failing cardiomyocytes. We co-expressed wildtype Cav3 or its dominant-negative mutant (Cav3DN) together with the Förster resonance energy transfer (FRET)-based cAMP sensor Epac2-camps in adult rat ventricular myocytes (ARVMs). FRET and scanning ion conductance microscopy were used to locally stimulate β2AR and to measure cytosolic cAMP. Cav3 overexpression increased the number of caveolae and decreased the magnitude of β2AR-cAMP signal. Conversely, Cav3DN expression resulted in an increased β2AR-cAMP response without altering the whole-cell L-type calcium current. Following local stimulation of Cav3DN-expressing ARVMs, β2AR response could only be generated in T-tubules. However, the normally compartmentalized β2AR-cAMP signal became diffuse, similar to the situation observed in heart failure. Finally, overexpression of Cav3 in failing myocytes led to partial β2AR redistribution back into the T-tubules. In conclusion, Cav3 plays a crucial role for the localization of β2AR and compartmentation of β2AR-cAMP signaling to the T-tubules of healthy ARVMs, and overexpression of Cav3 in failing myocytes can partially restore the disrupted localization of these receptors. PMID:24345421

  8. Control of heart rate by cAMP sensitivity of HCN channels

    PubMed Central

    Alig, Jacqueline; Marger, Laurine; Mesirca, Pietro; Ehmke, Heimo; Mangoni, Matteo E.; Isbrandt, Dirk

    2009-01-01

    “Pacemaker” f-channels mediating the hyperpolarization-activated nonselective cation current If are directly regulated by cAMP. Accordingly, the activity of f-channels increases when cellular cAMP levels are elevated (e.g., during sympathetic stimulation) and decreases when they are reduced (e.g., during vagal stimulation). Although these biophysical properties seem to make f-channels ideal molecular targets for heart rate regulation by the autonomic nervous system, the exact contribution of the major If-mediating cardiac isoforms HCN2 and HCN4 to sinoatrial node (SAN) function remains highly controversial. To directly investigate the role of cAMP-dependent regulation of hyperpolarization activated cyclic nucleotide activated (HCN) channels in SAN activity, we generated mice with heart-specific and inducible expression of a human HCN4 mutation (573X) that abolishes the cAMP-dependent regulation of HCN channels. We found that hHCN4–573X expression causes elimination of the cAMP sensitivity of If and decreases the maximum firing rates of SAN pacemaker cells. In conscious mice, hHCN4–573X expression leads to a marked reduction in heart rate at rest and during exercise. Despite the complete loss of cAMP sensitivity of If, the relative extent of SAN cell frequency and heart rate regulation are preserved. Our data demonstrate that cAMP-mediated regulation of If determines basal and maximal heart rates but does not play an indispensable role in heart rate adaptation during physical activity. Our data also reveal the pathophysiologic mechanism of hHCN4–573X–linked SAN dysfunction in humans. PMID:19570998

  9. Nuclease-Resistant c-di-AMP Derivatives That Differentially Recognize RNA and Protein Receptors.

    PubMed

    Meehan, Robert E; Torgerson, Chad D; Gaffney, Barbara L; Jones, Roger A; Strobel, Scott A

    2016-02-16

    The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3'-5'-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activates specific pathways and mediates phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogues, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-AMP and structurally related second messengers by discriminating against an amine at the C2 position more than a carbonyl at the C6 position. We also identified phosphate-modified analogues that bind both the ydaO RNA and GdpP protein with high affinity, whereas symmetrically modified ribose analogues exhibited a substantial decrease in ydaO affinity but retained high affinity for GdpP. These ligand modifications resulted in increased resistance to enzyme-catalyzed hydrolysis by the GdpP enzyme. Together, these data suggest that these c-di-AMP analogues could be useful as chemical tools to specifically target subsections of second-messenger signaling pathways. PMID:26789423

  10. Caveolin-3 regulates compartmentation of cardiomyocyte beta2-adrenergic receptor-mediated cAMP signaling

    PubMed Central

    Wright, Peter T.; Nikolaev, Viacheslav O.; O’Hara, Thomas; Diakonov, Ivan; Bhargava, Anamika; Tokar, Sergiy; Schobesberger, Sophie; Shevchuk, Andrew I.; Sikkel, Markus B.; Wilkinson, Ross; Trayanova, Natalia A.; Lyon, Alexander R.; Harding, Sian E.; Gorelik, Julia

    2014-01-01

    The purpose of this study was to investigate whether caveolin-3 (Cav3) regulates localization of β2-adrenergic receptor (β2AR) and its cAMP signaling in healthy or failing cardiomyocytes. We co-expressed wildtype Cav3 or its dominant-negative mutant (Cav3DN) together with the Förster resonance energy transfer (FRET)-based cAMP sensor Epac2-camps in adult rat ventricular myocytes (ARVMs). FRET and scanning ion conductance microscopy were used to locally stimulate β2AR and to measure cytosolic cAMP. Cav3 overexpression increased the number of caveolae and decreased the magnitude of β2AR-cAMP signal. Conversely, Cav3DN expression resulted in an increased β2AR-cAMP response without altering the whole-cell L-type calcium current. Following local stimulation of Cav3DN-expressing ARVMs, β2AR response could only be generated in T-tubules. However, the normally compartmentalized β2AR-cAMP signal became diffuse, similar to the situation observed in heart failure. Finally, overexpression of Cav3 in failing myocytes led to partial β2AR redistribution back into the T-tubules. In conclusion, Cav3 plays a crucial role for the localization of β2AR and compartmentation of β2AR-cAMP signaling to the T-tubules of healthy ARVMs, and overexpression of Cav3 in failing myocytes can partially restore the disrupted localization of these receptors. PMID:24345421

  11. Dibutyryl cyclic AMP does not influence glomerular collagen or basement membrane production in vitro.

    PubMed

    Uw, V Y; Cohen, M P

    1980-02-01

    Glomeruli isolated from normal rat renal cortex were incubated for 3 hr with radiolabeled proline in the presence or absence of dibutyryl cyclic AMP. Following incubation, glomerular basement membranes were purified with osmotic lysis followed by selective solubilization of the cell membranes and intracellular proteins with detergents. This technique permitted quantitative recovery of radiolabeled membranes synthesized under different incubational conditions. Dibutyryl cyclic AMP did not affect the incorporation of radioactive precursor glomerular basement membrane (control = 14.72 +/- 1.08 cpm/microgram of membrane protein; cyclic AMP = 14.43 +/- 1.13). Nondialyzable [14C]protein and hydroxy[14C]proline were also measured in the media and in the various glomerular cell fractions obtained during isolation of the basement membranes. Protein ([14C]proline) and collagen (OH[14C]proline) secretion into the media in incubations with cyclic AMP did not differ from that in control incubations. OH[14C]proline content was greatest (congruent to 23% in the water-soluble fraction recovered after osmotic lysis, but significant amounts of OH[14C]proline were also associated with the detergent-solubilized cell fractions. Dibutyryl cyclic AMP had no effect on either glomerular protein or collagen synthesis in these experiments. The results suggest that total glomerular basement membrane production in mixed cell populations is not modulated via a cyclic AMP--coordinated mechanism but do not exclude the possibility that cyclic AMP modulates the amount or kind of collagen synthesis by individual glomerular cell types. PMID:6243687

  12. Influence of cAMP on reporter bioassays for dioxin and dioxin-like compounds

    SciTech Connect

    Kasai, Ayumi; Yao, Jian; Yamauchi, Kozue; Hiramatsu, Nobuhiko; Hayakawa, Kunihiro; Meng, Yiman; Maeda, Shuichiro; Kitamura, Masanori . E-mail: masanori@yamanashi.ac.jp

    2006-02-15

    In reporter assays for detection of dioxins, the dioxin-responsive element (DRE) is generally used as a sensor sequence. In several systems, the CYP1A1 promoter containing DREs (DRE{sup cyp}) is inserted into a part of the long terminal repeat of mouse mammary tumor virus (LTR{sup MMTV}) to improve sensitivity of assays. We found that DRE{sup cyp}-LTR{sup MMTV} responds not only to dioxins and dioxin-like compounds but also to forskolin, a cAMP-elevating agent. This effect was dose-dependent and reproduced by other cAMP-elevating agents including 8-bromo-cAMP and 3-isobutyl-methylxanthine. The cAMP response element (CRE) and CRE-like sequences were absent in DRE{sup cyp}-LTR{sup MMTV} and not involved in this process. In contrast to the effect of dioxin, the activation of DRE{sup cyp}-LTR{sup MMTV} by cAMP was independent of the aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor for DRE. Furthermore, neither DRE{sup cyp}, LTR{sup MMTV} nor the consensus sequence of DRE alone was activated in response to cAMP. These data elucidated for the first time that the combination of DRE{sup cyp} with LTR{sup MMTV} causes a peculiar response to cAMP and suggested that use of AhR antagonists is essential to exclude false-positive responses of DRE{sup cyp}-LTR{sup MMTV}-based bioassays for detection and quantification of dioxins and dioxin-like compounds.

  13. Landscape Evolution and Carbon Accumulation: Uniformitarianism Revisited

    NASA Astrophysics Data System (ADS)

    Rosenbloom, N. A.; Harden, J. W.; Neff, J. C.; Schimel, D. S.

    2003-12-01

    What is the role of hillslope transport in long-term carbon accumulation in soils? How do parent material, climate, and landform interact to produce the landscapes we observe today and to what extent can we use present day conditions to infer the dominant processes of the past? We use the CREEP [Rosenbloom, N.A. et al., 2001] process-response model to ask these questions, exploring the time-evolution of landscape form, soil distribution, and carbon accumulation in an undisturbed prairie site in western Iowa [Harden, J.W. et al., 2002]. The CREEP model simulates differential transport of soil particles, blanket deposition of atmospheric 10Be with eolian dust, and passive advection of soil carbon and 10Be, enabling the preferential enrichment and burial of rapidly moving soil constituents. By comparing landscape-wide average accumulations of 10Be to borehole observations at three hillslope positions, we conclude that the distribution of clay-adsorbed 10Be cannot be explained by co-transport with clay particles alone. Rather, 10Be appears to behave as a more complex tracer than originally assumed, requiring an explicit, independent parameterization of wet deposition and transport. By comparison, model carbon accumulation strongly reflects patterns of clay redistribution indicating that in situ carbon turnover is faster than redistribution. Observed vertical distributions of soil properties, including 10Be, could only be explained by assuming variations in deposition and erosion rates, specifically periods of accumulation, followed by periods of transport. This effect might not be apparent if only landform shape, geometry, and soil depth were considered and vertical distributions of soil properties were not explicitly simulated. The current landscape reflects a history of strong shifts in erosion and accumulation rates that cannot be simulated using a uniform parameterization of long-term landscape-evolution processes.

  14. Update on the Argonne positron accumulator ring

    SciTech Connect

    Borland, M.

    1993-07-01

    The injector for the Advanced Photon Source incorporates a 450-MeV positron accumulator ring (PAR) to decrease the filling time with the 2-Hz synchrotron. In addition to accumulating positrons from the linac, the PAR damps the beam and reduces the bunch length. The PAR lattice has been redesigned to use zero-gradient dipoles, while retaining essentially the same damping partition. Extensive simulations have been performed to set tolerances that will give high capture efficiency, in spite of the large momentum spread of the incoming positron beam.

  15. Spilanthol from Acmella Oleracea Lowers the Intracellular Levels of cAMP Impairing NKCC2 Phosphorylation and Water Channel AQP2 Membrane Expression in Mouse Kidney

    PubMed Central

    Gerbino, Andrea; Schena, Giorgia; Milano, Serena; Milella, Luigi; Barbosa, Alan Franco; Armentano, Francesca; Procino, Giuseppe; Svelto, Maria; Carmosino, Monica

    2016-01-01

    Acmella oleracea is well recognized in Brazilian traditional medicine as diuretic, although few scientific data have been published to support this effect. Aim of this study was to determine the molecular effect of Acmella oleracea extract and its main alkylamide spilanthol on two major processes involved in the urine concentrating mechanism: Na-K-2Cl symporter (NKCC2) activity in the thick ascending limb and water channel aquaporin 2 accumulation at the apical plasma membrane of collecting duct cells. Phosphorylation of NKCC2 was evaluated as index of its activation by Western blotting. Rate of aquaporin 2 apical expression was analyzed by confocal laser microscopy. Spilanthol-induced intracellular signalling events were dissected by video-imaging experiments. Exposure to spilanthol reduced the basal phosphorylation level of NKCC2 both in freshly isolated mouse kidney slices and in NKCC2-expresing HEK293 cells. In addition, exposure to spilanthol strongly reduced both desmopressin and low Cl−-dependent increase in NKCC2 phosphorylation in mouse kidney slices and NKCC2-expressing HEK293 cells, respectively. Similarly, spilanthol reduced both desmopressin- and forskolin-stimulated aquaporin 2 accumulation at the apical plasma membrane of collecting duct in mouse kidney slice and MCD4 cells, respectively. Of note, when orally administered, spilanthol induced a significant increase in both urine output and salt urinary excretion associated with a markedly reduced urine osmolality compared with control mice. Finally, at cellular level, spilanthol rapidly reduced or reversed basal and agonist-increased cAMP levels through a mechanism involving increases in intracellular [Ca2+]. In conclusion, spilanthol-induced inhibition of cAMP production negatively modulates urine-concentrating mechanisms thus holding great promise for its use as diuretic. PMID:27213818

  16. Spilanthol from Acmella Oleracea Lowers the Intracellular Levels of cAMP Impairing NKCC2 Phosphorylation and Water Channel AQP2 Membrane Expression in Mouse Kidney.

    PubMed

    Gerbino, Andrea; Schena, Giorgia; Milano, Serena; Milella, Luigi; Barbosa, Alan Franco; Armentano, Francesca; Procino, Giuseppe; Svelto, Maria; Carmosino, Monica

    2016-01-01

    Acmella oleracea is well recognized in Brazilian traditional medicine as diuretic, although few scientific data have been published to support this effect. Aim of this study was to determine the molecular effect of Acmella oleracea extract and its main alkylamide spilanthol on two major processes involved in the urine concentrating mechanism: Na-K-2Cl symporter (NKCC2) activity in the thick ascending limb and water channel aquaporin 2 accumulation at the apical plasma membrane of collecting duct cells. Phosphorylation of NKCC2 was evaluated as index of its activation by Western blotting. Rate of aquaporin 2 apical expression was analyzed by confocal laser microscopy. Spilanthol-induced intracellular signalling events were dissected by video-imaging experiments. Exposure to spilanthol reduced the basal phosphorylation level of NKCC2 both in freshly isolated mouse kidney slices and in NKCC2-expresing HEK293 cells. In addition, exposure to spilanthol strongly reduced both desmopressin and low Cl--dependent increase in NKCC2 phosphorylation in mouse kidney slices and NKCC2-expressing HEK293 cells, respectively. Similarly, spilanthol reduced both desmopressin- and forskolin-stimulated aquaporin 2 accumulation at the apical plasma membrane of collecting duct in mouse kidney slice and MCD4 cells, respectively. Of note, when orally administered, spilanthol induced a significant increase in both urine output and salt urinary excretion associated with a markedly reduced urine osmolality compared with control mice. Finally, at cellular level, spilanthol rapidly reduced or reversed basal and agonist-increased cAMP levels through a mechanism involving increases in intracellular [Ca2+]. In conclusion, spilanthol-induced inhibition of cAMP production negatively modulates urine-concentrating mechanisms thus holding great promise for its use as diuretic. PMID:27213818

  17. Communication of cAMP by connexin43 gap junctions regulates osteoblast signaling and gene expression.

    PubMed

    Gupta, Aditi; Anderson, Hidayah; Buo, Atum M; Moorer, Megan C; Ren, Margaret; Stains, Joseph P

    2016-08-01

    Connexin43 (Cx43) containing gap junctions play an important role in bone homeostasis, yet little is known about the second messengers communicated by Cx43 among bone cells. Here, we used MC3T3-E1 pre-osteoblasts and UMR106 rat osteosarcoma cells to test the hypothesis that cAMP is a second messenger communicated by bone cells through Cx43 containing gap junctions in a manner that is sufficient to impact osteoblast function. Overexpression of Cx43 markedly enhanced the activity of a cAMP-response element driven transcriptional luciferase reporter (CRE-luc) and increased phospho-CREB and phospho-ERK1/2 levels following expression of a constitutively active Gsα or by treatment with prostaglandin E2 (PGE2), 3-Isobutyl-1-methyl xanthine (IBMX) or forskolin. The Cx43-dependent potentiation of signaling in PGE2 treated cells was not accompanied by a further increase in cAMP levels, suggesting that the cAMP was shared between cells rather than Cx43 enhancing cAMP production. To support this, we developed a novel assay in which one set of cells expressing constitutively active Gsα (donor cells) were co-cultured with a second set of cells expressing a CRE-luc reporter (acceptor cells). Using this assay, activation of a CRE-luc reporter in the acceptor cells was both Cx43- and cell contact-dependent, indicating communication of cAMP among cells. Finally, we showed that Cx43 increased the cAMP-dependent mRNA expression of receptor activator of nuclear factor kappa B ligand (RANKL) and enhanced the repression of the sclerostin mRNA, implying a potential mechanism for the modulation of tissue remodeling. In total, these data demonstrate that Cx43 can communicate cAMP between cells and, more importantly, that the communicated cAMP is sufficient to impact signal transduction cascades and the expression of key bone effector molecules between interconnected cells. PMID:27156839

  18. PKA RIα Homodimer Structure Reveals an Intermolecular Interface with Implications for Cooperative cAMP Binding and Carney Complex Disease

    PubMed Central

    Bruystens, Jessica G.H.; Wu, Jian; Fortezzo, Audrey; Kornev, Alexandr P.; Blumenthal, Donald K.; Taylor, Susan S.

    2014-01-01

    Summary The regulatory (R) subunit is the cAMP receptor of protein kinase A. Following cAMP binding, the inactive PKA holoenzyme complex separates into two active catalytic (C) subunits and a cAMP-bound R dimer. Thus far, only monomeric R structures have been solved, which fell short in explaining differences of cAMP binding for the full-length protein as compared to the truncated R subunits. Here we solved a full-length R-dimer structure that reflects the biologically relevant conformation, and this structure agrees well with small angle X-ray scattering. An isoform-specific interface is revealed between the protomers. This interface acts as an intermolecular sensor for cAMP and explains the cooperative character of cAMP binding to the RIα dimer. Mutagenesis of residues on this interface not only leads to structural and biochemical changes, but is also linked to Carney complex disease. PMID:24316401

  19. Ultrasonic and densimetric characterization of the association of cyclic AMP with the cAMP-binding domain of the exchange protein EPAC1.

    PubMed

    Son, Ikbae; Selvaratnam, Rajeevan; Dubins, David N; Melacini, Giuseppe; Chalikian, Tigran V

    2013-09-19

    We employed a combination of densimetric and ultrasonic velocimetric techniques to characterize the volumetric properties of the association of the cAMP-binding domain (CBD) of EPAC1 with cAMP at 25 °C in a pH 7.6 buffer. The binding of cAMP to the CBD of EPAC1 is accompanied by changes in volume, ΔV, and adiabatic compressibility, ΔKS, of -59 ± 4 cm(3) mol(-1) and (34 ± 9) × 10(-4) cm(3) mol(-1) bar(-1), respectively. We use these volumetric results in conjunction with the structural data to estimate a change in hydration, Δnh, accompanying the binding. We calculate that approximately 103 water molecules are released to the bulk from the associating surfaces of the protein and the ligand. This number is ∼30% larger than the number of water molecules in direct contact with the associating surfaces while also being within the error of our Δnh determination. Therefore, we conclude that cAMP binding to EPAC1 may involve, in addition to the waters from within the first coordination sphere, also some waters from the second coordination sphere of the protein and cAMP. Our analysis of the compressibility data reveals that the protein becomes more rigid and less dynamic upon the cAMP binding as reflected in a 4 ± 0.5% decrease in its intrinsic coefficient of adiabatic compressibility. Finally, we estimate the hydration, ΔShyd, and configurational, ΔSconf, contributions to the binding entropy, ΔSb. We find that the binding entropy is determined by the fine balance between the ΔShyd and ΔSconf terms. In general, we discuss insights that are derived from a combination of volumetric and structural properties, in particular, emphasizing how measured changes in volume and compressibility can be interpreted in terms of hydration and dynamic properties of EPAC1 in its apo- and holo-forms. PMID:23968295

  20. Adenylate Kinase and AMP Signaling Networks: Metabolic Monitoring, Signal Communication and Body Energy Sensing

    PubMed Central

    Dzeja, Petras; Terzic, Andre

    2009-01-01

    Adenylate kinase and downstream AMP signaling is an integrated metabolic monitoring system which reads the cellular energy state in order to tune and report signals to metabolic sensors. A network of adenylate kinase isoforms (AK1-AK7) are distributed throughout intracellular compartments, interstitial space and body fluids to regulate energetic and metabolic signaling circuits, securing efficient cell energy economy, signal communication and stress response. The dynamics of adenylate kinase-catalyzed phosphotransfer regulates multiple intracellular and extracellular energy-dependent and nucleotide signaling processes, including excitation-contraction coupling, hormone secretion, cell and ciliary motility, nuclear transport, energetics of cell cycle, DNA synthesis and repair, and developmental programming. Metabolomic analyses indicate that cellular, interstitial and blood AMP levels are potential metabolic signals associated with vital functions including body energy sensing, sleep, hibernation and food intake. Either low or excess AMP signaling has been linked to human disease such as diabetes, obesity and hypertrophic cardiomyopathy. Recent studies indicate that derangements in adenylate kinase-mediated energetic signaling due to mutations in AK1, AK2 or AK7 isoforms are associated with hemolytic anemia, reticular dysgenesis and ciliary dyskinesia. Moreover, hormonal, food and antidiabetic drug actions are frequently coupled to alterations of cellular AMP levels and associated signaling. Thus, by monitoring energy state and generating and distributing AMP metabolic signals adenylate kinase represents a unique hub within the cellular homeostatic network. PMID:19468337

  1. Senescent-induced dysregulation of cAMP/CREB signaling and correlations with cognitive decline.

    PubMed

    Hansen, Rolf T; Zhang, Han-Ting

    2013-06-21

    It is well known that alongside senescence there is a gradual decline in cognitive ability, most noticeably certain kinds of memory such as working, episodic, spatial, and long term memory. However, until recently, not much has been known regarding the specific mechanisms responsible for the decline in cognitive ability with age. Over the past decades, researchers have become more interested in cAMP signaling, and its downstream transcription factor cAMP response element binding protein (CREB) in the context of senescence. However, there is still a lack of understanding on what ultimately causes the cognitive deficits observed with senescence. This review will focus on the changes in intracellular signaling in the brain, more specifically, alterations in cAMP/CREB signaling in aging. In addition, the downstream effects of altered cAMP signaling on cognitive ability with age will be further discussed. Overall, understanding the senescent-related changes that occur in cAMP/CREB signaling could be important for the development of novel drug targets for both healthy aging, and pathological aging such as Alzheimer's disease. PMID:23623816

  2. cAMP signaling in skeletal muscle adaptation: hypertrophy, metabolism, and regeneration

    PubMed Central

    Stewart, Randi

    2012-01-01

    Among organ systems, skeletal muscle is perhaps the most structurally specialized. The remarkable subcellular architecture of this tissue allows it to empower movement with instructions from motor neurons. Despite this high degree of specialization, skeletal muscle also has intrinsic signaling mechanisms that allow adaptation to long-term changes in demand and regeneration after acute damage. The second messenger adenosine 3′,5′-monophosphate (cAMP) not only elicits acute changes within myofibers during exercise but also contributes to myofiber size and metabolic phenotype in the long term. Strikingly, sustained activation of cAMP signaling leads to pronounced hypertrophic responses in skeletal myofibers through largely elusive molecular mechanisms. These pathways can promote hypertrophy and combat atrophy in animal models of disorders including muscular dystrophy, age-related atrophy, denervation injury, disuse atrophy, cancer cachexia, and sepsis. cAMP also participates in muscle development and regeneration mediated by muscle precursor cells; thus, downstream signaling pathways may potentially be harnessed to promote muscle regeneration in patients with acute damage or muscular dystrophy. In this review, we summarize studies implicating cAMP signaling in skeletal muscle adaptation. We also highlight ligands that induce cAMP signaling and downstream effectors that are promising pharmacological targets. PMID:22354781

  3. Diatom acclimation to elevated CO2 via cAMP signalling and coordinated gene expression

    NASA Astrophysics Data System (ADS)

    Hennon, Gwenn M. M.; Ashworth, Justin; Groussman, Ryan D.; Berthiaume, Chris; Morales, Rhonda L.; Baliga, Nitin S.; Orellana, Mónica V.; Armbrust, E. V.

    2015-08-01

    Diatoms are responsible for ~40% of marine primary productivity, fuelling the oceanic carbon cycle and contributing to natural carbon sequestration in the deep ocean. Diatoms rely on energetically expensive carbon concentrating mechanisms (CCMs) to fix carbon efficiently at modern levels of CO2 (refs , , ). How diatoms may respond over the short and long term to rising atmospheric CO2 remains an open question. Here we use nitrate-limited chemostats to show that the model diatom Thalassiosira pseudonana rapidly responds to increasing CO2 by differentially expressing gene clusters that regulate transcription and chromosome folding, and subsequently reduces transcription of photosynthesis and respiration gene clusters under steady-state elevated CO2. These results suggest that exposure to elevated CO2 first causes a shift in regulation, and then a metabolic rearrangement. Genes in one CO2-responsive cluster included CCM and photorespiration genes that share a putative cAMP-responsive cis-regulatory sequence, implying these genes are co-regulated in response to CO2, with cAMP as an intermediate messenger. We verified cAMP-induced downregulation of CCM gene δ-CA3 in nutrient-replete diatom cultures by inhibiting the hydrolysis of cAMP. These results indicate an important role for cAMP in downregulating CCM and photorespiration genes under elevated CO2 and provide insights into mechanisms of diatom acclimation in response to climate change.

  4. An antimicrobial peptide Ar-AMP from amaranth (Amaranthus retroflexus L.) seeds.

    PubMed

    Lipkin, Aleksey; Anisimova, Veronika; Nikonorova, Aleksandra; Babakov, Aleksey; Krause, Eberhardt; Bienert, Mikhael; Grishin, Eugene; Egorov, Tsezi

    2005-10-01

    A 30-residue antimicrobial peptide Ar-AMP was isolated from the seeds of amaranth Amaranthus retroflexus L. essentially by a single step procedure using reversed-phase HPLC, and its in vitro biological activities were studied. The complete amino acid sequence of Ar-AMP was determined by Edman degradation in combination with mass spectrometric methods. In addition, the cDNA encoding Ar-AMP was obtained and sequenced. The cDNA encodes a precursor protein consisting of the N-terminal putative signal sequence of 25 amino acids, a mature peptide of 30 amino acids and a 34-residue long C-terminal region cleaved during post-translational processing. According to sequence similarity the Ar-AMP belongs to the hevein-like family of antimicrobial peptides with six cysteine residues. In spite of the fact that seeds were collected in 1967 and lost their germination capacity, Ar-AMP retained its biological activities. It effectively inhibited the growth of different fungi tested: Fusarium culmorium (Smith) Sacc., Helminthosporium sativum Pammel., King et Bakke, Alternaria consortiale Fr., and Botrytis cinerea Pers., caused morphological changes in Rhizoctonia solani Kühn at micromolar concentrations and protected barley seedlings from H. sativum infection. PMID:16126239

  5. Molecular and kinetic alterations of muscle AMP deaminase during chronic creatine depletion.

    PubMed

    Rush, J W; Tullson, P C; Terjung, R L

    1998-02-01

    We examined a possible mechanism to account for the maintenance of peak AMP deamination rate in fast-twitch muscle of rats fed the creatine analog beta-guanidinopropionic acid (beta-GPA), in spite of reduced abundance of the enzyme AMP deaminase (AMPD). AMPD enzymatic capacity (determined at saturating AMP concentration) and AMPD protein abundance (Western blot) were coordinately reduced approximately 80% in fast-twitch white gastrocnemius muscle by beta-GPA feeding over 7 wk. Kinetic analysis of AMPD in the soluble cell fraction demonstrated a single Michaelis-Menten constant (Km; approximately 1.5 mM) in control muscle extracts. An additional high-affinity Km (approximately 0.03 mM) was revealed at low AMP concentrations in extracts of beta-GPA-treated muscle. The kinetic alteration in AMPD reflects increased molecular activity at low AMP concentrations; this could account for high rates of deamination in beta-GPA-treated muscle in situ, despite the loss of AMPD enzyme protein. The elimination of this kinetic effect by treatment of beta-GPA-treated muscle extracts with acid phosphatase in vitro suggests that phosphorylation is involved in the kinetic control of skeletal muscle AMPD in vivo. PMID:9486137

  6. Pseudomonas aeruginosa AmpR: an acute–chronic switch regulator

    PubMed Central

    Balasubramanian, Deepak; Kumari, Hansi; Mathee, Kalai

    2015-01-01

    Pseudomonas aeruginosa is one of the most intractable human pathogens that pose serious clinical challenge due to extensive prevalence of multidrug-resistant clinical isolates. Armed with abundant virulence and antibiotic resistance mechanisms, it is a major etiologic agent in a number of acute and chronic infections. A complex and intricate network of regulators dictates the expression of pathogenicity factors in P. aeruginosa. Some proteins within the network play key roles and control multiple pathways. This review discusses the role of one such protein, AmpR, which was initially recognized for its role in antibiotic resistance by regulating AmpC β-lactamase. Recent genomic, proteomic and phenotypic analyses demonstrate that AmpR regulates expression of hundreds of genes that are involved in diverse pathways such as β-lactam and non-β-lactam resistance, quorum sensing and associated virulence phenotypes, protein phosphorylation, and physiological processes. Finally, ampR mutations in clinical isolates are reviewed to shed light on important residues required for its function in antibiotic resistance. The prevalence and evolutionary implications of AmpR in pathogenic and nonpathogenic proteobacteria are also discussed. A comprehensive understanding of proteins at nodal positions in the P. aeruginosa regulatory network is crucial in understanding, and ultimately targeting, the pathogenic stratagems of this organism. PMID:25066236

  7. Intercellular Redistribution of cAMP Underlies Selective Suppression of Cancer Cell Growth by Connexin26

    PubMed Central

    Polusani, Srikanth R.; Mathis, Sandra A.; Zucker, Shoshanna N.; Nicholson, Bruce J.

    2013-01-01

    Connexins (Cx), which constitute gap junction intercellular channels in vertebrates, have been shown to suppress transformed cell growth and tumorigenesis, but the mechanism(s) still remain largely speculative. Here, we define the molecular basis by which Cx26, but less frequently Cx43 or Cx32, selectively confer growth suppression on cancer cells. Functional intercellular coupling is shown to be required, producing partial blocks of the cell cycle due to prolonged activation of several mitogenic kinases. PKA is both necessary and sufficient for the Cx26 induced growth inhibition in low serum and the absence of anchorage. Activation of PKA was not associated with elevated cAMP levels, but appeared to result from a redistribution of cAMP throughout the cell population, eliminating the cell cycle oscillations in cAMP required for efficient cell cycle progression. Cx43 and Cx32 fail to mediate this redistribution as, unlike Cx26, these channels are closed during the G2/M phase of the cell cycle when cAMP levels peak. Comparisons of tumor cell lines indicate that this is a general pattern, with growth suppression by connexins occurring whenever cAMP oscillates with the cell cycle, and the gap junction remain open throughout the cell cycle. Thus, gap junctional coupling, in the absence of any external signals, provides a general means to limit the mitotic rate of cell populations. PMID:24312655

  8. Renal Epithelial Cyst Formation and Enlargement in vitro: Dependence on cAMP

    NASA Astrophysics Data System (ADS)

    Mangoo-Karim, Roberto; Uchic, Marie; Lechene, Claude; Grantham, Jared J.

    1989-08-01

    Cysts, a common abnormality of kidneys, are collections of urine-like fluid enclosed by a continuous layer of epithelial cells. Renal cysts derive from nephrons and collecting ducts and progressively enlarge as a consequence of epithelial proliferation and transepithelial fluid secretion. The initiation of cyst formation and the factors that control cyst enlargement are unknown. We used an in vitro model of renal cysts to explore the role of the cAMP signal transduction system in the formation and expansion of cysts. MDCK cells, cultured in hydrated-collagen gel, produced polarized monolayered epithelial cysts when intracellular cAMP was increased by prostaglandin E1, arginine vasopressin, cholera toxin, forskolin, or 8-bromoadenosine 3',5'-cyclic monophosphate. All agonists were potentiated by 3-isobutyl-1-methylxanthine, a nucleotide phosphodiesterase inhibitor. The cell proliferation component of cyst enlargement was accelerated by cAMP agonists, as shown by the increased growth of MDCK cells in subconfluent monolayers. The fluid secretion component, reflected by the transepithelial movement of fluid across polarized monolayers of MDCK cells grown on permeable supports, was stimulated by cAMP agonists in the basolateral medium. Chloride levels were higher in the cyst fluid and the secreted fluid than in the bathing medium. We conclude that the development of MDCK cysts is dependent on cAMP. This signal transduction system may be an important modulator of epithelial cell proliferation and transepithelial fluid secretion in the kidney.

  9. Persistent cAMP Signaling by Internalized LH Receptors in Ovarian Follicles.

    PubMed

    Lyga, Sandra; Volpe, Silvia; Werthmann, Ruth C; Götz, Konrad; Sungkaworn, Titiwat; Lohse, Martin J; Calebiro, Davide

    2016-04-01

    A crucial event in female reproduction occurs at midcycle, when a LH peak induces the final maturation of ovarian follicles. LH signals via a G protein-coupled receptor selectively expressed in the outermost follicular cell layers. However, how LH signals are relayed inside these cells and finally to the oocyte is incompletely understood. Here, we monitored LH signaling in intact ovarian follicles of transgenic mice expressing a fluorescent cAMP sensor. We found that LH stimulation induces 2 phases of cAMP signaling in all cell layers surrounding the oocyte. Interfering with LH receptor internalization abolished the second, persistent cAMP phase and partially inhibited oocyte meiosis resumption. These data suggest that persistent cAMP signals from internalized LH receptors contribute to transmitting LH effects inside follicle cells and ultimately to the oocyte. Thus, this study indicates that the recently proposed paradigm of cAMP signaling by internalized G protein-coupled receptors is implicated in receptor function and is physiologically relevant. PMID:26828746

  10. Cyclic AMP-receptor protein activates aerobactin receptor IutA expression in Vibrio vulnificus.

    PubMed

    Kim, Choon-Mee; Kim, Seong-Jung; Shin, Sung-Heui

    2012-04-01

    The ferrophilic bacterium Vibrio vulnificus can utilize the siderophore aerobactin of Escherichia coli for iron acquisition via its specific receptor IutA. This siderophore piracy by V. vulnificus may contribute to its survival and proliferation, especially in mixed bacterial environments. In this study, we examined the effects of glucose, cyclic AMP (cAMP), and cAMP-receptor protein (Crp) on iutA expression in V. vulnificus. Glucose dose-dependently repressed iutA expression. A mutation in cya encoding adenylate cyclase required for cAMP synthesis severely repressed iutA expression, and this change was recovered by in trans complementing cya or the addition of exogenous cAMP. Furthermore, a mutation in crp encoding Crp severely repressed iutA expression, and this change was recovered by complementing crp. Accordingly, glucose deprivation under iron-limited conditions is an environmental signal for iutA expression, and Crp functions as an activator that regulates iutA expression in response to glucose availability. PMID:22538662

  11. Role of cyclic AMP in the maturation of Ciona intestinalis oocytes.

    PubMed

    Silvestre, Francesco; Gallo, Alessandra; Cuomo, Annunziata; Covino, Tiziana; Tosti, Elisabetta

    2011-11-01

    Immature oocytes are arrested at prophase I of the meiotic process and maturation onset is indicated by oocyte nuclear disassembly (germinal vesicle breakdown or GVBD). Signaling pathways that elevate intracellular cyclic AMP (cAMP) may either prevent or induce oocyte maturation depending on the species. In some marine invertebrates and, in particular, in ascidian oocytes, cAMP triggers GVBD rather than blocking it. In this paper, we tested different cAMP elevators in fully grown oocytes at the germinal vesicle stage (GV) of the ascidian Ciona intestinalis. We demonstrated that through the activation of adenylate cyclase or the inhibition and phosphodiesterases the oocyte remained at the GV stage. This effect was reversible as the GV-arrested oocytes, rinsed and incubated in sea water, are able to undergo spontaneous maturation and extrusion of follicle cells. In addition, oocytes acquire the ability to be fertilized and start early development. However, morphology of follicle cells, embryos and larvae from in vitro matured oocytes showed different morphology from those derived from in vivo mature oocytes. The role and the transduction mechanism of cAMP in the regulation of oocyte maturation were discussed. Finally, we indicated a variation of biological mechanisms present in the ascidian species; moreover, we sustain evidence proving that tunicates share some biological mechanisms with vertebrates. This information provided new hints on the importance of ascidians in the evolution of chordates. PMID:20810008

  12. Cyclic AMP concentrations in dendritic cells induce and regulate Th2 immunity and allergic asthma

    PubMed Central

    Lee, Jihyung; Kim, Tae Hoon; Murray, Fiona; Li, Xiangli; Choi, Sara S.; Broide, David H.; Corr, Maripat; Lee, Jongdae; Webster, Nicholas J. G.; Insel, Paul A.; Raz, Eyal

    2015-01-01

    The inductive role of dendritic cells (DC) in Th2 differentiation has not been fully defined. We addressed this gap in knowledge by focusing on signaling events mediated by the heterotrimeric GTP binding proteins Gαs, and Gαi, which respectively stimulate and inhibit the activation of adenylyl cyclases and the synthesis of cAMP. We show here that deletion of Gnas, the gene that encodes Gαs in mouse CD11c+ cells (GnasΔCD11c mice), and the accompanying decrease in cAMP provoke Th2 polarization and yields a prominent allergic phenotype, whereas increases in cAMP inhibit these responses. The effects of cAMP on DC can be demonstrated in vitro and in vivo and are mediated via PKA. Certain gene products made by GnasΔCD11c DC affect the Th2 bias. These findings imply that G protein-coupled receptors, the physiological regulators of Gαs and Gαi activation and cAMP formation, act via PKA to regulate Th bias in DC and in turn, Th2-mediated immunopathologies. PMID:25605931

  13. Opposing actions of dibutyryl cyclic AMP and GMP on temperature in conscious guinea-pigs

    NASA Technical Reports Server (NTRS)

    Kandasamy, S. B.; Williaes, B. A.

    1983-01-01

    It is shown that the intracerebroventricular administration of dibutyryl cyclic AMP (Db-cAMP) induced hyperthermia in guinea pigs which was not mediated through prostaglandins or norepinephrine since a prostaglandin synthesis inhibitor and an alpha-adrenergic receptor blocking agent did not antagonize the hyperthermia. However, the hyperthermic response to Db-cAMP was attenuated by the central administration of a beta-adrenergic receptor antagonist, which indicates that cAMP may be involved, through beta-adrenergic receptors, in the central regulation of heat production and conservation. The central administration of Db-cGMP produced hypothermia which was not mediated via histamine H1 or H2 receptors and serotonin. The antagonism of hypothermia induced by Db-cGMP and acetylcholine + physostigmine by central administration of a cholinergic muscarine receptor antagonist and not by a cholinergic nicotinic receptor antagonist suggests that cholinoceptive neurons and endogenous cGMP may regulate heat loss through cholinergic muscarine receptors. It is concluded that these results indicate a regulatory role in thermoregulation provided by a balance between opposing actions of cAMP and cGMP in guinea pigs.

  14. The role of ventral striatal cAMP signaling in stress-induced behaviors

    PubMed Central

    Plattner, Florian; Hayashi, Kanehiro; Hernandez, Adan; Benavides, David R.; Tassin, Tara C.; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W.; Yuen, Eunice Y.; Yan, Zhen; Goldberg, Matthew S.; Nairn, Angus C.; Greengard, Paul; Nestler, Eric J.; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D.; Bibb, James A.

    2015-01-01

    The cAMP/PKA signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitates cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targets the regulation of PDE4 by Cdk5, all produced analogical effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  15. Role of insulin during exercise-induced glycogenesis in muscle: effect on cyclic AMP.

    PubMed

    Ivy, J L

    1977-12-01

    Skeletal muscle cyclic AMP (cAMP) content and glycogen synthesis were investigated in male rats subjected to exhaustive exercise, alloxan diabetes, and combinations of these conditions. After an exhaustive swim or control treatment of wading, randomly selected animals were administered 500 mg glucose via stomach tube. Two hours after glucose administration, gastrocnemius glycogen levels rose from 1.31 to 10.67 mg/g wet wt in fatigued nondiabetics (FND), producing a 94% supercompensation above control values. Glycogen of fatigued diabetics (FD) increased from 0.88 to 4.21 mg/g wet wt during the first 2 hr after glucose administration and did not reach control values for 24 h. In conjunction with these glycogen changes, cAMP increased from 1.23 to 2.59 and 1.47 to 2.81 pmol/mg wet wt for FND and FD, respectively (P less than 0.05). No difference in cAMP levels between diabetics and nondiabetics was found. These in vivo data suggest that insulin may not be essential for muscle glycogen synthesis, but that after glycogen depletion it plays a prominent role in supercompensation. Also, this hormone's mechanism of action in skeletal muscle does not appear to be mediated through alteration in the tissue cAMP concentration. PMID:202169

  16. Intercellular redistribution of cAMP underlies selective suppression of cancer cell growth by connexin26.

    PubMed

    Chandrasekhar, Anjana; Kalmykov, Edward A; Polusani, Srikanth R; Mathis, Sandra A; Zucker, Shoshanna N; Nicholson, Bruce J

    2013-01-01

    Connexins (Cx), which constitute gap junction intercellular channels in vertebrates, have been shown to suppress transformed cell growth and tumorigenesis, but the mechanism(s) still remain largely speculative. Here, we define the molecular basis by which Cx26, but less frequently Cx43 or Cx32, selectively confer growth suppression on cancer cells. Functional intercellular coupling is shown to be required, producing partial blocks of the cell cycle due to prolonged activation of several mitogenic kinases. PKA is both necessary and sufficient for the Cx26 induced growth inhibition in low serum and the absence of anchorage. Activation of PKA was not associated with elevated cAMP levels, but appeared to result from a redistribution of cAMP throughout the cell population, eliminating the cell cycle oscillations in cAMP required for efficient cell cycle progression. Cx43 and Cx32 fail to mediate this redistribution as, unlike Cx26, these channels are closed during the G2/M phase of the cell cycle when cAMP levels peak. Comparisons of tumor cell lines indicate that this is a general pattern, with growth suppression by connexins occurring whenever cAMP oscillates with the cell cycle, and the gap junction remain open throughout the cell cycle. Thus, gap junctional coupling, in the absence of any external signals, provides a general means to limit the mitotic rate of cell populations. PMID:24312655

  17. cAMP signalling in mushroom bodies modulates temperature preference behaviour in Drosophila.

    PubMed

    Hong, Sung-Tae; Bang, Sunhoe; Hyun, Seogang; Kang, Jongkyun; Jeong, Kyunghwa; Paik, Donggi; Chung, Jongkyeong; Kim, Jaeseob

    2008-08-01

    Homoiotherms, for example mammals, regulate their body temperature with physiological responses such as a change of metabolic rate and sweating. In contrast, the body temperature of poikilotherms, for example Drosophila, is the result of heat exchange with the surrounding environment as a result of the large ratio of surface area to volume of their bodies. Accordingly, these animals must instinctively move to places with an environmental temperature as close as possible to their genetically determined desired temperature. The temperature that Drosophila instinctively prefers has a function equivalent to the 'set point' temperature in mammals. Although various temperature-gated TRP channels have been discovered, molecular and cellular components in Drosophila brain responsible for determining the desired temperature remain unknown. We identified these components by performing a large-scale genetic screen of temperature preference behaviour (TPB) in Drosophila. In parallel, we mapped areas of the Drosophila brain controlling TPB by targeted inactivation of neurons with tetanus toxin and a potassium channel (Kir2.1) driven with various brain-specific GAL4s. Here we show that mushroom bodies (MBs) and the cyclic AMP-cAMP-dependent protein kinase A (cAMP-PKA) pathway are essential for controlling TPB. Furthermore, targeted expression of cAMP-PKA pathway components in only the MB was sufficient to rescue abnormal TPB of the corresponding mutants. Preferred temperatures were affected by the level of cAMP and PKA activity in the MBs in various PKA pathway mutants. PMID:18594510

  18. 19 CFR 10.772 - Accumulation.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 19 Customs Duties 1 2013-04-01 2013-04-01 false Accumulation. 10.772 Section 10.772 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Morocco Free Trade...

  19. 19 CFR 10.772 - Accumulation.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 19 Customs Duties 1 2014-04-01 2014-04-01 false Accumulation. 10.772 Section 10.772 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Morocco Free Trade...

  20. 19 CFR 10.772 - Accumulation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Accumulation. 10.772 Section 10.772 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Morocco Free Trade...

  1. 19 CFR 10.772 - Accumulation.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 19 Customs Duties 1 2012-04-01 2012-04-01 false Accumulation. 10.772 Section 10.772 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Morocco Free Trade...

  2. 19 CFR 10.772 - Accumulation.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 19 Customs Duties 1 2011-04-01 2011-04-01 false Accumulation. 10.772 Section 10.772 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Morocco Free Trade...

  3. Hippocampal Networks Habituate as Novelty Accumulates

    ERIC Educational Resources Information Center

    Murty, Vishnu P.; Ballard, Ian C.; Macduffie, Katherine E.; Krebs, Ruth M.; Adcock, R. Alison

    2013-01-01

    Novelty detection, a critical computation within the medial temporal lobe (MTL) memory system, necessarily depends on prior experience. The current study used functional magnetic resonance imaging (fMRI) in humans to investigate dynamic changes in MTL activation and functional connectivity as experience with novelty accumulates. fMRI data were…

  4. RF SYSTEM FOR THE SNS ACCUMULATOR RING.

    SciTech Connect

    BLASKIEWICZ, M.; BRENNAN, J.M.; BRODOWSKI, J.; DELONG, J.; METH, M.; SMITH, K.; ZALTSMAN, A.

    2001-06-18

    During accumulation the RF beam current in the spallation neutron source ring rises from 0 to 50 amperes. A clean, 250 nanosecond gap is needed for the extraction kicker risetime. Large momentum spread and small peak current are needed to prevent instabilities and stopband related losses. A robust RF system meeting these requirements has been designed.

  5. Copper accumulation in the crayfish (Orconectes rusticus)

    SciTech Connect

    Evans, M.L.

    1980-06-01

    The purpose of this study was to determine whether or not the crayfish, O. rusticus could fulfill Nehring's (1976) criteria for a good biological monitor of heavy metal pollution. Since there is some evidence that the cupric ion is the most toxic form of aqueous copper, crayfish-accumulated copper was compared to both total and cupric copper in the culture water.

  6. 19 CFR 10.597 - Accumulation.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 19 Customs Duties 1 2011-04-01 2011-04-01 false Accumulation. 10.597 Section 10.597 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. Dominican Republic-Central...

  7. ACCUMULATION FACTORS FOR ELEVEN POLYCHLORINATED BIPHENYL CONGENERS

    EPA Science Inventory

    According to the fugacity approach (Mackay 1979), pollutant uptake by an organism is determined by the chemical fugacity differential between the organism and its environment. he Accumulation Factor [AF - (concentration of pollutant in animal tissue, Ct (ng/g dry wt)/animal lipid...

  8. Plastic Accumulation in the Mediterranean Sea

    PubMed Central

    Cózar, Andrés; Sanz-Martín, Marina; Martí, Elisa; González-Gordillo, J. Ignacio; Ubeda, Bárbara; Gálvez, José Á.; Irigoien, Xabier; Duarte, Carlos M.

    2015-01-01

    Concentrations of floating plastic were measured throughout the Mediterranean Sea to assess whether this basin can be regarded as a great accumulation region of plastic debris. We found that the average density of plastic (1 item per 4 m2), as well as its frequency of occurrence (100% of the sites sampled), are comparable to the accumulation zones described for the five subtropical ocean gyres. Plastic debris in the Mediterranean surface waters was dominated by millimeter-sized fragments, but showed a higher proportion of large plastic objects than that present in oceanic gyres, reflecting the closer connection with pollution sources. The accumulation of floating plastic in the Mediterranean Sea (between 1,000 and 3,000 tons) is likely related to the high human pressure together with the hydrodynamics of this semi-enclosed basin, with outflow mainly occurring through a deep water layer. Given the biological richness and concentration of economic activities in the Mediterranean Sea, the affects of plastic pollution on marine and human life are expected to be particularly frequent in this plastic accumulation region. PMID:25831129

  9. 19 CFR 10.917 - Accumulation.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 19 Customs Duties 1 2013-04-01 2013-04-01 false Accumulation. 10.917 Section 10.917 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Peru Trade Promotion...

  10. 19 CFR 10.917 - Accumulation.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 19 Customs Duties 1 2012-04-01 2012-04-01 false Accumulation. 10.917 Section 10.917 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Peru Trade Promotion...

  11. 19 CFR 10.458 - Accumulation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Chile Free Trade Agreement Rules of Origin § 10.458 Accumulation. (a) Originating goods or materials of Chile or the United States... of Chile, the United States, or both, by one or more producers, will be considered as an...

  12. 19 CFR 10.534 - Accumulation.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 19 Customs Duties 1 2014-04-01 2014-04-01 false Accumulation. 10.534 Section 10.534 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Singapore Free Trade...

  13. 19 CFR 10.458 - Accumulation.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 19 Customs Duties 1 2014-04-01 2014-04-01 false Accumulation. 10.458 Section 10.458 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Chile Free Trade Agreement...

  14. Organic carbon accumulation in Brazilian mangal sediments

    NASA Astrophysics Data System (ADS)

    Sanders, Christian J.; Smoak, Joseph M.; Sanders, Luciana M.; Sathy Naidu, A.; Patchineelam, Sambasiva R.

    2010-12-01

    This study reviews the organic carbon (OC) accumulation rates in mangrove forests, margins and intertidal mudflats in geographically distinct areas along the Brazilian coastline (Northeastern to Southern). Our initial results indicate that the mangrove forests in the Northeastern region of Brazil are accumulating more OC (353 g/m 2/y) than in the Southeastern areas (192 g/m 2/y) being that the sediment accumulation rates, 2.8 and 2.5 mm/y, and OC content ˜7.1% and ˜5.8% (dry sediment weight) were contributing factors to the discrepancies between the forests. The intertidal mudflats on the other hand showed substantially greater OC accumulation rates, sedimentation rates and content 1129 g/m 2/y and 234 g/m 2/y; 7.3 and 3.4 mm/y; 10.3% and ˜2.7% (OC of dry sediment weight content), respectively, in the Northeastern compared to the Southeastern region. Mangrove forests in the South-Southeastern regions of Brazil may be more susceptible to the rising sea level, as they are geographically constricted by the vast mountain ranges along the coastline.

  15. 19 CFR 10.597 - Accumulation.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... States Free Trade Agreement Rules of Origin § 10.597 Accumulation. (a) Originating materials from the territory of one or more of the Parties that are used in the production of a good in the territory...

  16. 19 CFR 10.597 - Accumulation.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... States Free Trade Agreement Rules of Origin § 10.597 Accumulation. (a) Originating materials from the territory of one or more of the Parties that are used in the production of a good in the territory...

  17. 19 CFR 10.597 - Accumulation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... States Free Trade Agreement Rules of Origin § 10.597 Accumulation. (a) Originating materials from the territory of one or more of the Parties that are used in the production of a good in the territory...

  18. 19 CFR 10.597 - Accumulation.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... States Free Trade Agreement Rules of Origin § 10.597 Accumulation. (a) Originating materials from the territory of one or more of the Parties that are used in the production of a good in the territory...

  19. 19 CFR 10.3017 - Accumulation.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 19 Customs Duties 1 2014-04-01 2014-04-01 false Accumulation. 10.3017 Section 10.3017 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Colombia Trade...

  20. 19 CFR 10.3017 - Accumulation.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 19 Customs Duties 1 2013-04-01 2013-04-01 false Accumulation. 10.3017 Section 10.3017 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Colombia Trade...

  1. Plastic accumulation in the Mediterranean sea.

    PubMed

    Cózar, Andrés; Sanz-Martín, Marina; Martí, Elisa; González-Gordillo, J Ignacio; Ubeda, Bárbara; Gálvez, José Á; Irigoien, Xabier; Duarte, Carlos M

    2015-01-01

    Concentrations of floating plastic were measured throughout the Mediterranean Sea to assess whether this basin can be regarded as a great accumulation region of plastic debris. We found that the average density of plastic (1 item per 4 m2), as well as its frequency of occurrence (100% of the sites sampled), are comparable to the accumulation zones described for the five subtropical ocean gyres. Plastic debris in the Mediterranean surface waters was dominated by millimeter-sized fragments, but showed a higher proportion of large plastic objects than that present in oceanic gyres, reflecting the closer connection with pollution sources. The accumulation of floating plastic in the Mediterranean Sea (between 1,000 and 3,000 tons) is likely related to the high human pressure together with the hydrodynamics of this semi-enclosed basin, with outflow mainly occurring through a deep water layer. Given the biological richness and concentration of economic activities in the Mediterranean Sea, the affects of plastic pollution on marine and human life are expected to be particularly frequent in this plastic accumulation region. PMID:25831129

  2. 19 CFR 10.534 - Accumulation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Accumulation. 10.534 Section 10.534 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Singapore Free Trade...

  3. 19 CFR 10.812 - Accumulation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Accumulation. 10.812 Section 10.812 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. United States-Bahrain Free Trade...

  4. Acute Hypertonicity Alters Aquaporin-2 Trafficking and Induces a MAPK-dependent Accumulation at the Plasma Membrane of Renal Epithelial Cells*

    PubMed Central

    Hasler, Udo; Nunes, Paula; Bouley, Richard; Lu, Hua A. J.; Matsuzaki, Toshiyuki; Brown, Dennis

    2008-01-01

    The unique phenotype of renal medullary cells allows them to survive and functionally adapt to changes of interstitial osmolality/tonicity. We investigated the effects of acute hypertonic challenge on AQP2 (aquaporin-2) water channel trafficking. In the absence of vasopressin, hypertonicity alone induced rapid (<10 min) plasma membrane accumulation of AQP2 in rat kidney collecting duct principal cells in situ, and in several kidney epithelial lines. Confocal microscopy revealed that AQP2 also accumulated in the trans-Golgi network (TGN) following hypertonic challenge. AQP2 mutants that mimic the Ser256-phosphorylated and -nonphosphorylated state accumulated at the cell surface and TGN, respectively. Hypertonicity did not induce a change in cytosolic cAMP concentration, but inhibition of either calmodulin or cAMP-dependent protein kinase A activity blunted the hypertonicity-induced increase of AQP2 cell surface expression. Hypertonicity increased p38, ERK1/2, and JNK MAPK activity. Inhibiting MAPK activity abolished hypertonicity-induced accumulation of AQP2 at the cell surface but did not affect either vasopressin-dependent AQP2 trafficking or hypertonicity-induced AQP2 accumulation in the TGN. Finally, increased AQP2 cell surface expression induced by hypertonicity largely resulted from a reduction in endocytosis but not from an increase in exocytosis. These data indicate that acute hypertonicity profoundly alters AQP2 trafficking and that hypertonicity-induced AQP2 accumulation at the cell surface depends on MAP kinase activity. This may have important implications on adaptational processes governing transcellular water flux and/or cell survival under extreme conditions of hypertonicity. PMID:18664568

  5. DhhP, a cyclic di-AMP phosphodiesterase of Borrelia burgdorferi, is essential for cell growth and virulence.

    PubMed

    Ye, Meiping; Zhang, Jun-Jie; Fang, Xin; Lawlis, Gavin B; Troxell, Bryan; Zhou, Yan; Gomelsky, Mark; Lou, Yongliang; Yang, X Frank

    2014-05-01

    Cyclic di-AMP (c-di-AMP) is a recently discovered second messenger in bacteria. Most of work on c-di-AMP signaling has been done in Gram-positive bacteria, firmicutes, and actinobacteria, where c-di-AMP signaling pathways affect potassium transport, cell wall structure, and antibiotic resistance. Little is known about c-di-AMP signaling in other bacteria. Borrelia burgdorferi, the causative agent of Lyme disease, is a spirochete that has a Gram-negative dual membrane. In this study, we demonstrated that B. burgdorferi BB0619, a DHH-DHHA1 domain protein (herein designated DhhP), functions as c-di-AMP phosphodiesterase. Recombinant DhhP hydrolyzed c-di-AMP to pApA in a Mn(2+)- or Mg(2+)-dependent manner. In contrast to c-di-AMP phosphodiesterases reported thus far, DhhP appears to be essential for B. burgdorferi growth both in vitro and in the mammalian host. Inactivation of the chromosomal dhhP gene could be achieved only in the presence of a plasmid-encoded inducible dhhP gene. The conditional dhhP mutant had a dramatic increase in intracellular c-di-AMP level in comparison to the isogenic wild-type strain. Unlike what has been observed in Gram-positive bacteria, elevated cellular c-di-AMP in B. burgdorferi did not result in an increased resistance to β-lactamase antibiotics, suggesting that c-di-AMP's functions in spirochetes differ from those in Gram-positive bacteria. In addition, the dhhP mutant was defective in induction of the σ(S) factor, RpoS, and the RpoS-dependent outer membrane virulence factor OspC, which uncovers an important role of c-di-AMP in B. burgdorferi virulence. PMID:24566626

  6. DhhP, a Cyclic di-AMP Phosphodiesterase of Borrelia burgdorferi, Is Essential for Cell Growth and Virulence

    PubMed Central

    Ye, Meiping; Zhang, Jun-Jie; Fang, Xin; Lawlis, Gavin B.; Troxell, Bryan; Zhou, Yan; Gomelsky, Mark

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a recently discovered second messenger in bacteria. Most of work on c-di-AMP signaling has been done in Gram-positive bacteria, firmicutes, and actinobacteria, where c-di-AMP signaling pathways affect potassium transport, cell wall structure, and antibiotic resistance. Little is known about c-di-AMP signaling in other bacteria. Borrelia burgdorferi, the causative agent of Lyme disease, is a spirochete that has a Gram-negative dual membrane. In this study, we demonstrated that B. burgdorferi BB0619, a DHH-DHHA1 domain protein (herein designated DhhP), functions as c-di-AMP phosphodiesterase. Recombinant DhhP hydrolyzed c-di-AMP to pApA in a Mn2+- or Mg2+-dependent manner. In contrast to c-di-AMP phosphodiesterases reported thus far, DhhP appears to be essential for B. burgdorferi growth both in vitro and in the mammalian host. Inactivation of the chromosomal dhhP gene could be achieved only in the presence of a plasmid-encoded inducible dhhP gene. The conditional dhhP mutant had a dramatic increase in intracellular c-di-AMP level in comparison to the isogenic wild-type strain. Unlike what has been observed in Gram-positive bacteria, elevated cellular c-di-AMP in B. burgdorferi did not result in an increased resistance to β-lactamase antibiotics, suggesting that c-di-AMP's functions in spirochetes differ from those in Gram-positive bacteria. In addition, the dhhP mutant was defective in induction of the σS factor, RpoS, and the RpoS-dependent outer membrane virulence factor OspC, which uncovers an important role of c-di-AMP in B. burgdorferi virulence. PMID:24566626

  7. Role of taurine accumulation in keratinocyte hydration.

    PubMed

    Janeke, Guido; Siefken, Wilfried; Carstensen, Stefanie; Springmann, Gunja; Bleck, Oliver; Steinhart, Hans; Höger, Peter; Wittern, Klaus-Peter; Wenck, Horst; Stäb, Franz; Sauermann, Gerhard; Schreiner, Volker; Doering, Thomas

    2003-08-01

    Epidermal keratinocytes are exposed to a low water concentration at the stratum corneum-stratum granulosum interface. When epithelial tissues are osmotically perturbed, cellular protection and cell volume regulation is mediated by accumulation of organic osmolytes such as taurine. Previous studies reported the presence of taurine in the epidermis of several animal species. Therefore, we analyzed human skin for the presence of the taurine transporter (TAUT) and studied the accumulation of taurine as one potential mechanism protecting epidermal keratinocytes from dehydration. According to our results, TAUT is expressed as a 69 kDa protein in human epidermis but not in the dermis. For the epidermis a gradient was evident with maximal levels of TAUT in the outermost granular keratinocyte layer and lower levels in the stratum spinosum. No TAUT was found in the basal layer or in the stratum corneum. Keratinocyte accumulation of taurine was induced by experimental induction of skin dryness via application of silica gel to human skin. Cultured human keratinocytes accumulated taurine in a concentration- and osmolarity-dependent manner. TAUT mRNA levels were increased after exposure of human keratinocytes to hyperosmotic culture medium, indicating osmosensitive TAUT mRNA expression as part of the adaptation of keratinocytes to hyperosmotic stress. Keratinocyte uptake of taurine was inhibited by beta-alanine but not by other osmolytes such as betaine, inositol, or sorbitol. Accumulation of taurine protected cultured human keratinocytes from both osmotically induced and ultraviolet-induced apoptosis. Our data indicate that taurine is an important epidermal osmolyte required to maintain keratinocyte hydration in a dry environment. PMID:12880428

  8. Effects of granulocyte-macrophage colony-stimulating factor and cyclic AMP interaction on human neutrophil apoptosis.

    PubMed Central

    Tortorella, C; Piazzolla, G; Spaccavento, F; Antonaci, S

    1998-01-01

    The current study was undertaken to evaluate the effects of granulocyte-macrophage colony-stimulating factor (GM-CSF) and cyclic AMP (cAMP) signaling interaction on human neutrophil apoptosis, either occurring spontaneously or induced by Fas antigen activation. Results show that GM-CSF, dibutyryl cAMP (a cAMP analog) and forskolin (an adenylate cyclase activator) are all able to suppress spontaneous neutrophil cell death. Of note however, when GM-CSF is used in combination with cAMP-elevating agents, an additive effect on neutrophil survival is observed with dibutyryl cAMP only, whereas supplementation of cell cultures with GM-CSF and forskolin results in a progressive reduction of antiapoptotic effects exerted by the single compounds. Moreover, although dibutyryl cAMP and forskolin do not affect Fas-triggered apoptotic events, they are still able to modulate the GM-CSF capacity to prolong neutrophil survival following anti-Fas IgM cell challenge, with effects similar to those respectively exerted on spontaneous neutrophil apoptosis. The data indicate that GM-CSF may negatively modulate the cAMP-mediated antiapoptotic pathway in human neutrophils, likely via the inhibition of adenylate cyclase activity. This would prevent an abnormal neutrophil survival as a result of cAMP signaling stimulation, which provides a novel insight into the role of GM-CSF as a physiological regulator of myeloid cell turnover. PMID:9927231

  9. Improved Synthesis of Biotinol-5′-AMP: Implications for Antibacterial Discovery

    PubMed Central

    2014-01-01

    An improved synthesis of biotinol-5′-AMP, an acyl-AMP mimic of the natural reaction intermediate of biotin protein ligase (BPL), is reported. This compound was shown to be a pan inhibitor of BPLs from a series of clinically important bacteria, particularly Staphylococcus aureus and Mycobacterium tuberculosis, and kinetic analysis revealed it to be competitive against the substrate biotin. Biotinol-5′-AMP also exhibits antibacterial activity against a panel of clinical isolates of S. aureus and M. tuberculosis with MIC values of 1–8 and 0.5–2.5 μg/mL, respectively, while being devoid of cytotoxicity to human HepG2 cells. PMID:25699152

  10. Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

    NASA Astrophysics Data System (ADS)

    Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

    1996-06-01

    cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

  11. Modulation of adhesion-dependent cAMP signaling by echistatin and alendronate

    NASA Technical Reports Server (NTRS)

    Fong, J. H.; Ingber, D. E.

    1996-01-01

    We measured intracellular cAMP levels in cells during attachment and spreading on different extracellular matrix (ECM) proteins. Increases in cAMP were observed within minutes when cells attached to fibronectin, vitronectin, and a synthetic RGD-containing fibronectin peptide (Petite 2000), but not when they adhered to another integrin alpha nu beta 3 ligand, echistatin. Because echistatin also inhibits bone resorption, we measured the effects of adding another osteoporosis inhibitor, alendronate, in this system. Alendronate inhibited the cAMP increase induced by ligands that primarily utilize integrin alpha nu beta 3 (vitronectin, Peptite 2000), but not by fibronectin which can also use integrin alpha 5 beta 1. These results show that cell adhesion to ECM can increase intracellular cAPM levels and raise the possibility that inhibitors of osteoporosis may act, in part, by preventing activation of this pathway by integrins.

  12. Cyclic AMP-dependent phosphorylation of neuronal nitric oxide synthase mediates penile erection

    PubMed Central

    Hurt, K. Joseph; Sezen, Sena F.; Lagoda, Gwen F.; Musicki, Biljana; Rameau, Gerald A.; Snyder, Solomon H.; Burnett, Arthur L.

    2012-01-01

    Nitric oxide (NO) generated by neuronal NO synthase (nNOS) initiates penile erection, but has not been thought to participate in the sustained erection required for normal sexual performance. We now show that cAMP-dependent phosphorylation of nNOS mediates erectile physiology, including sustained erection. nNOS is phosphorylated by cAMP-dependent protein kinase (PKA) at serine(S)1412. Electrical stimulation of the penile innervation increases S1412 phosphorylation that is blocked by PKA inhibitors but not by PI3-kinase/Akt inhibitors. Stimulation of cAMP formation by forskolin also activates nNOS phosphorylation. Sustained penile erection elicited by either intracavernous forskolin injection, or augmented by forskolin during cavernous nerve electrical stimulation, is prevented by the NOS inhibitor l-NAME or in nNOS-deleted mice. Thus, nNOS mediates both initiation and maintenance of penile erection, implying unique approaches for treating erectile dysfunction. PMID:23012472

  13. Differential regulation of Paramecium ciliary motility by cAMP and cGMP.

    PubMed

    Bonini, N M; Nelson, D L

    1988-05-01

    cAMP and cGMP had distinct effects on the regulation of ciliary motility in Paramecium. Using detergent-permeabilized cells reactivated to swim with MgATP, we observed effects of cyclic nucleotides and interactions with Ca2+ on the swimming speed and direction of reactivated cells. Both cAMP and cGMP increased forward swimming speed two- to threefold with similar half-maximal concentrations near 0.5 microM. The two cyclic nucleotides, however, had different effects in antagonism with the Ca2+ response of backward swimming and on the handedness of the helical swimming paths of reactivated cells. These results suggest that cAMP and cGMP differentially regulate the direction of the ciliary power stroke. PMID:2836435

  14. Effect of leaving group on the oligomerization of 5'-AMP on montmorillonite. [Abstract only

    NASA Technical Reports Server (NTRS)

    Prabahar, K. Joseph; Ferris, James P.

    1994-01-01

    The oligomerization of imidazole derivative of 5'-AMP (ImpA) in the presence of montmorillonite clay yields oligomers containing up to 10 monomer units. In these reactions, the heterocyclic base, imidazole is the leaving group. In our present study, we synthesized a series of activated nucleotides of 5'AMP using other leaving groups such as pyrazole, 1,2,4-triazole, piperidine, morpholine, 4-aminopyridine, 4-methylaminopyridine, 4-dimethylaminopyridine, 2-aminobenzimidazole etc. to determine the effect of amine leaving group on the products of the oligomerization reaction. Earlier results from our laboratory showed that the presence AppA in the clay reaction of ImpA enhances the oligomerization reaction to yield higher oligomers. We also studied the effect of AppA in the clay mediated oligomerization reaction of the activated nucleotides. Oligomerization of 2-amino-benzimidazole derivative of 5'-AMP gave higher oligomers containing up to nine monomer units in the presence of AppA.

  15. Generation of cAMP-Activated Chloride Currents by Expression of CFTR

    NASA Astrophysics Data System (ADS)

    Anderson, Matthew P.; Rich, Devra P.; Gregory, Richard J.; Smith, Alan E.; Welsh, Michael J.

    1991-02-01

    Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) cause cystic fibrosis. In order to evaluate its function, CFTR was expressed in HeLa, Chinese hamster ovary (CHO), and NIH 3T3 fibroblast cells, and anion permeability was assessed with a fluorescence microscopic assay and the whole-cell patch-clamp technique. Adenosine 3',5'-monophosphate (cAMP) increased anion permeability and chloride currents in cells expressing CFTR, but not in cells expressing a mutant CFTR (ΔF508) or in nontransfected cells. The simplest interpretation of these observations is that CFTR is itself a cAMP-activated chloride channel. The alternative interpretation, that CFTR directly or indirectly regulates chloride channels, requires that these cells have endogenous cryptic, chloride channels that are stimulated by cAMP only in the presence of CFTR.

  16. Involvement of the second messenger cAMP in gravity-signal transduction in physarum

    NASA Astrophysics Data System (ADS)

    Block, I.; Rabien, H.; Ivanova, K.

    The aim of the investigation was to clarify, whether cellular signal processing following graviperception involves second messenger pathways. The test object was a most gravisensitive free-living ameboid cell, the myxomycete (acellular slime mold) Physarum polycephalum. It was demonstrated that the motor response is related to acceleration-dependent changes in the levels of the cellular second messenger cyclic adenosine monophosphate (cAMP). Rotating Physarum plasmodia in the gravity field of the Earth about a horizontal axis increased their cAMP concentration. Depriving the cells for a few days of the acceleration stimulus (near weightlessness in a space experiment on STS-69) slightly lowered plasmodial cAMP levels. Thus, the results provide first indications that the acceleration-stimulus signal transduction chain of Physarum uses an ubiquitous second messenger pathway.

  17. The cyclic AMP signaling pathway: Exploring targets for successful drug discovery (Review)

    PubMed Central

    YAN, KUO; GAO, LI-NA; CUI, YUAN-LU; ZHANG, YI; ZHOU, XIN

    2016-01-01

    During development of disease, complex intracellular signaling pathways regulate an intricate series of events, including resistance to external toxins, the secretion of cytokines and the production of pathological phenomena. Adenosine 3′,5′-cyclic monophosphate (cAMP) is a nucleotide that acts as a key second messenger in numerous signal transduction pathways. cAMP regulates various cellular functions, including cell growth and differentiation, gene transcription and protein expression. This review aimed to provide an understanding of the effects of the cAMP signaling pathway and the associated factors on disease occurrence and development by examining the information from a new perspective. These novel insights aimed to promote the development of novel therapeutic approaches and aid in the development of new drugs. PMID:27035868

  18. Effects of ethanol on cAMP production in murine embryonic palate mesenchymal cells

    SciTech Connect

    Weston, W.M.; Greene, R.M. )

    1991-01-01

    Ethanol affected the ability of murine embryonic palate mesenchymal (MEPM) cells to produce cAMP in response to hormone treatment. Acute exposure to ethanol resulted in an increase in hormone-stimulated cAMP levels, while chronic ethanol treatment led to decreased sensitivity to hormone. Forskolin-stimulated cAMP levels were decreased by both acute and chronic ethanol treatment, while the cells' response to cholera toxin was unchanged by ethanol treatment. The lack of sensitivity of the cholera toxin response to ethanol suggests that,in contrast to what has been observed in other systems, ethanol does not affect the production or activity of G{alpha}s in MEPM cells. These results suggest a possible explanation for the molecular basis for the craniofacial abnormalities observed in the fetal alcohol syndrome.

  19. Autoregulation of PhoP/PhoQ and positive regulation of the cyclic AMP receptor protein-cyclic AMP complex by PhoP in Yersinia pestis.

    PubMed

    Zhang, Yiquan; Wang, Li; Han, Yanping; Yan, Yanfeng; Tan, Yafang; Zhou, Lei; Cui, Yujun; Du, Zongmin; Wang, Xiaoyi; Bi, Yujing; Yang, Huiying; Song, Yajun; Zhang, Pingping; Zhou, Dongsheng; Yang, Ruifu

    2013-03-01

    Yersinia pestis is one of the most dangerous bacterial pathogens. PhoP and cyclic AMP receptor protein (CRP) are global regulators of Y. pestis, and they control two distinct regulons that contain multiple virulence-related genes. The PhoP regulator and its cognate sensor PhoQ constitute a two-component regulatory system. The regulatory activity of CRP is triggered only by binding to its cofactor cAMP, which is synthesized from ATP by adenylyl cyclase (encoded by cyaA). However, the association between the two regulatory systems PhoP/PhoQ and CRP-cAMP is still not understood for Y. pestis. In the present work, the four consecutive genes YPO1635, phoP, phoQ, and YPO1632 were found to constitute an operon, YPO1635-phoPQ-YPO1632, transcribed as a single primary RNA, whereas the last three genes comprised another operon, phoPQ-YPO1632, transcribed with two adjacent transcriptional starts. Through direct PhoP-target promoter association, the transcription of these two operons was stimulated and repressed by PhoP, respectively; thus, both positive autoregulation and negative autoregulation of PhoP/PhoQ were detected. In addition, PhoP acted as a direct transcriptional activator of crp and cyaA. The translational/transcriptional start sites, promoter -10 and -35 elements, PhoP sites, and PhoP box-like sequences were determined for these PhoP-dependent genes, providing a map of the PhoP-target promoter interaction. The CRP and PhoP regulons have evolved to merge into a single regulatory cascade in Y. pestis because of the direct regulatory association between PhoP/PhoQ and CRP-cAMP. PMID:23264579

  20. Xanthine effects on renal proximal tubular function and cyclic AMP metabolism.

    PubMed

    Coulson, R; Scheinman, S J

    1989-02-01

    We evaluated the renal effects of xanthines using two in vitro models: the isolated perfused rat kidney (IPRK) and cultured opossum kidney (OK) cells, a continuous cell line that resembles proximal tubule and responds to parathyroid hormone (PTH). 1,3-Diethyl-8-phenylxanthine (DPX) a potent adenosine receptor antagonist, increased urine volume, glomerular filtration rate, vascular resistance and the fractional excretions of Na, K, Ca and Pi in the IPRK. DPX lowered the Na-dependent uptake of Pi by OK cells. By comparison enprofylline, 3-propylxanthine (ENP), a weak adenosine receptor antagonist, produced a slight elevation in glomerular filtration rate but no changes in electrolyte excretion by IPRK or Pi uptake by OK cells. Both DPX and ENP produced negligible elevations in basal IPRK cAMP. A 1-nM bolus of PTH elevated urinary and perfusate cAMP 50- and 10-fold, respectively. PTH-elevated urinary and perfusate cAMP were augmented further 4- to 7-fold with DPX and 3- to 4-fold with ENP (All IPRK experiments used 50 microM xanthine). OK cells produced a 2-fold cAMP response to 10 nM PTH alone. OK cells treated with 50 microM DPX exhibited no increase in basal but a 13-fold increase in PTH-stimulated cell cAMP. The rank order of potency at 50 microM to